instruction stringlengths 161 2.29k | input stringlengths 137 955 | response stringclasses 11 values |
|---|---|---|
<Instruct>: Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallacoccus
B: gallispira (aka candidatus gallispira)
C: gallorhynchus
D: gallus sp.
E: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
F: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
G: arilus gallus
H: gallio
I: miletus gallus gallus
J: cancer gallus (aka calappa gallus)
K: None of the above. | F |
<Instruct>: Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus terricolor (earth-colored mouse) (aka mus terricolor)
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: mus sp. (mice (aka mus sp.))
D: mus domesticus (aka mus musculus domesticus)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
G: mouse (aka mus musculus)
H: mice (aka mus <genus>) (aka mus <genus>)
I: peromyscus
J: None of the above. | G |
<Instruct>: Given the context 'In chicken embryos, TrkB-expressing cells first appear at Hamburger-Hamilton Stage (St) 27 and they co-express HNK-1, confirming that they are migrating neural crest cells.', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallacoccus
B: cancer gallus (aka calappa gallus)
C: gallispira (aka candidatus gallispira)
D: chicken (aka gallus gallus)
E: gallus sp.
F: gallorhynchus
G: landfowls (aka galliformes)
H: gallio
I: arilus gallus
J: gallasellus
K: None of the above. | D |
<Instruct>: Given the context 'BDNF transcript expression parallels that of TrkB. In the mouse, TrkB-positive cells surround newly formed sympathetic ganglia and a small number of TrkB positive cells that co-express tyrosine hydroxylase are seen within ganglia between E13.5-15.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: peromyscus
C: mus terricolor (earth-colored mouse) (aka mus terricolor)
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: mus musculus (house mouse) (aka mus musculus)
F: eastern european house mouse (aka mus musculus musculus)
G: mus sp. (mice (aka mus sp.))
H: mus <genus> (mice (aka mus <genus>))
I: nannomys musculoides (aka mus musculoides)
J: None of the above. | E |
<Instruct>: Given the context 'In cell culture, many cells from St. 29–30 chicken lumbar sympathetic ganglia express neural markers and are dividing, indicating that they are sympathoblasts.', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: avian (aka aves)
B: gallio
C: chickens (aka gallus gallus)
D: arilus gallus
E: gallus
F: miletus gallus gallus
G: gallacoccus
H: gallus sp.
I: cancer gallus (aka calappa gallus)
J: gallorhynchus
K: None of the above. | C |
<Instruct>: Given the context 'In chicken embryos, migrating neural crest cells express catecholamines at Hamburger/Hamilton Stage (St.) 19, and these cells form the primary sympathetic chain dorsolateral to the aorta at St. 22 (E3.5)', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
B: gallasellus
C: gallus
D: miletus gallus gallus
E: landfowls (aka galliformes)
F: gallispira (aka candidatus gallispira)
G: gallacoccus
H: arilus gallus
I: gallus domesticus (aka gallus gallus)
J: gallus sp.
K: None of the above. | I |
<Instruct>: Given the context 'Time lapse photography has shown that cultured E15.5–E16.5 sympathetic neurons from rat embryos extend axons while they divide [3-5].', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options. | <Options>: A: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
B: rattus (rats (aka rattus))
C: rats (aka rattus norvegicus) (aka rattus norvegicus)
D: rattus rattus complex lineage i
E: rattus rattus iv (aka rattus rattus complex lineage iv)
F: rattus sp. (rats (aka rattus sp.))
G: black rat (aka rattus rattus)
H: rattus rattus lineage iii (aka rattus rattus complex lineage iii)
I: None of the above. | C |
<Instruct>: Given the context 'There are severe sympathetic defects in the superior cervical ganglion of individual NT-3 and NGF knockout mice [8-10].', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mus cricetus (aka cricetus cricetus)
B: xenomys
C: mus terricolor (earth-colored mouse) (aka mus terricolor)
D: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: mouse (aka mus <genus>)
G: house mouse (aka mus musculus)
H: mus sp. (mice (aka mus sp.))
I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
J: peromyscus
K: None of the above. | G |
<Instruct>: Given the context 'Furthermore, there is no additional cell death in the superior cervical ganglion of NT-3 and NGF double knockout mouse embryos, suggesting that all of the neurons are dependent on both neurotrophins for survival [11].', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus sp. (mice (aka mus sp.))
B: western european house mouse (aka mus musculus domesticus)
C: eastern european house mouse (aka mus musculus musculus)
D: mice (aka mus <genus>) (aka mus <genus>)
E: mus terricolor (earth-colored mouse) (aka mus terricolor)
F: mus <subgenus> (mus (aka mus <subgenus>))
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: peromyscus
I: mus musculus (house mouse) (aka mus musculus)
J: None of the above. | I |
<Instruct>: Given the context 'There is also an increase in sympathetic neuron cell death in TrkA knockout mice [12].', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: mus musculus (house mouse) (aka mus musculus)
C: mouse (aka mus <genus>)
D: mus domesticus (aka mus musculus domesticus)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: peromyscus
G: mus terricolor (earth-colored mouse) (aka mus terricolor)
H: xenomys
I: mus sp. (mice (aka mus sp.))
J: mus cricetus (aka cricetus cricetus)
K: None of the above. | B |
<Instruct>: Given the context 'However, in TrkB and BDNF knockout mice, there is no apparent phenotype in the superior cervical ganglion, and there is little evidence that TrkB or BDNF is expressed in sympathetic ganglia.', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: peromyscus
B: xenomys
C: western european house mouse (aka mus musculus domesticus)
D: mus sp. (mice (aka mus sp.))
E: mus cricetus (aka cricetus cricetus)
F: mouse (aka mus <genus>)
G: mus <subgenus> (mus (aka mus <subgenus>))
H: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
I: house mouse (aka mus musculus)
J: mus terricolor (earth-colored mouse) (aka mus terricolor)
K: None of the above. | I |
<Instruct>: Given the context 'To test whether BDNF, the ligand for TrkB, was present in embryonic chick sympathetic ganglia, we used quantitative real-time PCR with TaqMan probes to determine the relative abundance of BDNF transcripts in total RNA extracted from lumbar sympathetic ganglia at St. 29/30 (E6.5), St. 31 (E7), St. 34 (E8), and E9.', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: avian (aka aves)
B: fopius
C: landfowls (aka galliformes)
D: chickens (aka gallus gallus)
E: gallorhynchus
F: gallus sp.
G: gallio
H: gallasellus
I: cancer gallus (aka calappa gallus)
J: miletus gallus gallus
K: None of the above. | D |
<Instruct>: Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: avian (aka aves)
B: gallus sp.
