index
int64
0
1,000k
blob_id
stringlengths
40
40
code
stringlengths
7
10.4M
997,700
fba7c1f888701dee6d2b4e6fa3ec05b89de3003c
#!/usr/bin/env python ############################################################################ # # Script: create-master.py # # Description: Compute BB and CH station lists into one master list # ############################################################################ import os import sys import array import getopt import math import random # Domain side length DOMAINLENGTHETA = 180e3 DOMAINLENGTHCSI = 135e3 # Location tolerance TOL = 1e-3 class CreateMaster: def __init__(self, argv): self.argc = len(argv) self.argv = argv def usage(self): print "Usage: " + sys.argv[0] + " <station file1> [station file2]" print "Example: " + sys.argv[0] + " -m BB_station_xy.list CH_station_xy.list\n" print "Example: " + sys.argv[0] + " BB_station_xy\n" print "\t[-h] : This help message" print "\t[-m] : Perform merge" print "\t<stations file1> : Station list 1" print "\t<stations file2> : Station list 2 (Optional, used in merge)" sys.exit(1) def main(self): # Parse options try: opts, args = getopt.getopt(self.argv[1:], "hm", ["help", "merge"]) except getopt.GetoptError, err: print str(err) self.usage() return(1) # Defaults domerge = False for o, a in opts: if o in ("-h", "--help"): self.usage() return(0) elif o in ("-m", "--merge"): domerge = True else: print "Invalid option %s" % (o) return(1) # Check command-line arguments if ((domerge == True and len(args) != 2) or (domerge == False and len(args) != 1)): self.usage() return(1) sfile1 = args[0] if (domerge): sfile2 = args[1] #print "Reading in station list %s" % (sfile1) fp = open(sfile1, 'r') sdata1 = fp.readlines() fp.close() if (domerge): #print "Reading in station list %s" % (sfile2) fp = open(sfile2, 'r') sdata2 = fp.readlines() fp.close() master = [] # Preferred stations that must be included if they fit in sim box #print "Merging station lists:" for i in range(0, len(sdata1)): stokens = sdata1[i].split() snet1 = stokens[0] ssta1 = stokens[1] slon1 = float(stokens[2]) slat1 = float(stokens[3]) sx1 = float(stokens[4]) sy1 = float(stokens[5]) if ((sx1 >= 0.0) and (sx1 < DOMAINLENGTHETA) and (sy1 >= 0.0) and (sy1 < DOMAINLENGTHCSI)): master.append([snet1, ssta1, slon1, slat1, sx1, sy1]); #else: # print('Station %s %s is outside of sim box (%f, %f)\n' % (snet1, ssta1, sx1, sy1)); if (domerge): # Additional stations with possible duplicates that must be filtered master2 = [] for i in range(0, len(sdata2)): stokens = sdata2[i].split() snet2 = stokens[0] ssta2 = stokens[1] slon2 = float(stokens[2]) slat2 = float(stokens[3]) sx2 = float(stokens[4]) sy2 = float(stokens[5]) # Find in master list found = False for m in range(0, len(master)): mtokens = master[m] mnet = mtokens[0] msta = mtokens[1] mlon = float(mtokens[2]) mlat = float(mtokens[3]) mx = float(mtokens[4]) my = float(mtokens[5]) if ((math.fabs(slon2 - mlon) < TOL) and ((math.fabs(slat2 - mlat) < TOL))): #sys.stdout.write("%s %s duplicate of %s %s\n" % (snet2, ssta2, mnet, msta)) found = True break; # Append to new list to allow dupes in CH list if (not found): master2.append([snet2, ssta2, slon2, slat2, sx2, sy2]); # Merge the two lists master = master + master2 # Output merged list sys.stdout.write("# net sta lon lat x y sta_id\n") staid = 0 for m in range(0, len(master)): mtokens = master[m] mnet = mtokens[0] msta = mtokens[1] mlon = float(mtokens[2]) mlat = float(mtokens[3]) mx = float(mtokens[4]) my = float(mtokens[5]) stafile = "station.%d" % (staid) sys.stdout.write("%5s\t%10s\t%14.6f\t%14.6f\t%14.6f\t%14.6f\t%14.6f\t%12s\n" % (mnet, msta, mlon, mlat, 0.0, mx, my, stafile)) staid = staid + 1 #print "Done" return 0 if __name__ == '__main__': prog = CreateMaster(sys.argv) sys.exit(prog.main())
997,701
b255f5b5d0ec7d184b8df76ae9b911572690f277
''' Helper functions for working with sublime ''' import sublime import sublime_plugin def sublime_show_region(view, region): ''' Shows the region in the view (not moving if its already visible) ''' if not view.visible_region().intersects(region): view.show_at_center(region) def sublime_is_multiselect(view): ''' Figures out if we're in multiselect mode ''' selections = view.sel() return len(selections) > 1 def sublime_is_visual(view): ''' Figures out if we're in visual mode ''' selections = view.sel() # Is anything selecting at least one char? aka are we in block mode # Note: Command Mode is identical to Insert mode (selection of no chars) # except its displayed as a block cursor # ONLY visual mode selects a char return any( (not sel.empty()) for sel in selections ) class MetaWindowFactory(type): ''' Factory: Singleton per window Meta-Using classes: view MUST be passed into __init__ self.window is always assigned ''' def __init__(cls, name, bases, attrs, **kwargs): cls._instances = {} super().__init__(name, bases, attrs, **kwargs) def __call__(cls, *args, **kwargs): view = kwargs.pop('view', None) window = kwargs.pop('window', None) if window is None and view is not None: window = view.window() factory_id = window.id() self = cls._instances.get(factory_id, None) if self is None: self = cls.__new__(cls, *args, **kwargs) self.window = window self.__init__(*args, **kwargs) cls._instances[factory_id] = self return self class MetaViewFactory(type): ''' Factory: Singleton per view Meta-Using classes: view MUST be passed into __init__ self.view is always assigned ''' def __init__(cls, name, bases, attrs, **kwargs): cls._instances = {} super().__init__(name, bases, attrs, **kwargs) def __call__(cls, *args, **kwargs): view = kwargs.pop('view', None) factory_id = view.id() self = cls._instances.get(factory_id, None) if self is None: self = cls.__new__(cls, *args, **kwargs) self.view = view self.__init__(*args, **kwargs) cls._instances[factory_id] = self self.view = view return self class Viewport(): ''' Saved viewport in a specific view ''' def __init__(self, view): self.view = view self.__viewport = view.viewport_position() def load(self): ''' Reloads this viewport ''' self.view.window().focus_view(self.view) self.view.set_viewport_position(self.__viewport) class QuickPanelFinder(metaclass=MetaWindowFactory): ''' One-Use listener that gives you back the view of the quickpanel ''' def __init__(self): ''' Creates a listener ''' self.listener = None def listen(self, callback): ''' Callback that returns the view when the quickpanel opens ''' if self.listener is not None: raise RuntimeError("Existing Listener: Another quickpanel is also opening?") self.listener = callback def cancel(self, callback): ''' Removes a listener in case something went wrong ''' if self.listener is callback: self.listener = None def on_open(self, view): ''' Event: called when a quickpanel opens ''' if not self.listener: return try: self.listener(view) finally: self.listener = None class QuickPanelListener(sublime_plugin.EventListener): ''' Listener for a quickpanel ''' def on_activated(self, view): ''' This method is called whenever a view (tab, quick panel, etc.) gains focus ''' if view is None: return window = view.window() if window is None: # This is some subpanel, Not relevant return QuickPanelFinder(view=view).on_open(view) # -------------------------------------------------------------------------------------------------- def closest_visible(selection, visible_region=None, inverted=False): ''' Returns the first region which is fully visible. If nothing is visible, a random selection is returned visible_region = view.visible_region() ''' if len(selection) == 0: # Nothing to choose from... return None if visible_region is None or len(selection) == 1: # Since nothing seems visible, then the very first selection # is our default 'closest' return selection[0] # Find the first region which is withing our viewport for region in selection: if visible_region.contains(region): # We found one inside the viewport! return region elif not inverted and visible_region.begin() <= region.begin(): # We've Gone past the viewport, just take the next one return region elif inverted and visible_region.end() <= region.end(): # We've gone past the viewport, just take the next one return region # We've hit the end... loop back to the first one return selection[0] class CursorMatch(object): ''' Show that this region is special (is the one the viewport should jump to ''' # pylint: disable=too-few-public-methods def __init__(self, cursor, region, is_visible=False): ''' Stores a region ''' self.region = region self.orig = cursor self.is_visible = is_visible def cursor_to_matches(*, cursors, matches, viewport, inverted=False, find_visible_only=False): ''' Loops through and generates a new set of cursors to jump to a VisibleMatch() is yielded if that is the best region to show the user ''' matches = list(matches) if len(matches) == 0: # There is no such thing as 'next' return # We'll be messing with the list, duplicate it cursors = list(cursors) # Invert our jump if inverted: # Sublime merges adjacent regions, so they cannot overlap # THUS inverting it results in a sorted (backwards) list cursors = [cursor for cursor in cursors[::-1]] matches = matches[::-1] # Find the closest cursor to the visible regions if len(cursors) == 0: # There is no cursor to jump from? # Just go to a visible match new_visible = closest_visible(matches, viewport, inverted=inverted) # And theres no cursors to 'jump'... finish off yield CursorMatch(None, new_visible, is_visible=True) return # Find the first cursor that is visible visible_cursor = closest_visible(cursors, viewport, inverted=inverted) # If we just want the visible cursor only (aka only the new viewport focus) # Then pretend we only have one cursor... the closest visible one if find_visible_only: cursors = [visible_cursor] # Used when cursors no longer see a match after them # They all loop around to the first one loop_match = matches[0] # The search has Multiple Stages, this ensures we keep circling through them # until we're done limit = LoopLimit( 'Overflowed the search, either there were too many items (over 10000), ' 'or there is an infinite loop bug' ) while len(matches) and len(cursors): limit.count() # Stage 1: Drop matches that are before ANY Cursors while len(matches) and ( # Normal means we're going forwards (compare the starts) (not inverted and cursors[0].begin() >= matches[0].begin()) # Inverted means we're going backwards (compare the ends) or (inverted and cursors[0].end() <= matches[0].end()) ): limit.count() # Drop elements before the cursor matches.pop(0) # Stage 2: Early Abort (no Matches left!) if len(matches) == 0: # We've exhausted the search # Replace all remaining cursors with the looped match yield CursorMatch(None, loop_match, is_visible=(visible_cursor in cursors)) return # Stage 3: Jump cursors that are before the next match (with that match) was_visible = False replaced_cursors = [] while len(cursors) and ( (not inverted and cursors[0].begin() <= matches[0].begin()) or (inverted and cursors[0].end() >= matches[0].end()) ): limit.count() # We found the 'visible cursor' note that down if cursors[0] == visible_cursor: was_visible = True # Replace cursors before the match replaced_cursors.append(cursors.pop(0)) # All the cursors we just dropped go to this match yield CursorMatch( (replaced_cursors[0] if replaced_cursors else None), matches[0], is_visible=was_visible, ) # ------------------------------------------------------------------------------------------------- # Misc helpers # NON SUBLIME import itertools class Sentinel: ''' Sentinel Value ''' def __repr__(self): return self.__class__.__name__ def pairwise(iterable, include_tail=False): """ s -> (s0,s1), (s1,s2), (s2, s3), ... s, True -> (s0, s1) ... (sn-1, sn), (sn, None) """ left, right = itertools.tee(iterable) next(right, None) if include_tail: right = itertools.chain(right, [None]) return zip(left, right) class LoopLimit(Exception): ''' Counts loop counters until yourun out, then raises itself as an error ''' def __init__(self, message=None, limit=1000): self.counter = limit super().__init__(message) def count(self): ''' Counts down to the limit, crashes if its reached ''' self.counter -= 1 if self.counter <= 0: raise self
997,702
c8ea14bfe7c83991e05b32bd350fed1ba755cd18
#python 3.8 from numpy.random import dirichlet from typing import List from MuZeroConfig import MuZeroConfig from Action import Action from Player import Player class Node(object): def __init__(self, prior: int, to_play: Player, hidden_state = None, discount: float = 1.): self.visit_count = 0 self.prior = prior self.to_play = to_play self.value_sum = 0 self.children = [] self.hidden_state = hidden_state self.discount = discount self.reward = 0 def expand(self, actions: List[Action], hidden_state, policy, value): moves = [[action, policy[0, action.index].item()] for action in actions] p_sum = policy.sum().item() next_player = Player(-self.to_play.player) for action, p in moves: subnode = Node(p / p_sum, next_player, hidden_state) self.children.append([action, subnode]) def addNoise(self, config: MuZeroConfig): noise = dirichlet([config.root_dirichlet_alpha] * len(self.children)) for i in range(len(self.children)): self.children[i][1].prior = self.children[i][1].prior * ( 1 - config.root_exploration_fraction) + noise[i] * config.root_exploration_fraction def expanded(self) -> bool: return len(self.children) > 0 def value(self) -> float: return 0 if self.visit_count == 0 else self.value_sum / self.visit_count
997,703
bb4f25f230b1d8a0e2d5a524f7053d8795d61afb
given = "sausage" back = "" for digit in range(3): back += given[2*digit] print(back)
997,704
71cf2600a82b3c2c7d434a95c066cc419b263300
from django.shortcuts import render from django.http import JsonResponse from rest_framework.decorators import api_view from rest_framework.response import Response from .serializers import ProductSerializer from .models import Product import django_filters.rest_framework from rest_framework import status # Create your views here. @api_view(['GET']) def apiOverview(request): api_urls = { 'All Products List' : '/product-list/', 'Detailed View' : '/product-details/<str:pk>/', 'Register Product' : '/product-register/', 'Available Products List' : '/product-list-available/', 'Out of Stock Products List' : '/product-list-soldout/', 'Register Product Quantity Change' : '/product-quantity-change/<str:pk>/<str:quantity>/' } return Response(api_urls) @api_view(['GET']) def productList(request): products = Product.objects.all() serializer = ProductSerializer(products, many=True) return Response(serializer.data) @api_view(['GET']) def productDetails(request, pk): try: products = Product.objects.get(sku=pk) serializer = ProductSerializer(products, many=False) return Response(serializer.data) except Product.DoesNotExist: return Response(status=status.HTTP_404_NOT_FOUND) @api_view(['GET']) def productListAvailable(request): products = Product.objects.all().exclude(quantity=0) serializer = ProductSerializer(products, many=True) return Response(serializer.data) @api_view(['GET']) def productListSoldOut(request): products = Product.objects.filter(quantity=0) serializer = ProductSerializer(products, many=True) return Response(serializer.data) @api_view(['POST']) def productRegister(request): serializer = ProductSerializer(data=request.data) if serializer.is_valid(): serializer.save() return Response(serializer.data, status=status.HTTP_201_CREATED) return Response(serializer.data, status=status.HTTP_400_BAD_REQUEST) @api_view(['PATCH']) def productQuantityChange(request, pk, quantity): products = Product.objects.get(sku=pk) data = {'quantity': products.quantity + int(quantity)} serializer = ProductSerializer(products, data=data, partial=True) if serializer.is_valid(): serializer.save() return Response(serializer.data)
997,705
208f1f5678d54279fbd4bcfadaca290d462a49b9
from flask import Flask import redis from bson import json_util from config import * from mongo_client import Mongo app = Flask(__name__) mongo_client = Mongo() redis_client = redis.Redis.from_url(REDIS_DSN) @app.route('/') def healthy(): return "OK", 200 @app.route('/collection/<collection>/id/<document_id>') def fetch(collection, document_id): return get_from_cache_or_mongo(collection, document_id), 200 def get_from_cache_or_mongo(collection, document_id): key = f'mongodb:{collection}:{document_id}' result = get_from_cache(key) if result is None: result = mongo_client.find_one(collection, document_id) redis_client.set(key, json_util.dumps(result)) return result def get_from_cache(key): result = redis_client.get(key) if result is None: return result return json_util.loads(result) if __name__ == '__main__': app.run(host='0.0.0.0', port=PORT, debug=DEBUG_MODE)
997,706
ffe6d25356bcd18bf3b1642891d82a63580f76a0
from __future__ import annotations import argparse import dxtbx.util from dxtbx.sequence_filenames import find_matching_images def run(args=None): dxtbx.util.encode_output_as_utf8() parser = argparse.ArgumentParser( description="Find images that match a template specification" ) parser.add_argument( "template", help="The template specification", metavar="TEMPLATE" ) options = parser.parse_args(args) for mi in find_matching_images(options.template): print(mi) if __name__ == "__main__": run()
997,707
feeab94d6ef30b3107bf1159ce592ac304c686d0
# Generated by Django 3.0.7 on 2020-06-18 23:13 from django.db import migrations class Migration(migrations.Migration): dependencies = [ ('filmsnob', '0001_initial'), ] operations = [ migrations.RenameField( model_name='movies', old_name='movie_name', new_name='movie_title', ), ]
997,708
c5d40325fb37267244f921cc7370abd557e85b40
def graphDistances(g, s): g=Graph(g) return g.dijkstra(s) class Graph(): def __init__(self, graph): self.V = len(graph) self.graph = graph def minDistance(self, dist, SPT): # Initilaize min distance as large int to represent ~INF min_ = 1e9 # Search not nearest vertex not in Shortest Path Tree for v in range(self.V): if dist[v]!=-1 and dist[v] < min_ and not SPT[v] : min_ = dist[v] min_index = v return min_index # Dijkstra's single source graph algorithm def dijkstra(self, sourceNode): print('Dijkstra') dist = [1e9] * self.V dist[sourceNode] = 0 SPT = [0] * self.V # loop size(v) times to find all vertecies for _ in range(self.V): print('d:',dist) print('spt:',SPT) # find closest vertex not in SPT u = self.minDistance(dist, SPT) # mark vertex found (vertex in SPT) SPT[u] = 1 # update distance values for adjacent verticies # if (new distance to vertex is less and vertex not in SPT) for v in range(self.V): if self.graph[u][v] >= 0 and not SPT[v] and dist[v] > dist[u] + self.graph[u][v]: dist[v] = dist[u] + self.graph[u][v] return dist
997,709
16415d1a9fd7cc52d05e7b623110a65f60cddaba
from flask import Flask, jsonify, request, render_template, session, redirect, g, flash, url_for, make_response from flask_cors import CORS, cross_origin import requests import urllib from yandex_music import Client, exceptions from dl.models import SentimentDiscovery import multiprocessing as mp import numpy as np import random import uuid import json from datetime import datetime import pandas as pd import plotly import plotly.graph_objects as go import plotly.express as px from get_songs_data import SongProcessing import json from json import JSONEncoder import sys import traceback client_id = 'none' client_secret = 'none' sd_model = SentimentDiscovery() test_data = { "anger_lyrics": [ 0.0, 0.0, 0.4400000050663948, 0.0, 0.0, 0.07000000153978665 ], "anticipation_lyrics": [ 0.0, 0.0, 0.0, 0.0, 0.0, 0.009999999776482582 ], "disgust_lyrics": [ 0.0, 0.0, 0.8350000083446503, 0.0, 0.0, 0.07444444422920544 ], "fear_lyrics": [ 0.15000000596046448, 0.0, 0.07500000018626451, 0.0, 0.0, 0.0 ], "is_angry_music": [ 0.0, 0.0, 0.0, 2.0, 0.0, 1.0 ], "is_happy_music": [ 0.0, 2.0, 2.0, 3.0, 1.0, 6.0 ], "is_relaxed_music": [ 0.0, 0.0, 0.0, 0.0, 0.0, 0.0 ], "is_sad_music": [ 1.0, 0.0, 0.0, 0.0, 0.0, 0.0 ], "joy_lyrics": [ 0.6899999976158142, 0.0, 0.0, 0.0, 0.0, 0.17222221692403158 ], "main_mood": [ "joy", "joy", "disgust", "joy", "joy", "joy" ], "sadness_lyrics": [ 0.009999999776482582, 0.0, 0.635000005364418, 0.0, 0.0, 0.005555555431379212 ], "surprise_lyrics": [ 0.0, 0.0, 0.0, 0.0, 0.0, 0.0 ], "timestamp": [ "2021-07-30", "2021-07-31", "2021-08-06", "2021-08-08", "2021-08-09", "2021-08-21" ], "trust_lyrics": [ 0.0, 0.0, 0.0, 0.0, 0.0, 0.0 ]} class NumpyEncoder(JSONEncoder): def default(self, obj): if isinstance(obj, np.float32): return obj.astype(float) elif isinstance(obj, np.float16): return obj.astype(float) elif isinstance(obj, np.float64): return obj.astype(float) elif isinstance(obj, np.int32): return obj.astype(int) elif isinstance(obj, np.int64): return obj.astype(int) elif isinstance(obj, np.ndarray): return obj.tolist() else: return JSONEncoder.default(self, obj) def get_test_plot(data): songs_count = sum(data['is_angry_music'])+\ sum(data['is_happy_music']) + \ sum(data['is_relaxed_music']) + \ sum(data['is_sad_music']) data_df = pd.DataFrame(data) data_df['day_sn'] = data_df['is_angry_music'] + data_df['is_happy_music'] + data_df['is_relaxed_music'] + data_df['is_sad_music'] data_df['angry_music_perc'] = data_df['is_angry_music']/data_df['day_sn'] data_df['happy_music_perc'] = data_df['is_happy_music'] / data_df['day_sn'] data_df['relaxed_music_perc'] = data_df['is_relaxed_music'] / data_df['day_sn'] data_df['sad_music_perc'] = data_df['is_sad_music'] / data_df['day_sn'] data_df['Спокойствие'] = data_df['trust_lyrics'] + 0.25*data_df['relaxed_music_perc'] data_df['Ярость'] = data_df['anger_lyrics'] + 0.25*data_df['angry_music_perc'] data_df['Восторг'] = data_df['anticipation_lyrics'] data_df['Веселье'] = data_df['joy_lyrics'] + 0.25*data_df['happy_music_perc'] data_df['Неприязнь'] = data_df['disgust_lyrics'] data_df['Страх'] = data_df['fear_lyrics'] data_df['Удивление'] = data_df['surprise_lyrics'] data_df['Грусть'] = data_df['sadness_lyrics'] + 0.25*data_df['sad_music_perc'] emts = ['Спокойствие', 'Ярость', 'Восторг', 'Веселье', 'Неприязнь', 'Страх', 'Удивление', 'Грусть'] def get_main_emotion(x): vls = list(x[emts]) return emts[vls.index(max(vls))] data_df['main_mood'] = data_df.apply(get_main_emotion, axis=1) v_map = { 'Ярость': -3, 'Страх': -2, 'Неприязнь': -1, 'Грусть': 0, 'Спокойствие': 1, 'Удивление': 2, 'Восторг': 3, 'Веселье': 4 } sms = [data_df[e].sum() for e in emts] pie_df = pd.DataFrame({ "Настроение": emts, "Величина": sms }) st_b_d = {'Дата': [], 'Настроение': [], 'Величина': []} l_d = {'Дата': [], 'Настроение': [], 'Величина': [], 'z':[]} for ts in data['timestamp']: k = data_df[data_df['timestamp'] == ts]['main_mood'].values[0] v = v_map[k] l_d['Дата'].append(datetime.strptime(ts, '%Y-%m-%d')) l_d['Настроение'].append(k) l_d['Величина'].append(v) l_d['z'].append(5) for e in emts: st_b_d['Дата'].append(ts) st_b_d['Настроение'].append(e) st_b_d['Величина'].append(round(data_df[data_df['timestamp'] == ts][e].values[0], 2)) bar_df = pd.DataFrame(st_b_d) line_df = pd.DataFrame(l_d) cdm = { 'Ярость': '#FF6F76', 'Страх': '#FFCA2D', 'Неприязнь': '#6DCE8A', 'Грусть': '#8D92A5', 'Спокойствие': '#97F3FD', 'Удивление': '#FDB5B5', 'Восторг': '#D076FF', 'Веселье': '#52A3FD' } color_scale = [ [0.0, '#FF6F76'], [0.125, '#FFCA2D'], [0.25, '#6DCE8A'], [0.375, '#8D92A5'], [0.625, '#97F3FD'], [0.75, '#FDB5B5'], [0.875, '#D076FF'], [1.0, '#52A3FD'] ] pie_fig = px.pie(pie_df, values="Величина", names="Настроение", template='plotly_dark', color="Настроение", color_discrete_map=cdm) pie_fig.update_traces(textinfo='none', hoverinfo='label') pie_fig.layout.plot_bgcolor = "#292E43" pie_fig.layout.paper_bgcolor = "#292E43" bar_fig = px.bar(bar_df, x="Дата", y="Величина", template='plotly_dark', color="Настроение", color_discrete_map=cdm) bar_fig.layout.plot_bgcolor = "#292E43" bar_fig.layout.paper_bgcolor = "#292E43" bar_fig.update_yaxes(visible=False) bar_fig.update_layout(barnorm="percent") fig1 = px.line(line_df, x="Дата", y="Величина") fig1.update_traces(line=dict(color='#ECF8F7')) fig2 = px.scatter(line_df, x='Дата', y='Величина', template='plotly_dark', color='Настроение', color_discrete_map=cdm, size='z' # trendline="rolling", # trendline_options=dict(window=1) ) line_fig = go.Figure(data=fig1.data + fig2.data) line_fig.layout.plot_bgcolor = "#292E43" line_fig.layout.paper_bgcolor = "#292E43" line_fig.update_yaxes(visible=False) line_fig.update_layout(template='plotly_dark') line_fig.update_traces(line_shape='spline') return json.dumps(pie_fig, cls=plotly.utils.PlotlyJSONEncoder), \ json.dumps(bar_fig, cls=plotly.utils.PlotlyJSONEncoder), \ json.dumps(line_fig, cls=plotly.utils.PlotlyJSONEncoder) def get_plots(): return def create_app(app_name='YAMOOD_API'): app = Flask(app_name) app.secret_key = 'rand'+str(random.random()) CORS(app, resources={r"/api/*": {"origins": "*"}}) @app.route('/') def main_page(): at = request.cookies.get('access_token') if at: if request.args.get('n'): num_tracks = int(request.args.get('n')) else: num_tracks = 20 y_clnt = Client(at) g.user = { 'username': y_clnt.me.account.login, 'access_token': at } try: data = SongProcessing.get_user_stats(at, num_tracks, sd_model) except BaseException as e: error = "Что-то пошло не так( Показываем тестовых рыбов" ex_type, ex_value, ex_traceback = sys.exc_info() # Extract unformatter stack traces as tuples trace_back = traceback.extract_tb(ex_traceback) # Format stacktrace stack_trace = list() for trace in trace_back: stack_trace.append("File : %s , Line : %d, Func.Name : %s, Message : %s" % ( trace[0], trace[1], trace[2], trace[3])) flash("File : %s , Line : %d, Func.Name : %s, Message : %s" % ( trace[0], trace[1], trace[2], trace[3])) data = test_data flash(str(e)) flash(error) print("Exception type : %s " % ex_type.__name__) print("Exception message : %s" % ex_value) print("Stack trace : %s" % stack_trace) flash("Exception type : %s " % ex_type.__name__) flash("Exception message : %s" % ex_value) pieJSON, barJSON, lineJSON = get_test_plot(data) resp = make_response(render_template('notdash.html', pieJSON=pieJSON, barJSON=barJSON, lineJSON=lineJSON)) resp.set_cookie('access_token', at, max_age=60 * 60 * 24 * 365 * 2) return resp else: return render_template('login.html') @app.route('/get_songs_history') def songs_history(): session['access_token'] = 'AgAAAAAh7Vk7AAG8XtDkZzG_PEYLjGVYMIVdDQE' if 'access_token' in session: num_tracks = int(request.args.get('n')) final_chart_json = SongProcessing.get_user_stats(session['access_token'], num_tracks, sd_model) return final_chart_json, 200 else: return redirect('/') @app.route('/dash_test', methods=['GET', 'POST']) def notdash(): pieJSON, barJSON = get_test_plot(session['access_token']) return render_template('notdash.html', pieJSON=pieJSON, barJSON=barJSON) @app.route('/api/get_text_emotions', methods=['POST']) @cross_origin() def text_emotions(): if request.method == "POST": request_data = request.get_json() text = request_data['text'] fn = f'dl/data/data{uuid.uuid4()}.csv' with open(fn, 'w') as f: f.write('text\n'+text.replace("\n", " ")) res = sd_model.classify(fn) print(res) return {'result': str(res)}, 200 return jsonify({ 'statusCode': 400 }), 400 @app.route('/api/get_text_emotions_batch', methods=['POST']) @cross_origin() def text_emotions_batch(): if request.method == "POST": request_data = request.get_json() texts = request_data['texts'] fn = f'dl/data/data{uuid.uuid4()}.csv' with open(fn, 'w') as f: f.write('text\n') for t in texts: f.write('"'+t.replace("\n", " ").replace('"', '\\"')+'"\n') res = np.round(sd_model.classify(fn)[1], 2) print(res) return {'result': str(res)}, 200 return jsonify({ 'statusCode': 400 }), 400 def get_client(code): token_auth_uri = f"https://oauth.yandex.ru/token" headers = { 'Content-type': 'application/x-www-form-urlencoded', } query = { 'grant_type': 'authorization_code', 'code': code, 'client_id': client_id, 'client_secret': client_secret, } query = urllib.parse.urlencode(query) resp = requests.post(token_auth_uri, data=query, headers=headers) print(resp.text) rj = resp.json() return rj['access_token'] def get_client_from_cred(un, pwd): return Client.from_credentials(un, pwd).token @app.route('/auth', methods=['POST', 'GET']) @cross_origin() def auth(): if request.method == "GET": code = request.args.get('code') token = get_client(code) session['access_token'] = token return redirect('/') elif request.method == "POST": username = request.form.get('username') password = request.form.get('password') error = None if not username: error = 'Введите логин' elif not password: error = 'Введите пароль' if error is None: try: token = get_client_from_cred(username, password) session['access_token'] = token resp = make_response(redirect('/')) resp.set_cookie('access_token', token, max_age=60 * 60 * 24 * 365 * 2) return resp except Exception as e: flash(str(e)) error = "Неудалось войти... Вероятный диагноз -- неверный пароль(" flash(error) return render_template('login.html') @app.route('/logout', methods=['POST', 'GET']) @cross_origin() def logout(): session.clear() resp = make_response(redirect(url_for('main_page'))) resp.set_cookie('access_token', '', expires=0) return resp return app if __name__ == "__main__": app = create_app() app.run(host='0.0.0.0', debug=True, threaded=True)
997,710
eaa343eb6ed95e7307d889eb87e740cf350bd684
from bs4 import BeautifulSoup import requests import json def gather_urls(): r = requests.get("http://www.politico.com/") soup = BeautifulSoup(r.text, 'html.parser') divs = soup.find_all('div', class_='fig-graphic') return [div.find('a')['href'] for div in divs if div.find('a')] def parse_data(url): r = requests.get(url) soup = BeautifulSoup(r.text, 'html.parser') created_at = soup.find('p', class_='timestamp').find('time')['datetime'] updated_at = soup.find('p', class_='updated').find('time')['datetime'] js_string = soup.findAll('script')[13].string.split(';')[0].split('= ')[1].strip() data = json.loads(js_string) data['created_at'] = created_at data['updated_at'] = updated_at return data
997,711
7bbd8a519f59ff891290a7011fb74f65a152f697
from django import forms class CreateForm(forms.Form): title = forms.CharField(label='Title', max_length=300, widget=forms.TextInput(attrs={'class': 'form-control'})) text = forms.CharField(label='Text', widget=forms.Textarea(attrs={'class': 'form-control'}))
997,712
907fd2b337ddfd4b661b1ac2ecc8f48242e3c3ca
fout=open('fib.txt','wt') def fib(num): count = 1 a = 1 b = 1 print(count, a, file=fout) while(count < num): a, b = b, a+b count += 1 print(count, a, file=fout) fib(1000) fout.close()
997,713
54b9bb8a20b775fbff396831746a265eb1a51362
""" MITM DNS Poisoning script Developed by: - Hiro - Hiram """ from scapy.all import * from collections import deque import threading import time import sys """ Poisons gateway's and client's ARP tables, so packets are redirected the attacker machine. """ class ARPPoisonThread(threading.Thread): def __init__( self,\ targetip,\ gatewayip,\ name='arpoison' ): """ constructor, setting initial variables """ self._stopevent = threading.Event( ) self._sleepperiod = 1.0 threading.Thread.__init__(self, name=name) self.targetip = targetip self.gatewayip = gatewayip def _getmac(self, targetip): arppacket = Ether(dst="ff:ff:ff:ff:ff:ff")/ARP(op=1, pdst=targetip) targetmac = srp(arppacket)[0][0][1].hwsrc return targetmac def _poisonarpcache(self, targetip, targetmac, sourceip): spoofed = ARP(op=2 , pdst=targetip, psrc=sourceip, hwdst= targetmac) send(spoofed) def _restorearp(self, targetip, targetmac, sourceip, sourcemac): packet = ARP( op=2,\ hwsrc=sourcemac,\ psrc= sourceip,\ hwdst= targetmac,\ pdst= targetip) send(packet) print ("ARP Table restored to normal for", targetip) def run(self): try: self.targetmac = self._getmac(self.targetip) except: print("Target machine did not respond to ARP broadcast") quit() try: self.gatewaymac= self._getmac(self.gatewayip) except: print("Gateway is unreachable") quit() print ("Sending spoofed ARP replies") while True: time.sleep(5) self._poisonarpcache(self.targetip, self.targetmac, self.gatewayip) self._poisonarpcache(self.gatewayip, self.gatewaymac, self.targetip) def join(self, timeout=None): print ("ARP spoofing stopped") self._restorearp( self.gatewayip,\ self.gatewaymac,\ self.targetip,\ self.targetmac) self._restorearp( self.targetip,\ self.targetmac,\ self.gatewayip,\ self.gatewaymac) threading.Thread.join(self, timeout) class DNSPoisonThread(threading.Thread): def __init__( self,\ site,\ targetip,\ name='dnspoison'): """ constructor, setting initial variables """ threading.Thread.__init__(self, name=name) self.site = site self.targetip = targetip def _analysis(self, packet): #Performs checks, whether DNS response contains our gold or not. if self.site in packet[DNSQR].qname.decode('UTF-8'): udp_packet = (Ether(src=packet[Ether].dst, dst=packet[Ether].src, type = "IPv4") /IP(ihl = packet[IP].ihl, src=packet[IP].dst, dst= packet[IP].src, ttl = packet[IP].ttl, chksum = None) /UDP(sport=53, dport=packet[UDP].sport, len = None, chksum = None) /DNS(id=packet[DNS].id, rd=1, qr=1, ra=1, z=0, rcode=0,qdcount=1, ancount=1, nscount=0, arcount=0,qd = DNSQR(qname = packet[DNSQR].qname, qtype = "A", qclass="IN"),an=DNSRR(rrname=packet[DNSQR].qname, rdata= "23.96.35.235",type="A",rclass="IN", ttl=174))) udp_packet.show() sendp(udp_packet) def run(self): #Only do packet sniffing sniff( filter=f'ip src {self.targetip} and udp port 53',\ prn=self._analysis) def join(self, timeout=None): threading.Thread.join(self, timeout) import argparse def args(): arg_parser = argparse.ArgumentParser() arg_parser.add_argument('gatewayip', metavar='G', help='IP address of the gateway') arg_parser.add_argument('targetip', metavar='T', help='IP address of the target') arg_parser.add_argument('site', metavar='S', help='Domain to be spoofed') arg_parser.add_argument('poisonip', metavar='P', help='New IP for the domain') args = arg_parser.parse_args() return args def main(args): targetip = args.targetip gatewayip = args.gatewayip site = args.site poisonip = args.poisonip print(f"Will spoof {targetip} of gateway {gatewayip} for site {site} as {poisonip}") try: arp_poison = ARPPoisonThread(targetip, gatewayip) dns_poison = DNSPoisonThread(site, targetip) arp_poison.start() time.sleep(5) dns_poison.start() while True: time.sleep(.1) except KeyboardInterrupt: arp_poison.join() dns_poison.join() if __name__ == "__main__": main(args())
997,714
1346f251bfa849f1cf5cd0a49b1e19e66044226c
