instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: eastern european house mouse (aka mus musculus musculus)
C: gallus
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mouse (aka mus <genus>)
F: miletus gallus gallus
G: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
H: house mouse (aka mus musculus)
I: gallio
J: gallus domesticus (aka gallus gallus)
K: None of the above. | [J; H] |
<Instruct>: Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: galliformes (landfowls) (aka galliformes)
C: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
D: mus domesticus (aka mus musculus domesticus)
E: mouse (aka mus musculus)
F: mus molossinus (aka mus musculus molossinus)
G: gallasellus
H: turkey (aka meleagris gallopavo)
I: mus <genus> (mice (aka mus <genus>))
J: gallio
K: None of the above. | [C; E] |
<Instruct>: Given the context 'In chicken embryos, TrkB-expressing cells first appear at Hamburger-Hamilton Stage (St) 27 and they co-express HNK-1, confirming that they are migrating neural crest cells.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: gallus
B: turkey (aka meleagris gallopavo)
C: arilus gallus
D: gallus sp.
E: chicken (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'BDNF transcript expression parallels that of TrkB. In the mouse, TrkB-positive cells surround newly formed sympathetic ganglia and a small number of TrkB positive cells that co-express tyrosine hydroxylase are seen within ganglia between E13.5-15.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus musculus)
B: mus sp. (mice (aka mus sp.))
C: peromyscus
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: None of the above. | [A] |
<Instruct>: Given the context 'In cell culture, many cells from St. 29–30 chicken lumbar sympathetic ganglia express neural markers and are dividing, indicating that they are sympathoblasts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: avian (aka aves)
B: gallus gallus domesticus (aka gallus gallus)
C: gallasellus
D: miletus gallus gallus
E: gallorhynchus
F: None of the above. | [B] |
<Instruct>: Given the context 'In chicken embryos, migrating neural crest cells express catecholamines at Hamburger/Hamilton Stage (St.) 19, and these cells form the primary sympathetic chain dorsolateral to the aorta at St. 22 (E3.5)', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: galliformes (landfowls) (aka galliformes)
B: gallus
C: gallio
D: gallus domesticus (aka gallus gallus)
E: turkey (aka meleagris gallopavo)
F: None of the above. | [D] |
<Instruct>: Given the context 'Time lapse photography has shown that cultured E15.5–E16.5 sympathetic neurons from rat embryos extend axons while they divide [3-5].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rats (aka rattus sp.) (aka rattus sp.)
B: mus norvegicus (aka rattus norvegicus)
C: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
D: house rat (aka rattus rattus)
E: rattus norvegicus albus
F: None of the above. | [B] |
<Instruct>: Given the context 'There are severe sympathetic defects in the superior cervical ganglion of individual NT-3 and NGF knockout mice [8-10].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus castaneus (aka mus musculus castaneus)
B: mus sp. (mice (aka mus sp.))
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'There are severe sympathetic defects in the superior cervical ganglion of individual NT-3 and NGF knockout mice [8-10].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus sp. (mice (aka mus sp.))
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mus castaneus (aka mus musculus castaneus)
E: None of the above. | [E] |
<Instruct>: Given the context 'Furthermore, there is no additional cell death in the superior cervical ganglion of NT-3 and NGF double knockout mouse embryos, suggesting that all of the neurons are dependent on both neurotrophins for survival [11].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus domesticus (aka mus musculus domesticus)
C: peromyscus
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: mouse (aka mus <genus>)
F: None of the above. | [A] |
<Instruct>: Given the context 'There is also an increase in sympathetic neuron cell death in TrkA knockout mice [12].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: peromyscus
B: mouse (aka mus <genus>)
C: mouse (aka mus musculus)
D: mus cricetus (aka cricetus cricetus)
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: None of the above. | [C] |
<Instruct>: Given the context 'However, in TrkB and BDNF knockout mice, there is no apparent phenotype in the superior cervical ganglion, and there is little evidence that TrkB or BDNF is expressed in sympathetic ganglia.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: house mouse (aka mus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus castaneus (aka mus musculus castaneus)
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: mus sp. (mice (aka mus sp.))
F: None of the above. | [A] |
<Instruct>: Given the context 'To test whether BDNF, the ligand for TrkB, was present in embryonic chick sympathetic ganglia, we used quantitative real-time PCR with TaqMan probes to determine the relative abundance of BDNF transcripts in total RNA extracted from lumbar sympathetic ganglia at St. 29/30 (E6.5), St. 31 (E7), St. 34 (E8), and E9.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: fopius
B: gallio
C: miletus gallus gallus
D: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
E: gallus domesticus (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: gallio
B: miletus gallus gallus
C: house mouse (aka mus musculus)
D: mice (aka mus sp.) (aka mus sp.)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: gallasellus
G: arilus gallus
H: eastern european house mouse (aka mus musculus musculus)
I: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
J: gallus gallus domesticus (aka gallus gallus)
K: None of the above. | [J; C] |
<Instruct>: Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: mouse (aka mus musculus)
C: avian (aka aves)
D: gallus sp.
E: galliformes (landfowls) (aka galliformes)
F: peromyscus
G: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: mus sp. (mice (aka mus sp.))
J: chicken (aka gallus gallus)
K: None of the above. | [J; B] |
<Instruct>: Given the context 'In the chicken, TrkB expression is transient, and completely lost by St 34 (E8).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: gallus gallus domesticus (aka gallus gallus)
B: gallorhynchus
C: gallio
D: gallus sp.