C: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
D: gallus
E: gallispira (aka candidatus gallispira)
F: gallus gallus domesticus (aka gallus gallus)
G: cancer gallus (aka calappa gallus)
H: gallasellus
I: arilus gallus
J: gallacoccus
K: None of the above. | F |
<Instruct>: Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: house mouse (aka mus musculus)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: nannomys musculoides (aka mus musculoides)
D: mus terricolor (earth-colored mouse) (aka mus terricolor)
E: peromyscus
F: mus <subgenus> (mus (aka mus <subgenus>))
G: mus domesticus (aka mus musculus domesticus)
H: mus <genus> (mice (aka mus <genus>))
I: mice (aka mus sp.) (aka mus sp.)
J: None of the above. | A |
<Instruct>: Given the context 'In the chicken, TrkB expression is transient, and completely lost by St 34 (E8).', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: arilus gallus
B: gallus
C: gallasellus
D: avian (aka aves)
E: gallispira (aka candidatus gallispira)
F: gallacoccus
G: cancer gallus (aka calappa gallus)
H: gallio
I: landfowls (aka galliformes)
J: phasianus gallus (aka gallus gallus)
K: None of the above. | J |
<Instruct>: Given the context 'Early sympathetic ganglia contain at least two subpopulations: early differentiating neurons that lack TrkB expression and express TrkA and TrkC, and late differentiating sympathoblasts that express TrkB. Explant cultures of sympathetic ganglia from E16 chick embryos give rise to two neuronal populations: one that remains close to the explant, and one that migrates away from the explant [1].', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallus
B: arilus gallus
C: gallus sp.
D: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
E: gallorhynchus
F: avian (aka aves)
G: fopius
H: gallio
I: miletus gallus gallus
J: chickens (aka gallus gallus)
K: None of the above. | J |
<Instruct>: Given the context 'In the superior cervical ganglion, an increase in the number of neurons of BDNF null mice is likely due to apoptosis induced by BDNF via p75NTR', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mus cricetus (aka cricetus cricetus)
B: mus terricolor (earth-colored mouse) (aka mus terricolor)
C: mice (aka mus sp.) (aka mus sp.)
D: mus <genus> (mice (aka mus <genus>))
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: peromyscus
G: western european house mouse (aka mus musculus domesticus)
H: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
I: mouse (aka mus musculus)
J: xenomys
K: None of the above. | I |
<Instruct>: Given the context 'If our results indicating that BDNF promotes proliferation of TrkB-positive sympathoblasts in the chicken embryo can be extrapolated to the subset of TrkB-positive sympathoblasts in murine ganglia, then these TrkB-positive cells may be neurons destined to innervate the erector pilli.', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallacoccus
B: cancer gallus (aka calappa gallus)
C: chicken (aka gallus gallus)
D: gallorhynchus
E: arilus gallus
F: avian (aka aves)
G: gallasellus
H: gallispira (aka candidatus gallispira)
I: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
J: gallus
K: None of the above. | C |
<Instruct>: Given the context 'In other studies, TrkB null mice showed no changes in morphology or cell number in superior cervical ganglia [12] or in the intermediolateral column [20]; but this may not be predictive of a phenotype in the lumbar paravertebral chain.', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mus sp. (mice (aka mus sp.))
B: mice (aka mus <genus>) (aka mus <genus>)
C: mus domesticus (aka mus musculus domesticus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus cricetus (aka cricetus cricetus)
F: peromyscus
G: xenomys
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: eastern european house mouse (aka mus musculus musculus)
J: mus terricolor (earth-colored mouse) (aka mus terricolor)
K: None of the above. | D |
<Instruct>: Given the context 'However, if TrkB-positive cells are not normally actively proliferating in vivo, then it would not be surprising that the development of the paravertebral sympathetic chain is not disrupted in TrkB or BDNF null mice.', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: xenomys
D: peromyscus
E: mus sp. (mice (aka mus sp.))
F: eastern european house mouse (aka mus musculus musculus)
G: mus cricetus (aka cricetus cricetus)
H: mus terricolor (earth-colored mouse) (aka mus terricolor)
I: mus musculus (house mouse) (aka mus musculus)
J: mus <genus> (mice (aka mus <genus>))
K: None of the above. | I |
<Instruct>: Given the context 'It may be more informative to examine mice that over express BDNF on a promoter that targets expression to embryonic lumbar ganglia.', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus <genus> (mice (aka mus <genus>))
C: xenomys
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus cricetus (aka cricetus cricetus)
F: peromyscus
G: mouse (aka mus musculus)
H: mice (aka mus sp.) (aka mus sp.)
I: mus terricolor (earth-colored mouse) (aka mus terricolor)
J: western european house mouse (aka mus musculus domesticus)
K: None of the above. | G |
<Instruct>: Given the context 'Unfortunately, such mice do not exist.
', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: peromyscus
B: mus sp. (mice (aka mus sp.))
C: mus cricetus (aka cricetus cricetus)
D: mus terricolor (earth-colored mouse) (aka mus terricolor)
E: xenomys
F: mus <genus> (mice (aka mus <genus>))
G: mouse (aka mus musculus)
H: western european house mouse (aka mus musculus domesticus)
I: mus <subgenus> (mus (aka mus <subgenus>))
J: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
K: None of the above. | G |
<Instruct>: Given the context 'Our findings that the St. 29/30 (E6.5) sympathoblasts are dependent on both NT-3 and NGF for survival in culture are consistent with previous work on mouse sympathoblasts from the superior cervical ganglion', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: peromyscus
B: nannomys musculoides (aka mus musculoides)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: mice (aka mus sp.) (aka mus sp.)
G: mus terricolor (earth-colored mouse) (aka mus terricolor)
H: house mouse (aka mus musculus)
I: mus (aka mus <genus>) (aka mus <genus>)
J: None of the above. | H |
<Instruct>: Given the context 'In contrast, cultured rat superior cervical ganglion sympathetic neurons respond to NT-3 at E14.5 and then to NGF at E19.5, although time points in between were not analyzed [6].
', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options. | <Options>: A: rattus rattoides (aka rattus rattus)
B: rats (aka rattus sp.) (aka rattus sp.)
C: rattus rattus iv (aka rattus rattus complex lineage iv)
D: rattus (rats (aka rattus))
E: rat (aka rattus norvegicus) (aka rattus norvegicus)
F: rattus rattoides (aka rattus pyctoris)
G: rattus rattus lineage iii (aka rattus rattus complex lineage iii)
H: rattus rattus complex lineage i
I: None of the above. | E |
<Instruct>: Given the context 'NT-3 can promote the incorporation of [3H]-thymidine into cultured quail neural crest cells from the trunk region [21,22], Later in rat sympathetic development, NT-3 supports survival of neurons, but does not promote proliferation', select the correct biomedical concept corresponding to 'rat'. Answer using one of the provided options. | <Options>: A: rat (aka rattus) (aka rattus)
B: mus rattus (aka rattus rattus)
C: rattus rattus complex lineage i
D: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
E: rattus rattus lineage iii (aka rattus rattus complex lineage iii)
F: rattus rattus iv (aka rattus rattus complex lineage iv)
G: rattus norvegicus (rats (aka rattus norvegicus))
H: rats (aka rattus sp.) (aka rattus sp.)