import numpy import scipy import math import sys import getopt import random from scipy import spatial from scipy.special import erfinv import copy import networkx as nx # This simulation scheme follows ISO spherical coordinate system convention. # - angle_t(theta) := polar angle [0, pi] # - angle_p(phi) := azimuth angle [0, 2*pi] # Static variables (Hard-coded). --------------------------------------- Instance_Count = 50 Angle_Lower_Bound = 0.003935 Angle_Upper_Bound = 3.126928 Max_Performance = 10 + math.sqrt(40/3)*erfinv( math.cos(Angle_Lower_Bound) ) # approx 21.5472 Min_Performance = 10 + math.sqrt(40/3)*erfinv( math.cos(Angle_Upper_Bound) ) # approx 0.0001 Approx_30p_Angle = 2.548343 # approx 10.7736 Approx_50p_Angle = 1.333029 # approx 10.7736 Approx_60p_Angle = 0.732863 # approx 12.9283 Approx_70p_Angle = 0.314320 # approx 15.083 Approx_80p_Angle = 0.100644 # approx 17.2377 Approx_90p_Angle = 0.023457 # approx 19.3924 ## Explicit equation for angles x ## sqrt(40/3)*erfinv( cos(x) ) = P * ( sqrt(40/3)*erfinv( cos(LB) ) - sqrt(40/3)*erfinv( cos(UB) )) + sqrt(40/3)*erfinv( cos(UB) ) ## sqrt(40/3)*erfinv( cos(x) ) = P * ( sqrt(40/3)*erfinv( cos(0.003935) ) - sqrt(40/3)*erfinv( cos(3.126928) )) + sqrt(40/3)*erfinv( cos(3.126928) ) # ---------------------------------------------------------------------- def normal_performance(opinion, answer): # Assume market vector is not fixed. angle = angle_between(opinion, answer) return 10 + math.sqrt(40/3)*erfinv( math.cos(angle) ) def opinion_init(number_of_nodes, condition): ## Initialize polar angles (angle_t) and azimuth angles (angle_p) angle_t = None angle_p = None if condition == 1: # Initial performances are between 50% and 100%. U50p = 0.5*(numpy.cos(Approx_50p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(U50p, 1.0, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 2: # Initial performances are between 60% and 100%. U60p = 0.5*(numpy.cos(Approx_60p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(U60p, 1.0, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 3: # Initial performances are between 50% and 60%. U50p = 0.5*(numpy.cos(Approx_50p_Angle) + 1) U60p = 0.5*(numpy.cos(Approx_60p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(U50p, U60p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 4: # Initial performances are between 0% and 50%. U50p = 0.5*(numpy.cos(Approx_50p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(0.0, U50p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 5: # Initial performances are between 0% and 60%. U60p = 0.5*(numpy.cos(Approx_60p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(0.0, U60p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 6: # Initial performances are between 0% and 70%. U70p = 0.5*(numpy.cos(Approx_70p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(0.0, U70p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 7: # Initial performances are between 0% and 80%. U80p = 0.5*(numpy.cos(Approx_80p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(0.0, U80p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 8: # Initial performances are between 0% and 90%. U90p = 0.5*(numpy.cos(Approx_90p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(0.0, U90p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) elif condition == 9: # Initial performances are between 50% and 60%. # and angle_p (phi) are between 0 and pi/6 U50p = 0.5*(numpy.cos(Approx_50p_Angle) + 1) U60p = 0.5*(numpy.cos(Approx_60p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(U50p, U60p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1/20, number_of_nodes)) elif condition == 10: # Initial performances are between 50% and 60%. # and angle_p (phi) are between 0 and pi/6 U60p = 0.5*(numpy.cos(Approx_60p_Angle) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(0.0, U60p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1/20, number_of_nodes)) elif condition == 11: # Initial performances are between 0% and 47%. U50p = 0.5*(numpy.cos(Approx_50p_Angle + 0.2) + 1) angle_t = numpy.arccos(2 * numpy.random.uniform(0.0, U50p, number_of_nodes) - 1) angle_p = 2 * math.pi * (numpy.random.uniform(0, 1, number_of_nodes)) result = [] for i in range(0, number_of_nodes): result.append([angle_t[i], angle_p[i]]) return result def spherical2cartesian(a): ## Input: a spherical coordinates with unit length. [theta, phi] return [numpy.sin(a[0])*numpy.cos(a[1]), numpy.sin(a[0])*numpy.sin(a[1]), numpy.cos(a[0])] def arc_midpoint(a, b): ## Input: two spherical coordinates with unit length. cartesian_a = spherical2cartesian(a) cartesian_b = spherical2cartesian(b) lin_mpt = [ (cartesian_a[0] + cartesian_b[0])/2, \ (cartesian_a[1] + cartesian_b[1])/2, \ (cartesian_a[2] + cartesian_b[2])/2] magnitude = numpy.sqrt(lin_mpt[0]**2 + lin_mpt[1]**2 + lin_mpt[2]**2) mid_theta = numpy.arccos(lin_mpt[2]/magnitude) mid_phi = numpy.arctan2(lin_mpt[1], lin_mpt[0]) ## [Note] usage of arctan2 return [mid_theta, mid_phi] def learning(opinion_a, opinion_b, param): if param == 1: ## 12.5%, 1/8 return arc_midpoint(opinion_a, learning(opinion_a, opinion_b, 2)) elif param == 2: ## 25%, 2/8 return arc_midpoint(opinion_a, learning(opinion_a, opinion_b, 4)) elif param == 3: ## 37.5%, 3/8 return arc_midpoint(learning(opinion_a, opinion_b, 2), learning(opinion_a, opinion_b, 4)) elif param == 4: ## 50%, 4/8 return arc_midpoint(opinion_a, opinion_b) elif param == 5: ## 62.5%, 5/8 return arc_midpoint(learning(opinion_a, opinion_b, 4), learning(opinion_a, opinion_b, 6)) elif param == 6: ## 75%, 6/8 return arc_midpoint(learning(opinion_a, opinion_b, 4), opinion_b) elif param == 7: ## 87.5%, 7/8 return arc_midpoint(learning(opinion_a, opinion_b, 6), opinion_b) def angle_between(a, b): a = numpy.inner( spherical2cartesian(a), spherical2cartesian(b) ) return numpy.arccos(a) #return numpy.arccos( numpy.inner( spherical2cartesian(a), spherical2cartesian(b) ) ) def standardize(a): # polar angle in [0, pi] if a[0] > math.pi: a[0] = 2*math.pi - a[0] if a[0] < 0: a[0] = -a[0] # azimuth angle in [0, 2*pi] if a[1] > 2*math.pi: a[1] = a[1] - 2*math.pi if a[1] < 0: a[1] = 2*math.pi + a[1] if a[0] < 0.003935: ##print a[0] a[0] = 0.003935 if a[0] > 3.137657: a[0] = 3.137657 return a def simulator(input_option): # input_option := [NodeCount, SearchRange, LearningRate, Behavior, InitCondition] # 1. NodeCount := Indicates the number agents in the system (organization). # 2. SearchRange := Represents the search range of each agent's learning activity. # It is an upper limit of angle between two opinions. # 3. LearningRate := Represents the learning rate of each agent. # In this simulation, it is {25%, 50%, 75%}. # 4. Behavior := Represents the degree of randomness in the learning process. # 5. InitCondition := Represents the type of knowledge initialization pattern. # 6. marketFileName:= File name of market vector movement. NodeCount = int(input_option[0]) SearchRange = float(input_option[1]) LearningRate = int(input_option[2]) BehaviorParameter = float(input_option[3]) InitCondition = int(input_option[4]) convergence_log = [] elapsed_time_log = [] market_file = open(input_option[5], 'r') market_data = [] for i in range(0, 201): market_data.append( [float(x) for x in market_file.readline().split(",")] ) # [START] Simulations ---------------------------------------------- for instance in range(0, Instance_Count): ## initialize market coordinate market = [0.0, 0.0] ## initialize opinions opinion = opinion_init(NodeCount, InitCondition) performance_log = [] flag = 0 time = 0 mind = 0 stop = False current_performance = [0]*NodeCount if instance < 0.001 and InitCondition == 4: trackFile = open('./geonsik_result_track'+SearchRange+'.txt', 'w') ##while(stop == False): while(time < 1000): mind = int((time-1)/5) market = market_data[mind] # Step 1. Evaluation performance_log.append(sum(current_performance)/((Max_Performance-Min_Performance)*NodeCount)) for i in range(0, NodeCount): current_performance[i] = normal_performance(opinion[i], market) if time == 0: print "max!!", max(current_performance)/(Max_Performance-Min_Performance) if instance < 0.001 and InitCondition == 4: for i in range(0, NodeCount): cart = spherical2cartesian(opinion[i]) trackFile.write(repr(time)+","+",".join(str(x) for x in cart)+'\n'); # print opinion[i], " ::::", current_performance[i] #print "----------------" #print time, " ",max(current_performance/(Max_Performance-Min_Performance)) # Step 2. Learning. new_opinion = [[0 for v1 in range(2)] for v2 in range(NodeCount)] for i in range(0, NodeCount): # Step 2-1. Search and Assimilate. best_value = current_performance[i] best_index = i for j in range(0, NodeCount): if ( angle_between(opinion[i], opinion[j]) < SearchRange*math.pi ) \ and current_performance[j] > best_value: #if current_performance[j] > best_value: best_value = current_performance[j] best_index = j #print best_index, " ",best_value/(Max_Performance-Min_Performance) if i != best_index: new_opinion[i] = learning(opinion[i], opinion[best_index], LearningRate) else: new_opinion[i] = opinion[i] #print "---------" #print opinion[i] #print opinion[best_index] #print new_opinion[i] #print "---------" # Step 2-2. Add Perturbation. for j in range(0, 2): new_opinion[i][j] += numpy.random.uniform(-BehaviorParameter, +BehaviorParameter) # Step 2-3. Standardize. new_opinion[i] = standardize(new_opinion[i]) opinion = copy.deepcopy(new_opinion) # Step 3. Record Time and Check Exit Condition. time += 1 if (len(performance_log) > 2) and (abs(performance_log[-1] - performance_log[-2]) < 0.002): flag += 1 #else: # flag = 0 if flag > 4: stop = True; if sum(current_performance)/((Max_Performance-Min_Performance)*NodeCount) > 0.95: stop = True; #if time%100 == 0: # print sum(current_performance)/((Max_Performance-Min_Performance)*NodeCount), " ", best_value/(Max_Performance-Min_Performance) #if (len(performance_log) > 2): # print performance_log[-1] #if time > 100: # stop = True; org_performance = sum(current_performance)/((Max_Performance-Min_Performance)*NodeCount) print "Convergence = ", org_performance, ", Elapsed Time = ", time convergence_log.append(org_performance) elapsed_time_log.append(time) # [END] Simulations ------------------------------------------------ # return average statistics of instances under given conditions. ##return [sum(convergence_log)/len(convergence_log), sum(elapsed_time_log)/(1.0*len(elapsed_time_log))] return [sum(convergence_log)/len(convergence_log), numpy.var(convergence_log)] def main(argv=None): if argv is None: argv = sys.argv # parse command line options try: opts, args = getopt.getopt(sys.argv[1:], "h", ["help"]) except getopt.error, msg: print msg print "for help use --help" sys.exit(2) # process arguments NodeCount = 0 Neighbor = 0 LearningRate = 0 BehaviorParameter = 0 ## set random seed. numpy.random.seed(1) if len(args) > 0: NodeCount = int(args[0]) if len(args) > 1: Neighbor = int(args[1]) if len(args) > 2: LearningRate = float(args[2]) if len(args) > 3: BehaviorParameter = float(args[3]) ##org_option = [NodeCount, LearningRate, BehaviorParameter] #for BP in [0.0, 0.05, 0.1, 0.15, 0.20, 0.25, 0.3, 0.35, 0.4]: condition = 11 ##f = open('./geonsik_result'+repr(condition)+'.txt', 'w') ##for BP in [0.0, 0.01, 0.02, 0.03, 0.04, 0.05, 0.1, 0.15, 0.20, 0.25, 0.3, 0.35, 0.4]: ##for BP in [0.0, 0.1, 0.2, 0.3, 0.4, 0.5]: ##for BP in [0.0, 0.4, 0.8, 1.2, 1.6]: ##for BP in [0.0]: if False: ## Experiment 1: Effect of Randomness L = 3 for BP in [0.0, 0.01, 0.02, 0.03, 0.04, 0.05]: print BP for condition in [11, 4,5,6,7]: org_option = [40, 1, L, BP, condition] # input_option := [NodeCount, SearchRange, LearningRate, Behavior, InitCondition] result = simulator(org_option) f.write(repr(condition)+","+repr(BP)+","+repr(result[0])+","+repr(result[1])+'\n'); ## -------------------------------------------------------------------------------------------- if False: ## Experiment 2: Value of Slow Learning BP = 0 ##for L in [12.5, 25, 37.5, 50, 62.5, 75]: for L in [1,2,3,4,5,6,7]: for condition in [11, 4,5,6,7]: org_option = [40, 1, L, BP, condition] # input_option := [NodeCount, SearchRange, LearningRate, Behavior, InitCondition] result = simulator(org_option) f.write(repr(condition)+","+repr(BP)+","+repr(L)+","+repr(result[0])+","+repr(result[1])+'\n'); ## -------------------------------------------------------------------------------------------- if True: ## Experiment 3: Value of BP = 0 L = 3 market_file = "./market_simga2.0/market0_mu0.0_sigma2.0.txt" ## market_file = "./market_simga2.0/market0_mu0.0_sigma2.0.txt" for condition in [11, 4,5,6,7]: ##for searchRange in [0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1]: #for searchRange in [0.1, 0,2]5 for searchRange in [0.9, 1]: f = open('./geonsik_result'+repr(searchRange)+'.txt', 'w') org_option = [40, searchRange, L, BP, condition, market_file] # input_option := [NodeCount, SearchRange, LearningRate, Behavior, InitCondition] result = simulator(org_option) f.write(repr(condition)+","+repr(searchRange)+","+repr(result[0])+","+repr(result[1])+'\n'); ## -------------------------------------------------------------------------------------------- f.close() if __name__ == "__main__": main()
997,715
0a86eece0ea3fac9a12f3ac71ab7f0534f884f37
print ("%s is a string, %d is a decimal %.3f is a floating no. upto 3 decimal no. place")
997,716
c1e4eb02911180b65833df1278727565cf19a8f5
import argparse #import requests import time import pandas as pd #import os from pathlib import Path from bs4 import BeautifulSoup from selenium import webdriver from random import randrange max_tries = 10 root = Path(__file__).parents[1] descr = ("Download UNFCCC National Inventory Submissions lists " "and create list of submissions as CSV file") parser = argparse.ArgumentParser(description=descr) parser.add_argument( 'year', help='Year to download' ) args = parser.parse_args() year = args.year print("Fetching submissions for {}".format(year)) url = ( "https://unfccc.int/process/transparency-and-reporting/" "reporting-and-review-under-the-convention/" "greenhouse-gas-inventories-annex-i-parties/" "submissions/national-inventory-submissions-{}".format(year) ) if int(year) == 2019: url = ( "https://unfccc.int/process-and-meetings/transparency-and-reporting/" "reporting-and-review-under-the-convention/" "greenhouse-gas-inventories-annex-i-parties/" "national-inventory-submissions-{}".format(year) ) if int(year) >= 2020: url = ( "https://unfccc.int/ghg-inventories-annex-i-parties/{}".format(year) ) print(url) #result = requests.get(url) # set options for headless mode options = webdriver.firefox.options.Options() options.add_argument('-headless') # create profile for headless mode and automatical downloading profile = webdriver.FirefoxProfile() # set up selenium driver driver = webdriver.Firefox(options = options, firefox_profile = profile) driver.get(url) html = BeautifulSoup(driver.page_source, "html.parser") table = html.find("table") # check if table found. if not the get command didn't work, likely because of a captcha on the site ### TODO replace by error message if not(table): # try to load htm file from disk print('Download failed, trying to load manually downloaded file') file = open("manual_page_downloads/National-Inventory-Submissions-{}.html".format(year)) content = file.read() html = BeautifulSoup(content, "html.parser") table = html.find("table") if not(table): print("Manually downloaded file " + "manual_page_downloads/National-Inventory-Submissions-{}.html".format(year) + " not found") exit() links = table.findAll('a') targets = [] # sub-pages downloads = [] no_downloads = [] # Check links for Zipfiles or subpages for link in links: if "href" not in link.attrs: continue href = link.attrs["href"] if "/documents/" in href: if "title" in link.attrs.keys(): title = link.attrs["title"] else: title = link.contents[0] if href.startswith("/documents"): href = "https://unfccc.int" + href # Only add pages in the format https://unfccc.int/documents/65587 # to further downloads if str(Path(href).parent).endswith("documents"): targets.append({"title": title, "url": href}) elif href.endswith(".zip"): if href.startswith("/files"): href = "https://unfccc.int" + href country = Path(href).name.split("-")[0].upper() title = "{} {}".format(country, link.contents[0]) print("\t".join([title, href])) downloads.append({"Title": title, "URL": href}) # Go through sub-pages. for target in targets: time.sleep(randrange(5, 15)) url = target["url"] i = 0 while i < max_tries: try: #subpage = requests.get(url, timeout=15.5) #html = BeautifulSoup(subpage.content, "html.parser") driver.get(url) html = BeautifulSoup(driver.page_source, "html.parser") title = html.find("h1").contents[0] break except AttributeError: print("Error fetching " + target["url"]) print("Retrying ...") time.sleep(randrange(5, 15)) i += 1 continue if i == max_tries: print("Aborting after {}".format(max_tries) + " tries") quit() h2 = html.find("h2", text="Versions") if h2: div = h2.findNext("div") links = div.findAll("a") if len(links) > 1: print("Warning: More than one link found. Downloading only the first file.") zipfile = links[0].attrs["href"] downloads.append({"Title": title, "URL": zipfile}) print("\t".join([title, url, zipfile])) else: no_downloads.append((title, url)) if len(no_downloads) > 0: print("No downloads for ", no_downloads) driver.close() df = pd.DataFrame(downloads) df.to_csv(root / "data/submissions-{}.csv".format(year), index=False)
997,717
ac809f0dcb62b96d8f413ae3cb779743489d2a43
import numpy as np import matplotlib.pyplot as plt x = np.linspace(-np.pi, np.pi, 200) cosy = np.cos(x) / 2 siny = np.sin(x) plt.plot(x, cosy, linestyle="-", linewidth=1, color="red") plt.plot(x, siny, linestyle=":", linewidth=2.5, color="green") plt.show()
997,718
8746b00b6ad68ca94c2c90038259db1c795b64b9
### Test : warehouses_clients.py ==> OK import time from warehouses_clients import * # Warehouses df_warehouses # "random_clients" function start_time = time.time() df_complete, indexes = random_clients(5) print("Temps d'exécution : %s secondes ---" % (time.time() - start_time)) print(f"indexes : {indexes}") df_complete ### Test : routes.py ==> OK from routes import * # 'nearest_nodes' function coords_list, nearest_nodes_list = nearest_nodes(df_complete) print(f'coords_list : {coords_list} \n') print(f'nearest_nodes_list : {nearest_nodes_list}') # 'itineraries' function ==> slow but it works coords_list, weight_array, itineraries_dict = itineraries(df_complete) print(f'coords_list : {coords_list} \n') print(f'weight_array : \n {weight_array} \n') print(f'itineraries_dict : \n {itineraries_dict}')
997,719
a8fc01ceea8829fad4f5ad398d8e555afd53a54d
""" Name: Priyanka Gnanasekaran Class: CS 521 - Fall 1 Date:10/8/2020 Final Project - Home Expense & Retirement Calculator """ #Requirement: The class must be imported by main program from gpriyan_final_classes import Monthly import datetime print("\nHome Expense and Retirement Calculator.\n") #Requirement: User-Defined Functions def retire_calc(current_savings,current_age,retirement_age, avg_annual_return,yearly_contribution): '''This function calculates retirement amount and returns it.''' #Requirement: assert unit test assert retirement_age >= current_age, 'Please enter your valid age!' year_s = retirement_age - current_age #retirement main calculation retire_amt = current_savings * ((avg_annual_return) ** (year_s)) while year_s > 0: year_s -= 1 retire_amt += yearly_contribution * (avg_annual_return ** year_s) retire_amt = round(retire_amt,2) assert retire_amt != 0, 'Please enter valid data!' #Requirement: assert unit test return retire_amt if __name__ == "__main__": print("\nPlease enter your choice of calculation:(e.g m for monthly)") u_choi=input("Bi-weekly = bw, Weekly = w," "\nMonthly = m, Semi-Monthly = sm:") u_choi=u_choi.lower() #taking input as lower case #Requirement: Iteration type WHILE and FOR while u_choi.isalnum(): #Requirement: try blocks try: #calcuations for four types of income. #Requirement: Conditional IF if u_choi == 'bw': salary_in= float(input("Please Enter your Bi-weekly income:$")) Expense=input("Type bi-weekly expenses with space inbetween:") G_expense = Expense.split() #sum of all expenses in list #Requiement: container type and iteration type g_expense=sum([float(e) for e in G_expense]) print("\nTotal Amount spent for this bi-week:$",g_expense) #instantiate class methods res= Monthly.bi_weekly_cal(salary_in,g_expense) print("Amount saved per year:$",round(res,2)) elif u_choi== 'm': salary_in= float(input("Please Enter your monthly income:$")) Expense=input("Type monthly expenses with spaces inbetween:") G_expense = Expense.split() #sum of all expenses in list #Requiement: container type and iteration type g_expense=sum([float(e) for e in G_expense]) print("\nTotal Amount spent for this month:$",g_expense) #instantiate class Monthly rest = Monthly(salary_in,g_expense) print((rest)) elif u_choi == 'w': salary_in= float(input("Please Enter your weekly income:$")) Expense=input("Type weekly expenses with spaces inbetween:") G_expense = Expense.split() #sum of all expenses in list #Requiement: container type anf iteration type g_expense=sum([float(e) for e in G_expense]) print("\nTotal Amount spent this week:$",g_expense) #calling class method res= Monthly.weekly_cal(salary_in,g_expense) print("Amount saved per year:$",round(res,2)) elif u_choi == 'sm': salary_in= float( input("Please Enter your semi-months income:$")) Expense=input("Type semi-month expenses with space inbetween:") G_expense = Expense.split() #sum of all expenses in list #Requiement: container type and iteration type g_expense=sum([float(e) for e in G_expense]) print("\nTotal Amount spent for this semi-month:$",g_expense) #calling class method res= Monthly.semimon_cal(salary_in,g_expense) print("Amount saved per year:$",round(res,2)) elif u_choi == 'r': #Retirement calculations print("\nRetirement calculation.") u_name=input("Enter your name for record reference:") current_savings=float( input("Enter current saving for retirement:")) current_age=float( input ("Enter your current age:")) retirement_age=float( input ("Enter your desired retirement age:")) yearly_contribution=float( input("Enter yearly contribution:")) print("\nAverage annual return is a ratio:", " 1.07 is a 7% annual return") avg_annual_return=float( input("Enter the average annual return:")) #calling retire_calc fuction retire_amt = retire_calc(float(current_savings), float(current_age), float(retirement_age),float(avg_annual_return), float(yearly_contribution)) #printing retirement amount age= retirement_age - current_age print("\nHi {}!! In {} years, the retirement amount will be: {}" .format(u_name,int(age),retire_amt)) #Requirement: Input and/or Output file #Saving the retirement calculated amount in a file. new_file= open("new_test.txt","a+") print("\nHi {name}! In {age} years retirement amount will be:" "${amt} record saved on {dt}".format( name=u_name, age=int(age), amt=retire_amt, dt=(datetime.datetime.now().strftime('%Y-%m-%d %H:%M'))) ,file = new_file) new_file.close() #close the files. #Testing the input file for existence and #printing an error message, if the file does not exist. print("\nText file has been updated!!") report =input("Do you want to review your file type Yes or No:") report = report.lower() if report == 'yes': new_temp_file= open("new_test.txt","r") if new_temp_file != 0: file_content = new_temp_file.read() print(file_content) print("\nThank you for using Home Expense ", "& Retirement Calculator.") break else: print("file doesn't exists") new_temp_file.close() #close the file. elif report == 'no': print("\nThank you for using Home Expense", " & Retirement Calculator.") break else: print("Error: Please enter a valid choice") break print("\nPlease enter your choice of calculation:") u_choi=input("Bi-weekly = bw, Weekly = w," "\nMonthly = m, Semi-Monthly = sm, Retirement = r:") #Requirement: try-except blocks except TypeError: print("TypeError: Please enter a valid input") break #Requirement: try-except blocks except ValueError: print("ValueError: Please enter a valid input") break else: print("Error: Please enter a valid choice")
997,720
02cd5d962be16ea57367d110cd7a6d89d6225ecc
keyid = 'rzp_test_ixIzmpmVcqXV1J' keySecret = 'fCwpPR7wrXeClCzZjA7adlKg' import razorpay client = razorpay.Client(auth=(keyid,keySecret)) data ={ 'amount' : 100*100, "currency": "INR", "receipt" : "TSC", "notes":{ "name": "TEJAS", "Payment_for" : "IOT" } } order = client.order.create(data=data) print(order) #client.utility.verify_payment_signature(params_dict)
997,721
ed70839ed32df6b446f5c526fe64647f1ea572fa
#!/usr/bin/env python import os import toml from setuptools import setup, find_packages REQUIREMENTS_FILE = 'requirements.txt' README_FILE = 'README.md' PYPROJECT_FILE = 'pyproject.toml' SETUP_KWARGS = [ 'name', 'version', 'description', 'author', 'authors', 'author_email', 'license', 'url', 'project_urls', 'download_url', 'keywords', 'classifiers', 'packages', 'include', 'extras_require', 'include_package_data', 'python_requires', ] INCLUDE = ['pyproject.toml', 'init.py'] EXCLUDE_PACKAGE = ['tests*'] def get_requirements(): """Build the requirements list for this project""" requirements_list = [] if not os.path.isfile(REQUIREMENTS_FILE): # Check if requirements file did not exist. return requirements_list with open(REQUIREMENTS_FILE) as reqs: for install in reqs: requirements_list.append(install.strip()) return requirements_list def get_setup_kwargs(default=None): """Get setup kwargs""" with open(README_FILE, 'r', encoding='utf-8') as fd: kwargs = dict( long_description=fd.read(), install_requires=get_requirements(), include=INCLUDE, packages=find_packages(exclude=EXCLUDE_PACKAGE), ) if isinstance(default, dict): kwargs.update(default) pyproject = toml.load(PYPROJECT_FILE) for k, v in dict(pyproject['tool']['poetry']).items(): if k in SETUP_KWARGS: if k not in kwargs: kwargs[k] = v continue if isinstance(kwargs[k], list): kwargs[k].extend(v) elif isinstance(kwargs[k], dict): kwargs[k].update(v) return kwargs def main(): setup(**get_setup_kwargs()) if __name__ == '__main__': main()
997,722
063d2224cb083832ef287a42955e51af46e38ff7
# A Span is a slice of a Doc consisting of one or more tokens. # Span takes at least three arguments: #the doc it refers to, and the start and end index of the span. # Remember that the end index is exclusive! # Manually create a Span from spacy.tokens import Span doc = nlp("Hello world!") span = Span(doc, 0, 2) # Create a span with a label span_with_label = Span(doc, 0, 2, label="GREETING") # Add span to the doc.ents (entities) doc.ents = [span_with_label] # Example: Create a Doc *manually* # 1 import spacy nlp = spacy.load("en_core_web_sm") # Import the Doc class from spacy.tokens import Doc # Desired text: "spaCy is cool!" words = ["spaCy", "is", "cool", "!"] spaces = [True, True, False, False] # Create a Doc from the words and spaces doc = Doc(nlp.vocab, words=words, spaces=spaces) print(doc.text) # 2 import spacy nlp = spacy.load("en_core_web_sm") # Import the Doc class from spacy.tokens import Doc # Desired text: "Go, get started!" words = ["Go", ",", "get", "started", "!"] spaces = [False, True, True, False, False] # Create a Doc from the words and spaces doc = Doc(nlp.vocab, words=words, spaces=spaces) print(doc.text) # 3 import spacy nlp = spacy.load("en_core_web_sm") # Import the Doc class from spacy.tokens import Doc # Desired text: "Oh, really?!" words = ["Oh", ",", "really", "?", "!"] spaces = [False, True, False, False, False] # Create a Doc from the words and spaces doc = Doc(nlp.vocab, words=words, spaces=spaces) print(doc.text) # Example: Create a Doc + Span from spacy.lang.en import English nlp = English() # Import the Doc and Span classes from spacy.tokens import Doc, Span words = ["I", "like", "David", "Bowie"] spaces = [True, True, True, False] # Create a doc from the words and spaces doc = Doc(nlp.vocab, words=words, spaces=spaces) print(doc.text) # Create a span for "David Bowie" from the doc and assign it the label "PERSON" span = Span(doc, 2, 4, label="PERSON") print(span.text, span.label_) # Add the span to the doc's entities doc.ents = [span] # Print entities' text and labels print([(ent.text, ent.label_) for ent in doc.ents]) # Example: identify proper noun followed by a verb import spacy nlp = spacy.load("en_core_web_sm") doc = nlp("Berlin is a nice city") # Get all tokens and part-of-speech tags token_texts = [token.text for token in doc] pos_tags = [token.pos_ for token in doc] for token in doc: # Check if the current token is a proper noun if token.pos_ == "PROPN": # Check if the next token is a 'VERB' if doc[token.i + 1].pos_ == "VERB": print("Found proper noun before a verb:", token.text)
997,723
935a02b0bb535778dfdd0f2f14e71e12b6f4478c
""" INFO8003-1 2020 - 2021 Final Project Inverted Double Pendulum François LIEVENS - 20103816 Julien HUBAR - 10152485 In this file we are implementing a simple Neural network using fully connected layers in order to approximate our non-linear Q-value function. """ import torch import gym import pybullet_envs import numpy as np from ActorCriticNeural import ActorCriticNeural import time import os from Learner import Learner import pandas as pd from torch.distributions import Categorical GRAPHICAL = False TIME_STEP = 1/1000 NB_EPISODE = 10000 MAX_EPI_LEN = 1000 DEVICE = 'cuda:0' DISCOUNT = 0.8 SAVE_INTERVAL = 1000 STATE_SIZE = 9 NB_ACTONS = 50 LEARNING_RATE = 2e-6 EPSILON = 0.2 DROPOUT = 0 def trainer(name='PGRAD_A'): # Get the environment env = gym.make("InvertedDoublePendulumBulletEnv-v0") # Get the policy network AC_Network = ActorCriticNeural(name=name, device=DEVICE, state_size=STATE_SIZE, nb_actions=NB_ACTONS, lr=LEARNING_RATE, dropout= DROPOUT).to(DEVICE) # Try to restore more recent model if exist mod_lst = os.listdir('{}/model'.format(name)) restored = False if len(mod_lst) > 0: mod_lst_idx = [] for itm in mod_lst: try: mod_lst_idx.append(int(itm.replace('.pt', ''))) except: pass max_idx = max(mod_lst_idx) print('Already existing model found, try to restore idx {}'.format(max_idx)) try: AC_Network.restore(add=max_idx) print('Model successfully restored') except: print('Fail to restore existing model. Maybe corrupted? ') exit(-1) if GRAPHICAL: env.render(mode='human') start_epi_idx = 0 # Retore last index from tracking if restored model if restored: df = pd.read_csv('{}/tracking.csv', sep=';', header=None).numpy() start_epi_idx = int(df[:, 0]) end_epi_idx = start_epi_idx + NB_EPISODE # A learner object to perform learning steps learner_obj = Learner(model=AC_Network, discounter=DISCOUNT) # Main loop track_duration = [] track_reward = [] entropy_term = 0 for e in range(start_epi_idx, end_epi_idx): print('======= Episode {}/{} ========='.format(e, end_epi_idx)) # Store actions log probs and rewards tot_log_prbs = [] tot_rewards = [] tot_critic_val = [] tot_entropy = [] # Reinit the env obs = torch.Tensor(env.reset()).to(DEVICE) # Episode loop epi_idx = 0 while epi_idx < MAX_EPI_LEN: if GRAPHICAL: time.sleep(TIME_STEP) # Get actions probs AC_Network.train() critic_val, prbs = AC_Network.forward(obs.view(1, STATE_SIZE)) # To numpy np_prbs = prbs.cpu().detach().numpy() #np_val = prbs.cpu().detach().numpy() tot_critic_val.append(critic_val) # Chose the next action according to probability distribution action = np.random.choice(NB_ACTONS, p=np.squeeze(np_prbs)) # Get actuator value actuator_val = AC_Network.actions[action] # Get log probs of the chosen action log_prbs = torch.log(prbs.squeeze(0)[action]) tot_log_prbs.append(log_prbs) # Compute the entropy of the prediction entropy = Categorical(probs=prbs).entropy() tot_entropy.append(entropy) #entropy = -np.sum(np.mean(np_prbs) * np.log(np_prbs)) #entropy_term += entropy # Perform the action new_obs, r, done, _ = env.step([actuator_val]) obs = torch.Tensor(new_obs).to(DEVICE) tot_rewards.append(r) # If end of the episode: if done or epi_idx == MAX_EPI_LEN - 1: track_duration.append(epi_idx) track_reward.append(np.sum(tot_rewards)) file = open('{}/tracking.csv'.format(name), 'a') file.write('{};{};{};{}\n'.format(e, track_duration[-1], track_reward[-1], entropy.cpu().detach().item())) file.close() print('Episode {} : Duration {} - Total reward {} - Entropy: {}'.format(e, track_duration[-1], track_reward[-1], entropy.cpu().detach().item())) if len(track_duration) > 10: print('AVG 10 last duration: {} / Rewards: {}'.format(np.mean(track_duration[-10:-1]), np.mean(track_reward[-10:-1]))) break epi_idx += 1 # Computing cumulative rewards cum_rew = np.zeros(len(tot_rewards)) idx = len(tot_rewards) - 1 cum_rew[idx] = tot_rewards[idx] while idx > 0: idx -= 1 cum_rew[idx] = tot_rewards[idx] + DISCOUNT * cum_rew[idx + 1] # Actor critic update: val = torch.stack(tot_critic_val).to(DEVICE) cum_rew = torch.Tensor(cum_rew).to(DEVICE) log_prbs = torch.stack(tot_log_prbs).to(DEVICE) # Get the advantage adv = cum_rew - val # Compute the general loss final_entropy = torch.stack(tot_entropy).mean() print('entropy: ', final_entropy.cpu().detach().item()) loss = torch.mean((-1 * log_prbs) * adv) + (0.5 * torch.mean(adv ** 2)) + (100 / (final_entropy+1e-8)) # Optimize AC_Network.optimizer.zero_grad() loss.backward() AC_Network.optimizer.step() print('loss: ', loss.cpu().detach().item()) entropy_term = 0 # Model saving if e % SAVE_INTERVAL == 0 and e != 0: AC_Network.save(add=e) if __name__ == "__main__": trainer()
997,724
9b24745bd13c8c1c765eeb98e97283123f95a46a