E: miletus gallus gallus
F: None of the above. | [A] |
<Instruct>: Given the context 'Early sympathetic ganglia contain at least two subpopulations: early differentiating neurons that lack TrkB expression and express TrkA and TrkC, and late differentiating sympathoblasts that express TrkB. Explant cultures of sympathetic ganglia from E16 chick embryos give rise to two neuronal populations: one that remains close to the explant, and one that migrates away from the explant [1].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus sp.
B: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
C: birds (aka aves)
D: chicken (aka gallus gallus)
E: miletus gallus gallus
F: None of the above. | [D] |
<Instruct>: Given the context 'Early sympathetic ganglia contain at least two subpopulations: early differentiating neurons that lack TrkB expression and express TrkA and TrkC, and late differentiating sympathoblasts that express TrkB. Explant cultures of sympathetic ganglia from E16 chick embryos give rise to two neuronal populations: one that remains close to the explant, and one that migrates away from the explant [1].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: birds (aka aves)
B: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
C: gallus sp.
D: miletus gallus gallus
E: None of the above. | [E] |
<Instruct>: Given the context 'In the superior cervical ganglion, an increase in the number of neurons of BDNF null mice is likely due to apoptosis induced by BDNF via p75NTR', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: house mouse (aka mus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
D: peromyscus
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: None of the above. | [A] |
<Instruct>: Given the context 'If our results indicating that BDNF promotes proliferation of TrkB-positive sympathoblasts in the chicken embryo can be extrapolated to the subset of TrkB-positive sympathoblasts in murine ganglia, then these TrkB-positive cells may be neurons destined to innervate the erector pilli.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: galliformes (landfowls) (aka galliformes)
B: gallus
C: gallus domesticus (aka gallus gallus)
D: gallus sp.
E: birds (aka aves)
F: None of the above. | [C] |
<Instruct>: Given the context 'In other studies, TrkB null mice showed no changes in morphology or cell number in superior cervical ganglia [12] or in the intermediolateral column [20]; but this may not be predictive of a phenotype in the lumbar paravertebral chain.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus castaneus (aka mus musculus castaneus)
C: mouse (aka mus <genus>)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: None of the above. | [A] |
<Instruct>: Given the context 'However, if TrkB-positive cells are not normally actively proliferating in vivo, then it would not be surprising that the development of the paravertebral sympathetic chain is not disrupted in TrkB or BDNF null mice.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus castaneus (aka mus musculus castaneus)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'It may be more informative to examine mice that over express BDNF on a promoter that targets expression to embryonic lumbar ganglia.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mouse (aka mus musculus)
D: mus cricetus (aka cricetus cricetus)
E: peromyscus
F: None of the above. | [C] |
<Instruct>: Given the context 'Unfortunately, such mice do not exist.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: peromyscus
B: mice (aka mus sp.) (aka mus sp.)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus musculus (house mouse) (aka mus musculus)
E: mus <genus> (mice (aka mus <genus>))
F: None of the above. | [D] |
<Instruct>: Given the context 'Our findings that the St. 29/30 (E6.5) sympathoblasts are dependent on both NT-3 and NGF for survival in culture are consistent with previous work on mouse sympathoblasts from the superior cervical ganglion', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: mouse (aka mus musculus)
C: mus cricetus (aka cricetus cricetus)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | [B] |
<Instruct>: Given the context 'In contrast, cultured rat superior cervical ganglion sympathetic neurons respond to NT-3 at E14.5 and then to NGF at E19.5, although time points in between were not analyzed [6].
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
B: rat (aka rattus) (aka rattus)
C: rattus sp. (rats (aka rattus sp.))
D: rats (aka rattus norvegicus) (aka rattus norvegicus)
E: rattus norvegicus albus
F: None of the above. | [D] |
<Instruct>: Given the context 'NT-3 can promote the incorporation of [3H]-thymidine into cultured quail neural crest cells from the trunk region [21,22], Later in rat sympathetic development, NT-3 supports survival of neurons, but does not promote proliferation', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rat (aka rattus norvegicus) (aka rattus norvegicus)
B: rattus rattus (rattus wroughtoni) (aka rattus rattus)
C: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
D: rattus (rats (aka rattus))
E: rattus sp. (rats (aka rattus sp.))
F: None of the above. | [A] |
<Instruct>: Given the context 'NGF promotes an increase in BrdU incorporation from 25% to 35% in the DRG cervical segment 2 in the chick embryo [23].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: fopius
B: gallus
C: gallus domesticus (aka gallus gallus)
D: landfowls (aka galliformes)
E: arilus gallus
F: None of the above. | [C] |
<Instruct>: Given the context 'NGF promotes an increase in BrdU incorporation from 25% to 35% in the DRG cervical segment 2 in the chick embryo [23].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus
B: fopius
C: landfowls (aka galliformes)
D: arilus gallus
E: None of the above. | [E] |
<Instruct>: Given the context 'In chicken embryos that are treated with NGF in ovo at St. 18 and 21, there is an increase in BrdU uptake after formation of the primary sympathetic chain at St. 23', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: gallus sp.