I: None of the above. | G |
<Instruct>: Given the context 'NGF promotes an increase in BrdU incorporation from 25% to 35% in the DRG cervical segment 2 in the chick embryo [23].', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallus sp.
B: gallasellus
C: phasianus gallus gallus (aka gallus gallus gallus)
D: avian (aka aves)
E: gallio
F: gallus
G: fopius
H: gallorhynchus
I: cancer gallus (aka calappa gallus)
J: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
K: None of the above. | J |
<Instruct>: Given the context 'In chicken embryos that are treated with NGF in ovo at St. 18 and 21, there is an increase in BrdU uptake after formation of the primary sympathetic chain at St. 23', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: arilus gallus
B: gallacoccus
C: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
D: gallio
E: landfowls (aka galliformes)
F: gallispira (aka candidatus gallispira)
G: gallasellus
H: gallus sp.
I: phasianus gallus (aka gallus gallus)
J: gallorhynchus
K: None of the above. | I |
<Instruct>: Given the context 'Since NGF does not appear to affect proliferation of St. 29/30 (E6.5) chick sympathoblasts, NGF may only promote proliferation in primary, but not secondary chain sympathoblasts.', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallasellus
B: fopius
C: gallus
D: cancer gallus (aka calappa gallus)
E: arilus gallus
F: avian (aka aves)
G: chickens (aka gallus gallus)
H: landfowls (aka galliformes)
I: miletus gallus gallus
J: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
K: None of the above. | G |
<Instruct>: Given the context 'Motor neuron progenitors in the ventral neural tube from the chick embryo express TrkB and when ventral neural tube explants are treated with BDNF, there is an increase in the number of motor neurons produced and BrdU incorporation', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallasellus
B: gallus domesticus (aka gallus gallus)
C: phasianus gallus gallus (aka gallus gallus gallus)
D: gallio
E: cancer gallus (aka calappa gallus)
F: gallus
G: galliformes (landfowls) (aka galliformes)
H: avian (aka aves)
I: gallorhynchus
J: arilus gallus
K: None of the above. | B |
<Instruct>: Given the context 'Future studies will determine whether constitutive expression of BDNF and TrkB in the chick embryo sustains proliferation of differentiating sympathoblasts.
', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallorhynchus
B: gallus sp.
C: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
D: avian (aka aves)
E: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
F: gallasellus
G: cancer gallus (aka calappa gallus)
H: gallio
I: gallus
J: landfowls (aka galliformes)
K: None of the above. | E |
<Instruct>: Given the context 'Methods
Preparation of tissue for immunohistochemistry
The lumbar spinal column and surrounding tissues were dissected from chicken embryos at the indicated stages and placed in Zamboni's fixative (4% (w/v) paraformaldehyde, 15% (v/v) picric acid in 0.1 M sodium phosphate buffer, pH 7.4) for two hours at room temperature.', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallacoccus
B: gallus
C: gallus sp.
D: gallorhynchus
E: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
F: gallispira (aka candidatus gallispira)
G: gallasellus
H: gallio
I: arilus gallus
J: phasianus gallus (aka gallus gallus)
K: None of the above. | J |
<Instruct>: Given the context 'Mouse embryos at 13–15 days post-coitus were collected according to an IACUC-approved protocol to Dr. L. Sherman at the Oregon Health and Science University.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus domesticus (aka mus musculus domesticus)
B: mus (aka mus <genus>) (aka mus <genus>)
C: peromyscus
D: mice (aka mus sp.) (aka mus sp.)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
G: mus (aka mus <subgenus>) (aka mus <subgenus>)
H: mus terricolor (earth-colored mouse) (aka mus terricolor)
I: mus musculus (house mouse) (aka mus musculus)
J: None of the above. | I |
<Instruct>: Given the context 'The mouse embryos were immersion-fixed in Zamboni's fixative overnight at 4 degrees C then washed with phosphate buffered saline (PBS; 130 mM NaCl, 20 mM sodium phosphate buffer, pH 7.4).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mouse (aka mus musculus)
B: mus terricolor (earth-colored mouse) (aka mus terricolor)
C: eastern european house mouse (aka mus musculus musculus)
D: nannomys musculoides (aka mus musculoides)
E: mus <genus> (mice (aka mus <genus>))
F: mus <subgenus> (mus (aka mus <subgenus>))
G: mus sp. (mice (aka mus sp.))
H: mus domesticus (aka mus musculus domesticus)
I: peromyscus
J: None of the above. | A |
<Instruct>: Given the context 'Fixed mouse embryos were shipped to Vermont in sucrose.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: peromyscus
B: mus domesticus (aka mus musculus domesticus)
C: mus <subgenus> (mus (aka mus <subgenus>))
D: mus terricolor (earth-colored mouse) (aka mus terricolor)
E: mice (aka mus sp.) (aka mus sp.)
F: mouse (aka mus musculus)
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
I: mouse (aka mus <genus>)
J: None of the above. | F |
<Instruct>: Given the context 'Sections were dried at room temperature, washed in 1× PBS and incubated overnight in blocking buffer (1× PBS consisting of 10% (v/v) heat-inactivated horse serum (Invitrogen/Gibco), 0.5% Triton X-100 (Sigma), and 0.1% sodium azide (Fisher)).
', select the correct biomedical concept corresponding to 'horse'. Answer using one of the provided options. | <Options>: A: rv-horse
B: equus subg. equus (aka equus)
C: equidae (horses) (aka equidae)
D: equetus
E: equus przewalskii x equus caballus
F: horsetails (aka equisetidae)
G: eques
H: equus sp. llo-2009a
I: horse (aka equus caballus)
J: equus ferus (equus caballus ferus) (aka equus ferus)
K: None of the above. | I |
<Instruct>: Given the context 'Primary antibodies used were: rabbit anti-p75 (1:1500, generous gift from Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'rabbit'. Answer using one of the provided options. | <Options>: A: cuniculus algirus (aka oryctolagus cuniculus algirus)
B: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
C: lepus palustris (aka sylvilagus palustris)
D: oryctolagus sp. 'rabbit_od'
E: leporidae (rabbits and hares) (aka leporidae)
F: hares (aka lepus)
G: european hare (aka lepus europaeus)
H: swamp rabbit (aka sylvilagus aquaticus)
I: european rabbit (aka oryctolagus cuniculus)
J: None of the above. | I |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: peromyscus
E: mus terricolor (earth-colored mouse) (aka mus terricolor)
F: eastern european house mouse (aka mus musculus musculus)
G: mus sp. (mice (aka mus sp.))