import os import tqdm import json import argparse import torch import numpy as np import pandas as pd # from functools import partial # from multiprocessing.pool import ThreadPool from torch.utils.data import DataLoader from models.smp import SegmentModel, ClassifyModel from datasets.inference import InferenceDataset from datasets.classify import SegmentBasedClassifyDataset from utils.postprocess import DilateSigmoidPostProcess from utils.postprocess import DilateSoftmaxPostProcess def predict(Model, Dataset): args = parse_args() cls_prefix = args.cls_prefix with open(args.config_path) as f: cfg = json.load(f) cfg["model"]["load_ckpt"] = True assert cfg["model"]["load_ckpt"] model = get_model(cfg, Model) dataset = get_dataset(args, cfg, Dataset) if "DilateSigmoidPostProcess" in cfg["postprocess"]: postprocess = DilateSigmoidPostProcess([1, 1]) elif "DilateSoftmaxPostProcess" in cfg["postprocess"]: postprocess = DilateSoftmaxPostProcess([1, 1]) Predictor( args=args, cfg=cfg, model=model, dataset=dataset, postprocess=postprocess, cls_prefix=cls_prefix, ) def get_model(cfg, Model): print(cfg["model"]) model = Model(cfg["model"]) return model def get_dataset(args, cfg, Dataset): print("Prepare dataset...") print(cfg["dataset"]) # cfg["dataset"]["mask_file_postfix"] = "" cfg["dataset"]["catheters"] = "total" valid_path = args.data_path valid_set = Dataset( valid_path, **cfg["dataset"], is_train=False, ) return valid_set class Predictor: def __init__( self, args, cfg, model, dataset, postprocess, cls_prefix, ): print("Setting Arguments...", args) self.args = args self.cfg = cfg self.cls_prefix = cls_prefix self.cls_output = [] self.cls_target = [] self.path_list = [] self.data_path = self.args.data_path self.batch_size = 64 self.set_device() self.load_checkpoint() self.prepare_model(model, postprocess) self.prepare_datapipeline(dataset) self.predict() def set_device(self): self.device = "cuda" def load_checkpoint(self): if self.args.checkpoint is not None: print("Load checkpoint...", self.args.checkpoint) self.state = torch.load(self.args.checkpoint) else: print("No checkpoint will be loaded.") def prepare_model(self, model, postprocess): print("Prepare model...") print("Model configuring...") cfg = self.cfg["model"] self.model = model self.model.encoder = torch.nn.DataParallel( self.model.encoder, # device_ids=self.device_ids, ) if hasattr(model, "decoder"): self.model.decoder = torch.nn.DataParallel( self.model.decoder, # device_ids=self.device_ids, ) self.model.classification_head = torch.nn.DataParallel( self.model.classification_head, # device_ids=self.device_ids, ) self.model = self.model.to(self.device, dtype=torch.float32) if cfg["load_ckpt"]: print("Load model state...") self.model.load_state_dict(self.state["model"], strict=False) else: print("No model state dict will be loaded.") self.postprocess = postprocess def prepare_datapipeline(self, dataset): self.dataset = dataset # prepare dataloader print("Prepare dataloader...") self.dataloader = DataLoader( self.dataset, batch_size=self.batch_size, shuffle=False, num_workers=32, drop_last=False, prefetch_factor=1, ) def predict(self): print("Start predicting...") with torch.no_grad(): self.model.eval() num_batchs = len(self.dataloader) for row, inputs, target in tqdm.tqdm(self.dataloader, total=num_batchs): for k in inputs: inputs[k] = inputs[k].to("cuda") # inference output = self.model(inputs) # post-process output, target = self.postprocess(output, target) self.update(row, output, target) self.save_cls() def update(self, row, output, target): for k in output["cls"]: output["cls"][k] = output["cls"][k].cpu().detach().numpy() self.cls_output.append(output["cls"][k]) self.cls_target.append(target["cls"][k]) self.path_list.extend(row["Path"]) def save_cls(self): cfg = self.cfg["dataset"]["findings"] task_name = self.args.task_name for k in cfg: print(cfg[k]) output = np.concatenate(self.cls_output, axis=0) output = pd.DataFrame(output, columns=cfg[k]) target = np.concatenate(self.cls_target, axis=0) target = pd.DataFrame(target, columns=cfg[k]) output["Path"] = self.path_list target["Path"] = self.path_list output.to_csv( f"./results/{task_name}/{self.cls_prefix}_output.csv", index=False) target.to_csv( f"./results/{task_name}/{self.cls_prefix}_target.csv", index=False) def parse_args(): parser = argparse.ArgumentParser() parser.add_argument( "--cls_prefix", type=str, ) parser.add_argument( "--task_name", type=str, ) parser.add_argument( '--gpus', type=str, help='specify which GPUs to use.', ) parser.add_argument( '--workers', type=int, default=32, help='number of workers', ) parser.add_argument( '--checkpoint', type=str, default=None, help='pytorch checkpoint file path', ) parser.add_argument( "--config_path", type=str, ) parser.add_argument( "--data_path", type=str, ) return parser.parse_args() if __name__ == "__main__": predict(ClassifyModel, SegmentBasedClassifyDataset)
997,725
164e05981b0733702ac4cb9c230a1dbfe0e9e76a
#!/usr/bin/env python from shapely.geometry import Point, LineString, Polygon import math import numpy as np import matplotlib.pyplot as plt class uwb_agent: def __init__(self, ID, pos): self.id = ID self.pos = pos self.incidenceMatrix = np.array([]) self.M = [self.id] self.N = [] self.E = [] self.P = [] self.pairs = [] self.I = np.array([[1,0],[0,1]]) def get_distance(self, remote_pos): p1 = self.pos p2 = remote_pos dist = math.sqrt( (p2.x - p1.x)**2 + (p2.y - p1.y)**2 ) return dist def update_incidenceMatrix(self): self.incidenceMatrix = np.array([]) self.P = [] rows = len(self.M) cols = len(self.pairs) self.incidenceMatrix = np.zeros((rows,cols), dtype=int) for i, pair in enumerate(self.pairs): col = np.zeros(rows, dtype=int) m1 = pair[0] m2 = pair[1] col[m1] = 1 col[m2] = -1 self.incidenceMatrix[:,i] = col.T self.P.append(pair[2]) def add_nb_module(self, Id, range): if not any(x == Id for x in self.N): self.N.append(Id) self.E.append(range) self.M.append(Id) self.pairs.append([self.id, Id, range]) else: self.E[Id] = range for pair in self.pairs: if any(x == Id for x in pair) and any(x == self.id for x in pair): pair[2] = range def add_pair(self, Id1, Id2, range): pairs_present = 0 for i, pair in enumerate(self.pairs): if (pair[0] == Id1 and pair[1] == Id2) or (pair[1] == Id1 and pair[0] == Id2): self.pairs[i][2] = range else: pairs_present += 1 if pairs_present <= len(self.pairs): self.pairs.append([Id1, Id2, range]) def handle_range_msg(self, Id, nb_pos): range = self.get_distance(nb_pos) self.add_nb_module(Id, range) self.update_incidenceMatrix() def handle_other_msg(self, Id1, Id2, range): self.add_pair(Id1, Id2, range) self.update_incidenceMatrix() def define_triangle(self,a,b,c): angle_a = math.acos( (b**2 + c**2 - a**2) / (2 * b * c) ) angle_b = math.acos( (a**2 + c**2 - b**2) / (2 * a * c) ) angle_c = math.acos( (a**2 + b**2 - c**2) / (2 * a * b) ) A = Point(0.0, 0.0) B = Point(c, 0.0) C = Point(b*math.cos(angle_a), b*math.sin(angle_a)) return A, B, C, angle_a, angle_b, angle_c def define_rectangle(self): a,b,c,d,e,f = self.P A,B,C,angle_a1,angle_b1,_ = self.define_triangle(a,b,c) angle_a2 = math.acos( (b**2 + c**2 - a**2) / (2 * b * c) ) #angle_b2 = math.acos( (a**2 + c**2 - b**2) / (2 * a * c) ) #angle_c1 = math.acos( (b**2 + d**2 - e**2) / (2 * b * d) ) #angle_c2 = math.acos( (a**2 + d**2 - f**2) / (2 * a * d) ) #angle_d1 = math.acos( (e**2 + d**2 - b**2) / (2 * e * d) ) #angle_d2 = math.acos( (f**2 + d**2 - a**2) / (2 * f * d) ) D = Point(b*math.cos(angle_a2), -b*math.sin(angle_a2)) return A,B,C,D def run(): pass if __name__ == "__main__": A = uwb_agent(ID=0, pos=Point(0,0)) B = uwb_agent(ID=1, pos=Point(3,4)) C = uwb_agent(ID=2, pos=Point(1,5)) D = uwb_agent(ID=3, pos=Point(6,2)) A.handle_range_msg(Id=B.id, nb_pos=B.pos) A.handle_range_msg(Id=C.id, nb_pos=C.pos) A.handle_range_msg(Id=D.id, nb_pos=D.pos) A.handle_other_msg(Id1=B.id, Id2=C.id, range=B.get_distance(C.pos)) A.handle_other_msg(Id1=B.id, Id2=D.id, range=B.get_distance(D.pos)) A.handle_other_msg(Id1=C.id, Id2=D.id, range=C.get_distance(D.pos)) p1, p2, p3, p4 = A.define_rectangle() x = [p1.x, p2.x, p3.x, p4.x] y = [p1.y, p2.y, p3.y, p4.y] print("A: ", p1.x, p1.y, " B: ", p2.x, p2.y, " C: ", p3.x, p3.y, " D: ", p4.x, p4.y) print(A.pairs) print(A.incidenceMatrix) print(A.P) plt.scatter(x,y) plt.show()
997,726
832e2cf88094e76fbfa6264b0756bb9cae736b66
import os from dotenv import load_dotenv load_dotenv() CONFIG_PATH = os.path.dirname(os.path.realpath(__file__)) RESOURCES_FOLDER = os.path.join(CONFIG_PATH, 'resources') WML_SERVICE_URL = os.getenv('WML_SERVICE_URL', 'https://us-south.ml.cloud.ibm.com') WML_SERVICE_API_KEY = os.getenv('WML_SERVICE_API_KEY') WML_SPACE_UID = os.getenv('WML_SPACE_UID') WML_CREDENTIALS = { "url": WML_SERVICE_URL, "apikey": WML_SERVICE_API_KEY } WML_DEPLOYMENT_ID = os.getenv('WML_DEPLOYMENT_ID')
997,727
82fa5b9546ebb53a5d158aca6a771b17033365fc
import logging logger = logging.getLogger('restserver.rest_core') class ApiError(Exception): _message = '' def __init__(self, **kwargs): self._message = kwargs.get('message', self._message) def get_description(self): return self._message def get_dict(self): info = self.get_log_information() self.log(info) return { 'Error': { 'ErrorCode': self.code, 'ErrorDescription': self.get_description(), } } def get_log_information(self): return '[%s] %d %s' % (self.__class__.__name__, self.code, self.get_description()) def log(self, message): logger.info(message) class EmptyError(ApiError): code = 0 _message = '' def log(self, message): pass class NoContent(ApiError): code = 204 class BadRequest(ApiError): code = 400 class WrongParameter(BadRequest): _message = 'Invalid parameter %s.' def __init__(self, **kwargs): super(WrongParameter, self).__init__(**kwargs) self.parameter = kwargs['parameter'] def get_description(self): return self._message % self.parameter class ParameterExpected(WrongParameter): _message = 'Parameter %s expected.' class UnauthorizedError(ApiError): code = 401 _message = 'Authentication error.' class NotEnoughMoney(ApiError): code = 402 _message = 'Not enough money.' class Forbidden(ApiError): code = 403 class NotFound(ApiError): code = 404 class Conflict(ApiError): code = 409 class InternalServerError(ApiError): code = 500 # _message = 'Internal server error: %s (%s)' _message = 'Internal server error' def __init__(self, **kwargs): super(InternalServerError, self).__init__(**kwargs) self.caught_error = kwargs.get('error') # def get_description(self): # return self._message % (self.caught_error, type(self.caught_error)) def log(self, message): logger.exception(message) class ServiceUnavailable(InternalServerError): code = 503 _message = 'Third-party service is unavailable'
997,728
f9e1ab8945f0dfb175c14633cc03aaea24df239c
from unittest import TestCase from recommender import Recommender # TODO: write proper testcases class AllInOne(TestCase): def recommend(self): recom = Recommender(documents_n = 20, persons_n = 20) for vizit in Data(): recom.record(vizit[0], vizit[1]) self.assertEqual(recom.recommend('430586149'), ['433940066', '431329924', '433862262']) class Data(object): def __iter__(self): raw = self.raw().split('\n') for line in raw: yield line.split(',') def raw(self): return """430592357,ZvCTasj4 430586149,ZvCTasj4 201397816,ZyrCGvQQ 214597966,ZSV4Hkiw 430584391,zy0RUZnG 431065083,ZvCTasj4 201361464,ZyrCGvQQ 302482929,ZSV4Hkiw 330117582,ZvCTasj4 433862262,ZSOmPzCw 426482194,ZSOmPzCw 425224044,ZSOmPzCw 201369542,ZzVi46JN 363734570,ZZS1KlwN 431246574,ZxqvpImX 431249575,ZxqvpImX 201359004,ZzVi46JN 430466714,zy0RUZnG 319731179,ZxqvpImX 431246574,zXRRGKfX 430716481,zXRRGKfX 201362184,Zsl8FsLx 430466714,zXRRGKfX 324918927,ZSV4Hkiw 201361657,ZzVi46JN 424384375,ZSOmPzCw 431293112,ZSV4Hkiw 430519225,ZzVi46JN 330117582,ZYw24l7D 382903817,ZvAD7jk3 201423486,ZvAD7jk3 433862262,zwBr9yLl 430347776,zXRRGKfX 250683776,zXHGOep9 390255494,zXHGOep9 336148236,zXHGOep9 419502781,ZvAD7jk3 433178444,zwBr9yLl 412161719,ZvAD7jk3 429615716,zy0RUZnG 431246574,ZYw24l7D 201377744,ZYw24l7D 433650250,zwBr9yLl 431293112,zXHGOep9 425225457,zy0RUZnG 391386058,ZTJaUd81 422313668,ZTJaUd81 201369659,ZY1KyJuH 431293112,ZTJaUd81 201379948,ZY1KyJuH 430716481,ZTJaUd81 201366382,zWNxGYWo 201357695,ZY1KyJuH 433862262,Zsl8FsLx 430651758,ZWSlLHdc 431304967,Zsl8FsLx 201360390,ZY1KyJuH 430716481,Zsl8FsLx 430658308,ZWSlLHdc 330117582,ZWSlLHdc 431065083,ZWSlLHdc 431246574,ZxqvpImX 433178444,Zt3n32p0 250683776,Zt3n32p0 319731179,zWNxGYWo 330117582,Zt3n32p0 430347776,Zt3n32p0 201362419,zWNxGYWo 412161719,Zv8Uozhb 433862262,ZSnRUCB6 433178444,ZSnRUCB6 431329924,ZSnRUCB6 431293112,ZSnRUCB6 201366382,zWNxGYWo 201397816,ZyrCGvQQ 201366633,ZyrCGvQQ 422313668,Zv8Uozhb 363734570,Zv8Uozhb 371894284,Zv8Uozhb 429110215,zUl2imWb 430609436,ZZS1KlwN 433862262,zxKKxPIY 431304967,ZYnhGo6X 201361023,zUl2imWb 201382402,ZYw24l7D 433862262,ZYnhGo6X 429615716,ZZS1KlwN 201379347,zxKKxPIY 422313668,ZZS1KlwN 201359861,zxKKxPIY 201361844,zxKKxPIY 201721820,zUl2imWb 431244481,ZYnhGo6X 431293112,zUl2imWb 201358641,zwBr9yLl 201362419,ZYnhGo6X 433940066,zyYIkGkk 433862262,zyYIkGkk 431329924,zyYIkGkk 430586149,zyYIkGkk"""
997,729
815654909ee73aa3e4ffb8487d1aebf82b21ba9c
# Generated by Django 2.0.3 on 2018-04-20 20:18 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('forum', '0001_initial'), ] operations = [ migrations.CreateModel( name='Comment', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('com_title', models.CharField(max_length=140)), ('com_body', models.CharField(max_length=500)), ], ), migrations.AlterField( model_name='post', name='body', field=models.CharField(max_length=500), ), migrations.AddField( model_name='comment', name='post', field=models.ForeignKey(on_delete=None, related_name='comments', to='forum.Post'), ), ]
997,730
53c64ab2738c849239e19b267ffb7589d14947e1
from collections import defaultdict with open('perf.txt', 'r') as f: perfs = f.readlines() domains = ['Video_Games', 'Books', 'Toys_Games', 'Tools_Home_Improvement', 'Amazon_Instant_Video', 'Movies_TV', 'Electronics', 'Health', 'Shoes', 'Baby', 'Automotive', 'Software', 'Sports_Outdoors', 'Clothing_Accessories', 'Beauty', 'Patio', 'Music', 'Pet_Supplies', 'Office_Products', 'Home_Kitchen'] #word_embeddings = ['embeddings_snap_s256_e15.txt', 'embeddings_snap_s256_e50.txt', 'embeddings_snap_s256_e30.txt', # 'embeddings_snap_s512_e15.txt', 'embeddings_snap_s128_e15.txt', 'embeddings_snap_s128_e30.txt', # 'embeddings_snap_s128_e50.txt', 'embeddings_snap_s512_e50.txt', 'embeddings_snap_s512_e30.txt'] word_embeddings = ['embeddings_snap_s512_e15.txt', 'embeddings_snap_s128_e15.txt', 'embeddings_snap_s128_e30.txt', 'embeddings_snap_s128_e50.txt', 'embeddings_snap_s512_e50.txt', 'embeddings_snap_s512_e30.txt'] it = 0 perf_dict = defaultdict(list) for i, emb in enumerate(word_embeddings): for j, domain in enumerate(domains): perf = perfs[it].replace('\n', '').strip().split(':')[-1][0:5] it = it + 1 perf_dict[domain].append(perf) for dom in domains: print (dom + ':' +'&'.join(perf_dict[dom]))
997,731
9634f8c206d56a1597fc1f251e09fcb38f4f8ad0
from flask import render_template, flash, redirect, session, url_for, request, g from flask.ext.login import login_user, logout_user, current_user, login_required from app import app, db, lm from forms import LoginForm from models import User, Post, FlickrAccount, Account, PhotoAlbum import glob import json import traceback import flickr_api @lm.user_loader def load_user(id): return User.query.get(int(id)) @app.before_request def before_request(): g.user = current_user @app.route('/') @app.route('/index') def index(): user = g.user posts = Post.query.order_by(Post.timestamp.desc()) photo_urls = [] try: albums = PhotoAlbum.query.order_by(PhotoAlbum.id) except Exception as e: traceback.print_exc() print str(e) return render_template('home.html', albums=albums, posts=posts, photo_urls=json.dumps(photo_urls)) @app.route('/login', methods = ['GET', 'POST']) def login(): if g.user is not None and g.user.is_authenticated(): return redirect(url_for('index')) form = LoginForm() if form.validate_on_submit(): print "Form submitted and everyting was good?" if form.get_user(): login_user(form.get_user()) return redirect(url_for('admin')) return render_template('login.html', title = 'Sign In', form = form) @app.route('/logout') def logout(): logout_user() return redirect(url_for('index')) @app.route('/code') def code(): return render_template('code.html') @app.route('/about') def about(): return render_template('about.html') @app.route('/running') def running(): return render_template('running.html') @app.route('/photography/album/<id>') def photo_album(id): try: album = PhotoAlbum.query.get(id) except Exception as e: traceback.print_exc() print str(e) return render_template('album.html', album=album)
997,732
abe95463e187e0de0287c0c3c80d8dac7eda21cf
from math import floor def troca(a, i, j): a[i], a[j] = a[j], a[i] def arruma_heap(a, inicio, fim): raiz = inicio while raiz * 2 + 1 <= fim: filho = raiz * 2 + 1 trocar = raiz if a[trocar] < a[filho]: trocar = filho if filho + 1 <= fim and a[trocar] < a[filho + 1]: trocar = filho + 1 if trocar == raiz: break else: troca(a, raiz, trocar) raiz = trocar def cria_heap(a, tamanho): inicio = floor((tamanho - 2)/2) while inicio >= 0: arruma_heap(a, inicio, tamanho -1) inicio -= 1 def heap_sort(a, tamanho): cria_heap(a, tamanho) fim = tamanho - 1 while fim > 0: troca(a, 0, fim) fim = fim - 1 arruma_heap(a, 0, fim) lista = [5, 8, 2, 45, 6, 5, 3] heap_sort(lista, 7) print(lista)
997,733
54deca45c972bfad5b5b83e4893b6e66610f73c9
# pylint: disable=C0411,C0412,C0413 import logging from pathlib import Path import re from typing import Any, Optional, Union, List from urllib.parse import urlparse import RequestsLibrary.log from RequestsLibrary.utils import is_file_descriptor from robot.api import logger from RPA.core.notebook import notebook_file from RPA.FileSystem import FileSystem LOG_CHAR_LIMIT = 10000 def log_response(response): logger.debug( "%s Response : url=%s \n " % (response.request.method.upper(), response.url) + "status=%s, reason=%s \n " % (response.status_code, response.reason) + "headers=%s \n " % response.headers + "body=%s \n " % format_data_to_log_string(response.text) ) def log_request(response): request = response.request if response.history: original_request = response.history[0].request redirected = "(redirected) " else: original_request = request redirected = "" logger.debug( "%s Request : " % original_request.method.upper() + "url=%s %s\n " % (original_request.url, redirected) + "path_url=%s \n " % original_request.path_url + "headers=%s \n " % original_request.headers + "body=%s \n " % format_data_to_log_string(original_request.body) ) def format_data_to_log_string(data, limit=LOG_CHAR_LIMIT): if not data: return None if is_file_descriptor(data): return repr(data) if len(data) > limit and logging.getLogger().level > 10: data = ( "%s... (set the log level to DEBUG or TRACE to see the full content)" % data[:limit] ) return data RequestsLibrary.log.log_response = log_response RequestsLibrary.log.log_request = log_request from RequestsLibrary import RequestsLibrary # noqa: E402 # NOTE. Above logging changes are related to. Especially on Automation Studio # extensive INFO level logging makes readability problematic. # https://github.com/MarketSquare/robotframework-requests/issues/353 class HTTP(RequestsLibrary): """The *RPA.HTTP* library extends functionality of the `RequestsLibrary`_. See that documentation for several examples of how to issue ``GET`` requests and utilize the returned ``result`` objects. .. _RequestsLibrary: https://marketsquare.github.io/robotframework-requests/doc/RequestsLibrary.html This extension provides helper keywords to get an HTTP resource on a session. The ``HTTP Get`` and ``Download`` keywords will initiate a session if one does not exist for the provided URL, or use an existing session. When using these keywords, you do not need to manage sessions with ``Create Session``. Session management is still required if you use the underlying session keywords, e.g., ``* On Session``. """ # noqa: E501 ROBOT_LIBRARY_SCOPE = "GLOBAL" ROBOT_LIBRARY_DOC_FORMAT = "reST" def __init__(self, *args, **kwargs) -> None: RequestsLibrary.__init__(self, *args, **kwargs) self.logger = logging.getLogger(__name__) self.fs = FileSystem() self.session_alias_prefix = "rpasession_alias." self.current_session_alias = None def http_get( self, url: str, target_file: Optional[str] = None, verify: Union[bool, str] = True, force_new_session: bool = False, overwrite: bool = False, stream: bool = False, **kwargs, ) -> dict: """ A helper method for ``Get Request`` that will create a session, perform GET request, and store the target file, if set by the ``target_file`` parameter. The old session will be used if the URL scheme and the host are the same as previously, e.g., 'https://www.google.fi' part of the URL. .. code-block:: robotframework *** Settings *** Library RPA.HTTP *** Variables *** ${DOWNLOAD_PATH}= ${OUTPUT DIR}${/}downloads ${WORD_EXAMPLE}= https://file-examples.com/wp-content/uploads/2017/02/file-sample_100kB.doc ${EXCEL_EXAMPLE}= https://file-examples.com/wp-content/uploads/2017/02/file_example_XLS_10.xls *** Tasks *** Download files with reused session # Starts a new session HTTP Get ${WORD_EXAMPLE} target_file=${DOWNLOAD_PATH}${/}word-example.doc # Uses the previous session HTTP Get ${EXCEL_EXAMPLE} target_file=${DOWNLOAD_PATH}${/}excel-example.xls :param url: target URL for GET request :param target_file: filepath to save request content, default ``None`` :param verify: if SSL verification should be done, default ``True``, a CA_BUNDLE path can also be provided :param force_new_session: if new HTTP session should be created, default ``False`` :param overwrite: used together with ``target_file``, if ``True`` will overwrite the target file, default ``False`` :param stream: if ``False``, the response content will be immediately downloaded :return: request response as a dict """ # noqa: E501 uc = urlparse(url) http_host = f"{uc.scheme}://{uc.netloc}" request_alias = f"{self.session_alias_prefix}{uc.scheme}{uc.netloc}" url_path = url.replace(http_host, "") if force_new_session or not self.session_exists(request_alias): self.logger.info("Creating a new HTTP session") self.create_session(request_alias, http_host, verify=verify) else: self.logger.info("Using already existing HTTP session") self.current_session_alias = request_alias response = self.get_on_session(request_alias, url_path, stream=stream, **kwargs) if target_file is not None: self._create_or_overwrite_target_file( target_file, response.content, overwrite ) return response def _create_or_overwrite_target_file( self, path: str, response: Any, overwrite: bool, ) -> None: CHUNK_SIZE = 32768 Path(path).parent.mkdir(parents=True, exist_ok=True) file_exists = Path(path).is_file() if not file_exists or (file_exists and overwrite): with open(path, "wb") as f: for chunk in response.iter_content(CHUNK_SIZE): if chunk: # filter out keep-alive new chunks f.write(chunk) notebook_file(path) def get_current_session_alias(self) -> str: """Get request session alias that was used with the ``HTTP Get`` keyword. :return: name of session alias as a string """ return self.current_session_alias def download( self, url: str, target_file: Optional[str] = None, verify: Union[bool, str] = True, force_new_session: bool = False, overwrite: bool = False, stream: bool = False, **kwargs, ) -> dict: """An alias for the ``HTTP Get`` keyword. The difference in use is that the URL is always downloaded based on the URL path (even without ``target_file``). If there is a filename in the path, then that is used as ``target_file`` to save to. By default, the filename will be "downloaded.html". .. code-block:: robotframework *** Settings *** Library RPA.HTTP *** Variables *** ${DOWNLOAD_PATH}= ${OUTPUT DIR}${/}downloads ${WORD_EXAMPLE}= https://file-examples.com/wp-content/uploads/2017/02/file-sample_100kB.doc ${EXCEL_EXAMPLE}= https://file-examples.com/wp-content/uploads/2017/02/file_example_XLS_10.xls *** Tasks *** Download files with reused session with provided file names # Starts a new session Download ${WORD_EXAMPLE} target_file=${DOWNLOAD_PATH} # Uses the previous session Download ${EXCEL_EXAMPLE} target_file=${DOWNLOAD_PATH} # Above files are downloaded using the same names as they have # on the remote server. :param url: target URL for GET request :param target_file: filepath to save request content, default ``None`` :param verify: if SSL verification should be done, default ``True``, a CA_BUNDLE path can also be provided :param force_new_session: if new HTTP session should be created, default ``False`` :param overwrite: used together with ``target_file``, if ``True`` will overwrite the target file, default ``False`` :param stream: if ``False`` the response content will be immediately downloaded :return: request response as a dict """ # noqa: E501 response = self.http_get( url, verify=verify, force_new_session=force_new_session, overwrite=overwrite, stream=stream, **kwargs, ) dirname = Path() filename = None if target_file is not None: target = Path(target_file) if target.is_dir(): dirname = target else: dirname = target.parent filename = target.name if filename is None: filename = urlparse(url).path.rsplit("/", 1)[-1] or "downloaded.html" self._create_or_overwrite_target_file(dirname / filename, response, overwrite) return response def check_vulnerabilities(self) -> List: """Check for possible vulnerabilities in the installed runtime environment packages. Currently will check only for OpenSSL version and outputs warning message on any discovered vulnerability. :return: list of all check results .. code-block:: robotframework *** Tasks *** Vulnerability Check ${results}= Check Vulnerabilities FOR ${result} IN @{results} Log To Console TYPE: ${result}[type] Log To Console VULNERABLE: ${result}[vulnerable] Log To Console MESSAGE: ${result}[message] END """ all_results = [] vulnerable, message = self._check_openssl_vulnerabilities() all_results.append( {"type": "OpenSSL", "vulnerable": vulnerable, "message": message} ) if vulnerable: self.logger.warning(message) return all_results def _check_openssl_vulnerabilities(self): message = "No OpenSSL detected" try: import ssl # pylint: disable=C0415 open_ssl_version = re.match( r"OpenSSL (\d+)\.(\d+)\.(\d+).*", ssl.OPENSSL_VERSION ) if open_ssl_version and len(open_ssl_version.groups()) == 3: major, minor, fix = [int(val) for val in open_ssl_version.groups()] if major == 3 and minor == 0 and (0 <= fix <= 6): return True, ( rf"Dependency with HIGH severity vulnerability detected: '{ssl.OPENSSL_VERSION}'. " # noqa: E501 "For more information see https://robocorp.com/docs/faq/openssl-cve-2022-11-01" # noqa: E501 ) message = ssl.OPENSSL_VERSION except ImportError: pass return False, message
997,734
bad4bc972d735eb9f96cea8fcb6eb4b004cd4a54
import cv2 # import OpenCV module. from matplotlib import pyplot as plt # import matplotlib # Step 1 img = cv2.imread('Figures/PizzaOnConveyor.jpg') img_ref = img.copy() # "selectROI" : used to select a single RegionOfInterest bounding box. roiTop, roiLeft, roiWidth, roiHeight = cv2.selectROI(img) print(roiTop, roiLeft, roiWidth, roiHeight) roi = img[roiLeft:roiLeft+roiHeight, roiTop:roiTop+roiWidth] cv2.rectangle(img_ref, (roiTop,roiLeft), (roiTop+roiWidth,roiLeft+roiHeight), (0,0,255), 2) # Step 2 img_hsv = cv2.cvtColor(img, cv2.COLOR_BGR2HSV) # 1D histogram for img HSV histH_img = cv2.calcHist([img_hsv], [0], None, [180], [0,180]) histS_img = cv2.calcHist([img_hsv], [1], None, [256], [0,255]) histV_img = cv2.calcHist([img_hsv], [2], None, [256], [0,255]) # 2D histogram for img HSV hist2D_img = cv2.calcHist([img_hsv], [0,2], None, [180,256], [0,180,0,255]) cv2.normalize(hist2D_img, hist2D_img, alpha=0, beta=255, norm_type=cv2.NORM_MINMAX); roi_hsv = cv2.cvtColor(roi, cv2.COLOR_BGR2HSV) # 1D histogram for ROI HSV histH_roi = cv2.calcHist([roi_hsv], [0], None, [180], [0,180]) histS_roi = cv2.calcHist([roi_hsv], [1], None, [256], [0,255]) histV_roi = cv2.calcHist([roi_hsv], [2], None, [256], [0,255]) # 2D histogram for ROI HSV hist2D_roi = cv2.calcHist([roi_hsv], [0,2], None, [180,256], [0,180,0,255]) cv2.normalize(hist2D_roi, hist2D_roi, alpha=0, beta=255, norm_type=cv2.NORM_MINMAX); # Plot and visualized Histogram for selecting 2 channels plt.subplot(241) plt.imshow(cv2.cvtColor(img, cv2.COLOR_BGR2RGB)) plt.title("Original") plt.subplot(242) plt.plot(histH_img) plt.title("img: Hue Histogram") plt.subplot(243) plt.plot(histS_img) plt.title("img: Sat Histogram") plt.subplot(244) plt.plot(histV_img) plt.title("img: Val Histogram") plt.subplot(245) plt.imshow(cv2.cvtColor(roi, cv2.COLOR_BGR2RGB)) plt.title("ROI") plt.subplot(246) plt.plot(histH_roi) plt.title("ROI: Hue Histogram") plt.subplot(247) plt.plot(histS_roi) plt.title("ROI: Sat Histogram") plt.subplot(248) plt.plot(histV_roi) plt.title("ROI: Val Histogram") plt.show() # Plot 2D histogram from chosen channels (H&V) plt.subplot(221) plt.imshow(cv2.cvtColor(img, cv2.COLOR_BGR2RGB)) plt.title("Original") plt.subplot(222) plt.imshow(cv2.cvtColor(hist2D_img, cv2.COLOR_BGR2RGB)) plt.title("Original Image: 2D Histogram") plt.xlabel('Value') plt.ylabel('Hue') plt.subplot(223) plt.imshow(cv2.cvtColor(roi, cv2.COLOR_BGR2RGB)) plt.title("ROI") plt.subplot(224) plt.imshow(cv2.cvtColor(hist2D_roi, cv2.COLOR_BGR2RGB)) plt.title("ROI: 2D Histogram") plt.xlabel('Value') plt.ylabel('Hue') plt.show() # Step 3 # Compute BackProject image backproj = cv2.calcBackProject([img_hsv], [0,2], hist2D_roi, [0,180,0,255], scale=2) # Plot back projection plt.subplot(121) plt.imshow(cv2.cvtColor(img_ref, cv2.COLOR_BGR2RGB)) plt.title("Original Image w/ ROI") plt.subplot(122) plt.imshow(cv2.cvtColor(backproj, cv2.COLOR_BGR2RGB)) plt.title("Back Projection") plt.show()
997,735
7e55aca5ec79f7069f3a457ebc19b871f040bb20
#Author: Connor P. Bain #Code for CockyReaders server-side #Last modified December 3, 2014 import logging import webapp2 import jinja2 import os import json from google.appengine.api import users from google.appengine.ext import db from __builtin__ import int jinja_environment = jinja2.Environment( loader=jinja2.FileSystemLoader(os.path.dirname(__file__) + "/templates")) #Host = "http://localhost:9080/" Host = "http://www.cockyreaders-test.appspot.com/" class MainPage(webapp2.RequestHandler): def setupUser(self): self.template_values = {} self.currentUser = users.get_current_user() self.template_values['user'] = self.currentUser if self.currentUser: self.template_values['login'] = users.create_logout_url("/") else: self.template_values['login'] = users.create_login_url(self.request.uri) def setupJSON(self, objID): self.json = False if (self.request.get('fmt') == 'json'): self.json = True if ('json' in self.request.path.split('.')): objID = objID.split('.')[0] self.json = True return objID def render(self, loadTemplate): template = jinja_environment.get_template(loadTemplate) self.response.out.write(template.render(self.template_values)) def get(self): self.setupUser(); #Remove this code after dataStore Objects are created query = Book.all(); #DEMO CODE if query.count() == 0: newBook = Book(title = "Sleeping Beauty", genre = "Fantasy", isbn = int(1113), cover = "img/book_1.jpg", link = Host+"library/1113/") newBook.put() newBook = Book(title = "Moby Dick", genre = "Fantasy", isbn = int(1114), cover = "img/book_2.jpg", link = Host+"library/1114/") newBook.put() newBook = Book(title = "Where The Wild Things Are", genre = "Fantasy", isbn = int(1115), cover= "img/book_3.jpg" , link = Host+"library/1115/") newBook.put() self.template_values['title'] = "Administrator View" self.render("main.html") def getStudent(self, studentID): key = db.Key.from_path('Student', long(studentID)) theStudent = db.get(key) if theStudent == None: self.redirect('/') return None return theStudent #class for login side of the app class LoginHandler(MainPage): def get(self, stuff): loginUser = self.request.get('user') loginPassword = self.request.get('password') #demo user query = Student.all() if query.count() == 0: newStudent = Student(firstName="temp", lastName="temp", user="theFirst", password="password", bookList=[1113,1114]) newStudent.put() #this does now work properly unless the key_name of each entry is that of the UserName #currently the key_name is the student id #key = db.Key.from_path('Student', loginUser ) #theStudent = db.get(key) q = db.GqlQuery("SELECT * FROM Student WHERE user = :1 AND password = :2", loginUser, loginPassword) logging.info(q.count()) self.response.headers.add_header('Access-Control-Allow-Origin', '*') if q.count() == 0: self.response.out.write("Failure") self.error(500) else: logging.info("Login successful") currentUser = q.get() self.response.out.headers['Content-Type'] = "text/json" self.response.out.write(json.dumps(currentUser.user)) def post(self, stuff): newUserName = self.request.get('user') newUserPassword = self.request.get('password') newUserFirstName = self.request.get('firstName') newUserlastName = self.request.get('lastName') newUserTeacher = self.request.get('teacher') newUserGrade = self.request.get('grade') newUserPin = self.request.get('pinNumber') q = db.GqlQuery("SELECT * FROM Student " + "WHERE user = :1", newUserName) if q.count() >= 1: #return error that this invalid self.response.out.write("Failure") logging.debug("invalid user being added") else: #if error here, remove the int cast and just let the userpin be a string newUser = Student(user = newUserName, firstName = newUserFirstName, lastName = newUserlastName, password = newUserPassword, teacher = newUserTeacher, grade = int(newUserGrade), bookList = [1113, 1114, 1115, 1116 , 1117, 1119, 1120, 1121, 1123]) newUser.put() newStat = Stat(parent = newUser, isbn = 1113, owner = newUserName, pagesRead = 0, bookmark = 1) newStat.put() newStat = Stat(parent = newUser, isbn = 1114, owner = newUserName, pagesRead = 0, bookmark = 1) newStat.put() self.response.out.headers['Content-Type'] = "text" self.response.headers.add_header('Access-Control-Allow-Origin', '*') self.response.out.write("Success") #class for handling the sending of book info to app class BookHandler(MainPage): def get(self, bookID): self.setupUser() self.setupJSON(bookID) loginUser = self.request.get('user') logging.debug("value of my var is %s", str(loginUser)) query = Student.all() if (query.count() == 0): newStudent = Student(firstName="temp", lastName="temp", userName="theFirst", password="password", books= [1113,1114]) newStudent.put() q = db.GqlQuery("SELECT * FROM Student " + "WHERE user = :1",loginUser) theStudent = Student() for p in q.run(limit=1): theStudent = p if theStudent == None: libaryList = [1113,1114,1115] else: libaryList = theStudent.bookList query = Book.all(); #DEMO CODE if query.count() == 0: newBook = Book(title = "Sleeping Beauty", genre = "Fantasy", isbn = int(1113), cover = "img/book_1.jpg", link = Host+"library/1113/") newBook.put() newBook = Book(title = "Moby Dick", genre = "Fantasy", isbn = int(1114), cover = "img/book_2.jpg", link = Host+"library/1114/") newBook.put() newBook = Book(title = "Where The Wild Things Are", genre = "Fantasy", isbn = int(1115), cover= "img/book_3.jpg" , link = Host+"library/1115/") newBook.put() query = Book.all() if self.json: self.response.headers.add_header('Access-Control-Allow-Origin', '*') self.response.out.headers['Content-Type'] = "text/json" books = [] #look through the books based on the isbn number for isbnN in libaryList: q = db.GqlQuery("SELECT * FROM Book " + "WHERE isbn = :1",int(isbnN)) for book in q.run(limit=1): books.append(book.dict()) self.response.out.write(json.dumps(books)) return #app side update of stats for users class UpdateStats(MainPage): def get(self, stuff): #mostly place holder inUser = self.request.get('user') inISBN = self.request.get('isbn') q = db.GqlQuery("SELECT * FROM Stat " + "WHERE owner = :1 AND isbn = :2", inUser, int(inISBN)) returnRecord = q.get() if not returnRecord: returnRecord = Stat(isbn = int(inISBN), owner = inUser, timeSpentReading = int(0), bookmark = int(1)) db.put(returnRecord) self.response.headers.add_header('Access-Control-Allow-Origin', '*') self.response.out.headers['Content-Type'] = "text/json" logging.info(returnRecord) self.response.out.write(json.dumps(returnRecord.dict())) return def post(self, stuff): inUser = self.request.get('user') inISBN = self.request.get('isbn') inBookmark = self.request.get('bookmark') inPagesRead = self.request.get('pagesRead') q = db.GqlQuery("SELECT * FROM Stat " + "WHERE owner = :1 AND isbn = :2", inUser, int(inISBN)) for record in q.run(limit=1): record.bookmark = int(inBookmark) if(int(inPagesRead) > record.pagesRead): record.pagesRead = int(inPagesRead) db.put(record) return #admin Side stat catalogue class StatQuery(MainPage): def get(self,random): self.setupUser() self.template_values['title'] = 'Stats' self.render('stats.html') return def post(self, somerandomfieldthatbreakeverythingifnothere): self.setupUser() Owner = self.request.get('user') q = db.GqlQuery("SELECT * FROM Stat " + "WHERE owner = :1", Owner) self.template_values['title'] = 'Stats' self.template_values['stats']=q self.render('stats.html') return #admin side user catalogue class StudentHandler(MainPage): def get(self, studentID): self.setupUser() query = Student.all() logging.info(query.count()) self.template_values['students'] = query self.template_values['title'] = 'Your Students' self.render('studentlist.html') return def post(self, studentID): self.setupUser() fName = self.request.get('firstName') lName = self.request.get('lastName') UserName = self.request.get('user') Password = self.request.get('password') teacher = self.request.get('teacher') grade = self.request.get('grade') newStudent = Student(firstName = fName, lastName = lName, user = UserName, password = Password, teacher = teacher, grade = int(grade), bookList=[1113,1114], ) newStudent.put() newStat = Stat(parent = newStudent, isbn = 1113, owner = UserName, pagesRead = 0, bookmark = 1) newStat.put() newStat = Stat(parent = newStudent, isbn = 1114, owner = UserName, pagesRead = 0, bookmark = 1) newStat.put() self.redirect('/student') return #admin side user book catalogue class AddBooks(MainPage): def get(self, stuff): self.setupUser() self.template_values['title'] = 'Student Books' self.template_values['Returnsuccess'] = '' self.render('booklist.html') return def post(self, stuff): self.setupUser() UserName = self.request.get('user') Isbn = self.request.get('isbn') if (UserName != '' and Isbn != ''): q = db.GqlQuery("SELECT * FROM Student " + "WHERE user = :1",UserName) q2 = db.GqlQuery("SELECT * FROM Book " + "WHERE isbn = :1",int(Isbn)) if (q2.count() > 0 and q.count() > 0): for userN in q.run(limit = 1): userN.bookList.append(int(Isbn)) userN.put() #self.redirect('/addBook') self.template_values['Returnsuccess'] = "Success" self.render('booklist.html') else: #self.redirect('/addBook') self.template_values['Returnsuccess'] = "Failure" self.render('booklist.html') else: self.template_values['Returnsuccess'] = "Failure" self.render('booklist.html') return #admin side global book catalogue class Libary(MainPage): def get(self, stuff): #returns all the books in the libary self.setupUser() q = Book.all() books = [] #replace with template self.template_values['title']='Library' self.template_values['books'] = q self.render('libarylist.html') def post(self, stuff): #note the book file should be transferred using standard ftp and then this record should be added #do not post this first Title = self.request.get('title') Isbn = self.request.get('isbn') Genre = self.request.get('genre') Cover = self.request.get('cover') Link = self.request.get('link') newbook = Book(title = Title, genre = Genre, isbn = int(Isbn), cover = Cover, link = Host + Link) newbook.put() self.redirect('/libary') return #database side user model class Student(db.Model): user = db.StringProperty() firstName = db.StringProperty() lastName = db.StringProperty() teacher = db.StringProperty() grade = db.IntegerProperty() wordsDefined = db.IntegerProperty() timeReading = db.IntegerProperty() password = db.StringProperty() bookList = db.ListProperty(int) def id(self): return self.key().id() def dict(self): theStudentDict = {} theStudentDict['id'] = self.id() theStudentDict['firstName'] = self.firstName theStudentDict['lastName'] = self.lastName theStudentDict['teacher'] = self.teacher theStudentDict['grade'] = self.grade theStudentDict['isbnList'] = self.bookList return theStudentDict #database side book model class Book(db.Model): title = db.StringProperty() genre = db.StringProperty() isbn = db.IntegerProperty() cover = db.StringProperty() link = db.StringProperty() def dict(self): theBookDict = {} theBookDict['title'] = self.title theBookDict['genre'] = self.genre theBookDict['isbn'] = self.isbn theBookDict['cover'] = self.cover theBookDict['link'] = self.link return theBookDict #database side statistic model class Stat(db.Model): isbn = db.IntegerProperty() owner = db.StringProperty() pagesRead = db.IntegerProperty() timeSpentReading = db.IntegerProperty() bookmark = db.IntegerProperty() def dict(self): stat = {} stat['bookmark'] = self.bookmark stat['pagesRead'] = self.pagesRead return stat #class Bookshelf(db.Model):# books = db.ListProperty(long) # sort = db.IntegerProperty() # Sort by this variable # positions = db.ListProperty(long) app = webapp2.WSGIApplication([('/student()', StudentHandler), ('/student/(.*)', StudentHandler), ('/book()', BookHandler), ('/login()',LoginHandler), ('/stats()', UpdateStats), ('/addBook()',AddBooks), ('/addBook/(.*)',AddBooks), ('/libary()',Libary), ('/libary/(.*)', Libary), ('/stat()', StatQuery),('/stat/(.*)', StatQuery), ('/.*', MainPage)], debug=True)
