file_name
large_stringlengths
4
140
prefix
large_stringlengths
0
39k
suffix
large_stringlengths
0
36.1k
middle
large_stringlengths
0
29.4k
fim_type
large_stringclasses
4 values
SearchContainer.js
import React, { Component } from 'react'; import InfoSection from '../components/InfoSection'; import InfoSectionToggle from '../components/InfoSectionToggle'; class SearchContainer extends React.Component { constructor(props) { super(props);
showContent: true, content: `The field below accepts search criteria for those on Odecee bench. Try searching by technologies like: 'node', or 'javascript' and you will see a list of candidates with those skill sets.` }; } onPressError() { this.setState({ error: '' }); } onPressInfo() { this.setState({ showContent: !this.state.showContent }); } renderError() { if(this.state.error) { return ( <li> <div className="error"> <span className="message">{this.state.error}</span> <span className="error-icon" onClick={this.onPressError.bind(this)}> <i className="fa fa-times-circle"></i> </span> </div> </li> ) } } renderInfoSection() { return ( <InfoSection revealContent={this.state.showContent} content={this.state.content} title={'Add Skill'} /> ); } render() { return ( <div> {this.renderInfoSection()} <section> <InfoSectionToggle onPressInfo={this.onPressInfo.bind(this)} /> <ul className="input-list style-4 clearfix"> {this.renderError()} <li> <label className="search" htmlFor="search">Search: </label> <input type="text" style={{width: '100%'}} placeholder="Search" ref="email" id="search" /> </li> </ul> </section> </div> ) } } export default SearchContainer;
this.state = { message: '', error: '',
random_line_split
SearchContainer.js
import React, { Component } from 'react'; import InfoSection from '../components/InfoSection'; import InfoSectionToggle from '../components/InfoSectionToggle'; class SearchContainer extends React.Component { constructor(props) { super(props); this.state = { message: '', error: '', showContent: true, content: `The field below accepts search criteria for those on Odecee bench. Try searching by technologies like: 'node', or 'javascript' and you will see a list of candidates with those skill sets.` }; } onPressError() { this.setState({ error: '' }); } onPressInfo() { this.setState({ showContent: !this.state.showContent }); } renderError() { if(this.state.error) { return ( <li> <div className="error"> <span className="message">{this.state.error}</span> <span className="error-icon" onClick={this.onPressError.bind(this)}> <i className="fa fa-times-circle"></i> </span> </div> </li> ) } } renderInfoSection()
render() { return ( <div> {this.renderInfoSection()} <section> <InfoSectionToggle onPressInfo={this.onPressInfo.bind(this)} /> <ul className="input-list style-4 clearfix"> {this.renderError()} <li> <label className="search" htmlFor="search">Search: </label> <input type="text" style={{width: '100%'}} placeholder="Search" ref="email" id="search" /> </li> </ul> </section> </div> ) } } export default SearchContainer;
{ return ( <InfoSection revealContent={this.state.showContent} content={this.state.content} title={'Add Skill'} /> ); }
identifier_body
SearchContainer.js
import React, { Component } from 'react'; import InfoSection from '../components/InfoSection'; import InfoSectionToggle from '../components/InfoSectionToggle'; class SearchContainer extends React.Component { constructor(props) { super(props); this.state = { message: '', error: '', showContent: true, content: `The field below accepts search criteria for those on Odecee bench. Try searching by technologies like: 'node', or 'javascript' and you will see a list of candidates with those skill sets.` }; } onPressError() { this.setState({ error: '' }); } onPressInfo() { this.setState({ showContent: !this.state.showContent }); } renderError() { if(this.state.error) { return ( <li> <div className="error"> <span className="message">{this.state.error}</span> <span className="error-icon" onClick={this.onPressError.bind(this)}> <i className="fa fa-times-circle"></i> </span> </div> </li> ) } } renderInfoSection() { return ( <InfoSection revealContent={this.state.showContent} content={this.state.content} title={'Add Skill'} /> ); }
() { return ( <div> {this.renderInfoSection()} <section> <InfoSectionToggle onPressInfo={this.onPressInfo.bind(this)} /> <ul className="input-list style-4 clearfix"> {this.renderError()} <li> <label className="search" htmlFor="search">Search: </label> <input type="text" style={{width: '100%'}} placeholder="Search" ref="email" id="search" /> </li> </ul> </section> </div> ) } } export default SearchContainer;
render
identifier_name
ofx_test.py
import os import pytest from . import ofx from .source_test import check_source_example testdata_dir = os.path.realpath( os.path.join( os.path.dirname(__file__), '..', '..', 'testdata', 'source', 'ofx')) examples = [ ('test_vanguard_basic', 'vanguard.ofx'), ('test_vanguard_matching', 'vanguard.ofx'), ('test_vanguard_invalid', 'vanguard.ofx'), ('test_vanguard_with_cash_account', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_transfer', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_primary', 'vanguard.ofx'), ('test_vanguard401k', 'vanguard401k.ofx'), ('test_vanguard_401k_matching', 'vanguard401k.ofx'), ('test_vanguard_xfer_in', 'vanguard_xfer_in.ofx'), ('test_fidelity_savings', 'fidelity-savings.ofx'), ('test_suncorp', 'suncorp.ofx'), ('test_checking', 'checking.ofx'), ('test_checking_emptyledgerbal', 'checking-emptyledgerbal.ofx'), ('test_td_ameritrade', 'td_ameritrade.ofx'), ('test_anzcc', 'anzcc.ofx'), ('test_multiple_accounts', 'multiple_accounts.ofx'), ('test_bank_medium', 'bank_medium.ofx'), ('test_investment_401k', 'investment_401k.ofx'), ('test_investment_buy_sell_income', 'investment_buy_sell_income.ofx'), ('test_vanguard_roth_ira', 'vanguard_roth_ira.ofx'), ('test_vanguard_roth_ira_matching', 'vanguard_roth_ira.ofx'), ('test_checking2', 'checking2.ofx'), ('test_checking2_matching', 'checking2.ofx'), ('test_amex', 'amex.ofx'), ('test_fidelity', 'fidelity.ofx'), ('test_non_default_capital_gains', 'vanguard401k.ofx'), ] @pytest.mark.parametrize('name,ofx_filename', examples) def test_source(name: str, ofx_filename: str): check_source_example( example_dir=os.path.join(testdata_dir, name), source_spec={ 'module': 'beancount_import.source.ofx', 'ofx_filenames': [os.path.join(testdata_dir, ofx_filename)], }, replacements=[(testdata_dir, '<testdata>')]) def test_find_ofx_id_for_account():
ofx_ids = { 'Assets:Vanguard:401k': 1, } for (account, want) in [ ('Assets:Vanguard:401k:PreTax:VGI1', 1), ('Assets:Vanguard:401k:PreTax', 1), ('Assets:Vanguard:401k:VG1', 1), ('Assets:Vanguard:401k', 1), ('Assets:Vanguard:Unknown', None), ('Assets:Vanguard:401k:PreTax:Excessive:VGI1', None), ]: assert ofx.find_ofx_id_for_account(account, ofx_ids) == want, account
identifier_body
ofx_test.py
import os import pytest from . import ofx from .source_test import check_source_example testdata_dir = os.path.realpath( os.path.join( os.path.dirname(__file__), '..', '..', 'testdata', 'source', 'ofx')) examples = [ ('test_vanguard_basic', 'vanguard.ofx'), ('test_vanguard_matching', 'vanguard.ofx'), ('test_vanguard_invalid', 'vanguard.ofx'), ('test_vanguard_with_cash_account', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_transfer', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_primary', 'vanguard.ofx'), ('test_vanguard401k', 'vanguard401k.ofx'), ('test_vanguard_401k_matching', 'vanguard401k.ofx'), ('test_vanguard_xfer_in', 'vanguard_xfer_in.ofx'), ('test_fidelity_savings', 'fidelity-savings.ofx'), ('test_suncorp', 'suncorp.ofx'), ('test_checking', 'checking.ofx'), ('test_checking_emptyledgerbal', 'checking-emptyledgerbal.ofx'), ('test_td_ameritrade', 'td_ameritrade.ofx'), ('test_anzcc', 'anzcc.ofx'), ('test_multiple_accounts', 'multiple_accounts.ofx'), ('test_bank_medium', 'bank_medium.ofx'), ('test_investment_401k', 'investment_401k.ofx'), ('test_investment_buy_sell_income', 'investment_buy_sell_income.ofx'), ('test_vanguard_roth_ira', 'vanguard_roth_ira.ofx'), ('test_vanguard_roth_ira_matching', 'vanguard_roth_ira.ofx'), ('test_checking2', 'checking2.ofx'), ('test_checking2_matching', 'checking2.ofx'), ('test_amex', 'amex.ofx'), ('test_fidelity', 'fidelity.ofx'), ('test_non_default_capital_gains', 'vanguard401k.ofx'), ] @pytest.mark.parametrize('name,ofx_filename', examples) def test_source(name: str, ofx_filename: str): check_source_example( example_dir=os.path.join(testdata_dir, name), source_spec={ 'module': 'beancount_import.source.ofx', 'ofx_filenames': [os.path.join(testdata_dir, ofx_filename)], }, replacements=[(testdata_dir, '<testdata>')]) def test_find_ofx_id_for_account(): ofx_ids = { 'Assets:Vanguard:401k': 1, } for (account, want) in [ ('Assets:Vanguard:401k:PreTax:VGI1', 1), ('Assets:Vanguard:401k:PreTax', 1), ('Assets:Vanguard:401k:VG1', 1), ('Assets:Vanguard:401k', 1), ('Assets:Vanguard:Unknown', None), ('Assets:Vanguard:401k:PreTax:Excessive:VGI1', None), ]:
assert ofx.find_ofx_id_for_account(account, ofx_ids) == want, account
conditional_block
ofx_test.py
import os import pytest from . import ofx from .source_test import check_source_example testdata_dir = os.path.realpath( os.path.join( os.path.dirname(__file__), '..', '..', 'testdata', 'source', 'ofx')) examples = [ ('test_vanguard_basic', 'vanguard.ofx'), ('test_vanguard_matching', 'vanguard.ofx'), ('test_vanguard_invalid', 'vanguard.ofx'), ('test_vanguard_with_cash_account', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_transfer', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_primary', 'vanguard.ofx'), ('test_vanguard401k', 'vanguard401k.ofx'), ('test_vanguard_401k_matching', 'vanguard401k.ofx'), ('test_vanguard_xfer_in', 'vanguard_xfer_in.ofx'), ('test_fidelity_savings', 'fidelity-savings.ofx'), ('test_suncorp', 'suncorp.ofx'), ('test_checking', 'checking.ofx'),
('test_td_ameritrade', 'td_ameritrade.ofx'), ('test_anzcc', 'anzcc.ofx'), ('test_multiple_accounts', 'multiple_accounts.ofx'), ('test_bank_medium', 'bank_medium.ofx'), ('test_investment_401k', 'investment_401k.ofx'), ('test_investment_buy_sell_income', 'investment_buy_sell_income.ofx'), ('test_vanguard_roth_ira', 'vanguard_roth_ira.ofx'), ('test_vanguard_roth_ira_matching', 'vanguard_roth_ira.ofx'), ('test_checking2', 'checking2.ofx'), ('test_checking2_matching', 'checking2.ofx'), ('test_amex', 'amex.ofx'), ('test_fidelity', 'fidelity.ofx'), ('test_non_default_capital_gains', 'vanguard401k.ofx'), ] @pytest.mark.parametrize('name,ofx_filename', examples) def test_source(name: str, ofx_filename: str): check_source_example( example_dir=os.path.join(testdata_dir, name), source_spec={ 'module': 'beancount_import.source.ofx', 'ofx_filenames': [os.path.join(testdata_dir, ofx_filename)], }, replacements=[(testdata_dir, '<testdata>')]) def test_find_ofx_id_for_account(): ofx_ids = { 'Assets:Vanguard:401k': 1, } for (account, want) in [ ('Assets:Vanguard:401k:PreTax:VGI1', 1), ('Assets:Vanguard:401k:PreTax', 1), ('Assets:Vanguard:401k:VG1', 1), ('Assets:Vanguard:401k', 1), ('Assets:Vanguard:Unknown', None), ('Assets:Vanguard:401k:PreTax:Excessive:VGI1', None), ]: assert ofx.find_ofx_id_for_account(account, ofx_ids) == want, account
('test_checking_emptyledgerbal', 'checking-emptyledgerbal.ofx'),
random_line_split
ofx_test.py
import os import pytest from . import ofx from .source_test import check_source_example testdata_dir = os.path.realpath( os.path.join( os.path.dirname(__file__), '..', '..', 'testdata', 'source', 'ofx')) examples = [ ('test_vanguard_basic', 'vanguard.ofx'), ('test_vanguard_matching', 'vanguard.ofx'), ('test_vanguard_invalid', 'vanguard.ofx'), ('test_vanguard_with_cash_account', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_transfer', 'vanguard.ofx'), ('test_vanguard_with_cash_account_matching_missing_primary', 'vanguard.ofx'), ('test_vanguard401k', 'vanguard401k.ofx'), ('test_vanguard_401k_matching', 'vanguard401k.ofx'), ('test_vanguard_xfer_in', 'vanguard_xfer_in.ofx'), ('test_fidelity_savings', 'fidelity-savings.ofx'), ('test_suncorp', 'suncorp.ofx'), ('test_checking', 'checking.ofx'), ('test_checking_emptyledgerbal', 'checking-emptyledgerbal.ofx'), ('test_td_ameritrade', 'td_ameritrade.ofx'), ('test_anzcc', 'anzcc.ofx'), ('test_multiple_accounts', 'multiple_accounts.ofx'), ('test_bank_medium', 'bank_medium.ofx'), ('test_investment_401k', 'investment_401k.ofx'), ('test_investment_buy_sell_income', 'investment_buy_sell_income.ofx'), ('test_vanguard_roth_ira', 'vanguard_roth_ira.ofx'), ('test_vanguard_roth_ira_matching', 'vanguard_roth_ira.ofx'), ('test_checking2', 'checking2.ofx'), ('test_checking2_matching', 'checking2.ofx'), ('test_amex', 'amex.ofx'), ('test_fidelity', 'fidelity.ofx'), ('test_non_default_capital_gains', 'vanguard401k.ofx'), ] @pytest.mark.parametrize('name,ofx_filename', examples) def
(name: str, ofx_filename: str): check_source_example( example_dir=os.path.join(testdata_dir, name), source_spec={ 'module': 'beancount_import.source.ofx', 'ofx_filenames': [os.path.join(testdata_dir, ofx_filename)], }, replacements=[(testdata_dir, '<testdata>')]) def test_find_ofx_id_for_account(): ofx_ids = { 'Assets:Vanguard:401k': 1, } for (account, want) in [ ('Assets:Vanguard:401k:PreTax:VGI1', 1), ('Assets:Vanguard:401k:PreTax', 1), ('Assets:Vanguard:401k:VG1', 1), ('Assets:Vanguard:401k', 1), ('Assets:Vanguard:Unknown', None), ('Assets:Vanguard:401k:PreTax:Excessive:VGI1', None), ]: assert ofx.find_ofx_id_for_account(account, ofx_ids) == want, account
test_source
identifier_name
RolesDialog.py
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import wx from cairis.core.armid import * from cairis.core.Role import Role from RoleDialog import RoleDialog from DialogClassParameters import DialogClassParameters from cairis.core.ARM import * from DimensionBaseDialog import DimensionBaseDialog __author__ = 'Shamal Faily' class RolesDialog(DimensionBaseDialog): def __init__(self,parent): DimensionBaseDialog.__init__(self,parent,ROLES_ID,'Roles',(800,300),'role.png') idList = [ROLES_LISTROLES_ID,ROLES_BUTTONADD_ID,ROLES_BUTTONDELETE_ID] columnList = ['Name','Short Code','Type'] self.buildControls(idList,columnList,self.dbProxy.getRoles,'role') listCtrl = self.FindWindowById(ROLES_LISTROLES_ID) listCtrl.SetColumnWidth(0,150) listCtrl.SetColumnWidth(1,100) listCtrl.SetColumnWidth(2,400) def addObjectRow(self,listCtrl,listRow,role): listCtrl.InsertStringItem(listRow,role.name()) listCtrl.SetStringItem(listRow,1,role.shortCode()) listCtrl.SetStringItem(listRow,2,role.type()) def onAdd(self,evt): try: addParameters = DialogClassParameters(ROLE_ID,'Add role',RoleDialog,ROLE_BUTTONCOMMIT_ID,self.dbProxy.addRole,True) self.addObject(addParameters) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Add role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return def onUpdate(self,evt): selectedObjt = self.objts[self.selectedLabel] try: updateParameters = DialogClassParameters(ROLE_ID,'Edit role',RoleDialog,ROLE_BUTTONCOMMIT_ID,self.dbProxy.updateRole,False)
dlg.ShowModal() dlg.Destroy() return def onDelete(self,evt): try: self.deleteObject('No role','Delete role',self.dbProxy.deleteRole) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Delete role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return
self.updateObject(selectedObjt,updateParameters) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Edit role',wx.OK | wx.ICON_ERROR)
random_line_split
RolesDialog.py
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import wx from cairis.core.armid import * from cairis.core.Role import Role from RoleDialog import RoleDialog from DialogClassParameters import DialogClassParameters from cairis.core.ARM import * from DimensionBaseDialog import DimensionBaseDialog __author__ = 'Shamal Faily' class RolesDialog(DimensionBaseDialog): def __init__(self,parent): DimensionBaseDialog.__init__(self,parent,ROLES_ID,'Roles',(800,300),'role.png') idList = [ROLES_LISTROLES_ID,ROLES_BUTTONADD_ID,ROLES_BUTTONDELETE_ID] columnList = ['Name','Short Code','Type'] self.buildControls(idList,columnList,self.dbProxy.getRoles,'role') listCtrl = self.FindWindowById(ROLES_LISTROLES_ID) listCtrl.SetColumnWidth(0,150) listCtrl.SetColumnWidth(1,100) listCtrl.SetColumnWidth(2,400) def addObjectRow(self,listCtrl,listRow,role): listCtrl.InsertStringItem(listRow,role.name()) listCtrl.SetStringItem(listRow,1,role.shortCode()) listCtrl.SetStringItem(listRow,2,role.type()) def onAdd(self,evt): try: addParameters = DialogClassParameters(ROLE_ID,'Add role',RoleDialog,ROLE_BUTTONCOMMIT_ID,self.dbProxy.addRole,True) self.addObject(addParameters) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Add role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return def onUpdate(self,evt):
def onDelete(self,evt): try: self.deleteObject('No role','Delete role',self.dbProxy.deleteRole) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Delete role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return
selectedObjt = self.objts[self.selectedLabel] try: updateParameters = DialogClassParameters(ROLE_ID,'Edit role',RoleDialog,ROLE_BUTTONCOMMIT_ID,self.dbProxy.updateRole,False) self.updateObject(selectedObjt,updateParameters) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Edit role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return
identifier_body
RolesDialog.py
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import wx from cairis.core.armid import * from cairis.core.Role import Role from RoleDialog import RoleDialog from DialogClassParameters import DialogClassParameters from cairis.core.ARM import * from DimensionBaseDialog import DimensionBaseDialog __author__ = 'Shamal Faily' class RolesDialog(DimensionBaseDialog): def
(self,parent): DimensionBaseDialog.__init__(self,parent,ROLES_ID,'Roles',(800,300),'role.png') idList = [ROLES_LISTROLES_ID,ROLES_BUTTONADD_ID,ROLES_BUTTONDELETE_ID] columnList = ['Name','Short Code','Type'] self.buildControls(idList,columnList,self.dbProxy.getRoles,'role') listCtrl = self.FindWindowById(ROLES_LISTROLES_ID) listCtrl.SetColumnWidth(0,150) listCtrl.SetColumnWidth(1,100) listCtrl.SetColumnWidth(2,400) def addObjectRow(self,listCtrl,listRow,role): listCtrl.InsertStringItem(listRow,role.name()) listCtrl.SetStringItem(listRow,1,role.shortCode()) listCtrl.SetStringItem(listRow,2,role.type()) def onAdd(self,evt): try: addParameters = DialogClassParameters(ROLE_ID,'Add role',RoleDialog,ROLE_BUTTONCOMMIT_ID,self.dbProxy.addRole,True) self.addObject(addParameters) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Add role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return def onUpdate(self,evt): selectedObjt = self.objts[self.selectedLabel] try: updateParameters = DialogClassParameters(ROLE_ID,'Edit role',RoleDialog,ROLE_BUTTONCOMMIT_ID,self.dbProxy.updateRole,False) self.updateObject(selectedObjt,updateParameters) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Edit role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return def onDelete(self,evt): try: self.deleteObject('No role','Delete role',self.dbProxy.deleteRole) except ARMException,errorText: dlg = wx.MessageDialog(self,str(errorText),'Delete role',wx.OK | wx.ICON_ERROR) dlg.ShowModal() dlg.Destroy() return
__init__
identifier_name
translation.ts
<?xml version="1.0" encoding="utf-8"?> <!DOCTYPE TS> <TS version="2.0" language="hr_HR"> <context>
</message> <message> <source>Empty</source> <translation>Prazno</translation> </message> </context> <context> <name>extension/ezxmkinstaller</name> <message> <source>XML Publisher</source> <translation>XML objavljivač</translation> </message> </context> <context> <name>ezxmlinstaller/datatypes</name> <message> <source>Feature Select</source> <comment>Datatype name</comment> <translation>Odabir svojstava</translation> </message> </context> </TS>
<name>design/standard/class/datatype</name> <message> <source>Template Location</source> <translation>Lokacija predloška</translation>
random_line_split
instanceof.ts
class A {} class B extends A {} var a: A; var b: B; var i: i32; var I: i64; var f: f32; var F: f64; assert( a instanceof A ); assert( b instanceof A ); assert(!(i instanceof A)); assert(!(I instanceof A)); assert(!(f instanceof A)); assert(!(F instanceof A)); // assert(!(a instanceof B)); // dynamic upcast, checked in rt/instanceof assert( b instanceof B ); assert(!(i instanceof B)); assert(!(I instanceof B)); assert(!(f instanceof B)); assert(!(F instanceof B)); assert(!(a instanceof i32)); assert(!(b instanceof i32)); assert( i instanceof i32 ); assert(!(I instanceof i32)); assert(!(f instanceof i32)); assert(!(F instanceof i32)); assert(!(a instanceof i64)); assert(!(b instanceof i64)); assert(!(i instanceof i64)); assert( I instanceof i64 ); assert(!(f instanceof i64)); assert(!(F instanceof i64)); assert(!(a instanceof f32)); assert(!(b instanceof f32)); assert(!(i instanceof f32)); assert(!(I instanceof f32)); assert( f instanceof f32 ); assert(!(F instanceof f32)); assert(!(a instanceof f64)); assert(!(b instanceof f64)); assert(!(i instanceof f64)); assert(!(I instanceof f64)); assert(!(f instanceof f64)); assert( F instanceof f64 ); function isI32<T>(v: T): bool { // should eliminate non-applicable branches (see fixture) if (v instanceof i32) { return true; } else {
assert(!isI32(0.0)); assert(!isI32(<u32>0)); // signedness is relevant assert(!isI32(<u16>0)); // byte size is relevant var an: A | null = null; assert(!(an instanceof A)); // TS: ==null is not an instance of A assert( an instanceof A | null); // AS: ==null is an instance of A | null an = changetype<A | null>(1); assert( an instanceof A); // TS: !=null is an instance of A assert( an instanceof A | null); // AS: !=null is an instance of A | null // TODO: keep track of nullability during flows, so this becomes precomputable: // assert(an !== null && an instanceof A);
return false; } } assert( isI32(0));
random_line_split
instanceof.ts
class
{} class B extends A {} var a: A; var b: B; var i: i32; var I: i64; var f: f32; var F: f64; assert( a instanceof A ); assert( b instanceof A ); assert(!(i instanceof A)); assert(!(I instanceof A)); assert(!(f instanceof A)); assert(!(F instanceof A)); // assert(!(a instanceof B)); // dynamic upcast, checked in rt/instanceof assert( b instanceof B ); assert(!(i instanceof B)); assert(!(I instanceof B)); assert(!(f instanceof B)); assert(!(F instanceof B)); assert(!(a instanceof i32)); assert(!(b instanceof i32)); assert( i instanceof i32 ); assert(!(I instanceof i32)); assert(!(f instanceof i32)); assert(!(F instanceof i32)); assert(!(a instanceof i64)); assert(!(b instanceof i64)); assert(!(i instanceof i64)); assert( I instanceof i64 ); assert(!(f instanceof i64)); assert(!(F instanceof i64)); assert(!(a instanceof f32)); assert(!(b instanceof f32)); assert(!(i instanceof f32)); assert(!(I instanceof f32)); assert( f instanceof f32 ); assert(!(F instanceof f32)); assert(!(a instanceof f64)); assert(!(b instanceof f64)); assert(!(i instanceof f64)); assert(!(I instanceof f64)); assert(!(f instanceof f64)); assert( F instanceof f64 ); function isI32<T>(v: T): bool { // should eliminate non-applicable branches (see fixture) if (v instanceof i32) { return true; } else { return false; } } assert( isI32(0)); assert(!isI32(0.0)); assert(!isI32(<u32>0)); // signedness is relevant assert(!isI32(<u16>0)); // byte size is relevant var an: A | null = null; assert(!(an instanceof A)); // TS: ==null is not an instance of A assert( an instanceof A | null); // AS: ==null is an instance of A | null an = changetype<A | null>(1); assert( an instanceof A); // TS: !=null is an instance of A assert( an instanceof A | null); // AS: !=null is an instance of A | null // TODO: keep track of nullability during flows, so this becomes precomputable: // assert(an !== null && an instanceof A);
A
identifier_name
instanceof.ts
class A {} class B extends A {} var a: A; var b: B; var i: i32; var I: i64; var f: f32; var F: f64; assert( a instanceof A ); assert( b instanceof A ); assert(!(i instanceof A)); assert(!(I instanceof A)); assert(!(f instanceof A)); assert(!(F instanceof A)); // assert(!(a instanceof B)); // dynamic upcast, checked in rt/instanceof assert( b instanceof B ); assert(!(i instanceof B)); assert(!(I instanceof B)); assert(!(f instanceof B)); assert(!(F instanceof B)); assert(!(a instanceof i32)); assert(!(b instanceof i32)); assert( i instanceof i32 ); assert(!(I instanceof i32)); assert(!(f instanceof i32)); assert(!(F instanceof i32)); assert(!(a instanceof i64)); assert(!(b instanceof i64)); assert(!(i instanceof i64)); assert( I instanceof i64 ); assert(!(f instanceof i64)); assert(!(F instanceof i64)); assert(!(a instanceof f32)); assert(!(b instanceof f32)); assert(!(i instanceof f32)); assert(!(I instanceof f32)); assert( f instanceof f32 ); assert(!(F instanceof f32)); assert(!(a instanceof f64)); assert(!(b instanceof f64)); assert(!(i instanceof f64)); assert(!(I instanceof f64)); assert(!(f instanceof f64)); assert( F instanceof f64 ); function isI32<T>(v: T): bool { // should eliminate non-applicable branches (see fixture) if (v instanceof i32) { return true; } else
} assert( isI32(0)); assert(!isI32(0.0)); assert(!isI32(<u32>0)); // signedness is relevant assert(!isI32(<u16>0)); // byte size is relevant var an: A | null = null; assert(!(an instanceof A)); // TS: ==null is not an instance of A assert( an instanceof A | null); // AS: ==null is an instance of A | null an = changetype<A | null>(1); assert( an instanceof A); // TS: !=null is an instance of A assert( an instanceof A | null); // AS: !=null is an instance of A | null // TODO: keep track of nullability during flows, so this becomes precomputable: // assert(an !== null && an instanceof A);
{ return false; }
conditional_block
theme.ts
import { blue } from "@material-ui/core/colors"; import { createTheme } from "@material-ui/core"; import createPalette from "@material-ui/core/styles/createPalette"; const palette = createPalette({ primary: { main: "#292", light: "#3d3" } }); const theme = createTheme({ typography: { fontSize: 24, fontFamily: ["Roboto", "sans-serif"].join(",") }, overrides: { MuiPaper: { root: { width: "100%" } }, MuiToolbar: { root: { color: palette.text.primary, backgroundColor: palette.background.default } }, MuiTabs: { root: { color: "white", backgroundColor: palette.grey[800], }, indicator: {
}, MuiTab: { textColorInherit: { opacity: 1 }, root: { textTransform: "none", maxWidth: "none", padding: 12, transition: "background-color .2s", "&$selected": { backgroundColor: palette.primary.main }, "&:hover": { backgroundColor: palette.primary.light } } }, MuiFormGroup: { root: { marginLeft: 48 } }, MuiFormControlLabel: { root: { "&:not(.Mui-disabled):hover > .MuiTypography-root": { backgroundColor: palette.action.hover }, "&:not(.Mui-disabled):hover > .MuiIconButton-root": { color: palette.primary.light } }, label: { borderRadius: 12, transition: "background-color .2s", } }, MuiFormControl: { root: { width: "100%", boxSizing: "border-box", padding: 24 } }, MuiFormLabel: { root: { color: palette.text.primary, marginBottom: 8, "&$focused": { color: palette.text.primary } }, }, MuiCheckbox: { root: { padding: 4 } }, MuiRadio: { root: { padding: 4 } }, MuiSvgIcon: { root: { width: "0.7em", height: "0.7em" } }, MuiSlider: { root: { "&:hover .MuiSlider-thumb": { color: palette.primary.light }, "&:hover .MuiSlider-track": { color: palette.primary.light } }, thumb: { width: 24, height: 24, marginTop: -12, marginLeft: -12, color: palette.primary.main, }, track: { color: palette.primary.main, height: 3 }, rail: { color: palette.action.active } }, MuiLink: { root: { fontFamily: ["Roboto", "sans-serif"].join(","), // otherwise not set fontSize: 16, // if not set, prod is different color: blue[700], margin: 8, borderRadius: 12, transition: "background-color .2s", "&:hover": { color: palette.text.primary, backgroundColor: palette.action.hover } }, underlineHover: { "&:hover": { textDecoration: "none" } } }, MuiTooltip: { tooltip: { maxWidth: 'none' } } }, palette }); export default theme;
display: "none" }
random_line_split
lib.rs
//! Parallel mutation of vectors via non-overlapping slices. #![cfg_attr(feature = "bench", feature(test, step_by))] use std::fmt::{Formatter, Debug}; use std::fmt::Error as FmtError; use std::sync::{Arc, Condvar, Mutex}; use std::mem; use std::ops; /// Our inner `Vec` container. struct VecBox<T> { slice_count: usize, data: Vec<T>, } impl<T> VecBox<T> { fn new(slice_count: usize, data: Vec<T>) -> VecBox<T> { VecBox { slice_count: slice_count, data: data, } } /// Decrement the slice count fn decrement(&mut self) { self.slice_count -= 1; } /// Try to unwrap this box, replacing `data` with an empty vector if `slice_count == 0` fn try_unwrap(&mut self) -> Option<Vec<T>> { match self.slice_count { 0 => Some(mem::replace(&mut self.data, Vec::new())), _ => None, } } } struct ParVecInner<T> { inner: Mutex<VecBox<T>>, cvar: Condvar, } impl<T: Send> ParVecInner<T> { fn new(slice_count: usize, data: Vec<T>) -> ParVecInner<T> { ParVecInner { inner: Mutex::new(VecBox::new(slice_count, data)), cvar: Condvar::new(), } } fn decrement(&self) { self.inner.lock().unwrap().decrement(); self.cvar.notify_one(); } fn try_unwrap(&self, timeout: u32) -> Option<Vec<T>> { let mut lock = self.inner.lock().unwrap(); if let Some(data) = lock.try_unwrap() { return Some(data); } let (mut lock, _) = self.cvar.wait_timeout_ms(lock, timeout).unwrap(); lock.try_unwrap() } fn unwrap(&self) -> Vec<T> { let mut lock = self.inner.lock().unwrap(); loop { if let Some(data) = lock.try_unwrap() { return data; } lock = self.cvar.wait(lock).unwrap(); } } } /// A vector that can be mutated in-parallel via non-overlapping slices. /// /// Get a `ParVec` and a vector of slices via `new()`, send the slices to other threads /// and mutate them, then get the mutated vector with `.unwrap()` when finished. pub struct ParVec<T> { inner: Arc<ParVecInner<T>>, } impl<T: Send> ParVec<T> { /// Create a new `ParVec`, returning it and a number of slices equal to /// `slice_count`, that can be sent to other threads and mutated in-parallel. /// /// The vector's length will be divided up amongst the slices as evenly as possible. pub fn new(vec: Vec<T>, slice_count: usize) -> (ParVec<T>, Vec<ParSlice<T>>) { let slices = sub_slices(&vec, slice_count); let inner = Arc::new(ParVecInner::new(slice_count, vec)); let par_slices = slices.into_iter().map(|slice| ParSlice { inner: inner.clone(), data: slice, } ).collect(); let par_vec = ParVec { inner: inner, }; (par_vec, par_slices) } /// Attempt to take the inner `Vec` before `timeout` if there are no slices remaining. /// Returns `None` if the timeout elapses and there are still slices remaining. pub fn try_unwrap(&self, timeout: u32) -> Option<Vec<T>> { self.inner.try_unwrap(timeout) } /// Take the inner `Vec`, waiting until all slices have been freed. /// /// ###Deadlock Warning /// Before calling this method, you should ensure that all `ParSlice` instances have either been: /// /// - moved to other threads that will quit sometime in the future, or; /// - dropped, implicitly (left in an inner scope) or explicitly (passed to `mem::drop()`) /// /// Otherwise, a deadlock will likely occur. pub fn unwrap(self) -> Vec<T> { self.inner.unwrap() } } /// Create a vector of raw subslices that are as close to each other in size as possible. fn sub_slices<T>(parent: &[T], slice_count: usize) -> Vec<*mut [T]> { use std::cmp; let len = parent.len(); let mut start = 0; // By iteratively dividing the length remaining in the vector by the number of slices // remaining, we get a set of slices with a minimal deviation of lengths. // // For example, taking 8 slices of a vector of length 42 should yield 6 slices of length 5 and // 2 slices of length 6. In contrast, taking 7 slices should yield 7 slices of length 6. (1 .. slice_count + 1).rev().map(|curr| { let slice_len = (len - start) / curr; let end = cmp::min(start + slice_len, len); let slice = &parent[start..end]; start += slice_len; slice as *const [T] as *mut [T] }).collect() } /// A slice of `ParVec` that can be sent to another task for processing. /// Automatically releases the slice on drop. pub struct ParSlice<T: Send> { inner: Arc<ParVecInner<T>>, data: *mut [T], } unsafe impl<T: Send> Send for ParSlice<T> {} impl<T: Send> ops::Deref for ParSlice<T> { type Target = [T]; fn deref<'a>(&'a self) -> &'a [T] { unsafe { & *self.data } } } impl<T: Send> ops::DerefMut for ParSlice<T> { fn deref_mut<'a>(&'a mut self) -> &'a mut [T] { unsafe { &mut *self.data } } } impl<T: Send> Debug for ParSlice<T> where T: Debug { fn fmt(&self, f: &mut Formatter) -> Result<(), FmtError> { write!(f, "{:?}", &*self) } } impl<T: Send> Drop for ParSlice<T> { fn drop(&mut self) { self.inner.decrement(); } } // place these constants here so both the `test` and `bench` modules can use them const TEST_SLICES: usize = 8; const TEST_MAX: u32 = 1000; #[cfg(test)] mod test { use ::{ParVec, TEST_SLICES, TEST_MAX}; #[test] fn test_unwrap_safely() { let (vec, slices) = ParVec::new([5u32; TEST_MAX as usize].to_vec(), TEST_SLICES); drop(slices); let vec = vec.unwrap(); assert_eq!(&*vec, &[5u32; TEST_MAX as usize][..]); } #[test] fn test_slices() { let (_, slices) = ParVec::new((1u32 .. TEST_MAX).collect(), TEST_SLICES); assert_eq!(slices.len(), TEST_SLICES); } #[test] fn test_nonoverlapping_slices() { fn are_nonoverlapping<T>(left: &[T], right: &[T]) -> bool { let left_start = left.as_ptr() as usize; let right_start = right.as_ptr() as usize; let left_end = left_start + left.len(); let right_end = right_start + right.len(); // `left` starts and ends before `right` left_end < right_start || // `right` ends before `left` right_end < left_start } let data: Vec<u32> = (1 .. TEST_MAX).collect(); let start_ptr = data.as_ptr() as usize; let (_, slices) = ParVec::new(data, TEST_SLICES); // This can probably be done in O(n log n) instead of O(n^2). // Suggestions are welcome. for (left_idx, left) in slices.iter().enumerate() { for (_, right) in slices.iter().enumerate() .filter(|&(right_idx, _)| right_idx != left_idx) { let left_start = left.as_ptr() as usize - start_ptr; let right_start = right.as_ptr() as usize - start_ptr; assert!( are_nonoverlapping(left, right), "Slices overlapped! left: {left:?} right: {right:?}", left = (left_start, left_start + left.len()), right = (right_start, right_start + right.len()) ) } } } } #[cfg(feature = "bench")] mod bench { extern crate rand; extern crate threadpool; extern crate test; use ::{ParVec, TEST_SLICES, TEST_MAX}; use self::rand::{thread_rng, Rng}; use self::test::Bencher; use self::threadpool::ThreadPool; #[bench] fn seq_prime_factors_1000(b: &mut Bencher) { let vec: Vec<u32> = (1 .. TEST_MAX).collect(); b.iter(|| { let _: Vec<(u32, Vec<u32>)> = vec.iter() .map(|&x| (x, get_prime_factors(x))) .collect(); }); } #[bench] fn par_prime_factors_1000(b: &mut Bencher) { let mut rng = thread_rng(); let pool = ThreadPool::new(TEST_SLICES); b.iter(|| { let mut vec: Vec<(u32, Vec<u32>)> = (1 .. TEST_MAX) .map(|x| (x, Vec::new())).collect(); // Shuffle so each thread gets an even distribution of work. // Otherwise, the threads with the lower numbers will quit early. rng.shuffle(&mut *vec); let (par_vec, par_slices) = ParVec::new(vec, TEST_SLICES); for mut slice in par_slices { pool.execute(move || for pair in &mut *slice { let (x, ref mut x_primes) = *pair; *x_primes = get_prime_factors(x); } ); } let mut vec = par_vec.unwrap(); // Sort so they're in the same order as sequential. vec.sort(); }); } fn get_prime_factors(x: u32) -> Vec<u32> { (1 .. x).filter(|&y| x % y == 0 && is_prime(y)).collect() } fn is_prime(x: u32) -> bool { // 2 and 3 are prime, but 0 and 1 are not. (x > 1 && x < 4) || // Fast check for even-ness. x & 1 != 0 && // If `x mod i` for every odd number `i < x`, then x is prime. // Intentionally naive for the sake of the benchmark. (3 .. x).step_by(2).all(|i| x % i != 0) } #[test] fn
() { // Test a reasonable number of primes to make sure the function actually works for &i in &[2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37] { assert!(is_prime(i)); } for i in (4..40).step_by(2) { assert!(!is_prime(i)); } } }
test_is_prime
identifier_name
lib.rs
//! Parallel mutation of vectors via non-overlapping slices. #![cfg_attr(feature = "bench", feature(test, step_by))] use std::fmt::{Formatter, Debug}; use std::fmt::Error as FmtError; use std::sync::{Arc, Condvar, Mutex}; use std::mem; use std::ops; /// Our inner `Vec` container. struct VecBox<T> { slice_count: usize, data: Vec<T>, } impl<T> VecBox<T> { fn new(slice_count: usize, data: Vec<T>) -> VecBox<T> { VecBox { slice_count: slice_count, data: data, } } /// Decrement the slice count fn decrement(&mut self) { self.slice_count -= 1; } /// Try to unwrap this box, replacing `data` with an empty vector if `slice_count == 0` fn try_unwrap(&mut self) -> Option<Vec<T>> { match self.slice_count { 0 => Some(mem::replace(&mut self.data, Vec::new())), _ => None, } } } struct ParVecInner<T> { inner: Mutex<VecBox<T>>, cvar: Condvar, } impl<T: Send> ParVecInner<T> { fn new(slice_count: usize, data: Vec<T>) -> ParVecInner<T> { ParVecInner { inner: Mutex::new(VecBox::new(slice_count, data)), cvar: Condvar::new(), } } fn decrement(&self) { self.inner.lock().unwrap().decrement(); self.cvar.notify_one(); } fn try_unwrap(&self, timeout: u32) -> Option<Vec<T>> { let mut lock = self.inner.lock().unwrap(); if let Some(data) = lock.try_unwrap() { return Some(data); } let (mut lock, _) = self.cvar.wait_timeout_ms(lock, timeout).unwrap(); lock.try_unwrap() } fn unwrap(&self) -> Vec<T> { let mut lock = self.inner.lock().unwrap(); loop { if let Some(data) = lock.try_unwrap() { return data; } lock = self.cvar.wait(lock).unwrap(); } } } /// A vector that can be mutated in-parallel via non-overlapping slices. /// /// Get a `ParVec` and a vector of slices via `new()`, send the slices to other threads /// and mutate them, then get the mutated vector with `.unwrap()` when finished. pub struct ParVec<T> { inner: Arc<ParVecInner<T>>, } impl<T: Send> ParVec<T> { /// Create a new `ParVec`, returning it and a number of slices equal to /// `slice_count`, that can be sent to other threads and mutated in-parallel. /// /// The vector's length will be divided up amongst the slices as evenly as possible. pub fn new(vec: Vec<T>, slice_count: usize) -> (ParVec<T>, Vec<ParSlice<T>>) { let slices = sub_slices(&vec, slice_count); let inner = Arc::new(ParVecInner::new(slice_count, vec)); let par_slices = slices.into_iter().map(|slice| ParSlice { inner: inner.clone(), data: slice, } ).collect(); let par_vec = ParVec { inner: inner, }; (par_vec, par_slices) } /// Attempt to take the inner `Vec` before `timeout` if there are no slices remaining. /// Returns `None` if the timeout elapses and there are still slices remaining. pub fn try_unwrap(&self, timeout: u32) -> Option<Vec<T>> { self.inner.try_unwrap(timeout) } /// Take the inner `Vec`, waiting until all slices have been freed. /// /// ###Deadlock Warning /// Before calling this method, you should ensure that all `ParSlice` instances have either been: /// /// - moved to other threads that will quit sometime in the future, or; /// - dropped, implicitly (left in an inner scope) or explicitly (passed to `mem::drop()`) /// /// Otherwise, a deadlock will likely occur. pub fn unwrap(self) -> Vec<T> { self.inner.unwrap() } } /// Create a vector of raw subslices that are as close to each other in size as possible. fn sub_slices<T>(parent: &[T], slice_count: usize) -> Vec<*mut [T]> { use std::cmp; let len = parent.len(); let mut start = 0; // By iteratively dividing the length remaining in the vector by the number of slices // remaining, we get a set of slices with a minimal deviation of lengths. // // For example, taking 8 slices of a vector of length 42 should yield 6 slices of length 5 and // 2 slices of length 6. In contrast, taking 7 slices should yield 7 slices of length 6.