H: mouse (aka mus musculus)
I: mouse (aka mus <genus>)
J: None of the above. | H |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: peromyscus
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mus musculus (house mouse) (aka mus musculus)
D: mus sp. (mice (aka mus sp.))
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: mice (aka mus <genus>) (aka mus <genus>)
G: mus (aka mus <subgenus>) (aka mus <subgenus>)
H: nannomys musculoides (aka mus musculoides)
I: mus terricolor (earth-colored mouse) (aka mus terricolor)
J: None of the above. | C |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'rabbit'. Answer using one of the provided options. | <Options>: A: lepus palustris (aka sylvilagus palustris)
B: cuniculus algirus (aka oryctolagus cuniculus algirus)
C: european hare (aka lepus europaeus)
D: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
E: leporidae (rabbits and hares) (aka leporidae)
F: oryctolagus sp. 'rabbit_od'
G: swamp rabbit (aka sylvilagus aquaticus)
H: lepus (hares) (aka lepus)
I: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
J: None of the above. | I |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallus sp.
B: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
C: cancer gallus (aka calappa gallus)
D: arilus gallus
E: gallio
F: gallacoccus
G: avian (aka aves)
H: gallorhynchus
I: gallus
J: gallus gallus domesticus (aka gallus gallus)
K: None of the above. | J |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'rabbit'. Answer using one of the provided options. | <Options>: A: rabbits and hares (aka leporidae)
B: marsh rabbit (aka sylvilagus palustris)
C: hares (aka lepus)
D: cuniculus algirus (aka oryctolagus cuniculus algirus)
E: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
F: domestic rabbit (aka oryctolagus cuniculus)
G: swamp rabbit (aka sylvilagus aquaticus)
H: european hare (aka lepus europaeus)
I: oryctolagus sp. 'rabbit_od'
J: None of the above. | F |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallus gallus domesticus (aka gallus gallus)
B: gallacoccus
C: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
D: miletus gallus gallus
E: gallio
F: gallus sp.
G: arilus gallus
H: gallasellus
I: gallorhynchus
J: avian (aka aves)
K: None of the above. | A |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'rabbit'. Answer using one of the provided options. | <Options>: A: european hare (aka lepus europaeus)
B: lepus (hares) (aka lepus)
C: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
D: marsh rabbit (aka sylvilagus palustris)
E: cuniculus algirus (aka oryctolagus cuniculus algirus)
F: oryctolagus sp. 'rabbit_od'
G: swamp rabbit (aka sylvilagus aquaticus)
H: rabbits and hares (aka leporidae)
I: european rabbit (aka oryctolagus cuniculus)
J: None of the above. | I |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept corresponding to 'chicken'. Answer using one of the provided options. | <Options>: A: gallio
B: landfowls (aka galliformes)
C: avian (aka aves)
D: miletus gallus gallus
E: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
F: gallorhynchus
G: cancer gallus (aka calappa gallus)
H: arilus gallus
I: gallus sp.
J: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
K: None of the above. | E |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: nannomys musculoides (aka mus musculoides)
C: mus domesticus (aka mus musculus domesticus)
D: mus terricolor (earth-colored mouse) (aka mus terricolor)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: mice (aka mus sp.) (aka mus sp.)
G: mus (aka mus <subgenus>) (aka mus <subgenus>)
H: mouse (aka mus musculus)
I: peromyscus
J: None of the above. | H |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: mice (aka mus <genus>) (aka mus <genus>)
C: mus musculus (house mouse) (aka mus musculus)
D: western european house mouse (aka mus musculus domesticus)
E: mus (aka mus <subgenus>) (aka mus <subgenus>)
F: peromyscus
G: nannomys musculoides (aka mus musculoides)
H: mus sp. (mice (aka mus sp.))
I: mus terricolor (earth-colored mouse) (aka mus terricolor)
J: None of the above. | C |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept corresponding to 'sheep'. Answer using one of the provided options. | <Options>: A: ovis canadensis weemsi
B: ovis
C: ovis vignei (ovis orientalis vignei) (aka ovis vignei)
D: dall's sheep (aka ovis dalli)
E: ovis sp.
F: ovis canadensis x aries (ovis canadensis x ovis aries) (aka ovis canadensis x aries)
G: ovis ovis (aka ovis aries)
H: ovis canadensis canadensis
I: ovis nivicola (ovis canadensis nivicola) (aka ovis nivicola)
J: None of the above. | G |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept corresponding to 'rabbit'. Answer using one of the provided options. | <Options>: A: european hare (aka lepus europaeus)
B: swamp rabbit (aka sylvilagus aquaticus)
C: lepus palustris (aka sylvilagus palustris)
D: lepus (hares) (aka lepus)
E: lepus cuniculus (aka oryctolagus cuniculus)
F: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
G: cuniculus algirus (aka oryctolagus cuniculus algirus)
H: oryctolagus sp. 'rabbit_od'
I: rabbits and hares (aka leporidae)
J: None of the above. | E |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
B: capneidae
C: capreolus
D: capra sp.
E: capra hircus aegagrus (aka capra aegagrus)
F: domestic goat (aka capra hircus)
G: capra
H: capraita
I: capra nubiana x capra hircus
J: goatfishes (aka mullidae)
K: None of the above. | F |
<Instruct>: Given the context 'RNA Extraction/cDNA synthesis
Sympathetic ganglia were removed from chick embryos and RNA was isolated using TriReagent (Molecular Research Center), an acidified guanidinium with phenol extraction method', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: cancer gallus (aka calappa gallus)
B: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
C: gallus
D: gallorhynchus
E: gallio
F: landfowls (aka galliformes)
G: arilus gallus
H: phasianus gallus gallus (aka gallus gallus gallus)
I: miletus gallus gallus
J: gallus sp.
K: None of the above. | B |
<Instruct>: Given the context 'TaqMan probes were used to quantify the progression of the PCR reaction and reactions were normalized using the constitutively expressed gene chick ribosomal binding protein s17 (CHRPS).', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallio
B: fopius
C: gallasellus
D: cancer gallus (aka calappa gallus)
E: gallorhynchus
F: landfowls (aka galliformes)
G: miletus gallus gallus
H: avian (aka aves)
I: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
J: arilus gallus
K: None of the above. | I |
<Instruct>: Given the context 'The sequences were used for primer/probes sets: for BDNF: forward: 5'-AGCCCAGTGAGGAAAACAAG-3', reverse: 5'-ACTCCTCGAGCAGAAAGAGC-3', probe: 5'-[6-FAM]-TACACATCCCGAGTCATGCTGAGCA-[BHQ]-3'; for CHRPS (chick ribosomal binding protein S-17): 5'AACGACTTCCACACCAACAA3', reverse: 5'CTTCATCAGGTGGGTGACAT3', probe: 5'-[6-FAM]-CGCCATCATCCCCAGCAAGA [BHQ]-3'.', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallorhynchus
B: gallasellus
C: chickens (aka gallus gallus)
D: miletus gallus gallus
E: gallus
F: gallio
G: avian (aka aves)
H: fopius
I: gallus sp.