B: chickens (aka gallus gallus)
C: landfowls (aka galliformes)
D: gallorhynchus
E: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
F: None of the above. | [B] |
<Instruct>: Given the context 'Since NGF does not appear to affect proliferation of St. 29/30 (E6.5) chick sympathoblasts, NGF may only promote proliferation in primary, but not secondary chain sympathoblasts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: arilus gallus
B: birds (aka aves)
C: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
D: miletus gallus gallus
E: fopius
F: None of the above. | [C] |
<Instruct>: Given the context 'Motor neuron progenitors in the ventral neural tube from the chick embryo express TrkB and when ventral neural tube explants are treated with BDNF, there is an increase in the number of motor neurons produced and BrdU incorporation', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: fopius
B: mus spretus (mus musculus spretus) (aka mus spretus)
C: arilus gallus
D: birds (aka aves)
E: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Future studies will determine whether constitutive expression of BDNF and TrkB in the chick embryo sustains proliferation of differentiating sympathoblasts.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus sp.
B: mus spretus (mus musculus spretus) (aka mus spretus)
C: fopius
D: arilus gallus
E: gallus domesticus (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Methods
Preparation of tissue for immunohistochemistry
The lumbar spinal column and surrounding tissues were dissected from chicken embryos at the indicated stages and placed in Zamboni's fixative (4% (w/v) paraformaldehyde, 15% (v/v) picric acid in 0.1 M sodium phosphate buffer, pH 7.4) for two hours at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: birds (aka aves)
B: gallio
C: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
D: chickens (aka gallus gallus)
E: gallasellus
F: None of the above. | [D] |
<Instruct>: Given the context 'Mouse embryos at 13–15 days post-coitus were collected according to an IACUC-approved protocol to Dr. L. Sherman at the Oregon Health and Science University.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: western european house mouse (aka mus musculus domesticus)
C: house mouse (aka mus musculus)
D: mus sp. (mice (aka mus sp.))
E: mice (aka mus <genus>) (aka mus <genus>)
F: None of the above. | [C] |
<Instruct>: Given the context 'The mouse embryos were immersion-fixed in Zamboni's fixative overnight at 4 degrees C then washed with phosphate buffered saline (PBS; 130 mM NaCl, 20 mM sodium phosphate buffer, pH 7.4).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus musculus (house mouse) (aka mus musculus)
C: western european house mouse (aka mus musculus domesticus)
D: mus cricetus (aka cricetus cricetus)
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [B] |
<Instruct>: Given the context 'Fixed mouse embryos were shipped to Vermont in sucrose.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus cricetus (aka cricetus cricetus)
C: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: None of the above. | [D] |
<Instruct>: Given the context 'Sections were dried at room temperature, washed in 1× PBS and incubated overnight in blocking buffer (1× PBS consisting of 10% (v/v) heat-inactivated horse serum (Invitrogen/Gibco), 0.5% Triton X-100 (Sigma), and 0.1% sodium azide (Fisher)).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: eques
B: equetus
C: horse (aka equus caballus)
D: equus africanus (aka equus asinus africanus)
E: equus sp.
F: None of the above. | [C] |
<Instruct>: Given the context 'Primary antibodies used were: rabbit anti-p75 (1:1500, generous gift from Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit]
<Options>: A: rabbits (aka oryctolagus cuniculus)
B: lepus europaeus europaeus
C: european hare (aka lepus europaeus)
D: ox (aka bos taurus) (aka bos taurus)
E: swamp rabbit (aka sylvilagus aquaticus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Primary antibodies used were: rabbit anti-p75 (1:1500, generous gift from Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit]
<Options>: A: lepus europaeus europaeus
B: european hare (aka lepus europaeus)
C: swamp rabbit (aka sylvilagus aquaticus)
D: ox (aka bos taurus) (aka bos taurus)
E: None of the above. | [E] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; rabbit; chicken]
<Options>: A: lepus europaeus europaeus
B: gallus sp.
C: gallasellus
D: mus molossinus (aka mus musculus molossinus)
E: mus musculus (house mouse) (aka mus musculus)
F: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
G: japanese white rabbit (aka oryctolagus cuniculus)
H: bovidae
I: gallio
J: mus (aka mus <subgenus>) (aka mus <subgenus>)
K: marsh rabbit (aka sylvilagus palustris)
L: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
M: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
N: cattle (aka bos)
O: peromyscus
P: None of the above. | [E; G; L] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; rabbit; chicken]
<Options>: A: gallus gallus philippensis (aka gallus gallus gallus)
B: european rabbit (aka oryctolagus cuniculus)
C: chickens (aka gallus gallus)
D: mice (aka mus <genus>) (aka mus <genus>)
E: swamp rabbit (aka sylvilagus aquaticus)
F: mouse (aka mus musculus)
G: lepus (hares) (aka lepus)
H: ox (aka bos taurus) (aka bos taurus)
I: gallorhynchus
J: eastern european house mouse (aka mus musculus musculus)
K: gallus
L: gallus sp.
M: peromyscus
N: mus molossinus (aka mus musculus molossinus)
O: bovidae
P: None of the above. | [F; B; C] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; rabbit; chicken]
<Options>: A: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
B: cattle (aka bos)
C: leporidae (rabbits and hares) (aka leporidae)
D: miletus gallus gallus
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: domestic rabbit (aka oryctolagus cuniculus)
G: mus molossinus (aka mus musculus molossinus)
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: gallio
J: lepus europaeus europaeus
K: gallasellus
L: landfowls (aka galliformes)
M: mouse (aka mus musculus)
N: mus sp. (mice (aka mus sp.))