let slice = &parent[start..end]; start += slice_len; slice as *const [T] as *mut [T] }).collect() } /// A slice of `ParVec` that can be sent to another task for processing. /// Automatically releases the slice on drop. pub struct ParSlice<T: Send> { inner: Arc<ParVecInner<T>>, data: *mut [T], } unsafe impl<T: Send> Send for ParSlice<T> {} impl<T: Send> ops::Deref for ParSlice<T> { type Target = [T]; fn deref<'a>(&'a self) -> &'a [T] { unsafe { & *self.data } } } impl<T: Send> ops::DerefMut for ParSlice<T> { fn deref_mut<'a>(&'a mut self) -> &'a mut [T] { unsafe { &mut *self.data } } } impl<T: Send> Debug for ParSlice<T> where T: Debug { fn fmt(&self, f: &mut Formatter) -> Result<(), FmtError> { write!(f, "{:?}", &*self) } } impl<T: Send> Drop for ParSlice<T> { fn drop(&mut self) { self.inner.decrement(); } } // place these constants here so both the `test` and `bench` modules can use them const TEST_SLICES: usize = 8; const TEST_MAX: u32 = 1000; #[cfg(test)] mod test { use ::{ParVec, TEST_SLICES, TEST_MAX}; #[test] fn test_unwrap_safely() { let (vec, slices) = ParVec::new([5u32; TEST_MAX as usize].to_vec(), TEST_SLICES); drop(slices); let vec = vec.unwrap(); assert_eq!(&*vec, &[5u32; TEST_MAX as usize][..]); } #[test] fn test_slices() { let (_, slices) = ParVec::new((1u32 .. TEST_MAX).collect(), TEST_SLICES); assert_eq!(slices.len(), TEST_SLICES); } #[test] fn test_nonoverlapping_slices() { fn are_nonoverlapping<T>(left: &[T], right: &[T]) -> bool { let left_start = left.as_ptr() as usize; let right_start = right.as_ptr() as usize; let left_end = left_start + left.len(); let right_end = right_start + right.len(); // `left` starts and ends before `right` left_end < right_start || // `right` ends before `left` right_end < left_start } let data: Vec<u32> = (1 .. TEST_MAX).collect(); let start_ptr = data.as_ptr() as usize; let (_, slices) = ParVec::new(data, TEST_SLICES); // This can probably be done in O(n log n) instead of O(n^2). // Suggestions are welcome. for (left_idx, left) in slices.iter().enumerate() { for (_, right) in slices.iter().enumerate() .filter(|&(right_idx, _)| right_idx != left_idx) { let left_start = left.as_ptr() as usize - start_ptr; let right_start = right.as_ptr() as usize - start_ptr; assert!( are_nonoverlapping(left, right), "Slices overlapped! left: {left:?} right: {right:?}", left = (left_start, left_start + left.len()), right = (right_start, right_start + right.len()) ) } } } } #[cfg(feature = "bench")] mod bench { extern crate rand; extern crate threadpool; extern crate test; use ::{ParVec, TEST_SLICES, TEST_MAX}; use self::rand::{thread_rng, Rng}; use self::test::Bencher; use self::threadpool::ThreadPool; #[bench] fn seq_prime_factors_1000(b: &mut Bencher) { let vec: Vec<u32> = (1 .. TEST_MAX).collect(); b.iter(|| { let _: Vec<(u32, Vec<u32>)> = vec.iter() .map(|&x| (x, get_prime_factors(x))) .collect(); }); } #[bench] fn par_prime_factors_1000(b: &mut Bencher) { let mut rng = thread_rng(); let pool = ThreadPool::new(TEST_SLICES); b.iter(|| { let mut vec: Vec<(u32, Vec<u32>)> = (1 .. TEST_MAX) .map(|x| (x, Vec::new())).collect(); // Shuffle so each thread gets an even distribution of work. // Otherwise, the threads with the lower numbers will quit early. rng.shuffle(&mut *vec); let (par_vec, par_slices) = ParVec::new(vec, TEST_SLICES); for mut slice in par_slices { pool.execute(move || for pair in &mut *slice { let (x, ref mut x_primes) = *pair; *x_primes = get_prime_factors(x); } ); } let mut vec = par_vec.unwrap(); // Sort so they're in the same order as sequential. vec.sort(); }); } fn get_prime_factors(x: u32) -> Vec<u32> { (1 .. x).filter(|&y| x % y == 0 && is_prime(y)).collect() } fn is_prime(x: u32) -> bool { // 2 and 3 are prime, but 0 and 1 are not. (x > 1 && x < 4) || // Fast check for even-ness. x & 1 != 0 && // If `x mod i` for every odd number `i < x`, then x is prime. // Intentionally naive for the sake of the benchmark. (3 .. x).step_by(2).all(|i| x % i != 0) } #[test] fn test_is_prime() { // Test a reasonable number of primes to make sure the function actually works for &i in &[2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37] { assert!(is_prime(i)); } for i in (4..40).step_by(2) { assert!(!is_prime(i)); } } }
(1 .. slice_count + 1).rev().map(|curr| { let slice_len = (len - start) / curr; let end = cmp::min(start + slice_len, len);
random_line_split
lib.rs
//! Parallel mutation of vectors via non-overlapping slices. #![cfg_attr(feature = "bench", feature(test, step_by))] use std::fmt::{Formatter, Debug}; use std::fmt::Error as FmtError; use std::sync::{Arc, Condvar, Mutex}; use std::mem; use std::ops; /// Our inner `Vec` container. struct VecBox<T> { slice_count: usize, data: Vec<T>, } impl<T> VecBox<T> { fn new(slice_count: usize, data: Vec<T>) -> VecBox<T> { VecBox { slice_count: slice_count, data: data, } } /// Decrement the slice count fn decrement(&mut self) { self.slice_count -= 1; } /// Try to unwrap this box, replacing `data` with an empty vector if `slice_count == 0` fn try_unwrap(&mut self) -> Option<Vec<T>> { match self.slice_count { 0 => Some(mem::replace(&mut self.data, Vec::new())), _ => None, } } } struct ParVecInner<T> { inner: Mutex<VecBox<T>>, cvar: Condvar, } impl<T: Send> ParVecInner<T> { fn new(slice_count: usize, data: Vec<T>) -> ParVecInner<T> { ParVecInner { inner: Mutex::new(VecBox::new(slice_count, data)), cvar: Condvar::new(), } } fn decrement(&self) { self.inner.lock().unwrap().decrement(); self.cvar.notify_one(); } fn try_unwrap(&self, timeout: u32) -> Option<Vec<T>> { let mut lock = self.inner.lock().unwrap(); if let Some(data) = lock.try_unwrap() { return Some(data); } let (mut lock, _) = self.cvar.wait_timeout_ms(lock, timeout).unwrap(); lock.try_unwrap() } fn unwrap(&self) -> Vec<T> { let mut lock = self.inner.lock().unwrap(); loop { if let Some(data) = lock.try_unwrap() { return data; } lock = self.cvar.wait(lock).unwrap(); } } } /// A vector that can be mutated in-parallel via non-overlapping slices. /// /// Get a `ParVec` and a vector of slices via `new()`, send the slices to other threads /// and mutate them, then get the mutated vector with `.unwrap()` when finished. pub struct ParVec<T> { inner: Arc<ParVecInner<T>>, } impl<T: Send> ParVec<T> { /// Create a new `ParVec`, returning it and a number of slices equal to /// `slice_count`, that can be sent to other threads and mutated in-parallel. /// /// The vector's length will be divided up amongst the slices as evenly as possible. pub fn new(vec: Vec<T>, slice_count: usize) -> (ParVec<T>, Vec<ParSlice<T>>) { let slices = sub_slices(&vec, slice_count); let inner = Arc::new(ParVecInner::new(slice_count, vec)); let par_slices = slices.into_iter().map(|slice| ParSlice { inner: inner.clone(), data: slice, } ).collect(); let par_vec = ParVec { inner: inner, }; (par_vec, par_slices) } /// Attempt to take the inner `Vec` before `timeout` if there are no slices remaining. /// Returns `None` if the timeout elapses and there are still slices remaining. pub fn try_unwrap(&self, timeout: u32) -> Option<Vec<T>> { self.inner.try_unwrap(timeout) } /// Take the inner `Vec`, waiting until all slices have been freed. /// /// ###Deadlock Warning /// Before calling this method, you should ensure that all `ParSlice` instances have either been: /// /// - moved to other threads that will quit sometime in the future, or; /// - dropped, implicitly (left in an inner scope) or explicitly (passed to `mem::drop()`) /// /// Otherwise, a deadlock will likely occur. pub fn unwrap(self) -> Vec<T> { self.inner.unwrap() } } /// Create a vector of raw subslices that are as close to each other in size as possible. fn sub_slices<T>(parent: &[T], slice_count: usize) -> Vec<*mut [T]> { use std::cmp; let len = parent.len(); let mut start = 0; // By iteratively dividing the length remaining in the vector by the number of slices // remaining, we get a set of slices with a minimal deviation of lengths. // // For example, taking 8 slices of a vector of length 42 should yield 6 slices of length 5 and // 2 slices of length 6. In contrast, taking 7 slices should yield 7 slices of length 6. (1 .. slice_count + 1).rev().map(|curr| { let slice_len = (len - start) / curr; let end = cmp::min(start + slice_len, len); let slice = &parent[start..end]; start += slice_len; slice as *const [T] as *mut [T] }).collect() } /// A slice of `ParVec` that can be sent to another task for processing. /// Automatically releases the slice on drop. pub struct ParSlice<T: Send> { inner: Arc<ParVecInner<T>>, data: *mut [T], } unsafe impl<T: Send> Send for ParSlice<T> {} impl<T: Send> ops::Deref for ParSlice<T> { type Target = [T]; fn deref<'a>(&'a self) -> &'a [T] { unsafe { & *self.data } } } impl<T: Send> ops::DerefMut for ParSlice<T> { fn deref_mut<'a>(&'a mut self) -> &'a mut [T] { unsafe { &mut *self.data } } } impl<T: Send> Debug for ParSlice<T> where T: Debug { fn fmt(&self, f: &mut Formatter) -> Result<(), FmtError> { write!(f, "{:?}", &*self) } } impl<T: Send> Drop for ParSlice<T> { fn drop(&mut self) { self.inner.decrement(); } } // place these constants here so both the `test` and `bench` modules can use them const TEST_SLICES: usize = 8; const TEST_MAX: u32 = 1000; #[cfg(test)] mod test { use ::{ParVec, TEST_SLICES, TEST_MAX}; #[test] fn test_unwrap_safely() { let (vec, slices) = ParVec::new([5u32; TEST_MAX as usize].to_vec(), TEST_SLICES); drop(slices); let vec = vec.unwrap(); assert_eq!(&*vec, &[5u32; TEST_MAX as usize][..]); } #[test] fn test_slices() { let (_, slices) = ParVec::new((1u32 .. TEST_MAX).collect(), TEST_SLICES); assert_eq!(slices.len(), TEST_SLICES); } #[test] fn test_nonoverlapping_slices() { fn are_nonoverlapping<T>(left: &[T], right: &[T]) -> bool { let left_start = left.as_ptr() as usize; let right_start = right.as_ptr() as usize; let left_end = left_start + left.len(); let right_end = right_start + right.len(); // `left` starts and ends before `right` left_end < right_start || // `right` ends before `left` right_end < left_start } let data: Vec<u32> = (1 .. TEST_MAX).collect(); let start_ptr = data.as_ptr() as usize; let (_, slices) = ParVec::new(data, TEST_SLICES); // This can probably be done in O(n log n) instead of O(n^2). // Suggestions are welcome. for (left_idx, left) in slices.iter().enumerate() { for (_, right) in slices.iter().enumerate() .filter(|&(right_idx, _)| right_idx != left_idx) { let left_start = left.as_ptr() as usize - start_ptr; let right_start = right.as_ptr() as usize - start_ptr; assert!( are_nonoverlapping(left, right), "Slices overlapped! left: {left:?} right: {right:?}", left = (left_start, left_start + left.len()), right = (right_start, right_start + right.len()) ) } } } } #[cfg(feature = "bench")] mod bench { extern crate rand; extern crate threadpool; extern crate test; use ::{ParVec, TEST_SLICES, TEST_MAX}; use self::rand::{thread_rng, Rng}; use self::test::Bencher; use self::threadpool::ThreadPool; #[bench] fn seq_prime_factors_1000(b: &mut Bencher)
#[bench] fn par_prime_factors_1000(b: &mut Bencher) { let mut rng = thread_rng(); let pool = ThreadPool::new(TEST_SLICES); b.iter(|| { let mut vec: Vec<(u32, Vec<u32>)> = (1 .. TEST_MAX) .map(|x| (x, Vec::new())).collect(); // Shuffle so each thread gets an even distribution of work. // Otherwise, the threads with the lower numbers will quit early. rng.shuffle(&mut *vec); let (par_vec, par_slices) = ParVec::new(vec, TEST_SLICES); for mut slice in par_slices { pool.execute(move || for pair in &mut *slice { let (x, ref mut x_primes) = *pair; *x_primes = get_prime_factors(x); } ); } let mut vec = par_vec.unwrap(); // Sort so they're in the same order as sequential. vec.sort(); }); } fn get_prime_factors(x: u32) -> Vec<u32> { (1 .. x).filter(|&y| x % y == 0 && is_prime(y)).collect() } fn is_prime(x: u32) -> bool { // 2 and 3 are prime, but 0 and 1 are not. (x > 1 && x < 4) || // Fast check for even-ness. x & 1 != 0 && // If `x mod i` for every odd number `i < x`, then x is prime. // Intentionally naive for the sake of the benchmark. (3 .. x).step_by(2).all(|i| x % i != 0) } #[test] fn test_is_prime() { // Test a reasonable number of primes to make sure the function actually works for &i in &[2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37] { assert!(is_prime(i)); } for i in (4..40).step_by(2) { assert!(!is_prime(i)); } } }
{ let vec: Vec<u32> = (1 .. TEST_MAX).collect(); b.iter(|| { let _: Vec<(u32, Vec<u32>)> = vec.iter() .map(|&x| (x, get_prime_factors(x))) .collect(); }); }
identifier_body
test-async-wrap-disabled-propagate-parent.js
'use strict'; require('../common'); const assert = require('assert'); const net = require('net'); const async_wrap = process.binding('async_wrap'); const providers = Object.keys(async_wrap.Providers); const uidSymbol = Symbol('uid'); let cntr = 0; let client; function init(uid, type, parentUid, parentHandle) { this[uidSymbol] = uid; if (parentHandle)
} function noop() { } async_wrap.setupHooks({ init }); async_wrap.enable(); const server = net.createServer(function(c) { client = c; // Allow init callback to run before closing. setImmediate(() => { c.end(); this.close(); }); }).listen(0, function() { net.connect(this.address().port, noop); }); async_wrap.disable(); process.on('exit', function() { // init should have only been called once with a parent. assert.equal(cntr, 1); });
{ cntr++; // Cannot assert in init callback or will abort. process.nextTick(() => { assert.equal(providers[type], 'TCPWRAP'); assert.equal(parentUid, server._handle[uidSymbol], 'server uid doesn\'t match parent uid'); assert.equal(parentHandle, server._handle, 'server handle doesn\'t match parent handle'); assert.equal(this, client._handle, 'client doesn\'t match context'); }); }
conditional_block
test-async-wrap-disabled-propagate-parent.js
'use strict'; require('../common'); const assert = require('assert'); const net = require('net'); const async_wrap = process.binding('async_wrap'); const providers = Object.keys(async_wrap.Providers); const uidSymbol = Symbol('uid'); let cntr = 0; let client; function init(uid, type, parentUid, parentHandle) { this[uidSymbol] = uid; if (parentHandle) { cntr++; // Cannot assert in init callback or will abort. process.nextTick(() => { assert.equal(providers[type], 'TCPWRAP'); assert.equal(parentUid, server._handle[uidSymbol], 'server uid doesn\'t match parent uid'); assert.equal(parentHandle, server._handle, 'server handle doesn\'t match parent handle'); assert.equal(this, client._handle, 'client doesn\'t match context'); }); } } function noop() { } async_wrap.setupHooks({ init }); async_wrap.enable();
const server = net.createServer(function(c) { client = c; // Allow init callback to run before closing. setImmediate(() => { c.end(); this.close(); }); }).listen(0, function() { net.connect(this.address().port, noop); }); async_wrap.disable(); process.on('exit', function() { // init should have only been called once with a parent. assert.equal(cntr, 1); });
random_line_split
test-async-wrap-disabled-propagate-parent.js
'use strict'; require('../common'); const assert = require('assert'); const net = require('net'); const async_wrap = process.binding('async_wrap'); const providers = Object.keys(async_wrap.Providers); const uidSymbol = Symbol('uid'); let cntr = 0; let client; function init(uid, type, parentUid, parentHandle)
function noop() { } async_wrap.setupHooks({ init }); async_wrap.enable(); const server = net.createServer(function(c) { client = c; // Allow init callback to run before closing. setImmediate(() => { c.end(); this.close(); }); }).listen(0, function() { net.connect(this.address().port, noop); }); async_wrap.disable(); process.on('exit', function() { // init should have only been called once with a parent. assert.equal(cntr, 1); });
{ this[uidSymbol] = uid; if (parentHandle) { cntr++; // Cannot assert in init callback or will abort. process.nextTick(() => { assert.equal(providers[type], 'TCPWRAP'); assert.equal(parentUid, server._handle[uidSymbol], 'server uid doesn\'t match parent uid'); assert.equal(parentHandle, server._handle, 'server handle doesn\'t match parent handle'); assert.equal(this, client._handle, 'client doesn\'t match context'); }); } }
identifier_body
test-async-wrap-disabled-propagate-parent.js
'use strict'; require('../common'); const assert = require('assert'); const net = require('net'); const async_wrap = process.binding('async_wrap'); const providers = Object.keys(async_wrap.Providers); const uidSymbol = Symbol('uid'); let cntr = 0; let client; function init(uid, type, parentUid, parentHandle) { this[uidSymbol] = uid; if (parentHandle) { cntr++; // Cannot assert in init callback or will abort. process.nextTick(() => { assert.equal(providers[type], 'TCPWRAP'); assert.equal(parentUid, server._handle[uidSymbol], 'server uid doesn\'t match parent uid'); assert.equal(parentHandle, server._handle, 'server handle doesn\'t match parent handle'); assert.equal(this, client._handle, 'client doesn\'t match context'); }); } } function
() { } async_wrap.setupHooks({ init }); async_wrap.enable(); const server = net.createServer(function(c) { client = c; // Allow init callback to run before closing. setImmediate(() => { c.end(); this.close(); }); }).listen(0, function() { net.connect(this.address().port, noop); }); async_wrap.disable(); process.on('exit', function() { // init should have only been called once with a parent. assert.equal(cntr, 1); });
noop
identifier_name
rpc.rs
// Copyright 2015-2017 Parity Technologies (UK) Ltd. // This file is part of Parity. // Parity is free software: you can redistribute it and/or modify // it under the terms of the GNU General Public License as published by // the Free Software Foundation, either version 3 of the License, or // (at your option) any later version. // Parity is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the // GNU General Public License for more details. // You should have received a copy of the GNU General Public License // along with Parity. If not, see <http://www.gnu.org/licenses/>. use std::io; use std::sync::Arc; use std::path::PathBuf; use std::collections::HashSet; use dapps; use dir::default_data_path; use helpers::{parity_ipc_path, replace_home}; use jsonrpc_core::MetaIoHandler; use parity_reactor::TokioRemote; use parity_rpc::informant::{RpcStats, Middleware}; use parity_rpc::{self as rpc, Metadata, DomainsValidation}; use rpc_apis::{self, ApiSet}; pub use parity_rpc::{IpcServer, HttpServer, RequestMiddleware}; pub use parity_rpc::ws::Server as WsServer; pub use parity_rpc::informant::CpuPool; pub const DAPPS_DOMAIN: &'static str = "web3.site"; #[derive(Debug, Clone, PartialEq)] pub struct HttpConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub cors: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub server_threads: usize, pub processing_threads: usize, } impl HttpConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } } impl Default for HttpConfiguration { fn default() -> Self { HttpConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8545, apis: ApiSet::UnsafeContext, cors: None, hosts: Some(Vec::new()), server_threads: 1, processing_threads: 4, } } } #[derive(Debug, PartialEq, Clone)] pub struct UiConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub hosts: Option<Vec<String>>, } impl UiConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } pub fn redirection_address(&self) -> Option<(String, u16)> { self.address().map(|host| { let mut it = host.split(':'); let hostname: Option<String> = it.next().map(|s| s.to_owned()); let port: Option<u16> = it.next().and_then(|s| s.parse().ok()); (hostname.unwrap_or_else(|| "localhost".into()), port.unwrap_or(8180)) }) } } impl From<UiConfiguration> for HttpConfiguration { fn from(conf: UiConfiguration) -> Self { HttpConfiguration { enabled: conf.enabled, interface: conf.interface, port: conf.port, apis: rpc_apis::ApiSet::UnsafeContext, cors: None, hosts: conf.hosts, server_threads: 1, processing_threads: 0, } } } impl Default for UiConfiguration { fn default() -> Self { UiConfiguration { enabled: true && cfg!(feature = "ui-enabled"), port: 8180, interface: "127.0.0.1".into(), hosts: Some(vec![]), } } } #[derive(Debug, PartialEq)] pub struct IpcConfiguration { pub enabled: bool, pub socket_addr: String, pub apis: ApiSet, } impl Default for IpcConfiguration { fn default() -> Self { IpcConfiguration { enabled: true, socket_addr: if cfg!(windows) { r"\\.\pipe\jsonrpc.ipc".into() } else
, apis: ApiSet::IpcContext, } } } #[derive(Debug, Clone, PartialEq)] pub struct WsConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub origins: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub signer_path: PathBuf, pub support_token_api: bool, pub ui_address: Option<rpc::Host>, pub dapps_address: Option<rpc::Host>, } impl Default for WsConfiguration { fn default() -> Self { let data_dir = default_data_path(); WsConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8546, apis: ApiSet::UnsafeContext, origins: Some(vec!["chrome-extension://*".into(), "moz-extension://*".into()]), hosts: Some(Vec::new()), signer_path: replace_home(&data_dir, "$BASE/signer").into(), support_token_api: true, ui_address: Some("127.0.0.1:8180".into()), dapps_address: Some("127.0.0.1:8545".into()), } } } impl WsConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } } fn address(enabled: bool, bind_iface: &str, bind_port: u16, hosts: &Option<Vec<String>>) -> Option<rpc::Host> { if !enabled { return None; } match *hosts { Some(ref hosts) if !hosts.is_empty() => Some(hosts[0].clone().into()), _ => Some(format!("{}:{}", bind_iface, bind_port).into()), } } pub struct Dependencies<D: rpc_apis::Dependencies> { pub apis: Arc<D>, pub remote: TokioRemote, pub stats: Arc<RpcStats>, pub pool: Option<CpuPool>, } pub fn new_ws<D: rpc_apis::Dependencies>( conf: WsConfiguration, deps: &Dependencies<D>, ) -> Result<Option<WsServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid WebSockets listen host/port given: {}", url))?; let full_handler = setup_apis(rpc_apis::ApiSet::SafeContext, deps); let handler = { let mut handler = MetaIoHandler::with_middleware(( rpc::WsDispatcher::new(full_handler), Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) )); let apis = conf.apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler }; let remote = deps.remote.clone(); let ui_address = conf.ui_address.clone(); let allowed_origins = into_domains(with_domain(conf.origins, domain, &ui_address, &conf.dapps_address)); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let signer_path; let path = match conf.support_token_api && conf.ui_address.is_some() { true => { signer_path = ::signer::codes_path(&conf.signer_path); Some(signer_path.as_path()) }, false => None }; let start_result = rpc::start_ws( &addr, handler, remote.clone(), allowed_origins, allowed_hosts, rpc::WsExtractor::new(path.clone()), rpc::WsExtractor::new(path.clone()), rpc::WsStats::new(deps.stats.clone()), ); match start_result { Ok(server) => Ok(Some(server)), Err(rpc::ws::Error(rpc::ws::ErrorKind::Io(ref err), _)) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("WebSockets address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --ws-port and --ws-interface options.", url) ), Err(e) => Err(format!("WebSockets error: {:?}", e)), } } pub fn new_http<D: rpc_apis::Dependencies>( id: &str, options: &str, conf: HttpConfiguration, deps: &Dependencies<D>, middleware: Option<dapps::Middleware>, ) -> Result<Option<HttpServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid {} listen host/port given: {}", id, url))?; let handler = setup_apis(conf.apis, deps); let remote = deps.remote.clone(); let cors_domains = into_domains(conf.cors); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let start_result = rpc::start_http( &addr, cors_domains, allowed_hosts, handler, remote, rpc::RpcExtractor, middleware, conf.server_threads, ); match start_result { Ok(server) => Ok(Some(server)), Err(ref err) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("{} address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --{}-port and --{}-interface options.", id, url, options, options) ), Err(e) => Err(format!("{} error: {:?}", id, e)), } } pub fn new_ipc<D: rpc_apis::Dependencies>( conf: IpcConfiguration, dependencies: &Dependencies<D> ) -> Result<Option<IpcServer>, String> { if !conf.enabled { return Ok(None); } let handler = setup_apis(conf.apis, dependencies); let remote = dependencies.remote.clone(); let path = PathBuf::from(&conf.socket_addr); // Make sure socket file can be created on unix-like OS. // Windows pipe paths are not on the FS. if !cfg!(windows) { if let Some(dir) = path.parent() { ::std::fs::create_dir_all(&dir) .map_err(|err| format!("Unable to create IPC directory at {}: {}", dir.display(), err))?; } } match rpc::start_ipc(&conf.socket_addr, handler, remote, rpc::RpcExtractor) { Ok(server) => Ok(Some(server)), Err(io_error) => Err(format!("IPC error: {}", io_error)), } } fn into_domains<T: From<String>>(items: Option<Vec<String>>) -> DomainsValidation<T> { items.map(|vals| vals.into_iter().map(T::from).collect()).into() } fn with_domain(items: Option<Vec<String>>, domain: &str, ui_address: &Option<rpc::Host>, dapps_address: &Option<rpc::Host>) -> Option<Vec<String>> { fn extract_port(s: &str) -> Option<u16> { s.split(':').nth(1).and_then(|s| s.parse().ok()) } items.map(move |items| { let mut items = items.into_iter().collect::<HashSet<_>>(); { let mut add_hosts = |address: &Option<rpc::Host>| { if let Some(host) = address.clone() { items.insert(host.to_string()); items.insert(host.replace("127.0.0.1", "localhost")); items.insert(format!("http://*.{}", domain)); //proxypac if let Some(port) = extract_port(&*host) { items.insert(format!("http://*.{}:{}", domain, port)); } } }; add_hosts(ui_address); add_hosts(dapps_address); } items.into_iter().collect() }) } fn setup_apis<D>(apis: ApiSet, deps: &Dependencies<D>) -> MetaIoHandler<Metadata, Middleware<D::Notifier>> where D: rpc_apis::Dependencies { let mut handler = MetaIoHandler::with_middleware( Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) ); let apis = apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler } #[cfg(test)] mod tests { use super::address; #[test] fn should_return_proper_address() { assert_eq!(address(false, "localhost", 8180, &None), None); assert_eq!(address(true, "localhost", 8180, &None), Some("localhost:8180".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host:443".into()])), Some("host:443".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host".into()])), Some("host".into())); } }
{ let data_dir = ::dir::default_data_path(); parity_ipc_path(&data_dir, "$BASE/jsonrpc.ipc", 0) }
conditional_block
rpc.rs
// Copyright 2015-2017 Parity Technologies (UK) Ltd. // This file is part of Parity. // Parity is free software: you can redistribute it and/or modify // it under the terms of the GNU General Public License as published by // the Free Software Foundation, either version 3 of the License, or // (at your option) any later version. // Parity is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the // GNU General Public License for more details. // You should have received a copy of the GNU General Public License // along with Parity. If not, see <http://www.gnu.org/licenses/>. use std::io; use std::sync::Arc; use std::path::PathBuf; use std::collections::HashSet; use dapps; use dir::default_data_path; use helpers::{parity_ipc_path, replace_home}; use jsonrpc_core::MetaIoHandler; use parity_reactor::TokioRemote; use parity_rpc::informant::{RpcStats, Middleware}; use parity_rpc::{self as rpc, Metadata, DomainsValidation}; use rpc_apis::{self, ApiSet}; pub use parity_rpc::{IpcServer, HttpServer, RequestMiddleware}; pub use parity_rpc::ws::Server as WsServer; pub use parity_rpc::informant::CpuPool; pub const DAPPS_DOMAIN: &'static str = "web3.site"; #[derive(Debug, Clone, PartialEq)] pub struct HttpConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub cors: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub server_threads: usize, pub processing_threads: usize, } impl HttpConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } } impl Default for HttpConfiguration { fn default() -> Self { HttpConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8545, apis: ApiSet::UnsafeContext, cors: None, hosts: Some(Vec::new()), server_threads: 1, processing_threads: 4, } } } #[derive(Debug, PartialEq, Clone)] pub struct UiConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub hosts: Option<Vec<String>>, } impl UiConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } pub fn redirection_address(&self) -> Option<(String, u16)> { self.address().map(|host| { let mut it = host.split(':'); let hostname: Option<String> = it.next().map(|s| s.to_owned()); let port: Option<u16> = it.next().and_then(|s| s.parse().ok()); (hostname.unwrap_or_else(|| "localhost".into()), port.unwrap_or(8180)) }) } } impl From<UiConfiguration> for HttpConfiguration { fn from(conf: UiConfiguration) -> Self { HttpConfiguration { enabled: conf.enabled, interface: conf.interface, port: conf.port, apis: rpc_apis::ApiSet::UnsafeContext, cors: None, hosts: conf.hosts, server_threads: 1, processing_threads: 0, } } } impl Default for UiConfiguration { fn default() -> Self { UiConfiguration { enabled: true && cfg!(feature = "ui-enabled"), port: 8180, interface: "127.0.0.1".into(), hosts: Some(vec![]), } } } #[derive(Debug, PartialEq)] pub struct IpcConfiguration { pub enabled: bool, pub socket_addr: String, pub apis: ApiSet, } impl Default for IpcConfiguration { fn default() -> Self { IpcConfiguration { enabled: true, socket_addr: if cfg!(windows) { r"\\.\pipe\jsonrpc.ipc".into() } else { let data_dir = ::dir::default_data_path(); parity_ipc_path(&data_dir, "$BASE/jsonrpc.ipc", 0) }, apis: ApiSet::IpcContext, } } } #[derive(Debug, Clone, PartialEq)] pub struct WsConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub origins: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub signer_path: PathBuf, pub support_token_api: bool, pub ui_address: Option<rpc::Host>, pub dapps_address: Option<rpc::Host>, } impl Default for WsConfiguration { fn default() -> Self { let data_dir = default_data_path(); WsConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8546, apis: ApiSet::UnsafeContext, origins: Some(vec!["chrome-extension://*".into(), "moz-extension://*".into()]), hosts: Some(Vec::new()), signer_path: replace_home(&data_dir, "$BASE/signer").into(), support_token_api: true, ui_address: Some("127.0.0.1:8180".into()), dapps_address: Some("127.0.0.1:8545".into()), } } } impl WsConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } } fn address(enabled: bool, bind_iface: &str, bind_port: u16, hosts: &Option<Vec<String>>) -> Option<rpc::Host> { if !enabled { return None; } match *hosts { Some(ref hosts) if !hosts.is_empty() => Some(hosts[0].clone().into()), _ => Some(format!("{}:{}", bind_iface, bind_port).into()), } } pub struct
<D: rpc_apis::Dependencies> { pub apis: Arc<D>, pub remote: TokioRemote, pub stats: Arc<RpcStats>, pub pool: Option<CpuPool>, } pub fn new_ws<D: rpc_apis::Dependencies>( conf: WsConfiguration, deps: &Dependencies<D>, ) -> Result<Option<WsServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid WebSockets listen host/port given: {}", url))?; let full_handler = setup_apis(rpc_apis::ApiSet::SafeContext, deps); let handler = { let mut handler = MetaIoHandler::with_middleware(( rpc::WsDispatcher::new(full_handler), Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) )); let apis = conf.apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler }; let remote = deps.remote.clone(); let ui_address = conf.ui_address.clone(); let allowed_origins = into_domains(with_domain(conf.origins, domain, &ui_address, &conf.dapps_address)); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let signer_path; let path = match conf.support_token_api && conf.ui_address.is_some() { true => { signer_path = ::signer::codes_path(&conf.signer_path); Some(signer_path.as_path()) }, false => None }; let start_result = rpc::start_ws( &addr, handler, remote.clone(), allowed_origins, allowed_hosts, rpc::WsExtractor::new(path.clone()), rpc::WsExtractor::new(path.clone()), rpc::WsStats::new(deps.stats.clone()), ); match start_result { Ok(server) => Ok(Some(server)), Err(rpc::ws::Error(rpc::ws::ErrorKind::Io(ref err), _)) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("WebSockets address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --ws-port and --ws-interface options.", url) ), Err(e) => Err(format!("WebSockets error: {:?}", e)), } } pub fn new_http<D: rpc_apis::Dependencies>( id: &str, options: &str, conf: HttpConfiguration, deps: &Dependencies<D>, middleware: Option<dapps::Middleware>, ) -> Result<Option<HttpServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid {} listen host/port given: {}", id, url))?; let handler = setup_apis(conf.apis, deps); let remote = deps.remote.clone(); let cors_domains = into_domains(conf.cors); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let start_result = rpc::start_http( &addr, cors_domains, allowed_hosts, handler, remote, rpc::RpcExtractor, middleware, conf.server_threads, ); match start_result { Ok(server) => Ok(Some(server)), Err(ref err) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("{} address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --{}-port and --{}-interface options.", id, url, options, options) ), Err(e) => Err(format!("{} error: {:?}", id, e)), } } pub fn new_ipc<D: rpc_apis::Dependencies>( conf: IpcConfiguration, dependencies: &Dependencies<D> ) -> Result<Option<IpcServer>, String> { if !conf.enabled { return Ok(None); } let handler = setup_apis(conf.apis, dependencies); let remote = dependencies.remote.clone(); let path = PathBuf::from(&conf.socket_addr); // Make sure socket file can be created on unix-like OS. // Windows pipe paths are not on the FS. if !cfg!(windows) { if let Some(dir) = path.parent() { ::std::fs::create_dir_all(&dir) .map_err(|err| format!("Unable to create IPC directory at {}: {}", dir.display(), err))?; } } match rpc::start_ipc(&conf.socket_addr, handler, remote, rpc::RpcExtractor) { Ok(server) => Ok(Some(server)), Err(io_error) => Err(format!("IPC error: {}", io_error)), } } fn into_domains<T: From<String>>(items: Option<Vec<String>>) -> DomainsValidation<T> { items.map(|vals| vals.into_iter().map(T::from).collect()).into() } fn with_domain(items: Option<Vec<String>>, domain: &str, ui_address: &Option<rpc::Host>, dapps_address: &Option<rpc::Host>) -> Option<Vec<String>> { fn extract_port(s: &str) -> Option<u16> { s.split(':').nth(1).and_then(|s| s.parse().ok()) } items.map(move |items| { let mut items = items.into_iter().collect::<HashSet<_>>(); { let mut add_hosts = |address: &Option<rpc::Host>| { if let Some(host) = address.clone() { items.insert(host.to_string()); items.insert(host.replace("127.0.0.1", "localhost")); items.insert(format!("http://*.{}", domain)); //proxypac if let Some(port) = extract_port(&*host) { items.insert(format!("http://*.{}:{}", domain, port)); } } }; add_hosts(ui_address); add_hosts(dapps_address); } items.into_iter().collect() }) } fn setup_apis<D>(apis: ApiSet, deps: &Dependencies<D>) -> MetaIoHandler<Metadata, Middleware<D::Notifier>> where D: rpc_apis::Dependencies { let mut handler = MetaIoHandler::with_middleware( Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) ); let apis = apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler } #[cfg(test)] mod tests { use super::address; #[test] fn should_return_proper_address() { assert_eq!(address(false, "localhost", 8180, &None), None); assert_eq!(address(true, "localhost", 8180, &None), Some("localhost:8180".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host:443".into()])), Some("host:443".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host".into()])), Some("host".into())); } }
Dependencies
identifier_name
rpc.rs
// Copyright 2015-2017 Parity Technologies (UK) Ltd. // This file is part of Parity. // Parity is free software: you can redistribute it and/or modify // it under the terms of the GNU General Public License as published by // the Free Software Foundation, either version 3 of the License, or // (at your option) any later version. // Parity is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the // GNU General Public License for more details. // You should have received a copy of the GNU General Public License // along with Parity. If not, see <http://www.gnu.org/licenses/>. use std::io; use std::sync::Arc; use std::path::PathBuf; use std::collections::HashSet; use dapps; use dir::default_data_path; use helpers::{parity_ipc_path, replace_home}; use jsonrpc_core::MetaIoHandler; use parity_reactor::TokioRemote; use parity_rpc::informant::{RpcStats, Middleware}; use parity_rpc::{self as rpc, Metadata, DomainsValidation}; use rpc_apis::{self, ApiSet}; pub use parity_rpc::{IpcServer, HttpServer, RequestMiddleware}; pub use parity_rpc::ws::Server as WsServer; pub use parity_rpc::informant::CpuPool; pub const DAPPS_DOMAIN: &'static str = "web3.site"; #[derive(Debug, Clone, PartialEq)] pub struct HttpConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub cors: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub server_threads: usize, pub processing_threads: usize, } impl HttpConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } } impl Default for HttpConfiguration { fn default() -> Self { HttpConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8545, apis: ApiSet::UnsafeContext, cors: None, hosts: Some(Vec::new()), server_threads: 1, processing_threads: 4, } } } #[derive(Debug, PartialEq, Clone)] pub struct UiConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub hosts: Option<Vec<String>>, } impl UiConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } pub fn redirection_address(&self) -> Option<(String, u16)> { self.address().map(|host| { let mut it = host.split(':'); let hostname: Option<String> = it.next().map(|s| s.to_owned()); let port: Option<u16> = it.next().and_then(|s| s.parse().ok()); (hostname.unwrap_or_else(|| "localhost".into()), port.unwrap_or(8180)) }) } } impl From<UiConfiguration> for HttpConfiguration { fn from(conf: UiConfiguration) -> Self { HttpConfiguration { enabled: conf.enabled, interface: conf.interface, port: conf.port, apis: rpc_apis::ApiSet::UnsafeContext, cors: None, hosts: conf.hosts, server_threads: 1, processing_threads: 0, } } } impl Default for UiConfiguration { fn default() -> Self { UiConfiguration { enabled: true && cfg!(feature = "ui-enabled"), port: 8180, interface: "127.0.0.1".into(), hosts: Some(vec![]), } } } #[derive(Debug, PartialEq)] pub struct IpcConfiguration { pub enabled: bool, pub socket_addr: String, pub apis: ApiSet, } impl Default for IpcConfiguration { fn default() -> Self { IpcConfiguration { enabled: true, socket_addr: if cfg!(windows) { r"\\.\pipe\jsonrpc.ipc".into() } else { let data_dir = ::dir::default_data_path(); parity_ipc_path(&data_dir, "$BASE/jsonrpc.ipc", 0) }, apis: ApiSet::IpcContext, } } } #[derive(Debug, Clone, PartialEq)] pub struct WsConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub origins: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub signer_path: PathBuf, pub support_token_api: bool, pub ui_address: Option<rpc::Host>, pub dapps_address: Option<rpc::Host>, } impl Default for WsConfiguration { fn default() -> Self { let data_dir = default_data_path(); WsConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8546, apis: ApiSet::UnsafeContext, origins: Some(vec!["chrome-extension://*".into(), "moz-extension://*".into()]), hosts: Some(Vec::new()), signer_path: replace_home(&data_dir, "$BASE/signer").into(), support_token_api: true, ui_address: Some("127.0.0.1:8180".into()), dapps_address: Some("127.0.0.1:8545".into()), } } } impl WsConfiguration { pub fn address(&self) -> Option<rpc::Host>