J: landfowls (aka galliformes)
K: None of the above. | C |
<Instruct>: Given the context 'Sympathetic ganglia were removed from the lumbar region of the paravertebral chain of St. 29/30 (E6.5) chick embryos and placed in Modified Puck's solution with glucose (MPG).', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: fopius
B: gallus
C: phasianus gallus gallus (aka gallus gallus gallus)
D: gallus sp.
E: arilus gallus
F: cancer gallus (aka calappa gallus)
G: gallio
H: gallasellus
I: phasianus gallus (aka gallus gallus)
J: miletus gallus gallus
K: None of the above. | I |
<Instruct>: Given the context 'Cells were then resuspended in Dulbecco's Modified Eagle Medium (DMEM) consisting of 10% horse serum, 2% fetal calf serum, and 10 mg/ml penicillin/streptomycin.', select the correct biomedical concept corresponding to 'horse'. Answer using one of the provided options. | <Options>: A: equus przewalskii x equus caballus
B: equus sp. llo-2009a
C: eques
D: equetus
E: rv-horse
F: equus subg. asinus (aka equus)
G: russian wild horse (aka equus ferus)
H: domestic horse (aka equus caballus)
I: horsetails (aka equisetidae)
J: equus grevyi x equus caballus
K: None of the above. | H |
<Instruct>: Given the context 'For in vivo studies, 25 μg BrdU was injected into the amnion of chick embryos at St. 27.', select the correct biomedical concept corresponding to 'chick'. Answer using one of the provided options. | <Options>: A: gallorhynchus
B: phasianus gallus gallus (aka gallus gallus gallus)
C: arilus gallus
D: avian (aka aves)
E: gallus
F: chickens (aka gallus gallus)
G: gallasellus
H: galliformes (landfowls) (aka galliformes)
I: miletus gallus gallus
J: fopius
K: None of the above. | F |
<Instruct>: Given the context 'Abbreviations
BDNF, brain-derived neurotrophic factor; BrdU, Bromodeoxyuridine; DA, dorsal aorta; DMEM, Dulbecco's Modified Eagle's Medium; DRG, dorsal root ganglion; E, embryonic day; HS, horse serum; MPG, Modified Puck's solution with glucose; NGF, nerve growth factor; NC, notochord; NT, neural tube; NT-3, neurotrophin-3; NTR, neurotrophin receptor; PBS, phosphate-buffered saline; SC, spinal cord; SCG, superior cervical ganglion; SEM, standard error of the mean; SG, sympathetic ganglion; St., stage; w/v, weight/volume; v/v, volume/volume.
', select the correct biomedical concept corresponding to 'horse'. Answer using one of the provided options. | <Options>: A: equus sp.
B: equus przewalskii x equus caballus
C: equus grevyi x equus caballus
D: horses (aka equidae)
E: eques
F: rv-horse
G: domestic horse (aka equus caballus)
H: russian wild horse (aka equus ferus)
I: equus subg. asinus (aka equus)
J: equetus
K: None of the above. | G |
<Instruct>: Given the context 'Identification of a human peripheral blood monocyte subset that differentiates into osteoclasts
Abstract
Increased bone resorption mediated by osteoclasts causes various diseases such as osteoporosis and bone erosion in rheumatoid arthritis (RA).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: great apes (aka hominidae)
B: humans (aka homo)
C: kingdom
D: mammals (aka mammalia)
E: macrobiotus sapiens
F: ape (aka hominoidea) (aka hominoidea)
G: neandertal man (aka homo sapiens neanderthalensis)
H: primate (aka primates)
I: genus
J: homo sapiens (human) (aka homo sapiens)
K: None of the above. | J |
<Instruct>: Given the context 'In the present study, we show that the purified CD16- human peripheral blood monocyte subset, but not the CD16+ monocyte subset, differentiates into osteoclast by stimulation with receptor activator of NF-κB ligand (RANKL) in combination with macrophage colony-stimulating factor (M-CSF).', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: anthropoides
B: humans (aka homo)
C: mammals (aka mammalia)
D: neanderthal man (aka homo sapiens neanderthalensis)
E: primate (aka primates)
F: ape (aka hominoidea) (aka hominoidea)
G: kingdom
H: human (aka homo sapiens)
I: gymnopleurus humanus
J: homininae (homo/pan/gorilla group) (aka homininae)
K: None of the above. | H |
<Instruct>: Given the context 'Interestingly, the deletion of RANKL or c-Fos gene, which is important for osteoclastogenesis, results in minimal bone destruction in mouse models of arthritis [1,2].', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus sp. (mice (aka mus sp.))
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus terricolor (earth-colored mouse) (aka mus terricolor)
D: house mouse (aka mus musculus)
E: mus <subgenus> (mus (aka mus <subgenus>))
F: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
G: western european house mouse (aka mus musculus domesticus)
H: peromyscus
I: mus (aka mus <genus>) (aka mus <genus>)
J: None of the above. | D |
<Instruct>: Given the context 'It is reported that osteoclast precursors reside in human peripheral blood monocytes [4,5].', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: genus
B: primate (aka primates)
C: gymnopleurus humanus
D: anthropoides
E: kingdom
F: macrobiotus sapiens
G: humans (aka homo)
H: human (aka homo sapiens)
I: great apes (aka hominidae)
J: mammals (aka mammalia)
K: None of the above. | H |
<Instruct>: Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: plasmids
B: aides
C: perna
D: human (aka homo sapiens)
E: clinical samples (aka clinical samples <bacteria,ncbi:txid226901>)
F: circe
G: personidae
H: clientister
I: cancer
J: pera
K: None of the above. | D |
<Instruct>: Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mus cricetus (aka cricetus cricetus)
B: eastern european house mouse (aka mus musculus musculus)
C: peromyscus
D: xenomys
E: mus <genus> (mice (aka mus <genus>))
F: mus sp. (mice (aka mus sp.))
G: mus terricolor (earth-colored mouse) (aka mus terricolor)
H: house mouse (aka mus musculus)
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
K: None of the above. | H |
<Instruct>: Given the context 'Monocytes are therefore involved not only in synovial inflammation, but also in bone remodeling as potential precursors for synovial macrophages and osteoclasts.