997,736
23e857de8ce487a096c673f99188a79123206a0e
import unittest import numpy as np from numcube import Index class IndexTests(unittest.TestCase): def test_create_index(self): a = Index("A", [10, 20, 30]) self.assertEqual(a.name, "A") self.assertEqual(len(a), 3) a = Index("Dim", ["a", "b", "c", "d"]) self.assertEqual(a.name, "Dim") self.assertEqual(len(a), 4) # duplicate values self.assertRaises(ValueError, Index, "A", ["a", "b", "a"]) self.assertRaises(ValueError, Index, "A", [0, 1, 1]) # invalid Index name self.assertRaises(TypeError, Index, 1, [1, 2, 3]) def test_index_take(self): a = Index("A", ["a", "b", "c", "d"]) self.assertEqual(a.take([0, 2]).name, "A") # keep name self.assertTrue(np.array_equal(a.take([0, 2]).values, ["a", "c"])) self.assertTrue(np.array_equal(a.take([2, 0]).values, ["c", "a"])) self.assertRaises(ValueError, a.take, [0, 2, 0]) # duplicate values in Index def test_compress(self): a = Index("A", ["a", "b", "c", "d"]) selector = [True, False, True, False] b = a.compress(selector) c = a[np.array(selector)] self.assertTrue(np.array_equal(b.values, c.values)) self.assertEqual(a.name, b.name) # keep name self.assertTrue(np.array_equal(b.values, a.values.compress(selector))) def test_writeable(self): # once index has been created, its values cannot be changed in order not to break lookup function a = Index("A", [10, 20, 30]) self.assertRaises(ValueError, a.values.__setitem__, 0, 40) self.assertRaises(ValueError, a.values.sort) def test_indexof(self): a = Index("A", [10, 20, 30]) b = Index("Dim", ["ab", "bc", "cd", "de"]) # a single value self.assertEqual(a.indexof(10), 0) self.assertEqual(b.indexof("cd"), 2) self.assertEqual(b.indexof(["cd"]), 2) # multiple values self.assertTrue(np.array_equal(a.indexof([10, 30]), [0, 2])) self.assertTrue(np.array_equal(b.indexof(["de", "cd"]), [3, 2])) # non-existent value raises KeyError (similar to dictionary lookup) self.assertRaises(KeyError, a.indexof, 0) self.assertRaises(KeyError, b.indexof, "ef") self.assertRaises(KeyError, b.indexof, None) self.assertRaises(KeyError, a.indexof, [0, 1]) self.assertRaises(KeyError, b.indexof, ["de", "ef"]) def test_operator_in(self): a = Index("A", [10, 20, 30]) b = Index("B", ["ab", "bc", "cd", "de"]) self.assertTrue(20 in a) self.assertFalse(40 in a) self.assertTrue("bc" in b) self.assertFalse("ef" in b) # unlike Index.contains() operator 'in' cannot work with multiple values #self.assertRaises(TypeError, a, __contains__, [0, 10]) #self.assertRaises(TypeError, a, __contains__, (0, 10)) def test_contains(self): a = Index("A", [10, 20, 30]) b = Index("B", ["ab", "bc", "cd", "de"]) # a single value (in this case, operator 'in' is preferred) self.assertTrue(a.contains(20)) self.assertFalse(a.contains(40)) self.assertTrue(b.contains("bc")) self.assertFalse(b.contains("ef")) # multiple values returns one-dimensional numpy array of logical values self.assertTrue(np.array_equal(a.contains([0, 10, 20, 40]), [False, True, True, False])) self.assertTrue(np.array_equal(b.contains(["ab"]), [True])) self.assertTrue(np.array_equal(b.contains(["ab", "ef", "bc"]), [True, False, True])) self.assertTrue(np.array_equal(b.contains(("ab", "ef", "bc")), [True, False, True]))
997,737
d41c5f2102188d3bc7fcf1fc66da9cd089cbdb01
# -*- coding: utf-8 -*- """ Created on Tue Apr 5 11:32:38 2016 @author: maestre """ import matplotlib.pyplot as plt import numpy as np # fake up some data #spread = np.random.rand(50) * 100 spread = np.random.randint(-15,15, 50) #center = np.ones(1) * 50 center = np.zeros(50) #flier_high = np.random.rand(10) * 100 + 100 flier_high = np.random.randint(5, 25, 10) #flier_low = np.random.rand(10) * -100 flier_low = np.random.randint(-25, -5, 10) data = np.concatenate((spread, center, flier_high, flier_low), 0) # basic plot #plt.boxplot(data) ## notched plot #plt.figure() #plt.boxplot(data, 1) # ## change outlier point symbols #plt.figure() #plt.boxplot(data, 0, 'gD') # ## don't show outlier points #plt.figure() #plt.boxplot(data, 0, '') # ## horizontal boxes #plt.figure() #plt.boxplot(data, 0, 'rs', 0) # ## change whisker length #plt.figure() #plt.boxplot(data, 0, 'rs', 0, 0.75) # # fake up some more data spread = np.random.rand(50) * 100 center = np.ones(25) * 40 flier_high = np.random.rand(10) * 100 + 100 flier_low = np.random.rand(10) * -100 d2 = np.concatenate((spread, center, flier_high, flier_low), 0) data.shape = (-1, 1) d2.shape = (-1, 1) # data = concatenate( (data, d2), 1 ) # Making a 2-D array only works if all the columns are the # same length. If they are not, then use a list instead. # This is actually more efficient because boxplot converts # a 2-D array into a list of vectors internally anyway. data = [data, d2] # multiple box plots on one figure plt.figure() plt.boxplot(data) plt.show()
997,738
1610e1c5da800c784d8acac4fc363b1bc4b65bbc
from datetime import timedelta, datetime import traceback from csv_utils import read_csv DATE_TIME_FORMAT = '%Y-%m-%d %H:%M:%S' def write_to_file(file_name, data): with open(file_name, 'w') as f: f.write('\n'.join(data)) print("File generated") def format_rain(csv_file, start): timeseries = read_csv(csv_file) rain_dat = [] total_rain = 0 cumulative_timeseries = [] for i in range(len(timeseries)): total_rain += float(timeseries[i][1]) cumulative_timeseries.append(total_rain) for i in range(len(timeseries)): time_col = ((datetime.strptime(timeseries[i][0], DATE_TIME_FORMAT) - start).total_seconds())/3600 rain_col = float(timeseries[i][1])/total_rain rain_dat.append("R {} {}".format('%.4f' % time_col, cumulative_timeseries[i]/total_rain)) rain_dat.insert(0, "R 0 0") rain_dat.insert(0, "{} 5 0 0".format(total_rain)) rain_dat.insert(0, "0 0 ") write_to_file("RAIN.DAT", rain_dat) # format_rain("6531.csv", datetime.strptime("2019-06-12 23:30:00", DATE_TIME_FORMAT)) def generate_time_values(start, end): start = datetime.strptime(start, DATE_TIME_FORMAT) end = datetime.strptime(end, DATE_TIME_FORMAT) times_original = [start] time = start while times_original[-1] < end: time = time + timedelta(minutes=5) times_original.append(time) print(time) times = [] for i in range(len(times_original)): times.append("{}".format('%.4f' % ((times_original[i] - start).total_seconds() / 3600))) print((times_original[i] - start).total_seconds() / 3600) write_to_file("times.DAT", times) # generate_time_values(start="2019-06-01 00:00:00", end="2019-06-20 00:00:00")
997,739
feeb1a2f4e4289dc1cb80779806fa7fffd1e9593
import pytest from ..__main__ import defaultdict def test_case_1(): assert defaultdict(['a','a','b','a','b'],['a','b','c']) == [[1,2,4],[3,5],[-1]]
997,740
80610e200559754c9964fdbf41773840d3564207
import socket, errno, struct, time from twisted.internet import main, error from twisted.python import log class IcmpReader(object): """ This is a simple icmp reader class. it reads all ICMP messages and does simple processing on them: - rtt calculation - sequence number check """ def __init__(self, socket, callback=None, hosts=[]): self.socket = socket self.callback = callback self.hosts = hosts from twisted.internet import reactor reactor.addReader(self) def fileno(self): try: return self.socket.fileno() except socket.error: return -1 def printStats(self): for host_addr, host in self.hosts.iteritems(): print host def connectionLost(self, reason): self.socket.close() from twisted.internet import reactor reactor.removeReader(self) self.printStats() def processPacket(self, recv_packet, addr): # skip first 20 bytes for IP header, and 4 bytes of: # packet type, something else and the checksum icmp_header = recv_packet[24:40] packet_id, sequence, timestamp = struct.unpack( #428 "Ihd", icmp_header ) rtt = time.time() - timestamp # extract the source of this echo packet # and compare it with the id included in payload (src_ip,) = struct.unpack("!I", recv_packet[12:16]) if packet_id != src_ip: log.msg("ignoring received packet with an unknown ID {}, should be: {}".format(packet_id, src_ip)) return try: host = self.hosts[addr] host.updateStats(rtt) except KeyError: log.msg("host {} not found in the hosts table".format(addr,)) return # ignore if it's not an echo reply message # if packet_type == 0: # self.removeTimeout(addr, sequence) if self.callback is None: log.msg("got packet: ", packet_id, sequence, addr, "rtt:" ,rtt) else: self.callback(host, rtt) def doRead(self): while True: try: recv_packet, addr = self.socket.recvfrom(1024) except socket.error, e: if e.args[0] == errno.EWOULDBLOCK: break return main.CONNECTION_LOST self.processPacket(recv_packet, addr[0]) def logPrefix(self): return "IcmpReader"
997,741
13dda0f6c7282044139e083f013d9a9312a921e9
# Core Pkgs import streamlit as st from memory_profiler import profile @profile def main(): st.title("Memeory Profiling Streamlit Apps") menu = ["Home","Text Analysis","About"] choice = st.sidebar.selectbox("Menu",menu) if choice == "Home": st.subheader("Home") elif choice == "Text Analysis": st.subheader("Text Analysis") else: st.subheader("About") if __name__ == '__main__': main() # How to Run # python3 -m memory_profiler app.py # mprof run app.py # mprof plot
997,742
ac1f10c2bc528b6a6eef66dd13550b2b219c7dea
""" h_letters = [letter for letter in 'human'] print(h_letters) this_list = [] for x in 'human': this_list.append(x) print(this_list) h_nums = [num*2 for num in range(1,11)] print(h_nums) number_list = [x for x in range(20) if x % 2 == 0] print(number_list) number_list_two = ['Even' if x % 2 == 0 else 'Odd' for x in range(10)] print(number_list_two) """ test_list = [('gfg', 1, True),('is', False),('best', 2)] print(f'The original list : {test_list}')
997,743
da211532a604c6b73f15759edc4fe8ba23e9caf1
bicycles = ['trek', 'cannondale', 'redline', 'specialized'] print(bicycles) print(bicycles[0]) message = "my first bicycle was a " + bicycles[0].title() + "." print(message) motorcycles = ["honda", 'yamaha', "suzuki"] print(motorcycles) motorcycles[0] = "ducati" print(motorcycles) motorcycles.append("ducati") print(motorcycles) motorcycles.clear() print(motorcycles) motorcycles.append("honda") motorcycles.append("yamaha") motorcycles.append("suzuki") print(motorcycles) motorcycles.insert(1, "ducati") print(motorcycles) del motorcycles[1] print(motorcycles) popped_motorcycle = motorcycles.pop() print(popped_motorcycle) print(motorcycles) motorcycles = ["honda", 'yamaha', "suzuki"] print(motorcycles) popped_motorcycle = motorcycles.pop(2) print(popped_motorcycle) print(motorcycles) motorcycles = ["honda", 'yamaha', "suzuki", "ducati"] print(motorcycles) motorcycles.remove("ducati") print(motorcycles) cars = ["bmw", "auid", "toyota", "subaru"] print(cars) cars.sort() print(cars) cars.sort(reverse=True) print(cars) cars = ["bmw", "auid", "toyota", "subaru"] print(cars) print(sorted(cars)) print(cars) print(sorted(cars, reverse=True)) cars = ["bmw", "auid", "toyota", "subaru"] print(cars) cars.reverse() print(cars) print(len(cars))
997,744
e81d080a47c45c6f897daabf6e88256f5e58d93d
import random randomNumber = random.randint(0, 1000) print(randomNumber)
997,745
9c959ec708e911a49892d9eef8ead745d289d6c2
import numpy as np import matplotlib.pyplot as plt import test import copy as cp # Relu function def rel(z): return (abs(z) + z) / 2 # Show data classified result def show_ans(x_s, y_s, m_s, subplt): for k in range(0, m_s): if y_s[0, k] == 1: subplt.plot(x_s[0, k], x_s[1, k], 'ro') else: subplt.plot(x_s[0, k], x_s[1, k], 'go') # y1 = -b_s / w_s[0, 1] # y2 = -(100 * w_s[0, 0] + b_s) / w_s[0, 1] # plt.plot([0, 100], [y1, y2]) # Show err's curve def show_err(subplt, err_data): subplt.cla() subplt.plot(err_data[0], err_data[1]) # Show plane classified result def show_class(W, b, n, g, max, min, subplt): X_t = np.arange(min[0], max[0], max[0] / 16) Y_t = np.arange(min[1], max[1], max[1] / 16) X_temp = [[], []] Z_t = [] A_t = [] for i in X_t: for j in Y_t: X_temp[0].append(i) X_temp[1].append(j) m_t = len(X_temp[0]) X_t = np.array(X_temp).reshape(2, m_t) # forward Z_t.clear() A_t.clear() for i in range(len(n)): if i == 0: Z_t.append(np.dot(W[i], np.array(X_t).reshape(2, m_t)) + b[i]) else: Z_t.append(np.dot(W[i], A_t[i - 1]) + b[i]) if g[i] == 'RELU': A_t.append(rel(Z_t[i])) elif g[i] == 'sigmoid': A_t.append(1.0 / (1.0 + np.exp(-Z_t[i]))) Y_tra_t = cp.deepcopy(A_t[len(n) - 1]) Y_tra_t[Y_tra_t >= 0.5] = 1 Y_tra_t[Y_tra_t < 0.5] = 0 show_ans(X_t, Y_tra_t, m_t, subplt) fo = open("data1.txt") x_temp = [] y_temp = [] for line in fo: temp = line.split(',') x_temp += [float(f) for f in temp[0:2]] y_temp += [float(f) for f in temp[2][0]] alpha = 3.5 # alpha = 5 beta = 0.9 X = np.array(x_temp).reshape(int(len(x_temp) / 2), 2).T Y = np.array(y_temp).reshape(1, int(len(y_temp))) # init par v = len(X) m = len(X[0]) n = [4, 4, 4,4,4, 1] g = ["RELU", "RELU", "RELU","RELU","RELU", "sigmoid"] W = [] b = [] gamma = [] Z = [] A = [] j = 1 epsilon = 0.00000000000001 loop = 10000 dJdZ = [0] * len(n) dJdZ_cali = [0] * len(n) dJdZ_norm = [0] * len(n) dJdW = [0] * len(n) dJdb = [0] * len(n) VdJdW = [0] * len(n) VdJdb = [0] * len(n) SdJdW = [0] * len(n) SdJdb = [0] * len(n) err = [[], []] fig1, ax1 = plt.subplots() fig2, ax2 = plt.subplots() fig3, ax3 = plt.subplots() fig4, ax4 = plt.subplots() for i in n: if j == 1: W.append(np.random.randn(i, v)) # W.append(np.ones(i * v).reshape(i, v)) j += 1 else: W.append(np.random.randn(i, last_i)) # W.append(np.ones(i * last_i).reshape(i, last_i)) b.append(np.zeros(i).reshape(i, 1)) gamma.append(np.ones(i).reshape(i, 1)) last_i = i # normalize sets miu = np.mean(X, 1).reshape(v, 1) X = X - miu lambd = np.mean(np.square(X), 1).reshape(v, 1) X = X / lambd X = X / np.max(X[0, :]) X_max = [1, 1] X_min = [-1, -1] # X_max = [np.ceil(np.max(X[0, :])), np.ceil(np.max(X[1, :]))] # X_min = [np.floor(np.min(X[0, :])), np.floor(np.min(X[1, :]))] # loop j = 0 for j in range(loop): # while True: # forward Z.clear() A.clear() for i in range(len(n)): if i == 0: Z.append(np.dot(W[i], np.array(X).reshape(v, m)) + b[i]) else: Z.append(np.dot(W[i], A[i - 1]) + b[i]) if g[i] == 'RELU': A.append(rel(Z[i])) elif g[i] == 'sigmoid': A.append(1.0 / (1.0 + np.exp(-Z[i]))) Y_tra = cp.deepcopy(A[len(n) - 1]) Y_tra[Y_tra >= 0.5] = 1 Y_tra[Y_tra < 0.5] = 0 print("-------------------------") J = -(np.dot(Y, np.log(A[len(n) - 1] + epsilon).T) + np.dot((1 - Y), np.log(1 - A[len(n) - 1] + epsilon).T)) / m print(J[0][0]) if J[0][0] < 0.01: break err[0].append(j + 1) err[1].append(J[0][0]) # backward dJdZ[len(n) - 1] = (A[len(n) - 1] - Y) / m for i in range(len(n)): if len(n) - 1 - i == 0: dJdW[len(n) - 1 - i] = np.dot(dJdZ[len(n) - 1 - i], X.T) else: dJdW[len(n) - 1 - i] = np.dot(dJdZ[len(n) - 1 - i], A[len(n) - 1 - i - 1].T) dJdb[len(n) - 1 - i] = np.sum(dJdZ[len(n) - 1 - i], 1, None, None, True) # print(dJdW[len(n) - 1 - i]) if i <= len(n) - 2: temp_matrix = cp.deepcopy(Z[len(n) - 1 - i - 1]) if g[len(n) - 1 - i - 1] == 'RELU': temp_matrix[temp_matrix <= 0] = 0 temp_matrix[temp_matrix > 0] = 1 elif g[len(n) - 1 - i - 1] == 'sigmoid': temp_matrix_s = np.exp(-temp_matrix) / np.square(1 + np.exp(-temp_matrix)) temp_matrix = temp_matrix_s dJdZ[len(n) - 1 - i - 1] = np.dot(W[len(n) - 1 - i].T, dJdZ[len(n) - 1 - i]) * temp_matrix # Update parameter for ini_i in range(len(n)): # RMSprop gradient descent # SdJdW[len(n) - 1 - ini_i] = beta * SdJdW[len(n) - 1 - ini_i] + (1 - beta) * np.square(dJdW[len(n) - 1 - ini_i]) # SdJdb[len(n) - 1 - ini_i] = beta * SdJdb[len(n) - 1 - ini_i] + (1 - beta) * np.square(dJdb[len(n) - 1 - ini_i]) # W[len(n) - 1 - ini_i] = W[len(n) - 1 - ini_i] - alpha * (dJdW[len(n) - 1 - ini_i]/np.sqrt(SdJdW[len(n) - 1 - ini_i]+epsilon)) # b[len(n) - 1 - ini_i] = b[len(n) - 1 - ini_i] - alpha * (dJdb[len(n) - 1 - ini_i]/np.sqrt(SdJdb[len(n) - 1 - ini_i]+epsilon)) # Momentum gradient descent VdJdW[len(n) - 1 - ini_i] = beta * VdJdW[len(n) - 1 - ini_i] + (1 - beta) * dJdW[len(n) - 1 - ini_i] VdJdb[len(n) - 1 - ini_i] = beta * VdJdb[len(n) - 1 - ini_i] + (1 - beta) * dJdb[len(n) - 1 - ini_i] W[len(n) - 1 - ini_i] = W[len(n) - 1 - ini_i] - alpha * VdJdW[len(n) - 1 - ini_i] b[len(n) - 1 - ini_i] = b[len(n) - 1 - ini_i] - alpha * VdJdb[len(n) - 1 - ini_i] # General gradient descent # W[len(n) - 1 - ini_i] = W[len(n) - 1 - ini_i] - alpha * dJdW[len(n) - 1 - ini_i] # b[len(n) - 1 - ini_i] = b[len(n) - 1 - ini_i] - alpha * dJdb[len(n) - 1 - ini_i] j = j + 1 # print(dJdW) print("iteration times is:%d" % j) # test result # print(test.caculate_W_batch_norm(X, Y, g, n)) show_ans(X, Y, m, ax1) show_class(W, b, n, g, X_max, X_min, ax2) show_ans(X, Y_tra, m, ax3) show_err(ax4, err) plt.show()
997,746
d929e0a5ffce4708ecd3042435a696254f2d0e0c
from flask_wtf import FlaskForm from wtforms import StringField, SubmitField, DecimalField from wtforms.validators import DataRequired class ProductForm(FlaskForm): name = StringField('Product Name') description = StringField('Product Description') price = DecimalField('Per Unit Price', places=2) image = StringField('Product Image URL') submit = SubmitField() class DeletePostForm(FlaskForm): submit = SubmitField()
997,747
39c538142b70d8bf20a6015ce1a9adeebc674225
#testing commands print("New Python file")
997,748
baa66480eda9edf19c46c53ae933c145c66f6e2d
#/usr/bin/python # coding: utf-8 import pytest import os from src import hotcount_standalone def test_writetofile(tmpdir): count = {'TS_L251a_21_Ampliseq_2014-11-14.fastq': {'all': 550, 'wt': 282, 'delg': 24}, 'TS_L1095a_055_Ampliseq_AML_201-12-22.fastq': {'all': 317, 'wt': 151, 'delg': 22}} res_file = tmpdir.mkdir("sub").join("result.txt") file = hotcount_standalone.to_csv(count, str(res_file)) with open(file, 'r') as file: assert file.readline() == 'sample,all,wt,delg\r\n' def test_to_dict(): assert diff(hotcount_standalone.to_dict("resources/testfile/test2.txt"), {'/home/aurelien/HotCount_project/hotcount/data/asxl1/dupG_Pos/TS_L251a_21_Ampliseq_2014-11-14.fastq': {'all': '750', 'delg': '420', 'wt': '140'}, "/home/aurelien/HotCount_project/hotcount/data/asxl1/dupG_Pos/TS_L1095a_055_Ampliseq_AML_201-12-22.fastq":{'all':'317','delg':'151','wt':'22'}})==0 def test_count(): hotcount_standalone.StandAlone().count( {'all': 'ATCGGAGGG.*GGGTGGCCC', 'wt': 'ATCGGAGGGGGGGGTGGCCC', 'delg': 'ATCGGAGGGGGGGTGGCCC'}, 'resources/testfile/asxl1/file1/','FASTQ',True,"DNA","result.txt") with open("result.txt", 'r') as file: assert file.readline() == 'sample,all,wt,delg\r\n' assert file.readline() == "resources/testfile/asxl1/file1/TS_L251a_21_Ampliseq_2014-11-14.fastq, 550,282,24\r\n" def test_stat(): #hotcount_standalone.StandAlone().stat() pass def test_all(): pass def diff(list1, list2): """ docstring pour diff function used to compare 2 list without redundancy usable for test with known input """ c = set(list1).union(set(list2)) d = set(list1).intersection(set(list2)) return len(list(c - d))
997,749
23be3289a2537779c09796714b528d5a7f8dd92e
# methods for jet tracking that do not involve the camera import numpy as np from scipy.optimize import curve_fit def gaussianslope(x, a, mean, std, m, b): ''' Define the function for a Gaussian on a slope (Gaussian + linear) Parameters ---------- x : float x-coordinate a : float amplitude of Gaussian mean : float mean of Gaussian std : float standard deviation of Gaussian m : float slope of linear baseline b : float y-intercept of linear baseline Returns ------- y : float the y-coordinate for the given x-coordinate as defined by the parameters given for the Gaussian on a slope ''' return (a * np.exp(-((x-mean) / 2 / std) ** 2)) + (m * x + b) def fit_cspad(azav, norm, gas_det): ''' Fit the Azimuthal average of the CSPAD to a Gaussian on a slope Parameters ---------- azav : ndarray Azimuthal average for CSPAD norm : ndarray number of pixels in each qbin gas_det : float gas detector Returns ------- center : int radius of the diffraction ring intensity : float sum of qbins 5 above and below the center, normalized by gas detector ''' # determine number of pixels in each qbin, only use qbins where pixels > 150 # **can change 150 to different value if needed start = 0 end = len(norm) begin = end / 2 for i in range(begin): a = begin - i b = begin + i if (norm[a] < 150) and (a > start): start = a if (norm[b] < 150) and (b < end): end = b x = np.arange(len(azav)) # estimate mean and standard deviation for Gaussian n = len(x) mean = sum(x*azav) / sum(azav) std = np.sqrt(sum((x-mean)**2)/n) # estimate slope and y-intercept for linear baseline by taking first & last # 50 points and fitting a line between them # **can change 50 to different value if needed x0 = 50/2 l = len(azav) x1 = l - (50/2) y0 = np.mean(azav[0:50]) y1 = np.mean(azav[l-50:]) m, b = np.polyfit((x0, x1), (y0, y1), 1) # fit Gaussian + linear to Azimuthal average; provide initial parameters popt, pcov = curve_fit(gaussianslope, x, azav, p0=[max(azav), mean, std, m, b]) # calculate radius of ring and intensity of center 10 qbins center = int(round(popt[1])) intensity = sum(azav[center-5:center+5]) / gas_det return center, intensity def get_cspad(azav, r, gas_det): ''' Get the intensity of the diffraction ring on the CSPAD Parameters ---------- azav : ndarray Azimuthal average calculated from CSPAD r : int radius of diffraction ring gas_det : float gas detector Returns ------- intensity : float sum of qbins 5 above and below the center, normalized by gas detector ''' intensity = sum(azav[r-5:r+5]) / gas_det return intensity # unfinished methods for checking stopper, pulse picker, and Wave8 # can make Ophyd devices or load specific PV needed directly into beamline.py def get_stopper(stopper): return stopper def get_pulse_picker(pulse_picker): return pulse_picker def get_wave8(wave8): return wave8
997,750
73f51d8b3acd9ad305dda6aa1b0bf980718dd591
from src.transpiler.syntax_tree import * from src.grammar.nodes.expression import Expression class Declaration(Node): def is_init(self): """ Returns true, if the declaration also contains an initialization. :return: """ if len(self.children) == 4: return isinstance(self.children[3], Expression) return False def write(self, int_state, block=None): # Only write the initialization. Declaration is handled by top level objects. if self.is_init(): block.append_line(self.children[1].string + ' := ') self.children[3].write(int_state, block) Node.node_map['DECLARATION'] = Declaration class GlobalVariable(Node): def write(self, int_state, block=None): # GLOBAL = seq(DECLARATION, ';') declaration = self.children[0] int_state.globals.append_line(declaration.children[1].string) # DECLARATION = seq(TYPE, VARIABLE_NAME, opt(Choice(seq('=', EXPRESSION), Repeat(seq(',', VARIABLE_NAME))))) # If the declaration contains at least 4 elements, # it has either an initialization or contains multiple variable names. if len(declaration.children) >= 4: if isinstance(declaration.children[3], Expression): # Initialization. # seq(TYPE, VARIABLE_NAME, '=', EXPRESSION) int_state.init.append_line(declaration.children[1].string + ' := ') declaration.children[3].write(int_state, int_state.init) int_state.init.append(';') else: # Multiple declarations. # seq(TYPE, VARIABLE_NAME, Repeat(seq(',', VARIABLE_NAME))) # additional names are at positions 3 + 2 * k for i in range(3, len(declaration.children), 2): int_state.globals.append(', ' + declaration.children[i].string) # Type and semi colon. int_state.globals.append(' : ' + declaration.children[0].translated() + ';') Node.node_map['GLOBAL'] = GlobalVariable class Constant(Node): def write(self, int_state, block=None): # CONSTANT = seq(Keyword('const'), opt(TYPE), VARIABLE_NAME, '=', LITERAL, ';') name = self.children[1].translated() value = self.children[3].translated() if value == '=': # opt(TYPE) is used. name = self.children[2].translated() value = self.children[4].translated() int_state.constants.append_line(name + ' = ' + value + ';') Node.node_map['CONSTANT'] = Constant
997,751
306a0acad858ba4af0c4ccb83eaa285f36b81e21
import argparse import fasttext from functools import reduce import math import pdb import operator from sklearn.metrics import accuracy_score model=fasttext.load_model('./train.sentiment.bin') def geometric_mean(precisions): return (reduce(operator.mul, precisions))**(1.0/len(precisions)) def clip_count(cand_d, ref_ds): ''' arguments: cand_d:{'I': 1, 'had': 1, 'a':1, 'dinner':1} ref_ds:[{'He':1, 'had': 1, 'a':1, 'dinner':1}, {'He':1, 'had':1, 'a':1, 'lunch':1}[ returns: ''' count=0 for key, value in cand_d.items(): key_max=0 # for ref in ref_ds: # if key in ref: if key in ref_ds: key_max=max(key_max, ref_ds[key]) # key_max=max(key_max, ref[key]) clipped_count=min(value, key_max) count+=clipped_count return count def ngram_precision(candidate, references, n): def _count_ngram(sentence, n): ngram_d={} words=sentence.strip().split() leng=len(words) limits=leng-n+1 for i in range(limits): ngram=' '.join(words[i:i+n]).lower() if ngram in ngram_d.keys(): ngram_d[ngram]+=1 else: ngram_d[ngram]=1 return ngram_d clipped_count=0 count=0 for si in range(len(candidate)): # ref_counts=[] # for reference in references: # ngram_d=_count_ngram(reference, n) # ref_counts.append(ngram_d) ref_counts=_count_ngram(references[si], n) cand_dict=_count_ngram(candidate[si], n) n_grams=0 for key, values in cand_dict.items(): n_grams+=values clipped_count+=clip_count(cand_dict, ref_counts) count+=n_grams if clipped_count==0: pr=0 else: pr=float(clipped_count) / count return pr def brevity_penalty(c, r): if c>r: bp=1 else: bp=math.exp(1-(float(r)/c)) return bp def best_length_match(ref_lens, cand_len): least_diff=abs(cand_len-ref_lens[0]) best=ref_lens[0] for ref_len in ref_lens: if abs(cand_len-ref_len) < least_diff: least_diff=abs(cand_l-ref_len) best=ref_len return best def calculate_bp(candidate, references): r, c=0, 0 # bp=list() for si in range(len(candidate)): # ref_lengths=list() len_ref=len(references[si].strip().split()) # for reference in references: # ref_length=len(reference[si].strip().split()) # ref_lengths.append(ref_length) len_candidate=len(candidate[si].strip().split()) # r+=best_length_match(ref_length, len_candidate) # r+=best_length_match(ref_lengths, len_candidate) r+=len_ref c+=len_candidate bp=brevity_penalty(c, r) return bp def getBleu(candidate, references): precisions=list() for i in range(4): pr=ngram_precision(candidate, references, i+1) precisions.append(pr) bp=calculate_bp(candidate, references) bleu=geometric_mean(precisions)*bp return bleu, bp, precisions def getAccuracy(generated_sentence, labels, positive=None, negative=None, pred=None): if positive is None: positive=list() negative=list() pred=list() # #one sentence # if type(generated_sentence)==str: # result=model.predict(generated_sentence, k=1, threshold=0.5) # if '0' in result[0][0]: # pred.append(0) # elif '1' in result[0][0]: # pred.append(1) # return accuracy_score(true, pred) # for i in range(len(generated_sentence)): result=model.predict(generated_sentence[i], k=1, threshold=0.5) if '0' in result[0][0]: negative.append(generated_sentence[i]) pred.append(0) elif '1' in result[0][0]: positive.append(generated_sentence[i]) pred.append(1) else: print('classification error') pdb.set_trace() return accuracy_score(labels, pred)
997,752
550e245065105ad7d02ef64cfd5ffec3439e6f6c
N=int(input()) S=str(input()) ls = [] for i in range(len(S)): ls.append(S[i]) for i in range(len(S)): x = S[i] #print(ord(x)+N,ord("Z")) if ord(x)+N > ord("Z"): #print("if") #print(ord("A")-ord("Z")+(ord(x)+N)) ls[i]=chr(ord("A")-ord("Z")+(ord(x)+N)-1) else: #print("else") ls[i]=chr((ord(x)+N)) print("".join(ls))
997,753
4c61fa68366aed9a39d4bace93c6b4413e727c9c
import serial import pycurl import StringIO import re import time import requests ser = serial.Serial('/dev/ttyACM0', 9600) sensorDataOld = '0' sensorDataNew = '1' try: while 1 : sensorDataNew = ser.readline() if(sensorDataNew != sensorDataOld) : sensorList = sensorDataNew.split(',') urlToSend = 'http://erictest.strivemanagementgroup.com/prostudy/piFeed.php' payload = {'l':re.sub('[^0-9]', '', sensorList[1]), 'm':re.sub('[^0-9]', '', sensorList[2]), 'd':1} r = requests.get(urlToSend, params=payload) print(r.url) print (r.text) sensorDataOld = sensorDataNew except KeyboardInterrupt: print 'terminating'
997,754
26804231a1d427e50850f8b778f266b8eaadaff3
# Generated by Django 2.1 on 2018-08-10 17:28 from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): initial = True dependencies = [ ] operations = [ migrations.CreateModel( name='Discipline', fields=[ ('discipline_id_num', models.CharField(max_length=20, primary_key=True, serialize=False)), ('name', models.CharField(max_length=200)), ('workload', models.IntegerField()), ('description', models.CharField(max_length=300)), ], ), migrations.CreateModel( name='Student', fields=[ ('student_id_num', models.CharField(max_length=20, primary_key=True, serialize=False)), ('first_name', models.CharField(max_length=200)), ('last_name', models.CharField(max_length=200)), ('subscription_date', models.DateTimeField(verbose_name='Subscription Date')), ('year_in_school', models.CharField(choices=[('FR', 'Freshman'), ('SO', 'Sophomore'), ('JR', 'Junior'), ('SR', 'Senior'), ('GR', 'Graduate')], default='FR', max_length=2)), ], ), migrations.CreateModel( name='Teacher', fields=[ ('teacher_id_number', models.CharField(max_length=20, primary_key=True, serialize=False)), ('first_name', models.CharField(max_length=200)), ('last_name', models.CharField(max_length=200)), ('subscription_date', models.DateField(verbose_name='subscription date')), ('area_of_domain', models.CharField(choices=[('CE', 'College of Engineering'), ('CAS', 'College of Arts and Sciences'), ('IA', 'International Affairs'), ('MCS', 'Mathematics and Computer Science'), ('MHS', 'Medicine and Health Sciences')], default='CE', max_length=3)), ], ), migrations.AddField( model_name='discipline', name='students', field=models.ManyToManyField(to='uni.Student'), ), migrations.AddField( model_name='discipline', name='teacher', field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='uni.Teacher'), ), ]
997,755
bed09a50076d72ab86693a3cb46345c2f7f7476b