O: ox (aka bos taurus) (aka bos taurus)
P: None of the above. | [M; F; A] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; chicken]
<Options>: A: gallus gallus domesticus (aka gallus gallus)
B: ox (aka bos taurus) (aka bos taurus)
C: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
D: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
E: lepus europaeus europaeus
F: gallus sp.
G: gallus
H: bovidae
I: avian (aka aves)
J: arilus gallus
K: None of the above. | [D; A] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; chicken]
<Options>: A: miletus gallus gallus
B: gallorhynchus
C: bovidae
D: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
E: leporidae (rabbits and hares) (aka leporidae)
F: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
G: european hare (aka lepus europaeus)
H: turkey (aka meleagris gallopavo)
I: gallasellus
J: gallus gallus domesticus (aka gallus gallus)
K: None of the above. | [D; J] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; sheep; rabbit]
<Options>: A: peromyscus
B: mus sp. (mice (aka mus sp.))
C: bovidae
D: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: suidae (pigs (aka suidae))
G: japanese white rabbit (aka oryctolagus cuniculus)
H: mouse (aka mus musculus)
I: dall's sheep (aka ovis dalli)
J: lepus europaeus europaeus
K: marsh rabbit (aka sylvilagus palustris)
L: ovis orientalis aries (aka ovis aries)
M: ovis aries vignei (aka ovis vignei)
N: ovis nivicola (ovis canadensis nivicola) (aka ovis nivicola)
O: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
P: None of the above. | [H; L; G] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; sheep; rabbit]
<Options>: A: ovis nivicola (ovis canadensis nivicola) (aka ovis nivicola)
B: peromyscus
C: ovis vignei (ovis orientalis vignei) (aka ovis vignei)
D: lepus (hares) (aka lepus)
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: european hare (aka lepus europaeus)
G: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
H: bovidae
I: mus musculus (house mouse) (aka mus musculus)
J: sheep (aka ovis aries)
K: suidae (pigs (aka suidae))
L: mus <genus> (mice (aka mus <genus>))
M: swamp rabbit (aka sylvilagus aquaticus)
N: lepus europaeus europaeus
O: western european house mouse (aka mus musculus domesticus)
P: None of the above. | [I; J; G] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; sheep; rabbit]
<Options>: A: peromyscus
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: japanese white rabbit (aka oryctolagus cuniculus)
D: european hare (aka lepus europaeus)
E: marsh rabbit (aka sylvilagus palustris)
F: hares (aka lepus)
G: mouse (aka mus musculus)
H: lepus europaeus europaeus
I: mus <genus> (mice (aka mus <genus>))
J: suidae (pigs (aka suidae))
K: ovis sp.
L: ovis ovis (aka ovis aries)
M: ovis
N: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
O: ovis nivicola (ovis canadensis nivicola) (aka ovis nivicola)
P: None of the above. | [G; L; C] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat]
<Options>: A: sueus
B: bovidae
C: goats (aka capra hircus)
D: capra hircus aegagrus (aka capra aegagrus)
E: capneidae
F: None of the above. | [C] |
<Instruct>: Given the context 'RNA Extraction/cDNA synthesis
Sympathetic ganglia were removed from chick embryos and RNA was isolated using TriReagent (Molecular Research Center), an acidified guanidinium with phenol extraction method', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: fopius
B: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
C: gallasellus
D: zebrafish (aka danio rerio)
E: gallus domesticus (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'TaqMan probes were used to quantify the progression of the PCR reaction and reactions were normalized using the constitutively expressed gene chick ribosomal binding protein s17 (CHRPS).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus gallus domesticus (aka gallus gallus)
B: zebrafish (aka danio rerio)
C: gallorhynchus
D: avian (aka aves)
E: miletus gallus gallus
F: None of the above. | [A] |
<Instruct>: Given the context 'The sequences were used for primer/probes sets: for BDNF: forward: 5'-AGCCCAGTGAGGAAAACAAG-3', reverse: 5'-ACTCCTCGAGCAGAAAGAGC-3', probe: 5'-[6-FAM]-TACACATCCCGAGTCATGCTGAGCA-[BHQ]-3'; for CHRPS (chick ribosomal binding protein S-17): 5'AACGACTTCCACACCAACAA3', reverse: 5'CTTCATCAGGTGGGTGACAT3', probe: 5'-[6-FAM]-CGCCATCATCCCCAGCAAGA [BHQ]-3'.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: zebrafish (aka danio rerio)
B: gallus sp.
C: arilus gallus
D: mus spretus (mus musculus spretus) (aka mus spretus)
E: gallus gallus domesticus (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Sympathetic ganglia were removed from the lumbar region of the paravertebral chain of St. 29/30 (E6.5) chick embryos and placed in Modified Puck's solution with glucose (MPG).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: chicken (aka gallus gallus)
B: zebrafish (aka danio rerio)
C: arilus gallus
D: mus spretus (mus musculus spretus) (aka mus spretus)
E: gallorhynchus
F: None of the above. | [A] |
<Instruct>: Given the context 'Cells were then resuspended in Dulbecco's Modified Eagle Medium (DMEM) consisting of 10% horse serum, 2% fetal calf serum, and 10 mg/ml penicillin/streptomycin.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: equine (aka equus caballus)
B: equetus
C: equus subgen. sussemionus (aka equus)
D: equus przewalskii (equus caballus przewalskii) (aka equus przewalskii)
E: eques
F: None of the above. | [A] |
<Instruct>: Given the context 'For in vivo studies, 25 μg BrdU was injected into the amnion of chick embryos at St. 27.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
B: mus spretus (mus musculus spretus) (aka mus spretus)
C: gallus sp.