Human peripheral blood monocytes consist of two major subsets, CD16+ and CD16-, comprising 5–10% and 90–95% of the monocytes, respectively.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: great apes (aka hominidae)
B: genus
C: anthropoides
D: gymnopleurus humanus
E: homo sapiens neanderthalensis (homo neanderthalensis) (aka homo sapiens neanderthalensis)
F: kingdom
G: macrobiotus sapiens
H: primate (aka primates)
I: human (aka homo sapiens)
J: homininae (homo/pan/gorilla group) (aka homininae)
K: None of the above. | I |
<Instruct>: Given the context 'In the present study, we determined the human peripheral blood monocyte subset that differentiates into osteoclasts, and revealed that each subset exhibits a different response for osteoclastogenic stimuli.
', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: primate (aka primates)
B: anthropoides
C: apes (aka hominoidea) (aka hominoidea)
D: neandertal man (aka homo sapiens neanderthalensis)
E: mammals (aka mammalia)
F: kingdom
G: hominidae (great apes) (aka hominidae)
H: homininae (homo/pan/gorilla group) (aka homininae)
I: human (aka homo sapiens)
J: gymnopleurus humanus
K: None of the above. | I |
<Instruct>: Given the context 'Flow cytometry analysis using FITC-conjugated mouse anti-CD14 mAb (MY4; Bechman Coulter, Fullerton, CA, USA) and phycoerythin-conjugated mouse anti-CD16 mAb (3G8; BD Biosciences, San Jose, CA, USA) showed that the purities of the CD16+ and CD16- monocytes were more than 90% and 92%, respectively.
', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: peromyscus
B: mus terricolor (earth-colored mouse) (aka mus terricolor)
C: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
D: mus (aka mus <genus>) (aka mus <genus>)
E: mus sp. (mice (aka mus sp.))
F: nannomys musculoides (aka mus musculoides)
G: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
H: mus musculus (house mouse) (aka mus musculus)
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: None of the above. | H |
<Instruct>: Given the context 'Flow cytometry analysis using FITC-conjugated mouse anti-CD14 mAb (MY4; Bechman Coulter, Fullerton, CA, USA) and phycoerythin-conjugated mouse anti-CD16 mAb (3G8; BD Biosciences, San Jose, CA, USA) showed that the purities of the CD16+ and CD16- monocytes were more than 90% and 92%, respectively.
', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus terricolor (earth-colored mouse) (aka mus terricolor)
C: mice (aka mus sp.) (aka mus sp.)
D: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
E: mice (aka mus <genus>) (aka mus <genus>)
F: mus (aka mus <subgenus>) (aka mus <subgenus>)
G: peromyscus
H: mus musculus (house mouse) (aka mus musculus)
I: eastern european house mouse (aka mus musculus musculus)
J: None of the above. | H |
<Instruct>: Given the context 'For the other experiment, monocytes were purified using CD14 MicroBeads (Miltenyi Biotec), and then stained either with FITC-conjugated mouse anti-CD33 mAb (MY9; Bechman Coulter) or phycoerythin-conjugated mouse anti-CD16 mAb (3G8).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus terricolor (earth-colored mouse) (aka mus terricolor)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus sp. (mice (aka mus sp.))
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: peromyscus
G: mouse (aka mus musculus)
H: mus (aka mus <genus>) (aka mus <genus>)
I: mus domesticus (aka mus musculus domesticus)
J: None of the above. | G |
<Instruct>: Given the context 'For the other experiment, monocytes were purified using CD14 MicroBeads (Miltenyi Biotec), and then stained either with FITC-conjugated mouse anti-CD33 mAb (MY9; Bechman Coulter) or phycoerythin-conjugated mouse anti-CD16 mAb (3G8).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mouse (aka mus musculus)
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mice (aka mus sp.) (aka mus sp.)
D: mouse (aka mus <genus>)
E: mus terricolor (earth-colored mouse) (aka mus terricolor)
F: mus <subgenus> (mus (aka mus <subgenus>))
G: peromyscus
H: nannomys musculoides (aka mus musculoides)
I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
J: None of the above. | A |
<Instruct>: Given the context 'Osteoclast differentiation
Purified CD16+ and CD16- monocytes (5 × 104 cells/well) were incubated in 96-well plates in αMEM (Sigma, St Louis, MO, USA) with heat-inactivated 10% fetal bovine serum (FBS) (Sigma) or with Ultra-Low IgG FBS (IgG < 5 μg/ml; Invitrogen, Carlsbad, CA, USA), and where indicated with M-CSF + RANKL (Peprotech, Rocky Hill, NJ, USA).
', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options. | <Options>: A: beefalo (aka bos taurus x bison bison)
B: bos indicus (bos primigenius indicus) (aka bos indicus)
C: boveria
D: bos sp.
E: cattle (aka bos)
F: bovine (aka bos taurus)
G: bovidae
H: bos taurus x bos indicus (aka bos indicus x bos taurus)
I: bovichthus (aka bovichtus)
J: None of the above. | F |
<Instruct>: Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: capra sp.
B: capreolus
C: goatfishes (aka mullidae)
D: capraita
E: domestic goat (aka capra hircus)
F: capra aegagrus cretica (aka capra hircus cretica)
G: caponia
H: capra hircus x ovis aries
I: capneidae
J: capra
K: None of the above. | E |
<Instruct>: Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: capneidae
B: capra
C: capra nubiana x capra hircus
D: capraita
E: capreolus
F: capra cretica (aka capra hircus cretica)
G: goatfishes (aka mullidae)
H: caponia
I: goat (aka capra hircus) (aka capra hircus)
J: capra hircus x ovis aries
K: None of the above. | I |
<Instruct>: Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus terricolor (earth-colored mouse) (aka mus terricolor)
B: mus domesticus (aka mus musculus domesticus)
C: mus sp. (mice (aka mus sp.))