} fn address(enabled: bool, bind_iface: &str, bind_port: u16, hosts: &Option<Vec<String>>) -> Option<rpc::Host> { if !enabled { return None; } match *hosts { Some(ref hosts) if !hosts.is_empty() => Some(hosts[0].clone().into()), _ => Some(format!("{}:{}", bind_iface, bind_port).into()), } } pub struct Dependencies<D: rpc_apis::Dependencies> { pub apis: Arc<D>, pub remote: TokioRemote, pub stats: Arc<RpcStats>, pub pool: Option<CpuPool>, } pub fn new_ws<D: rpc_apis::Dependencies>( conf: WsConfiguration, deps: &Dependencies<D>, ) -> Result<Option<WsServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid WebSockets listen host/port given: {}", url))?; let full_handler = setup_apis(rpc_apis::ApiSet::SafeContext, deps); let handler = { let mut handler = MetaIoHandler::with_middleware(( rpc::WsDispatcher::new(full_handler), Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) )); let apis = conf.apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler }; let remote = deps.remote.clone(); let ui_address = conf.ui_address.clone(); let allowed_origins = into_domains(with_domain(conf.origins, domain, &ui_address, &conf.dapps_address)); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let signer_path; let path = match conf.support_token_api && conf.ui_address.is_some() { true => { signer_path = ::signer::codes_path(&conf.signer_path); Some(signer_path.as_path()) }, false => None }; let start_result = rpc::start_ws( &addr, handler, remote.clone(), allowed_origins, allowed_hosts, rpc::WsExtractor::new(path.clone()), rpc::WsExtractor::new(path.clone()), rpc::WsStats::new(deps.stats.clone()), ); match start_result { Ok(server) => Ok(Some(server)), Err(rpc::ws::Error(rpc::ws::ErrorKind::Io(ref err), _)) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("WebSockets address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --ws-port and --ws-interface options.", url) ), Err(e) => Err(format!("WebSockets error: {:?}", e)), } } pub fn new_http<D: rpc_apis::Dependencies>( id: &str, options: &str, conf: HttpConfiguration, deps: &Dependencies<D>, middleware: Option<dapps::Middleware>, ) -> Result<Option<HttpServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid {} listen host/port given: {}", id, url))?; let handler = setup_apis(conf.apis, deps); let remote = deps.remote.clone(); let cors_domains = into_domains(conf.cors); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let start_result = rpc::start_http( &addr, cors_domains, allowed_hosts, handler, remote, rpc::RpcExtractor, middleware, conf.server_threads, ); match start_result { Ok(server) => Ok(Some(server)), Err(ref err) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("{} address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --{}-port and --{}-interface options.", id, url, options, options) ), Err(e) => Err(format!("{} error: {:?}", id, e)), } } pub fn new_ipc<D: rpc_apis::Dependencies>( conf: IpcConfiguration, dependencies: &Dependencies<D> ) -> Result<Option<IpcServer>, String> { if !conf.enabled { return Ok(None); } let handler = setup_apis(conf.apis, dependencies); let remote = dependencies.remote.clone(); let path = PathBuf::from(&conf.socket_addr); // Make sure socket file can be created on unix-like OS. // Windows pipe paths are not on the FS. if !cfg!(windows) { if let Some(dir) = path.parent() { ::std::fs::create_dir_all(&dir) .map_err(|err| format!("Unable to create IPC directory at {}: {}", dir.display(), err))?; } } match rpc::start_ipc(&conf.socket_addr, handler, remote, rpc::RpcExtractor) { Ok(server) => Ok(Some(server)), Err(io_error) => Err(format!("IPC error: {}", io_error)), } } fn into_domains<T: From<String>>(items: Option<Vec<String>>) -> DomainsValidation<T> { items.map(|vals| vals.into_iter().map(T::from).collect()).into() } fn with_domain(items: Option<Vec<String>>, domain: &str, ui_address: &Option<rpc::Host>, dapps_address: &Option<rpc::Host>) -> Option<Vec<String>> { fn extract_port(s: &str) -> Option<u16> { s.split(':').nth(1).and_then(|s| s.parse().ok()) } items.map(move |items| { let mut items = items.into_iter().collect::<HashSet<_>>(); { let mut add_hosts = |address: &Option<rpc::Host>| { if let Some(host) = address.clone() { items.insert(host.to_string()); items.insert(host.replace("127.0.0.1", "localhost")); items.insert(format!("http://*.{}", domain)); //proxypac if let Some(port) = extract_port(&*host) { items.insert(format!("http://*.{}:{}", domain, port)); } } }; add_hosts(ui_address); add_hosts(dapps_address); } items.into_iter().collect() }) } fn setup_apis<D>(apis: ApiSet, deps: &Dependencies<D>) -> MetaIoHandler<Metadata, Middleware<D::Notifier>> where D: rpc_apis::Dependencies { let mut handler = MetaIoHandler::with_middleware( Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) ); let apis = apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler } #[cfg(test)] mod tests { use super::address; #[test] fn should_return_proper_address() { assert_eq!(address(false, "localhost", 8180, &None), None); assert_eq!(address(true, "localhost", 8180, &None), Some("localhost:8180".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host:443".into()])), Some("host:443".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host".into()])), Some("host".into())); } }
{ address(self.enabled, &self.interface, self.port, &self.hosts) }
identifier_body
rpc.rs
// Copyright 2015-2017 Parity Technologies (UK) Ltd. // This file is part of Parity. // Parity is free software: you can redistribute it and/or modify // it under the terms of the GNU General Public License as published by // the Free Software Foundation, either version 3 of the License, or // (at your option) any later version. // Parity is distributed in the hope that it will be useful, // but WITHOUT ANY WARRANTY; without even the implied warranty of // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the // GNU General Public License for more details. // You should have received a copy of the GNU General Public License // along with Parity. If not, see <http://www.gnu.org/licenses/>. use std::io; use std::sync::Arc; use std::path::PathBuf; use std::collections::HashSet; use dapps; use dir::default_data_path; use helpers::{parity_ipc_path, replace_home}; use jsonrpc_core::MetaIoHandler; use parity_reactor::TokioRemote; use parity_rpc::informant::{RpcStats, Middleware}; use parity_rpc::{self as rpc, Metadata, DomainsValidation}; use rpc_apis::{self, ApiSet}; pub use parity_rpc::{IpcServer, HttpServer, RequestMiddleware}; pub use parity_rpc::ws::Server as WsServer; pub use parity_rpc::informant::CpuPool; pub const DAPPS_DOMAIN: &'static str = "web3.site"; #[derive(Debug, Clone, PartialEq)] pub struct HttpConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub cors: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub server_threads: usize, pub processing_threads: usize, } impl HttpConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } } impl Default for HttpConfiguration { fn default() -> Self { HttpConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8545, apis: ApiSet::UnsafeContext, cors: None, hosts: Some(Vec::new()), server_threads: 1, processing_threads: 4, } } } #[derive(Debug, PartialEq, Clone)] pub struct UiConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub hosts: Option<Vec<String>>, } impl UiConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } pub fn redirection_address(&self) -> Option<(String, u16)> { self.address().map(|host| { let mut it = host.split(':'); let hostname: Option<String> = it.next().map(|s| s.to_owned()); let port: Option<u16> = it.next().and_then(|s| s.parse().ok()); (hostname.unwrap_or_else(|| "localhost".into()), port.unwrap_or(8180)) }) } } impl From<UiConfiguration> for HttpConfiguration { fn from(conf: UiConfiguration) -> Self { HttpConfiguration { enabled: conf.enabled, interface: conf.interface, port: conf.port, apis: rpc_apis::ApiSet::UnsafeContext, cors: None, hosts: conf.hosts, server_threads: 1, processing_threads: 0, } } } impl Default for UiConfiguration { fn default() -> Self { UiConfiguration { enabled: true && cfg!(feature = "ui-enabled"), port: 8180, interface: "127.0.0.1".into(), hosts: Some(vec![]), } } } #[derive(Debug, PartialEq)] pub struct IpcConfiguration { pub enabled: bool, pub socket_addr: String, pub apis: ApiSet, } impl Default for IpcConfiguration { fn default() -> Self { IpcConfiguration { enabled: true, socket_addr: if cfg!(windows) { r"\\.\pipe\jsonrpc.ipc".into() } else { let data_dir = ::dir::default_data_path(); parity_ipc_path(&data_dir, "$BASE/jsonrpc.ipc", 0) }, apis: ApiSet::IpcContext, } } } #[derive(Debug, Clone, PartialEq)] pub struct WsConfiguration { pub enabled: bool, pub interface: String, pub port: u16, pub apis: ApiSet, pub origins: Option<Vec<String>>, pub hosts: Option<Vec<String>>, pub signer_path: PathBuf, pub support_token_api: bool, pub ui_address: Option<rpc::Host>, pub dapps_address: Option<rpc::Host>, } impl Default for WsConfiguration { fn default() -> Self { let data_dir = default_data_path(); WsConfiguration { enabled: true, interface: "127.0.0.1".into(), port: 8546, apis: ApiSet::UnsafeContext, origins: Some(vec!["chrome-extension://*".into(), "moz-extension://*".into()]), hosts: Some(Vec::new()), signer_path: replace_home(&data_dir, "$BASE/signer").into(), support_token_api: true, ui_address: Some("127.0.0.1:8180".into()), dapps_address: Some("127.0.0.1:8545".into()), } } } impl WsConfiguration { pub fn address(&self) -> Option<rpc::Host> { address(self.enabled, &self.interface, self.port, &self.hosts) } } fn address(enabled: bool, bind_iface: &str, bind_port: u16, hosts: &Option<Vec<String>>) -> Option<rpc::Host> { if !enabled { return None; } match *hosts { Some(ref hosts) if !hosts.is_empty() => Some(hosts[0].clone().into()), _ => Some(format!("{}:{}", bind_iface, bind_port).into()), } } pub struct Dependencies<D: rpc_apis::Dependencies> { pub apis: Arc<D>, pub remote: TokioRemote, pub stats: Arc<RpcStats>, pub pool: Option<CpuPool>, } pub fn new_ws<D: rpc_apis::Dependencies>( conf: WsConfiguration, deps: &Dependencies<D>, ) -> Result<Option<WsServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid WebSockets listen host/port given: {}", url))?; let full_handler = setup_apis(rpc_apis::ApiSet::SafeContext, deps); let handler = { let mut handler = MetaIoHandler::with_middleware(( rpc::WsDispatcher::new(full_handler), Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) )); let apis = conf.apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler }; let remote = deps.remote.clone(); let ui_address = conf.ui_address.clone(); let allowed_origins = into_domains(with_domain(conf.origins, domain, &ui_address, &conf.dapps_address)); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let signer_path; let path = match conf.support_token_api && conf.ui_address.is_some() { true => { signer_path = ::signer::codes_path(&conf.signer_path); Some(signer_path.as_path()) }, false => None }; let start_result = rpc::start_ws( &addr, handler, remote.clone(), allowed_origins, allowed_hosts, rpc::WsExtractor::new(path.clone()), rpc::WsExtractor::new(path.clone()), rpc::WsStats::new(deps.stats.clone()), ); match start_result { Ok(server) => Ok(Some(server)), Err(rpc::ws::Error(rpc::ws::ErrorKind::Io(ref err), _)) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("WebSockets address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --ws-port and --ws-interface options.", url) ), Err(e) => Err(format!("WebSockets error: {:?}", e)), } } pub fn new_http<D: rpc_apis::Dependencies>( id: &str, options: &str, conf: HttpConfiguration, deps: &Dependencies<D>, middleware: Option<dapps::Middleware>, ) -> Result<Option<HttpServer>, String> { if !conf.enabled { return Ok(None); } let domain = DAPPS_DOMAIN; let url = format!("{}:{}", conf.interface, conf.port); let addr = url.parse().map_err(|_| format!("Invalid {} listen host/port given: {}", id, url))?; let handler = setup_apis(conf.apis, deps); let remote = deps.remote.clone(); let cors_domains = into_domains(conf.cors); let allowed_hosts = into_domains(with_domain(conf.hosts, domain, &Some(url.clone().into()), &None)); let start_result = rpc::start_http( &addr, cors_domains, allowed_hosts, handler, remote, rpc::RpcExtractor, middleware, conf.server_threads, ); match start_result { Ok(server) => Ok(Some(server)),
} } pub fn new_ipc<D: rpc_apis::Dependencies>( conf: IpcConfiguration, dependencies: &Dependencies<D> ) -> Result<Option<IpcServer>, String> { if !conf.enabled { return Ok(None); } let handler = setup_apis(conf.apis, dependencies); let remote = dependencies.remote.clone(); let path = PathBuf::from(&conf.socket_addr); // Make sure socket file can be created on unix-like OS. // Windows pipe paths are not on the FS. if !cfg!(windows) { if let Some(dir) = path.parent() { ::std::fs::create_dir_all(&dir) .map_err(|err| format!("Unable to create IPC directory at {}: {}", dir.display(), err))?; } } match rpc::start_ipc(&conf.socket_addr, handler, remote, rpc::RpcExtractor) { Ok(server) => Ok(Some(server)), Err(io_error) => Err(format!("IPC error: {}", io_error)), } } fn into_domains<T: From<String>>(items: Option<Vec<String>>) -> DomainsValidation<T> { items.map(|vals| vals.into_iter().map(T::from).collect()).into() } fn with_domain(items: Option<Vec<String>>, domain: &str, ui_address: &Option<rpc::Host>, dapps_address: &Option<rpc::Host>) -> Option<Vec<String>> { fn extract_port(s: &str) -> Option<u16> { s.split(':').nth(1).and_then(|s| s.parse().ok()) } items.map(move |items| { let mut items = items.into_iter().collect::<HashSet<_>>(); { let mut add_hosts = |address: &Option<rpc::Host>| { if let Some(host) = address.clone() { items.insert(host.to_string()); items.insert(host.replace("127.0.0.1", "localhost")); items.insert(format!("http://*.{}", domain)); //proxypac if let Some(port) = extract_port(&*host) { items.insert(format!("http://*.{}:{}", domain, port)); } } }; add_hosts(ui_address); add_hosts(dapps_address); } items.into_iter().collect() }) } fn setup_apis<D>(apis: ApiSet, deps: &Dependencies<D>) -> MetaIoHandler<Metadata, Middleware<D::Notifier>> where D: rpc_apis::Dependencies { let mut handler = MetaIoHandler::with_middleware( Middleware::new(deps.stats.clone(), deps.apis.activity_notifier(), deps.pool.clone()) ); let apis = apis.list_apis(); deps.apis.extend_with_set(&mut handler, &apis); handler } #[cfg(test)] mod tests { use super::address; #[test] fn should_return_proper_address() { assert_eq!(address(false, "localhost", 8180, &None), None); assert_eq!(address(true, "localhost", 8180, &None), Some("localhost:8180".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host:443".into()])), Some("host:443".into())); assert_eq!(address(true, "localhost", 8180, &Some(vec!["host".into()])), Some("host".into())); } }
Err(ref err) if err.kind() == io::ErrorKind::AddrInUse => Err( format!("{} address {} is already in use, make sure that another instance of an Ethereum client is not running or change the address using the --{}-port and --{}-interface options.", id, url, options, options) ), Err(e) => Err(format!("{} error: {:?}", id, e)),
random_line_split
main.js
$(function() { var Y = YUI().use("profiler", function(Y){ var profile = [ { "namespace": ["sakai", "api", "Security"], "functions": ["saneHTML"] }, { "namespace": ["sakai", "api", "Widgets", "widgetLoader"], "functions": ["loadWidgets"] }, { "namespace": ["$"], "functions": ["TemplateRenderer", "trim", "curCSS", "parseJSON", "ajax"] }, { "namespace": ["sakai", "api", "i18n", "General"], "functions": ["process", "getValueForKey"] } ]; var allFns = []; $("#ifr").attr("src", "/dev/my_sakai.html"); console.log($("#ifr")[0].contentWindow.document); $("#ifr").bind("load", function() { console.log("iframe loaded, attaching profilers"); for (var i=0, j=profile.length; i<j; i++)
setTimeout(function() { // get the report for all the registered function var report = Y.Profiler.getFullReport(); console.log(report); },5000); }); }); });
{ var ns = profile[i].namespace; var fns = profile[i].functions; // construct the namespace of the function properly var nsobj = $("#ifr")[0].contentWindow[ns[0]]; for (var x=1, y=ns.length; x<y; x++) { nsobj = nsobj[ns[x]]; } // Register each function in this namespace to be profiled for (var k=0,l=fns.length; k<l; k++) { Y.Profiler.registerFunction(fns[k], nsobj); allFns.push(fns[k]); } }
conditional_block
main.js
$(function() { var Y = YUI().use("profiler", function(Y){ var profile = [ { "namespace": ["sakai", "api", "Security"], "functions": ["saneHTML"] }, { "namespace": ["sakai", "api", "Widgets", "widgetLoader"], "functions": ["loadWidgets"] }, { "namespace": ["$"], "functions": ["TemplateRenderer", "trim", "curCSS", "parseJSON", "ajax"] }, { "namespace": ["sakai", "api", "i18n", "General"], "functions": ["process", "getValueForKey"] } ]; var allFns = []; $("#ifr").attr("src", "/dev/my_sakai.html"); console.log($("#ifr")[0].contentWindow.document); $("#ifr").bind("load", function() { console.log("iframe loaded, attaching profilers"); for (var i=0, j=profile.length; i<j; i++) { var ns = profile[i].namespace; var fns = profile[i].functions; // construct the namespace of the function properly var nsobj = $("#ifr")[0].contentWindow[ns[0]]; for (var x=1, y=ns.length; x<y; x++) { nsobj = nsobj[ns[x]]; } // Register each function in this namespace to be profiled for (var k=0,l=fns.length; k<l; k++) {
} setTimeout(function() { // get the report for all the registered function var report = Y.Profiler.getFullReport(); console.log(report); },5000); }); }); });
Y.Profiler.registerFunction(fns[k], nsobj); allFns.push(fns[k]); }
random_line_split
assistStorageEntry.js
// Licensed to Cloudera, Inc. under one // or more contributor license agreements. See the NOTICE file // distributed with this work for additional information // regarding copyright ownership. Cloudera, Inc. licenses this file // to you under the Apache License, Version 2.0 (the // "License"); you may not use this file except in compliance // with the License. You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. import $ from 'jquery'; import * as ko from 'knockout'; import apiHelper from 'api/apiHelper'; import huePubSub from 'utils/huePubSub'; import { findBrowserConnector, getRootFilePath } from 'config/hueConfig'; const PAGE_SIZE = 100; const TYPE_SPECIFICS = { adls: { apiHelperFetchFunction: 'fetchAdlsPath', dblClickPubSubId: 'assist.dblClickAdlsItem' }, abfs: { apiHelperFetchFunction: 'fetchAbfsPath', dblClickPubSubId: 'assist.dblClickAbfsItem' }, hdfs: { apiHelperFetchFunction: 'fetchHdfsPath', dblClickPubSubId: 'assist.dblClickHdfsItem' }, s3: { apiHelperFetchFunction: 'fetchS3Path', dblClickPubSubId: 'assist.dblClickS3Item' } }; class AssistStorageEntry { /** * @param {object} options * @param {object} options.definition * @param {string} options.definition.name * @param {string} options.definition.type (file, dir) * @param {string} options.source - The storage source * @param {string} [options.originalType] - The original storage type ('adl', 's3a') * @param {AssistStorageEntry} options.parent * @constructor */ constructor(options) { const self = this; self.source = options.source; self.originalType = options.originalType; self.definition = options.definition; self.parent = options.parent; self.rootPath = options.rootPath || ''; self.path = ''; if (self.parent !== null) { self.path = self.parent.path; if (self.parent.path !== '/' && !/\/$/.test(self.path)) { self.path += '/'; } } self.path += self.definition.name; self.abfsPath = (/^\//.test(self.path) ? 'abfs:/' : 'abfs://') + self.path; self.currentPage = 1; self.hasMorePages = true; self.preview = ko.observable(); self.contextPopoverVisible = ko.observable(false); self.filter = ko.observable('').extend({ rateLimit: 400 }); self.filter.subscribe(() => { self.currentPage = 1; self.hasMorePages = true; self.loadEntries(); }); self.entries = ko.observableArray([]); self.loaded = false; self.loading = ko.observable(false); self.loadingMore = ko.observable(false); self.errorText = ko.observable(); self.hasErrors = ko.observable(false); self.open = ko.observable(false); self.open.subscribe(newValue => { if (newValue && self.entries().length === 0) { if (self.definition.type === 'dir') { self.loadEntries(); } else { self.loadPreview(); } } }); self.hasEntries = ko.pureComputed(() => self.entries().length > 0); } dblClick() { huePubSub.publish(TYPE_SPECIFICS[self.source.type].dblClickPubSubId, this); } loadPreview() { const self = this; self.loading(true); apiHelper .fetchStoragePreview({ path: self.getHierarchy(), type: self.source.type, silenceErrors: true }) .done(data => { self.preview(data); }) .fail(errorText => { self.hasErrors(true); self.errorText(errorText); }) .always(() => { self.loading(false); }); } loadEntries(callback) { const self = this; if (self.loading()) { return; } self.loading(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), rootPath: self.rootPath, successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( filteredFiles.map(file => { return new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }); }) ); self.loaded = true; self.loading(false); self.hasErrors(!!data.s3_listing_not_allowed); // Special case where we want errors inline instead of the default popover. We don't want errorCallback handling self.errorText(data.s3_listing_not_allowed); if (callback) { callback(); } }, errorCallback: errorText => { self.hasErrors(true); self.errorText(errorText); self.loading(false); if (callback) { callback(); } } }); } goHome() { huePubSub.publish('assist.storage.go.home'); } loadDeep(folders, callback) { const self = this; if (folders.length === 0) { callback(self); return; } if (this.rootPath) { const relativeFolders = folders.join('/').replace(new RegExp('^' + this.rootPath, ''), ''); folders = relativeFolders.split('/'); } const nextName = folders.shift(); let loadedPages = 0; const findNextAndLoadDeep = () => { const foundEntry = self.entries().filter(entry => entry.definition.name === nextName); const passedAlphabetically = self.entries().length > 0 && self.entries()[self.entries().length - 1].definition.name.localeCompare(nextName) > 0; if (foundEntry.length === 1) { foundEntry[0].loadDeep(folders, callback); } else if (!passedAlphabetically && self.hasMorePages && loadedPages < 50) { loadedPages++; self.fetchMore(findNextAndLoadDeep, () => { callback(self); }); } else { callback(self); } }; if (!self.loaded) { self.loadEntries(findNextAndLoadDeep); } else { findNextAndLoadDeep(); } } getHierarchy() { const self = this; let parts = []; let entry = self; while (entry) { if (!entry.parent && entry.definition.name) { const rootParts = entry.definition.name.split('/').filter(Boolean); rootParts.reverse(); parts = parts.concat(rootParts); } else if (entry.definition.name) { parts.push(entry.definition.name); } entry = entry.parent; } parts.reverse(); return parts; } toggleOpen(data, event) { const self = this; if (self.definition.type === 'file') { if (event.ctrlKey || event.metaKey || event.which === 2) { window.open('/hue' + self.definition.url, '_blank'); } else { huePubSub.publish('open.link', self.definition.url); } return; } self.open(!self.open()); if (self.definition.name === '..') { if (self.parent.parent) { huePubSub.publish('assist.selectStorageEntry', self.parent.parent); } } else { huePubSub.publish('assist.selectStorageEntry', self); } } fetchMore(successCallback, errorCallback) { const self = this; if (!self.hasMorePages || self.loadingMore()) { return; } self.currentPage++; self.loadingMore(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( self.entries().concat( filteredFiles.map( file => new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }) ) ) ); self.loadingMore(false); if (successCallback) { successCallback(); } }, errorCallback: () => { self.hasErrors(true); if (errorCallback) { errorCallback(); } } }); } showContextPopover(entry, event, positionAdjustment) { const $source = $(event.target); const offset = $source.offset(); entry.contextPopoverVisible(true); if (positionAdjustment) { offset.left += positionAdjustment.left; offset.top += positionAdjustment.top; } huePubSub.publish('context.popover.show', { data: { type: 'storageEntry', storageEntry: entry }, pinEnabled: true, orientation: 'right', source: { element: event.target, left: offset.left, top: offset.top - 3, right: offset.left + $source.width() + 3, bottom: offset.top + $source.height() - 3 } }); huePubSub.subscribeOnce('context.popover.hidden', () => { entry.contextPopoverVisible(false); }); } openInImporter() { huePubSub.publish('open.in.importer', this.definition.path); } /** * Helper function to create an assistStorageEntry. It will load the entries starting from the root up until the * path or stop when a part is not found. * * @param {string} path - The path, can include the type i.e. '/tmp' or 's3:/tmp'. * @param {string} [type] - Optional type, if not specified here or in the path 'hdfs' will be used. * @return {JQueryPromise<AssistStorageEntry>} */ static getEntry(path, type)
} export default AssistStorageEntry;
{ const deferred = $.Deferred(); const typeMatch = path.match(/^([^:]+):\/(\/.*)\/?/i); type = typeMatch ? typeMatch[1] : type || 'hdfs'; type = type.replace(/s3.*/i, 's3'); type = type.replace(/adl.*/i, 'adls'); type = type.replace(/abfs.*/i, 'abfs'); // TODO: connector.id for browser connectors const connector = findBrowserConnector(connector => connector.type === type); if (connector) { const rootPath = getRootFilePath(connector); const rootEntry = new AssistStorageEntry({ source: connector, rootPath: rootPath, originalType: typeMatch && typeMatch[1], definition: { name: rootPath, type: 'dir' }, parent: null, apiHelper: apiHelper }); if (type === 'abfs' || type === 'adls') { // ABFS / ADLS can have domain name in path. To prevent regression with s3 which allow periods in bucket name handle separately. const azureMatch = path.match( /^([^:]+):\/(\/((\w+)@)?[\w]+([\-\.]{1}\w+)*\.[\w]*)?(\/.*)?\/?/i ); path = (azureMatch ? azureMatch[6] || '' : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); if (azureMatch && azureMatch[4]) { path.unshift(azureMatch[4]); } } else { path = (typeMatch ? typeMatch[2] : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); } rootEntry.loadDeep(path, deferred.resolve); } else { deferred.reject(); } return deferred.promise(); }
identifier_body
assistStorageEntry.js
// Licensed to Cloudera, Inc. under one // or more contributor license agreements. See the NOTICE file // distributed with this work for additional information // regarding copyright ownership. Cloudera, Inc. licenses this file // to you under the Apache License, Version 2.0 (the // "License"); you may not use this file except in compliance // with the License. You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. import $ from 'jquery'; import * as ko from 'knockout'; import apiHelper from 'api/apiHelper'; import huePubSub from 'utils/huePubSub'; import { findBrowserConnector, getRootFilePath } from 'config/hueConfig'; const PAGE_SIZE = 100; const TYPE_SPECIFICS = { adls: { apiHelperFetchFunction: 'fetchAdlsPath', dblClickPubSubId: 'assist.dblClickAdlsItem' }, abfs: { apiHelperFetchFunction: 'fetchAbfsPath', dblClickPubSubId: 'assist.dblClickAbfsItem' }, hdfs: { apiHelperFetchFunction: 'fetchHdfsPath', dblClickPubSubId: 'assist.dblClickHdfsItem' }, s3: { apiHelperFetchFunction: 'fetchS3Path', dblClickPubSubId: 'assist.dblClickS3Item' } }; class AssistStorageEntry { /** * @param {object} options * @param {object} options.definition * @param {string} options.definition.name * @param {string} options.definition.type (file, dir) * @param {string} options.source - The storage source * @param {string} [options.originalType] - The original storage type ('adl', 's3a') * @param {AssistStorageEntry} options.parent * @constructor */ constructor(options) { const self = this; self.source = options.source; self.originalType = options.originalType; self.definition = options.definition; self.parent = options.parent; self.rootPath = options.rootPath || ''; self.path = ''; if (self.parent !== null) { self.path = self.parent.path; if (self.parent.path !== '/' && !/\/$/.test(self.path)) { self.path += '/'; } } self.path += self.definition.name; self.abfsPath = (/^\//.test(self.path) ? 'abfs:/' : 'abfs://') + self.path; self.currentPage = 1; self.hasMorePages = true; self.preview = ko.observable(); self.contextPopoverVisible = ko.observable(false); self.filter = ko.observable('').extend({ rateLimit: 400 }); self.filter.subscribe(() => { self.currentPage = 1; self.hasMorePages = true; self.loadEntries(); }); self.entries = ko.observableArray([]); self.loaded = false; self.loading = ko.observable(false); self.loadingMore = ko.observable(false); self.errorText = ko.observable(); self.hasErrors = ko.observable(false); self.open = ko.observable(false); self.open.subscribe(newValue => { if (newValue && self.entries().length === 0) { if (self.definition.type === 'dir') { self.loadEntries(); } else { self.loadPreview(); } } }); self.hasEntries = ko.pureComputed(() => self.entries().length > 0); } dblClick() { huePubSub.publish(TYPE_SPECIFICS[self.source.type].dblClickPubSubId, this); } loadPreview() { const self = this; self.loading(true); apiHelper .fetchStoragePreview({ path: self.getHierarchy(), type: self.source.type, silenceErrors: true }) .done(data => { self.preview(data); }) .fail(errorText => { self.hasErrors(true); self.errorText(errorText); }) .always(() => { self.loading(false); }); } loadEntries(callback) { const self = this; if (self.loading()) { return; } self.loading(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), rootPath: self.rootPath, successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( filteredFiles.map(file => { return new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }); }) ); self.loaded = true; self.loading(false); self.hasErrors(!!data.s3_listing_not_allowed); // Special case where we want errors inline instead of the default popover. We don't want errorCallback handling self.errorText(data.s3_listing_not_allowed); if (callback) { callback(); } }, errorCallback: errorText => { self.hasErrors(true); self.errorText(errorText); self.loading(false); if (callback) { callback(); } } }); } goHome() { huePubSub.publish('assist.storage.go.home'); } loadDeep(folders, callback) { const self = this; if (folders.length === 0) { callback(self); return; } if (this.rootPath) { const relativeFolders = folders.join('/').replace(new RegExp('^' + this.rootPath, ''), ''); folders = relativeFolders.split('/'); } const nextName = folders.shift(); let loadedPages = 0; const findNextAndLoadDeep = () => { const foundEntry = self.entries().filter(entry => entry.definition.name === nextName); const passedAlphabetically = self.entries().length > 0 && self.entries()[self.entries().length - 1].definition.name.localeCompare(nextName) > 0; if (foundEntry.length === 1) { foundEntry[0].loadDeep(folders, callback); } else if (!passedAlphabetically && self.hasMorePages && loadedPages < 50) { loadedPages++; self.fetchMore(findNextAndLoadDeep, () => { callback(self); }); } else { callback(self); } }; if (!self.loaded) { self.loadEntries(findNextAndLoadDeep); } else { findNextAndLoadDeep(); } } getHierarchy() { const self = this; let parts = []; let entry = self; while (entry) { if (!entry.parent && entry.definition.name) { const rootParts = entry.definition.name.split('/').filter(Boolean); rootParts.reverse(); parts = parts.concat(rootParts); } else if (entry.definition.name) { parts.push(entry.definition.name); } entry = entry.parent; } parts.reverse(); return parts; } toggleOpen(data, event) { const self = this; if (self.definition.type === 'file') { if (event.ctrlKey || event.metaKey || event.which === 2) { window.open('/hue' + self.definition.url, '_blank'); } else { huePubSub.publish('open.link', self.definition.url); } return; } self.open(!self.open()); if (self.definition.name === '..') { if (self.parent.parent) { huePubSub.publish('assist.selectStorageEntry', self.parent.parent); } } else { huePubSub.publish('assist.selectStorageEntry', self); } } fetchMore(successCallback, errorCallback) { const self = this; if (!self.hasMorePages || self.loadingMore()) { return; } self.currentPage++; self.loadingMore(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( self.entries().concat( filteredFiles.map( file => new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }) ) ) ); self.loadingMore(false); if (successCallback) { successCallback(); } }, errorCallback: () => { self.hasErrors(true); if (errorCallback) { errorCallback(); } } }); }
(entry, event, positionAdjustment) { const $source = $(event.target); const offset = $source.offset(); entry.contextPopoverVisible(true); if (positionAdjustment) { offset.left += positionAdjustment.left; offset.top += positionAdjustment.top; } huePubSub.publish('context.popover.show', { data: { type: 'storageEntry', storageEntry: entry }, pinEnabled: true, orientation: 'right', source: { element: event.target, left: offset.left, top: offset.top - 3, right: offset.left + $source.width() + 3, bottom: offset.top + $source.height() - 3 } }); huePubSub.subscribeOnce('context.popover.hidden', () => { entry.contextPopoverVisible(false); }); } openInImporter() { huePubSub.publish('open.in.importer', this.definition.path); } /** * Helper function to create an assistStorageEntry. It will load the entries starting from the root up until the * path or stop when a part is not found. * * @param {string} path - The path, can include the type i.e. '/tmp' or 's3:/tmp'. * @param {string} [type] - Optional type, if not specified here or in the path 'hdfs' will be used. * @return {JQueryPromise<AssistStorageEntry>} */ static getEntry(path, type) { const deferred = $.Deferred(); const typeMatch = path.match(/^([^:]+):\/(\/.*)\/?/i); type = typeMatch ? typeMatch[1] : type || 'hdfs'; type = type.replace(/s3.*/i, 's3'); type = type.replace(/adl.*/i, 'adls'); type = type.replace(/abfs.*/i, 'abfs'); // TODO: connector.id for browser connectors const connector = findBrowserConnector(connector => connector.type === type); if (connector) { const rootPath = getRootFilePath(connector); const rootEntry = new AssistStorageEntry({ source: connector, rootPath: rootPath, originalType: typeMatch && typeMatch[1], definition: { name: rootPath, type: 'dir' }, parent: null, apiHelper: apiHelper }); if (type === 'abfs' || type === 'adls') { // ABFS / ADLS can have domain name in path. To prevent regression with s3 which allow periods in bucket name handle separately. const azureMatch = path.match( /^([^:]+):\/(\/((\w+)@)?[\w]+([\-\.]{1}\w+)*\.[\w]*)?(\/.*)?\/?/i ); path = (azureMatch ? azureMatch[6] || '' : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); if (azureMatch && azureMatch[4]) { path.unshift(azureMatch[4]); } } else { path = (typeMatch ? typeMatch[2] : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); } rootEntry.loadDeep(path, deferred.resolve); } else { deferred.reject(); } return deferred.promise(); } } export default AssistStorageEntry;
showContextPopover
identifier_name
assistStorageEntry.js
// Licensed to Cloudera, Inc. under one // or more contributor license agreements. See the NOTICE file // distributed with this work for additional information // regarding copyright ownership. Cloudera, Inc. licenses this file // to you under the Apache License, Version 2.0 (the // "License"); you may not use this file except in compliance // with the License. You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. import $ from 'jquery'; import * as ko from 'knockout'; import apiHelper from 'api/apiHelper'; import huePubSub from 'utils/huePubSub'; import { findBrowserConnector, getRootFilePath } from 'config/hueConfig'; const PAGE_SIZE = 100; const TYPE_SPECIFICS = { adls: { apiHelperFetchFunction: 'fetchAdlsPath', dblClickPubSubId: 'assist.dblClickAdlsItem' }, abfs: { apiHelperFetchFunction: 'fetchAbfsPath', dblClickPubSubId: 'assist.dblClickAbfsItem' }, hdfs: { apiHelperFetchFunction: 'fetchHdfsPath', dblClickPubSubId: 'assist.dblClickHdfsItem' }, s3: { apiHelperFetchFunction: 'fetchS3Path', dblClickPubSubId: 'assist.dblClickS3Item' } }; class AssistStorageEntry { /** * @param {object} options * @param {object} options.definition * @param {string} options.definition.name * @param {string} options.definition.type (file, dir) * @param {string} options.source - The storage source * @param {string} [options.originalType] - The original storage type ('adl', 's3a') * @param {AssistStorageEntry} options.parent * @constructor */ constructor(options) { const self = this; self.source = options.source; self.originalType = options.originalType; self.definition = options.definition; self.parent = options.parent; self.rootPath = options.rootPath || ''; self.path = ''; if (self.parent !== null) { self.path = self.parent.path; if (self.parent.path !== '/' && !/\/$/.test(self.path)) { self.path += '/'; } } self.path += self.definition.name; self.abfsPath = (/^\//.test(self.path) ? 'abfs:/' : 'abfs://') + self.path; self.currentPage = 1; self.hasMorePages = true; self.preview = ko.observable(); self.contextPopoverVisible = ko.observable(false); self.filter = ko.observable('').extend({ rateLimit: 400 }); self.filter.subscribe(() => { self.currentPage = 1; self.hasMorePages = true; self.loadEntries(); }); self.entries = ko.observableArray([]); self.loaded = false; self.loading = ko.observable(false); self.loadingMore = ko.observable(false); self.errorText = ko.observable(); self.hasErrors = ko.observable(false); self.open = ko.observable(false); self.open.subscribe(newValue => { if (newValue && self.entries().length === 0) { if (self.definition.type === 'dir') { self.loadEntries(); } else { self.loadPreview(); } } }); self.hasEntries = ko.pureComputed(() => self.entries().length > 0); } dblClick() { huePubSub.publish(TYPE_SPECIFICS[self.source.type].dblClickPubSubId, this); } loadPreview() { const self = this; self.loading(true); apiHelper .fetchStoragePreview({ path: self.getHierarchy(), type: self.source.type, silenceErrors: true }) .done(data => { self.preview(data); }) .fail(errorText => { self.hasErrors(true); self.errorText(errorText); }) .always(() => { self.loading(false); }); } loadEntries(callback) { const self = this; if (self.loading()) { return; } self.loading(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), rootPath: self.rootPath, successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( filteredFiles.map(file => { return new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }); }) ); self.loaded = true; self.loading(false); self.hasErrors(!!data.s3_listing_not_allowed); // Special case where we want errors inline instead of the default popover. We don't want errorCallback handling self.errorText(data.s3_listing_not_allowed); if (callback) { callback(); } }, errorCallback: errorText => { self.hasErrors(true); self.errorText(errorText); self.loading(false); if (callback) { callback(); } } }); } goHome() { huePubSub.publish('assist.storage.go.home'); } loadDeep(folders, callback) { const self = this; if (folders.length === 0) { callback(self); return; } if (this.rootPath) { const relativeFolders = folders.join('/').replace(new RegExp('^' + this.rootPath, ''), ''); folders = relativeFolders.split('/'); } const nextName = folders.shift(); let loadedPages = 0; const findNextAndLoadDeep = () => { const foundEntry = self.entries().filter(entry => entry.definition.name === nextName); const passedAlphabetically = self.entries().length > 0 && self.entries()[self.entries().length - 1].definition.name.localeCompare(nextName) > 0; if (foundEntry.length === 1) { foundEntry[0].loadDeep(folders, callback); } else if (!passedAlphabetically && self.hasMorePages && loadedPages < 50) { loadedPages++; self.fetchMore(findNextAndLoadDeep, () => { callback(self); }); } else { callback(self); } }; if (!self.loaded) { self.loadEntries(findNextAndLoadDeep); } else { findNextAndLoadDeep(); } }