#!/usr/bin/env python3 oldfile = open("lalala","w") oldfile.write("hello word\n") oldfile.close() newfile = open("lalala", "r") for i in newfile: print(i, end='') newfile.close()
997,756
35411ee4dcc1df0b2b4b2a59de7c2610a1ec4e3a
""" BATCH - How it works async def get_location(address) 1. Put the address on a queue of requests. 2. Start a background task that: i. Waits a short time for other requests to be enqueued. ii. Processes all queued requests as a batch. iii. Notifies the waiting 'get_location' functions. 3. Wait for the result and return it. """ import asyncio import json from urllib.parse import urlencode import aiohttp # Constants for accessing the Geoapify batch API GEOCODING_BATCH_API = "https://api.geoapify.com/v1/batch/geocode/search" YOUR_API_KEY = "xxxx-xxxx-xxxx-xxxx" async def get_locations(addresses): """Return a dictionary of address -> (lat, lon).""" # Construct the URL to do the batch request query_string = urlencode({"apiKey": YOUR_API_KEY}) url = f"{GEOCODING_BATCH_API}?{query_string}" # Build the JSON payload for the batch POST request data = json.dumps(addresses) # And use Content-Type: application/json in the headers headers = {"Content-Type": "application/json", "Accept": "application/json"} # Make the POST request to the API async with aiohttp.ClientSession() as session: async with session.post(url, data=data, headers=headers) as response: response_json = await response.read() response_data = json.loads(response_json) # The API can return a dict with a pending status if it needs more # time to complete. Poll the API until the result is ready. while isinstance(response_data, dict) and response_data.get("status") == "pending": # Wait a bit before calling the API await asyncio.sleep(0.1) # Query the result to see if it's ready yet request_id = response_data.get("id") async with aiohttp.ClientSession() as session: async with session.get(url + f"&id={request_id}") as response: response_json = await response.read() response_data = json.loads(response_json) # Gather the results into a dictionary of address -> (lat, lon) locations = {} for result in response_data: address = result["query"]["text"] coords = result["lat"], result["lon"] locations[address] = coords return locations
997,757
1b53918d324ad62b336781e35772ccb1e52848eb
#!/usr/bin/env python from socketIO_client import SocketIO, BaseNamespace import requests,json,sys ''' This file suppose deploy on the docker container with python image pre-configed. It will listen to the socketIO server side if there is any link event such as node failure, link failure. ''' # Disable warnings about unverified certificates if hasattr(requests, 'packages') and hasattr(requests.packages, 'urllib3'): requests.packages.urllib3.disable_warnings() # load from your config file plz... serverURL = 'https://1.1.1.1' username = '*******' password = '*******' class NSNotificationNamespace(BaseNamespace): def on_connect(self): print('Connected to %s:8443/restNotifications-v2'%serverURL) def on_event(key,name,data): print "NorthStar Event: %r,data:%r"%(name,json.dumps(data)) if data['notificationType'] == 'link': print 'Got Link update: ' obj = data['object'] print 'id: ',obj['id'] from_ = obj['endA'] to = obj['endZ'] print 'from ',from_['ipv4Address']['address'] print 'to ',to['ipv4Address']['address'] print 'status: ', obj['operationalStatus'] elif data['notificationType'] == 'node': print 'Got Node update' else: print 'Got Unknown update' print '' # First use NorhtStar OAuth2 authentication API to get a token payload = {'grant_type': 'password','username': username,'password': password} r = requests.post(serverURL + ':8443/oauth2/token',data=payload,verify=False,auth=(username, password)) data =r.json() if "token_type" not in data or "access_token" not in data: print "Error: Invalid credentials" sys.exit(1) headers= {'Authorization': "{token_type} {access_token}".format(**data)} socketIO = SocketIO(serverURL, 8443,verify=False,headers= headers) ns = socketIO.define(NSNotificationNamespace, '/restNotifications-v2') socketIO.wait()
997,758
9eabd78864709d55efb13130be4583d7c74fc2ed
from django.contrib import admin from demo.models.application import application from demo.models.product import product from demo.models.indication import indication from demo.models.personne import Personne from import_export.admin import ImportExportModelAdmin @admin.register(application) class applicationAdmin(ImportExportModelAdmin): pass @admin.register(product) class productAdmin(ImportExportModelAdmin): pass @admin.register(indication) class indicationAdmin(ImportExportModelAdmin): pass @admin.register(Personne) class indicationAdmin(ImportExportModelAdmin): pass
997,759
2831ec2beee9ad9ea6ded5e532e1ba34fe698d97
from django.urls import path from .views import ( PlaceListAPIView, PlaceDetailAPIView, PlaceUpdateAPIView, ) urlpatterns=[ path('',PlaceListAPIView.as_view(),name='list'), path('<slug:slug>/detail',PlaceDetailAPIView.as_view(),name='detail'), path('<slug:slug>/update',PlaceUpdateAPIView.as_view(),name='update'), ]
997,760
a02f81207bb180262f692c7f5648902ed4f1e3bd
# invoer dikte_papier = int(input('dikte papier (in mm): ')) afstand_hemellichaam = int(input('afstand tot hemellichaam (in mm): ')) # berekening aantal_keer_vouwen = 0 hoogte_gevouwen_papier = dikte_papier while hoogte_gevouwen_papier < afstand_hemellichaam: aantal_keer_vouwen += 1 hoogte_gevouwen_papier *= 2 uitvoer = 'Na {} keer vouwen bedraagt de dikte van het papier {} mm.' # uitvoer print(uitvoer.format(aantal_keer_vouwen, hoogte_gevouwen_papier))
997,761
6bd5f07e27e8b836cf04465ee7c47a0dd3730e45
"""Docutils transforms used by Sphinx.""" from __future__ import annotations import re from typing import TYPE_CHECKING, Any, cast from docutils import nodes from docutils.nodes import Element, Node from sphinx import addnodes from sphinx.errors import NoUri from sphinx.locale import __ from sphinx.transforms import SphinxTransform from sphinx.util import logging from sphinx.util.docutils import SphinxTranslator from sphinx.util.nodes import find_pending_xref_condition, process_only_nodes if TYPE_CHECKING: from collections.abc import Sequence from sphinx.addnodes import pending_xref from sphinx.application import Sphinx from sphinx.domains import Domain logger = logging.getLogger(__name__) class SphinxPostTransform(SphinxTransform): """A base class of post-transforms. Post transforms are invoked to modify the document to restructure it for outputting. They resolve references, convert images, do special transformation for each output formats and so on. This class helps to implement these post transforms. """ builders: tuple[str, ...] = () formats: tuple[str, ...] = () def apply(self, **kwargs: Any) -> None: if self.is_supported(): self.run(**kwargs) def is_supported(self) -> bool: """Check this transform working for current builder.""" if self.builders and self.app.builder.name not in self.builders: return False if self.formats and self.app.builder.format not in self.formats: return False return True def run(self, **kwargs: Any) -> None: """Main method of post transforms. Subclasses should override this method instead of ``apply()``. """ raise NotImplementedError class ReferencesResolver(SphinxPostTransform): """ Resolves cross-references on doctrees. """ default_priority = 10 def run(self, **kwargs: Any) -> None: for node in self.document.findall(addnodes.pending_xref): content = self.find_pending_xref_condition(node, ("resolved", "*")) if content: contnode = cast(Element, content[0].deepcopy()) else: contnode = cast(Element, node[0].deepcopy()) newnode = None typ = node['reftype'] target = node['reftarget'] node.setdefault('refdoc', self.env.docname) refdoc = node.get('refdoc') domain = None try: if 'refdomain' in node and node['refdomain']: # let the domain try to resolve the reference try: domain = self.env.domains[node['refdomain']] except KeyError as exc: raise NoUri(target, typ) from exc newnode = domain.resolve_xref(self.env, refdoc, self.app.builder, typ, target, node, contnode) # really hardwired reference types elif typ == 'any': newnode = self.resolve_anyref(refdoc, node, contnode) # no new node found? try the missing-reference event if newnode is None: newnode = self.app.emit_firstresult('missing-reference', self.env, node, contnode, allowed_exceptions=(NoUri,)) # still not found? warn if node wishes to be warned about or # we are in nit-picky mode if newnode is None: self.warn_missing_reference(refdoc, typ, target, node, domain) except NoUri: newnode = None if newnode: newnodes: list[Node] = [newnode] else: newnodes = [contnode] if newnode is None and isinstance(node[0], addnodes.pending_xref_condition): matched = self.find_pending_xref_condition(node, ("*",)) if matched: newnodes = matched else: logger.warning(__('Could not determine the fallback text for the ' 'cross-reference. Might be a bug.'), location=node) node.replace_self(newnodes) def resolve_anyref( self, refdoc: str, node: pending_xref, contnode: Element, ) -> Element | None: """Resolve reference generated by the "any" role.""" stddomain = self.env.get_domain('std') target = node['reftarget'] results: list[tuple[str, Element]] = [] # first, try resolving as :doc: doc_ref = stddomain.resolve_xref(self.env, refdoc, self.app.builder, 'doc', target, node, contnode) if doc_ref: results.append(('doc', doc_ref)) # next, do the standard domain (makes this a priority) results.extend(stddomain.resolve_any_xref(self.env, refdoc, self.app.builder, target, node, contnode)) for domain in self.env.domains.values(): if domain.name == 'std': continue # we did this one already try: results.extend(domain.resolve_any_xref(self.env, refdoc, self.app.builder, target, node, contnode)) except NotImplementedError: # the domain doesn't yet support the new interface # we have to manually collect possible references (SLOW) for role in domain.roles: res = domain.resolve_xref(self.env, refdoc, self.app.builder, role, target, node, contnode) if res and len(res) > 0 and isinstance(res[0], nodes.Element): results.append((f'{domain.name}:{role}', res)) # now, see how many matches we got... if not results: return None if len(results) > 1: def stringify(name: str, node: Element) -> str: reftitle = node.get('reftitle', node.astext()) return f':{name}:`{reftitle}`' candidates = ' or '.join(stringify(name, role) for name, role in results) logger.warning(__("more than one target found for 'any' cross-" 'reference %r: could be %s'), target, candidates, location=node) res_role, newnode = results[0] # Override "any" class with the actual role type to get the styling # approximately correct. res_domain = res_role.split(':')[0] if (len(newnode) > 0 and isinstance(newnode[0], nodes.Element) and newnode[0].get('classes')): newnode[0]['classes'].append(res_domain) newnode[0]['classes'].append(res_role.replace(':', '-')) return newnode def warn_missing_reference(self, refdoc: str, typ: str, target: str, node: pending_xref, domain: Domain | None) -> None: warn = node.get('refwarn') if self.config.nitpicky: warn = True dtype = f'{domain.name}:{typ}' if domain else typ if self.config.nitpick_ignore: if (dtype, target) in self.config.nitpick_ignore: warn = False # for "std" types also try without domain name if (not domain or domain.name == 'std') and \ (typ, target) in self.config.nitpick_ignore: warn = False if self.config.nitpick_ignore_regex: def matches_ignore(entry_type: str, entry_target: str) -> bool: return any( ( re.fullmatch(ignore_type, entry_type) and re.fullmatch(ignore_target, entry_target) ) for ignore_type, ignore_target in self.config.nitpick_ignore_regex ) if matches_ignore(dtype, target): warn = False # for "std" types also try without domain name if (not domain or domain.name == 'std') and \ matches_ignore(typ, target): warn = False if not warn: return if self.app.emit_firstresult('warn-missing-reference', domain, node): return elif domain and typ in domain.dangling_warnings: msg = domain.dangling_warnings[typ] % {'target': target} elif node.get('refdomain', 'std') not in ('', 'std'): msg = (__('%s:%s reference target not found: %s') % (node['refdomain'], typ, target)) else: msg = __('%r reference target not found: %s') % (typ, target) logger.warning(msg, location=node, type='ref', subtype=typ) def find_pending_xref_condition(self, node: pending_xref, conditions: Sequence[str], ) -> list[Node] | None: for condition in conditions: matched = find_pending_xref_condition(node, condition) if matched: return matched.children return None class OnlyNodeTransform(SphinxPostTransform): default_priority = 50 def run(self, **kwargs: Any) -> None: # A comment on the comment() nodes being inserted: replacing by [] would # result in a "Losing ids" exception if there is a target node before # the only node, so we make sure docutils can transfer the id to # something, even if it's just a comment and will lose the id anyway... process_only_nodes(self.document, self.app.builder.tags) class SigElementFallbackTransform(SphinxPostTransform): """Fallback various desc_* nodes to inline if translator does not support them.""" default_priority = 200 def run(self, **kwargs: Any) -> None: def has_visitor(translator: type[nodes.NodeVisitor], node: type[Element]) -> bool: return hasattr(translator, "visit_%s" % node.__name__) try: translator = self.app.builder.get_translator_class() except AttributeError: # do nothing if no translator class is specified (e.g., on a dummy builder) return if issubclass(translator, SphinxTranslator): # subclass of SphinxTranslator supports desc_sig_element nodes automatically. return # for the leaf elements (desc_sig_element), the translator should support _all_, # unless there exists a generic visit_desc_sig_element default visitor if (not all(has_visitor(translator, node) for node in addnodes.SIG_ELEMENTS) and not has_visitor(translator, addnodes.desc_sig_element)): self.fallback(addnodes.desc_sig_element) if not has_visitor(translator, addnodes.desc_inline): self.fallback(addnodes.desc_inline) def fallback(self, node_type: Any) -> None: """Translate nodes of type *node_type* to docutils inline nodes. The original node type name is stored as a string in a private ``_sig_node_type`` attribute if the latter did not exist. """ for node in self.document.findall(node_type): newnode = nodes.inline() newnode.update_all_atts(node) newnode.extend(node) # Only set _sig_node_type if not defined by the user newnode.setdefault('_sig_node_type', node.tagname) node.replace_self(newnode) class PropagateDescDomain(SphinxPostTransform): """Add the domain name of the parent node as a class in each desc_signature node.""" default_priority = 200 def run(self, **kwargs: Any) -> None: for node in self.document.findall(addnodes.desc_signature): if node.parent.get('domain'): node['classes'].append(node.parent['domain']) def setup(app: Sphinx) -> dict[str, Any]: app.add_post_transform(ReferencesResolver) app.add_post_transform(OnlyNodeTransform) app.add_post_transform(SigElementFallbackTransform) app.add_post_transform(PropagateDescDomain) return { 'version': 'builtin', 'parallel_read_safe': True, 'parallel_write_safe': True, }
997,762
7f952b6b152e8c76216268b5c4cd7a97b8a3167b
from xai.brain.wordbase.nouns._watchtower import _WATCHTOWER #calss header class _WATCHTOWERS(_WATCHTOWER, ): def __init__(self,): _WATCHTOWER.__init__(self) self.name = "WATCHTOWERS" self.specie = 'nouns' self.basic = "watchtower" self.jsondata = {}
997,763
16864dea148107076a2c6ea45b9827fd87f0eb83
for i in range(1, 11): # If i is equals to 6, # continue to next iteration # without printing if i == 6: continue else: # otherwise print the value # of i print(i, end=" ")
997,764
8ab2c2bcb8d2cebfc7b5bee11fbe0fdfc0a41582
import sys from PyQt4.QtCore import * from PyQt4.QtGui import * from zoket import client import MySQLdb import string class MyTableModel(QAbstractTableModel): def __init__(self, datain, parent=None, *args): QAbstractTableModel.__init__(self, parent, *args) self.arraydata = datain def rowCount(self, parent): return len(self.arraydata) def columnCount(self, parent): return len(self.arraydata[0]) def data(self, index, role): if not index.isValid(): return QVariant() elif role != Qt.DisplayRole: return QVariant() return QVariant(self.arraydata[index.row()][index.column()]) class Ui_Dialog(object): def showEMessageBox(self,message): msg = QMessageBox() msq.setIcon(QMessageBox.Warning) msg.setWindowTitle("Error") msg.setInformativeText(message) msg.setStandardButtons(QMessageBox.Ok) msg.exec_() def showCMessageBox(self,message): msg = QMessageBox() msg.setIcon(QMessageBox.Information) msg.setWindowTitle("Error") msg.setInformativeText(message) msg.setStandardButtons(QMessageBox.Ok) msg.exec_() ################# Todo lo de articulos Aca abajo################### class listaa(QMainWindow): def __init__(self): QMainWindow.__init__(self) artitable = QTableView() layout = QHBoxLayout() layout.addWidget(artitable) con = MySQLdb.connect('localhost','root','oveja','Tienda Virtual') cursor = con.cursor() cursor.execute("SELECT idArticulos, Articulos.Descripcion, stock, precio_unitario, Categoria.Descripcion FROM Articulos, Categoria WHERE Cod_categoria = idCategoria;") save = cursor.fetchall() tablemodel = MyTableModel(save, self) artitable.setModel(tablemodel) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Lista de articulos") class agregara(QMainWindow): def __init__(self): QMainWindow.__init__(self) global cod, desc, st,pre,cat l1 = QLabel("Codigo de Articulo") cod = QTextEdit() l2 = QLabel("Descripcion") desc = QTextEdit() l3 = QLabel("Cantidads") st = QTextEdit() l4 = QLabel("Precio") pre = QTextEdit() l5 = QLabel("Categoria") cat = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,cod) fbox.addRow(l2,desc) fbox.addRow(l3,st) fbox.addRow(l4,pre) fbox.addRow(l5,cat) button1 = QPushButton("Agregar") fbox.addRow(button1) self.connect(button1, SIGNAL('clicked()'), self.inserta) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Agregar articulos") def inserta(self): abc = client() prot = "insertarA" uid = cod.toPlainText() nm = desc.toPlainText() ape= st.toPlainText() cor= pre.toPlainText() tel= cat.toPlainText() ms = Ui_Dialog() if(str(uid).isalpha() or uid == "" or int(uid)<0): ms.showEMessageBox("Id no puede contener letras o estar vacio y no puede ser menor a 0") elif(nm==""): ms.showEMessageBox("Descripcion vacio") elif(ape==""): ms.showEMessageBox("Cantidad vacio, tiene letras o es menor a 0") elif(str(cor).isalpha() or cor=="" or int(cor)<0): ms.showEMessageBox("el precio esta vacio, tiene letras o es menor a 0") elif(str(tel).isalpha() or tel=="" or int(tel)<0): ms.showEMessageBox("la categoria esta vacio o tiene alguna letra en su contenedor y no puede ser menor a 0") else: mess1 = "%s, %s, %s, %s, %s, %s"%(prot,uid,nm,ape,cor,tel) met = mess1 abc.send(met) ms.showCMessageBox("Exito") class editara(QMainWindow): def __init__(self): QMainWindow.__init__(self) global cod, desc, st,pre,cat l1 = QLabel("Codigo de Articulo") cod = QTextEdit() l2 = QLabel("Descripcion") desc = QTextEdit() l3 = QLabel("Stock") st = QTextEdit() l4 = QLabel("Precio") pre = QTextEdit() l5 = QLabel("Categoria") cat = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,cod) fbox.addRow(l2,desc) fbox.addRow(l3,st) fbox.addRow(l4,pre) fbox.addRow(l5,cat) p1 = QPushButton("Actualizar") fbox.addRow(p1) self.connect(p1, SIGNAL('clicked()'), self.actuar) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Editar articulos") def actuar(self): abc = client() prot = "UpdateA" uid = cod.toPlainText() nm = desc.toPlainText() ape= st.toPlainText() cor= pre.toPlainText() tel= cat.toPlainText() ms= Ui_Dialog() if(str(uid).isalpha() or uid == "" or int(uid)<0): ms.showEMessageBox("Id no puede contener letras o estar vacio y no puede ser menor a 0") elif(nm==""): ms.showEMessageBox("Descripcion vacio") elif(ape==""): ms.showEMessageBox("Cantidad vacio, tiene letras o es menor a 0") elif(str(cor).isalpha() or cor=="" or int(cor)<0): ms.showEMessageBox("el precio esta vacio, tiene letras o es menor a 0") elif(str(tel).isalpha() or tel=="" or int(tel)<0): ms.showEMessageBox("la categoria esta vacio o tiene alguna letra en su contenedor y no puede ser menor a 0") else: mess1 = "%s, %s, %s, %s, %s, %s"%(prot,uid,nm,ape,cor,tel) met = mess1 abc.send(met) ms.showCMessageBox("Articulo Actualizad@") class eliminara(QMainWindow): def __init__(self): QMainWindow.__init__(self) l1 = QLabel("Codigo de Articulo") cod = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,cod) button = QPushButton("Eliminar") fbox.addRow(button) self.connect(button, SIGNAL('clicked()'), self.elia) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Eliminar articulos") def elia(self): abc = client() prot = "Eliminar" prot2 = "Artic" ed=cod.toPlainText() ms= Ui_Dialog() if(str(ed).isalpha() or ed == "" or int(ed)<0): ms.showEMessageBox("Id no puede contener letras o estar vacio o ser menor a 0") else: mess1 = "%s, %s, %s"%(prot,prot2,ed) met = mess1 abc.send(met) ms.showCMessageBox("Usuario Eliminao!!!! FOREVA!") class articulos(QMainWindow): def __init__(self): QMainWindow.__init__(self) layout = QHBoxLayout() button = QPushButton("Lista de articulos disponibles") button2 = QPushButton("Agregar articulos") button3 = QPushButton("Editar articulos") button4 = QPushButton("Eliminar articulos") layout.addWidget(button) layout.addWidget(button2) layout.addWidget(button3) layout.addWidget(button4) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Administrar Articulos") self.connect(button, SIGNAL('clicked()'), self.listaa) self.connect(button2, SIGNAL('clicked()'), self.agregara) self.connect(button3, SIGNAL('clicked()'), self.editara) self.connect(button4, SIGNAL('clicked()'), self.eliminara) def listaa(self): self.mylista = listaa() self.mylista.show() def agregara(self): self.myadda = agregara() self.myadda.show() def editara(self): self.myedita = editara() self.myedita.show() def eliminara(self): self.mydeleta = eliminara() self.mydeleta.show() ################# aca para arriba ^ articulos######### ################# Todo lo de ventas Aca abajo################### class registro_ventas(QMainWindow): def __init__(self): QMainWindow.__init__(self) ventastable = QTableView() layout = QHBoxLayout() layout.addWidget(ventastable) con = MySQLdb.connect('localhost','root','oveja','Tienda Virtual') cursor = con.cursor() cursor.execute("SELECT idFacturacion as '#Factura', Fecha, nombrart as 'Articulo Vendido', Precio_total as 'Precio Unitario', Nombre as 'Comprador', idUsuarios as 'id' FROM Facturacion,Usuarios where User_id = idUsuarios;") save = cursor.fetchall() tablemodel = MyTableModel(save, self) ventastable.setModel(tablemodel) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Registro de ventas") class ventas_por_categoria(QMainWindow): def __init__(self): QMainWindow.__init__(self) global buscar, Ventasxc button = QPushButton("Buscar") buscar= QTextEdit() con = MySQLdb.connect('localhost','root','oveja','Tienda Virtual') Ventasxc= QTableView() layout = QHBoxLayout() layout.addWidget(Ventasxc) leyout = QVBoxLayout() leyout.addWidget(button) leyout.addWidget(buscar) layout.addLayout(leyout) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Ventas por Categoria") self.connect(button, SIGNAL('clicked()'), self.llenartablita) def llenartablita(self): con = MySQLdb.connect('localhost','root','oveja','Tienda Virtual') cursor = con.cursor() tent = buscar.toPlainText() cursor.execute("SELECT idFacturacion as '#Factura', Fecha, nombrart as 'Articulo Vendido', Precio_total as 'Precio Unitario', Nombre as 'Comprador', idUsuarios as 'id' FROM Facturacion, Articulos, Usuarios, Categoria where nombrart=Articulos.Descripcion AND User_id = idUsuarios and Categoria.Descripcion = '%s';"%(tent)) save = cursor.fetchall() tablemodel = MyTableModel(save, self) Ventasxc.setModel(tablemodel) class ventas(QMainWindow): def __init__(self): QMainWindow.__init__(self) layout = QHBoxLayout() button = QPushButton("Registro de ventas") button2= QPushButton("Registro de ventas por categoria") layout.addWidget(button) layout.addWidget(button2) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Ventas") self.connect(button, SIGNAL('clicked()'), self.registro) self.connect(button2, SIGNAL('clicked()'), self.registroc) def registro(self): self.myreg = registro_ventas() self.myreg.show() def registroc(self): self.myregc = ventas_por_categoria() self.myregc.show() ################# aca para arriba ^ Ventas######### ################# Todo lo de Usuarios Aca abajo################### class listac(QMainWindow): def __init__(self): QMainWindow.__init__(self) self.widget = QWidget() cattable = QTableView() layout = QHBoxLayout() layout.addWidget(cattable) con = MySQLdb.connect('localhost','root','oveja','Tienda Virtual') cursor = con.cursor() cursor.execute("SELECT * FROM Categoria;") save = cursor.fetchall() tablemodel = MyTableModel(save, self) cattable.setModel(tablemodel) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Lista de categorias") class agregarc(QMainWindow): def __init__(self): QMainWindow.__init__(self) global cod, desc l1 = QLabel("Codigo de Categoria") cod = QTextEdit() l2 = QLabel("Descripcion") desc = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,cod) fbox.addRow(l2,desc) button1= QPushButton("Agregar") fbox.addRow(button1) self.connect(button1, SIGNAL('clicked()'), self.insertc) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Agregar categoria") def insertc(self): abc = client() prot = "Insertarad" prot2 = "Categoria" de=cod.toPlainText() dcp=desc.toPlainText() ms= Ui_Dialog() if(str(de).isalpha() or int(de)<0 or de==""): ms.showEMessageBox("Id no puede contener letras ni ser menor a 0") elif(dcp==""): ms.showEMessageBox("La descripcion esta vacia") else: mess1 = "%s, %s, %s, %s"%(prot,prot2,de,dcp) met = mess1 abc.send(met) ms.showCMessageBox("Exito") class editarc(QMainWindow): def __init__(self): QMainWindow.__init__(self) global cod, cod1,desc l1 = QLabel("Codigo de Categoria Viejo") cod = QTextEdit() l2 = QLabel("Descripcion Nueva") desc = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,cod) fbox.addRow(l2,desc) p1 = QPushButton("Actualizar") fbox.addRow(p1) self.connect(p1, SIGNAL('clicked()'), self.actuC) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Editar categoria") def actuC(self): abc = client() prot = "Updatead" prot2 = "Categoria" ed=cod.toPlainText() de = ed dcp=desc.toPlainText() ms= Ui_Dialog() if(str(de).isalpha() or int(de)<0 or de==""): ms.showEMessageBox("Id no puede contener letras ni ser menor a 0") elif(dcp==""): ms.showEMessageBox("La descripcion esta vacia") else: mess1 = "%s, %s, %s, %s"%(prot,prot2,ed,dcp) met = mess1 abc.send(met) ms.showCMessageBox("Categoria Actualizada") class eliminarc(QMainWindow): def __init__(self): QMainWindow.__init__(self) global cod l1 = QLabel("Codigo de Categoria") cod = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,cod) button = QPushButton("Eliminar") fbox.addRow(button) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Eliminar categoria") self.connect(button, SIGNAL('clicked()'), self.elic) def elic(self): abc = client() prot = "Eliminar" prot2 = "Categoria" ed=cod.toPlainText() ms= Ui_Dialog() if(str(ed).isalpha() or ed == "" or int(ed)<0): ms.showEMessageBox("Id no puede contener letras o estar vacio o ser menor a 0") else: mess1 = "%s, %s, %s"%(prot,prot2,ed) met = mess1 abc.send(met) ms.showCMessageBox("Usuario Eliminao!!!! FOREVA!") class Categorias(QMainWindow): def __init__(self): QMainWindow.__init__(self) layout = QHBoxLayout() button = QPushButton("Lista de categorias disponibles") button2 = QPushButton("Agregar categorias") button3 = QPushButton("Editar categorias") button4 = QPushButton("Eliminar categorias") layout.addWidget(button) layout.addWidget(button2) layout.addWidget(button3) layout.addWidget(button4) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Categorias") self.connect(button, SIGNAL('clicked()'), self.listac) self.connect(button2, SIGNAL('clicked()'), self.agregarc) self.connect(button3, SIGNAL('clicked()'), self.editarc) self.connect(button4, SIGNAL('clicked()'), self.eliminarc) def listac(self): self.mylistc = listac() self.mylistc.show() def agregarc(self): self.myaddc = agregarc() self.myaddc.show() def editarc(self): self.myeditc = editarc() self.myeditc.show() def eliminarc(self): self.mydeletc = eliminarc() self.mydeletc.show() ################# aca para arriba ^ categorias######### ################# Todo lo de Usuarios Aca abajo################### class listau(QMainWindow): def __init__(self): QMainWindow.__init__(self) self.widget = QWidget() clientetable = QTableView() layout = QHBoxLayout() layout.addWidget(clientetable) con = MySQLdb.connect('localhost','root','oveja','Tienda Virtual') cursor = con.cursor() cursor.execute("SELECT idUsuarios, Nombre, Apellidos, Correo, Telefono, Descrip as 'Pais', Cod_postal as 'Codigo postal' , Descripcion as 'Tipo Usuario' FROM Usuarios, Pais, Tipo_usuario where cod_pais = idPais and Tipo_usuario = Cod_Tipo_Usuario;") save = cursor.fetchall() tablemodel = MyTableModel(save, self) clientetable.setModel(tablemodel) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Lista de usuarios") class agregaru(QMainWindow): def __init__(self): QMainWindow.__init__(self) l1 = QLabel("Cedula") global ida, nom, ap, corr, telf, tip, pais, cod, contr ida= QTextEdit() l2 = QLabel("Nombre") nom = QTextEdit() l3 = QLabel("Apellido") ap = QTextEdit() l4 = QLabel("Correo") corr = QTextEdit() l10 = QLabel("Telefono") telf = QTextEdit() l5 = QLabel("Tipo de Usuario") tip = QTextEdit() l6 = QLabel("Pais") pais = QTextEdit() l7 = QLabel("Codigo Postal") cod = QTextEdit() l8 = QLabel("Contrasena") contr = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,ida) vbox = QVBoxLayout() vbox.addWidget(nom) fbox.addRow(l2,vbox) fbox.addRow(l3,ap) fbox.addRow(l4,corr) fbox.addRow(l10,telf) fbox.addRow(l5,tip) fbox.addRow(l6,pais) fbox.addRow(l7,cod) fbox.addRow(l8,contr) button1 = QPushButton("Registrar") fbox.addRow(button1) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Agregar usuarios") self.connect(button1, SIGNAL('clicked()'), self.insertt) def insertt(self): abc = client() prot = "UsuarioI" uid = ida.toPlainText() nm = nom.toPlainText() ape= ap.toPlainText() cor= corr.toPlainText() tel = telf.toPlainText() cp= pais.toPlainText() cps= cod.toPlainText() contra = contr.toPlainText() tipo= tip.toPlainText() ms= Ui_Dialog() if(str(uid).isalpha() or uid == ""): ms.showEMessageBox("Id no puede contener letras o estar vacio") elif(nm==""): ms.showEMessageBox("el Nombre esta vacio") elif(ape==""): ms.showEMessageBox("el apellido esta vacio") elif(cor==""): ms.showEMessageBox("el correo esta vacio") elif(str(tel).isalpha() or tel=="" or int(tel)<0): ms.showEMessageBox("el telefono esta vacio o tiene alguna letra en su contenedor o es menor a 0") elif(str(cp).isalpha() or cp=="" or int(cp)<0): ms.showEMessageBox("el codigo pais esta vacio o tiene letras en su contenedor o es menor a 0") elif(str(cps).isalpha() or cps=="" or int(cps)<0): ms.showEMessageBox("Codigo postal esta vacio, tiene letras o es menor a 0") elif(contra==""): ms.showEMessageBox("Password esta vacio") elif(str(tipo).isalpha() or tipo=="" or int(tipo)<0): ms.showEMessageBox("el tipo esta vacio o tiene letras en su contenedor") else: mess1 = "%s, %s, %s, %s, %s, %s, %s, %s, %s, %s"%(prot,uid,nm,ape,cor,tel,cp,cps,contra,tipo) met = mess1 abc.send(met) ms.showCMessageBox("Usuario Actualizad@") class editaru(QMainWindow): def __init__(self): QMainWindow.__init__(self) global ced, nom, ap, corr, tip, pais, cod, contr,telf l1 = QLabel("Cedula") ced = QTextEdit() l2 = QLabel("Nombre") nom = QTextEdit() l3 = QLabel("Apellido") ap = QTextEdit() l4 = QLabel("Correo") corr = QTextEdit() l5 = QLabel("Tipo de Usuario") tip = QTextEdit() l6 = QLabel("Pais") pais = QTextEdit() l7 = QLabel("Codigo Postal") cod = QTextEdit() l8 = QLabel("Contrasena") contr = QTextEdit() l9 = QLabel("Telefono") telf = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,ced) vbox = QVBoxLayout() vbox.addWidget(nom) fbox.addRow(l2,vbox) fbox.addRow(l3,ap) fbox.addRow(l4,corr) fbox.addRow(l9,telf) fbox.addRow(l5,tip) fbox.addRow(l6,pais) fbox.addRow(l7,cod) fbox.addRow(l8,contr) p1 = QPushButton("Actualizar") fbox.addRow(p1) self.connect(p1, SIGNAL('clicked()'), self.actu) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Editar Usuarios") def actu(self): abc = client() prot = "UsuarioU" uid = ced.toPlainText() nm = nom.toPlainText() ape= ap.toPlainText() cor= corr.toPlainText() tel = telf.toPlainText() cp= pais.toPlainText() cps= cod.toPlainText() contra = contr.toPlainText() tipo= tip.toPlainText() ms= Ui_Dialog() if(str(uid).isalpha() or uid == ""): ms.showEMessageBox("Id no puede contener letras o estar vacio") elif(nm==""): ms.showEMessageBox("el Nombre esta vacio") elif(ape==""): ms.showEMessageBox("el apellido esta vacio") elif(cor==""): ms.showEMessageBox("el correo esta vacio") elif(str(tel).isalpha() or tel=="" or int(tel)<0): ms.showEMessageBox("el telefono esta vacio o tiene alguna letra en su contenedor o es menor a 0") elif(str(cp).isalpha() or cp=="" or int(cp)<0): ms.showEMessageBox("el codigo pais esta vacio o tiene letras en su contenedor o es menor a 0") elif(str(cps).isalpha() or cps=="" or int(cps)<0): ms.showEMessageBox("Codigo postal esta vacio, tiene letras o es menor a 0") elif(contra==""): ms.showEMessageBox("Password esta vacio") elif(str(tipo).isalpha() or tipo=="" or int(tipo)<0): ms.showEMessageBox("el tipo esta vacio o tiene letras en su contenedor") else: mess1 = "%s, %s, %s, %s, %s, %s, %s, %s, %s, %s"%(prot,uid,nm,ape,cor,tel,cp,cps,contra,tipo) met = mess1 abc.send(met) ms.showCMessageBox("Usuario Actualizad@") class eliminaru(QMainWindow): def __init__(self): QMainWindow.__init__(self) global ced,nom, ap l1 = QLabel("Cedula") ced = QTextEdit() fbox = QFormLayout() fbox.addRow(l1,ced) button = QPushButton("Eliminar") fbox.addRow(button) self.widget = QWidget() self.widget.setLayout(fbox) self.setCentralWidget(self.widget) self.setWindowTitle("Eliminar usuarios") self.connect(button, SIGNAL('clicked()'), self.eliu) def eliu(self): abc = client() prot = "Eliminar" prot2 = "User" ed=ced.toPlainText() ms= Ui_Dialog() if(str(ed).isalpha() or ed == "" or int(ed)<0): ms.showEMessageBox("Id no puede contener letras o estar vacio o ser menor a 0") else: mess1 = "%s, %s, %s"%(prot,prot2,ed) met = mess1 abc.send(met) ms.showCMessageBox("Usuario Eliminao!!!! FOREVA!") class Client(QMainWindow): def __init__(self): QMainWindow.__init__(self) layout = QHBoxLayout() lineEdit = QTextEdit() button = QPushButton("Ver lista de Usuarios") button2 = QPushButton("Agregar Usuario Nuevo") button3 = QPushButton("Editar Usuarios") button4 = QPushButton("Eliminar Usuarios") layout.addWidget(button) layout.addWidget(button2) layout.addWidget(button3) layout.addWidget(button4) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Aministrador de usuarios") self.connect(button, SIGNAL('clicked()'), self.listau) self.connect(button2, SIGNAL('clicked()'), self.agregaru) self.connect(button3, SIGNAL('clicked()'), self.editaru) self.connect(button4, SIGNAL('clicked()'), self.eliminaru) def listau(self): self.mylistu = listau() self.mylistu.show() def agregaru(self): self.myaddu = agregaru() self.myaddu.show() def editaru(self): self.myeditu = editaru() self.myeditu.show() def eliminaru(self): self.mydeletu = eliminaru() self.mydeletu.show() ################Usuarios de ^ ############################## ##############Todo lo de la main windown V abajo############ class MainWindow(QMainWindow): def __init__(self): QMainWindow.__init__(self) layout = QVBoxLayout() button = QPushButton("Administrar Usuarios") button2 = QPushButton("Administrar Articulos") button3 = QPushButton("Administrar Categorias") button4 = QPushButton("Administrar Ventas") layout.addWidget(button) layout.addWidget(button2) layout.addWidget(button3) layout.addWidget(button4) self.widget = QWidget() self.widget.setLayout(layout) self.setCentralWidget(self.widget) self.setWindowTitle("Servidor") self.connect(button, SIGNAL('clicked()'), self.newWindow) self.connect(button2, SIGNAL('clicked()'), self.newWindow2) self.connect(button3, SIGNAL('clicked()'), self.newWindow3) self.connect(button4, SIGNAL('clicked()'), self.newWindow4) def newWindow(self): self.myClient = Client() self.myClient.show() def newWindow2(self): self.misArticulos = articulos() self.misArticulos.show() def newWindow3(self): self.myCats = Categorias() self.myCats.show() def newWindow4(self): self.myvent = ventas() self.myvent.show() ############# de aca para ^ main windown y abajo el Main func########## if __name__ == "__main__": app = QApplication(sys.argv) mainWindow = MainWindow() mainWindow.setGeometry(200, 200, 200, 200) mainWindow.show() sys.exit(app.exec_()) #Funcion Main :)