D: gallio
E: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Abbreviations
BDNF, brain-derived neurotrophic factor; BrdU, Bromodeoxyuridine; DA, dorsal aorta; DMEM, Dulbecco's Modified Eagle's Medium; DRG, dorsal root ganglion; E, embryonic day; HS, horse serum; MPG, Modified Puck's solution with glucose; NGF, nerve growth factor; NC, notochord; NT, neural tube; NT-3, neurotrophin-3; NTR, neurotrophin receptor; PBS, phosphate-buffered saline; SC, spinal cord; SCG, superior cervical ganglion; SEM, standard error of the mean; SG, sympathetic ganglion; St., stage; w/v, weight/volume; v/v, volume/volume.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: horses (aka equidae)
B: russian wild horse (aka equus ferus)
C: domestic horse (aka equus caballus)
D: equus sp.
E: equus przewalskii (equus caballus przewalskii) (aka equus przewalskii)
F: None of the above. | [C] |
<Instruct>: Given the context 'Abbreviations
BDNF, brain-derived neurotrophic factor; BrdU, Bromodeoxyuridine; DA, dorsal aorta; DMEM, Dulbecco's Modified Eagle's Medium; DRG, dorsal root ganglion; E, embryonic day; HS, horse serum; MPG, Modified Puck's solution with glucose; NGF, nerve growth factor; NC, notochord; NT, neural tube; NT-3, neurotrophin-3; NTR, neurotrophin receptor; PBS, phosphate-buffered saline; SC, spinal cord; SCG, superior cervical ganglion; SEM, standard error of the mean; SG, sympathetic ganglion; St., stage; w/v, weight/volume; v/v, volume/volume.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: horses (aka equidae)
B: equus przewalskii (equus caballus przewalskii) (aka equus przewalskii)
C: equus sp.
D: russian wild horse (aka equus ferus)
E: None of the above. | [E] |
<Instruct>: Given the context 'Identification of a human peripheral blood monocyte subset that differentiates into osteoclasts
Abstract
Increased bone resorption mediated by osteoclasts causes various diseases such as osteoporosis and bone erosion in rheumatoid arthritis (RA).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: animals (aka metazoa)
C: suborder
D: macrobiotus sapiens
E: birds (aka aves)
F: None of the above. | [A] |
<Instruct>: Given the context 'In the present study, we show that the purified CD16- human peripheral blood monocyte subset, but not the CD16+ monocyte subset, differentiates into osteoclast by stimulation with receptor activator of NF-κB ligand (RANKL) in combination with macrophage colony-stimulating factor (M-CSF).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: species
C: homo sapiens (human) (aka homo sapiens)
D: this
E: suborder
F: None of the above. | [C] |
<Instruct>: Given the context 'Interestingly, the deletion of RANKL or c-Fos gene, which is important for osteoclastogenesis, results in minimal bone destruction in mouse models of arthritis [1,2].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mice (aka mus sp.) (aka mus sp.)
C: mouse (aka mus musculus)
D: mus domesticus (aka mus musculus domesticus)
E: peromyscus
F: None of the above. | [C] |
<Instruct>: Given the context 'It is reported that osteoclast precursors reside in human peripheral blood monocytes [4,5].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: macrobiotus sapiens
C: probles
D: suborder
E: eutherian mammals (aka eutheria)
F: None of the above. | [A] |
<Instruct>: Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; mice]
<Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus musculus (house mouse) (aka mus musculus)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: genus
F: house mouse (aka mus musculus)
G: human (aka homo sapiens)
H: probles
I: homo (humans) (aka homo)
J: mus <subgenus> (mus (aka mus <subgenus>))
K: None of the above. | [G; F] |
<Instruct>: Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; mice]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: human (aka homo sapiens)
C: mouse (aka mus musculus)
D: mus domesticus (aka mus musculus domesticus)
E: aides
F: humans (aka homo)
G: subsection
H: suborder
I: mus sp. (mice (aka mus sp.))
J: mus castaneus (aka mus musculus castaneus)
K: None of the above. | [B; C] |
<Instruct>: Given the context 'Monocytes are therefore involved not only in synovial inflammation, but also in bone remodeling as potential precursors for synovial macrophages and osteoclasts.