let entry = self; while (entry) { if (!entry.parent && entry.definition.name) { const rootParts = entry.definition.name.split('/').filter(Boolean); rootParts.reverse(); parts = parts.concat(rootParts); } else if (entry.definition.name) { parts.push(entry.definition.name); } entry = entry.parent; } parts.reverse(); return parts; } toggleOpen(data, event) { const self = this; if (self.definition.type === 'file') { if (event.ctrlKey || event.metaKey || event.which === 2) { window.open('/hue' + self.definition.url, '_blank'); } else { huePubSub.publish('open.link', self.definition.url); } return; } self.open(!self.open()); if (self.definition.name === '..') { if (self.parent.parent) { huePubSub.publish('assist.selectStorageEntry', self.parent.parent); } } else { huePubSub.publish('assist.selectStorageEntry', self); } } fetchMore(successCallback, errorCallback) { const self = this; if (!self.hasMorePages || self.loadingMore()) { return; } self.currentPage++; self.loadingMore(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( self.entries().concat( filteredFiles.map( file => new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }) ) ) ); self.loadingMore(false); if (successCallback) { successCallback(); } }, errorCallback: () => { self.hasErrors(true); if (errorCallback) { errorCallback(); } } }); } showContextPopover(entry, event, positionAdjustment) { const $source = $(event.target); const offset = $source.offset(); entry.contextPopoverVisible(true); if (positionAdjustment) { offset.left += positionAdjustment.left; offset.top += positionAdjustment.top; } huePubSub.publish('context.popover.show', { data: { type: 'storageEntry', storageEntry: entry }, pinEnabled: true, orientation: 'right', source: { element: event.target, left: offset.left, top: offset.top - 3, right: offset.left + $source.width() + 3, bottom: offset.top + $source.height() - 3 } }); huePubSub.subscribeOnce('context.popover.hidden', () => { entry.contextPopoverVisible(false); }); } openInImporter() { huePubSub.publish('open.in.importer', this.definition.path); } /** * Helper function to create an assistStorageEntry. It will load the entries starting from the root up until the * path or stop when a part is not found. * * @param {string} path - The path, can include the type i.e. '/tmp' or 's3:/tmp'. * @param {string} [type] - Optional type, if not specified here or in the path 'hdfs' will be used. * @return {JQueryPromise<AssistStorageEntry>} */ static getEntry(path, type) { const deferred = $.Deferred(); const typeMatch = path.match(/^([^:]+):\/(\/.*)\/?/i); type = typeMatch ? typeMatch[1] : type || 'hdfs'; type = type.replace(/s3.*/i, 's3'); type = type.replace(/adl.*/i, 'adls'); type = type.replace(/abfs.*/i, 'abfs'); // TODO: connector.id for browser connectors const connector = findBrowserConnector(connector => connector.type === type); if (connector) { const rootPath = getRootFilePath(connector); const rootEntry = new AssistStorageEntry({ source: connector, rootPath: rootPath, originalType: typeMatch && typeMatch[1], definition: { name: rootPath, type: 'dir' }, parent: null, apiHelper: apiHelper }); if (type === 'abfs' || type === 'adls') { // ABFS / ADLS can have domain name in path. To prevent regression with s3 which allow periods in bucket name handle separately. const azureMatch = path.match( /^([^:]+):\/(\/((\w+)@)?[\w]+([\-\.]{1}\w+)*\.[\w]*)?(\/.*)?\/?/i ); path = (azureMatch ? azureMatch[6] || '' : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); if (azureMatch && azureMatch[4]) { path.unshift(azureMatch[4]); } } else { path = (typeMatch ? typeMatch[2] : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); } rootEntry.loadDeep(path, deferred.resolve); } else { deferred.reject(); } return deferred.promise(); } } export default AssistStorageEntry;
getHierarchy() { const self = this; let parts = [];
random_line_split
assistStorageEntry.js
// Licensed to Cloudera, Inc. under one // or more contributor license agreements. See the NOTICE file // distributed with this work for additional information // regarding copyright ownership. Cloudera, Inc. licenses this file // to you under the Apache License, Version 2.0 (the // "License"); you may not use this file except in compliance // with the License. You may obtain a copy of the License at // // http://www.apache.org/licenses/LICENSE-2.0 // // Unless required by applicable law or agreed to in writing, software // distributed under the License is distributed on an "AS IS" BASIS, // WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. // See the License for the specific language governing permissions and // limitations under the License. import $ from 'jquery'; import * as ko from 'knockout'; import apiHelper from 'api/apiHelper'; import huePubSub from 'utils/huePubSub'; import { findBrowserConnector, getRootFilePath } from 'config/hueConfig'; const PAGE_SIZE = 100; const TYPE_SPECIFICS = { adls: { apiHelperFetchFunction: 'fetchAdlsPath', dblClickPubSubId: 'assist.dblClickAdlsItem' }, abfs: { apiHelperFetchFunction: 'fetchAbfsPath', dblClickPubSubId: 'assist.dblClickAbfsItem' }, hdfs: { apiHelperFetchFunction: 'fetchHdfsPath', dblClickPubSubId: 'assist.dblClickHdfsItem' }, s3: { apiHelperFetchFunction: 'fetchS3Path', dblClickPubSubId: 'assist.dblClickS3Item' } }; class AssistStorageEntry { /** * @param {object} options * @param {object} options.definition * @param {string} options.definition.name * @param {string} options.definition.type (file, dir) * @param {string} options.source - The storage source * @param {string} [options.originalType] - The original storage type ('adl', 's3a') * @param {AssistStorageEntry} options.parent * @constructor */ constructor(options) { const self = this; self.source = options.source; self.originalType = options.originalType; self.definition = options.definition; self.parent = options.parent; self.rootPath = options.rootPath || ''; self.path = ''; if (self.parent !== null) { self.path = self.parent.path; if (self.parent.path !== '/' && !/\/$/.test(self.path)) { self.path += '/'; } } self.path += self.definition.name; self.abfsPath = (/^\//.test(self.path) ? 'abfs:/' : 'abfs://') + self.path; self.currentPage = 1; self.hasMorePages = true; self.preview = ko.observable(); self.contextPopoverVisible = ko.observable(false); self.filter = ko.observable('').extend({ rateLimit: 400 }); self.filter.subscribe(() => { self.currentPage = 1; self.hasMorePages = true; self.loadEntries(); }); self.entries = ko.observableArray([]); self.loaded = false; self.loading = ko.observable(false); self.loadingMore = ko.observable(false); self.errorText = ko.observable(); self.hasErrors = ko.observable(false); self.open = ko.observable(false); self.open.subscribe(newValue => { if (newValue && self.entries().length === 0) { if (self.definition.type === 'dir') { self.loadEntries(); } else { self.loadPreview(); } } }); self.hasEntries = ko.pureComputed(() => self.entries().length > 0); } dblClick() { huePubSub.publish(TYPE_SPECIFICS[self.source.type].dblClickPubSubId, this); } loadPreview() { const self = this; self.loading(true); apiHelper .fetchStoragePreview({ path: self.getHierarchy(), type: self.source.type, silenceErrors: true }) .done(data => { self.preview(data); }) .fail(errorText => { self.hasErrors(true); self.errorText(errorText); }) .always(() => { self.loading(false); }); } loadEntries(callback) { const self = this; if (self.loading()) { return; } self.loading(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), rootPath: self.rootPath, successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( filteredFiles.map(file => { return new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }); }) ); self.loaded = true; self.loading(false); self.hasErrors(!!data.s3_listing_not_allowed); // Special case where we want errors inline instead of the default popover. We don't want errorCallback handling self.errorText(data.s3_listing_not_allowed); if (callback) { callback(); } }, errorCallback: errorText => { self.hasErrors(true); self.errorText(errorText); self.loading(false); if (callback) { callback(); } } }); } goHome() { huePubSub.publish('assist.storage.go.home'); } loadDeep(folders, callback) { const self = this; if (folders.length === 0) { callback(self); return; } if (this.rootPath) { const relativeFolders = folders.join('/').replace(new RegExp('^' + this.rootPath, ''), ''); folders = relativeFolders.split('/'); } const nextName = folders.shift(); let loadedPages = 0; const findNextAndLoadDeep = () => { const foundEntry = self.entries().filter(entry => entry.definition.name === nextName); const passedAlphabetically = self.entries().length > 0 && self.entries()[self.entries().length - 1].definition.name.localeCompare(nextName) > 0; if (foundEntry.length === 1) { foundEntry[0].loadDeep(folders, callback); } else if (!passedAlphabetically && self.hasMorePages && loadedPages < 50)
else { callback(self); } }; if (!self.loaded) { self.loadEntries(findNextAndLoadDeep); } else { findNextAndLoadDeep(); } } getHierarchy() { const self = this; let parts = []; let entry = self; while (entry) { if (!entry.parent && entry.definition.name) { const rootParts = entry.definition.name.split('/').filter(Boolean); rootParts.reverse(); parts = parts.concat(rootParts); } else if (entry.definition.name) { parts.push(entry.definition.name); } entry = entry.parent; } parts.reverse(); return parts; } toggleOpen(data, event) { const self = this; if (self.definition.type === 'file') { if (event.ctrlKey || event.metaKey || event.which === 2) { window.open('/hue' + self.definition.url, '_blank'); } else { huePubSub.publish('open.link', self.definition.url); } return; } self.open(!self.open()); if (self.definition.name === '..') { if (self.parent.parent) { huePubSub.publish('assist.selectStorageEntry', self.parent.parent); } } else { huePubSub.publish('assist.selectStorageEntry', self); } } fetchMore(successCallback, errorCallback) { const self = this; if (!self.hasMorePages || self.loadingMore()) { return; } self.currentPage++; self.loadingMore(true); self.hasErrors(false); apiHelper[TYPE_SPECIFICS[self.source.type].apiHelperFetchFunction]({ pageSize: PAGE_SIZE, page: self.currentPage, filter: self.filter().trim() ? self.filter() : undefined, pathParts: self.getHierarchy(), successCallback: data => { self.hasMorePages = data.page.next_page_number > self.currentPage; const filteredFiles = data.files.filter(file => file.name !== '.' && file.name !== '..'); self.entries( self.entries().concat( filteredFiles.map( file => new AssistStorageEntry({ originalType: self.originalType, rootPath: self.rootPath, source: self.source, definition: file, parent: self }) ) ) ); self.loadingMore(false); if (successCallback) { successCallback(); } }, errorCallback: () => { self.hasErrors(true); if (errorCallback) { errorCallback(); } } }); } showContextPopover(entry, event, positionAdjustment) { const $source = $(event.target); const offset = $source.offset(); entry.contextPopoverVisible(true); if (positionAdjustment) { offset.left += positionAdjustment.left; offset.top += positionAdjustment.top; } huePubSub.publish('context.popover.show', { data: { type: 'storageEntry', storageEntry: entry }, pinEnabled: true, orientation: 'right', source: { element: event.target, left: offset.left, top: offset.top - 3, right: offset.left + $source.width() + 3, bottom: offset.top + $source.height() - 3 } }); huePubSub.subscribeOnce('context.popover.hidden', () => { entry.contextPopoverVisible(false); }); } openInImporter() { huePubSub.publish('open.in.importer', this.definition.path); } /** * Helper function to create an assistStorageEntry. It will load the entries starting from the root up until the * path or stop when a part is not found. * * @param {string} path - The path, can include the type i.e. '/tmp' or 's3:/tmp'. * @param {string} [type] - Optional type, if not specified here or in the path 'hdfs' will be used. * @return {JQueryPromise<AssistStorageEntry>} */ static getEntry(path, type) { const deferred = $.Deferred(); const typeMatch = path.match(/^([^:]+):\/(\/.*)\/?/i); type = typeMatch ? typeMatch[1] : type || 'hdfs'; type = type.replace(/s3.*/i, 's3'); type = type.replace(/adl.*/i, 'adls'); type = type.replace(/abfs.*/i, 'abfs'); // TODO: connector.id for browser connectors const connector = findBrowserConnector(connector => connector.type === type); if (connector) { const rootPath = getRootFilePath(connector); const rootEntry = new AssistStorageEntry({ source: connector, rootPath: rootPath, originalType: typeMatch && typeMatch[1], definition: { name: rootPath, type: 'dir' }, parent: null, apiHelper: apiHelper }); if (type === 'abfs' || type === 'adls') { // ABFS / ADLS can have domain name in path. To prevent regression with s3 which allow periods in bucket name handle separately. const azureMatch = path.match( /^([^:]+):\/(\/((\w+)@)?[\w]+([\-\.]{1}\w+)*\.[\w]*)?(\/.*)?\/?/i ); path = (azureMatch ? azureMatch[6] || '' : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); if (azureMatch && azureMatch[4]) { path.unshift(azureMatch[4]); } } else { path = (typeMatch ? typeMatch[2] : path).replace(/(?:^\/)|(?:\/$)/g, '').split('/'); } rootEntry.loadDeep(path, deferred.resolve); } else { deferred.reject(); } return deferred.promise(); } } export default AssistStorageEntry;
{ loadedPages++; self.fetchMore(findNextAndLoadDeep, () => { callback(self); }); }
conditional_block
id.js
$.extend(window.lang_id, { "Title": "Apakah Anda Melainkan ..", "installApp": "Gunakan Aplikasi untuk membagikan jajak pendapat ini!", "installAppComments": "Download gratis.", "haveApp": "Aku sudah App!", "SecondPageButton": "Bermain", "Welcome": "Halo selamat datang!", "rules": "1. Klik link aplikasi untuk memuat votasi <br/> 2. Pilih suara anda <br/> 3. Bagikan gambar yang diperbarui kepada siapa saja!", "MakeNew": "Poll baru", "Create": "Membuat", "VotedPolls": "Voting polling:", "swipeToRemove": "Gesek untuk menghapus", "showYourPolls": "Tunjukkan jajak pendapatmu", "Return": "Kembali", "Share+": "Bagikan +", "Share": "Bagikan", "Save": "Menyimpan", "Voters": "Pemilih", "Cancel": "Membatalkan", "needsPhone": "Untuk mendapatkan suara di poling umum, kami mencegah agar bots mengirim SMS ke nomor telepon Anda", "needsPhoneComment": "Identifikasi ini disediakan oleh rangkaian pengembangan twitter auth dan aplikasi ini akan mengenkripsi nomor telepon Anda.", "multipleChoice": "Biarkan memilih beberapa pilihan.", "onlyDevice": "Pilih hanya suara dari App.", "openVotes": "Membuka suara", "firstOk": "Baik", "Activate": "Mengaktifkan", "downloadAppStore": "Pasang aplikasi dan bagikan!", "createPoll": "Bagikan polis ke manapun Anda inginkan:", "QuestionPlaceholder": "Tuliskan disini pertanyaannya, sertakan info tambahan di jalur lain.", "OptionsPlaceholder": "Masukkan setiap pilihan pada baris yang berbeda.", "UsernamePlaceholder": "Nama anda (opsional)", "PublicOnlyFromApp": "Untuk memilih di poling umum, Anda perlu menggunakan <u> APP </ u>", "PollOnlyAvailableIn": "Jajak pendapat ini hanya tersedia di", "AllowAppServices": "Tolong, <b> perbaiki </ b> pengalaman pengguna Anda sehingga memungkinkan penggunaan akses <b> '</ b>.", "whyNeedServicesPermission": "Mengapa perlu ini? <br/> Sejak versi 5.0 Lollipop 5.0, diperlukan izin khusus untuk membaca penggunaan aplikasi. Kami membutuhkan ini untuk meningkatkan penerapan dengan aplikasi sosial lainnya.", "votationNotExists": "Pemungutan suara tidak ada", "votationNotSaved": "Tidak dapat terhubung ke server: voting tidak disimpan", "waitingKey": "Membuat demokrasi ..", "waitingKeyExpired": "Kesalahan saat menyimpan jajak pendapat Coba lagi..", "onlyMostVotedShows": "Secara default hanya 4 pilihan yang paling terpilih yang ditampilkan di gambar bersama.",
"notPublicUsers": "Tidak ada nama pemilih", "missingAjaxKey": "Batas waktu meminta kunci polling, silakan cek koneksi internet anda.", "more": "lebih", "min1Option": "Letakkan setidaknya 1 pilihan", "min2Options": "Pilihan tidak boleh kosong", "duplicatedOptions": "Pilihan duplikat!", "myName": "Masukkan nama panggilan", "requiredName": "Masukkan nama anda (wajib)", "privateNeedUserName": "Tambahkan nama Anda diperlukan (hanya untuk polling pribadi)", "unknown": "Tidak diketahui", "browser": "Browser", "notInApp": "Gunakan App untuk meneruskan polling.", "pollWillVisible": "Terima kasih. Jajak pendapat akan terlihat dalam beberapa jam ke depan!", "error": "kesalahan", "errorAjaxResponse": "Kesalahan saat mengambil respon ajax", "votationNotFound": "Pemungutan suara tidak ditemukan", "WrongCountry": "Anda tidak berada di tempat", "notValidUserId": "Id pengguna tidak valid", "notLoadingPolls": "Kesalahan pemuatan jajak pendapat", "warnNotPublic": "Peringatkan: jajak pendapat ini bersifat pribadi dan tidak memvalidasi pemilih, jadi tidak berlaku untuk pemungutan suara publik", "e_noDataReceived": "Tidak ada data yang diambil", "e_phoneValidationNotWork": "Masalah untuk melakukan verifikasi SMS? Tolong kalau begitu hubungi kami.", "warnMaximumOptions": "Verifikasi gambar tidak dipotong di lingkungan bersama", "e_retrievingData": "Polling tidak ditemukan, periksa koneksi internet anda:", "loadingPublicKey": "Memvalidasi nomor telepon, tunggu sebentar dan coba lagi ..", "PopularPolls": "Jajak pendapat populer:", "total": "total", "New": "Baru", "search": "pencarian", "showAll": "Tunjukkan semua negara", "showMine": "Default", "duplicatedKey": "Digandakan kunci", "noPollsFound": "Bukan jajak pendapat yang ditemukan", "forgetPoll": "lupakan ini", "UNDO": "MEMBUKA", "Votes": "Suara", "ClickTheLink": "Link untuk memilih!", "CustomStyles": "Gaya default:", "defaults": "Default", "Symbol": "Simbol:", "ChooseFile": "Upload gambar", "QuestionColor": "Warna pertanyaan:", "OptionTextColor": "Warna teks opsi:", "BackgroundColor": "Warna latar belakang:", "GradientBackground": "Latar belakang gradasi:", "GradientColor1": "Gradien warna 1:", "GradientColor2": "Warna gradien 2:", "LimitByCountry": "Batas menurut wilayah:", "WillShowPublic": "- Jajak pendapat publik akan ditampilkan di halaman 'jajak pendapat publik'.", "ChooseCountry": "Memilih", "ExampleQuestion": "Ini adalah contoh pertanyaan <br> Dan ini adalah beberapa teks tambahan", "OptionExample1": "Contoh pilihan A", "OptionExample2": "Contoh pilihan B", "ownerNameExample": "nama pemilik", "AddPollLink": "Tambahkan LINK web tambahan untuk polling ini", "Public": "Publik", "StyleNamePlaceholder": "Nama gaya", "SaveStyle": "Menyimpan", "Delete": "Menghapus", "allCountries": "Negara manapun ..", "Yes": "iya nih", "Not": "Tidak", "cantChangePublic": "Jajak pendapat ini sudah disimpan. Untuk mengubah nilai Publik, batalkan ini dan buatlah yang baru.", "noUserCountryFound": "Kesalahan: tidak dapat mengambil negara telepon Anda, hubungi kami", "p_notEditable": "Tidak tersedia pilihan disini.", "e_votationRemoved": "Maaf, pemungutan suara ini telah dihapus", "e_connectionLost": "Koneksi terputus", "e_votationWithErrors": "Maaf, pemungutan suara memiliki kesalahan. Silahkan hubungi kami.", "e_flagNotFound": "Tidak bisa memuat bendera", "e_parsingIndexFile": "Kesalahan parsing file _index.txt", "e_connection": "Silahkan cek koneksi internet anda dan coba lagi", "e_publicPolls": "Tidak ditemukan jajak pendapat umum", "e_imageNotFound": "Kesalahan: gambar tidak ditemukan", });
"hidePolls": "Menyembunyikan jajak pendapat",
random_line_split
buffer.rs
use crate::parsing::ParsingContext; use amq_protocol::frame::{BackToTheBuffer, GenError, GenResult, WriteContext}; use futures_io::{AsyncRead, AsyncWrite}; use std::{ cmp, io::{self, IoSlice, IoSliceMut}, pin::Pin, task::{Context, Poll}, }; #[derive(Debug, PartialEq, Clone)] pub(crate) struct Buffer { memory: Vec<u8>, capacity: usize, position: usize, end: usize, available_data: usize, } pub(crate) struct Checkpoint { end: usize, backwards: bool, } impl Buffer { pub(crate) fn with_capacity(capacity: usize) -> Buffer { Buffer { memory: vec![0; capacity], capacity, position: 0, end: 0, available_data: 0, } } pub(crate) fn checkpoint(&self) -> Checkpoint { Checkpoint { end: self.end, backwards: true, } } pub(crate) fn rollback(&mut self, checkpoint: Checkpoint) { if checkpoint.end == self.end { return; } if checkpoint.backwards { if self.end > checkpoint.end { self.available_data -= self.end - checkpoint.end; } else { self.available_data -= self.end + (self.capacity - checkpoint.end); } } else if self.end > checkpoint.end { self.available_data += (self.capacity - self.end) + checkpoint.end; } else { self.available_data += checkpoint.end - self.end; } self.end = checkpoint.end; } pub(crate) fn grow(&mut self, new_size: usize) -> bool { if self.capacity >= new_size { return false; } let old_capacity = self.capacity; let growth = new_size - old_capacity; self.memory.resize(new_size, 0); self.capacity = new_size; if self.end <= self.position && self.available_data > 0 { // We have data and the "tail" was at the beginning of the buffer. // We need to move it in the new end. let (old, new) = self.memory.split_at_mut(old_capacity); if self.end < growth { // There is enough room in the new end for this whole "tail". new[..].copy_from_slice(&old[..self.end]); self.end += old_capacity; } else { // Fill the new end with as much data as we can. // We also update the end pointer to the future right location. // We still have [growth..old_end] to move into [..new_end] new[..].copy_from_slice(&old[..growth]); self.end -= growth; if self.end < growth { // Less than half the data is yet to be moved, we can split + copy. let (start, data) = self.memory.split_at_mut(growth); start[..].copy_from_slice(&data[..self.end]) } else { // Not enough room to split + copy, we copy each byte one at a time. for i in 0..=self.end { self.memory[i] = self.memory[i + growth]; } } } } true } pub(crate) fn available_data(&self) -> usize { self.available_data } pub(crate) fn available_space(&self) -> usize { self.capacity - self.available_data } pub(crate) fn consume(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_data()); self.position += cnt; self.position %= self.capacity; self.available_data -= cnt; cnt } pub(crate) fn fill(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_space()); self.end += cnt; self.end %= self.capacity; self.available_data += cnt; cnt } pub(crate) fn poll_write_to<T: AsyncWrite>( &self, cx: &mut Context<'_>, writer: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_data() == 0 { Poll::Ready(Ok(0)) } else if self.end > self.position { writer.poll_write(cx, &self.memory[self.position..self.end]) } else { writer.poll_write_vectored( cx, &[ IoSlice::new(&self.memory[self.position..]), IoSlice::new(&self.memory[..self.end]), ], ) } } pub(crate) fn poll_read_from<T: AsyncRead>( &mut self, cx: &mut Context<'_>, reader: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_space() == 0
else if self.end >= self.position { let (start, end) = self.memory.split_at_mut(self.end); reader.poll_read_vectored( cx, &mut [ IoSliceMut::new(&mut *end), IoSliceMut::new(&mut start[..self.position]), ][..], ) } else { reader.poll_read(cx, &mut self.memory[self.end..self.position]) } } pub(crate) fn offset(&self, buf: ParsingContext<'_>) -> usize { let data = &self.memory[self.position..self.position]; let dataptr = data.as_ptr() as usize; let bufptr = buf.as_ptr() as usize; if dataptr < bufptr { bufptr - dataptr } else { let start = &self.memory[..0]; let startptr = start.as_ptr() as usize; bufptr + self.capacity - self.position - startptr } } pub(crate) fn parsing_context(&self) -> ParsingContext<'_> { if self.available_data() == 0 { self.memory[self.end..self.end].into() } else if self.end > self.position { self.memory[self.position..self.end].into() } else { [&self.memory[self.position..], &self.memory[..self.end]].into() } } } impl io::Write for &mut Buffer { fn write(&mut self, data: &[u8]) -> io::Result<usize> { let amt = if self.available_space() == 0 { 0 } else if self.end >= self.position { let mut space = &mut self.memory[self.end..]; let mut amt = space.write(data)?; if amt == self.capacity - self.end { let mut space = &mut self.memory[..self.position]; amt += space.write(&data[amt..])?; } amt } else { let mut space = &mut self.memory[self.end..self.position]; space.write(data)? }; self.fill(amt); Ok(amt) } fn flush(&mut self) -> io::Result<()> { Ok(()) } } impl BackToTheBuffer for &mut Buffer { fn reserve_write_use< Tmp, Gen: Fn(WriteContext<Self>) -> Result<(WriteContext<Self>, Tmp), GenError>, Before: Fn(WriteContext<Self>, Tmp) -> GenResult<Self>, >( s: WriteContext<Self>, reserved: usize, gen: &Gen, before: &Before, ) -> Result<WriteContext<Self>, GenError> { if s.write.available_space() < reserved { return Err(GenError::BufferTooSmall( reserved - s.write.available_space(), )); } let start = s.write.checkpoint(); s.write.fill(reserved); gen(s).and_then(|(s, tmp)| { let mut end = s.write.checkpoint(); end.backwards = false; s.write.rollback(start); before(s, tmp).map(|s| { s.write.rollback(end); s }) }) } }
{ Poll::Ready(Ok(0)) }
conditional_block
buffer.rs
use crate::parsing::ParsingContext; use amq_protocol::frame::{BackToTheBuffer, GenError, GenResult, WriteContext}; use futures_io::{AsyncRead, AsyncWrite}; use std::{ cmp, io::{self, IoSlice, IoSliceMut}, pin::Pin, task::{Context, Poll}, }; #[derive(Debug, PartialEq, Clone)] pub(crate) struct Buffer { memory: Vec<u8>, capacity: usize, position: usize, end: usize, available_data: usize, } pub(crate) struct Checkpoint { end: usize, backwards: bool, } impl Buffer { pub(crate) fn with_capacity(capacity: usize) -> Buffer { Buffer { memory: vec![0; capacity], capacity, position: 0, end: 0, available_data: 0, } } pub(crate) fn checkpoint(&self) -> Checkpoint
pub(crate) fn rollback(&mut self, checkpoint: Checkpoint) { if checkpoint.end == self.end { return; } if checkpoint.backwards { if self.end > checkpoint.end { self.available_data -= self.end - checkpoint.end; } else { self.available_data -= self.end + (self.capacity - checkpoint.end); } } else if self.end > checkpoint.end { self.available_data += (self.capacity - self.end) + checkpoint.end; } else { self.available_data += checkpoint.end - self.end; } self.end = checkpoint.end; } pub(crate) fn grow(&mut self, new_size: usize) -> bool { if self.capacity >= new_size { return false; } let old_capacity = self.capacity; let growth = new_size - old_capacity; self.memory.resize(new_size, 0); self.capacity = new_size; if self.end <= self.position && self.available_data > 0 { // We have data and the "tail" was at the beginning of the buffer. // We need to move it in the new end. let (old, new) = self.memory.split_at_mut(old_capacity); if self.end < growth { // There is enough room in the new end for this whole "tail". new[..].copy_from_slice(&old[..self.end]); self.end += old_capacity; } else { // Fill the new end with as much data as we can. // We also update the end pointer to the future right location. // We still have [growth..old_end] to move into [..new_end] new[..].copy_from_slice(&old[..growth]); self.end -= growth; if self.end < growth { // Less than half the data is yet to be moved, we can split + copy. let (start, data) = self.memory.split_at_mut(growth); start[..].copy_from_slice(&data[..self.end]) } else { // Not enough room to split + copy, we copy each byte one at a time. for i in 0..=self.end { self.memory[i] = self.memory[i + growth]; } } } } true } pub(crate) fn available_data(&self) -> usize { self.available_data } pub(crate) fn available_space(&self) -> usize { self.capacity - self.available_data } pub(crate) fn consume(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_data()); self.position += cnt; self.position %= self.capacity; self.available_data -= cnt; cnt } pub(crate) fn fill(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_space()); self.end += cnt; self.end %= self.capacity; self.available_data += cnt; cnt } pub(crate) fn poll_write_to<T: AsyncWrite>( &self, cx: &mut Context<'_>, writer: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_data() == 0 { Poll::Ready(Ok(0)) } else if self.end > self.position { writer.poll_write(cx, &self.memory[self.position..self.end]) } else { writer.poll_write_vectored( cx, &[ IoSlice::new(&self.memory[self.position..]), IoSlice::new(&self.memory[..self.end]), ], ) } } pub(crate) fn poll_read_from<T: AsyncRead>( &mut self, cx: &mut Context<'_>, reader: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_space() == 0 { Poll::Ready(Ok(0)) } else if self.end >= self.position { let (start, end) = self.memory.split_at_mut(self.end); reader.poll_read_vectored( cx, &mut [ IoSliceMut::new(&mut *end), IoSliceMut::new(&mut start[..self.position]), ][..], ) } else { reader.poll_read(cx, &mut self.memory[self.end..self.position]) } } pub(crate) fn offset(&self, buf: ParsingContext<'_>) -> usize { let data = &self.memory[self.position..self.position]; let dataptr = data.as_ptr() as usize; let bufptr = buf.as_ptr() as usize; if dataptr < bufptr { bufptr - dataptr } else { let start = &self.memory[..0]; let startptr = start.as_ptr() as usize; bufptr + self.capacity - self.position - startptr } } pub(crate) fn parsing_context(&self) -> ParsingContext<'_> { if self.available_data() == 0 { self.memory[self.end..self.end].into() } else if self.end > self.position { self.memory[self.position..self.end].into() } else { [&self.memory[self.position..], &self.memory[..self.end]].into() } } } impl io::Write for &mut Buffer { fn write(&mut self, data: &[u8]) -> io::Result<usize> { let amt = if self.available_space() == 0 { 0 } else if self.end >= self.position { let mut space = &mut self.memory[self.end..]; let mut amt = space.write(data)?; if amt == self.capacity - self.end { let mut space = &mut self.memory[..self.position]; amt += space.write(&data[amt..])?; } amt } else { let mut space = &mut self.memory[self.end..self.position]; space.write(data)? }; self.fill(amt); Ok(amt) } fn flush(&mut self) -> io::Result<()> { Ok(()) } } impl BackToTheBuffer for &mut Buffer { fn reserve_write_use< Tmp, Gen: Fn(WriteContext<Self>) -> Result<(WriteContext<Self>, Tmp), GenError>, Before: Fn(WriteContext<Self>, Tmp) -> GenResult<Self>, >( s: WriteContext<Self>, reserved: usize, gen: &Gen, before: &Before, ) -> Result<WriteContext<Self>, GenError> { if s.write.available_space() < reserved { return Err(GenError::BufferTooSmall( reserved - s.write.available_space(), )); } let start = s.write.checkpoint(); s.write.fill(reserved); gen(s).and_then(|(s, tmp)| { let mut end = s.write.checkpoint(); end.backwards = false; s.write.rollback(start); before(s, tmp).map(|s| { s.write.rollback(end); s }) }) } }
{ Checkpoint { end: self.end, backwards: true, } }
identifier_body
buffer.rs
use crate::parsing::ParsingContext; use amq_protocol::frame::{BackToTheBuffer, GenError, GenResult, WriteContext}; use futures_io::{AsyncRead, AsyncWrite}; use std::{ cmp, io::{self, IoSlice, IoSliceMut}, pin::Pin, task::{Context, Poll}, }; #[derive(Debug, PartialEq, Clone)] pub(crate) struct Buffer { memory: Vec<u8>, capacity: usize, position: usize, end: usize, available_data: usize, } pub(crate) struct Checkpoint { end: usize, backwards: bool, } impl Buffer { pub(crate) fn with_capacity(capacity: usize) -> Buffer { Buffer { memory: vec![0; capacity], capacity, position: 0, end: 0, available_data: 0, } } pub(crate) fn checkpoint(&self) -> Checkpoint { Checkpoint { end: self.end, backwards: true, } } pub(crate) fn rollback(&mut self, checkpoint: Checkpoint) { if checkpoint.end == self.end { return; } if checkpoint.backwards { if self.end > checkpoint.end { self.available_data -= self.end - checkpoint.end; } else { self.available_data -= self.end + (self.capacity - checkpoint.end); } } else if self.end > checkpoint.end { self.available_data += (self.capacity - self.end) + checkpoint.end; } else { self.available_data += checkpoint.end - self.end; } self.end = checkpoint.end; } pub(crate) fn grow(&mut self, new_size: usize) -> bool { if self.capacity >= new_size { return false; } let old_capacity = self.capacity; let growth = new_size - old_capacity; self.memory.resize(new_size, 0); self.capacity = new_size; if self.end <= self.position && self.available_data > 0 { // We have data and the "tail" was at the beginning of the buffer. // We need to move it in the new end. let (old, new) = self.memory.split_at_mut(old_capacity); if self.end < growth { // There is enough room in the new end for this whole "tail". new[..].copy_from_slice(&old[..self.end]); self.end += old_capacity; } else { // Fill the new end with as much data as we can. // We also update the end pointer to the future right location. // We still have [growth..old_end] to move into [..new_end] new[..].copy_from_slice(&old[..growth]); self.end -= growth; if self.end < growth { // Less than half the data is yet to be moved, we can split + copy. let (start, data) = self.memory.split_at_mut(growth); start[..].copy_from_slice(&data[..self.end]) } else { // Not enough room to split + copy, we copy each byte one at a time. for i in 0..=self.end { self.memory[i] = self.memory[i + growth]; } } } } true } pub(crate) fn available_data(&self) -> usize { self.available_data } pub(crate) fn available_space(&self) -> usize { self.capacity - self.available_data } pub(crate) fn consume(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_data()); self.position += cnt; self.position %= self.capacity; self.available_data -= cnt; cnt } pub(crate) fn fill(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_space()); self.end += cnt; self.end %= self.capacity; self.available_data += cnt; cnt } pub(crate) fn poll_write_to<T: AsyncWrite>( &self, cx: &mut Context<'_>, writer: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_data() == 0 { Poll::Ready(Ok(0)) } else if self.end > self.position { writer.poll_write(cx, &self.memory[self.position..self.end]) } else { writer.poll_write_vectored( cx, &[ IoSlice::new(&self.memory[self.position..]), IoSlice::new(&self.memory[..self.end]), ], ) } } pub(crate) fn poll_read_from<T: AsyncRead>( &mut self, cx: &mut Context<'_>, reader: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_space() == 0 { Poll::Ready(Ok(0)) } else if self.end >= self.position { let (start, end) = self.memory.split_at_mut(self.end); reader.poll_read_vectored( cx, &mut [ IoSliceMut::new(&mut *end), IoSliceMut::new(&mut start[..self.position]), ][..], ) } else { reader.poll_read(cx, &mut self.memory[self.end..self.position]) } } pub(crate) fn offset(&self, buf: ParsingContext<'_>) -> usize { let data = &self.memory[self.position..self.position]; let dataptr = data.as_ptr() as usize; let bufptr = buf.as_ptr() as usize; if dataptr < bufptr { bufptr - dataptr } else { let start = &self.memory[..0]; let startptr = start.as_ptr() as usize; bufptr + self.capacity - self.position - startptr } } pub(crate) fn parsing_context(&self) -> ParsingContext<'_> { if self.available_data() == 0 { self.memory[self.end..self.end].into() } else if self.end > self.position { self.memory[self.position..self.end].into() } else { [&self.memory[self.position..], &self.memory[..self.end]].into() } } } impl io::Write for &mut Buffer { fn write(&mut self, data: &[u8]) -> io::Result<usize> { let amt = if self.available_space() == 0 { 0 } else if self.end >= self.position { let mut space = &mut self.memory[self.end..]; let mut amt = space.write(data)?; if amt == self.capacity - self.end { let mut space = &mut self.memory[..self.position]; amt += space.write(&data[amt..])?; } amt } else { let mut space = &mut self.memory[self.end..self.position]; space.write(data)? }; self.fill(amt); Ok(amt) } fn
(&mut self) -> io::Result<()> { Ok(()) } } impl BackToTheBuffer for &mut Buffer { fn reserve_write_use< Tmp, Gen: Fn(WriteContext<Self>) -> Result<(WriteContext<Self>, Tmp), GenError>, Before: Fn(WriteContext<Self>, Tmp) -> GenResult<Self>, >( s: WriteContext<Self>, reserved: usize, gen: &Gen, before: &Before, ) -> Result<WriteContext<Self>, GenError> { if s.write.available_space() < reserved { return Err(GenError::BufferTooSmall( reserved - s.write.available_space(), )); } let start = s.write.checkpoint(); s.write.fill(reserved); gen(s).and_then(|(s, tmp)| { let mut end = s.write.checkpoint(); end.backwards = false; s.write.rollback(start); before(s, tmp).map(|s| { s.write.rollback(end); s }) }) } }
flush
identifier_name
buffer.rs
use crate::parsing::ParsingContext; use amq_protocol::frame::{BackToTheBuffer, GenError, GenResult, WriteContext}; use futures_io::{AsyncRead, AsyncWrite}; use std::{ cmp, io::{self, IoSlice, IoSliceMut}, pin::Pin, task::{Context, Poll},
pub(crate) struct Buffer { memory: Vec<u8>, capacity: usize, position: usize, end: usize, available_data: usize, } pub(crate) struct Checkpoint { end: usize, backwards: bool, } impl Buffer { pub(crate) fn with_capacity(capacity: usize) -> Buffer { Buffer { memory: vec![0; capacity], capacity, position: 0, end: 0, available_data: 0, } } pub(crate) fn checkpoint(&self) -> Checkpoint { Checkpoint { end: self.end, backwards: true, } } pub(crate) fn rollback(&mut self, checkpoint: Checkpoint) { if checkpoint.end == self.end { return; } if checkpoint.backwards { if self.end > checkpoint.end { self.available_data -= self.end - checkpoint.end; } else { self.available_data -= self.end + (self.capacity - checkpoint.end); } } else if self.end > checkpoint.end { self.available_data += (self.capacity - self.end) + checkpoint.end; } else { self.available_data += checkpoint.end - self.end; } self.end = checkpoint.end; } pub(crate) fn grow(&mut self, new_size: usize) -> bool { if self.capacity >= new_size { return false; } let old_capacity = self.capacity; let growth = new_size - old_capacity; self.memory.resize(new_size, 0); self.capacity = new_size; if self.end <= self.position && self.available_data > 0 { // We have data and the "tail" was at the beginning of the buffer. // We need to move it in the new end. let (old, new) = self.memory.split_at_mut(old_capacity); if self.end < growth { // There is enough room in the new end for this whole "tail". new[..].copy_from_slice(&old[..self.end]); self.end += old_capacity; } else { // Fill the new end with as much data as we can. // We also update the end pointer to the future right location. // We still have [growth..old_end] to move into [..new_end] new[..].copy_from_slice(&old[..growth]); self.end -= growth; if self.end < growth { // Less than half the data is yet to be moved, we can split + copy. let (start, data) = self.memory.split_at_mut(growth); start[..].copy_from_slice(&data[..self.end]) } else { // Not enough room to split + copy, we copy each byte one at a time. for i in 0..=self.end { self.memory[i] = self.memory[i + growth]; } } } } true } pub(crate) fn available_data(&self) -> usize { self.available_data } pub(crate) fn available_space(&self) -> usize { self.capacity - self.available_data } pub(crate) fn consume(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_data()); self.position += cnt; self.position %= self.capacity; self.available_data -= cnt; cnt } pub(crate) fn fill(&mut self, count: usize) -> usize { let cnt = cmp::min(count, self.available_space()); self.end += cnt; self.end %= self.capacity; self.available_data += cnt; cnt } pub(crate) fn poll_write_to<T: AsyncWrite>( &self, cx: &mut Context<'_>, writer: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_data() == 0 { Poll::Ready(Ok(0)) } else if self.end > self.position { writer.poll_write(cx, &self.memory[self.position..self.end]) } else { writer.poll_write_vectored( cx, &[ IoSlice::new(&self.memory[self.position..]), IoSlice::new(&self.memory[..self.end]), ], ) } } pub(crate) fn poll_read_from<T: AsyncRead>( &mut self, cx: &mut Context<'_>, reader: Pin<&mut T>, ) -> Poll<io::Result<usize>> { if self.available_space() == 0 { Poll::Ready(Ok(0)) } else if self.end >= self.position { let (start, end) = self.memory.split_at_mut(self.end); reader.poll_read_vectored( cx, &mut [ IoSliceMut::new(&mut *end), IoSliceMut::new(&mut start[..self.position]), ][..], ) } else { reader.poll_read(cx, &mut self.memory[self.end..self.position]) } } pub(crate) fn offset(&self, buf: ParsingContext<'_>) -> usize { let data = &self.memory[self.position..self.position]; let dataptr = data.as_ptr() as usize; let bufptr = buf.as_ptr() as usize; if dataptr < bufptr { bufptr - dataptr } else { let start = &self.memory[..0]; let startptr = start.as_ptr() as usize; bufptr + self.capacity - self.position - startptr } } pub(crate) fn parsing_context(&self) -> ParsingContext<'_> { if self.available_data() == 0 { self.memory[self.end..self.end].into() } else if self.end > self.position { self.memory[self.position..self.end].into() } else { [&self.memory[self.position..], &self.memory[..self.end]].into() } } } impl io::Write for &mut Buffer { fn write(&mut self, data: &[u8]) -> io::Result<usize> { let amt = if self.available_space() == 0 { 0 } else if self.end >= self.position { let mut space = &mut self.memory[self.end..]; let mut amt = space.write(data)?; if amt == self.capacity - self.end { let mut space = &mut self.memory[..self.position]; amt += space.write(&data[amt..])?; } amt } else { let mut space = &mut self.memory[self.end..self.position]; space.write(data)? }; self.fill(amt); Ok(amt) } fn flush(&mut self) -> io::Result<()> { Ok(()) } } impl BackToTheBuffer for &mut Buffer { fn reserve_write_use< Tmp, Gen: Fn(WriteContext<Self>) -> Result<(WriteContext<Self>, Tmp), GenError>, Before: Fn(WriteContext<Self>, Tmp) -> GenResult<Self>, >( s: WriteContext<Self>, reserved: usize, gen: &Gen, before: &Before, ) -> Result<WriteContext<Self>, GenError> { if s.write.available_space() < reserved { return Err(GenError::BufferTooSmall( reserved - s.write.available_space(), )); } let start = s.write.checkpoint(); s.write.fill(reserved); gen(s).and_then(|(s, tmp)| { let mut end = s.write.checkpoint(); end.backwards = false; s.write.rollback(start); before(s, tmp).map(|s| { s.write.rollback(end); s }) }) } }