997,765
f19a7895ee072fb8a0b33d3106908455925fd375
from sqlalchemy import * from sqlalchemy.orm import * from tables import * engine = create_engine("postgresql://cavuser:cavuser@localhost:5432/cav_dblp") Base.metadata.create_all(engine) Session = sessionmaker(bind=engine) session = Session() def get_name(author_id): return engine.execute(text("SELECT name FROM authors WHERE id=:id;"), id=author_id).fetchall()[0] import operator def coauthors_within_5y_span(): print "Number of coauthors within 5 year span" for l in range(1989, 2010): print l, "to", (l+5) co_authors_in_range = dict() for author in session.query(Author): # I'm sure there is a much better way to do this using SQL and SQL Alchemy co_authors_in_range[author.id] = len(engine.execute(text(""" SELECT DISTINCT ON (limited_to_author.author_id) pub.year, limited_to_author.author_id, limited_to_author.publication_id FROM publications pub INNER JOIN ( SELECT pa.publication_id, pa.author_id FROM publication_authors pa WHERE pa.publication_id IN ( (SELECT publication_id FROM publication_authors WHERE author_id=:id) )) limited_to_author ON pub.id=limited_to_author.publication_id WHERE year>=:lower AND year<:upper; """), id = author.id, lower=l, upper=(l+5)).fetchall()) m = sorted(co_authors_in_range.iteritems(), key=operator.itemgetter(1))[-3:] m.reverse() for i in range(3): print (i+1), ")", get_name(m[i][0]), "with", m[i][1] def publications_within_5y_span(): print "Number of publications within 5 year span" for l in range(1989, 2010): print l, "to", (l+5) publications_in_range = dict() for author in session.query(Author): # I'm sure there is a much better way to do this using SQL and SQL Alchemy publications_in_range[author.id] = len(engine.execute(text(""" SELECT pub.year, limited_to_author.author_id, limited_to_author.publication_id FROM publications pub INNER JOIN ( (SELECT author_id, publication_id FROM publication_authors WHERE author_id=:id) ) limited_to_author ON pub.id=limited_to_author.publication_id WHERE year>=:lower AND year<:upper; """), id = author.id, lower=l, upper=(l+5)).fetchall()) m = sorted(publications_in_range.iteritems(), key=operator.itemgetter(1))[-3:] m.reverse() for i in range(3): print (i+1), ")", get_name(m[i][0]), "with", m[i][1] def single_author_papers(): print "Single author papers" publications = dict() for author in session.query(Author): # I'm sure there is a much better way to do this using SQL and SQL Alchemy publications[author.id] = len(engine.execute(text(""" SELECT pub.author_id, pub.publication_id FROM publication_authors pub INNER JOIN ( SELECT publication_id FROM publication_authors GROUP BY publication_id HAVING COUNT(author_id) = 1 ) single_author_papers ON pub.publication_id = single_author_papers.publication_id WHERE author_id=:id; """), id = author.id).fetchall()) m = sorted(publications.iteritems(), key=operator.itemgetter(1))[-3:] m.reverse() for i in range(3): print (i+1), ")", get_name(m[i][0]), "with", m[i][1] single_author_papers() print "" coauthors_within_5y_span() print "" publications_within_5y_span()
997,766
b4d78da93511493fd9fe69cda1d089997ae16c7e
from django.contrib.auth import get_backends, authenticate
997,767
87b206eab89ff6f4f464721bea7f8f8f2dcbb326
# -*- coding: utf-8 -*- import socket import os, sys from module_declarations import PL1012DataFormat, PL1012BYTE_N, SAMPLING_BASE_TIME, SCREEN_POS, BYTE_N, CWD_PATH from module_declarations import SKT_PATH, SKT_PL1000, SKT_TC08, HW_SN_EN, TC08DataFormat, TC08FLOAT_N, PEAKDataFormat from module_declarations import PC_OFFLINE, RPI_DEVELOPMENT, RPI_PRODUCTION import time import datetime import xml.etree.ElementTree import csv import threading # Class for thread running a blinking of PowerStatus LED class BlinkPowerLed (threading.Thread): def __init__(self, thread_id, name, counter): threading.Thread.__init__(self) self.threadID = thread_id self.name = name self.counter = counter def run(self): print("Starting " + self.name) while power_latch: set_power_led(LED_OFF) time.sleep(0.25) set_power_led(LED_ON) time.sleep(0.25) print("Exiting " + self.name) # Class for thread running a blinking of PowerStatus LED class BlinkLoggingLed (threading.Thread): def __init__(self, thread_id, name, counter): threading.Thread.__init__(self) self.threadID = thread_id self.name = name self.counter = counter def run(self): print("Starting " + self.name) while logging_led_status: set_logging_led(LED_OFF) time.sleep(0.5) set_logging_led(LED_ON) time.sleep(0.5) print("Exiting " + self.name) # Function for printing in Screen Matrix the displayed values # def print_xy(x, y, contents=None, color=None): sys.stdout.write("\x1b7\x1b[%d;%df%s\x1b8" % (x, y, contents)) sys.stdout.flush() # Function for detecting the Key status from RPI GPIO # The key status is connected to Raspberry GPIO 3 def key_status(): key_status_detected = GPIO.input(3) return key_status_detected # Function for setting the power status indicator LED mode # The power status indicator LED is connected to Raspberry GPIO 9 def set_power_led(status): GPIO.output(9,status) # Function for setting the logging status indicator LED mode # The logging status indicator LED is connected to Raspberry GPIO 7 def set_logging_led(status): GPIO.output(7,status) return status # Function for setting the power latch enable mode # The power latch enable is connected to Raspberry GPIO 5 def set_power_latch(status): GPIO.output(5,status) return status # Function for linearize signal before writing records to CSV file def linearise_signal(raw_value,parameters): linearized_value = None if parameters['hw'] == "pl1012": linearized_value = raw_value*float(parameters['slope'])+float(parameters['offset']) if parameters['hw'] == "pcan": resolution = float(parameters['resolution']) offset = float(parameters['offset']) if int(parameters['bits']) == 8 and int(parameters['bit_offset']) == 0: try: linearized_value = float(raw_value[0])*resolution+offset except: print("\n8 bits raw_value not convertible ='{}'".format(raw_value)) print("for parameter ='{}'\n".format(parameters)) linearized_value= None elif int(parameters['bits']) == 16 and int(parameters['bit_offset']) == 0: try: lsbyte = float(raw_value[0]) msbyte = float(raw_value[1]) raw_value_int = lsbyte+msbyte*2**8 linearized_value = float(raw_value_int)*resolution+offset except: print("\n16 bits raw_value not convertible ='{}'".format(raw_value)) print("for parameter ='{}'\n".format(parameters)) linearized_value= None else: #TODO CAN linearization for data lenth less than 8 bits print("\nno 8 and no 16 bits raw_value not convertible ='{}'".format(raw_value)) print("for parameter ='{}'\n".format(parameters)) linearized_value = None return linearized_value # Function sending command to Sockets client def send_command(socket_client=None,command=None): bcommand = command.encode('utf-8') socket_client.send(bcommand) environment = PC_OFFLINE if environment == PC_OFFLINE: bt = SAMPLING_BASE_TIME.total_seconds() sleep_time = bt lag_correction = 0.0 full_connect= False from RPiSim.GPIO import GPIO elif environment == RPI_PRODUCTION: bt = SAMPLING_BASE_TIME.total_seconds() sleep_time = bt lag_correction = 0.0 full_connect = False GPIO.setmode(GPIO.BCM) KEY_ON = True KEY_OFF = False LED_ON = GPIO.HIGH LED_OFF = GPIO.LOW GPIO.setup(3, GPIO.IN, initial=GPIO.HIGH, pull_up_down=GPIO.PUD_UP) # this is the key sense input GPIO.setup(5, GPIO.OUT, initial=GPIO.HIGH, pull_up_down=GPIO.PUD_DOWN) # this the power latch enable output logging_led_status = GPIO.LOW GPIO.setup(7, GPIO.OUT, initial=logging_led_status, pull_up_down=GPIO.PUD_DOWN) # this is the Datalogging running blinking led GPIO.setup(9,GPIO.OUT, initial=GPIO.LOW, pull_up_down=GPIO.PUD_DOWN) # this is the power state led output if key_status() == KEY_ON: set_power_led(GPIO.HIGH) power_latch = set_power_latch(GPIO.HIGH) else: set_power_led(GPIO.LOW) sys.exit(2) #TODO develop the LED blinking and fixed #TODO develop the power latch management # calculates required connections total number total_connection_req_conf = 0 for item in iter(HW_SN_EN): print(item) if HW_SN_EN[item]["en"]: total_connection_req_conf += 1 print("Connecting... looking for {} devices.".format(total_connection_req_conf)) time_conn_begin = datetime.datetime.now() total_connection_req_det = 0 # Create clients for the three sockets # Create PL1012 socket client if HW_SN_EN["PL1000"]["en"]: try: # Starting C modules streaming sockets # Starting PL1000 if os.path.exists(os.path.join(SKT_PATH,HW_SN_EN["PL1000"]["socket_file"])): client_PL1012 = socket.socket(socket.AF_UNIX, socket.SOCK_STREAM) client_PL1012.connect(os.path.join(SKT_PATH,HW_SN_EN["PL1000"]["socket_file"])) answ = client_PL1012.recv(20) total_connection_req_det += 1 else: answ = "socket file {} not found".format(os.path.join(SKT_PATH,HW_SN_EN["PL1000"]["socket_file"])) except Exception as e: print("something's wrong. Exception is %s" % (e)) answ = "None" finally: print("Answer from server PL1012 socket: {}".format(answ)) print("Ready.") # print("Ctrl-C to quit.") # print("Sending 'DONE' shuts down the server and quits.") # Create TC08 socket client if HW_SN_EN["TC08"]["en"]: try: if os.path.exists(os.path.join(SKT_PATH, HW_SN_EN["TC08"]["socket_file"])): client_TC08 = socket.socket(socket.AF_UNIX, socket.SOCK_STREAM) client_TC08.connect(os.path.join(SKT_PATH, HW_SN_EN["TC08"]["socket_file"])) answ = client_TC08.recv(20) total_connection_req_det += 1 else: answ = "socket file {} not found".format(os.path.join(SKT_PATH,HW_SN_EN["PL1000"]["socket_file"])) except Exception as e: print("something's wrong with %s:%d. Exception is %s" % (address, port, e)) answ = "None" finally: print("Answer from server TC08 socket: {}".format(answ)) print("Ready.") print("Ctrl-C to quit.") print("Sending 'DONE' shuts down the server and quits.") # Create PCAN socket client if HW_SN_EN["PEAK"]["en"]: try: if os.path.exists(os.path.join(SKT_PATH, HW_SN_EN["PEAK"]["socket_file"])): client_PEAK = socket.socket(socket.AF_UNIX, socket.SOCK_STREAM) client_PEAK.connect(os.path.join(SKT_PATH, HW_SN_EN["PEAK"]["socket_file"])) answ = client_PEAK.recv(20) total_connection_req_det += 1 else: answ = "socket file {} not found".format(os.path.join(SKT_PATH, HW_SN_EN["PL1000"]["socket_file"])) except Exception as e: print("something's wrong with opening PEAK. Exception is %s " % (e)) answ = "None" finally: print("Answer from server PEAK socket: {}".format(answ)) print("Ready.") print("Ctrl-C to quit.") print("Sending 'DONE' shuts down the server and quits.") _=os.system("clear") sys.stdout.flush() if total_connection_req_det != total_connection_req_conf: sys.exit(1) # Parsing channels configuration from xml file # BEGIN tree = xml.etree.ElementTree.parse(os.path.join(CWD_PATH, 'conf/channel_config.xml')) root = tree.getroot() channels_dict = dict() data_row = [None] for type in root: print(type.tag, '<-- child.tag | child.attrib --->', type.attrib) if type.tag == 'DatalogFilenamePrefix': FILENAME_PREFIX = type.attrib['prefix'] for ch in type.iter('ch'): channels_dict[ch.attrib['col']] = ch.attrib data_row.append(None) print(type.attrib['type'], ' --> Analog input channels --> ', ch.attrib) del root, tree, type, ch # END OF CHANNELS CONFIG PARSER #TODO write the csv writer for file container of data file_name_suffix = datetime.datetime.now().strftime('%Y%m%d_%H%M%S') file_name = FILENAME_PREFIX+file_name_suffix+'.csv' csv_file_name = os.path.join(CWD_PATH,file_name) csv_file_header= open(csv_file_name,mode='w', encoding='utf-8') csv_file = csv.writer(csv_file_header, dialect='excel', delimiter=',', quotechar="'", quoting=csv.QUOTE_MINIMAL, lineterminator='\n') del file_name, file_name_suffix, FILENAME_PREFIX # write the file table columns header head_row = list(' '*(len(channels_dict)+1)) # add first column as timestamp in position 0 (zero) head_row[0]='Timestamp(Unix) [s from 1.1.1970]' for col, channel in channels_dict.items(): col_head = "{} [{}]".format(channel['name'],channel['um']) head_row[int(col)]=col_head csv_file.writerow(head_row) del head_row, col_head # MAIN LOOP OF DATA LOGGING first_cycle = True #check the staus of the Key input - if KEY_OFF jump to program exit while key_status() == KEY_ON: try: #for cycle in range(cycles): if first_cycle: # Create new threads thread2 = BlinkLoggingLed(2, "Blink-LogLed", 1) logging_led_status = True # Start new Threads thread2.start() t_old = datetime.datetime.now() iet = datetime.timedelta(0) et_mean=datetime.timedelta(0) send_command(client_PL1012, 'K') answ = "" send_command(client_TC08, 'S') answ_tc08 = "" cycle = 1 first_cycle=False else: answ = client_PL1012.recv(24) answ_tc08 = client_TC08.recv(256) send_command(client_PEAK, 'S') answPEAK = client_PEAK.recv(2048) CAN_row_Data = [] CAN_row_Data_parser = csv.reader(answPEAK.decode().split('\n'), delimiter=',') for value in CAN_row_Data_parser: CAN_row_Data.append(value) print('\t'.join(value)) temperatures_data = TC08DataFormat.parse(answ_tc08) pl1012_data = PL1012DataFormat.parse(answ) # for i in range(TC08FLOAT_N): # # # for i in range(PL1012BYTE_N): # print_xy(SCREEN_POS[i][0], SCREEN_POS[i][1] + 12, "{:06d}".format(data.data[i])) # for i in range(PL1012BYTE_N, PL1012BYTE_N + TC08FLOAT_N): # print_xy(SCREEN_POS[i][0], SCREEN_POS[i][1] + 12, # "{:04.3f}".format(temperatures.data[i - PL1012BYTE_N])) # # start_time_data = PL1012BYTE_N + TC08FLOAT_N + 1 # # print_xy(SCREEN_POS[start_time_data][0], SCREEN_POS[start_time_data][1]+12, "{}".format(i)) # print_xy(SCREEN_POS[start_time_data + 1][0], SCREEN_POS[start_time_data + 1][1] + 12, # "cycle {}/{}".format(cycle, cycles)) # print_xy(SCREEN_POS[start_time_data + 2][0], SCREEN_POS[start_time_data + 2][1] + 12, # "Mean {:09.6f}".format(et_mean.total_seconds())) # print_xy(SCREEN_POS[start_time_data + 3][0], SCREEN_POS[start_time_data + 3][1] + 12, # "Min {:09.6f}".format(et_min.total_seconds())) # print_xy(SCREEN_POS[start_time_data + 4][0], SCREEN_POS[start_time_data + 4][1] + 12, # "Max {:09.6f}".format(et_max.total_seconds())) # print_xy(SCREEN_POS[start_time_data + 5][0], SCREEN_POS[start_time_data + 5][1] + 12, # "Lag corr {:09.6f}".format(lag_correction)) cycle +=1 t_now = datetime.datetime.now() et = t_now -t_old iet += et et_mean= iet/cycle #print("SENT {} on iteration {}: et_mean={}, et_max= {} et_min= {}".format(x, i, et_mean.total_seconds(),et_max.total_seconds(), et_min.total_seconds())) t_old=t_now lag_time = et.total_seconds()-bt lag_correction += lag_time/10 sleep_time = bt - lag_correction # print_xy(SCREEN_POS[start_time_data+6][0], SCREEN_POS[start_time_data+6][1]+12, "Sleep time{}".format(sleep_time)) send_command(client_PL1012,'K') send_command(client_TC08,'S') # Loop for data linearization according to channel_config.xml for col, channel in channels_dict.items(): if channel['hw']=='tc08': # TC08 return float value already linearized data_row[int(col)] = temperatures_data.data[int(channel['ph'])] elif channel['hw']=='pl1012': data_row[int(col)] = linearise_signal(pl1012_data.data[int(channel['ph'])],channel) elif channel['hw']=='pcan': for msg in CAN_row_Data: if len(msg) > 1: msg_id = msg[0] if channel['pgn'] in msg_id.upper(): data_len = int((float(channel['bits'])+7)/8) data_row[int(col)] = linearise_signal(msg[int(channel['byte']):int(channel['byte'])+data_len],channel) else: data_row[int(col)] = None # write the data row in csv file # insert timestamp data_row[0] = datetime.datetime.now(datetime.timezone.utc).timestamp() csv_file.writerow(data_row) if sleep_time < 0.0: sleep_time = bt time.sleep(sleep_time) except KeyboardInterrupt as k: print("\nClient Shutting down.\n") client_PL1012.close() client_TC08.close() client_PEAK.close() break # send closing command and close all clients print("\nClient Shutting down.\n") logging_led_status = False time.sleep(2) # Create new threads thread1 = BlinkPowerLed(1, "Thread-1", 1) # Start new Threads thread1.start() print ("Exiting Main Thread") send_command(client_PL1012, 'X') client_PL1012.close() send_command(client_TC08, 'X') client_TC08.close() send_command(client_PEAK, 'X') client_PEAK.close() GPIO.cleanup() csv_file_header.close() power_latch = False thread1.join() time.sleep(5) set_power_latch(GPIO.LOW) sys.exit(0)
997,768
acd1df17e2b0964f54e8701640dce4bf02c227b8
import sys import os import argparse argparser = argparse.ArgumentParser(''' Builds Brent dataset into appropriate format for use with DNN-Seg. ''') argparser.add_argument('dir_path', help='Path to Brent source directory') argparser.add_argument('-o', '--outdir', default='../dnnseg_data/brent/', help='') args = argparser.parse_args() if not os.path.exists(args.outdir): os.makedirs(args.outdir) if not os.path.exists(args.outdir + '/train'): os.makedirs(args.outdir + '/train') if not os.path.exists(args.outdir + '/test'): os.makedirs(args.outdir + '/test') with open(args.dir_path + '/br-phono.txt', 'r') as f: with open(args.outdir + '/train/br-phono.txt', 'w') as train: with open(args.outdir + '/test/br-phono.txt', 'w') as test: for i, l in enumerate(f.readlines()): if l.strip(): if i < 8000: train.write(l) else: test.write(l)
997,769
99aabb664017dc2b3e78571d5c7213b80df50307
from volapi import Room import argparse import config import os import requests def upload_process(room, passwd, user, userpasswd, files): if len(files) == 0: print("[X] No files were recognised! - Aborting upload") return False if room == "": print(f"[X] You must provide a room! - Aborting upload!") return False if user == "" and config.VOLAFILE_USER == "": local_user = "volapi" upw_set = False elif user == "" and config.VOLAFILE_USER != "": local_user = config.VOLAFILE_USER if config.VOLAFILE_USER_PASSWORD != "": local_password = config.VOLAFILE_USER_PASSWORD upw_set = True else: upw_set = False else: local_user = user if userpasswd != "": local_password = userpasswd upw_set = True else: upw_set = False if passwd == "": rpw_set = False else: rpw_set = True try: if rpw_set and passwd[0:4] == "#key": local_room = Room(name=room, key=passwd[4:], user=local_user) elif rpw_set: local_room = Room(name=room, password=passwd, user=local_user) else: local_room = Room(name=room, user=local_user) except RuntimeError: print( f"[X] Could not connect to the specified room: {room} - Aborting upload.") return False if upw_set: try: local_room.user.login(local_password) except RuntimeError: print( f"[X] Could not login user: {local_user} with the provided password - Aborting upload." ) return False filenum = 0 for f in files: if os.path.isfile(f): filenum += 1 handle_file(f, local_room, filenum) elif os.path.isdir(f): for filename in os.listdir(f): if os.path.isfile(os.path.join(f, filename)): filenum += 1 handle_file(os.path.join(f, filename), local_room, filenum) else: print( f"[X] Subfolders are not handled, please specify seperately: {f} - Continue to next specified file" ) else: print( f"[X] File/Folder could not be recognised: {f} - Continue to next specified file/folder" ) continue local_room.close() def handle_file(file, room, filenum): callback = CallbackInfo(file.split("/")[-1], filenum, room) try: file_id = room.upload_file(file, callback=callback, allow_timeout=True) except ValueError: print( f"[{filenum}] Uploading to {room.name} | ERROR: File was too big to upload!", end="\r", ) except requests.exceptions.ConnectionError: print( f"[{filenum}] Uploading to {room.name} | ERROR: Connection timed out!", end="\r", ) except ConnectionError: print( f"[{filenum}] Uploading to {room.name} | ERROR: Connection timed out!", end="\r", ) if file_id: print("") print( f"[{filenum}] {file.split('/')[-1]} uploaded to https://volafile.org/get/{file_id}/" ) else: print("") class CallbackInfo: def __init__(self, name, num, room): self.name = name self.num = num self.room = room.name def __call__(self, current, total): print( f"[{self.num}] Uploading to {self.room} | {self.name} -> {current / (1024 * 1024.0):.2f}MB/{total / (1024 * 1024.0):.2f}MB -> {float(current) / total:.2%} completed!", end="\r", ) def parse_args(): """Parses user arguments""" parser = argparse.ArgumentParser(description="volafile uploader") parser.add_argument( "--room", "-r", dest="room", type=str, required=True, help="Room name, as in https://volafile.org/r/ROOMNAME", ) parser.add_argument( "--passwd", "-p", dest="passwd", type=str, default="", help="Room password to enter the room", ) parser.add_argument( "--user", "-u", dest="user", type=str, default="", help="Overwrite for VOLAFILE_USER in config.py", ) parser.add_argument( "--userpasswd", "-up", dest="userpasswd", type=str, default="", help="Overwrite for VOLAFILE_USER_PASSWORD in config.py", ) parser.add_argument( "-f", "--files", metavar="FILE", type=str, nargs="+", help="Files/folders to upload", ) return parser.parse_args() def main(): """Main method""" args = parse_args() upload_process(args.room, args.passwd, args.user, args.userpasswd, args.files) if __name__ == "__main__": main()
997,770
6632e5c001ef557b19e1e5585ef78101f707c531
import builtins import difflib import inspect import os # Hack that modifies the built-in `open` function in such a way that # an assignment can be done even at other places than the server. def find_filename(filename): if os.path.exists(filename): return filename path = os.path.dirname(inspect.getfile(inspect.currentframe())) path = os.path.join(path, os.path.basename(filename)) if os.path.exists(path): return path return filename old_open = builtins.open def new_open(filename, mode='r', buffering=-1, encoding=None, errors=None, newline=None, closefd=True, opener=None): return old_open(find_filename(filename), mode, buffering, encoding, errors, newline, closefd, opener) builtins.open = new_open # Lab code proper def _diff(gold_tokens, pred_tokens): """Iterator over pairs describing longest differing subsequences within `gold_tokens` and `pred_tokens`. """ matcher = difflib.SequenceMatcher(None, gold_tokens, pred_tokens) a_lo = b_lo = 0 for a_hi, b_hi, n in matcher.get_matching_blocks(): if a_lo < a_hi or b_lo < b_hi: yield gold_tokens[a_lo:a_hi], pred_tokens[b_lo:b_hi] a_lo = a_hi + n b_lo = b_hi + n def diff(gold_tokens, pred_tokens): """Return a list of pairs describing longest differing subsequences within `gold_tokens` and `pred_tokens`. """ return list(_diff(gold_tokens, pred_tokens)) def _n_matches(gold_tokens, pred_tokens): """Return the number of elements that match within `gold_tokens` and `pred_tokens`. """ matcher = difflib.SequenceMatcher(None, gold_tokens, pred_tokens) return sum(match.size for match in matcher.get_matching_blocks()) def n_errors(gold_tokens, pred_tokens): """Return the number of errors in the tokenization given by `pred_tokens`, relative to the gold-standard tokenization given by `gold_tokens`. """ return len(gold_tokens) + len(pred_tokens) - 2 * _n_matches(gold_tokens, pred_tokens) def precision(gold_tokens, pred_tokens): """Return the precision of the tokenization given by `pred_tokens`, relative to the gold-standard tokenization given by `gold_tokens`. """ n_pred_tokens = len(pred_tokens) n_matches = _n_matches(gold_tokens, pred_tokens) return n_matches / n_pred_tokens if n_pred_tokens > 0 else float('NaN') def recall(gold_tokens, pred_tokens): """Return the recall of the tokenization given by `pred_tokens`, relative to the gold-standard tokenization given by `gold_tokens`. """ n_gold_tokens = len(gold_tokens) n_matches = _n_matches(gold_tokens, pred_tokens) return n_matches / n_gold_tokens if n_gold_tokens > 0 else float('NaN')
997,771
cd08d727c9ca3cbed23a15773da5c18b04a3d9b4
rule abundance: input: assembly=RESULTS + "/assemblies/{sample}_trinity.Trinity.fasta", fwd=RESULTS + "/fastq_trimmed/{sample}.1.trimmed.fastq", rev=RESULTS + "/fastq_trimmed/{sample}.2.trimmed.fastq", map=RESULTS + "/assemblies/{sample}_trinity.Trinity.fasta.gene_trans_map" output: check=RESULTS + "/quantification/{sample}.ok", #salmon_dir=directory(RESULTS + "/quantification/{sample}"), quant=RESULTS + "/quantification/{sample}/quant.sf" log: RESULTS + "/logs/quant/{sample}.quant.log" params: method="--est_method salmon", type="--seqType fq", prep="--prep_reference", #options="--validateMappings", outdir=RESULTS + "/quantification/{sample}" shell: "/home/progs/trinityrnaseq-v2.11.0/util/align_and_estimate_abundance.pl " "--transcripts {input.assembly} {params.type} --left {input.fwd} --right {input.rev} " "{params.method} --gene_trans_map {input.map} {params.prep} " "--output {params.outdir} 2> {log} && touch {output.check}"
997,772
a33ab7900b04782b3b1f27487d55fe25475d4d24
#Favorite Genres #https://leetcode.com/discuss/interview-question/373006 def initialize(): userSongs = { "David": ["song1", "song2", "song3", "song4", "song8"], "Emma": ["song5", "song6", "song7"] } songGenres = { "Rock": ["song1", "song3"], "Dubstep": ["song7"], "Techno": ["song2", "song4"], "Pop": ["song5", "song6"], "Jazz": ["song8", "song9"] } return userSongs, songGenres def favGenres(userSongs, songGenres): genreSong = {} for genre in songGenres: for song in songGenres[genre]: genreSong[song] = genre userGenres = {} for user in userSongs: genres_count = {} max = 0 for song in userSongs[user]: genre = genreSong[song] if genre in genres_count: genres_count[genre] += 1 else: genres_count[genre] = 1 if genres_count[genre] > max: max = genres_count[genre] userGenres[user] = [gen for gen,count in genres_count.items() if count == max] return userGenres if __name__ == '__main__': userSongs, songGenres = initialize() print(favGenres(userSongs, songGenres))
997,773
2dd5860d86f9c086e99b686075f347599a0a2c25
# -*- coding: utf-8 -*- """SparseRegElasticNetILC Automatically generated by Colaboratory. Original file is located at https://colab.research.google.com/drive/17Mq9jU51uZgUpvuSK3NuXbY8oxq6H_y- # Copmparing Sparse Regularization with Elastic Net with ILC Regularization ### Installations and imports """ !pip install -q git+git://github.com/deepmind/optax.git !pip install -q git+https://github.com/deepmind/dm-haiku from typing import Any, Generator, Mapping, Tuple from absl import app import haiku as hk import jax import jax.numpy as jnp import numpy as np import optax import tensorflow as tf import tensorflow_datasets as tfds from optax._src import transform from jax import jit, grad, vmap from jax.tree_util import tree_structure import matplotlib.pyplot as plt import seaborn as sns from sklearn.metrics import confusion_matrix from sklearn.metrics import precision_recall_fscore_support from matplotlib.pyplot import figure """### AND-mask optax class definition""" class ANDMaskState(optax.OptState): """Stateless.""" # Following optax code style def and_mask(agreement_threshold: float) -> optax.GradientTransformation: def init_fn(_): # Required by optax return ANDMaskState() def update_fn(updates, opt_state, params=None): def and_mask(update): # Compute the masked gradients for a single parameter tensor mask = jnp.abs(jnp.mean(jnp.sign(update), 0)) >= agreement_threshold mask = mask.astype(jnp.float32) avg_update = jnp.mean(update, 0) mask_t = mask.sum() / mask.size update = mask * avg_update * (1. / (1e-10 + mask_t)) return update del params # Following optax code style # Compute the masked gradients over all parameters # jax.tree_map maps a function (lambda function in this case) over a pytree to produce a new pytree. updates = jax.tree_map(lambda x: and_mask(x), updates) return updates, opt_state return transform.GradientTransformation(init_fn, update_fn) """ ### Sparse Logistic Regression Function (For reusability) """ OptState = Any Batch = Mapping[str, np.ndarray] def sparse_logistic_regression(train=None, test=None, adam_lr=1e-3, agreement_threshold=0.0, use_ilc=False, l1_coef=1e-5, l2_coef=1e-4, epochs=10001, Verbose=False, n_classes=10, normalizer=255., training=True): training_accs = [] testing_accs = [] def net_fn(batch) -> jnp.ndarray: x = jnp.array(batch, jnp.float32) / normalizer mlp = hk.Sequential([ hk.Flatten(), hk.Linear(n_classes), ]) return mlp(x) # Make the network and optimiser. net = hk.without_apply_rng(hk.transform(net_fn)) # Training loss (cross-entropy). def loss(params: hk.Params, batch, label) -> jnp.ndarray: """Compute the loss of the network, including L2.""" logits = net.apply(params, batch) labels = jax.nn.one_hot(label, n_classes) # Cross Entropy Loss softmax_xent = -jnp.sum(labels * jax.nn.log_softmax(logits)) softmax_xent /= labels.shape[0] return softmax_xent # Regularization loss (L1,L2). def regularization_loss(params: hk.Params) -> jnp.ndarray: """Compute the regularization loss of the network, applied after ILC.""" # L1 Loss sum_in_layer = lambda p: jnp.sum(jnp.abs(p)) sum_p_layers = [sum_in_layer(p) for p in jax.tree_leaves(params)] l1_loss = sum(sum_p_layers) # L2 Loss l2_loss = 0.5 * sum(jnp.sum(jnp.square(p)) for p in jax.tree_leaves(params)) return l2_coef * l2_loss + l1_coef * l1_loss @jax.jit def gradient_per_sample(params, batch, label): batch, label = jnp.expand_dims(batch,1), jnp.expand_dims(label,1) return vmap(grad(loss), in_axes=(None, 0, 0))(params, batch, label) gradient = jax.jit(grad(loss)) gradient_reg = jax.jit(grad(regularization_loss)) # Evaluation metric (classification accuracy). @jax.jit def accuracy(params: hk.Params, batch, label) -> jnp.ndarray: predictions = net.apply(params, batch) return jnp.mean(jnp.argmax(predictions, axis=-1) == label) @jax.jit def update( params: hk.Params, opt_state: OptState, batch, label, agreement ) -> Tuple[hk.Params, OptState]: """Learning rule (stochastic gradient descent).""" # grads = jax.grad(loss)(params, batch, label) # grads_masked = (gradient_per_sample if use_ilc else gradient)(params, batch, label) # (gradient_per_sample)(params, batch, label) # sum_grad_masked_regularized = jax.tree_multimap(lambda x,y:x+y,grads_masked,gradient_reg(params)) # grads = sum_grad_masked_regularized # updates, opt_state = opt.update(grads, opt_state) # new_params = optax.apply_updates(params, updates) grads_samples = gradient_per_sample(params, batch, label) ANDmask = and_mask(agreement) masked_grads,_ = ANDmask.update(grads_samples, opt_state) reg_grads = gradient_reg(params) sum_grad_masked_regularized = jax.tree_multimap(lambda x,y:x+y,masked_grads,reg_grads) updates,_ = opt.update(sum_grad_masked_regularized, opt_state) new_params = optax.apply_updates(params, updates) return new_params, opt_state # We maintain avg_params, the exponential moving average of the "live" params. # avg_params is used only for evaluation. # For more, see: https://doi.org/10.1137/0330046 @jax.jit def ema_update( avg_params: hk.Params, new_params: hk.Params, epsilon: float = 0.001, ) -> hk.Params: return jax.tree_multimap(lambda p1, p2: (1 - epsilon) * p1 + epsilon * p2, avg_params, new_params) if training is False: return net, accuracy else: if use_ilc: use_ilc = False opt = optax.chain(optax.adam(adam_lr) # ,optax.scale_by_adam() ) # Initialize network and optimiser; note we draw an input to get shapes. params = avg_params = net.init(jax.random.PRNGKey(42), next(train)['image']) opt_state = opt.init(params) # opt = optax.chain(and_mask(agreement_threshold) if use_ilc else optax.identity(),optax.adam(adam_lr)) # schedule_fn = optax.exponential_decay(adam_lr, # Note the minus sign! # 1, # 0.9) # opt = optax.chain(optax.sgd(adam_lr), optax.scale_by_schedule(schedule_fn)) # Or Adam could be used # Train/eval loop. WITHOUT ILC print("Begin training with ILC") for step in range(np.int(.5*epochs)): if step % np.int(epochs/10) == 0: # Periodically evaluate classification accuracy on train & test sets. Batch = next(train) train_accuracy = accuracy(avg_params, Batch['image'], Batch['label']) train_accuracy = jax.device_get(train_accuracy) Batch = next(test) test_accuracy = accuracy(avg_params, Batch['image'], Batch['label']) test_accuracy = jax.device_get(test_accuracy) training_accs.append(train_accuracy) testing_accs.append(test_accuracy) if Verbose: print(f"[ILC Off, Step {step}] Train accuracy/Test accuracy: " f"{train_accuracy:.3f} / {test_accuracy:.3f}.") # Do SGD on a batch of training examples. Batch = next(train) params, opt_state = update(params, opt_state, Batch['image'], Batch['label'], 0.) avg_params = ema_update(avg_params, params) use_ilc = True # Train/eval loop. WITH ILC for step in range(np.int(.5*epochs)): if step % np.int(epochs/10) == 0: # Periodically evaluate classification accuracy on train & test sets. Batch = next(train) train_accuracy = accuracy(avg_params, Batch['image'], Batch['label']) train_accuracy = jax.device_get(train_accuracy) Batch = next(test) test_accuracy = accuracy(avg_params, Batch['image'], Batch['label']) test_accuracy = jax.device_get(test_accuracy) training_accs.append(train_accuracy) testing_accs.append(test_accuracy) if Verbose: print(f"[ILC On, Step {step}] Train accuracy/Test accuracy: " f"{train_accuracy:.3f} / {test_accuracy:.3f}.") # Do SGD on a batch of training examples. Batch = next(train) params, opt_state = update(params, opt_state, Batch['image'], Batch['label'], agreement_threshold) avg_params = ema_update(avg_params, params) return params, training_accs, testing_accs else: # schedule_fn = optax.exponential_decay(adam_lr, # Note the minus sign! # 1, # 0.9) # opt = optax.chain(optax.sgd(adam_lr), optax.scale_by_schedule(schedule_fn)) # Or Adam could be used opt = optax.chain(optax.adam(adam_lr)) # Initialize network and optimiser; note we draw an input to get shapes. params = avg_params = net.init(jax.random.PRNGKey(42), next(train)[0]) opt_state = opt.init(params) use_ilc=False # Train/eval loop. print("Begin training without ILC") for step in range(np.int(epochs)): if step % np.int(epochs/10) == 0: # Periodically evaluate classification accuracy on train & test sets. Batch = next(train) train_accuracy = accuracy(avg_params, Batch['image'], Batch['label']) train_accuracy = jax.device_get(train_accuracy) Batch = next(test) test_accuracy = accuracy(avg_params, Batch['image'], Batch['label']) test_accuracy = jax.device_get(test_accuracy) training_accs.append(train_accuracy) testing_accs.append(test_accuracy) if Verbose: print(f"[ADAM, Step {step}] Train accuracy/Test accuracy: " f"{train_accuracy:.3f} / {test_accuracy:.3f}.") # Do SGD on a batch of training examples. Batch = next(train) params, opt_state = update(params, opt_state, Batch['image'], Batch['label'], 0.) avg_params = ema_update(avg_params, params) return params, training_accs, testing_accs """### Storing the resulting weights for various hyperparameters, for plotting and exploratory purposes. Change the name when you store a parameter accordingly.""" import pickle root_dir = '/content/drive/MyDrive/Mila Fall 2020/Probabilistic Graphical Models/Project/Data/' def storeData(object, file_name, root_dir): with open(root_dir+file_name, 'wb') as f: pickle.dump(object, f) f.close() def loadData(file_name, root_dir): with open(root_dir+file_name, 'rb') as f: db = pickle.load(f) f.close() return db # storeData(envs_elastic_net_params, 'envs_elastic_net_params', root_dir) # storeData(envs_ilc_params, 'envs_ilc_params_l24_agth_09_late_turn_on_ilc_before_reg', root_dir) # envs_elastic_net_params = loadData('envs_elastic_net_params_l14_l25', root_dir) # envs_ilc_params = loadData('envs_ilc_params_l24_agth_03', root_dir) # storeData(setting_overlaps, 'setting_overlaps', root_dir) # setting_overlaps = loadData('setting_overlaps', root_dir) # all_hps = loadData('all_hps', root_dir) # model, accuracy_fn = sparse_logistic_regression(training=False) """### MAIN CELL: Experimenting a range of hyperparameters""" # at = [0.2, 0.9] # ll1 = [1e-3] # ll2 = [1e-3, 1e-4] # all = [] at = [0.0, 0.2, 0.4, 0.5, 0.7, 0.9] ll1 = [1e-1, 1e-2, 1e-3] ll2 = [1e-3, 1e-4, 1e-5] all = [] n_envs = 2 ds_train_envs = [] batch_size = 10000 splits = tfds.even_splits('train', n=n_envs) for m in range(n_envs): ds = tfds.load("mnist:3.