Human peripheral blood monocytes consist of two major subsets, CD16+ and CD16-, comprising 5–10% and 90–95% of the monocytes, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: kingdom
B: birds (aka aves)
C: placental mammals (aka eutheria)
D: homo sapiens (human) (aka homo sapiens)
E: mammals (aka mammalia)
F: None of the above. | [D] |
<Instruct>: Given the context 'In the present study, we determined the human peripheral blood monocyte subset that differentiates into osteoclasts, and revealed that each subset exhibits a different response for osteoclastogenic stimuli.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: mammals (aka mammalia)
B: kingdom
C: animals (aka metazoa)
D: homo sapiens (human) (aka homo sapiens)
E: avian (aka aves)
F: None of the above. | [D] |
<Instruct>: Given the context 'In the present study, we determined the human peripheral blood monocyte subset that differentiates into osteoclasts, and revealed that each subset exhibits a different response for osteoclastogenic stimuli.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: mammals (aka mammalia)
B: kingdom
C: animals (aka metazoa)
D: avian (aka aves)
E: None of the above. | [E] |
<Instruct>: Given the context 'Flow cytometry analysis using FITC-conjugated mouse anti-CD14 mAb (MY4; Bechman Coulter, Fullerton, CA, USA) and phycoerythin-conjugated mouse anti-CD16 mAb (3G8; BD Biosciences, San Jose, CA, USA) showed that the purities of the CD16+ and CD16- monocytes were more than 90% and 92%, respectively.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus cricetus (aka cricetus cricetus)
C: house mouse (aka mus musculus)
D: mus molossinus (aka mus musculus molossinus)
E: mus sp. (mice (aka mus sp.))
F: None of the above. | [C] |
<Instruct>: Given the context 'For the other experiment, monocytes were purified using CD14 MicroBeads (Miltenyi Biotec), and then stained either with FITC-conjugated mouse anti-CD33 mAb (MY9; Bechman Coulter) or phycoerythin-conjugated mouse anti-CD16 mAb (3G8).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus sp. (mice (aka mus sp.))
B: mus <genus> (mice (aka mus <genus>))
C: house mouse (aka mus musculus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus domesticus (aka mus musculus domesticus)
F: None of the above. | [C] |
<Instruct>: Given the context 'Osteoclast differentiation
Purified CD16+ and CD16- monocytes (5 × 104 cells/well) were incubated in 96-well plates in αMEM (Sigma, St Louis, MO, USA) with heat-inactivated 10% fetal bovine serum (FBS) (Sigma) or with Ultra-Low IgG FBS (IgG < 5 μg/ml; Invitrogen, Carlsbad, CA, USA), and where indicated with M-CSF + RANKL (Peprotech, Rocky Hill, NJ, USA).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: bos bubalis (aka bubalus bubalis)
B: bos sp.
C: bos bubalis bubalis (aka bubalus bubalis bubalis)
D: bos indicus (bos primigenius indicus) (aka bos indicus)
E: domestic cow (aka bos taurus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: sueus
B: mus domesticus (aka mus musculus domesticus)
C: mus <genus> (mice (aka mus <genus>))
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: capneidae
F: capra hircus aegagrus (aka capra aegagrus)
G: mus (aka mus <subgenus>) (aka mus <subgenus>)
H: mouse (aka mus musculus)
I: domestic goat (aka capra hircus)
J: capreolus
K: None of the above. | [I; H] |
<Instruct>: Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: capneidae
B: domestic goat (aka capra hircus)
C: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
D: mouse (aka mus musculus)
E: peromyscus
F: mus cricetus (aka cricetus cricetus)
G: eastern european house mouse (aka mus musculus musculus)
H: mus molossinus (aka mus musculus molossinus)
I: sueus
J: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
K: None of the above. | [B; D] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: lepus europaeus europaeus
B: peromyscus
C: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
D: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
E: european hare (aka lepus europaeus)
F: swamp rabbit (aka sylvilagus aquaticus)
G: bovidae
H: capra hircus (capra aegagrus hircus) (aka capra hircus)
I: capneidae
J: mus (aka mus <genus>) (aka mus <genus>)
K: mus musculus (house mouse) (aka mus musculus)
L: capraita
M: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
N: rabbits (aka oryctolagus cuniculus)
O: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
P: None of the above. | [N; H; K] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: swamp rabbit (aka sylvilagus aquaticus)
B: capneidae
C: lepus europaeus europaeus
D: european hare (aka lepus europaeus)
E: capraita
F: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
G: rabbits (aka oryctolagus cuniculus)
H: mus (aka mus <genus>) (aka mus <genus>)
I: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
J: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
K: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
L: peromyscus
M: bovidae
N: mus musculus (house mouse) (aka mus musculus)
O: None of the above. | [G; O; N] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: rabbits and hares (aka leporidae)
B: mus (aka mus <genus>) (aka mus <genus>)
C: capraita
D: caponia
E: peromyscus
F: capra
G: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
H: mus cricetus (aka cricetus cricetus)
I: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
J: marsh rabbit (aka sylvilagus palustris)
K: capneidae
L: cattle (aka bos)
M: mus molossinus (aka mus musculus molossinus)
N: mus musculus (house mouse) (aka mus musculus)
O: goats (aka capra hircus)
P: None of the above. | [I; O; N] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: rabbits and hares (aka leporidae)
C: house mouse (aka mus musculus)
D: lepus europaeus europaeus
E: capra
F: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
G: marsh rabbit (aka sylvilagus palustris)
H: lepus cuniculus (aka oryctolagus cuniculus)
I: mus <subgenus> (mus (aka mus <subgenus>))
J: peromyscus
K: sueus
L: capra aegagrus cretica (aka capra hircus cretica)
M: donkey (aka equus asinus)
N: capra hircus (capra aegagrus hircus) (aka capra hircus)
O: swamp rabbit (aka sylvilagus aquaticus)
P: None of the above. | [H; N; C] |
<Instruct>: Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <genus>) (aka mus <genus>)
B: mus molossinus (aka mus musculus molossinus)
C: peromyscus
D: mus cricetus (aka cricetus cricetus)
E: house mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Peripheral blood monocytes (1 × 105 cells) were incubated with 1 μg human IgG for 15 minutes, and were then stained with three fluorochrome-labeled mAbs for 45 minutes on ice.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: primate (aka primates)
B: homo (humans) (aka homo)
C: homo sapiens (human) (aka homo sapiens)
D: suborder
E: probles
F: None of the above. | [C] |
<Instruct>: Given the context 'The cells were fixed in acetone and then stained with anti-αvβ3 mAb (LM609; Chemicon, Temecula, CA, USA) or mouse IgG1 (11711; R&D Systems) as an isotype-matched control.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: mus cricetus (aka cricetus cricetus)
C: peromyscus
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: donkey (aka equus asinus)
C: house mouse (aka mus musculus)
D: bovidae
E: mice (aka mus <genus>) (aka mus <genus>)
F: eastern european house mouse (aka mus musculus musculus)
G: capra aegagrus cretica (aka capra hircus cretica)
H: mus cricetus (aka cricetus cricetus)
I: capra hircus aegagrus (aka capra aegagrus)
J: capra aegagrus hircus (aka capra hircus)
K: None of the above. | [J; C] |
<Instruct>: Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: goat (aka capra hircus) (aka capra hircus)
C: capreolus
D: mus cricetus (aka cricetus cricetus)
E: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
F: mus sp. (mice (aka mus sp.))