D: eastern european house mouse (aka mus musculus musculus)
E: mus musculus (house mouse) (aka mus musculus)
F: mus <genus> (mice (aka mus <genus>))
G: mus <subgenus> (mus (aka mus <subgenus>))
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: peromyscus
J: None of the above. | E |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept corresponding to 'rabbit'. Answer using one of the provided options. | <Options>: A: lepus palustris (aka sylvilagus palustris)
B: oryctolagus sp. 'rabbit_od'
C: european hare (aka lepus europaeus)
D: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
E: leporidae (rabbits and hares) (aka leporidae)
F: cuniculus algirus (aka oryctolagus cuniculus algirus)
G: swamp rabbit (aka sylvilagus aquaticus)
H: hares (aka lepus)
I: lepus cuniculus cuniculus (aka oryctolagus cuniculus cuniculus)
J: None of the above. | D |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: capreolus
B: capra
C: capra aegagrus hircus (aka capra hircus)
D: capra hircus x ovis aries
E: goatfishes (aka mullidae)
F: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
G: capra hircus aegagrus (aka capra aegagrus)
H: caponia
I: capraita
J: capneidae
K: None of the above. | C |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept corresponding to 'rabbit'. Answer using one of the provided options. | <Options>: A: oryctolagus sp. 'rabbit_od'
B: swamp rabbit (aka sylvilagus aquaticus)
C: cuniculus algirus (aka oryctolagus cuniculus algirus)
D: european hare (aka lepus europaeus)
E: lepus (hares) (aka lepus)
F: sylvilagus palustris (lepus palustris) (aka sylvilagus palustris)
G: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
H: rabbits and hares (aka leporidae)
I: european rabbit (aka oryctolagus cuniculus)
J: None of the above. | I |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mouse (aka mus musculus)
B: mice (aka mus sp.) (aka mus sp.)
C: peromyscus
D: mouse (aka mus <genus>)
E: mus terricolor (earth-colored mouse) (aka mus terricolor)
F: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
G: mus <subgenus> (mus (aka mus <subgenus>))
H: nannomys musculoides (aka mus musculoides)
I: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
J: None of the above. | A |
<Instruct>: Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: peromyscus
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus terricolor (earth-colored mouse) (aka mus terricolor)
E: mouse (aka mus <genus>)
F: mice (aka mus sp.) (aka mus sp.)
G: eastern european house mouse (aka mus musculus musculus)
H: mus musculus (house mouse) (aka mus musculus)
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: None of the above. | H |
<Instruct>: Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: nannomys musculoides (aka mus musculoides)
B: mus terricolor (earth-colored mouse) (aka mus terricolor)
C: mice (aka mus <genus>) (aka mus <genus>)
D: mus domesticus (aka mus musculus domesticus)
E: mice (aka mus sp.) (aka mus sp.)
F: mouse (aka mus musculus)
G: eastern european house mouse (aka mus musculus musculus)
H: peromyscus
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: None of the above. | F |
<Instruct>: Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: western european house mouse (aka mus musculus domesticus)
B: mus sp. (mice (aka mus sp.))
C: peromyscus
D: nannomys musculoides (aka mus musculoides)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: house mouse (aka mus musculus)
G: mus (aka mus <subgenus>) (aka mus <subgenus>)
H: mus <genus> (mice (aka mus <genus>))
I: mus terricolor (earth-colored mouse) (aka mus terricolor)
J: None of the above. | F |
<Instruct>: Given the context 'Peripheral blood monocytes (1 × 105 cells) were incubated with 1 μg human IgG for 15 minutes, and were then stained with three fluorochrome-labeled mAbs for 45 minutes on ice.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: human (aka homo sapiens)
B: homininae (homo/pan/gorilla group) (aka homininae)
C: anthropoides
D: primate (aka primates)
E: neanderthal man (aka homo sapiens neanderthalensis)
F: macrobiotus sapiens
G: kingdom
H: mammals (aka mammalia)
I: genus
J: great apes (aka hominidae)
K: None of the above. | A |
<Instruct>: Given the context 'The cells were fixed in acetone and then stained with anti-αvβ3 mAb (LM609; Chemicon, Temecula, CA, USA) or mouse IgG1 (11711; R&D Systems) as an isotype-matched control.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus sp. (mice (aka mus sp.))
B: mouse (aka mus <genus>)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mus musculus (house mouse) (aka mus musculus)
E: mus terricolor (earth-colored mouse) (aka mus terricolor)
F: mus <subgenus> (mus (aka mus <subgenus>))
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: eastern european house mouse (aka mus musculus musculus)
I: peromyscus
J: None of the above. | D |
<Instruct>: Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
B: goat (aka capra hircus) (aka capra hircus)
C: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
D: capreolus
E: capra sp.
F: capneidae
G: caponia
H: capra nubiana x capra hircus
I: capra hircus x ovis aries
J: capraita
K: None of the above. | B |
<Instruct>: Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: eastern european house mouse (aka mus musculus musculus)
B: mus (aka mus <genus>) (aka mus <genus>)
C: mus sp. (mice (aka mus sp.))
D: house mouse (aka mus musculus)
E: mus terricolor (earth-colored mouse) (aka mus terricolor)
F: mus (aka mus <subgenus>) (aka mus <subgenus>)
G: peromyscus
H: mus domesticus (aka mus musculus domesticus)
I: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
J: None of the above. | D |
<Instruct>: Given the context 'A total of 1 × 105 cells was then Fc blocked with 1 μg human IgG for 15 minutes, and was stained with Alexa Fluor 647-conjugated mAb either to phospho-p38 MAPK (T180/Y182) or to phospho-ERK1/2 (T202/Y204) (BD Biosciences) for 30 minutes at room temperature.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: kingdom
B: genus
C: primate (aka primates)
D: mammals (aka mammalia)
E: macrobiotus sapiens
F: homo sapiens (human) (aka homo sapiens)
G: ape (aka hominoidea) (aka hominoidea)
H: hominidae (great apes) (aka hominidae)
I: gymnopleurus humanus
J: humans (aka homo)
K: None of the above. | F |
<Instruct>: Given the context 'Alexa Fluor 647-conjugated mouse IgG1 (BD Biosciences) was used as an isotype control.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: nannomys musculoides (aka mus musculoides)
B: peromyscus
C: mus terricolor (earth-colored mouse) (aka mus terricolor)
D: mus (aka mus <subgenus>) (aka mus <subgenus>)
E: eastern european house mouse (aka mus musculus musculus)
F: mus domesticus (aka mus musculus domesticus)
G: mouse (aka mus <genus>)
H: mice (aka mus sp.) (aka mus sp.)
I: mouse (aka mus musculus)
J: None of the above. | I |
<Instruct>: Given the context 'Immunohistochemistry
Synovial tissue samples were obtained during total knee joint replacement surgery from four RA patients.', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: proxys
B: clinical samples (aka clinical samples <bacteria,ncbi:txid191496>)
C: perotis <beetles> (perotis) (aka perotis <beetles>)
D: personidae
E: species
F: perna
G: human (aka homo sapiens)
H: theraps
I: genus
J: pera
K: None of the above. | G |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: capra
B: goatfishes (aka mullidae)
C: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
D: capraita
E: capra aegagrus hircus (aka capra hircus)
F: capneidae
G: capra sp.
H: capra cretica (aka capra hircus cretica)
I: capreolus
J: capra nubiana x capra hircus
K: None of the above. | E |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mus (aka mus <genus>) (aka mus <genus>)
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mus terricolor (earth-colored mouse) (aka mus terricolor)
D: mouse (aka mus musculus)
E: mus sp. (mice (aka mus sp.))