*.*", split=splits[m]).cache().repeat() ds = ds.shuffle(10 * batch_size, seed=0) ds = ds.batch(batch_size) ds_train_envs.append(iter(tfds.as_numpy(ds))) test_ds = tfds.load("mnist:3.*.*", split='test').cache().repeat() test_ds = test_ds.shuffle(10 * 10000, seed=0) test_ds = test_ds.batch(10000) test_ds= iter(tfds.as_numpy(test_ds)) round = 0 for idx, thresh in enumerate(at): for l1 in ll1: for l2 in ll2: round += 1 print('Round: ', round) envs_elastic_net_params = [] hp = {} hp['thresh'] = thresh hp['l1'] = l1 hp['l2'] = l2 hp['params'] = [] hp['training_accuracies'] = [] hp['testing_accuracies'] = [] for m in range(n_envs): print('Parameters=[l1={}, l2={}, agreement={}], Environment={}'.format(l1,l2,thresh, m)) params, train_accs, test_accs = sparse_logistic_regression(ds_train_envs[m], test_ds, adam_lr=1e-3, agreement_threshold=thresh, use_ilc=True, l1_coef=l1, l2_coef=l2, epochs=10001, Verbose=True) envs_elastic_net_params.append(params) hp['params'].append(params) hp['training_accuracies'].append(train_accs) hp['testing_accuracies'].append(test_accs) all.append(hp) # ############################## Run up to here ############################## # # all = all_hps n_envs = 2 setting_overlaps_method1 = np.zeros([len(all),10]) setting_overlaps_method2 = np.zeros([len(all),10]) num=0 for r in all: num += 1 envs_elastic_net_params = r['params'] fig, axes = plt.subplots(len(envs_elastic_net_params), 10, figsize=(16, 4), dpi=130, facecolor='w', edgecolor='k') # use global min / max to ensure all weights are shown on the same scale for m in range(n_envs): vmin, vmax = envs_elastic_net_params[m]['linear']['w'].min(), envs_elastic_net_params[m]['linear']['w'].max() for coef, ax in zip(envs_elastic_net_params[m]['linear']['w'].T, axes[m,:]): # print(coef.reshape(28, 28)[0,0]) ax.matshow(coef.reshape(28, 28), cmap=plt.cm.gray, vmin=.5 * vmin, vmax=.5 * vmax) ax.set_xticks(()) ax.set_yticks(()) ''' 1st method for calculating overlaps: map zeros to 0s, nonzeros to 1s. Get and the mappings. Sum over axis 1 and normalize: by total pixels or max # of nonzero elements. ''' c = [np.abs(envs_elastic_net_params[i]['linear']['w'].T.round(3)) > 0.0 for i in range(n_envs)] c = np.array(c) overlapping_selectors = np.logical_and(c[0],c[1]) denom = np.max(np.vstack((c[0].sum(axis=1),c[1].sum(axis=1))).T, axis=1) caps = overlapping_selectors.sum(axis=1)/denom # or /28**2 caps[~np.isfinite(caps)] = 0 caps_method1 = caps.round(3) * 100 setting_overlaps_method1[num-1] = caps_method1 ''' 2nd method for calculating overlaps: get a boolean mask for equal elements, get a boolean mask for nonzeros elements. And the masks. Sum over axis 1 and normalize: by total pixels or max # of nonzero elements. ''' c = [envs_elastic_net_params[i]['linear']['w'].T.round(3) for i in range(n_envs)] c = np.array(c) equal_mask = (c[0] == c[1]) nonzero_mask = (c[0] != 0) overlapping_selectors = np.logical_and(equal_mask,nonzero_mask) denom = np.max(np.vstack((np.count_nonzero(c[0],axis=1), np.count_nonzero(c[1],axis=1))).T,axis=1) caps = overlapping_selectors.sum(axis=1)/denom # or /28**2 caps[~np.isfinite(caps)] = 0 caps_method2 = caps.round(3) * 100 setting_overlaps_method2[num-1] = caps_method2 caps_method1[~np.isfinite(caps_method1)] = 0 caps_method1 = caps_method1.round(3) caps_method2[~np.isfinite(caps_method2)] = 0 caps_method2 = caps_method2.round(3) caps = ['m1: '+str(c1) +', m2: '+str(c2) for c1,c2 in zip(caps_method1,caps_method2)] # rows = np.array(r['acc']).round(3) # rows = ['in: '+str(c1) +', out: '+str(c2) for c1,c2 in zip(np.array(r['acc']).round(3),np.array(r['test_accuracy']).round(3))] rows = np.array(r['test_accuracy']).round(3) for ax, col in zip(axes[0], caps): ax.set_title(col,{'fontsize': 8}) for ax, row in zip(axes[:,0], rows): ax.set_ylabel(row) one = r['thresh'] two = r['l1'] three = r['l2'] plt.suptitle('ILC Regularization, Agreement Threshold={}, l1 coefficient={}, l2 coefficient={}'.format(one,two,three)) plt.savefig(f'{num}.png') plt.show() """### Plots for the whole run""" # NOTE: "all_hps", and "setting_overlaps" should be loaded from your local drive # (I uploaded them along with the zip file) import pickle root_dir = '/' def storeData(object, file_name, root_dir): with open(root_dir+file_name, 'wb') as f: pickle.dump(object, f) f.close() def loadData(file_name, root_dir): with open(root_dir+file_name, 'rb') as f: db = pickle.load(f) f.close() return db # storeData(setting_overlaps, 'setting_overlaps', root_dir) setting_overlaps = loadData('setting_overlaps', root_dir) all_hps = loadData('all_hps', root_dir) # There are 54 settings for hps, for each we need to extract the thresh and l1 # for fixed vals of l2. This function does that. def idx_extrct(env_idx): agreement = all_hps[env_idx]['thresh'] l1_coef = all_hps[env_idx]['l1'] return agreement, l1_coef print(setting_overlaps.shape) """ coordinate_1 is a list of dictionaries, each dictionary corresponds to a digit so coordinate_1 is a list of 10 dictionaries. Each dictionary holds these keys: 'digit', 'x', 'y', 'z'. 'digit' is obvious. 'x','y','z' hold the values for 3d plots, so 'x' holds 18 values for agreement thresholds, 'y' 18 vals for log of l1 coefs, 'z' 18 vals for overlap scores. Why 18? Remember that our hps are these: at = [0.0, 0.2, 0.4, 0.5, 0.7, 0.9] ll1 = [1e-1, 1e-2, 1e-3] ll2 = [1e-3, 1e-4, 1e-5] so 6 possible vals for at, 3 for l1, 3 for l2. In total there are 6x3x3=54 configs. But when l2 is fixed (3D plots are for fixed l2), there remain 6x3=18 combination of values for agreement and thresh. That's why 'x','y','z' have 18 elements for each digit in coordinate_1. Now coordinate_1 holds the dicts for l2=0.001. The same goes for coordinates_2 and coordinates_3. They hold the the coordinates for digits in settings where l2=1e-4 and l2=1e-5, respectively. """ # There are 54 envs. # threshold coordinates_1 = [] coordinates_2 = [] coordinates_3 = [] for digit in range(10): x_1 = [] y_1 = [] z_1 = [] x_2 = [] y_2 = [] z_2 = [] x_3 = [] y_3 = [] z_3 = [] for counter, hp in enumerate(all_hps): # l2 coef = 0.001 if np.mod(counter,3) == 0: thresh, l1 = idx_extrct(counter) x_1.append(thresh) y_1.append(np.log10(l1)) z_1.append(setting_overlaps[counter, digit]) # l2 coef = 1e-4 if np.mod(counter,3) == 1: thresh, l1 = idx_extrct(counter) x_2.append(thresh) y_2.append(np.log10(l1)) z_2.append(setting_overlaps[counter, digit]) # l2 coef = 1e-5 if np.mod(counter,3) == 2: thresh, l1 = idx_extrct(counter) x_3.append(thresh) y_3.append(np.log10(l1)) z_3.append(setting_overlaps[counter, digit]) coordinates_1.append({'digit': digit, 'x':x_1,'y':y_1,'z':z_1}) coordinates_2.append({'digit': digit, 'x':x_2,'y':y_2,'z':z_2}) coordinates_3.append({'digit': digit, 'x':x_3,'y':y_3,'z':z_3}) """ Getting the coordinates for plotting test accuracies""" # There are 54 envs. # threshold coordinates_test_1 = [] coordinates_test_2 = [] coordinates_test_3 = [] x_1 = [] y_1 = [] z_1 = [] x_2 = [] y_2 = [] z_2 = [] x_3 = [] y_3 = [] z_3 = [] for counter, hp in enumerate(all_hps): # l2 coef = 0.001 if np.mod(counter,3) == 0: thresh, l1 = idx_extrct(counter) x_1.append(thresh) y_1.append(np.log10(l1)) z_1.append(jax.device_get(hp['test_accuracy_avg'])) # l2 coef = 1e-4 if np.mod(counter,3) == 1: thresh, l1 = idx_extrct(counter) x_2.append(thresh) y_2.append(np.log10(l1)) z_2.append(jax.device_get(hp['test_accuracy_avg'])) # l2 coef = 1e-5 if np.mod(counter,3) == 2: thresh, l1 = idx_extrct(counter) x_3.append(thresh) y_3.append(np.log10(l1)) z_3.append(jax.device_get(hp['test_accuracy_avg'])) coordinates_test_1 = {'l2': 1e-3, 'x':x_1,'y':y_1,'z':z_1} coordinates_test_2 = {'l2': 1e-4, 'x':x_2,'y':y_2,'z':z_2} coordinates_test_3 = {'l2': 1e-5, 'x':x_3,'y':y_3,'z':z_3} colors = dict(mcolors.BASE_COLORS, **mcolors.CSS4_COLORS) print(colors) import plotly.express as px import pandas as pd import plotly.graph_objs as go from plotly.subplots import make_subplots # import plotly.plotly as py # import plotly.tools as tls # from plotly.graph_objs import * ########## l2=0.001 ########## # np_data = [] # df_digits = [] fig = go.Figure() colors = ["brown","blue","orange","green","magenta","cyan","yellow","violet","skyblue","cornflowerblue"] # "blue" if digit == 7 else "red" for digit in [7,8]: # This is to show that you can plot the evolution of whatever digits you want. for m in range(3): x = [coordinates_1[digit]['x'][n] for n in range(18) if np.mod(n,3) == m] y = [coordinates_1[digit]['y'][n] for n in range(18) if np.mod(n,3) == m] z = [coordinates_1[digit]['z'][n] for n in range(18) if np.mod(n,3) == m] fig.add_trace(go.Scatter3d(x=x, y=y, z=z, mode='lines', line=dict(color=colors[digit]), name=str(digit))) fig.update_layout(scene = dict( xaxis_title='Agreement Threshold', yaxis_title='Log L1 Coef', zaxis_title='Overlap Score'), width=700, margin=dict(r=20, b=10, l=10, t=10)) fig.update_layout(title_text='Salam', title_font_size=10) fig.show() fig = go.Figure() for digit in range(10): # This is to show that you can plot the evolution of whatever digits you want. for m in range(3): x = [coordinates_1[digit]['x'][n] for n in range(18) if np.mod(n,3) == m] y = [coordinates_1[digit]['y'][n] for n in range(18) if np.mod(n,3) == m] z = [coordinates_1[digit]['z'][n] for n in range(18) if np.mod(n,3) == m] fig.add_trace(go.Scatter3d(x=x, y=y, z=z, mode='lines', line=dict(color=colors[digit]), name=str(digit))) fig.update_layout(scene = dict( xaxis_title='Agreement Threshold', yaxis_title='Log L1 Coef', zaxis_title='Overlap Score'), width=700, margin=dict(r=20, b=10, l=10, t=10)) fig.show() # ------------------------ # fig = go.Figure() for m in range(3): x = [coordinates_test_1['x'][n] for n in range(18) if np.mod(n,3) == m] y = [coordinates_test_1['y'][n] for n in range(18) if np.mod(n,3) == m] z = [coordinates_test_1['z'][n][0].item()*100 for n in range(18) if np.mod(n,3) == m] # print(x) # print(y) # print(z) # break fig.add_trace(go.Scatter3d(x=x, y=y, z=z, mode='lines' # , line=dict(color="blue" if digit == 7 else "red") )) fig.update_layout(scene = dict( xaxis_title='Agreement Threshold', yaxis_title='Log L1 Coef', zaxis_title='Test Accuracy'), width=700, margin=dict(r=20, b=10, l=10, t=10)) fig.show() # ########## l2=1e-4 ########## for digit in range(10): # This is to show that you can plot the evolution of whatever digits you want. for m in range(3): x = [coordinates_2[digit]['x'][n] for n in range(18) if np.mod(n,3) == m] y = [coordinates_2[digit]['y'][n] for n in range(18) if np.mod(n,3) == m] z = [coordinates_2[digit]['z'][n] for n in range(18) if np.mod(n,3) == m] fig.add_trace(go.Scatter3d(x=x, y=y, z=z, mode='lines', line=dict(color=colors[digit]), name=str(digit))) fig.update_layout(scene = dict( xaxis_title='Agreement Threshold', yaxis_title='Log L1 Coef', zaxis_title='Overlap Score'), width=700, margin=dict(r=20, b=10, l=10, t=10)) fig.show() # fig = go.Figure() # for digit in range(10): # fig.add_trace(go.Scatter3d(x=coordinates_2[digit]['x'], y=coordinates_2[digit]['y'], z=coordinates_2[digit]['z'], mode='markers'))#(df_digits[digit], x='agreement', y='log l1', z='overlap')) # fig.update_layout(scene = dict( # xaxis_title='Agreement Threshold', # yaxis_title='Log L1 Coef', # zaxis_title='Overlap Score'), # width=700, # margin=dict(r=20, b=10, l=10, t=10)) # fig.show() fig = go.Figure() for m in range(3): x = [coordinates_test_2['x'][n] for n in range(18) if np.mod(n,3) == m] y = [coordinates_test_2['y'][n] for n in range(18) if np.mod(n,3) == m] z = [coordinates_test_2['z'][n][0].item()*100 for n in range(18) if np.mod(n,3) == m] fig.add_trace(go.Scatter3d(x=x, y=y, z=z, mode='lines' # , line=dict(color="blue" if digit == 7 else "red") )) fig.update_layout(scene = dict( xaxis_title='Agreement Threshold', yaxis_title='Log L1 Coef', zaxis_title='Test Accuracy'), width=700, margin=dict(r=20, b=10, l=10, t=10)) fig.show() # ########## l2=1e-5 ########## for digit in range(10): # This is to show that you can plot the evolution of whatever digits you want. for m in range(3): x = [coordinates_3[digit]['x'][n] for n in range(18) if np.mod(n,3) == m] y = [coordinates_3[digit]['y'][n] for n in range(18) if np.mod(n,3) == m] z = [coordinates_3[digit]['z'][n] for n in range(18) if np.mod(n,3) == m] fig.add_trace(go.Scatter3d(x=x, y=y, z=z, mode='lines', line=dict(color=colors[digit]), name=str(digit))) fig.update_layout(scene = dict( xaxis_title='Agreement Threshold', yaxis_title='Log L1 Coef', zaxis_title='Overlap Score'), width=700, margin=dict(r=20, b=10, l=10, t=10)) fig.show() # fig = go.Figure() # for digit in range(10): # fig.add_trace(go.Scatter3d(x=coordinates_3[digit]['x'], y=coordinates_3[digit]['y'], z=coordinates_3[digit]['z'], mode='markers'))#(df_digits[digit], x='agreement', y='log l1', z='overlap')) # fig.update_layout(scene = dict( # xaxis_title='Agreement Threshold', # yaxis_title='Log L1 Coef', # zaxis_title='Overlap Score'), # width=700, # margin=dict(r=20, b=10, l=10, t=10)) # fig.show() fig = go.Figure() for m in range(3): x = [coordinates_test_3['x'][n] for n in range(18) if np.mod(n,3) == m] y = [coordinates_test_3['y'][n] for n in range(18) if np.mod(n,3) == m] z = [coordinates_test_3['z'][n][0].item()*100 for n in range(18) if np.mod(n,3) == m] fig.add_trace(go.Scatter3d(x=x, y=y, z=z, mode='lines' # , line=dict(color="blue" if digit == 7 else "red") )) fig.update_layout(scene = dict( xaxis_title='Agreement Threshold', yaxis_title='Log L1 Coef', zaxis_title='Test Accuracy'), width=700, margin=dict(r=20, b=10, l=10, t=10)) fig.show()
997,774
2e5ab912cc4c6852e5a571518f6a0d6dcd013d2d
# modified from code at https://docs.ocean.dwavesys.com/en/stable/examples/map_coloring_full_code.html import dwavebinarycsp from neal import SimulatedAnnealingSampler from dwave.system import DWaveSampler, EmbeddingComposite import networkx as nx import matplotlib.pyplot as plt from datetime import datetime import pickle from pprint import pprint import hybrid hybrid.logger.setLevel(hybrid.logging.DEBUG) def backup(expName, samples): with open("data/"+expName + str(datetime.now()), "wb") as f: pickle.dump(samples, f) wa_out = "{2, 3, 4, 5} | {1, 3} | {1, 2, 5, 31, 32} | {1, 5, 6, 7} | {1, 3, 4, 6, 8, 27, 31, 42} | {4, 5, 7, 8, 9, 10} | {4, 6, 10} | {5, 6, 9, 18, 19, 33, 34, 42} | {6, 8, 10, 13, 17, 18} | {6, 7, 9, 13} | {12, 13, 14, 15} | {11, 14, 16} | {9, 10, 11, 17} | {11, 12, 15, 16, 38} | {11, 14, 17, 20, 38} | {12, 14, 38, 40} | {9, 13, 15, 18, 19, 20} | {8, 9, 17, 19} | {8, 17, 18, 20, 33, 36} | {15, 17, 19, 36, 38, 39} | {22, 23, 24} | {21, 23, 24, 46, 47} | {21, 22, 29, 30, 47} | {21, 22} | {26, 27} | {25, 27, 28, 30, 45} | {5, 25, 26, 31, 42, 45} | {26, 29, 30} | {23, 28, 30} | {23, 26, 28, 29, 44, 45} | {3, 5, 27, 32} | {3, 31} | {8, 19, 34, 35, 36, 37} | {8, 33, 37, 41, 42} | {33, 36, 37, 49} | {19, 20, 33, 35, 39, 49} | {33, 34, 35, 43} | {14, 15, 16, 20, 39, 40} | {20, 36, 38, 49} | {16, 38} | {34, 42, 43, 44} | {5, 8, 27, 34, 41, 44, 45} | {37, 41, 44} | {30, 41, 42, 43, 45} | {26, 27, 30, 42, 44} | {22, 47, 48} | {22, 23, 46} | {46} | {35, 36, 39}".replace(" ","") wa_singlets = wa_out.split("|") cleaned = [] for singlet in wa_singlets: cleaned.append(singlet.replace("{","").replace("}","").split(",")) #print(cleaned) vertices = [] for i in range(1,len(wa_singlets)+1): vertices.append(str(i)) #print(vertices) edges = [] for i in range(0, len(cleaned)): for j in range(len(cleaned[i])): edges.append((str(i+1), cleaned[i][j])) #print(edges) def not_same_color(v,u): return not (v and u) one_hot_encoding = {(0,0,0,1), (0,0,1,0), (0,1,0,0), (1,0,0,0)} colors = len(one_hot_encoding) def plot_map(sample): G = nx.Graph() G.add_nodes_from(vertices) G.add_edges_from(edges) # Translate from binary to integer color representation color_map = {} for state in vertices: for i in range(colors): if sample[state+"_"+str(i)]: color_map[state] = i # Plot the sample with color-coded nodes node_colors = [color_map.get(node) for node in G.nodes()] nx.draw_planar(G, with_labels=True, node_color=node_colors, node_size=10, cmap=plt.cm.rainbow) plt.savefig("out.png") csp = dwavebinarycsp.ConstraintSatisfactionProblem(dwavebinarycsp.BINARY) for state in vertices: variables = [state+"_"+str(i) for i in range(colors)] csp.add_constraint(one_hot_encoding, variables) for neighbor in edges: v,u = neighbor for i in range(colors): variables = [v+"_"+str(i), u+"_"+str(i)] csp.add_constraint(not_same_color, variables) bqm = dwavebinarycsp.stitch(csp) workflow = hybrid.Loop( hybrid.RacingBranches( hybrid.InterruptableTabuSampler(max_time=0), hybrid.EnergyImpactDecomposer(size=100, rolling=True, rolling_history=0.3) | hybrid.QPUSubproblemAutoEmbeddingSampler(num_reads=1)| hybrid.SplatComposer() )| hybrid.ArgMin() , convergence=3 ) result = hybrid.HybridSampler(workflow).sample(bqm) hybrid.Unwind(workflow) print("Solution: sample={}".format(result.first)) hybrid.print_structure(workflow) print("-----------------------") hybrid.print_counters(workflow)
997,775
fe885f9ba22f347dd4351a3eb6bc21fc51657978
fromnetid = 0.6642 rejectmin = 0.99 * fromnetid rejectlimit = rejectmin + 0.01 f = open('edges.txt', 'r') fo = open('edges-output.txt', 'w') count = 0 #PR = float((1.0/685229.0)*(1.0-0.85)) PR = float(1.0/685230.0) print PR prevdata = 0 degree = 0 list_output = '' prevdata1 = 0 flag = 0 tab = '\t' delim = '\t' edge_count = 0 for line in f: line1 = ' '.join(line.split()) data = line1.split(' ') if len(data) < 3: print "fucked!" if not(((float(data[2]) >= float(rejectmin)) and (float(data[2]) < float(rejectlimit)))): edge_count = edge_count + 1 if (int(data[0]) == int(prevdata)): degree += 1 list_output += data[1]+delim continue elif degree == 0: list_output += str(prevdata1)+delim degree = 1 output = str(prevdata)+tab+str(PR)+delim+str(degree)+delim+list_output+"\n" #print str(output) fo.write(str(output)) prevdata = data[0] prevdata1 = data[1] degree = 0 list_output = '' if degree == 0: output = str(data[0])+tab+str(PR)+delim+str(degree+1)+delim+str(data[1]) else: output = str(data[0])+tab+str(PR)+delim+str(degree)+delim+"\n" #print str(output) fo.write(str(output)) print "edge count is" print edge_count f.close() fo.close()
997,776
0d7f3acce257f314a5e3e67a87e636a012b44573
class Time(object): """Time of day.attributes: hour, minute, second""" t1 = Time() t1.hour = 11 t1.minute = 59 t1.second = 30 t2 = Time() t2.hour = 10 t2.minute = 45 t2.second = 25 def is_after(t1, t2): t1_total_seconds = (t1.hour * 3600) + (t1.minute * 60) + t1.second t2_total_seconds = (t2.hour * 3600) + (t2.minute * 60) + t2.second return t1_total_seconds > t2_total_seconds print(is_after(t1, t2))
997,777
0e52356e89e04ac83da42c77eba76e39d1134d1a
from datetime import datetime from django.shortcuts import render, redirect, get_object_or_404 , reverse from django.contrib.auth.decorators import login_required from django.views.generic import ListView, DetailView from django.db.models import Q from django.http import JsonResponse from django.core.paginator import Paginator import json from django.core import serializers from .models import * from .models import Book # Create your views here. @login_required def profile(request): order = Order.objects.get(user=request.user, order_completion_status=False) context = {'order':order} return render(request, 'profile.html', context) def about(request): try: order = Order.objects.get(user=request.user, order_completion_status=False) context = {'order':order} except: context = {} return render(request, 'about.html', context) @login_required def read(request, pk): book1 = Book.objects.get(id=pk) books_bought = [] orders = Order.objects.filter(user=request.user) for order in orders: if order.order_completion_status: orderitems = order.orderitem_set.all() bought = [item.book.id for item in orderitems] books_bought +=bought if pk in books_bought: context = {'book':book1} return render(request, 'read.html', context) else: context = {'id':pk} return render(request, 'no_permisson.html', context) @login_required def books(request): books = Book.objects.all() books_bought = [] try: orders = Order.objects.filter(user=request.user) for order in orders: if order.order_completion_status: orderitems = order.orderitem_set.all() bought = [item.book.id for item in orderitems] books_bought += bought orders_ongo, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) except: orders_ongo, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) context = {'books':books, 'order':orders_ongo, 'books_bought':books_bought} return render(request, 'books/book_list.html', context) # class BooksListView(ListView): # model = Book # context_object_name = "books" # def get_context_data(self, **kwargs): # user = get_user_model() # order, created = Order.objects.get_or_create(user=user.username,order_completion_status=False) # context = super(BooksListView, self).get_context_data(**kwargs) # context.update({'get_total_cart_items':order.get_total_cart_items}) # return context @login_required def detail(request, pk): book = Book.objects.get(id=pk) books_bought = [] try: orders = Order.objects.filter(user=request.user, order_completion_status=True) for order in orders: orderitems = order.orderitem_set.all() # book_detail = bought = [item.book.id for item in orderitems] books_bought += bought orders, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) except: orders, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) context = {'book':book, 'order':orders, 'books_bought':books_bought} return render(request, 'books/book_detail.html', context) # class BooksDetailView(DetailView): # model = Book # context_object_name = "book" @login_required def add_to_cart(request, operation, pk): user = request.user book = get_object_or_404(Book, id=pk) order, created = Order.objects.get_or_create(user=user,order_completion_status=False) orderItem, created = OrderItem.objects.get_or_create(book=book, order=order) # orderItem.quantity +=1 # orderItem.save() if operation=="add" or operation=="addition": orderItem.quantity +=1 elif operation =="remove": orderItem.quantity -=1 elif operation =="delete": orderItem.quantity = 0 orderItem.save() if orderItem.quantity <=0: orderItem.delete() if operation=="addition": return redirect('book-list') else: return redirect('checkout') @login_required def add_to_cart_ajax(request): data = json.loads(request.body) pk= data['itemid'] operation = data['operation'] user = request.user book = get_object_or_404(Book, id=pk) order, created = Order.objects.get_or_create(user=user,order_completion_status=False) orderItem, created = OrderItem.objects.get_or_create(book=book, order=order) # orderItem.quantity +=1 # orderItem.save() if operation=="add" or operation=="addition": orderItem.quantity +=1 elif operation =="remove": orderItem.quantity -=1 elif operation =="delete": orderItem.quantity = 0 orderItem.save() if orderItem.quantity <=0: orderItem.delete() cartvalue = {'cartItem':orderItem.quantity, 'total_cart_items':order.get_total_cart_items} print(cartvalue) return JsonResponse(cartvalue,safe=False) def books_not_bought(user): books = Book.objects.all() all_books_ids = [book for book in books] books_not_bought = [] books_bought = [] try: orders = Order.objects.filter(user=user, order_completion_status=True) for order in orders: orderitems = order.orderitem_set.all() bought = [item.book.id for item in orderitems] books_bought += bought for book in all_books_ids: if book.id in books_bought: continue else: books_not_bought.append(book) return books_not_bought except: pass return True @login_required def checkout(request): user=request.user books_not_bought_list = books_not_bought(user) paginator= Paginator(books_not_bought_list, 3) books = Book.objects.all() order, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) orderItems = order.orderitem_set.all() # paginator= Paginator(books_not_bought_list, 3) # print('books', paginator.count) page = paginator.page(1) context = {'orderItems':orderItems, 'order':order, 'books':books , 'page':page} details = {} if request.method == "POST": for page in paginator.page_range: book = paginator.page(page) book_data = book.object_list[0] details[page]={'id':book_data.id, 'image':book_data.image.url} if page == 1: details['prev']=False else: details['prev']=True if page == paginator.num_pages: details['next']=False else: details['next']=True page_data = json.loads(request.body) # pages = serializers.serialize('json', [page,]) page_info = {'page':details} print('bookssssssssssssssssssss', page_data) return JsonResponse(page_info,safe=False) return render(request, 'checkout.html', context) @login_required def payment(request): books = Book.objects.all() order, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) orderItems = order.orderitem_set.all() context = {'orderItems':orderItems, 'order':order} if request.method == "POST": # order, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) order.order_completion_status = True order.date_of_order=datetime.now() order.save() # alert("Payment Success!!") return redirect('book-list') return render(request, 'payment.html', context) @login_required def completed_orders(request): orderItems = [] ongoing_order, craeted = Order.objects.get_or_create(user=request.user, order_completion_status=False) orders = Order.objects.filter(user=request.user, order_completion_status=True) for order in orders: orderItemset = order.orderitem_set.all() for Items in orderItemset: orderItems.append(Items) # orderItems = [order.orderitem_set.all() for order in orders] context = {'orderItems':orderItems, 'order':ongoing_order} return render(request, 'completed_orders.html', context) # class SearchResultsView(ListView): # model = Book # template_name = "search_results.html" # context_object_name = 'search_book_results' # def get_queryset(self): # query = self.request.GET['val1'] # return Book.objects.filter(title__icontains=query ) @login_required def search(request): query = request.GET['search_value'] books = Book.objects.filter(Q(title__icontains = query) | Q(author__icontains = query) ) books_bought = [] try: orders = Order.objects.filter(user=request.user) for order in orders: if order.order_completion_status: orderitems = order.orderitem_set.all() bought = [item.book.id for item in orderitems] books_bought += bought orders, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) except: orders, created = Order.objects.get_or_create(user=request.user,order_completion_status=False) context = {'books':books, 'order':orders, 'books_bought':books_bought} return render(request, 'search_results.html', context) # def error_handler(request): # return redirect('book-list') def error_404_view(request, execption): return render(request, 'error_404.html') def error_handler(request, execption, template_name="error_404.html"): response.status_code=404 return response
997,778
1954623bcfbd08f7cd9d9af53593217ae861cfd5
"""Repeating a beat in a loop.""" __author__ = "730330944" # Begin your solution here... beat: str = input("What beat do you want to repeat? ") beat_repeat: str = beat repeat: int = int(input("How many times do you want to repeat it? ")) if(repeat <= 0): print("No beat...") else: while repeat-1 > 0: beat_repeat += " " + beat repeat -= 1 print(beat_repeat)
997,779
fb1163e6c30966a80510663a25758826e99d75b3
from __future__ import print_function, unicode_literals from clckwrkbdgr import unittest from clckwrkbdgr.unittest import mock import os import mimetypes from .. import webserver class MockPopen(object): def __init__(self, rc, stdout, stderr): self.rc = rc self.stdout = stdout self.stderr = stderr def communicate(self, stdin): return self.stdout, self.stderr def wait(self): return self.rc class TestWebResponses(unittest.fs.TestCase): def setUp(self): self.setUpPyfakefs(modules_to_reload=[webserver]) self.fs.create_dir('/data') def should_prepare_base_response(self): response = webserver.Response(200, b'content', content_type='text/html', content_encoding='utf-8') self.assertEqual(response.get_code(), 200) self.assertEqual(response.get_content(), b'content') self.assertEqual(response.get_headers(), {'Content-Type':'text/html', 'Content-Encoding':'utf-8'}) def should_prepare_response_from_file(self): self.fs.create_file('/data/file.md', contents='content') response = webserver.FileContentResponse(200, '/data/file.md', content_type='text/html', content_encoding='utf-8') self.assertEqual(response.get_code(), 200) self.assertEqual(response.get_content(), b'content') self.assertEqual(response.get_headers(), {'Content-Type':'text/html', 'Content-Encoding':'utf-8'}) with open('/data/file.md', 'w') as f: f.write('content') response = webserver.FileContentResponse(200, '/data/file.md') self.assertEqual(response.get_code(), 200) self.assertEqual(response.get_content(), b'content') expected_content_type, _ = mimetypes.guess_type('/data/file.md') self.assertEqual(response.get_headers(), {'Content-Type':expected_content_type or 'text/plain'}) self.fs.create_file('/data/file.jpg', contents='content') response = webserver.FileContentResponse(200, '/data/file.jpg') self.assertEqual(response.get_code(), 200) self.assertEqual(response.get_content(), b'content') self.assertEqual(response.get_headers(), {'Content-Type':'image/jpeg'}) self.fs.create_file('/data/file.html', contents='<html><head><meta http-equiv="content-type" content="text/html; charset=utf-8"></head><body></body>') response = webserver.FileContentResponse(200, '/data/file.html') self.assertEqual(response.get_code(), 200) self.assertEqual(response.get_content(), b'<html><head><meta http-equiv="content-type" content="text/html; charset=utf-8"></head><body></body>') self.assertEqual(response.get_headers(), {'Content-Type':'text/html'}) @mock.patch('subprocess.Popen', side_effect=[ MockPopen(0, b'CONTENT' + os.linesep.encode(), b''), MockPopen(1, b'', b'ERROR'), ]) @mock.patch('clckwrkbdgr.webserver.base_log_message') def should_prepare_cgi_response(self, base_log_message, popen): self.fs.create_file('/data/file.md', contents='content') response = webserver.CGIResponse(200, '/data/file.md', 'python -c "import six; print(six.moves.input().upper())"') self.assertEqual(response.get_code(), 200) self.assertEqual(response.get_content(), b'CONTENT' + os.linesep.encode()) self.assertEqual(response.get_headers(), {'Content-Type':'text/html', 'Content-Encoding':'utf-8'}) response = webserver.CGIResponse(200, '/data/file.md', 'unknown_command') self.assertEqual(response.get_code(), 200) self.assertEqual(response.get_content(), b'') self.assertEqual(response.get_headers(), {'Content-Type':'text/html', 'Content-Encoding':'utf-8'}) base_log_message.assert_has_calls([ mock.call('CGI process exited with %d', 1), mock.call('Error during processing CGI:\n%s', str(b'ERROR')), ])
997,780
d454e80535c7a702d97acc28eaf387ed0713e938