}; #[derive(Debug, PartialEq, Clone)]
random_line_split
RPCServer.py
#!/usr/bin/python -OO # This file is part of Archivematica. # # Copyright 2010-2013 Artefactual Systems Inc. <http://artefactual.com> # # Archivematica is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Archivematica is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Archivematica. If not, see <http://www.gnu.org/licenses/>. # @package Archivematica # @subpackage MCPServer # @author Joseph Perry <joseph@artefactual.com> import archivematicaMCP import sys from linkTaskManagerChoice import choicesAvailableForUnits import logging import lxml.etree as etree import gearman import cPickle import time import traceback from socket import gethostname sys.path.append("/usr/lib/archivematica/archivematicaCommon") from custom_handlers import GroupWriteRotatingFileHandler import databaseInterface def rpcError(code="", details=""): ret = etree.Element("Error") etree.SubElement(ret, "code").text = code.__str__() etree.SubElement(ret, "details").text = details.__str__() return ret def verifyDatabaseIsNotLocked(): timeBeforeReturningErrorLockedDB = 4 timeToSleep = 0.1 numberOfRuns = 0 #count of number of runs in loop while not databaseInterface.sqlLock.acquire(False): time.sleep(timeToSleep) numberOfRuns += 1 if numberOfRuns * timeToSleep > timeBeforeReturningErrorLockedDB: return rpcError(code="DatabaseLock", details="Couldn't acquire database lock") databaseInterface.sqlLock.release() return None def getJobsAwaitingApproval(): ret = etree.Element("choicesAvailableForUnits") dbStatus = verifyDatabaseIsNotLocked() if dbStatus: #print etree.tostring(dbStatus) return etree.tostring(dbStatus) for UUID, choice in choicesAvailableForUnits.items():
return etree.tostring(ret, pretty_print=True) def approveJob(jobUUID, chain, agent): print "approving: ", jobUUID, chain, agent if jobUUID in choicesAvailableForUnits: choicesAvailableForUnits[jobUUID].proceedWithChoice(chain, agent) return "approving: ", jobUUID, chain def gearmanApproveJob(gearman_worker, gearman_job): try: #execute = gearman_job.task data = cPickle.loads(gearman_job.data) jobUUID = data["jobUUID"] chain = data["chain"] agent = str(data["uid"]) ret = cPickle.dumps(approveJob(jobUUID, chain, agent)) if not ret: ret = "" return "" #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanApproveJob" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def gearmanGetJobsAwaitingApproval(gearman_worker, gearman_job): try: #print "DEBUG - getting list of jobs" #execute = gearman_job.task ret = cPickle.dumps(getJobsAwaitingApproval()) #print ret if not ret: ret = "" return ret #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanGetJobsAwaitingApproval" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def startRPCServer(): logger = logging.getLogger("archivematica") logger.addHandler(GroupWriteRotatingFileHandler("/var/log/archivematica/MCPServer/MCPServer.log", maxBytes=4194304)) gm_worker = gearman.GearmanWorker([archivematicaMCP.config.get('MCPServer', 'GearmanServerWorker')]) hostID = gethostname() + "_MCPServer" gm_worker.set_client_id(hostID) gm_worker.register_task("approveJob", gearmanApproveJob) gm_worker.register_task("getJobsAwaitingApproval", gearmanGetJobsAwaitingApproval) failMaxSleep = 30 failSleep = 1 failSleepIncrementor = 2 while True: try: gm_worker.work() except gearman.errors.ServerUnavailable as inst: #print >>sys.stderr, inst.args #print >>sys.stderr, "Retrying in %d seconds." % (failSleep) time.sleep(failSleep) if failSleep < failMaxSleep: failSleep += failSleepIncrementor
ret.append(choice.xmlify())
conditional_block
RPCServer.py
#!/usr/bin/python -OO # This file is part of Archivematica. # # Copyright 2010-2013 Artefactual Systems Inc. <http://artefactual.com> # # Archivematica is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Archivematica is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Archivematica. If not, see <http://www.gnu.org/licenses/>. # @package Archivematica # @subpackage MCPServer # @author Joseph Perry <joseph@artefactual.com> import archivematicaMCP import sys from linkTaskManagerChoice import choicesAvailableForUnits import logging import lxml.etree as etree import gearman import cPickle import time import traceback from socket import gethostname sys.path.append("/usr/lib/archivematica/archivematicaCommon") from custom_handlers import GroupWriteRotatingFileHandler import databaseInterface def rpcError(code="", details=""): ret = etree.Element("Error") etree.SubElement(ret, "code").text = code.__str__() etree.SubElement(ret, "details").text = details.__str__() return ret def verifyDatabaseIsNotLocked(): timeBeforeReturningErrorLockedDB = 4 timeToSleep = 0.1 numberOfRuns = 0 #count of number of runs in loop while not databaseInterface.sqlLock.acquire(False): time.sleep(timeToSleep) numberOfRuns += 1 if numberOfRuns * timeToSleep > timeBeforeReturningErrorLockedDB: return rpcError(code="DatabaseLock", details="Couldn't acquire database lock") databaseInterface.sqlLock.release() return None def getJobsAwaitingApproval(): ret = etree.Element("choicesAvailableForUnits") dbStatus = verifyDatabaseIsNotLocked() if dbStatus: #print etree.tostring(dbStatus) return etree.tostring(dbStatus) for UUID, choice in choicesAvailableForUnits.items(): ret.append(choice.xmlify()) return etree.tostring(ret, pretty_print=True) def approveJob(jobUUID, chain, agent): print "approving: ", jobUUID, chain, agent if jobUUID in choicesAvailableForUnits: choicesAvailableForUnits[jobUUID].proceedWithChoice(chain, agent) return "approving: ", jobUUID, chain def gearmanApproveJob(gearman_worker, gearman_job): try: #execute = gearman_job.task data = cPickle.loads(gearman_job.data) jobUUID = data["jobUUID"] chain = data["chain"] agent = str(data["uid"]) ret = cPickle.dumps(approveJob(jobUUID, chain, agent)) if not ret: ret = "" return "" #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanApproveJob" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def
(gearman_worker, gearman_job): try: #print "DEBUG - getting list of jobs" #execute = gearman_job.task ret = cPickle.dumps(getJobsAwaitingApproval()) #print ret if not ret: ret = "" return ret #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanGetJobsAwaitingApproval" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def startRPCServer(): logger = logging.getLogger("archivematica") logger.addHandler(GroupWriteRotatingFileHandler("/var/log/archivematica/MCPServer/MCPServer.log", maxBytes=4194304)) gm_worker = gearman.GearmanWorker([archivematicaMCP.config.get('MCPServer', 'GearmanServerWorker')]) hostID = gethostname() + "_MCPServer" gm_worker.set_client_id(hostID) gm_worker.register_task("approveJob", gearmanApproveJob) gm_worker.register_task("getJobsAwaitingApproval", gearmanGetJobsAwaitingApproval) failMaxSleep = 30 failSleep = 1 failSleepIncrementor = 2 while True: try: gm_worker.work() except gearman.errors.ServerUnavailable as inst: #print >>sys.stderr, inst.args #print >>sys.stderr, "Retrying in %d seconds." % (failSleep) time.sleep(failSleep) if failSleep < failMaxSleep: failSleep += failSleepIncrementor
gearmanGetJobsAwaitingApproval
identifier_name
RPCServer.py
#!/usr/bin/python -OO # This file is part of Archivematica. # # Copyright 2010-2013 Artefactual Systems Inc. <http://artefactual.com> # # Archivematica is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Archivematica is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Archivematica. If not, see <http://www.gnu.org/licenses/>. # @package Archivematica # @subpackage MCPServer # @author Joseph Perry <joseph@artefactual.com> import archivematicaMCP import sys from linkTaskManagerChoice import choicesAvailableForUnits import logging import lxml.etree as etree import gearman import cPickle import time import traceback from socket import gethostname sys.path.append("/usr/lib/archivematica/archivematicaCommon") from custom_handlers import GroupWriteRotatingFileHandler import databaseInterface def rpcError(code="", details=""): ret = etree.Element("Error") etree.SubElement(ret, "code").text = code.__str__() etree.SubElement(ret, "details").text = details.__str__() return ret def verifyDatabaseIsNotLocked():
def getJobsAwaitingApproval(): ret = etree.Element("choicesAvailableForUnits") dbStatus = verifyDatabaseIsNotLocked() if dbStatus: #print etree.tostring(dbStatus) return etree.tostring(dbStatus) for UUID, choice in choicesAvailableForUnits.items(): ret.append(choice.xmlify()) return etree.tostring(ret, pretty_print=True) def approveJob(jobUUID, chain, agent): print "approving: ", jobUUID, chain, agent if jobUUID in choicesAvailableForUnits: choicesAvailableForUnits[jobUUID].proceedWithChoice(chain, agent) return "approving: ", jobUUID, chain def gearmanApproveJob(gearman_worker, gearman_job): try: #execute = gearman_job.task data = cPickle.loads(gearman_job.data) jobUUID = data["jobUUID"] chain = data["chain"] agent = str(data["uid"]) ret = cPickle.dumps(approveJob(jobUUID, chain, agent)) if not ret: ret = "" return "" #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanApproveJob" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def gearmanGetJobsAwaitingApproval(gearman_worker, gearman_job): try: #print "DEBUG - getting list of jobs" #execute = gearman_job.task ret = cPickle.dumps(getJobsAwaitingApproval()) #print ret if not ret: ret = "" return ret #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanGetJobsAwaitingApproval" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def startRPCServer(): logger = logging.getLogger("archivematica") logger.addHandler(GroupWriteRotatingFileHandler("/var/log/archivematica/MCPServer/MCPServer.log", maxBytes=4194304)) gm_worker = gearman.GearmanWorker([archivematicaMCP.config.get('MCPServer', 'GearmanServerWorker')]) hostID = gethostname() + "_MCPServer" gm_worker.set_client_id(hostID) gm_worker.register_task("approveJob", gearmanApproveJob) gm_worker.register_task("getJobsAwaitingApproval", gearmanGetJobsAwaitingApproval) failMaxSleep = 30 failSleep = 1 failSleepIncrementor = 2 while True: try: gm_worker.work() except gearman.errors.ServerUnavailable as inst: #print >>sys.stderr, inst.args #print >>sys.stderr, "Retrying in %d seconds." % (failSleep) time.sleep(failSleep) if failSleep < failMaxSleep: failSleep += failSleepIncrementor
timeBeforeReturningErrorLockedDB = 4 timeToSleep = 0.1 numberOfRuns = 0 #count of number of runs in loop while not databaseInterface.sqlLock.acquire(False): time.sleep(timeToSleep) numberOfRuns += 1 if numberOfRuns * timeToSleep > timeBeforeReturningErrorLockedDB: return rpcError(code="DatabaseLock", details="Couldn't acquire database lock") databaseInterface.sqlLock.release() return None
identifier_body
RPCServer.py
#!/usr/bin/python -OO # This file is part of Archivematica. # # Copyright 2010-2013 Artefactual Systems Inc. <http://artefactual.com> # # Archivematica is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Archivematica is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Archivematica. If not, see <http://www.gnu.org/licenses/>. # @package Archivematica # @subpackage MCPServer # @author Joseph Perry <joseph@artefactual.com> import archivematicaMCP import sys
import gearman import cPickle import time import traceback from socket import gethostname sys.path.append("/usr/lib/archivematica/archivematicaCommon") from custom_handlers import GroupWriteRotatingFileHandler import databaseInterface def rpcError(code="", details=""): ret = etree.Element("Error") etree.SubElement(ret, "code").text = code.__str__() etree.SubElement(ret, "details").text = details.__str__() return ret def verifyDatabaseIsNotLocked(): timeBeforeReturningErrorLockedDB = 4 timeToSleep = 0.1 numberOfRuns = 0 #count of number of runs in loop while not databaseInterface.sqlLock.acquire(False): time.sleep(timeToSleep) numberOfRuns += 1 if numberOfRuns * timeToSleep > timeBeforeReturningErrorLockedDB: return rpcError(code="DatabaseLock", details="Couldn't acquire database lock") databaseInterface.sqlLock.release() return None def getJobsAwaitingApproval(): ret = etree.Element("choicesAvailableForUnits") dbStatus = verifyDatabaseIsNotLocked() if dbStatus: #print etree.tostring(dbStatus) return etree.tostring(dbStatus) for UUID, choice in choicesAvailableForUnits.items(): ret.append(choice.xmlify()) return etree.tostring(ret, pretty_print=True) def approveJob(jobUUID, chain, agent): print "approving: ", jobUUID, chain, agent if jobUUID in choicesAvailableForUnits: choicesAvailableForUnits[jobUUID].proceedWithChoice(chain, agent) return "approving: ", jobUUID, chain def gearmanApproveJob(gearman_worker, gearman_job): try: #execute = gearman_job.task data = cPickle.loads(gearman_job.data) jobUUID = data["jobUUID"] chain = data["chain"] agent = str(data["uid"]) ret = cPickle.dumps(approveJob(jobUUID, chain, agent)) if not ret: ret = "" return "" #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanApproveJob" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def gearmanGetJobsAwaitingApproval(gearman_worker, gearman_job): try: #print "DEBUG - getting list of jobs" #execute = gearman_job.task ret = cPickle.dumps(getJobsAwaitingApproval()) #print ret if not ret: ret = "" return ret #catch OS errors except Exception as inst: print >>sys.stderr, "DEBUG EXCEPTION! gearmanGetJobsAwaitingApproval" traceback.print_exc(file=sys.stdout) print >>sys.stderr, type(inst) # the exception instance print >>sys.stderr, inst.args return "" def startRPCServer(): logger = logging.getLogger("archivematica") logger.addHandler(GroupWriteRotatingFileHandler("/var/log/archivematica/MCPServer/MCPServer.log", maxBytes=4194304)) gm_worker = gearman.GearmanWorker([archivematicaMCP.config.get('MCPServer', 'GearmanServerWorker')]) hostID = gethostname() + "_MCPServer" gm_worker.set_client_id(hostID) gm_worker.register_task("approveJob", gearmanApproveJob) gm_worker.register_task("getJobsAwaitingApproval", gearmanGetJobsAwaitingApproval) failMaxSleep = 30 failSleep = 1 failSleepIncrementor = 2 while True: try: gm_worker.work() except gearman.errors.ServerUnavailable as inst: #print >>sys.stderr, inst.args #print >>sys.stderr, "Retrying in %d seconds." % (failSleep) time.sleep(failSleep) if failSleep < failMaxSleep: failSleep += failSleepIncrementor
from linkTaskManagerChoice import choicesAvailableForUnits import logging import lxml.etree as etree
random_line_split
feed.js
"use strict"; Object.defineProperty(exports, "__esModule", {
value: true }); var feed = exports.feed = { "viewBox": "0 0 16 16", "children": [{ "name": "path", "attribs": { "fill": "#000000", "d": "M6 8c0-1.105 0.895-2 2-2s2 0.895 2 2c0 1.105-0.895 2-2 2s-2-0.895-2-2zM10.38 3.602c1.56 0.846 2.62 2.498 2.62 4.398s-1.059 3.552-2.62 4.398c0.689-1.096 1.12-2.66 1.12-4.398s-0.431-3.302-1.12-4.398zM4.5 8c0 1.738 0.431 3.302 1.12 4.398-1.56-0.846-2.62-2.498-2.62-4.398s1.059-3.552 2.62-4.398c-0.689 1.096-1.12 2.66-1.12 4.398zM1.5 8c0 2.686 0.85 5.097 2.198 6.746-2.223-1.421-3.698-3.911-3.698-6.746s1.474-5.325 3.698-6.746c-1.348 1.649-2.198 4.060-2.198 6.746zM12.302 1.254c2.223 1.421 3.698 3.911 3.698 6.746s-1.474 5.325-3.698 6.746c1.348-1.649 2.198-4.060 2.198-6.746s-0.85-5.097-2.198-6.746z" } }] };
random_line_split
elfinder.ar.js
/** * Arabic translation (Syrian Localization, it may differ if you aren't from Syria or any Country in Middle East) * @author Tawfek Daghistani <tawfekov@gmail.com> * @version 2011-07-09 */ if (elFinder && elFinder.prototype && typeof(elFinder.prototype.i18) == 'object') { elFinder.prototype.i18.ar = { translator : 'Tawfek Daghistani &lt;tawfekov@gmail.com&gt;', language : 'العربية', direction : 'rtl', messages : { /********************************** errors **********************************/ 'error' : 'خطأ', 'errUnknown' : 'خطأ غير معروف .', 'errUnknownCmd' : 'أمر غير معروف .', 'errJqui' : 'إعدادات jQuery UI غير كاملة الرجاء التأكد من وجود كل من selectable, draggable and droppable', 'errNode' : '. موجود DOM إلى عنصر elFinder تحتاج ', 'errURL' : 'إعدادات خاطئة , عليك وضع الرابط ضمن الإعدادات', 'errAccess' : 'وصول مرفوض .', 'errConnect' : 'غير قادر على الاتصال بالخادم الخلفي (backend)', 'errAbort' : 'تم فصل الإتصال', 'errTimeout' : 'مهلة الإتصال قد إنتهت .', 'errNotFound' : 'الخادم الخلفي غير موجود .', 'errResponse' : 'رد غير مقبول من الخادم الخلفي', 'errConf' : 'خطأ في الإعدادات الخاصة بالخادم الخلفي ', 'errJSON' : 'الميزة PHP JSON module غير موجودة ', 'errNoVolumes' : 'لا يمكن القراءة من أي من الوسائط الموجودة ', 'errCmdParams' : 'البيانات المرسلة للأمر غير مقبولة "$1".', 'errDataNotJSON' : 'المعلومات المرسلة ليست من نوع JSON ', 'errDataEmpty' : 'لا يوجد معلومات مرسلة', 'errCmdReq' : 'الخادم الخلفي يطلب وجود اسم الأمر ', 'errOpen' : 'غير قادر على فتح "$1".', 'errNotFolder' : 'العنصر المختار ليس مجلد', 'errNotFile' : 'العنصر المختار ليس ملف', 'errRead' : 'غير قادر على القراءة "$1".', 'errWrite' : 'غير قادر على الكتابة "$1".', 'errPerm' : 'وصول مرفوض ', 'errLocked' : ' محمي و لا يمكن التعديل أو النقل أو إعادة التسمية"$1"', 'errExists' : ' موجود مسبقاً "$1"', 'errInvName' : 'الاسم مرفوض', 'errFolderNotFound' : 'المجلد غير موجود', 'errFileNotFound' : 'الملف غير موجود', 'errTrgFolderNotFound' : 'الملف الهدف "$1" غير موجود ', 'errPopup' : 'يمنعني المتصفح من إنشاء نافذة منبثقة , الرجاء تعديل الخيارات الخاصة من إعدادات المتصفح ', 'errMkdir' : ' غير قادر على إنشاء مجلد جديد "$1".', 'errMkfile' : ' غير قادر على إنشاء ملف جديد"$1".', 'errRename' : 'غير قادر على إعادة تسمية ال "$1".', 'errCopyFrom' : 'نسخ الملفات من الوسط المحدد "$1"غير مسموح.', 'errCopyTo' : 'نسخ الملفات إلى الوسط المحدد "$1" غير مسموح .', 'errUploadCommon' : 'خطأ أثناء عملية الرفع', 'errUpload' : 'غير قادر على رفع "$1".', 'errUploadNoFiles' : 'لم يتم رفع أي ملف ', 'errMaxSize' : 'حجم البيانات أكبر من الحجم المسموح به ', 'errFileMaxSize' : 'حجم الملف أكبر من الحجم المسموح به', 'errUploadMime' : 'نوع ملف غير مسموح ', 'errUploadTransfer' : '"$1" خطأ أثناء عملية النقل', 'errSave' : 'غير قادر على الحفظ في "$1".', 'errCopy' : 'غير قادر على النسخ إلى"$1".', 'errMove' : 'غير قادر على القص إلى "$1".', 'errCopyInItself' : 'غير قادر على نسخ الملف "$1" ضمن الملف نفسه.', 'errRm' : 'غير قادر على الحذف "$1".', 'errExtract' : 'غير قادر على استخراج الملفات من "$1".', 'errArchive' : 'غير قادر على إنشاء ملف مضغوط', 'errArcType' : 'نوع الملف المضغوط غير مدعومة', 'errNoArchive' : 'هذا الملف ليس ملف مضغوط أو ذو صسغة غير مدعومة ', 'errCmdNoSupport' : 'الخادم الخلفي لا يدعم هذا الأمر ', 'errReplByChild' : 'The folder “$1” can’t be replaced by an item it contains.', 'errArcSymlinks' : 'For security reason denied to unpack archives contains symlinks.',
/******************************* commands names ********************************/ 'cmdarchive' : 'أنشئ مجلد مضغوط', 'cmdback' : 'الخلف', 'cmdcopy' : 'نسخ', 'cmdcut' : 'قص', 'cmddownload' : 'تحميل', 'cmdduplicate' : 'تكرار', 'cmdedit' : 'تعديل الملف', 'cmdextract' : 'استخراج الملفات', 'cmdforward' : 'الأمام', 'cmdgetfile' : 'أختيار الملفات', 'cmdhelp' : 'عن هذا المشروع', 'cmdhome' : 'المجلد الرئيسي', 'cmdinfo' : 'معلومات ', 'cmdmkdir' : 'مجلد جديد', 'cmdmkfile' : 'ملف نصي جديد', 'cmdopen' : 'فتح', 'cmdpaste' : 'لصق', 'cmdquicklook' : 'معاينة', 'cmdreload' : 'إعادة تحميل', 'cmdrename' : 'إعادة تسمية', 'cmdrm' : 'حذف', 'cmdsearch' : 'بحث عن ملفات', 'cmdup' : 'تغيير المسار إلى مستوى أعلى', 'cmdupload' : 'رفع ملفات', 'cmdview' : 'عرض', /*********************************** buttons ***********************************/ 'btnClose' : 'إغلاق', 'btnSave' : 'حفظ', 'btnRm' : 'إزالة', 'btnCancel' : 'إلغاء', 'btnNo' : 'لا', 'btnYes' : 'نعم', /******************************** notifications ********************************/ 'ntfopen' : 'فتح مجلد', 'ntffile' : 'فتح ملف', 'ntfreload' : 'إعادة عرض محتويات المجلد ', 'ntfmkdir' : 'ينشئ المجلدات', 'ntfmkfile' : 'ينشئ الملفات', 'ntfrm' : 'حذف الملفات', 'ntfcopy' : 'نسخ الملفات', 'ntfmove' : 'نقل الملفات', 'ntfprepare' : 'تحضير لنسخ الملفات', 'ntfrename' : 'إعادة تسمية الملفات', 'ntfupload' : 'رفع الملفات', 'ntfdownload' : 'تحميل الملفات', 'ntfsave' : 'حفظ الملفات', 'ntfarchive' : 'ينشئ ملف مضغوط', 'ntfextract' : 'استخراج ملفات من الملف المضغوط ', 'ntfsearch' : 'يبحث عن ملفات', 'ntfsmth' : 'يحضر لشيء ما >_<', /************************************ dates **********************************/ 'dateUnknown' : 'غير معلوم', 'Today' : 'اليوم', 'Yesterday' : 'البارحة', 'Jan' : 'كانون الثاني', 'Feb' : 'شباط', 'Mar' : 'آذار', 'Apr' : 'نيسان', 'May' : 'أيار', 'Jun' : 'حزيران', 'Jul' : 'تموز', 'Aug' : 'آب', 'Sep' : 'أيلول', 'Oct' : 'تشرين الأول', 'Nov' : 'تشرين الثاني', 'Dec' : 'كانون الأول ', /********************************** messages **********************************/ 'confirmReq' : 'يرجى التأكيد', 'confirmRm' : 'هل انت متأكد من انك تريد الحذف<br/>لا يمكن التراجع عن هذه العملية ', 'confirmRepl' : 'استبدال الملف القديم بملف جديد ؟', 'apllyAll' : 'تطبيق على الكل', 'name' : 'الأسم', 'size' : 'الحجم', 'perms' : 'الصلاحيات', 'modify' : 'أخر تعديل', 'kind' : 'نوع الملف', 'read' : 'قراءة', 'write' : 'كتابة', 'noaccess' : 'وصول ممنوع', 'and' : 'و', 'unknown' : 'غير معروف', 'selectall' : 'تحديد كل الملفات', 'selectfiles' : 'تحديد ملفات', 'selectffile' : 'تحديد الملف الاول', 'selectlfile' : 'تحديد الملف الأخير', 'viewlist' : 'اعرض ك قائمة', 'viewicons' : 'اعرض ك ايقونات', 'places' : 'المواقع', 'calc' : 'حساب', 'path' : 'مسار', 'aliasfor' : 'Alias for', 'locked' : 'مقفول', 'dim' : 'الابعاد', 'files' : 'ملفات', 'folders' : 'مجلدات', 'items' : 'عناصر', 'yes' : 'نعم', 'no' : 'لا', 'link' : 'اربتاط', 'searcresult' : 'نتائج البحث', 'selected' : 'العناصر المحددة', 'about' : 'عن البرنامج', 'shortcuts' : 'الاختصارات', 'help' : 'مساعدة', 'webfm' : 'مدير ملفات الويب', 'ver' : 'رقم الإصدار', 'protocol' : 'اصدار البرتوكول', 'homepage' : 'الصفحة الرئيسية', 'docs' : 'التعليمات', 'github' : 'شاركنا بتطوير المشروع على Github', 'twitter' : 'تابعنا على تويتر', 'facebook' : 'انضم إلينا على الفيس بوك', 'team' : 'الفريق', 'chiefdev' : 'رئيس المبرمجين', 'developer' : 'مبرمح', 'contributor' : 'مبرمح', 'maintainer' : 'مشارك', 'translator' : 'مترجم', 'icons' : 'أيقونات', 'dontforget' : 'and don\'t forget to take your towel', 'shortcutsof' : 'الاختصارات غير مفعلة', 'dropFiles' : 'لصق الملفات هنا', 'or' : 'أو', 'selectForUpload' : 'اختر الملفات التي تريد رفعها', 'moveFiles' : 'قص الملفات', 'copyFiles' : 'نسخ الملفات', 'rmFromPlaces' : 'Remove from places', 'untitled folder' : 'untitled folder', 'untitled file.txt' : 'untitled file.txt', /********************************** mimetypes **********************************/ 'kindUnknown' : 'غير معروف', 'kindFolder' : 'مجلد', 'kindAlias' : 'اختصار', 'kindAliasBroken' : 'اختصار غير صالح', // applications 'kindApp' : 'برنامج', 'kindPostscript' : 'Postscript ملف', 'kindMsOffice' : 'Microsoft Office ملف', 'kindMsWord' : 'Microsoft Word ملف', 'kindMsExcel' : 'Microsoft Excel ملف', 'kindMsPP' : 'Microsoft Powerpoint عرض تقديمي ', 'kindOO' : 'Open Office ملف', 'kindAppFlash' : 'تطبيق فلاش', 'kindPDF' : 'ملف (PDF)', 'kindTorrent' : 'Bittorrent ملف', 'kind7z' : '7z ملف', 'kindTAR' : 'TAR ملف', 'kindGZIP' : 'GZIP ملف', 'kindBZIP' : 'BZIP ملف', 'kindZIP' : 'ZIP ملف', 'kindRAR' : 'RAR ملف', 'kindJAR' : 'Java JAR ملف', 'kindTTF' : 'True Type خط ', 'kindOTF' : 'Open Type خط ', 'kindRPM' : 'RPM ملف تنصيب', // texts 'kindText' : 'Text ملف', 'kindTextPlain' : 'مستند نصي', 'kindPHP' : 'PHP ملف نصي برمجي لـ', 'kindCSS' : 'Cascading style sheet', 'kindHTML' : 'HTML ملف', 'kindJS' : 'Javascript ملف نصي برمجي لـ', 'kindRTF' : 'Rich Text Format', 'kindC' : 'C ملف نصي برمجي لـ', 'kindCHeader' : 'C header ملف نصي برمجي لـ', 'kindCPP' : 'C++ ملف نصي برمجي لـ', 'kindCPPHeader' : 'C++ header ملف نصي برمجي لـ', 'kindShell' : 'Unix shell script', 'kindPython' : 'Python ملف نصي برمجي لـ', 'kindJava' : 'Java ملف نصي برمجي لـ', 'kindRuby' : 'Ruby ملف نصي برمجي لـ', 'kindPerl' : 'Perl script', 'kindSQL' : 'SQL ملف نصي برمجي لـ', 'kindXML' : 'XML ملف', 'kindAWK' : 'AWK ملف نصي برمجي لـ', 'kindCSV' : 'ملف CSV', 'kindDOCBOOK' : 'Docbook XML ملف', // images 'kindصورة' : 'صورة', 'kindBMP' : 'BMP صورة', 'kindJPEG' : 'JPEG صورة', 'kindGIF' : 'GIF صورة', 'kindPNG' : 'PNG صورة', 'kindTIFF' : 'TIFF صورة', 'kindTGA' : 'TGA صورة', 'kindPSD' : 'Adobe Photoshop صورة', 'kindXBITMAP' : 'X bitmap صورة', 'kindPXM' : 'Pixelmator صورة', // media 'kindAudio' : 'ملف صوتي', 'kindAudioMPEG' : 'MPEG ملف صوتي', 'kindAudioMPEG4' : 'MPEG-4 ملف صوتي', 'kindAudioMIDI' : 'MIDI ملف صوتي', 'kindAudioOGG' : 'Ogg Vorbis ملف صوتي', 'kindAudioWAV' : 'WAV ملف صوتي', 'AudioPlaylist' : 'MP3 قائمة تشغيل', 'kindVideo' : 'ملف فيديو', 'kindVideoDV' : 'DV ملف فيديو', 'kindVideoMPEG' : 'MPEG ملف فيديو', 'kindVideoMPEG4' : 'MPEG-4 ملف فيديو', 'kindVideoAVI' : 'AVI ملف فيديو', 'kindVideoMOV' : 'Quick Time ملف فيديو', 'kindVideoWM' : 'Windows Media ملف فيديو', 'kindVideoFlash' : 'Flash ملف فيديو', 'kindVideoMKV' : 'Matroska ملف فيديو', 'kindVideoOGG' : 'Ogg ملف فيديو' } } }
'errArcMaxSize' : 'Archive files exceeds maximum allowed size.',
random_line_split
elfinder.ar.js
/** * Arabic translation (Syrian Localization, it may differ if you aren't from Syria or any Country in Middle East) * @author Tawfek Daghistani <tawfekov@gmail.com> * @version 2011-07-09 */ if (elFinder && elFinder.prototype && typeof(elFinder.prototype.i18) == 'object')
{ elFinder.prototype.i18.ar = { translator : 'Tawfek Daghistani &lt;tawfekov@gmail.com&gt;', language : 'العربية', direction : 'rtl', messages : { /********************************** errors **********************************/ 'error' : 'خطأ', 'errUnknown' : 'خطأ غير معروف .', 'errUnknownCmd' : 'أمر غير معروف .', 'errJqui' : 'إعدادات jQuery UI غير كاملة الرجاء التأكد من وجود كل من selectable, draggable and droppable', 'errNode' : '. موجود DOM إلى عنصر elFinder تحتاج ', 'errURL' : 'إعدادات خاطئة , عليك وضع الرابط ضمن الإعدادات', 'errAccess' : 'وصول مرفوض .', 'errConnect' : 'غير قادر على الاتصال بالخادم الخلفي (backend)', 'errAbort' : 'تم فصل الإتصال', 'errTimeout' : 'مهلة الإتصال قد إنتهت .', 'errNotFound' : 'الخادم الخلفي غير موجود .', 'errResponse' : 'رد غير مقبول من الخادم الخلفي', 'errConf' : 'خطأ في الإعدادات الخاصة بالخادم الخلفي ', 'errJSON' : 'الميزة PHP JSON module غير موجودة ', 'errNoVolumes' : 'لا يمكن القراءة من أي من الوسائط الموجودة ', 'errCmdParams' : 'البيانات المرسلة للأمر غير مقبولة "$1".', 'errDataNotJSON' : 'المعلومات المرسلة ليست من نوع JSON ', 'errDataEmpty' : 'لا يوجد معلومات مرسلة', 'errCmdReq' : 'الخادم الخلفي يطلب وجود اسم الأمر ', 'errOpen' : 'غير قادر على فتح "$1".', 'errNotFolder' : 'العنصر المختار ليس مجلد', 'errNotFile' : 'العنصر المختار ليس ملف', 'errRead' : 'غير قادر على القراءة "$1".', 'errWrite' : 'غير قادر على الكتابة "$1".', 'errPerm' : 'وصول مرفوض ', 'errLocked' : ' محمي و لا يمكن التعديل أو النقل أو إعادة التسمية"$1"', 'errExists' : ' موجود مسبقاً "$1"', 'errInvName' : 'الاسم مرفوض', 'errFolderNotFound' : 'المجلد غير موجود', 'errFileNotFound' : 'الملف غير موجود', 'errTrgFolderNotFound' : 'الملف الهدف "$1" غير موجود ', 'errPopup' : 'يمنعني المتصفح من إنشاء نافذة منبثقة , الرجاء تعديل الخيارات الخاصة من إعدادات المتصفح ', 'errMkdir' : ' غير قادر على إنشاء مجلد جديد "$1".', 'errMkfile' : ' غير قادر على إنشاء ملف جديد"$1".', 'errRename' : 'غير قادر على إعادة تسمية ال "$1".', 'errCopyFrom' : 'نسخ الملفات من الوسط المحدد "$1"غير مسموح.', 'errCopyTo' : 'نسخ الملفات إلى الوسط المحدد "$1" غير مسموح .', 'errUploadCommon' : 'خطأ أثناء عملية الرفع', 'errUpload' : 'غير قادر على رفع "$1".', 'errUploadNoFiles' : 'لم يتم رفع أي ملف ', 'errMaxSize' : 'حجم البيانات أكبر من الحجم المسموح به ', 'errFileMaxSize' : 'حجم الملف أكبر من الحجم المسموح به', 'errUploadMime' : 'نوع ملف غير مسموح ', 'errUploadTransfer' : '"$1" خطأ أثناء عملية النقل', 'errSave' : 'غير قادر على الحفظ في "$1".', 'errCopy' : 'غير قادر على النسخ إلى"$1".', 'errMove' : 'غير قادر على القص إلى "$1".', 'errCopyInItself' : 'غير قادر على نسخ الملف "$1" ضمن الملف نفسه.', 'errRm' : 'غير قادر على الحذف "$1".', 'errExtract' : 'غير قادر على استخراج الملفات من "$1".', 'errArchive' : 'غير قادر على إنشاء ملف مضغوط', 'errArcType' : 'نوع الملف المضغوط غير مدعومة', 'errNoArchive' : 'هذا الملف ليس ملف مضغوط أو ذو صسغة غير مدعومة ', 'errCmdNoSupport' : 'الخادم الخلفي لا يدعم هذا الأمر ', 'errReplByChild' : 'The folder “$1” can’t be replaced by an item it contains.', 'errArcSymlinks' : 'For security reason denied to unpack archives contains symlinks.', 'errArcMaxSize' : 'Archive files exceeds maximum allowed size.', /******************************* commands names ********************************/ 'cmdarchive' : 'أنشئ مجلد مضغوط', 'cmdback' : 'الخلف', 'cmdcopy' : 'نسخ', 'cmdcut' : 'قص', 'cmddownload' : 'تحميل', 'cmdduplicate' : 'تكرار', 'cmdedit' : 'تعديل الملف', 'cmdextract' : 'استخراج الملفات', 'cmdforward' : 'الأمام', 'cmdgetfile' : 'أختيار الملفات', 'cmdhelp' : 'عن هذا المشروع', 'cmdhome' : 'المجلد الرئيسي', 'cmdinfo' : 'معلومات ', 'cmdmkdir' : 'مجلد جديد', 'cmdmkfile' : 'ملف نصي جديد', 'cmdopen' : 'فتح', 'cmdpaste' : 'لصق', 'cmdquicklook' : 'معاينة', 'cmdreload' : 'إعادة تحميل', 'cmdrename' : 'إعادة تسمية', 'cmdrm' : 'حذف', 'cmdsearch' : 'بحث عن ملفات', 'cmdup' : 'تغيير المسار إلى مستوى أعلى', 'cmdupload' : 'رفع ملفات', 'cmdview' : 'عرض', /*********************************** buttons ***********************************/ 'btnClose' : 'إغلاق', 'btnSave' : 'حفظ', 'btnRm' : 'إزالة', 'btnCancel' : 'إلغاء', 'btnNo' : 'لا', 'btnYes' : 'نعم', /******************************** notifications ********************************/ 'ntfopen' : 'فتح مجلد', 'ntffile' : 'فتح ملف', 'ntfreload' : 'إعادة عرض محتويات المجلد ', 'ntfmkdir' : 'ينشئ المجلدات', 'ntfmkfile' : 'ينشئ الملفات', 'ntfrm' : 'حذف الملفات', 'ntfcopy' : 'نسخ الملفات', 'ntfmove' : 'نقل الملفات', 'ntfprepare' : 'تحضير لنسخ الملفات', 'ntfrename' : 'إعادة تسمية الملفات', 'ntfupload' : 'رفع الملفات', 'ntfdownload' : 'تحميل الملفات', 'ntfsave' : 'حفظ الملفات', 'ntfarchive' : 'ينشئ ملف مضغوط', 'ntfextract' : 'استخراج ملفات من الملف المضغوط ', 'ntfsearch' : 'يبحث عن ملفات', 'ntfsmth' : 'يحضر لشيء ما >_<', /************************************ dates **********************************/ 'dateUnknown' : 'غير معلوم', 'Today' : 'اليوم', 'Yesterday' : 'البارحة', 'Jan' : 'كانون الثاني', 'Feb' : 'شباط', 'Mar' : 'آذار', 'Apr' : 'نيسان', 'May' : 'أيار', 'Jun' : 'حزيران', 'Jul' : 'تموز', 'Aug' : 'آب', 'Sep' : 'أيلول', 'Oct' : 'تشرين الأول', 'Nov' : 'تشرين الثاني', 'Dec' : 'كانون الأول ', /********************************** messages **********************************/ 'confirmReq' : 'يرجى التأكيد', 'confirmRm' : 'هل انت متأكد من انك تريد الحذف<br/>لا يمكن التراجع عن هذه العملية ', 'confirmRepl' : 'استبدال الملف القديم بملف جديد ؟', 'apllyAll' : 'تطبيق على الكل', 'name' : 'الأسم', 'size' : 'الحجم', 'perms' : 'الصلاحيات', 'modify' : 'أخر تعديل', 'kind' : 'نوع الملف', 'read' : 'قراءة', 'write' : 'كتابة', 'noaccess' : 'وصول ممنوع', 'and' : 'و', 'unknown' : 'غير معروف', 'selectall' : 'تحديد كل الملفات', 'selectfiles' : 'تحديد ملفات', 'selectffile' : 'تحديد الملف الاول', 'selectlfile' : 'تحديد الملف الأخير', 'viewlist' : 'اعرض ك قائمة', 'viewicons' : 'اعرض ك ايقونات', 'places' : 'المواقع', 'calc' : 'حساب', 'path' : 'مسار', 'aliasfor' : 'Alias for', 'locked' : 'مقفول', 'dim' : 'الابعاد', 'files' : 'ملفات', 'folders' : 'مجلدات', 'items' : 'عناصر', 'yes' : 'نعم', 'no' : 'لا', 'link' : 'اربتاط', 'searcresult' : 'نتائج البحث', 'selected' : 'العناصر المحددة', 'about' : 'عن البرنامج', 'shortcuts' : 'الاختصارات', 'help' : 'مساعدة', 'webfm' : 'مدير ملفات الويب', 'ver' : 'رقم الإصدار', 'protocol' : 'اصدار البرتوكول', 'homepage' : 'الصفحة الرئيسية', 'docs' : 'التعليمات', 'github' : 'شاركنا بتطوير المشروع على Github', 'twitter' : 'تابعنا على تويتر', 'facebook' : 'انضم إلينا على الفيس بوك', 'team' : 'الفريق', 'chiefdev' : 'رئيس المبرمجين', 'developer' : 'مبرمح', 'contributor' : 'مبرمح', 'maintainer' : 'مشارك', 'translator' : 'مترجم', 'icons' : 'أيقونات', 'dontforget' : 'and don\'t forget to take your towel', 'shortcutsof' : 'الاختصارات غير مفعلة', 'dropFiles' : 'لصق الملفات هنا', 'or' : 'أو', 'selectForUpload' : 'اختر الملفات التي تريد رفعها', 'moveFiles' : 'قص الملفات', 'copyFiles' : 'نسخ الملفات', 'rmFromPlaces' : 'Remove from places', 'untitled folder' : 'untitled folder', 'untitled file.txt' : 'untitled file.txt', /********************************** mimetypes **********************************/ 'kindUnknown' : 'غير معروف', 'kindFolder' : 'مجلد', 'kindAlias' : 'اختصار', 'kindAliasBroken' : 'اختصار غير صالح', // applications 'kindApp' : 'برنامج', 'kindPostscript' : 'Postscript ملف', 'kindMsOffice' : 'Microsoft Office ملف', 'kindMsWord' : 'Microsoft Word ملف', 'kindMsExcel' : 'Microsoft Excel ملف', 'kindMsPP' : 'Microsoft Powerpoint عرض تقديمي ', 'kindOO' : 'Open Office ملف', 'kindAppFlash' : 'تطبيق فلاش', 'kindPDF' : 'ملف (PDF)', 'kindTorrent' : 'Bittorrent ملف', 'kind7z' : '7z ملف', 'kindTAR' : 'TAR ملف', 'kindGZIP' : 'GZIP ملف', 'kindBZIP' : 'BZIP ملف', 'kindZIP' : 'ZIP ملف', 'kindRAR' : 'RAR ملف', 'kindJAR' : 'Java JAR ملف', 'kindTTF' : 'True Type خط ', 'kindOTF' : 'Open Type خط ', 'kindRPM' : 'RPM ملف تنصيب', // texts 'kindText' : 'Text ملف', 'kindTextPlain' : 'مستند نصي', 'kindPHP' : 'PHP ملف نصي برمجي لـ', 'kindCSS' : 'Cascading style sheet', 'kindHTML' : 'HTML ملف', 'kindJS' : 'Javascript ملف نصي برمجي لـ', 'kindRTF' : 'Rich Text Format', 'kindC' : 'C ملف نصي برمجي لـ', 'kindCHeader' : 'C header ملف نصي برمجي لـ', 'kindCPP' : 'C++ ملف نصي برمجي لـ', 'kindCPPHeader' : 'C++ header ملف نصي برمجي لـ', 'kindShell' : 'Unix shell script', 'kindPython' : 'Python ملف نصي برمجي لـ', 'kindJava' : 'Java ملف نصي برمجي لـ', 'kindRuby' : 'Ruby ملف نصي برمجي لـ', 'kindPerl' : 'Perl script', 'kindSQL' : 'SQL ملف نصي برمجي لـ', 'kindXML' : 'XML ملف', 'kindAWK' : 'AWK ملف نصي برمجي لـ', 'kindCSV' : 'ملف CSV', 'kindDOCBOOK' : 'Docbook XML ملف', // images 'kindصورة' : 'صورة', 'kindBMP' : 'BMP صورة', 'kindJPEG' : 'JPEG صورة', 'kindGIF' : 'GIF صورة', 'kindPNG' : 'PNG صورة', 'kindTIFF' : 'TIFF صورة', 'kindTGA' : 'TGA صورة', 'kindPSD' : 'Adobe Photoshop صورة', 'kindXBITMAP' : 'X bitmap صورة', 'kindPXM' : 'Pixelmator صورة', // media 'kindAudio' : 'ملف صوتي', 'kindAudioMPEG' : 'MPEG ملف صوتي', 'kindAudioMPEG4' : 'MPEG-4 ملف صوتي', 'kindAudioMIDI' : 'MIDI ملف صوتي', 'kindAudioOGG' : 'Ogg Vorbis ملف صوتي', 'kindAudioWAV' : 'WAV ملف صوتي', 'AudioPlaylist' : 'MP3 قائمة تشغيل', 'kindVideo' : 'ملف فيديو', 'kindVideoDV' : 'DV ملف فيديو', 'kindVideoMPEG' : 'MPEG ملف فيديو', 'kindVideoMPEG4' : 'MPEG-4 ملف فيديو', 'kindVideoAVI' : 'AVI ملف فيديو', 'kindVideoMOV' : 'Quick Time ملف فيديو', 'kindVideoWM' : 'Windows Media ملف فيديو', 'kindVideoFlash' : 'Flash ملف فيديو', 'kindVideoMKV' : 'Matroska ملف فيديو', 'kindVideoOGG' : 'Ogg ملف فيديو' } } }
conditional_block
_project_cfg_importer.py
""" Project Configuration Importer Handles the importing the project configuration from a separate location and validates the version against the specified expected version. NOTE: If you update this file or any others in scripts and require a NEW variable in project_cfg, then you need to UPDATE THE EXPECTED_CFG_VERSION That way, if someone tries to use the new scripts with an old cfg, they'll get a warning. """ import importlib import os import sys PROJECT_CFG_DIR = os.path.realpath(os.path.dirname(__file__) + "/../../cfg/") PROJECT_CFG_NAME = "project_cfg" EXPECTED_CFG_VERSION = 1.1 def get_project_cfg(): """ Returns the project configuration module """ sys.path.append(PROJECT_CFG_DIR) try: project_cfg_module = importlib.import_module(PROJECT_CFG_NAME) except: raise FileNotFoundError("\n\n================================= ERROR ========================================" "\nUnable to import project configuration: " + PROJECT_CFG_DIR + "/" + PROJECT_CFG_NAME + ".py" "\n================================================================================\n") _verify_correct_version(project_cfg_module) return project_cfg_module def
(project_cfg_module): is_correct_version = False if project_cfg_module.__CFG_VERSION__ == EXPECTED_CFG_VERSION: is_correct_version = True else: raise Exception("\n\n================================= ERROR ========================================" "\nIncorrect project configuration version: " + str(project_cfg_module.__CFG_VERSION__) + "\n Development environment expected: " + str(EXPECTED_CFG_VERSION) + "\n================================================================================\n") return is_correct_version
_verify_correct_version
identifier_name
_project_cfg_importer.py
""" Project Configuration Importer Handles the importing the project configuration from a separate location and validates the version against the specified expected version. NOTE: If you update this file or any others in scripts and require a NEW variable in project_cfg, then you need to UPDATE THE EXPECTED_CFG_VERSION That way, if someone tries to use the new scripts with an old cfg, they'll get a warning. """ import importlib import os import sys PROJECT_CFG_DIR = os.path.realpath(os.path.dirname(__file__) + "/../../cfg/") PROJECT_CFG_NAME = "project_cfg" EXPECTED_CFG_VERSION = 1.1 def get_project_cfg(): """ Returns the project configuration module """ sys.path.append(PROJECT_CFG_DIR) try: project_cfg_module = importlib.import_module(PROJECT_CFG_NAME) except: raise FileNotFoundError("\n\n================================= ERROR ========================================" "\nUnable to import project configuration: " + PROJECT_CFG_DIR + "/" + PROJECT_CFG_NAME + ".py" "\n================================================================================\n") _verify_correct_version(project_cfg_module) return project_cfg_module def _verify_correct_version(project_cfg_module):
is_correct_version = False if project_cfg_module.__CFG_VERSION__ == EXPECTED_CFG_VERSION: is_correct_version = True else: raise Exception("\n\n================================= ERROR ========================================" "\nIncorrect project configuration version: " + str(project_cfg_module.__CFG_VERSION__) + "\n Development environment expected: " + str(EXPECTED_CFG_VERSION) + "\n================================================================================\n") return is_correct_version