G: cattle (aka bos)
H: peromyscus
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: wild goat (aka capra aegagrus)
K: None of the above. | [B; A] |
<Instruct>: Given the context 'A total of 1 × 105 cells was then Fc blocked with 1 μg human IgG for 15 minutes, and was stained with Alexa Fluor 647-conjugated mAb either to phospho-p38 MAPK (T180/Y182) or to phospho-ERK1/2 (T202/Y204) (BD Biosciences) for 30 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: suborder
B: primate (aka primates)
C: biota (aka cellular organisms)
D: eutherian mammals (aka eutheria)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Alexa Fluor 647-conjugated mouse IgG1 (BD Biosciences) was used as an isotype control.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus <genus> (mice (aka mus <genus>))
C: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
D: mus cricetus (aka cricetus cricetus)
E: house mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Immunohistochemistry
Synovial tissue samples were obtained during total knee joint replacement surgery from four RA patients.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: subsection
B: cancer
C: kingdom
D: this
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: bovidae
C: ox (aka bos taurus) (aka bos taurus)
D: bovinae
E: peromyscus
F: capra aegagrus cretica (aka capra hircus cretica)
G: donkey (aka equus asinus)
H: mus domesticus (aka mus musculus domesticus)
I: house mouse (aka mus musculus)
J: bos indicus (bos primigenius indicus) (aka bos indicus)
K: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
L: bos (cattle) (aka bos)
M: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
N: bos bubalis bubalis (aka bubalus bubalis bubalis)
O: capra aegagrus hircus (aka capra hircus)
P: None of the above. | [O; I; C] |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: bovinae
C: bos taurus x bos indicus (aka bos indicus x bos taurus)
D: mus cricetus (aka cricetus cricetus)
E: capra aegagrus hircus (aka capra hircus)
F: bos bovis (aka bos taurus)
G: capraita
H: mus sp. (mice (aka mus sp.))
I: capreolus
J: sueus
K: mouse (aka mus <genus>)
L: bos bubalis (aka bubalus bubalis)
M: bovidae
N: mus molossinus (aka mus musculus molossinus)
O: None of the above. | [E; A; F] |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: bos indicus (bos primigenius indicus) (aka bos indicus)
C: bos sp.
D: mice (aka mus sp.) (aka mus sp.)
E: mus musculus (house mouse) (aka mus musculus)
F: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
G: mus <subgenus> (mus (aka mus <subgenus>))
H: caponia
I: capra
J: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
K: bos bubalis bubalis (aka bubalus bubalis bubalis)
L: bovinae
M: capra hircus (capra aegagrus hircus) (aka capra hircus)
N: dairy cow (aka bos taurus)
O: cattle (aka bos)
P: None of the above. | [M; E; N] |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: bos sp.
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: bos taurus x bos indicus (aka bos indicus x bos taurus)
E: mouse (aka mus musculus)
F: peromyscus
G: mus cricetus (aka cricetus cricetus)
H: bovidae
I: capra cretica (aka capra hircus cretica)
J: donkey (aka equus asinus)
K: bos taurus indicus (aka bos indicus)
L: capra aegagrus hircus (aka capra hircus)
M: capneidae
N: bovine (aka bos taurus)
O: caponia
P: None of the above. | [L; E; N] |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: bos taurus indicus (aka bos indicus)
B: sueus
C: boveria
D: bos sp.
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: goat (aka capra hircus) (aka capra hircus)
G: capreolus
H: peromyscus
I: mus <subgenus> (mus (aka mus <subgenus>))
J: eastern european house mouse (aka mus musculus musculus)
K: capra hircus aegagrus (aka capra aegagrus)
L: bovinae
M: mus musculus (house mouse) (aka mus musculus)
N: capneidae
O: ox (aka bos taurus) (aka bos taurus)
P: None of the above. | [F; M; O] |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: peromyscus
B: bos taurus x bos indicus (aka bos indicus x bos taurus)
C: caponia
D: boveria
E: mus sp. (mice (aka mus sp.))