""" Tests for ParserNode interface """ import sys import pytest from certbot_apache._internal import interfaces from certbot_apache._internal import parsernode_util as util class DummyParserNode(interfaces.ParserNode): """ A dummy class implementing ParserNode interface """ def __init__(self, **kwargs): """ Initializes the ParserNode instance. """ ancestor, dirty, filepath, metadata = util.parsernode_kwargs(kwargs) self.ancestor = ancestor self.dirty = dirty self.filepath = filepath self.metadata = metadata super().__init__(**kwargs) def save(self, msg): # pragma: no cover """Save""" pass def find_ancestors(self, name): # pragma: no cover """ Find ancestors """ return [] class DummyCommentNode(DummyParserNode): """ A dummy class implementing CommentNode interface """ def __init__(self, **kwargs): """ Initializes the CommentNode instance and sets its instance variables. """ comment, kwargs = util.commentnode_kwargs(kwargs) self.comment = comment super().__init__(**kwargs) class DummyDirectiveNode(DummyParserNode): """ A dummy class implementing DirectiveNode interface """ # pylint: disable=too-many-arguments def __init__(self, **kwargs): """ Initializes the DirectiveNode instance and sets its instance variables. """ name, parameters, enabled, kwargs = util.directivenode_kwargs(kwargs) self.name = name self.parameters = parameters self.enabled = enabled super().__init__(**kwargs) def set_parameters(self, parameters): # pragma: no cover """Set parameters""" pass class DummyBlockNode(DummyDirectiveNode): """ A dummy class implementing BlockNode interface """ def add_child_block(self, name, parameters=None, position=None): # pragma: no cover """Add child block""" pass def add_child_directive(self, name, parameters=None, position=None): # pragma: no cover """Add child directive""" pass def add_child_comment(self, comment="", position=None): # pragma: no cover """Add child comment""" pass def find_blocks(self, name, exclude=True): # pragma: no cover """Find blocks""" pass def find_directives(self, name, exclude=True): # pragma: no cover """Find directives""" pass def find_comments(self, comment, exact=False): # pragma: no cover """Find comments""" pass def delete_child(self, child): # pragma: no cover """Delete child""" pass def unsaved_files(self): # pragma: no cover """Unsaved files""" pass interfaces.CommentNode.register(DummyCommentNode) interfaces.DirectiveNode.register(DummyDirectiveNode) interfaces.BlockNode.register(DummyBlockNode) def test_dummy(): """Dummy placeholder test case for ParserNode interfaces""" dummyblock = DummyBlockNode( name="None", parameters=(), ancestor=None, dirty=False, filepath="/some/random/path" ) dummydirective = DummyDirectiveNode( name="Name", ancestor=None, filepath="/another/path" ) dummycomment = DummyCommentNode( comment="Comment", ancestor=dummyblock, filepath="/some/file" ) if __name__ == "__main__": sys.exit(pytest.main(sys.argv[1:] + [__file__])) # pragma: no cover
997,781
0a9985334493d2f2fe5bbd9ea521e825549f9f99
""" Quick program to add crimes into the database """ import csv import psycopg2 conn = psycopg2.connect(host="localhost",database="DirectedStudiesFall2019", user="postgres", password="REDACTED") cur = conn.cursor() with open('random_blocks_with_location.csv', 'r') as f: reader = csv.reader(f) next(reader) # Skip the header row. for row in reader: cur.execute( "INSERT INTO random_with_location VALUES (%s, %s, %s, %s,%s, %s, %s)", row ) conn.commit()
997,782
8ed1b87ac8ad54ee9ae36c43de379f776a7a324e
from django.urls import path,include from post.api.views import PostListAPIView,PostCreatelAPIView,PostDetailAPIView,PostUpdatelAPIView app_name="post" urlpatterns = [ path("list",PostListAPIView.as_view(),name="list"), path("detail/<slug>",PostDetailAPIView.as_view(),name="detail"), path("update/<slug>",PostUpdatelAPIView.as_view(),name="update"), path("create",PostCreatelAPIView.as_view(),name="create") ]
997,783
3b58a3dc2afc8fde0902ccf87f0acf0419edfdc8
import math x = int(input("Enter a number between 1-10")) y = int(input("ENter another number between 1-10")) cal = x ** y print(cal) cal2 = math.sqrt(cal) print(cal2) while cal2<100000: cal2 = cal2+1 if cal2 == 100000: print(cal2)
997,784
4eea87d00d8e76066af317be19440f8aeb7c1db6
import turtle as t #터틀이라는 것을 t로써 가져옴 이를통해 turtle이라고 통째로 안써도 됨 n = 60 # 원을 60번 그림 t.shape('turtle') #모양을 거북이로 변환시킴, 화살표등의 여러가지 있음 t.speed('fastest') # 거북이 속도를 가장 빠르게 설정 for i in range(n): t.circle(120) # 반지름이 120인 원을 그림 t.right(360 / n) t.mainloop() #프로그래밍을 실행하고 바로 끝나는걸 방지함 # t.shape('turtle') # t.speed('fastest') # 거북이 속도를 가장 빠르게 설정 # for i in range(600): # 300번 반복 # t.forward(i) # i만큼 앞으로 이동. 반복할 때마다 선이 길어짐 # t.right(90) t.mainloop()
997,785
2c2bd5bed50ebc69759323bb6af5aff4850ed966
#!/usr/bin/env python # # Autogenerated by Thrift Compiler (0.7.0) # # DO NOT EDIT UNLESS YOU ARE SURE THAT YOU KNOW WHAT YOU ARE DOING # import sys import pprint from urlparse import urlparse from thrift.transport import TTransport from thrift.transport import TSocket from thrift.transport import THttpClient from thrift.protocol import TBinaryProtocol import INotificationsThriftService from ttypes import * if len(sys.argv) <= 1 or sys.argv[1] == '--help': print '' print 'Usage: ' + sys.argv[0] + ' [-h host:port] [-u url] [-f[ramed]] function [arg1 [arg2...]]' print '' print 'Functions:' print ' StateResult sendInf(Info info)' print ' StateResult batchSendInf( infos)' print ' StateResult markProcessed(string mid)' print ' StateResult markRead(string mid)' print ' queryInfo(string appId, string type, string receiverId, string objectId)' print ' StateResult replaceInf(Info info)' print ' StateResult batchReplaceInf( infos)' print ' listAll(string receiverId, string status, i64 from, i32 size)' print ' listAllOfApp(string appId, string receiverId, string status, i64 from, i32 size)' print ' listById(string receiverId, string status, i64 mid, i32 count)' print ' listOfAppById(string appId, string receiverId, string status, i64 mid, i32 count)' print ' listByTime(string receiverId, string status, i64 from, i32 count)' print ' listOfAppByTime(string appId, string receiverId, string status, i64 from, i32 count)' print ' top(string receiverId, string status, i32 topn)' print ' topOfApp(string appId, string receiverId, string status, i32 topn)' print ' i32 count(string receiverId, string status)' print ' i32 countOfApp(string appId, string receiverId, string status)' print ' string send(string message)' print ' string batchSend(string messages)' print ' string process(string mid)' print ' string query(string appId, string type, string receiverId, string objectId)' print ' string replace(string message)' print ' string batchReplace(string messages)' print '' sys.exit(0) pp = pprint.PrettyPrinter(indent = 2) host = 'localhost' port = 9090 uri = '' framed = False http = False argi = 1 if sys.argv[argi] == '-h': parts = sys.argv[argi+1].split(':') host = parts[0] port = int(parts[1]) argi += 2 if sys.argv[argi] == '-u': url = urlparse(sys.argv[argi+1]) parts = url[1].split(':') host = parts[0] if len(parts) > 1: port = int(parts[1]) else: port = 80 uri = url[2] if url[4]: uri += '?%s' % url[4] http = True argi += 2 if sys.argv[argi] == '-f' or sys.argv[argi] == '-framed': framed = True argi += 1 cmd = sys.argv[argi] args = sys.argv[argi+1:] if http: transport = THttpClient.THttpClient(host, port, uri) else: socket = TSocket.TSocket(host, port) if framed: transport = TTransport.TFramedTransport(socket) else: transport = TTransport.TBufferedTransport(socket) protocol = TBinaryProtocol.TBinaryProtocol(transport) client = INotificationsThriftService.Client(protocol) transport.open() if cmd == 'sendInf': if len(args) != 1: print 'sendInf requires 1 args' sys.exit(1) pp.pprint(client.sendInf(eval(args[0]),)) elif cmd == 'batchSendInf': if len(args) != 1: print 'batchSendInf requires 1 args' sys.exit(1) pp.pprint(client.batchSendInf(eval(args[0]),)) elif cmd == 'markProcessed': if len(args) != 1: print 'markProcessed requires 1 args' sys.exit(1) pp.pprint(client.markProcessed(args[0],)) elif cmd == 'markRead': if len(args) != 1: print 'markRead requires 1 args' sys.exit(1) pp.pprint(client.markRead(args[0],)) elif cmd == 'queryInfo': if len(args) != 4: print 'queryInfo requires 4 args' sys.exit(1) pp.pprint(client.queryInfo(args[0],args[1],args[2],args[3],)) elif cmd == 'replaceInf': if len(args) != 1: print 'replaceInf requires 1 args' sys.exit(1) pp.pprint(client.replaceInf(eval(args[0]),)) elif cmd == 'batchReplaceInf': if len(args) != 1: print 'batchReplaceInf requires 1 args' sys.exit(1) pp.pprint(client.batchReplaceInf(eval(args[0]),)) elif cmd == 'listAll': if len(args) != 4: print 'listAll requires 4 args' sys.exit(1) pp.pprint(client.listAll(args[0],args[1],eval(args[2]),eval(args[3]),)) elif cmd == 'listAllOfApp': if len(args) != 5: print 'listAllOfApp requires 5 args' sys.exit(1) pp.pprint(client.listAllOfApp(args[0],args[1],args[2],eval(args[3]),eval(args[4]),)) elif cmd == 'listById': if len(args) != 4: print 'listById requires 4 args' sys.exit(1) pp.pprint(client.listById(args[0],args[1],eval(args[2]),eval(args[3]),)) elif cmd == 'listOfAppById': if len(args) != 5: print 'listOfAppById requires 5 args' sys.exit(1) pp.pprint(client.listOfAppById(args[0],args[1],args[2],eval(args[3]),eval(args[4]),)) elif cmd == 'listByTime': if len(args) != 4: print 'listByTime requires 4 args' sys.exit(1) pp.pprint(client.listByTime(args[0],args[1],eval(args[2]),eval(args[3]),)) elif cmd == 'listOfAppByTime': if len(args) != 5: print 'listOfAppByTime requires 5 args' sys.exit(1) pp.pprint(client.listOfAppByTime(args[0],args[1],args[2],eval(args[3]),eval(args[4]),)) elif cmd == 'top': if len(args) != 3: print 'top requires 3 args' sys.exit(1) pp.pprint(client.top(args[0],args[1],eval(args[2]),)) elif cmd == 'topOfApp': if len(args) != 4: print 'topOfApp requires 4 args' sys.exit(1) pp.pprint(client.topOfApp(args[0],args[1],args[2],eval(args[3]),)) elif cmd == 'count': if len(args) != 2: print 'count requires 2 args' sys.exit(1) pp.pprint(client.count(args[0],args[1],)) elif cmd == 'countOfApp': if len(args) != 3: print 'countOfApp requires 3 args' sys.exit(1) pp.pprint(client.countOfApp(args[0],args[1],args[2],)) elif cmd == 'send': if len(args) != 1: print 'send requires 1 args' sys.exit(1) pp.pprint(client.send(args[0],)) elif cmd == 'batchSend': if len(args) != 1: print 'batchSend requires 1 args' sys.exit(1) pp.pprint(client.batchSend(args[0],)) elif cmd == 'process': if len(args) != 1: print 'process requires 1 args' sys.exit(1) pp.pprint(client.process(args[0],)) elif cmd == 'query': if len(args) != 4: print 'query requires 4 args' sys.exit(1) pp.pprint(client.query(args[0],args[1],args[2],args[3],)) elif cmd == 'replace': if len(args) != 1: print 'replace requires 1 args' sys.exit(1) pp.pprint(client.replace(args[0],)) elif cmd == 'batchReplace': if len(args) != 1: print 'batchReplace requires 1 args' sys.exit(1) pp.pprint(client.batchReplace(args[0],)) else: print 'Unrecognized method %s' % cmd sys.exit(1) transport.close()
997,786
078fa9899379ada11f6bd1ed346190b08a820ebf
import numpy as np def loaddata(): return np.fromfile("ex1data1.txt", int, sep="\n") if __name__ == "__mian__": traindata = loaddata() version = '1.0' print(version.startswitch('1')) print('end') print("Hello the Pycharm!")
997,787
8151b86e80afb1f028b48be72576361ddd041ff4
from py1811.sungJuk import SungjukService sjsrv = SungjukService.SungJukService() std3 = sjsrv.readSungJuk() print(std3) sjsrv.computeSungJuk(std3) print(std3)
997,788
68f6dc6f0dae3667a5633397655455e3b06cfb65
import socket from threading import Thread, Condition from downloadInThread import MyThread import argparse from collections import deque from Queue import Queue condition = Condition() queue = [] class Server(Thread): def __init__(self,host,port,name): Thread.__init__(self) self.port = port self.host = host self.name = name self.bufsize = 1024 self.addr = (host,port) self.socket = socket.socket(socket.AF_INET, socket.SOCK_STREAM) self.socket.bind(self.addr) def run(self): self.socket.listen(5) while True: print 'Waiting for connection..' client, caddr = self.socket.accept() print 'Connected To',caddr data = client.recv(self.bufsize) if not data: continue print data condition.acquire() queue.append(data) print "Produced", data condition.notify() condition.release() if data == "END": return class Client(Thread): def __init__(self,host,port,name, delays, txpower, mintxpower, maxtxpower, incThreshold, decThreshold): Thread.__init__(self) self.port = port self.host = host self.name = name self.bufsize = 1024 self.addr = (host,port) self.delays = delays self.txpower = txpower self.mintxpower = mintxpower self.maxtxpower = maxtxpower self.incThreshold = incThreshold self.decThreshold = decThreshold self.socket = socket.socket(socket.AF_INET, socket.SOCK_STREAM) def run(self): invalid = True while invalid: try: invalid = False self.socket.connect(self.addr) except: invalid = True global queue while True: condition.acquire() if not queue: condition.wait() num = queue.pop() if num == "END": return num = float(num) self.delays.append(num) changePower = False if len(self.delay) == self.delay.maxlen and self.delays.count(-1) >= self.incThreshold and self.txpower < self.maxtxpower: self.txpower += 1 changePower = True self.delays.clear() elif len(self.delay) == self.delay.maxlen and self.delays.count(-1) <= self.decThreshold and self.txpower > self.mintxpower: self.txpower -= 1 changePower = True self.delays.clear() if changePower: commandVal = "set:tx-power:" + str(self.txpower) print "Consumed", commandVal self.socket.send(commandVal) condition.release() if __name__ == "__main__": progName = "downloadInThread" parser = argparse.ArgumentParser(prog = progName) parser.add_argument("-s", "--baseIP", dest="baseIP", help="server address") parser.add_argument("-c", "--commandIP", dest="commandIP", help="client address") parser.add_argument("-a", "--basePort", dest="basePort", help="server port", type=int) parser.add_argument("-b", "--commandPort", dest="commandPort", help="client port", type=int) parser.add_argument("-n", "--name", dest="name", help="Name") parser.add_argument("-d", "--downloadTime", dest="dTime", help="Download time") parser.add_argument("-k", "--sleepTime", dest="sTime", help="Sleep time") parser.add_argument("-i", "--iterations", dest="iteration", help="No. of iterations", type=int) args = parser.parse_args() downloaderQ = Queue() downloaderThread = MyThread(downloaderQ, args=(True,)) server = Server(args.commandIP, args.commandPort, args.name) client = Client(args.baseIP, args.basePort, args.name, deque(maxlen=15),22, 22, 27, 5, 2) server.start() client.start() downloaderThread.start() for i in range(0, args.iteration): downloaderThread.queue.put("download:"+args.dTime) downloaderThread.queue.put("sleep:"+args.sTime) downloaderThread.queue.put(None) downloaderThread.join() server.join()
997,789
a5e88040e0a54f491bc605325bc9ee484cf50ce6
from django.shortcuts import render from django.http import HttpResponse import numpy as np import pandas as pd # Create your views here. from sklearn.externals import joblib classifier=joblib.load('./models/RFModelforMPG.pkl') def index(request): temp={} temp['ageVal']=50 temp['bs_fastVal']=6.8 temp['bs_ppVal']=8.8 temp['plasma_rVal']=11.2 temp['plasma_fVal']=7.2 temp['hbA1cVal']=62 context ={'temp':temp} return render(request,'index.html',context) # return HttpResponse({'a':1}) def predictMPG(request): context ={'temp':' '} print (request) if request.method == 'POST': temp={} temp['ageVal']=request.POST.get('ageVal') temp['bs_fastVal']=request.POST.get('bs_fastVal') temp['bs_ppVal']=request.POST.get('bs_ppVal') temp['plasma_rVal']=request.POST.get('plasma_rVal') temp['plasma_fVal']=request.POST.get('plasma_fVal') temp['hbA1cVal']=request.POST.get('hbA1cVal') # testDtaa=pd.DataFrame({'x':temp2}).transpose() # scoreval=reloadModel.predict(testDtaa)[0] # context={'scoreval':scoreval,'temp':temp} #Datapreprocessing Convert the values to float age = float(temp['ageVal']) bs_fast = float(temp['bs_fastVal']) bs_pp = float(temp['bs_ppVal']) plasma_r = float(temp['plasma_rVal']) plasma_f = float(temp['plasma_fVal']) hbA1c = float(temp['hbA1cVal']) result = [age,bs_fast,bs_pp,plasma_r,plasma_f,hbA1c] #Passing data to model & loading the model from disks #model_path = 'ml_model/model.pkl' #classifier = pickle.load(open(model_path, 'rb')) prediction = classifier.predict([result])[0] conf_score = np.max(classifier.predict_proba([result]))*100 context ={'a':'Diabetes Prediction :' + prediction ,'temp':temp} return render(request,'index.html',context)
997,790
87c5d81d89e01ea4ab7ea4500a06abc5e69c7726
import random from signtest import compute_significance_two_tails def crossvalidation(datas, class_count, disc, classifier, params={}, fold=10): random.shuffle(datas) one_fold_length = len(datas) / fold fold_with_extra = len(datas) % fold classification_rate = [0] * fold start = 0 for i in xrange(0, fold): classifier.reset() if i < fold_with_extra: last = start + one_fold_length + 1 else: last = start + one_fold_length test_set = datas[start:last] train_set = datas[0:start] + datas[last:] if params: classifier.train(train_set, class_count, params) else: classifier.train(train_set, class_count) print "{}th fold training over".format(i) correct = len(filter(lambda (data, label): classifier.classify(data, params=params) == label, test_set)) classification_rate[i] = correct / float(len(test_set)) start = last print "{}th fold over".format(i) result = "" result += "{} CR: {}, AVG: {}\n".format(disc, classification_rate, sum(classification_rate) / len(classification_rate)) result += "\n\n" print result return result # takes pre-precessed data - [(tokens, label)] def crossvalidation_compare(datas, class_count, method1_disc, classifier_1, params_1, method2_disc, classifier_2, params_2, fold=10): random.shuffle(datas) one_fold_length = len(datas) / fold fold_with_extra = len(datas) % fold classification_rate_1 = [0] * fold classification_rate_2 = [0] * fold start = 0 win_1 = 0 win_2 = 0 for i in xrange(0, fold): correct_1 = 0 correct_2 = 0 classifier_1.reset() classifier_2.reset() if i < fold_with_extra: last = start + one_fold_length + 1 else: last = start + one_fold_length test_set = datas[start:last] train_set = datas[0:start] + datas[last:] classifier_1.train(train_set, class_count, params_1) classifier_2.train(train_set, class_count, params_2) result = [] for data, expected in test_set: result.append( (expected, classifier_1.classify(data, params=params_1), classifier_2.classify(data, params=params_2))) for expected, r_1, r_2 in result: par = r_1 == r_2 if par: win_1 += 0.5 win_2 += 0.5 if expected == r_1: correct_1 += 1 if not par: win_1 += 1 if expected == r_2: correct_2 += 1 if not par: win_2 += 1 classification_rate_1[i] = float(correct_1) / len(test_set) classification_rate_2[i] = float(correct_2) / len(test_set) start = last win_1 = int(round(win_1)) win_2 = int(round(win_2)) result = "" result += "{} CR: {}, AVG: {}\n".format(method1_disc, classification_rate_1, sum(classification_rate_1) / len(classification_rate_1)) result += "{} CR: {}, AVG: {}\n".format(method2_disc, classification_rate_2, sum(classification_rate_2) / len(classification_rate_2)) result += "Sig {}\n".format(compute_significance_two_tails(win_1, win_1 + win_2)) result += "\n\n" print result return result
997,791
004eeb38bf2503633fdfc373d0cded865cb870be
__author__ = "Nikhil Mehta" __copyright__ = "--" #--------------------------- import tensorflow as tf import numpy as np import os class DataHandler: def __init__(self, data_dir): self.data_dir = data_dir self.test_data_loaded = False def load_data(self): train_class_file = os.path.join(self.data_dir, 'trainclasses_ps.txt') train_label_file = os.path.join(self.data_dir, 'trainLabels') train_data_file = os.path.join(self.data_dir, 'trainData') train_attr_file = os.path.join(self.data_dir, 'trainAttributes') test_class_file = os.path.join(self.data_dir, 'testclasses_ps.txt') test_label_file = os.path.join(self.data_dir, 'testLabels') test_data_file = os.path.join(self.data_dir, 'testData') all_attr_file = os.path.join(self.data_dir, 'dataAttributes') all_class_file = os.path.join(self.data_dir, 'allclasses.txt') if not os.path.exists(train_class_file) or \ not os.path.exists(train_label_file) or \ not os.path.exists(train_data_file) or \ not os.path.exists(train_attr_file) or \ not os.path.exists(test_class_file) or \ not os.path.exists(test_label_file) or \ not os.path.exists(test_data_file) or \ not os.path.exists(all_class_file) or \ not os.path.exists(all_attr_file): raise IOError("File cannot be read") self.all_classes = {} with open(all_class_file, 'r') as f: data = f.readlines() for idx, cl in enumerate(data): self.all_classes[cl.split()[0]] = idx with open(test_class_file, 'r') as f: data = f.readlines() self.test_classes = [self.all_classes[x.split()[0]] for x in data] with open(train_class_file, 'r') as f: data = f.readlines() self.train_classes = [self.all_classes[x.split()[0]] for x in data] with open(all_attr_file) as f: self.all_attr = np.load(f) # Train files load self.load_train_data(train_class_file, train_label_file, train_data_file, train_attr_file) self.load_test_data(test_class_file, test_label_file, test_data_file, all_attr_file) def preprocess_data(self): print 'Preprocess' # Do everything here so i can remove this function if i want to # Preprocess c and x self.epsilon = 1e-6 self.attr_mean = np.mean(self.all_attr, axis=0, keepdims=True) # Note all_attr (Seen and Unseen classes) available at training time self.attr_std = np.std(self.all_attr, axis=0, keepdims=True) print self.all_attr.shape print self.attr_mean.shape print self.attr_std.shape self.train_attr = np.divide(self.train_attr - self.attr_mean, (self.attr_std + self.epsilon)) self.all_attr = np.divide(self.all_attr - self.attr_mean, (self.attr_std + self.epsilon)) self.test_attr = np.divide(self.test_attr - self.attr_mean, (self.attr_std + self.epsilon)) self.train_data_mean = np.mean(self.train_data, axis=0, keepdims=True) self.train_data_std = np.std(self.train_data, axis=0, keepdims=True) self.train_data = np.divide(self.train_data - self.train_data_mean, (self.train_data_std + self.epsilon)) # Here only preprocessing the test data # Note: Test data has not been used for preprocessing (calculation of mean or std) self.test_data = np.divide(self.test_data - self.train_data_mean, (self.train_data_std + self.epsilon)) def load_train_data(self, train_class_file, train_label_file, train_data_file, train_attr_file): with open(train_label_file) as f: self.train_label = np.load(f) with open(train_data_file) as f: self.train_data = np.load(f) with open(train_attr_file) as f: self.train_attr = np.load(f) self.train_size = self.train_data.shape[0] self.x_dim = self.train_data.shape[1] self.attr_dim = self.train_attr.shape[1] print 'Training Data: ' + str(self.train_data.shape) print 'Training Attr: ' + str(self.train_attr.shape) def load_test_data(self, test_class_file, test_label_file, test_data_file, all_attr_file): with open(test_label_file) as f: self.test_label = np.load(f) with open(test_data_file) as f: self.test_data = np.load(f) self.test_attr = self.all_attr[self.test_classes] self.test_size = self.test_data.shape[0] print 'Testing Data: ' + str(self.test_data.shape) print 'Testing Attr: ' + str(self.test_attr.shape) print 'Testing Classes' + str(len(self.test_classes)) print 'Testin Labels' + str(self.test_label.shape) def next_train_batch(self, index, batch_size): start_index = index end_index = index+batch_size return self.train_data[start_index:end_index], self.train_attr[start_index:end_index] def next_test_batch(self, index, batch_size): start_index = index end_index = index+batch_size return self.test_data[start_index:end_index], self.test_attr[start_index:end_index]
997,792
585c4958b50e0d3e4d1deb43c8b607864cd66d52
import os import json import logging from flask import (Blueprint, flash, g, redirect, render_template, request, url_for, make_response, send_from_directory) from werkzeug.exceptions import abort from app.db import get_db, close_db from app.auth import login_required bp = Blueprint('hw', __name__) @bp.route('/hw_img/<context>', methods=('GET', 'POST')) def hw_img(context): import base64 img_stream = '' with open('./files/hw/' + context + '/prob.png', 'rb') as f: img_stream = f.read() return img_stream @bp.route('/sp_prob_img/<context>', methods=('GET', 'POST')) def sp_prob_img(context): import base64 img_stream = '' with open('./files/sp_exe/' + context + '/prob.png', 'rb') as f: img_stream = f.read() return img_stream @bp.route('/sp_ans_img/<context>', methods=('GET', 'POST')) def sp_ans_img(context): import base64 img_stream = '' with open('./files/sp_exe/' + context + '/ans.png', 'rb') as f: img_stream = f.read() return img_stream # Record hw_history def record_hw_history(user_ip, operation, context=None): if (g.user != '{}') and (g.user is not None): user_id = json.loads(g.user)['id'] if (operation == 1 or operation == 2) and context: db = get_db() df = db.fetchall( 'SELECT id FROM hw_info WHERE context="{context}"'.format( context=context)) hw_id = df.id[0] db.execute( 'INSERT INTO hw_history (user_id, user_ip, hw_id, operation, time) VALUES ({user_id}, "{user_ip}", {hw_id}, {operation}, now())' .format(user_id=user_id, user_ip=user_ip, hw_id=hw_id, operation=operation)) db.commit() close_db() # Record sp_exe_history def record_sp_exe_history(context, user_ip, operation, ans="null", difficulty="null", answer_easy_if="null"): db = get_db() if (g.user != '{}') and (g.user is not None): user_id = json.loads(g.user)['id'] df = db.fetchall( 'SELECT id FROM sp_exe_info WHERE context="{context}"'.format( context=context)) sp_exe_id = df.id[0] db.execute( 'INSERT INTO sp_exe_history (user_id, user_ip, sp_exe_id, operation, time, ans, difficulty, answer_easy_if) VALUES ({user_id}, "{user_ip}", {sp_exe_id}, {operation}, now(), {ans}, {difficulty}, {answer_easy_if})' .format(user_id=user_id, user_ip=user_ip, sp_exe_id=sp_exe_id, operation=operation, ans=ans, difficulty=difficulty, answer_easy_if=answer_easy_if)) db.commit() close_db() # Check submit status with { user_id, hw_id } def check_submitted(context, operation): db = get_db() if (g.user != '{}') and (g.user is not None): user_id = json.loads(g.user)['id'] df = db.fetchall( 'SELECT id FROM hw_info WHERE context="{context}"'.format( context=context)) hw_id = df.id[0] df = db.fetchall( 'SELECT * FROM hw_history WHERE user_id="{user_id}" AND operation={operation} AND hw_id={hw_id}' .format(user_id=user_id, operation=operation, hw_id=hw_id)) amount = len(df) close_db() if amount >= 1: return True, df.iloc[0].time elif amount == 0: return False, None else: close_db() return False, None
997,793
0202b0c94690844c29540f6b846e8da5ae07f91e
from tkinter.constants import END from tkinter import simpledialog from tkinter import messagebox import imap_tools attachment_path = "./attachment/" dictionary_email = {} login_list = [] def imap_login(window): global login_list while 1: window.update_idletasks() email = simpledialog.askstring("email", "inserisci la tua email") window.update_idletasks() password = simpledialog.askstring( "password", "inserisci la tua password") mailbox = imap_tools.MailBox("imap.gmail.com") try: mailbox = mailbox.login(email, password) break except Exception: messagebox.showerror("Error", "Dati non validi") login_list.append(email) login_list.append(password) print(mailbox) return mailbox def receive_email(listEmail, window): global dictionary_email s = "" i = 0 mailbox = imap_login(window) for msg in mailbox.fetch(): foo = [] print(f"Da: {msg.from_}\nOggetto: {msg.subject}\nBody: {msg.text}") foo.append(f"Da: {msg.from_}") foo.append(f"Oggetto: {msg.subject}") foo.append(msg.text) s += f"{msg.from_} {msg.subject}" for att in msg.attachments: print(f"Allegato: {att.filename}, {att.content_type}\n") foo.append(f"Allegato: {att.filename}") foo.append(att.payload) dictionary_email[i] = foo listEmail.insert(END, s) i += 1 s = "" def download_attachments(i): temp = dictionary_email[i][len(dictionary_email[i])-2].split(" ") filename = temp[len(temp)-1] with open(attachment_path + filename, "wb") as f: f.write(dictionary_email[i][len(dictionary_email[i])-1]) messagebox.showinfo("info", "Ho scaricato il file")
997,794
33689be0f96cf9020252dbf7df20f84b10b225ad
import os import random import string from typing import Optional, Tuple import healpy import pytest from precovery.orbit import Orbit from precovery.sourcecatalog import SourceFrame, SourceObservation def make_sourceobs( exposure_id: str = "exposure", id: Optional[bytes] = None, obscode: str = "obs", healpixel: Optional[int] = None, nside: int = 32, ra: float = 1.0, dec: float = 2.0, mjd: float = 50000.0, exposure_mjd_start: float = 50000.0, exposure_mjd_mid: float = 50000.0, ) -> SourceObservation: """Constructor for SourceObservations which provides default values for anything unspecified, which makes test setup less verbose. """ if id is None: id = random_string(16).encode("utf8") if healpixel is not None: ra, dec = radec_for_healpixel(healpixel, nside) return SourceObservation( exposure_id=exposure_id, obscode=obscode, id=id, mjd=mjd, ra=ra, dec=dec, ra_sigma=3.0, dec_sigma=4.0, mag=5.0, mag_sigma=6.0, filter="filter", exposure_mjd_start=exposure_mjd_start, exposure_mjd_mid=exposure_mjd_mid, exposure_duration=30, ) def make_sourceobs_of_orbit( orbit: Orbit, obscode: str, mjd: float = 50000.0, ): ephem = orbit.compute_ephemeris(obscode=obscode, epochs=[mjd])[0] obs = make_sourceobs( mjd=mjd, exposure_mjd_mid=mjd, obscode=obscode, ra=ephem.ra, dec=ephem.dec ) return obs def make_sourceframe_with_observations( n_observations: int, exposure_id: str = "exposure", obscode: str = "obs", exposure_mjd_start: float = 50000.0, exposure_mjd_mid: float = 50000.0, healpixel: int = 1, ) -> SourceFrame: """Constructor for SourceFrames which provides default values for anything unspecified, which makes test setup less verbose. SourceObservations are generated and included. """ observations = [ make_sourceobs( exposure_id=exposure_id, obscode=obscode, healpixel=healpixel, mjd=exposure_mjd_mid, exposure_mjd_start=exposure_mjd_start, exposure_mjd_mid=exposure_mjd_mid, ) for _ in range(n_observations) ] return SourceFrame( exposure_id=exposure_id, obscode=obscode, filter="filter", exposure_mjd_start=exposure_mjd_start, exposure_mjd_mid=exposure_mjd_mid, exposure_duration=30.0, healpixel=1, observations=observations, ) def radec_for_healpixel(healpixel: int, nside: int) -> Tuple[float, float]: """ Compute the ra and dec associated with a healpixel """ return healpy.pix2ang(nside=nside, ipix=healpixel, nest=True, lonlat=True) def random_string(length: int): return "".join(random.choice(string.ascii_lowercase) for i in range(length)) requires_openorb_data = pytest.mark.skipif( "OORB_DATA" not in os.environ, reason="test requires propagation, so OORB_DATA environment variable must be set", )
997,795
c93638f3cd8de1b9d4950c3d8ceaaf46e477713d
from regularizationNetworks import MixGauss import scipy.io as sio import numpy as np import os.path [Xtr, Ytr] = MixGauss.mixgauss(np.matrix('0 1; 0 1'), np.matrix('0.5 0.25'), 100) [Xts, Yts] = MixGauss.mixgauss(np.matrix('0 1; 0 1'), np.matrix('0.5 0.3'), 100) flag = True while flag: file_name = raw_input('Insert the dataset name ') file_name = os.path.join(os.path.dirname(os.path.dirname(__file__)), 'datasets/'+file_name) if os.path.isfile(file_name + '.mat'): choose = raw_input('A file with this name already exists, do you want to override it? (y/n) ') if choose == 'y': flag = False else: flag = True else: flag = False sio.savemat(file_name, {'Xtr': Xtr, 'Ytr': Ytr, 'Xts': Xts, 'Yts': Yts})
997,796
a2a66aa34cdf521393e44e1ec95ea9c856391cdf
def sum(r):# 若函数中的局部变量和全局变量的变量名一样,那么优先使用局部变量 pi=3.14 # 局部变量 return (pi*2*r) r=input("请输入半径:") # 全局变量 if r.isdigit(): print(sum(float(r))) else: print("输入有误")
997,797
8c1735f8b6a0d5a1f683bab7a39b2f66218405d4
"""Meat Engine Copyright (C) 2007, Big Dice Games One practical definition of a "game engine" is "the code you reuse on your second game". That's mostly tongue-in-cheek, but it isn't far from the philosophy of what's currently included in MeatEngine. I've included a variety of pieces of code, not because they're all appropriate for the game you want to make, and they're certainly not all appropriate for any particular game, but instead, each piece might be useful for some game, or for some game-related-project. MeatEngine is more of a toolbox than a framework - you're responsible for the main loop of your program. Some of the code makes certain assumptions about being called periodically. This should not be difficult to handle, regardless of the structure of your game. Included (currently) are modules for adaptive music, GUI display, AI, and low-level math. Also included is the beginnings of a ray tracer - not that you'd want to use a ray tracer in your game (certainly not this ray tracer, anyway), but it may be of benefit in creating assets. Also, it serves as a test harness for the math module. Version History -------------------- 0.0.1 - Initial packaging in advance of PyWeek5 """ __all__ = ['MoodMusic', 'Math', 'Widgets', 'LookAhead', 'RayTrace'] __version__ = "0.0.1" __docformat__="restructuredtext en"
997,798
3d75b0f9947e55bbc0a7b5bf6d88f5bd2c1ac33a
# Alec Dewulf # "Hidden Palindrome" 2016 J3 # December 31, 2019 pal = input() lengths = [] x = 1 y = 1 # getting lengths of palindromes that have a middle consisting of 1 letter while x < len(pal) - 1: # checking to make sure the guess is whithin the length of the palindrome while (x + y) < len(pal) and (x - y) >= 0: if pal[x - y] == pal[x + y]: # multiply ans by two for the letters on both sides and # add the middle ans = (2 * y) + 1 lengths.append(ans) y += 1 else: break y = 1 x += 1 y = 1 x = 1 # getting the lengths of palindromes that have a middle of 2 letters while x < len(pal) - 1: # checking for a two letter middle if pal[x] == pal[x + 1]: y = 1 # finding the largest palindrome while (x + 1 + y) < len(pal): # the digits after the two digit middle are the same if pal[x - y] == pal[x + y + 1] and (x-y) >= 0: ans = (2 * y) + 2 lengths.append(ans) y +=1 else: break x += 1 #check the list for pals of length two if len(lengths) == 0: for i in range(len(pal)): # if two of the same letters are beside each other if (i+1) < len(pal): if pal[i] == pal[i +1]: lengths.append(2) # returning the answer which is the greatest length found if len(lengths) != 0: print(max(lengths)) else: print(1)
997,799
64dfc5c96aea30d0e420ba9ef1000325711638a6
import math import numpy import matplotlib matplotlib.use('TkAgg') from skimage import io from skimage import feature from skimage import draw from skimage import util from skimage import color from skimage import morphology from skimage import filters from skimage import measure from skimage import transform from skimage import exposure from sklearn.neighbors import NearestNeighbors from scipy import ndimage as ndi #import matplotlib.pyplot as plt from matplotlib.figure import Figure from matplotlib.backends.backend_tkagg import FigureCanvasTkAgg, NavigationToolbar2TkAgg import sys if sys.version_info[0] < 3: import Tkinter as Tk from tkinter import messagebox else: import tkinter as Tk from tkinter import messagebox from scipy.spatial import Delaunay import Si_Ring_Classes import matplotlib.pyplot as plt light_centers = False #170908_SiO2@RuVII_STM110_det (27.4x11.5).jpg save_figures = False #Colors for each of the ring numbers colors = [[178, 112, 248], [75, 176, 246], [67, 196, 127], [249, 222, 62], [249, 76, 62], [247, 38, 232]] scaling_factor = 1 #Sets up the Tk window root = Tk.Tk() root.wm_title("Auto Ring Center Finder") bin_list = [[5,6,7,8],[6,6,7],[6,6,6,6,6,8],[6,6,6,6,6,6]] bin_mids = [0.5,1,1.5,2] def Crystallinity(bin_list, bin_mids): crys_list = [] for cur_list in bin_list: num_sixes = cur_list.count(6) crystallinity = num_sixes/len(cur_list) crys_list.append(crystallinity) plt.plot(bin_mids, crys_list, 'ro') plt.axis([0, bin_mids[-1] + 1, 0, 1]) plt.title('Crystallinity') plt.xlabel('Distance') plt.ylabel('Crystallinity') plt.show() Crystallinity(bin_list, bin_mids)