identifier_body
_project_cfg_importer.py
""" Project Configuration Importer Handles the importing the project configuration from a separate location and validates the version against the specified expected version. NOTE: If you update this file or any others in scripts and require a NEW variable in project_cfg, then you need to UPDATE THE EXPECTED_CFG_VERSION That way, if someone tries to use the new scripts with an old cfg, they'll get a warning. """ import importlib import os import sys PROJECT_CFG_DIR = os.path.realpath(os.path.dirname(__file__) + "/../../cfg/") PROJECT_CFG_NAME = "project_cfg" EXPECTED_CFG_VERSION = 1.1
""" sys.path.append(PROJECT_CFG_DIR) try: project_cfg_module = importlib.import_module(PROJECT_CFG_NAME) except: raise FileNotFoundError("\n\n================================= ERROR ========================================" "\nUnable to import project configuration: " + PROJECT_CFG_DIR + "/" + PROJECT_CFG_NAME + ".py" "\n================================================================================\n") _verify_correct_version(project_cfg_module) return project_cfg_module def _verify_correct_version(project_cfg_module): is_correct_version = False if project_cfg_module.__CFG_VERSION__ == EXPECTED_CFG_VERSION: is_correct_version = True else: raise Exception("\n\n================================= ERROR ========================================" "\nIncorrect project configuration version: " + str(project_cfg_module.__CFG_VERSION__) + "\n Development environment expected: " + str(EXPECTED_CFG_VERSION) + "\n================================================================================\n") return is_correct_version
def get_project_cfg(): """ Returns the project configuration module
random_line_split
_project_cfg_importer.py
""" Project Configuration Importer Handles the importing the project configuration from a separate location and validates the version against the specified expected version. NOTE: If you update this file or any others in scripts and require a NEW variable in project_cfg, then you need to UPDATE THE EXPECTED_CFG_VERSION That way, if someone tries to use the new scripts with an old cfg, they'll get a warning. """ import importlib import os import sys PROJECT_CFG_DIR = os.path.realpath(os.path.dirname(__file__) + "/../../cfg/") PROJECT_CFG_NAME = "project_cfg" EXPECTED_CFG_VERSION = 1.1 def get_project_cfg(): """ Returns the project configuration module """ sys.path.append(PROJECT_CFG_DIR) try: project_cfg_module = importlib.import_module(PROJECT_CFG_NAME) except: raise FileNotFoundError("\n\n================================= ERROR ========================================" "\nUnable to import project configuration: " + PROJECT_CFG_DIR + "/" + PROJECT_CFG_NAME + ".py" "\n================================================================================\n") _verify_correct_version(project_cfg_module) return project_cfg_module def _verify_correct_version(project_cfg_module): is_correct_version = False if project_cfg_module.__CFG_VERSION__ == EXPECTED_CFG_VERSION: is_correct_version = True else:
return is_correct_version
raise Exception("\n\n================================= ERROR ========================================" "\nIncorrect project configuration version: " + str(project_cfg_module.__CFG_VERSION__) + "\n Development environment expected: " + str(EXPECTED_CFG_VERSION) + "\n================================================================================\n")
conditional_block
ogbg_molpcba.py
# coding=utf-8 # Copyright 2022 The init2winit Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Input pipeline for the ogbg_molpcba graph dataset from TFDS. See https://www.tensorflow.org/datasets/catalog/ogbg_molpcba and https://ogb.stanford.edu/docs/graphprop/ for more details. """ import itertools from init2winit.dataset_lib import data_utils from init2winit.dataset_lib.data_utils import Dataset import jax import jraph from ml_collections.config_dict import config_dict import numpy as np import tensorflow_datasets as tfds AVG_NODES_PER_GRAPH = 26 AVG_EDGES_PER_GRAPH = 56 DEFAULT_HPARAMS = config_dict.ConfigDict( dict( output_shape=(128,), input_edge_shape=(3,), input_node_shape=(9,), train_size=350343, valid_size=43793, test_size=43793, # Max edges/nodes per batch will batch_size times the multiplier. # We set them to the average size of the graph in the dataset, # so that each batch contains batch_size graphs on average. max_edges_multiplier=AVG_EDGES_PER_GRAPH, max_nodes_multiplier=AVG_NODES_PER_GRAPH, )) METADATA = { 'apply_one_hot_in_loss': False, } def _load_dataset(split, should_shuffle=False, shuffle_seed=None, shuffle_buffer_size=None): """Loads a dataset split from TFDS.""" if should_shuffle: assert shuffle_seed is not None and shuffle_buffer_size is not None file_shuffle_seed, dataset_shuffle_seed = jax.random.split(shuffle_seed) file_shuffle_seed = file_shuffle_seed[0] dataset_shuffle_seed = dataset_shuffle_seed[0] else: file_shuffle_seed = None dataset_shuffle_seed = None read_config = tfds.ReadConfig( add_tfds_id=True, shuffle_seed=file_shuffle_seed) dataset = tfds.load( 'ogbg_molpcba', split=split, shuffle_files=should_shuffle, read_config=read_config) if should_shuffle: dataset = dataset.shuffle( seed=dataset_shuffle_seed, buffer_size=shuffle_buffer_size) dataset = dataset.repeat() return dataset def _to_jraph(example): """Converts an example graph to jraph.GraphsTuple.""" example = data_utils.tf_to_numpy(example) edge_feat = example['edge_feat'] node_feat = example['node_feat'] edge_index = example['edge_index'] labels = example['labels'] num_nodes = example['num_nodes'] senders = edge_index[:, 0] receivers = edge_index[:, 1] return jraph.GraphsTuple( n_node=num_nodes, n_edge=np.array([len(edge_index) * 2]), nodes=node_feat, edges=np.concatenate([edge_feat, edge_feat]), # Make the edges bidirectional senders=np.concatenate([senders, receivers]), receivers=np.concatenate([receivers, senders]), # Keep the labels with the graph for batching. They will be removed # in the processed batch. globals=np.expand_dims(labels, axis=0)) def _get_weights_by_nan_and_padding(labels, padding_mask): """Handles NaNs and padding in labels. Sets all the weights from examples coming from padding to 0. Changes all NaNs in labels to 0s and sets the corresponding per-label weight to 0. Args: labels: Labels including labels from padded examples padding_mask: Binary array of which examples are padding Returns: tuple of (processed labels, corresponding weights) """ nan_mask = np.isnan(labels) replaced_labels = np.copy(labels) np.place(replaced_labels, nan_mask, 0) weights = 1.0 - nan_mask # Weights for all labels of a padded element will be 0 weights = weights * padding_mask[:, None] return replaced_labels, weights def _get_batch_iterator(dataset_iter, batch_size, nodes_per_graph, edges_per_graph, num_shards=None): """Turns a TFDS per-example iterator into a batched iterator in the init2winit format. Constructs the batch from num_shards smaller batches, so that we can easily shard the batch to multiple devices during training. We use dynamic batching, so we specify some max number of graphs/nodes/edges, add as many graphs as we can, and then pad to the max values. Args: dataset_iter: The TFDS dataset iterator. batch_size: How many average-sized graphs go into the batch. nodes_per_graph: How many nodes per graph there are on average. Max number of nodes in the batch will be nodes_per_graph * batch_size. edges_per_graph: How many edges per graph there are on average. Max number of edges in the batch will be edges_per_graph * batch_size. num_shards: How many devices we should be able to shard the batch into. Yields: Batch in the init2winit format. Each field is a list of num_shards separate smaller batches. """ if not num_shards: num_shards = jax.device_count() # We will construct num_shards smaller batches and then put them together. batch_size /= num_shards max_n_nodes = nodes_per_graph * batch_size max_n_edges = edges_per_graph * batch_size max_n_graphs = batch_size jraph_iter = map(_to_jraph, dataset_iter) batched_iter = jraph.dynamically_batch(jraph_iter, max_n_nodes + 1, max_n_edges, max_n_graphs + 1) count = 0 graphs_shards = [] labels_shards = [] weights_shards = [] for batched_graph in batched_iter:
def get_ogbg_molpcba(shuffle_rng, batch_size, eval_batch_size, hps=None): """Data generators for ogbg-molpcba.""" shuffle_buffer_size = 2**15 shuffle_rng_train, shuffle_rng_eval_train = jax.random.split(shuffle_rng) train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_train, shuffle_buffer_size=shuffle_buffer_size) eval_train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_eval_train, shuffle_buffer_size=shuffle_buffer_size) valid_ds = _load_dataset('validation') test_ds = _load_dataset('test') def train_iterator_fn(): return _get_batch_iterator( iter(train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier) def eval_train_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(eval_train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def valid_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(valid_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def test_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(test_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) return Dataset(train_iterator_fn, eval_train_epoch, valid_epoch, test_epoch)
count += 1 # Separate the labels from the graph labels = batched_graph.globals graph = batched_graph._replace(globals={}) replaced_labels, weights = _get_weights_by_nan_and_padding( labels, jraph.get_graph_padding_mask(graph)) graphs_shards.append(graph) labels_shards.append(replaced_labels) weights_shards.append(weights) if count == num_shards: yield { 'inputs': graphs_shards, 'targets': labels_shards, 'weights': weights_shards } count = 0 graphs_shards = [] labels_shards = [] weights_shards = []
conditional_block
ogbg_molpcba.py
# coding=utf-8 # Copyright 2022 The init2winit Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Input pipeline for the ogbg_molpcba graph dataset from TFDS. See https://www.tensorflow.org/datasets/catalog/ogbg_molpcba and https://ogb.stanford.edu/docs/graphprop/ for more details. """ import itertools from init2winit.dataset_lib import data_utils from init2winit.dataset_lib.data_utils import Dataset import jax import jraph from ml_collections.config_dict import config_dict import numpy as np import tensorflow_datasets as tfds AVG_NODES_PER_GRAPH = 26 AVG_EDGES_PER_GRAPH = 56 DEFAULT_HPARAMS = config_dict.ConfigDict( dict( output_shape=(128,), input_edge_shape=(3,), input_node_shape=(9,), train_size=350343, valid_size=43793, test_size=43793, # Max edges/nodes per batch will batch_size times the multiplier. # We set them to the average size of the graph in the dataset, # so that each batch contains batch_size graphs on average. max_edges_multiplier=AVG_EDGES_PER_GRAPH, max_nodes_multiplier=AVG_NODES_PER_GRAPH, )) METADATA = { 'apply_one_hot_in_loss': False, } def _load_dataset(split, should_shuffle=False, shuffle_seed=None, shuffle_buffer_size=None): """Loads a dataset split from TFDS.""" if should_shuffle: assert shuffle_seed is not None and shuffle_buffer_size is not None file_shuffle_seed, dataset_shuffle_seed = jax.random.split(shuffle_seed) file_shuffle_seed = file_shuffle_seed[0] dataset_shuffle_seed = dataset_shuffle_seed[0] else: file_shuffle_seed = None dataset_shuffle_seed = None read_config = tfds.ReadConfig( add_tfds_id=True, shuffle_seed=file_shuffle_seed) dataset = tfds.load( 'ogbg_molpcba', split=split, shuffle_files=should_shuffle, read_config=read_config) if should_shuffle: dataset = dataset.shuffle( seed=dataset_shuffle_seed, buffer_size=shuffle_buffer_size) dataset = dataset.repeat() return dataset def _to_jraph(example): """Converts an example graph to jraph.GraphsTuple.""" example = data_utils.tf_to_numpy(example) edge_feat = example['edge_feat'] node_feat = example['node_feat'] edge_index = example['edge_index'] labels = example['labels'] num_nodes = example['num_nodes'] senders = edge_index[:, 0] receivers = edge_index[:, 1] return jraph.GraphsTuple( n_node=num_nodes, n_edge=np.array([len(edge_index) * 2]), nodes=node_feat, edges=np.concatenate([edge_feat, edge_feat]), # Make the edges bidirectional senders=np.concatenate([senders, receivers]), receivers=np.concatenate([receivers, senders]), # Keep the labels with the graph for batching. They will be removed # in the processed batch. globals=np.expand_dims(labels, axis=0)) def _get_weights_by_nan_and_padding(labels, padding_mask): """Handles NaNs and padding in labels. Sets all the weights from examples coming from padding to 0. Changes all NaNs in labels to 0s and sets the corresponding per-label weight to 0. Args: labels: Labels including labels from padded examples padding_mask: Binary array of which examples are padding Returns: tuple of (processed labels, corresponding weights) """ nan_mask = np.isnan(labels) replaced_labels = np.copy(labels) np.place(replaced_labels, nan_mask, 0) weights = 1.0 - nan_mask # Weights for all labels of a padded element will be 0 weights = weights * padding_mask[:, None] return replaced_labels, weights def _get_batch_iterator(dataset_iter, batch_size, nodes_per_graph, edges_per_graph, num_shards=None): """Turns a TFDS per-example iterator into a batched iterator in the init2winit format. Constructs the batch from num_shards smaller batches, so that we can easily shard the batch to multiple devices during training. We use dynamic batching, so we specify some max number of graphs/nodes/edges, add as many graphs as we can, and then pad to the max values. Args: dataset_iter: The TFDS dataset iterator. batch_size: How many average-sized graphs go into the batch. nodes_per_graph: How many nodes per graph there are on average. Max number of nodes in the batch will be nodes_per_graph * batch_size. edges_per_graph: How many edges per graph there are on average. Max number of edges in the batch will be edges_per_graph * batch_size. num_shards: How many devices we should be able to shard the batch into. Yields: Batch in the init2winit format. Each field is a list of num_shards separate smaller batches. """ if not num_shards: num_shards = jax.device_count() # We will construct num_shards smaller batches and then put them together. batch_size /= num_shards max_n_nodes = nodes_per_graph * batch_size max_n_edges = edges_per_graph * batch_size max_n_graphs = batch_size jraph_iter = map(_to_jraph, dataset_iter) batched_iter = jraph.dynamically_batch(jraph_iter, max_n_nodes + 1, max_n_edges, max_n_graphs + 1) count = 0 graphs_shards = [] labels_shards = [] weights_shards = [] for batched_graph in batched_iter: count += 1 # Separate the labels from the graph labels = batched_graph.globals graph = batched_graph._replace(globals={}) replaced_labels, weights = _get_weights_by_nan_and_padding( labels, jraph.get_graph_padding_mask(graph)) graphs_shards.append(graph) labels_shards.append(replaced_labels) weights_shards.append(weights) if count == num_shards: yield { 'inputs': graphs_shards, 'targets': labels_shards, 'weights': weights_shards } count = 0 graphs_shards = [] labels_shards = [] weights_shards = [] def get_ogbg_molpcba(shuffle_rng, batch_size, eval_batch_size, hps=None): """Data generators for ogbg-molpcba.""" shuffle_buffer_size = 2**15 shuffle_rng_train, shuffle_rng_eval_train = jax.random.split(shuffle_rng) train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_train, shuffle_buffer_size=shuffle_buffer_size) eval_train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_eval_train, shuffle_buffer_size=shuffle_buffer_size) valid_ds = _load_dataset('validation') test_ds = _load_dataset('test') def train_iterator_fn(): return _get_batch_iterator( iter(train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier) def eval_train_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(eval_train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def valid_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(valid_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def test_epoch(num_batches=None):
return Dataset(train_iterator_fn, eval_train_epoch, valid_epoch, test_epoch)
return itertools.islice( _get_batch_iterator( iter(test_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches)
identifier_body
ogbg_molpcba.py
# coding=utf-8 # Copyright 2022 The init2winit Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Input pipeline for the ogbg_molpcba graph dataset from TFDS. See https://www.tensorflow.org/datasets/catalog/ogbg_molpcba and https://ogb.stanford.edu/docs/graphprop/ for more details. """ import itertools from init2winit.dataset_lib import data_utils from init2winit.dataset_lib.data_utils import Dataset import jax import jraph from ml_collections.config_dict import config_dict import numpy as np import tensorflow_datasets as tfds AVG_NODES_PER_GRAPH = 26 AVG_EDGES_PER_GRAPH = 56 DEFAULT_HPARAMS = config_dict.ConfigDict( dict( output_shape=(128,), input_edge_shape=(3,), input_node_shape=(9,), train_size=350343, valid_size=43793, test_size=43793, # Max edges/nodes per batch will batch_size times the multiplier. # We set them to the average size of the graph in the dataset, # so that each batch contains batch_size graphs on average. max_edges_multiplier=AVG_EDGES_PER_GRAPH, max_nodes_multiplier=AVG_NODES_PER_GRAPH, )) METADATA = { 'apply_one_hot_in_loss': False, } def _load_dataset(split, should_shuffle=False, shuffle_seed=None, shuffle_buffer_size=None): """Loads a dataset split from TFDS.""" if should_shuffle: assert shuffle_seed is not None and shuffle_buffer_size is not None file_shuffle_seed, dataset_shuffle_seed = jax.random.split(shuffle_seed) file_shuffle_seed = file_shuffle_seed[0] dataset_shuffle_seed = dataset_shuffle_seed[0] else: file_shuffle_seed = None dataset_shuffle_seed = None read_config = tfds.ReadConfig( add_tfds_id=True, shuffle_seed=file_shuffle_seed) dataset = tfds.load( 'ogbg_molpcba', split=split, shuffle_files=should_shuffle, read_config=read_config) if should_shuffle: dataset = dataset.shuffle( seed=dataset_shuffle_seed, buffer_size=shuffle_buffer_size) dataset = dataset.repeat() return dataset def _to_jraph(example): """Converts an example graph to jraph.GraphsTuple.""" example = data_utils.tf_to_numpy(example) edge_feat = example['edge_feat'] node_feat = example['node_feat'] edge_index = example['edge_index'] labels = example['labels'] num_nodes = example['num_nodes'] senders = edge_index[:, 0] receivers = edge_index[:, 1] return jraph.GraphsTuple( n_node=num_nodes, n_edge=np.array([len(edge_index) * 2]), nodes=node_feat, edges=np.concatenate([edge_feat, edge_feat]), # Make the edges bidirectional senders=np.concatenate([senders, receivers]), receivers=np.concatenate([receivers, senders]), # Keep the labels with the graph for batching. They will be removed # in the processed batch. globals=np.expand_dims(labels, axis=0)) def _get_weights_by_nan_and_padding(labels, padding_mask): """Handles NaNs and padding in labels. Sets all the weights from examples coming from padding to 0. Changes all NaNs in labels to 0s and sets the corresponding per-label weight to 0. Args: labels: Labels including labels from padded examples padding_mask: Binary array of which examples are padding Returns: tuple of (processed labels, corresponding weights) """ nan_mask = np.isnan(labels) replaced_labels = np.copy(labels) np.place(replaced_labels, nan_mask, 0) weights = 1.0 - nan_mask # Weights for all labels of a padded element will be 0 weights = weights * padding_mask[:, None] return replaced_labels, weights def _get_batch_iterator(dataset_iter, batch_size, nodes_per_graph, edges_per_graph, num_shards=None): """Turns a TFDS per-example iterator into a batched iterator in the init2winit format. Constructs the batch from num_shards smaller batches, so that we can easily shard the batch to multiple devices during training. We use dynamic batching, so we specify some max number of graphs/nodes/edges, add as many graphs as we can, and then pad to the max values. Args: dataset_iter: The TFDS dataset iterator. batch_size: How many average-sized graphs go into the batch. nodes_per_graph: How many nodes per graph there are on average. Max number of nodes in the batch will be nodes_per_graph * batch_size. edges_per_graph: How many edges per graph there are on average. Max number of edges in the batch will be edges_per_graph * batch_size. num_shards: How many devices we should be able to shard the batch into. Yields: Batch in the init2winit format. Each field is a list of num_shards separate smaller batches. """ if not num_shards: num_shards = jax.device_count() # We will construct num_shards smaller batches and then put them together. batch_size /= num_shards max_n_nodes = nodes_per_graph * batch_size max_n_edges = edges_per_graph * batch_size max_n_graphs = batch_size jraph_iter = map(_to_jraph, dataset_iter) batched_iter = jraph.dynamically_batch(jraph_iter, max_n_nodes + 1, max_n_edges, max_n_graphs + 1) count = 0 graphs_shards = [] labels_shards = [] weights_shards = [] for batched_graph in batched_iter: count += 1 # Separate the labels from the graph labels = batched_graph.globals graph = batched_graph._replace(globals={}) replaced_labels, weights = _get_weights_by_nan_and_padding( labels, jraph.get_graph_padding_mask(graph)) graphs_shards.append(graph) labels_shards.append(replaced_labels) weights_shards.append(weights) if count == num_shards: yield { 'inputs': graphs_shards, 'targets': labels_shards, 'weights': weights_shards } count = 0 graphs_shards = [] labels_shards = [] weights_shards = [] def
(shuffle_rng, batch_size, eval_batch_size, hps=None): """Data generators for ogbg-molpcba.""" shuffle_buffer_size = 2**15 shuffle_rng_train, shuffle_rng_eval_train = jax.random.split(shuffle_rng) train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_train, shuffle_buffer_size=shuffle_buffer_size) eval_train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_eval_train, shuffle_buffer_size=shuffle_buffer_size) valid_ds = _load_dataset('validation') test_ds = _load_dataset('test') def train_iterator_fn(): return _get_batch_iterator( iter(train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier) def eval_train_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(eval_train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def valid_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(valid_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def test_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(test_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) return Dataset(train_iterator_fn, eval_train_epoch, valid_epoch, test_epoch)
get_ogbg_molpcba
identifier_name
ogbg_molpcba.py
# coding=utf-8 # Copyright 2022 The init2winit Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Input pipeline for the ogbg_molpcba graph dataset from TFDS. See https://www.tensorflow.org/datasets/catalog/ogbg_molpcba and https://ogb.stanford.edu/docs/graphprop/ for more details. """ import itertools from init2winit.dataset_lib import data_utils from init2winit.dataset_lib.data_utils import Dataset import jax import jraph from ml_collections.config_dict import config_dict import numpy as np import tensorflow_datasets as tfds AVG_NODES_PER_GRAPH = 26 AVG_EDGES_PER_GRAPH = 56 DEFAULT_HPARAMS = config_dict.ConfigDict( dict( output_shape=(128,), input_edge_shape=(3,), input_node_shape=(9,), train_size=350343, valid_size=43793, test_size=43793, # Max edges/nodes per batch will batch_size times the multiplier. # We set them to the average size of the graph in the dataset, # so that each batch contains batch_size graphs on average. max_edges_multiplier=AVG_EDGES_PER_GRAPH, max_nodes_multiplier=AVG_NODES_PER_GRAPH, )) METADATA = { 'apply_one_hot_in_loss': False, } def _load_dataset(split, should_shuffle=False, shuffle_seed=None, shuffle_buffer_size=None): """Loads a dataset split from TFDS.""" if should_shuffle: assert shuffle_seed is not None and shuffle_buffer_size is not None file_shuffle_seed, dataset_shuffle_seed = jax.random.split(shuffle_seed) file_shuffle_seed = file_shuffle_seed[0] dataset_shuffle_seed = dataset_shuffle_seed[0] else: file_shuffle_seed = None dataset_shuffle_seed = None read_config = tfds.ReadConfig( add_tfds_id=True, shuffle_seed=file_shuffle_seed) dataset = tfds.load( 'ogbg_molpcba', split=split, shuffle_files=should_shuffle, read_config=read_config) if should_shuffle: dataset = dataset.shuffle( seed=dataset_shuffle_seed, buffer_size=shuffle_buffer_size) dataset = dataset.repeat() return dataset def _to_jraph(example): """Converts an example graph to jraph.GraphsTuple.""" example = data_utils.tf_to_numpy(example) edge_feat = example['edge_feat'] node_feat = example['node_feat'] edge_index = example['edge_index'] labels = example['labels'] num_nodes = example['num_nodes']
n_node=num_nodes, n_edge=np.array([len(edge_index) * 2]), nodes=node_feat, edges=np.concatenate([edge_feat, edge_feat]), # Make the edges bidirectional senders=np.concatenate([senders, receivers]), receivers=np.concatenate([receivers, senders]), # Keep the labels with the graph for batching. They will be removed # in the processed batch. globals=np.expand_dims(labels, axis=0)) def _get_weights_by_nan_and_padding(labels, padding_mask): """Handles NaNs and padding in labels. Sets all the weights from examples coming from padding to 0. Changes all NaNs in labels to 0s and sets the corresponding per-label weight to 0. Args: labels: Labels including labels from padded examples padding_mask: Binary array of which examples are padding Returns: tuple of (processed labels, corresponding weights) """ nan_mask = np.isnan(labels) replaced_labels = np.copy(labels) np.place(replaced_labels, nan_mask, 0) weights = 1.0 - nan_mask # Weights for all labels of a padded element will be 0 weights = weights * padding_mask[:, None] return replaced_labels, weights def _get_batch_iterator(dataset_iter, batch_size, nodes_per_graph, edges_per_graph, num_shards=None): """Turns a TFDS per-example iterator into a batched iterator in the init2winit format. Constructs the batch from num_shards smaller batches, so that we can easily shard the batch to multiple devices during training. We use dynamic batching, so we specify some max number of graphs/nodes/edges, add as many graphs as we can, and then pad to the max values. Args: dataset_iter: The TFDS dataset iterator. batch_size: How many average-sized graphs go into the batch. nodes_per_graph: How many nodes per graph there are on average. Max number of nodes in the batch will be nodes_per_graph * batch_size. edges_per_graph: How many edges per graph there are on average. Max number of edges in the batch will be edges_per_graph * batch_size. num_shards: How many devices we should be able to shard the batch into. Yields: Batch in the init2winit format. Each field is a list of num_shards separate smaller batches. """ if not num_shards: num_shards = jax.device_count() # We will construct num_shards smaller batches and then put them together. batch_size /= num_shards max_n_nodes = nodes_per_graph * batch_size max_n_edges = edges_per_graph * batch_size max_n_graphs = batch_size jraph_iter = map(_to_jraph, dataset_iter) batched_iter = jraph.dynamically_batch(jraph_iter, max_n_nodes + 1, max_n_edges, max_n_graphs + 1) count = 0 graphs_shards = [] labels_shards = [] weights_shards = [] for batched_graph in batched_iter: count += 1 # Separate the labels from the graph labels = batched_graph.globals graph = batched_graph._replace(globals={}) replaced_labels, weights = _get_weights_by_nan_and_padding( labels, jraph.get_graph_padding_mask(graph)) graphs_shards.append(graph) labels_shards.append(replaced_labels) weights_shards.append(weights) if count == num_shards: yield { 'inputs': graphs_shards, 'targets': labels_shards, 'weights': weights_shards } count = 0 graphs_shards = [] labels_shards = [] weights_shards = [] def get_ogbg_molpcba(shuffle_rng, batch_size, eval_batch_size, hps=None): """Data generators for ogbg-molpcba.""" shuffle_buffer_size = 2**15 shuffle_rng_train, shuffle_rng_eval_train = jax.random.split(shuffle_rng) train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_train, shuffle_buffer_size=shuffle_buffer_size) eval_train_ds = _load_dataset( 'train', should_shuffle=True, shuffle_seed=shuffle_rng_eval_train, shuffle_buffer_size=shuffle_buffer_size) valid_ds = _load_dataset('validation') test_ds = _load_dataset('test') def train_iterator_fn(): return _get_batch_iterator( iter(train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier) def eval_train_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(eval_train_ds), batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def valid_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(valid_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) def test_epoch(num_batches=None): return itertools.islice( _get_batch_iterator( iter(test_ds), eval_batch_size, hps.max_nodes_multiplier, hps.max_edges_multiplier), num_batches) return Dataset(train_iterator_fn, eval_train_epoch, valid_epoch, test_epoch)
senders = edge_index[:, 0] receivers = edge_index[:, 1] return jraph.GraphsTuple(
random_line_split
talents.ts
import 'rxjs/add/operator/map'; import { Injectable } from '@angular/core'; import { Http, Headers, URLSearchParams } from '@angular/http'; import { Observable } from 'rxjs/Observable'; import Constants from '../constants'; import { ITalent } from '../models'; @Injectable() export class TalentsService { private API_PATH: string = `${Constants.API_URL}/talents`; constructor(private http: Http) { } public getTalents(payload, token): Observable<ITalent[]> { const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); const params: URLSearchParams = new URLSearchParams(); if (payload.pagination) { params.set('per', payload.pagination.per); params.set('page', payload.pagination.page); } if (payload.filter) { Object.keys(payload.filter).forEach((name) => { if (name !== 'talents_ids') { params.set(`filter[${name}]`, payload.filter[name]); } else if (payload.filter['talents_ids'] && payload.filter['talents_ids'].length)
}); } if (payload.order) { Object.keys(payload.order).map((name) => { params.set(`order[${name}]`, payload.order[name]); }); } if (!params.get('order[name]')) { params.set('order[name]', 'asc'); } return this.http.get(this.API_PATH, { search: params, headers }) .map((res) => res.json()); } public postTalents(payload, token): Observable<ITalent> { const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); return this.http.post(this.API_PATH, payload, { headers }) .map((res) => res.json()); } }
{ payload.filter['talents_ids'].forEach((item) => { params.append('filter[talents_ids][]', item); }); }
conditional_block
talents.ts
import 'rxjs/add/operator/map'; import { Injectable } from '@angular/core'; import { Http, Headers, URLSearchParams } from '@angular/http'; import { Observable } from 'rxjs/Observable'; import Constants from '../constants'; import { ITalent } from '../models'; @Injectable() export class TalentsService { private API_PATH: string = `${Constants.API_URL}/talents`; constructor(private http: Http) { } public getTalents(payload, token): Observable<ITalent[]>
public postTalents(payload, token): Observable<ITalent> { const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); return this.http.post(this.API_PATH, payload, { headers }) .map((res) => res.json()); } }
{ const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); const params: URLSearchParams = new URLSearchParams(); if (payload.pagination) { params.set('per', payload.pagination.per); params.set('page', payload.pagination.page); } if (payload.filter) { Object.keys(payload.filter).forEach((name) => { if (name !== 'talents_ids') { params.set(`filter[${name}]`, payload.filter[name]); } else if (payload.filter['talents_ids'] && payload.filter['talents_ids'].length) { payload.filter['talents_ids'].forEach((item) => { params.append('filter[talents_ids][]', item); }); } }); } if (payload.order) { Object.keys(payload.order).map((name) => { params.set(`order[${name}]`, payload.order[name]); }); } if (!params.get('order[name]')) { params.set('order[name]', 'asc'); } return this.http.get(this.API_PATH, { search: params, headers }) .map((res) => res.json()); }
identifier_body
talents.ts
import 'rxjs/add/operator/map'; import { Injectable } from '@angular/core'; import { Http, Headers, URLSearchParams } from '@angular/http'; import { Observable } from 'rxjs/Observable'; import Constants from '../constants'; import { ITalent } from '../models'; @Injectable() export class
{ private API_PATH: string = `${Constants.API_URL}/talents`; constructor(private http: Http) { } public getTalents(payload, token): Observable<ITalent[]> { const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); const params: URLSearchParams = new URLSearchParams(); if (payload.pagination) { params.set('per', payload.pagination.per); params.set('page', payload.pagination.page); } if (payload.filter) { Object.keys(payload.filter).forEach((name) => { if (name !== 'talents_ids') { params.set(`filter[${name}]`, payload.filter[name]); } else if (payload.filter['talents_ids'] && payload.filter['talents_ids'].length) { payload.filter['talents_ids'].forEach((item) => { params.append('filter[talents_ids][]', item); }); } }); } if (payload.order) { Object.keys(payload.order).map((name) => { params.set(`order[${name}]`, payload.order[name]); }); } if (!params.get('order[name]')) { params.set('order[name]', 'asc'); } return this.http.get(this.API_PATH, { search: params, headers }) .map((res) => res.json()); } public postTalents(payload, token): Observable<ITalent> { const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); return this.http.post(this.API_PATH, payload, { headers }) .map((res) => res.json()); } }
TalentsService
identifier_name
talents.ts
import 'rxjs/add/operator/map'; import { Injectable } from '@angular/core'; import { Http, Headers, URLSearchParams } from '@angular/http'; import { Observable } from 'rxjs/Observable'; import Constants from '../constants'; import { ITalent } from '../models'; @Injectable() export class TalentsService { private API_PATH: string = `${Constants.API_URL}/talents`; constructor(private http: Http) { } public getTalents(payload, token): Observable<ITalent[]> { const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); const params: URLSearchParams = new URLSearchParams(); if (payload.pagination) { params.set('per', payload.pagination.per); params.set('page', payload.pagination.page); } if (payload.filter) { Object.keys(payload.filter).forEach((name) => { if (name !== 'talents_ids') { params.set(`filter[${name}]`, payload.filter[name]); } else if (payload.filter['talents_ids'] && payload.filter['talents_ids'].length) { payload.filter['talents_ids'].forEach((item) => { params.append('filter[talents_ids][]', item); }); } }); }
Object.keys(payload.order).map((name) => { params.set(`order[${name}]`, payload.order[name]); }); } if (!params.get('order[name]')) { params.set('order[name]', 'asc'); } return this.http.get(this.API_PATH, { search: params, headers }) .map((res) => res.json()); } public postTalents(payload, token): Observable<ITalent> { const headers = new Headers({ 'Content-Type': 'application/json', 'X-Auth-Secret': token }); return this.http.post(this.API_PATH, payload, { headers }) .map((res) => res.json()); } }
if (payload.order) {
random_line_split
eggie.py
#!/usr/bin/env python #Copyright (c) <2015>, <Jaakko Leppakangas> #All rights reserved. # #Redistribution and use in source and binary forms, with or without #modification, are permitted provided that the following conditions are met: # #1. Redistributions of source code must retain the above copyright notice, this # list of conditions and the following disclaimer. #2. Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # #THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND #ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED #WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE #DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR #ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES #(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; #LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND #ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT #(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS #SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # #The views and conclusions contained in the software and documentation are those #of the authors and should not be interpreted as representing official policies, #either expressed or implied, of the FreeBSD Project. ''' Created on Dec 16, 2014 @author: Jaakko Leppakangas ''' import sys from PyQt4 import QtGui from ui.preprocessDialog import PreprocessDialog def
(): app = QtGui.QApplication(sys.argv) window=PreprocessDialog() window.show() sys.exit(app.exec_()) if __name__ == '__main__': main()
main
identifier_name
eggie.py
#!/usr/bin/env python #Copyright (c) <2015>, <Jaakko Leppakangas> #All rights reserved. # #Redistribution and use in source and binary forms, with or without #modification, are permitted provided that the following conditions are met: # #1. Redistributions of source code must retain the above copyright notice, this # list of conditions and the following disclaimer. #2. Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # #THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND #ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED #WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE #DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR #ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES #(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; #LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND #ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT #(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS #SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # #The views and conclusions contained in the software and documentation are those #of the authors and should not be interpreted as representing official policies, #either expressed or implied, of the FreeBSD Project. ''' Created on Dec 16, 2014 @author: Jaakko Leppakangas ''' import sys from PyQt4 import QtGui from ui.preprocessDialog import PreprocessDialog def main(): app = QtGui.QApplication(sys.argv) window=PreprocessDialog() window.show() sys.exit(app.exec_()) if __name__ == '__main__':
main()
conditional_block
eggie.py
#!/usr/bin/env python #Copyright (c) <2015>, <Jaakko Leppakangas> #All rights reserved. # #Redistribution and use in source and binary forms, with or without #modification, are permitted provided that the following conditions are met: # #1. Redistributions of source code must retain the above copyright notice, this
# this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # #THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND #ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED #WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE #DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR #ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES #(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; #LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND #ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT #(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS #SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # #The views and conclusions contained in the software and documentation are those #of the authors and should not be interpreted as representing official policies, #either expressed or implied, of the FreeBSD Project. ''' Created on Dec 16, 2014 @author: Jaakko Leppakangas ''' import sys from PyQt4 import QtGui from ui.preprocessDialog import PreprocessDialog def main(): app = QtGui.QApplication(sys.argv) window=PreprocessDialog() window.show() sys.exit(app.exec_()) if __name__ == '__main__': main()
# list of conditions and the following disclaimer. #2. Redistributions in binary form must reproduce the above copyright notice,
random_line_split