F: mus cricetus (aka cricetus cricetus)
G: goats (aka capra hircus)
H: bos primigenius taurus (aka bos taurus)
I: capreolus
J: capraita
K: bos indicus (bos primigenius indicus) (aka bos indicus)
L: donkey (aka equus asinus)
M: mus musculus (house mouse) (aka mus musculus)
N: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
O: bos sp.
P: None of the above. | [G; M; H] |
<Instruct>: Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; goat]
<Options>: A: house mouse (aka mus musculus)
B: goats (aka capra hircus)
C: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
D: mouse (aka mus <genus>)
E: capneidae
F: peromyscus
G: mus molossinus (aka mus musculus molossinus)
H: capra
I: mus domesticus (aka mus musculus domesticus)
J: capraita
K: None of the above. | [A; B] |
<Instruct>: Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; goat]
<Options>: A: capneidae
B: mus <genus> (mice (aka mus <genus>))
C: capraita
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: sueus
F: goat (aka capra hircus) (aka capra hircus)
G: mus musculus (house mouse) (aka mus musculus)
H: bovidae
I: mus molossinus (aka mus musculus molossinus)
J: mus cricetus (aka cricetus cricetus)
K: None of the above. | [G; F] |
<Instruct>: Given the context 'Results
Induction of osteoclasts from CD16- peripheral blood monocytes
To identify the monocyte subset that differentiates into osteoclasts, we examined osteoclast formation from CD16+ and CD16- human peripheral blood monocytes.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: species
B: primate (aka primates)
C: human (aka homo sapiens)
D: cellular organisms (biota) (aka cellular organisms)
E: this
F: None of the above. | [C] |
<Instruct>: Given the context 'We therefore examined the involvement of αvβ3 in RANKL + M-CSF-induced osteoclastogenesis in human CD16- monocytes using siRNA targeting the integrin-β3 subunit.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: kingdom
B: mammals (aka mammalia)
C: probles
D: homo sapiens (human) (aka homo sapiens)
E: placental mammals (aka eutheria)
F: None of the above. | [D] |
<Instruct>: Given the context 'We therefore examined the involvement of αvβ3 in RANKL + M-CSF-induced osteoclastogenesis in human CD16- monocytes using siRNA targeting the integrin-β3 subunit.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: kingdom
B: mammals (aka mammalia)
C: placental mammals (aka eutheria)
D: probles
E: None of the above. | [E] |
<Instruct>: Given the context 'Interestingly, integrin-β3 knockdown did not alter the NFATc1 mRNA level (Figure 7), suggesting that signal transduction mediated by integrin β3 does not affect the expression of NFATc1.
Detection of CD16+ and CD16- macrophages in synovium of RA patients
RA synovial macrophages are derived from peripheral blood monocytes, and their recruitment into the synovium is facilitated by various adhesion molecules and chemokines [24].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: kingdom
C: mouse (aka mus musculus)
D: theraps
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Discussion
Human peripheral blood monocytes are a heterogeneous population, and they are divided into two subsets based on the expression of CD16.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: this
C: animals (aka metazoa)
D: eutherian mammals (aka eutheria)
E: humans (aka homo)
F: None of the above. | [A] |
<Instruct>: Given the context 'It was recently reported that bone marrow macrophages of integrin-β3-deficient mice could not differentiate into mature osteoclasts in vitro, suggesting that αvβ3 is involved not only in activation, but also in differentiation, of osteoclasts in mice [26,27].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus cricetus (aka cricetus cricetus)
C: peromyscus
D: mice (aka mus sp.) (aka mus sp.)
E: mus castaneus (aka mus musculus castaneus)
F: None of the above. | [A] |
<Instruct>: Given the context 'In addition, it was reported that echistatin, an αvβ3 antagonist, inhibited osteoclast formation of mouse bone marrow cells [30].
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: mus <genus> (mice (aka mus <genus>))
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: mus musculus (house mouse) (aka mus musculus)
E: mice (aka mus sp.) (aka mus sp.)
F: None of the above. | [D] |
<Instruct>: Given the context 'In accordance with these reports, our data showed that knockdown of integrin-β3 expression resulted in downregulation of the αvβ3 heterodimer, and abrogated osteoclastogenesis from human peripheral blood CD16- monocytes.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: cellular organisms (biota) (aka cellular organisms)
B: suborder
C: this
D: eutherian mammals (aka eutheria)
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Indeed, integrin αvβ3 antagonists effectively treated osteoporosis in mice, rats and humans, and protected bone destruction in rat adjuvant-induced arthritis in vivo [31-34].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice; rats; humans]
<Options>: A: house mouse (aka mus musculus)
B: rat (aka rattus) (aka rattus)
C: mus castaneus (aka mus musculus castaneus)
D: mus sp. (mice (aka mus sp.))
E: rats (aka rattus sp.) (aka rattus sp.)
F: genus
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: rattus rattoides (aka rattus rattus)
I: western european house mouse (aka mus musculus domesticus)
J: rats (aka rattus norvegicus) (aka rattus norvegicus)
K: neanderthal man (aka homo sapiens neanderthalensis)
L: primate (aka primates)
M: kingdom
N: rattus norvegicus albus
O: human (aka homo sapiens)
P: None of the above. | [A; J; O] |
End of preview. Expand
in Data Studio
README.md exists but content is empty.
- Downloads last month
- 12