F: peromyscus
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: mus <subgenus> (mus (aka mus <subgenus>))
I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
J: None of the above. | D |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options. | <Options>: A: bos sp.
B: bos taurus x bos indicus (aka bos indicus x bos taurus)
C: beefalo (aka bos taurus x bison bison)
D: bos taurus indicus (aka bos indicus)
E: bovine (aka bos taurus)
F: bovidae
G: cattle (aka bos)
H: bovichthus (aka bovichtus)
I: boveria
J: None of the above. | E |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: goatfishes (aka mullidae)
B: caponia
C: wild goat (aka capra aegagrus)
D: capraita
E: capra hircus x ovis aries
F: capra sp.
G: goats (aka capra hircus)
H: capra
I: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
J: capneidae
K: None of the above. | G |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: house mouse (aka mus musculus)
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: mus terricolor (earth-colored mouse) (aka mus terricolor)
D: mus (aka mus <genus>) (aka mus <genus>)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: mus sp. (mice (aka mus sp.))
G: mus domesticus (aka mus musculus domesticus)
H: peromyscus
I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
J: None of the above. | A |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept corresponding to 'bovine'. Answer using one of the provided options. | <Options>: A: bos taurus x bos indicus (aka bos indicus x bos taurus)
B: bos primigenius taurus (aka bos taurus)
C: bovichthus (aka bovichtus)
D: bos primigenius indicus (aka bos indicus)
E: boveria
F: beefalo (aka bos taurus x bison bison)
G: bovidae
H: bos (cattle) (aka bos)
I: bos sp.
J: None of the above. | B |
<Instruct>: Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: mus terricolor (earth-colored mouse) (aka mus terricolor)
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: peromyscus
E: western european house mouse (aka mus musculus domesticus)
F: mus musculus (house mouse) (aka mus musculus)
G: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
H: mus sp. (mice (aka mus sp.))
I: nannomys musculoides (aka mus musculoides)
J: None of the above. | F |
<Instruct>: Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', select the correct biomedical concept corresponding to 'goat'. Answer using one of the provided options. | <Options>: A: capra nubiana x capra hircus
B: goats (aka capra hircus)
C: goatfishes (aka mullidae)
D: capra hircus x ovis aries
E: caponia
F: capneidae
G: capra
H: capra hircus aegagrus (aka capra aegagrus)
I: capra sp.
J: capreolus
K: None of the above. | B |
<Instruct>: Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', select the correct biomedical concept corresponding to 'mouse'. Answer using one of the provided options. | <Options>: A: nannomys musculoides (aka mus musculoides)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mice (aka mus sp.) (aka mus sp.)
D: peromyscus
E: mus musculus (house mouse) (aka mus musculus)
F: mus (aka mus <genus>) (aka mus <genus>)
G: western european house mouse (aka mus musculus domesticus)
H: mus <subgenus> (mus (aka mus <subgenus>))
I: mus terricolor (earth-colored mouse) (aka mus terricolor)
J: None of the above. | E |
<Instruct>: Given the context 'Results
Induction of osteoclasts from CD16- peripheral blood monocytes
To identify the monocyte subset that differentiates into osteoclasts, we examined osteoclast formation from CD16+ and CD16- human peripheral blood monocytes.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: humans (aka homo)
B: mammals (aka mammalia)
C: homininae (homo/pan/gorilla group) (aka homininae)
D: macrobiotus sapiens
E: genus
F: kingdom
G: gymnopleurus humanus
H: apes (aka hominoidea) (aka hominoidea)
I: human (aka homo sapiens)
J: primate (aka primates)
K: None of the above. | I |
<Instruct>: Given the context 'We therefore examined the involvement of αvβ3 in RANKL + M-CSF-induced osteoclastogenesis in human CD16- monocytes using siRNA targeting the integrin-β3 subunit.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: homininae (homo/pan/gorilla group) (aka homininae)
B: genus
C: gymnopleurus humanus
D: homo (humans) (aka homo)
E: great apes (aka hominidae)
F: homo sapiens (human) (aka homo sapiens)
G: homo sapiens neanderthalensis (homo neanderthalensis) (aka homo sapiens neanderthalensis)
H: hominoidea (apes (aka hominoidea))
I: kingdom
J: macrobiotus sapiens
K: None of the above. | F |
<Instruct>: Given the context 'Interestingly, integrin-β3 knockdown did not alter the NFATc1 mRNA level (Figure 7), suggesting that signal transduction mediated by integrin β3 does not affect the expression of NFATc1.
Detection of CD16+ and CD16- macrophages in synovium of RA patients
RA synovial macrophages are derived from peripheral blood monocytes, and their recruitment into the synovium is facilitated by various adhesion molecules and chemokines [24].', select the correct biomedical concept corresponding to 'patients'. Answer using one of the provided options. | <Options>: A: circe
B: aetius
C: species
D: clientister
E: clinical samples (aka clinical samples <bacteria,ncbi:txid226901>)
F: theraps
G: perotis <beetles> (perotis) (aka perotis <beetles>)
H: humans (aka homo)
I: human (aka homo sapiens)
J: inquisitor
K: None of the above. | I |
<Instruct>: Given the context 'Discussion
Human peripheral blood monocytes are a heterogeneous population, and they are divided into two subsets based on the expression of CD16.', select the correct biomedical concept corresponding to 'human'. Answer using one of the provided options. | <Options>: A: mammals (aka mammalia)
B: anthropoides
C: human (aka homo sapiens)
D: genus
E: neanderthal man (aka homo sapiens neanderthalensis)
F: hominoidea (apes (aka hominoidea))
G: homininae (homo/pan/gorilla group) (aka homininae)
H: humans (aka homo)
I: macrobiotus sapiens
J: kingdom
K: None of the above. | C |
<Instruct>: Given the context 'It was recently reported that bone marrow macrophages of integrin-β3-deficient mice could not differentiate into mature osteoclasts in vitro, suggesting that αvβ3 is involved not only in activation, but also in differentiation, of osteoclasts in mice [26,27].', select the correct biomedical concept corresponding to 'mice'. Answer using one of the provided options. | <Options>: A: mouse (aka mus musculus)
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mus cricetus (aka cricetus cricetus)
D: peromyscus
E: mus <subgenus> (mus (aka mus <subgenus>))
F: xenomys
G: mus terricolor (earth-colored mouse) (aka mus terricolor)
H: mice (aka mus sp.) (aka mus sp.)
I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
J: mus (aka mus <genus>) (aka mus <genus>)
K: None of the above. | A |
End of preview. Expand
in Data Studio
README.md exists but content is empty.
- Downloads last month
- 24