eggie.py
#!/usr/bin/env python #Copyright (c) <2015>, <Jaakko Leppakangas> #All rights reserved. # #Redistribution and use in source and binary forms, with or without #modification, are permitted provided that the following conditions are met: # #1. Redistributions of source code must retain the above copyright notice, this # list of conditions and the following disclaimer. #2. Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # #THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND #ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED #WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE #DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR #ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES #(INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; #LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND #ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT #(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS #SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # #The views and conclusions contained in the software and documentation are those #of the authors and should not be interpreted as representing official policies, #either expressed or implied, of the FreeBSD Project. ''' Created on Dec 16, 2014 @author: Jaakko Leppakangas ''' import sys from PyQt4 import QtGui from ui.preprocessDialog import PreprocessDialog def main():
if __name__ == '__main__': main()
app = QtGui.QApplication(sys.argv) window=PreprocessDialog() window.show() sys.exit(app.exec_())
identifier_body
js_Fc4I144XPrPKyUpaWv36lNESuazCkfla6EpZyDPBOQk.js
(function ($) { /** * Attach the child dialog behavior to new content. */ Drupal.behaviors.overlayChild = { attach: function (context, settings) { // Make sure this behavior is not processed more than once. if (this.processed) { return; } this.processed = true; // If we cannot reach the parent window, break out of the overlay. if (!parent.Drupal || !parent.Drupal.overlay) { window.location = window.location.href.replace(/([?&]?)render=overlay&?/g, '$1').replace(/\?$/, ''); } var settings = settings.overlayChild || {}; // If the entire parent window should be refreshed when the overlay is // closed, pass that information to the parent window. if (settings.refreshPage) { parent.Drupal.overlay.refreshPage = true; } // If a form has been submitted successfully, then the server side script // may have decided to tell the parent window to close the popup dialog. if (settings.closeOverlay) { parent.Drupal.overlay.bindChild(window, true); // Use setTimeout to close the child window from a separate thread, // because the current one is busy processing Drupal behaviors. setTimeout(function () { if (typeof settings.redirect == 'string') { parent.Drupal.overlay.redirect(settings.redirect); } else { parent.Drupal.overlay.close(); } }, 1); return; } // If one of the regions displaying outside the overlay needs to be // reloaded immediately, let the parent window know. if (settings.refreshRegions) { parent.Drupal.overlay.refreshRegions(settings.refreshRegions); } // Ok, now we can tell the parent window we're ready. parent.Drupal.overlay.bindChild(window); // IE8 crashes on certain pages if this isn't called; reason unknown. window.scrollTo(window.scrollX, window.scrollY); // Attach child related behaviors to the iframe document. Drupal.overlayChild.attachBehaviors(context, settings); // There are two links within the message that informs people about the // overlay and how to disable it. Make sure both links are visible when // either one has focus and add a class to the wrapper for styling purposes. $('#overlay-disable-message', context) .focusin(function () { $(this).addClass('overlay-disable-message-focused'); $('a.element-focusable', this).removeClass('element-invisible'); }) .focusout(function () { $(this).removeClass('overlay-disable-message-focused'); $('a.element-focusable', this).addClass('element-invisible'); }); } }; /** * Overlay object for child windows. */ Drupal.overlayChild = Drupal.overlayChild || { behaviors: {} }; Drupal.overlayChild.prototype = {}; /** * Attach child related behaviors to the iframe document. */ Drupal.overlayChild.attachBehaviors = function (context, settings) { $.each(this.behaviors, function () { this(context, settings); }); }; /** * Capture and handle clicks. * * Instead of binding a click event handler to every link we bind one to the * document and handle events that bubble up. This also allows other scripts * to bind their own handlers to links and also to prevent overlay's handling. */ Drupal.overlayChild.behaviors.addClickHandler = function (context, settings) { $(document).bind('click.drupal-overlay mouseup.drupal-overlay', $.proxy(parent.Drupal.overlay, 'eventhandlerOverrideLink')); }; /** * Modify forms depending on their relation to the overlay. * * By default, forms are assumed to keep the flow in the overlay. Thus their * action attribute get a ?render=overlay suffix. */ Drupal.overlayChild.behaviors.parseForms = function (context, settings) { $('form', context).once('overlay', function () { // Obtain the action attribute of the form. var action = $(this).attr('action'); // Keep internal forms in the overlay. if (action == undefined || (action.indexOf('http') != 0 && action.indexOf('https') != 0)) { action += (action.indexOf('?') > -1 ? '&' : '?') + 'render=overlay'; $(this).attr('action', action); } // Submit external forms into a new window. else { $(this).attr('target', '_new'); } }); }; /** * Replace the overlay title with a message while loading another page. */ Drupal.overlayChild.behaviors.loading = function (context, settings) { var $title; var text = Drupal.t('Loading'); var dots = ''; $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $title = $('#overlay-title').text(text); var id = setInterval(function () { dots = (dots.length > 10) ? '' : dots + '.'; $title.text(text + dots); }, 500); }); }; /** * Switch active tab immediately. */ Drupal.overlayChild.behaviors.tabs = function (context, settings) { var $tabsLinks = $('#overlay-tabs > li > a'); $('#overlay-tabs > li > a').bind('click.drupal-overlay', function () { var active_tab = Drupal.t('(active tab)'); $tabsLinks.parent().siblings().removeClass('active').find('element-invisible:contains(' + active_tab + ')').appendTo(this); $(this).parent().addClass('active'); }); }; /** * If the shortcut add/delete button exists, move it to the overlay titlebar. */ Drupal.overlayChild.behaviors.shortcutAddLink = function (context, settings) { // Remove any existing shortcut button markup from the titlebar. $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); // If the shortcut add/delete button exists, move it to the titlebar. var $addToShortcuts = $('.add-or-remove-shortcuts'); if ($addToShortcuts.length) { $addToShortcuts.insertAfter('#overlay-title'); } $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); }); }; /** * Use displacement from parent window. */ Drupal.overlayChild.behaviors.alterTableHeaderOffset = function (context, settings) { if (Drupal.settings.tableHeaderOffset) { Drupal.overlayChild.prevTableHeaderOffset = Drupal.settings.tableHeaderOffset; } Drupal.settings.tableHeaderOffset = 'Drupal.overlayChild.tableHeaderOffset'; }; /** * Callback for Drupal.settings.tableHeaderOffset. */ Drupal.overlayChild.tableHeaderOffset = function () { var topOffset = Drupal.overlayChild.prevTableHeaderOffset ? eval(Drupal.overlayChild.prevTableHeaderOffset + '()') : 0; return topOffset + parseInt($(document.body).css('marginTop')); }; })(jQuery); ; (function ($) { /** * Retrieves the summary for the first element. */ $.fn.drupalGetSummary = function () { var callback = this.data('summaryCallback'); return (this[0] && callback) ? $.trim(callback(this[0])) : ''; }; /** * Sets the summary for all matched elements. * * @param callback * Either a function that will be called each time the summary is * retrieved or a string (which is returned each time). */ $.fn.drupalSetSummary = function (callback) { var self = this; // To facilitate things, the callback should always be a function. If it's // not, we wrap it into an anonymous function which just returns the value. if (typeof callback != 'function') { var val = callback; callback = function () { return val; }; } return this .data('summaryCallback', callback) // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind('formUpdated.summary') .bind('formUpdated.summary', function () { self.trigger('summaryUpdated'); }) // The actual summaryUpdated handler doesn't fire when the callback is // changed, so we have to do this manually. .trigger('summaryUpdated'); }; /** * Sends a 'formUpdated' event each time a form element is modified. */ Drupal.behaviors.formUpdated = { attach: function (context) { // These events are namespaced so that we can remove them later. var events = 'change.formUpdated click.formUpdated blur.formUpdated keyup.formUpdated'; $(context) // Since context could be an input element itself, it's added back to // the jQuery object and filtered again. .find(':input').andSelf().filter(':input') // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind(events).bind(events, function () { $(this).trigger('formUpdated'); }); } }; /** * Prepopulate form fields with information from the visitor cookie. */ Drupal.behaviors.fillUserInfoFromCookie = { attach: function (context, settings) { $('form.user-info-from-cookie').once('user-info-from-cookie', function () { var formContext = this; $.each(['name', 'mail', 'homepage'], function () { var $element = $('[name=' + this + ']', formContext); var cookie = $.cookie('Drupal.visitor.' + this); if ($element.length && cookie) { $element.val(cookie); } }); }); } }; })(jQuery); ; (function ($) { /** * The base States namespace. * * Having the local states variable allows us to use the States namespace * without having to always declare "Drupal.states". */ var states = Drupal.states = { // An array of functions that should be postponed. postponed: [] }; /** * Attaches the states. */ Drupal.behaviors.states = { attach: function (context, settings) { for (var selector in settings.states) { for (var state in settings.states[selector]) { new states.Dependent({ element: $(selector), state: states.State.sanitize(state), dependees: settings.states[selector][state] }); } } // Execute all postponed functions now. while (states.postponed.length) { (states.postponed.shift())(); } } }; /** * Object representing an element that depends on other elements. * * @param args * Object with the following keys (all of which are required): * - element: A jQuery object of the dependent element * - state: A State object describing the state that is dependent * - dependees: An object with dependency specifications. Lists all elements * that this element depends on. */ states.Dependent = function (args) { $.extend(this, { values: {}, oldValue: undefined }, args); for (var selector in this.dependees) { this.initializeDependee(selector, this.dependees[selector]); } }; /** * Comparison functions for comparing the value of an element with the * specification from the dependency settings. If the object type can't be * found in this list, the === operator is used by default. */ states.Dependent.comparisons = { 'RegExp': function (reference, value) { return reference.test(value); }, 'Function': function (reference, value) { // The "reference" variable is a comparison function. return reference(value); }, 'Number': function (reference, value) { // If "reference" is a number and "value" is a string, then cast reference // as a string before applying the strict comparison in compare(). Otherwise // numeric keys in the form's #states array fail to match string values // returned from jQuery's val(). return (value.constructor.name === 'String') ? compare(String(reference), value) : compare(reference, value); } }; states.Dependent.prototype = { /** * Initializes one of the elements this dependent depends on. * * @param selector * The CSS selector describing the dependee. * @param dependeeStates * The list of states that have to be monitored for tracking the * dependee's compliance status. */ initializeDependee: function (selector, dependeeStates) { var self = this; // Cache for the states of this dependee. self.values[selector] = {}; $.each(dependeeStates, function (state, value) { state = states.State.sanitize(state); // Initialize the value of this state. self.values[selector][state.pristine] = undefined; // Monitor state changes of the specified state for this dependee. $(selector).bind('state:' + state, function (e) { var complies = self.compare(value, e.value); self.update(selector, state, complies); }); // Make sure the event we just bound ourselves to is actually fired. new states.Trigger({ selector: selector, state: state }); }); }, /** * Compares a value with a reference value. * * @param reference * The value used for reference. * @param value * The value to compare with the reference value. * @return * true, undefined or false. */ compare: function (reference, value) { if (reference.constructor.name in states.Dependent.comparisons) { // Use a custom compare function for certain reference value types. return states.Dependent.comparisons[reference.constructor.name](reference, value); } else { // Do a plain comparison otherwise. return compare(reference, value); } }, /** * Update the value of a dependee's state. * * @param selector * CSS selector describing the dependee. * @param state * A State object describing the dependee's updated state. * @param value * The new value for the dependee's updated state. */ update: function (selector, state, value) { // Only act when the 'new' value is actually new. if (value !== this.values[selector][state.pristine]) { this.values[selector][state.pristine] = value; this.reevaluate(); } }, /** * Triggers change events in case a state changed. */ reevaluate: function () { var value = undefined; // Merge all individual values to find out whether this dependee complies. for (var selector in this.values) { for (var state in this.values[selector]) { state = states.State.sanitize(state); var complies = this.values[selector][state.pristine]; value = ternary(value, invert(complies, state.invert)); } } // Only invoke a state change event when the value actually changed. if (value !== this.oldValue) { // Store the new value so that we can compare later whether the value // actually changed. this.oldValue = value; // Normalize the value to match the normalized state name. value = invert(value, this.state.invert); // By adding "trigger: true", we ensure that state changes don't go into // infinite loops. this.element.trigger({ type: 'state:' + this.state, value: value, trigger: true }); } } }; states.Trigger = function (args) { $.extend(this, args); if (this.state in states.Trigger.states) { this.element = $(this.selector); // Only call the trigger initializer when it wasn't yet attached to this // element. Otherwise we'd end up with duplicate events. if (!this.element.data('trigger:' + this.state)) { this.initialize(); } } }; states.Trigger.prototype = { initialize: function () { var self = this; var trigger = states.Trigger.states[this.state]; if (typeof trigger == 'function') { // We have a custom trigger initialization function. trigger.call(window, this.element); } else { $.each(trigger, function (event, valueFn) { self.defaultTrigger(event, valueFn); }); } // Mark this trigger as initialized for this element. this.element.data('trigger:' + this.state, true); }, defaultTrigger: function (event, valueFn) { var self = this; var oldValue = valueFn.call(this.element); // Attach the event callback. this.element.bind(event, function (e) { var value = valueFn.call(self.element, e); // Only trigger the event if the value has actually changed. if (oldValue !== value) { self.element.trigger({ type: 'state:' + self.state, value: value, oldValue: oldValue }); oldValue = value; } }); states.postponed.push(function () { // Trigger the event once for initialization purposes. self.element.trigger({ type: 'state:' + self.state, value: oldValue, oldValue: undefined }); }); } }; /** * This list of states contains functions that are used to monitor the state * of an element. Whenever an element depends on the state of another element, * one of these trigger functions is added to the dependee so that the * dependent element can be updated. */ states.Trigger.states = { // 'empty' describes the state to be monitored empty: { // 'keyup' is the (native DOM) event that we watch for. 'keyup': function () { // The function associated to that trigger returns the new value for the // state. return this.val() == ''; } }, checked: { 'change': function () { return this.attr('checked'); } }, // For radio buttons, only return the value if the radio button is selected. value: { 'keyup': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); }, 'change': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); } }, collapsed: { 'collapsed': function(e) { return (e !== undefined && 'value' in e) ? e.value : this.is('.collapsed'); } } }; /** * A state object is used for describing the state and performing aliasing. */ states.State = function(state) { // We may need the original unresolved name later. this.pristine = this.name = state; // Normalize the state name. while (true) { // Iteratively remove exclamation marks and invert the value. while (this.name.charAt(0) == '!') { this.name = this.name.substring(1); this.invert = !this.invert; } // Replace the state with its normalized name. if (this.name in states.State.aliases) { this.name = states.State.aliases[this.name]; } else { break; } } }; /** * Create a new State object by sanitizing the passed value. */ states.State.sanitize = function (state) { if (state instanceof states.State) { return state; } else { return new states.State(state); } }; /** * This list of aliases is used to normalize states and associates negated names * with their respective inverse state. */ states.State.aliases = { 'enabled': '!disabled', 'invisible': '!visible', 'invalid': '!valid', 'untouched': '!touched', 'optional': '!required', 'filled': '!empty', 'unchecked': '!checked', 'irrelevant': '!relevant', 'expanded': '!collapsed', 'readwrite': '!readonly' }; states.State.prototype = { invert: false, /** * Ensures that just using the state object returns the name. */ toString: function() { return this.name; } }; /** * Global state change handlers. These are bound to "document" to cover all * elements whose state changes. Events sent to elements within the page * bubble up to these handlers. We use this system so that themes and modules * can override these state change handlers for particular parts of a page. */ { $(document).bind('state:disabled', function(e) { // Only act when this change was triggered by a dependency and not by the // element monitoring itself. if (e.trigger) { $(e.target) .attr('disabled', e.value) .filter('.form-element') .closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'addClass' : 'removeClass']('form-disabled'); // Note: WebKit nightlies don't reflect that change correctly. // See https://bugs.webkit.org/show_bug.cgi?id=23789 } }); $(document).bind('state:required', function(e) { if (e.trigger) { if (e.value) { $(e.target).closest('.form-item, .form-wrapper').find('label').append('<span class="form-required">*</span>'); } else { $(e.target).closest('.form-item, .form-wrapper').find('label .form-required').remove(); } } }); $(document).bind('state:visible', function(e) { if (e.trigger) { $(e.target).closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'show' : 'hide'](); } }); $(document).bind('state:checked', function(e) { if (e.trigger) { $(e.target).attr('checked', e.value); } }); $(document).bind('state:collapsed', function(e) { if (e.trigger) { if ($(e.target).is('.collapsed') !== e.value) { $('> legend a', e.target).click(); } } }); } /** * These are helper functions implementing addition "operators" and don't * implement any logic that is particular to states. */ { // Bitwise AND with a third undefined state. function ternary (a, b) { return a === undefined ? b : (b === undefined ? a : a && b); }; // Inverts a (if it's not undefined) when invert is true. function
(a, invert) { return (invert && a !== undefined) ? !a : a; }; // Compares two values while ignoring undefined values. function compare (a, b) { return (a === b) ? (a === undefined ? a : true) : (a === undefined || b === undefined); } } })(jQuery); ;
invert
identifier_name
js_Fc4I144XPrPKyUpaWv36lNESuazCkfla6EpZyDPBOQk.js
(function ($) { /** * Attach the child dialog behavior to new content. */ Drupal.behaviors.overlayChild = { attach: function (context, settings) { // Make sure this behavior is not processed more than once. if (this.processed) { return; } this.processed = true; // If we cannot reach the parent window, break out of the overlay. if (!parent.Drupal || !parent.Drupal.overlay) { window.location = window.location.href.replace(/([?&]?)render=overlay&?/g, '$1').replace(/\?$/, ''); } var settings = settings.overlayChild || {}; // If the entire parent window should be refreshed when the overlay is // closed, pass that information to the parent window. if (settings.refreshPage) { parent.Drupal.overlay.refreshPage = true; } // If a form has been submitted successfully, then the server side script // may have decided to tell the parent window to close the popup dialog. if (settings.closeOverlay) { parent.Drupal.overlay.bindChild(window, true); // Use setTimeout to close the child window from a separate thread, // because the current one is busy processing Drupal behaviors. setTimeout(function () { if (typeof settings.redirect == 'string') { parent.Drupal.overlay.redirect(settings.redirect); } else { parent.Drupal.overlay.close(); } }, 1); return; } // If one of the regions displaying outside the overlay needs to be // reloaded immediately, let the parent window know. if (settings.refreshRegions) { parent.Drupal.overlay.refreshRegions(settings.refreshRegions); } // Ok, now we can tell the parent window we're ready. parent.Drupal.overlay.bindChild(window); // IE8 crashes on certain pages if this isn't called; reason unknown. window.scrollTo(window.scrollX, window.scrollY); // Attach child related behaviors to the iframe document. Drupal.overlayChild.attachBehaviors(context, settings); // There are two links within the message that informs people about the // overlay and how to disable it. Make sure both links are visible when // either one has focus and add a class to the wrapper for styling purposes. $('#overlay-disable-message', context) .focusin(function () { $(this).addClass('overlay-disable-message-focused'); $('a.element-focusable', this).removeClass('element-invisible'); }) .focusout(function () { $(this).removeClass('overlay-disable-message-focused'); $('a.element-focusable', this).addClass('element-invisible'); }); } }; /** * Overlay object for child windows. */ Drupal.overlayChild = Drupal.overlayChild || { behaviors: {} }; Drupal.overlayChild.prototype = {}; /** * Attach child related behaviors to the iframe document. */ Drupal.overlayChild.attachBehaviors = function (context, settings) { $.each(this.behaviors, function () { this(context, settings); }); }; /** * Capture and handle clicks. * * Instead of binding a click event handler to every link we bind one to the * document and handle events that bubble up. This also allows other scripts * to bind their own handlers to links and also to prevent overlay's handling. */ Drupal.overlayChild.behaviors.addClickHandler = function (context, settings) { $(document).bind('click.drupal-overlay mouseup.drupal-overlay', $.proxy(parent.Drupal.overlay, 'eventhandlerOverrideLink')); }; /** * Modify forms depending on their relation to the overlay. * * By default, forms are assumed to keep the flow in the overlay. Thus their * action attribute get a ?render=overlay suffix. */ Drupal.overlayChild.behaviors.parseForms = function (context, settings) { $('form', context).once('overlay', function () { // Obtain the action attribute of the form. var action = $(this).attr('action'); // Keep internal forms in the overlay. if (action == undefined || (action.indexOf('http') != 0 && action.indexOf('https') != 0)) { action += (action.indexOf('?') > -1 ? '&' : '?') + 'render=overlay'; $(this).attr('action', action); } // Submit external forms into a new window. else { $(this).attr('target', '_new'); } }); }; /** * Replace the overlay title with a message while loading another page. */ Drupal.overlayChild.behaviors.loading = function (context, settings) { var $title; var text = Drupal.t('Loading'); var dots = ''; $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $title = $('#overlay-title').text(text); var id = setInterval(function () { dots = (dots.length > 10) ? '' : dots + '.'; $title.text(text + dots); }, 500); }); }; /** * Switch active tab immediately. */ Drupal.overlayChild.behaviors.tabs = function (context, settings) { var $tabsLinks = $('#overlay-tabs > li > a'); $('#overlay-tabs > li > a').bind('click.drupal-overlay', function () { var active_tab = Drupal.t('(active tab)'); $tabsLinks.parent().siblings().removeClass('active').find('element-invisible:contains(' + active_tab + ')').appendTo(this); $(this).parent().addClass('active'); }); }; /** * If the shortcut add/delete button exists, move it to the overlay titlebar. */ Drupal.overlayChild.behaviors.shortcutAddLink = function (context, settings) { // Remove any existing shortcut button markup from the titlebar. $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); // If the shortcut add/delete button exists, move it to the titlebar. var $addToShortcuts = $('.add-or-remove-shortcuts'); if ($addToShortcuts.length) { $addToShortcuts.insertAfter('#overlay-title'); } $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); }); }; /** * Use displacement from parent window. */ Drupal.overlayChild.behaviors.alterTableHeaderOffset = function (context, settings) { if (Drupal.settings.tableHeaderOffset) { Drupal.overlayChild.prevTableHeaderOffset = Drupal.settings.tableHeaderOffset; } Drupal.settings.tableHeaderOffset = 'Drupal.overlayChild.tableHeaderOffset'; }; /** * Callback for Drupal.settings.tableHeaderOffset. */ Drupal.overlayChild.tableHeaderOffset = function () { var topOffset = Drupal.overlayChild.prevTableHeaderOffset ? eval(Drupal.overlayChild.prevTableHeaderOffset + '()') : 0; return topOffset + parseInt($(document.body).css('marginTop')); }; })(jQuery); ; (function ($) { /** * Retrieves the summary for the first element. */ $.fn.drupalGetSummary = function () { var callback = this.data('summaryCallback'); return (this[0] && callback) ? $.trim(callback(this[0])) : ''; }; /** * Sets the summary for all matched elements. * * @param callback * Either a function that will be called each time the summary is * retrieved or a string (which is returned each time). */ $.fn.drupalSetSummary = function (callback) { var self = this; // To facilitate things, the callback should always be a function. If it's // not, we wrap it into an anonymous function which just returns the value. if (typeof callback != 'function') { var val = callback; callback = function () { return val; }; } return this .data('summaryCallback', callback) // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind('formUpdated.summary') .bind('formUpdated.summary', function () { self.trigger('summaryUpdated'); }) // The actual summaryUpdated handler doesn't fire when the callback is // changed, so we have to do this manually. .trigger('summaryUpdated'); }; /** * Sends a 'formUpdated' event each time a form element is modified. */ Drupal.behaviors.formUpdated = { attach: function (context) { // These events are namespaced so that we can remove them later. var events = 'change.formUpdated click.formUpdated blur.formUpdated keyup.formUpdated'; $(context) // Since context could be an input element itself, it's added back to // the jQuery object and filtered again. .find(':input').andSelf().filter(':input') // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind(events).bind(events, function () { $(this).trigger('formUpdated'); }); } }; /** * Prepopulate form fields with information from the visitor cookie. */ Drupal.behaviors.fillUserInfoFromCookie = { attach: function (context, settings) { $('form.user-info-from-cookie').once('user-info-from-cookie', function () { var formContext = this; $.each(['name', 'mail', 'homepage'], function () { var $element = $('[name=' + this + ']', formContext); var cookie = $.cookie('Drupal.visitor.' + this); if ($element.length && cookie) { $element.val(cookie); } }); }); } }; })(jQuery); ; (function ($) { /** * The base States namespace. * * Having the local states variable allows us to use the States namespace * without having to always declare "Drupal.states". */ var states = Drupal.states = { // An array of functions that should be postponed. postponed: [] }; /** * Attaches the states. */ Drupal.behaviors.states = { attach: function (context, settings) { for (var selector in settings.states) { for (var state in settings.states[selector]) { new states.Dependent({ element: $(selector), state: states.State.sanitize(state), dependees: settings.states[selector][state] }); } } // Execute all postponed functions now. while (states.postponed.length) { (states.postponed.shift())(); } } }; /** * Object representing an element that depends on other elements. * * @param args * Object with the following keys (all of which are required): * - element: A jQuery object of the dependent element * - state: A State object describing the state that is dependent * - dependees: An object with dependency specifications. Lists all elements * that this element depends on. */ states.Dependent = function (args) { $.extend(this, { values: {}, oldValue: undefined }, args); for (var selector in this.dependees) { this.initializeDependee(selector, this.dependees[selector]); } }; /** * Comparison functions for comparing the value of an element with the * specification from the dependency settings. If the object type can't be * found in this list, the === operator is used by default. */ states.Dependent.comparisons = { 'RegExp': function (reference, value) { return reference.test(value); }, 'Function': function (reference, value) { // The "reference" variable is a comparison function. return reference(value); }, 'Number': function (reference, value) { // If "reference" is a number and "value" is a string, then cast reference // as a string before applying the strict comparison in compare(). Otherwise // numeric keys in the form's #states array fail to match string values // returned from jQuery's val(). return (value.constructor.name === 'String') ? compare(String(reference), value) : compare(reference, value); } }; states.Dependent.prototype = { /** * Initializes one of the elements this dependent depends on. * * @param selector * The CSS selector describing the dependee. * @param dependeeStates * The list of states that have to be monitored for tracking the * dependee's compliance status. */ initializeDependee: function (selector, dependeeStates) { var self = this; // Cache for the states of this dependee. self.values[selector] = {}; $.each(dependeeStates, function (state, value) { state = states.State.sanitize(state); // Initialize the value of this state. self.values[selector][state.pristine] = undefined; // Monitor state changes of the specified state for this dependee. $(selector).bind('state:' + state, function (e) { var complies = self.compare(value, e.value); self.update(selector, state, complies); }); // Make sure the event we just bound ourselves to is actually fired. new states.Trigger({ selector: selector, state: state }); }); }, /** * Compares a value with a reference value. * * @param reference * The value used for reference. * @param value * The value to compare with the reference value. * @return * true, undefined or false. */ compare: function (reference, value) { if (reference.constructor.name in states.Dependent.comparisons) { // Use a custom compare function for certain reference value types. return states.Dependent.comparisons[reference.constructor.name](reference, value); } else { // Do a plain comparison otherwise. return compare(reference, value); } }, /** * Update the value of a dependee's state. * * @param selector * CSS selector describing the dependee. * @param state * A State object describing the dependee's updated state. * @param value * The new value for the dependee's updated state. */ update: function (selector, state, value) { // Only act when the 'new' value is actually new. if (value !== this.values[selector][state.pristine]) { this.values[selector][state.pristine] = value; this.reevaluate(); } }, /** * Triggers change events in case a state changed. */ reevaluate: function () { var value = undefined; // Merge all individual values to find out whether this dependee complies. for (var selector in this.values) { for (var state in this.values[selector]) { state = states.State.sanitize(state); var complies = this.values[selector][state.pristine]; value = ternary(value, invert(complies, state.invert)); } } // Only invoke a state change event when the value actually changed. if (value !== this.oldValue) { // Store the new value so that we can compare later whether the value // actually changed. this.oldValue = value; // Normalize the value to match the normalized state name. value = invert(value, this.state.invert); // By adding "trigger: true", we ensure that state changes don't go into // infinite loops. this.element.trigger({ type: 'state:' + this.state, value: value, trigger: true }); } } }; states.Trigger = function (args) { $.extend(this, args); if (this.state in states.Trigger.states) { this.element = $(this.selector); // Only call the trigger initializer when it wasn't yet attached to this // element. Otherwise we'd end up with duplicate events. if (!this.element.data('trigger:' + this.state)) { this.initialize(); } } }; states.Trigger.prototype = { initialize: function () { var self = this; var trigger = states.Trigger.states[this.state]; if (typeof trigger == 'function') { // We have a custom trigger initialization function. trigger.call(window, this.element); } else { $.each(trigger, function (event, valueFn) { self.defaultTrigger(event, valueFn); }); } // Mark this trigger as initialized for this element. this.element.data('trigger:' + this.state, true); }, defaultTrigger: function (event, valueFn) { var self = this; var oldValue = valueFn.call(this.element); // Attach the event callback. this.element.bind(event, function (e) { var value = valueFn.call(self.element, e); // Only trigger the event if the value has actually changed. if (oldValue !== value) { self.element.trigger({ type: 'state:' + self.state, value: value, oldValue: oldValue }); oldValue = value; } }); states.postponed.push(function () { // Trigger the event once for initialization purposes. self.element.trigger({ type: 'state:' + self.state, value: oldValue, oldValue: undefined }); }); } }; /** * This list of states contains functions that are used to monitor the state * of an element. Whenever an element depends on the state of another element, * one of these trigger functions is added to the dependee so that the * dependent element can be updated. */ states.Trigger.states = { // 'empty' describes the state to be monitored empty: { // 'keyup' is the (native DOM) event that we watch for. 'keyup': function () { // The function associated to that trigger returns the new value for the // state. return this.val() == ''; } }, checked: { 'change': function () { return this.attr('checked'); } }, // For radio buttons, only return the value if the radio button is selected. value: { 'keyup': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); }, 'change': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); } }, collapsed: { 'collapsed': function(e) { return (e !== undefined && 'value' in e) ? e.value : this.is('.collapsed'); } } }; /** * A state object is used for describing the state and performing aliasing. */ states.State = function(state) { // We may need the original unresolved name later. this.pristine = this.name = state; // Normalize the state name. while (true) { // Iteratively remove exclamation marks and invert the value. while (this.name.charAt(0) == '!') { this.name = this.name.substring(1); this.invert = !this.invert; } // Replace the state with its normalized name. if (this.name in states.State.aliases) { this.name = states.State.aliases[this.name]; } else { break; } } }; /** * Create a new State object by sanitizing the passed value. */ states.State.sanitize = function (state) { if (state instanceof states.State) { return state; } else { return new states.State(state); } }; /** * This list of aliases is used to normalize states and associates negated names * with their respective inverse state. */ states.State.aliases = { 'enabled': '!disabled', 'invisible': '!visible', 'invalid': '!valid', 'untouched': '!touched', 'optional': '!required', 'filled': '!empty', 'unchecked': '!checked', 'irrelevant': '!relevant', 'expanded': '!collapsed', 'readwrite': '!readonly' }; states.State.prototype = { invert: false, /** * Ensures that just using the state object returns the name. */ toString: function() { return this.name; } }; /** * Global state change handlers. These are bound to "document" to cover all * elements whose state changes. Events sent to elements within the page * bubble up to these handlers. We use this system so that themes and modules * can override these state change handlers for particular parts of a page. */ { $(document).bind('state:disabled', function(e) { // Only act when this change was triggered by a dependency and not by the // element monitoring itself. if (e.trigger) { $(e.target) .attr('disabled', e.value) .filter('.form-element') .closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'addClass' : 'removeClass']('form-disabled'); // Note: WebKit nightlies don't reflect that change correctly. // See https://bugs.webkit.org/show_bug.cgi?id=23789 } }); $(document).bind('state:required', function(e) { if (e.trigger) { if (e.value) { $(e.target).closest('.form-item, .form-wrapper').find('label').append('<span class="form-required">*</span>'); } else { $(e.target).closest('.form-item, .form-wrapper').find('label .form-required').remove(); } } }); $(document).bind('state:visible', function(e) { if (e.trigger) { $(e.target).closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'show' : 'hide'](); } }); $(document).bind('state:checked', function(e) { if (e.trigger) { $(e.target).attr('checked', e.value); } }); $(document).bind('state:collapsed', function(e) { if (e.trigger) { if ($(e.target).is('.collapsed') !== e.value) { $('> legend a', e.target).click(); } } }); } /** * These are helper functions implementing addition "operators" and don't * implement any logic that is particular to states. */ { // Bitwise AND with a third undefined state. function ternary (a, b) { return a === undefined ? b : (b === undefined ? a : a && b); }; // Inverts a (if it's not undefined) when invert is true. function invert (a, invert) { return (invert && a !== undefined) ? !a : a; }; // Compares two values while ignoring undefined values. function compare (a, b)
} })(jQuery); ;
{ return (a === b) ? (a === undefined ? a : true) : (a === undefined || b === undefined); }
identifier_body
js_Fc4I144XPrPKyUpaWv36lNESuazCkfla6EpZyDPBOQk.js
(function ($) { /** * Attach the child dialog behavior to new content. */ Drupal.behaviors.overlayChild = { attach: function (context, settings) { // Make sure this behavior is not processed more than once. if (this.processed) { return; } this.processed = true; // If we cannot reach the parent window, break out of the overlay. if (!parent.Drupal || !parent.Drupal.overlay) { window.location = window.location.href.replace(/([?&]?)render=overlay&?/g, '$1').replace(/\?$/, ''); } var settings = settings.overlayChild || {}; // If the entire parent window should be refreshed when the overlay is // closed, pass that information to the parent window. if (settings.refreshPage) { parent.Drupal.overlay.refreshPage = true; } // If a form has been submitted successfully, then the server side script // may have decided to tell the parent window to close the popup dialog. if (settings.closeOverlay) { parent.Drupal.overlay.bindChild(window, true); // Use setTimeout to close the child window from a separate thread, // because the current one is busy processing Drupal behaviors. setTimeout(function () { if (typeof settings.redirect == 'string') { parent.Drupal.overlay.redirect(settings.redirect); } else { parent.Drupal.overlay.close(); } }, 1); return; } // If one of the regions displaying outside the overlay needs to be // reloaded immediately, let the parent window know. if (settings.refreshRegions) { parent.Drupal.overlay.refreshRegions(settings.refreshRegions); } // Ok, now we can tell the parent window we're ready. parent.Drupal.overlay.bindChild(window); // IE8 crashes on certain pages if this isn't called; reason unknown. window.scrollTo(window.scrollX, window.scrollY); // Attach child related behaviors to the iframe document. Drupal.overlayChild.attachBehaviors(context, settings); // There are two links within the message that informs people about the // overlay and how to disable it. Make sure both links are visible when // either one has focus and add a class to the wrapper for styling purposes. $('#overlay-disable-message', context) .focusin(function () { $(this).addClass('overlay-disable-message-focused'); $('a.element-focusable', this).removeClass('element-invisible'); }) .focusout(function () { $(this).removeClass('overlay-disable-message-focused'); $('a.element-focusable', this).addClass('element-invisible'); }); } }; /** * Overlay object for child windows. */ Drupal.overlayChild = Drupal.overlayChild || { behaviors: {} }; Drupal.overlayChild.prototype = {}; /** * Attach child related behaviors to the iframe document. */ Drupal.overlayChild.attachBehaviors = function (context, settings) { $.each(this.behaviors, function () { this(context, settings); }); }; /** * Capture and handle clicks. * * Instead of binding a click event handler to every link we bind one to the * document and handle events that bubble up. This also allows other scripts * to bind their own handlers to links and also to prevent overlay's handling. */ Drupal.overlayChild.behaviors.addClickHandler = function (context, settings) { $(document).bind('click.drupal-overlay mouseup.drupal-overlay', $.proxy(parent.Drupal.overlay, 'eventhandlerOverrideLink')); }; /** * Modify forms depending on their relation to the overlay. * * By default, forms are assumed to keep the flow in the overlay. Thus their * action attribute get a ?render=overlay suffix. */ Drupal.overlayChild.behaviors.parseForms = function (context, settings) { $('form', context).once('overlay', function () { // Obtain the action attribute of the form. var action = $(this).attr('action'); // Keep internal forms in the overlay. if (action == undefined || (action.indexOf('http') != 0 && action.indexOf('https') != 0)) { action += (action.indexOf('?') > -1 ? '&' : '?') + 'render=overlay'; $(this).attr('action', action); } // Submit external forms into a new window. else { $(this).attr('target', '_new'); } }); }; /** * Replace the overlay title with a message while loading another page. */ Drupal.overlayChild.behaviors.loading = function (context, settings) { var $title; var text = Drupal.t('Loading'); var dots = ''; $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $title = $('#overlay-title').text(text); var id = setInterval(function () { dots = (dots.length > 10) ? '' : dots + '.'; $title.text(text + dots); }, 500); }); }; /** * Switch active tab immediately. */ Drupal.overlayChild.behaviors.tabs = function (context, settings) { var $tabsLinks = $('#overlay-tabs > li > a'); $('#overlay-tabs > li > a').bind('click.drupal-overlay', function () { var active_tab = Drupal.t('(active tab)'); $tabsLinks.parent().siblings().removeClass('active').find('element-invisible:contains(' + active_tab + ')').appendTo(this); $(this).parent().addClass('active'); }); }; /** * If the shortcut add/delete button exists, move it to the overlay titlebar. */ Drupal.overlayChild.behaviors.shortcutAddLink = function (context, settings) { // Remove any existing shortcut button markup from the titlebar. $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); // If the shortcut add/delete button exists, move it to the titlebar. var $addToShortcuts = $('.add-or-remove-shortcuts'); if ($addToShortcuts.length) { $addToShortcuts.insertAfter('#overlay-title'); } $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); }); }; /** * Use displacement from parent window. */ Drupal.overlayChild.behaviors.alterTableHeaderOffset = function (context, settings) { if (Drupal.settings.tableHeaderOffset) { Drupal.overlayChild.prevTableHeaderOffset = Drupal.settings.tableHeaderOffset; } Drupal.settings.tableHeaderOffset = 'Drupal.overlayChild.tableHeaderOffset'; }; /** * Callback for Drupal.settings.tableHeaderOffset. */ Drupal.overlayChild.tableHeaderOffset = function () { var topOffset = Drupal.overlayChild.prevTableHeaderOffset ? eval(Drupal.overlayChild.prevTableHeaderOffset + '()') : 0; return topOffset + parseInt($(document.body).css('marginTop')); }; })(jQuery); ; (function ($) { /** * Retrieves the summary for the first element. */ $.fn.drupalGetSummary = function () { var callback = this.data('summaryCallback'); return (this[0] && callback) ? $.trim(callback(this[0])) : ''; }; /** * Sets the summary for all matched elements. * * @param callback * Either a function that will be called each time the summary is * retrieved or a string (which is returned each time). */ $.fn.drupalSetSummary = function (callback) { var self = this; // To facilitate things, the callback should always be a function. If it's // not, we wrap it into an anonymous function which just returns the value. if (typeof callback != 'function') { var val = callback; callback = function () { return val; }; } return this .data('summaryCallback', callback) // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind('formUpdated.summary') .bind('formUpdated.summary', function () { self.trigger('summaryUpdated'); }) // The actual summaryUpdated handler doesn't fire when the callback is // changed, so we have to do this manually. .trigger('summaryUpdated'); }; /** * Sends a 'formUpdated' event each time a form element is modified. */ Drupal.behaviors.formUpdated = { attach: function (context) { // These events are namespaced so that we can remove them later. var events = 'change.formUpdated click.formUpdated blur.formUpdated keyup.formUpdated'; $(context) // Since context could be an input element itself, it's added back to // the jQuery object and filtered again. .find(':input').andSelf().filter(':input') // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind(events).bind(events, function () { $(this).trigger('formUpdated'); }); } }; /** * Prepopulate form fields with information from the visitor cookie. */ Drupal.behaviors.fillUserInfoFromCookie = { attach: function (context, settings) { $('form.user-info-from-cookie').once('user-info-from-cookie', function () { var formContext = this; $.each(['name', 'mail', 'homepage'], function () { var $element = $('[name=' + this + ']', formContext); var cookie = $.cookie('Drupal.visitor.' + this); if ($element.length && cookie) { $element.val(cookie); } }); }); } }; })(jQuery); ; (function ($) { /** * The base States namespace. * * Having the local states variable allows us to use the States namespace * without having to always declare "Drupal.states". */ var states = Drupal.states = { // An array of functions that should be postponed. postponed: [] }; /** * Attaches the states. */ Drupal.behaviors.states = { attach: function (context, settings) { for (var selector in settings.states) { for (var state in settings.states[selector]) { new states.Dependent({ element: $(selector), state: states.State.sanitize(state), dependees: settings.states[selector][state] }); } } // Execute all postponed functions now. while (states.postponed.length) { (states.postponed.shift())(); } } }; /** * Object representing an element that depends on other elements. * * @param args * Object with the following keys (all of which are required): * - element: A jQuery object of the dependent element * - state: A State object describing the state that is dependent * - dependees: An object with dependency specifications. Lists all elements * that this element depends on. */ states.Dependent = function (args) { $.extend(this, { values: {}, oldValue: undefined }, args); for (var selector in this.dependees) { this.initializeDependee(selector, this.dependees[selector]); } }; /** * Comparison functions for comparing the value of an element with the * specification from the dependency settings. If the object type can't be * found in this list, the === operator is used by default. */ states.Dependent.comparisons = { 'RegExp': function (reference, value) { return reference.test(value); }, 'Function': function (reference, value) { // The "reference" variable is a comparison function. return reference(value); }, 'Number': function (reference, value) { // If "reference" is a number and "value" is a string, then cast reference // as a string before applying the strict comparison in compare(). Otherwise // numeric keys in the form's #states array fail to match string values // returned from jQuery's val(). return (value.constructor.name === 'String') ? compare(String(reference), value) : compare(reference, value); } }; states.Dependent.prototype = { /** * Initializes one of the elements this dependent depends on. * * @param selector * The CSS selector describing the dependee. * @param dependeeStates * The list of states that have to be monitored for tracking the * dependee's compliance status. */ initializeDependee: function (selector, dependeeStates) { var self = this; // Cache for the states of this dependee. self.values[selector] = {}; $.each(dependeeStates, function (state, value) { state = states.State.sanitize(state); // Initialize the value of this state. self.values[selector][state.pristine] = undefined; // Monitor state changes of the specified state for this dependee. $(selector).bind('state:' + state, function (e) { var complies = self.compare(value, e.value); self.update(selector, state, complies); }); // Make sure the event we just bound ourselves to is actually fired. new states.Trigger({ selector: selector, state: state }); }); }, /** * Compares a value with a reference value. * * @param reference * The value used for reference. * @param value * The value to compare with the reference value. * @return * true, undefined or false. */ compare: function (reference, value) { if (reference.constructor.name in states.Dependent.comparisons) { // Use a custom compare function for certain reference value types. return states.Dependent.comparisons[reference.constructor.name](reference, value); } else { // Do a plain comparison otherwise. return compare(reference, value); } }, /** * Update the value of a dependee's state. * * @param selector * CSS selector describing the dependee. * @param state * A State object describing the dependee's updated state. * @param value * The new value for the dependee's updated state. */ update: function (selector, state, value) { // Only act when the 'new' value is actually new. if (value !== this.values[selector][state.pristine])
}, /** * Triggers change events in case a state changed. */ reevaluate: function () { var value = undefined; // Merge all individual values to find out whether this dependee complies. for (var selector in this.values) { for (var state in this.values[selector]) { state = states.State.sanitize(state); var complies = this.values[selector][state.pristine]; value = ternary(value, invert(complies, state.invert)); } } // Only invoke a state change event when the value actually changed. if (value !== this.oldValue) { // Store the new value so that we can compare later whether the value // actually changed. this.oldValue = value; // Normalize the value to match the normalized state name. value = invert(value, this.state.invert); // By adding "trigger: true", we ensure that state changes don't go into // infinite loops. this.element.trigger({ type: 'state:' + this.state, value: value, trigger: true }); } } }; states.Trigger = function (args) { $.extend(this, args); if (this.state in states.Trigger.states) { this.element = $(this.selector); // Only call the trigger initializer when it wasn't yet attached to this // element. Otherwise we'd end up with duplicate events. if (!this.element.data('trigger:' + this.state)) { this.initialize(); } } }; states.Trigger.prototype = { initialize: function () { var self = this; var trigger = states.Trigger.states[this.state]; if (typeof trigger == 'function') { // We have a custom trigger initialization function. trigger.call(window, this.element); } else { $.each(trigger, function (event, valueFn) { self.defaultTrigger(event, valueFn); }); } // Mark this trigger as initialized for this element. this.element.data('trigger:' + this.state, true); }, defaultTrigger: function (event, valueFn) { var self = this; var oldValue = valueFn.call(this.element); // Attach the event callback. this.element.bind(event, function (e) { var value = valueFn.call(self.element, e); // Only trigger the event if the value has actually changed. if (oldValue !== value) { self.element.trigger({ type: 'state:' + self.state, value: value, oldValue: oldValue }); oldValue = value; } }); states.postponed.push(function () { // Trigger the event once for initialization purposes. self.element.trigger({ type: 'state:' + self.state, value: oldValue, oldValue: undefined }); }); } }; /** * This list of states contains functions that are used to monitor the state * of an element. Whenever an element depends on the state of another element, * one of these trigger functions is added to the dependee so that the * dependent element can be updated. */ states.Trigger.states = { // 'empty' describes the state to be monitored empty: { // 'keyup' is the (native DOM) event that we watch for. 'keyup': function () { // The function associated to that trigger returns the new value for the // state. return this.val() == ''; } }, checked: { 'change': function () { return this.attr('checked'); } }, // For radio buttons, only return the value if the radio button is selected. value: { 'keyup': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); }, 'change': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); } }, collapsed: { 'collapsed': function(e) { return (e !== undefined && 'value' in e) ? e.value : this.is('.collapsed'); } } }; /** * A state object is used for describing the state and performing aliasing. */ states.State = function(state) { // We may need the original unresolved name later. this.pristine = this.name = state; // Normalize the state name. while (true) { // Iteratively remove exclamation marks and invert the value. while (this.name.charAt(0) == '!') { this.name = this.name.substring(1); this.invert = !this.invert; } // Replace the state with its normalized name. if (this.name in states.State.aliases) { this.name = states.State.aliases[this.name]; } else { break; } } }; /** * Create a new State object by sanitizing the passed value. */ states.State.sanitize = function (state) { if (state instanceof states.State) { return state; } else { return new states.State(state); } }; /** * This list of aliases is used to normalize states and associates negated names * with their respective inverse state. */ states.State.aliases = { 'enabled': '!disabled', 'invisible': '!visible', 'invalid': '!valid', 'untouched': '!touched', 'optional': '!required', 'filled': '!empty', 'unchecked': '!checked', 'irrelevant': '!relevant', 'expanded': '!collapsed', 'readwrite': '!readonly' }; states.State.prototype = { invert: false, /** * Ensures that just using the state object returns the name. */ toString: function() { return this.name; } }; /** * Global state change handlers. These are bound to "document" to cover all * elements whose state changes. Events sent to elements within the page * bubble up to these handlers. We use this system so that themes and modules * can override these state change handlers for particular parts of a page. */ { $(document).bind('state:disabled', function(e) { // Only act when this change was triggered by a dependency and not by the // element monitoring itself. if (e.trigger) { $(e.target) .attr('disabled', e.value) .filter('.form-element') .closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'addClass' : 'removeClass']('form-disabled'); // Note: WebKit nightlies don't reflect that change correctly. // See https://bugs.webkit.org/show_bug.cgi?id=23789 } }); $(document).bind('state:required', function(e) { if (e.trigger) { if (e.value) { $(e.target).closest('.form-item, .form-wrapper').find('label').append('<span class="form-required">*</span>'); } else { $(e.target).closest('.form-item, .form-wrapper').find('label .form-required').remove(); } } }); $(document).bind('state:visible', function(e) { if (e.trigger) { $(e.target).closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'show' : 'hide'](); } }); $(document).bind('state:checked', function(e) { if (e.trigger) { $(e.target).attr('checked', e.value); } }); $(document).bind('state:collapsed', function(e) { if (e.trigger) { if ($(e.target).is('.collapsed') !== e.value) { $('> legend a', e.target).click(); } } }); } /** * These are helper functions implementing addition "operators" and don't * implement any logic that is particular to states. */ { // Bitwise AND with a third undefined state. function ternary (a, b) { return a === undefined ? b : (b === undefined ? a : a && b); }; // Inverts a (if it's not undefined) when invert is true. function invert (a, invert) { return (invert && a !== undefined) ? !a : a; }; // Compares two values while ignoring undefined values. function compare (a, b) { return (a === b) ? (a === undefined ? a : true) : (a === undefined || b === undefined); } } })(jQuery); ;
{ this.values[selector][state.pristine] = value; this.reevaluate(); }
conditional_block
js_Fc4I144XPrPKyUpaWv36lNESuazCkfla6EpZyDPBOQk.js
(function ($) { /** * Attach the child dialog behavior to new content. */ Drupal.behaviors.overlayChild = { attach: function (context, settings) { // Make sure this behavior is not processed more than once. if (this.processed) { return; } this.processed = true; // If we cannot reach the parent window, break out of the overlay. if (!parent.Drupal || !parent.Drupal.overlay) { window.location = window.location.href.replace(/([?&]?)render=overlay&?/g, '$1').replace(/\?$/, ''); } var settings = settings.overlayChild || {}; // If the entire parent window should be refreshed when the overlay is // closed, pass that information to the parent window. if (settings.refreshPage) { parent.Drupal.overlay.refreshPage = true; } // If a form has been submitted successfully, then the server side script // may have decided to tell the parent window to close the popup dialog. if (settings.closeOverlay) { parent.Drupal.overlay.bindChild(window, true); // Use setTimeout to close the child window from a separate thread, // because the current one is busy processing Drupal behaviors. setTimeout(function () { if (typeof settings.redirect == 'string') { parent.Drupal.overlay.redirect(settings.redirect); } else { parent.Drupal.overlay.close(); } }, 1); return; } // If one of the regions displaying outside the overlay needs to be // reloaded immediately, let the parent window know. if (settings.refreshRegions) { parent.Drupal.overlay.refreshRegions(settings.refreshRegions); } // Ok, now we can tell the parent window we're ready. parent.Drupal.overlay.bindChild(window); // IE8 crashes on certain pages if this isn't called; reason unknown. window.scrollTo(window.scrollX, window.scrollY); // Attach child related behaviors to the iframe document. Drupal.overlayChild.attachBehaviors(context, settings); // There are two links within the message that informs people about the // overlay and how to disable it. Make sure both links are visible when // either one has focus and add a class to the wrapper for styling purposes. $('#overlay-disable-message', context) .focusin(function () { $(this).addClass('overlay-disable-message-focused'); $('a.element-focusable', this).removeClass('element-invisible'); }) .focusout(function () { $(this).removeClass('overlay-disable-message-focused'); $('a.element-focusable', this).addClass('element-invisible'); }); } }; /** * Overlay object for child windows. */ Drupal.overlayChild = Drupal.overlayChild || { behaviors: {} }; Drupal.overlayChild.prototype = {}; /** * Attach child related behaviors to the iframe document. */ Drupal.overlayChild.attachBehaviors = function (context, settings) { $.each(this.behaviors, function () { this(context, settings); }); }; /** * Capture and handle clicks. * * Instead of binding a click event handler to every link we bind one to the * document and handle events that bubble up. This also allows other scripts * to bind their own handlers to links and also to prevent overlay's handling. */ Drupal.overlayChild.behaviors.addClickHandler = function (context, settings) { $(document).bind('click.drupal-overlay mouseup.drupal-overlay', $.proxy(parent.Drupal.overlay, 'eventhandlerOverrideLink')); }; /** * Modify forms depending on their relation to the overlay. * * By default, forms are assumed to keep the flow in the overlay. Thus their * action attribute get a ?render=overlay suffix. */ Drupal.overlayChild.behaviors.parseForms = function (context, settings) { $('form', context).once('overlay', function () { // Obtain the action attribute of the form. var action = $(this).attr('action'); // Keep internal forms in the overlay. if (action == undefined || (action.indexOf('http') != 0 && action.indexOf('https') != 0)) { action += (action.indexOf('?') > -1 ? '&' : '?') + 'render=overlay'; $(this).attr('action', action); } // Submit external forms into a new window. else { $(this).attr('target', '_new'); } }); }; /** * Replace the overlay title with a message while loading another page. */ Drupal.overlayChild.behaviors.loading = function (context, settings) { var $title; var text = Drupal.t('Loading'); var dots = ''; $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $title = $('#overlay-title').text(text); var id = setInterval(function () { dots = (dots.length > 10) ? '' : dots + '.'; $title.text(text + dots); }, 500); }); }; /** * Switch active tab immediately. */ Drupal.overlayChild.behaviors.tabs = function (context, settings) { var $tabsLinks = $('#overlay-tabs > li > a'); $('#overlay-tabs > li > a').bind('click.drupal-overlay', function () { var active_tab = Drupal.t('(active tab)'); $tabsLinks.parent().siblings().removeClass('active').find('element-invisible:contains(' + active_tab + ')').appendTo(this); $(this).parent().addClass('active'); }); }; /** * If the shortcut add/delete button exists, move it to the overlay titlebar. */ Drupal.overlayChild.behaviors.shortcutAddLink = function (context, settings) { // Remove any existing shortcut button markup from the titlebar. $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); // If the shortcut add/delete button exists, move it to the titlebar. var $addToShortcuts = $('.add-or-remove-shortcuts'); if ($addToShortcuts.length) { $addToShortcuts.insertAfter('#overlay-title'); } $(document).bind('drupalOverlayBeforeLoad.drupal-overlay.drupal-overlay-child-loading', function () { $('#overlay-titlebar').find('.add-or-remove-shortcuts').remove(); }); }; /** * Use displacement from parent window. */ Drupal.overlayChild.behaviors.alterTableHeaderOffset = function (context, settings) { if (Drupal.settings.tableHeaderOffset) { Drupal.overlayChild.prevTableHeaderOffset = Drupal.settings.tableHeaderOffset; } Drupal.settings.tableHeaderOffset = 'Drupal.overlayChild.tableHeaderOffset'; }; /** * Callback for Drupal.settings.tableHeaderOffset. */ Drupal.overlayChild.tableHeaderOffset = function () { var topOffset = Drupal.overlayChild.prevTableHeaderOffset ? eval(Drupal.overlayChild.prevTableHeaderOffset + '()') : 0; return topOffset + parseInt($(document.body).css('marginTop')); }; })(jQuery); ; (function ($) { /** * Retrieves the summary for the first element. */ $.fn.drupalGetSummary = function () { var callback = this.data('summaryCallback'); return (this[0] && callback) ? $.trim(callback(this[0])) : ''; }; /** * Sets the summary for all matched elements. * * @param callback * Either a function that will be called each time the summary is * retrieved or a string (which is returned each time). */ $.fn.drupalSetSummary = function (callback) { var self = this; // To facilitate things, the callback should always be a function. If it's // not, we wrap it into an anonymous function which just returns the value. if (typeof callback != 'function') { var val = callback; callback = function () { return val; }; } return this .data('summaryCallback', callback) // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind('formUpdated.summary') .bind('formUpdated.summary', function () { self.trigger('summaryUpdated'); }) // The actual summaryUpdated handler doesn't fire when the callback is // changed, so we have to do this manually. .trigger('summaryUpdated'); }; /** * Sends a 'formUpdated' event each time a form element is modified. */ Drupal.behaviors.formUpdated = { attach: function (context) { // These events are namespaced so that we can remove them later. var events = 'change.formUpdated click.formUpdated blur.formUpdated keyup.formUpdated'; $(context) // Since context could be an input element itself, it's added back to // the jQuery object and filtered again. .find(':input').andSelf().filter(':input') // To prevent duplicate events, the handlers are first removed and then // (re-)added. .unbind(events).bind(events, function () { $(this).trigger('formUpdated'); }); } }; /** * Prepopulate form fields with information from the visitor cookie. */ Drupal.behaviors.fillUserInfoFromCookie = { attach: function (context, settings) { $('form.user-info-from-cookie').once('user-info-from-cookie', function () { var formContext = this; $.each(['name', 'mail', 'homepage'], function () { var $element = $('[name=' + this + ']', formContext); var cookie = $.cookie('Drupal.visitor.' + this); if ($element.length && cookie) { $element.val(cookie); } }); }); } }; })(jQuery); ; (function ($) { /** * The base States namespace. * * Having the local states variable allows us to use the States namespace
var states = Drupal.states = { // An array of functions that should be postponed. postponed: [] }; /** * Attaches the states. */ Drupal.behaviors.states = { attach: function (context, settings) { for (var selector in settings.states) { for (var state in settings.states[selector]) { new states.Dependent({ element: $(selector), state: states.State.sanitize(state), dependees: settings.states[selector][state] }); } } // Execute all postponed functions now. while (states.postponed.length) { (states.postponed.shift())(); } } }; /** * Object representing an element that depends on other elements. * * @param args * Object with the following keys (all of which are required): * - element: A jQuery object of the dependent element * - state: A State object describing the state that is dependent * - dependees: An object with dependency specifications. Lists all elements * that this element depends on. */ states.Dependent = function (args) { $.extend(this, { values: {}, oldValue: undefined }, args); for (var selector in this.dependees) { this.initializeDependee(selector, this.dependees[selector]); } }; /** * Comparison functions for comparing the value of an element with the * specification from the dependency settings. If the object type can't be * found in this list, the === operator is used by default. */ states.Dependent.comparisons = { 'RegExp': function (reference, value) { return reference.test(value); }, 'Function': function (reference, value) { // The "reference" variable is a comparison function. return reference(value); }, 'Number': function (reference, value) { // If "reference" is a number and "value" is a string, then cast reference // as a string before applying the strict comparison in compare(). Otherwise // numeric keys in the form's #states array fail to match string values // returned from jQuery's val(). return (value.constructor.name === 'String') ? compare(String(reference), value) : compare(reference, value); } }; states.Dependent.prototype = { /** * Initializes one of the elements this dependent depends on. * * @param selector * The CSS selector describing the dependee. * @param dependeeStates * The list of states that have to be monitored for tracking the * dependee's compliance status. */ initializeDependee: function (selector, dependeeStates) { var self = this; // Cache for the states of this dependee. self.values[selector] = {}; $.each(dependeeStates, function (state, value) { state = states.State.sanitize(state); // Initialize the value of this state. self.values[selector][state.pristine] = undefined; // Monitor state changes of the specified state for this dependee. $(selector).bind('state:' + state, function (e) { var complies = self.compare(value, e.value); self.update(selector, state, complies); }); // Make sure the event we just bound ourselves to is actually fired. new states.Trigger({ selector: selector, state: state }); }); }, /** * Compares a value with a reference value. * * @param reference * The value used for reference. * @param value * The value to compare with the reference value. * @return * true, undefined or false. */ compare: function (reference, value) { if (reference.constructor.name in states.Dependent.comparisons) { // Use a custom compare function for certain reference value types. return states.Dependent.comparisons[reference.constructor.name](reference, value); } else { // Do a plain comparison otherwise. return compare(reference, value); } }, /** * Update the value of a dependee's state. * * @param selector * CSS selector describing the dependee. * @param state * A State object describing the dependee's updated state. * @param value * The new value for the dependee's updated state. */ update: function (selector, state, value) { // Only act when the 'new' value is actually new. if (value !== this.values[selector][state.pristine]) { this.values[selector][state.pristine] = value; this.reevaluate(); } }, /** * Triggers change events in case a state changed. */ reevaluate: function () { var value = undefined; // Merge all individual values to find out whether this dependee complies. for (var selector in this.values) { for (var state in this.values[selector]) { state = states.State.sanitize(state); var complies = this.values[selector][state.pristine]; value = ternary(value, invert(complies, state.invert)); } } // Only invoke a state change event when the value actually changed. if (value !== this.oldValue) { // Store the new value so that we can compare later whether the value // actually changed. this.oldValue = value; // Normalize the value to match the normalized state name. value = invert(value, this.state.invert); // By adding "trigger: true", we ensure that state changes don't go into // infinite loops. this.element.trigger({ type: 'state:' + this.state, value: value, trigger: true }); } } }; states.Trigger = function (args) { $.extend(this, args); if (this.state in states.Trigger.states) { this.element = $(this.selector); // Only call the trigger initializer when it wasn't yet attached to this // element. Otherwise we'd end up with duplicate events. if (!this.element.data('trigger:' + this.state)) { this.initialize(); } } }; states.Trigger.prototype = { initialize: function () { var self = this; var trigger = states.Trigger.states[this.state]; if (typeof trigger == 'function') { // We have a custom trigger initialization function. trigger.call(window, this.element); } else { $.each(trigger, function (event, valueFn) { self.defaultTrigger(event, valueFn); }); } // Mark this trigger as initialized for this element. this.element.data('trigger:' + this.state, true); }, defaultTrigger: function (event, valueFn) { var self = this; var oldValue = valueFn.call(this.element); // Attach the event callback. this.element.bind(event, function (e) { var value = valueFn.call(self.element, e); // Only trigger the event if the value has actually changed. if (oldValue !== value) { self.element.trigger({ type: 'state:' + self.state, value: value, oldValue: oldValue }); oldValue = value; } }); states.postponed.push(function () { // Trigger the event once for initialization purposes. self.element.trigger({ type: 'state:' + self.state, value: oldValue, oldValue: undefined }); }); } }; /** * This list of states contains functions that are used to monitor the state * of an element. Whenever an element depends on the state of another element, * one of these trigger functions is added to the dependee so that the * dependent element can be updated. */ states.Trigger.states = { // 'empty' describes the state to be monitored empty: { // 'keyup' is the (native DOM) event that we watch for. 'keyup': function () { // The function associated to that trigger returns the new value for the // state. return this.val() == ''; } }, checked: { 'change': function () { return this.attr('checked'); } }, // For radio buttons, only return the value if the radio button is selected. value: { 'keyup': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); }, 'change': function () { // Radio buttons share the same :input[name="key"] selector. if (this.length > 1) { // Initial checked value of radios is undefined, so we return false. return this.filter(':checked').val() || false; } return this.val(); } }, collapsed: { 'collapsed': function(e) { return (e !== undefined && 'value' in e) ? e.value : this.is('.collapsed'); } } }; /** * A state object is used for describing the state and performing aliasing. */ states.State = function(state) { // We may need the original unresolved name later. this.pristine = this.name = state; // Normalize the state name. while (true) { // Iteratively remove exclamation marks and invert the value. while (this.name.charAt(0) == '!') { this.name = this.name.substring(1); this.invert = !this.invert; } // Replace the state with its normalized name. if (this.name in states.State.aliases) { this.name = states.State.aliases[this.name]; } else { break; } } }; /** * Create a new State object by sanitizing the passed value. */ states.State.sanitize = function (state) { if (state instanceof states.State) { return state; } else { return new states.State(state); } }; /** * This list of aliases is used to normalize states and associates negated names * with their respective inverse state. */ states.State.aliases = { 'enabled': '!disabled', 'invisible': '!visible', 'invalid': '!valid', 'untouched': '!touched', 'optional': '!required', 'filled': '!empty', 'unchecked': '!checked', 'irrelevant': '!relevant', 'expanded': '!collapsed', 'readwrite': '!readonly' }; states.State.prototype = { invert: false, /** * Ensures that just using the state object returns the name. */ toString: function() { return this.name; } }; /** * Global state change handlers. These are bound to "document" to cover all * elements whose state changes. Events sent to elements within the page * bubble up to these handlers. We use this system so that themes and modules * can override these state change handlers for particular parts of a page. */ { $(document).bind('state:disabled', function(e) { // Only act when this change was triggered by a dependency and not by the // element monitoring itself. if (e.trigger) { $(e.target) .attr('disabled', e.value) .filter('.form-element') .closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'addClass' : 'removeClass']('form-disabled'); // Note: WebKit nightlies don't reflect that change correctly. // See https://bugs.webkit.org/show_bug.cgi?id=23789 } }); $(document).bind('state:required', function(e) { if (e.trigger) { if (e.value) { $(e.target).closest('.form-item, .form-wrapper').find('label').append('<span class="form-required">*</span>'); } else { $(e.target).closest('.form-item, .form-wrapper').find('label .form-required').remove(); } } }); $(document).bind('state:visible', function(e) { if (e.trigger) { $(e.target).closest('.form-item, .form-submit, .form-wrapper')[e.value ? 'show' : 'hide'](); } }); $(document).bind('state:checked', function(e) { if (e.trigger) { $(e.target).attr('checked', e.value); } }); $(document).bind('state:collapsed', function(e) { if (e.trigger) { if ($(e.target).is('.collapsed') !== e.value) { $('> legend a', e.target).click(); } } }); } /** * These are helper functions implementing addition "operators" and don't * implement any logic that is particular to states. */ { // Bitwise AND with a third undefined state. function ternary (a, b) { return a === undefined ? b : (b === undefined ? a : a && b); }; // Inverts a (if it's not undefined) when invert is true. function invert (a, invert) { return (invert && a !== undefined) ? !a : a; }; // Compares two values while ignoring undefined values. function compare (a, b) { return (a === b) ? (a === undefined ? a : true) : (a === undefined || b === undefined); } } })(jQuery); ;
* without having to always declare "Drupal.states". */
random_line_split
AIReviewStream.tsx
/* * Copyright (C) 2012-2022 Online-Go.com * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Affero General Public License as * published by the Free Software Foundation, either version 3 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Affero General Public License for more details. * * You should have received a copy of the GNU Affero General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ import * as React from "react"; import * as data from "data"; import { ai_socket } from "sockets"; import { MoveTree } from "goban"; import { IdType } from "src/lib/types"; const analysis_requests_made: { [id: string]: boolean } = {}; interface AIReviewStreamProperties { uuid?: string; game_id?: IdType; ai_review_id?: IdType; callback: (data: any) => any; } export function AIReviewStream(props: AIReviewStreamProperties): JSX.Element { const uuid = props.uuid; const game_id = props.game_id; const ai_review_id = props.ai_review_id; React.useEffect(() => { if (!props.uuid) { console.log("No UUID for review stream"); return; } else { ai_socket.on("connect", onConnect); ai_socket.on(uuid, onMessage); if (ai_socket.connected) { onConnect(); } } function onJwtChange() { const user = data.get("config.user"); const user_jwt = data.get("config.user_jwt"); if (!user.anonymous && user_jwt) { ai_socket.send("authenticate", { jwt: user_jwt }); } } function watch_jwt() { data.watch("config.user_jwt", onJwtChange); } function unwatch_jwt()
function onConnect() { ai_socket.send("ai-review-connect", { uuid, game_id, ai_review_id }); watch_jwt(); } function onMessage(data: any) { props.callback(data); } return () => { if (ai_socket.connected) { ai_socket.send("ai-review-disconnect", { uuid }); } ai_socket.off("connect", onConnect); ai_socket.off(uuid, onMessage); unwatch_jwt(); }; }, [uuid]); return null; } export function ai_request_variation_analysis( uuid, game_id, ai_review_id, cur_move: MoveTree, trunk_move: MoveTree, ): void { if (!ai_socket.connected) { console.warn( "Not sending request for variation analysis since we wern't connected to the AI server", ); return; } const trunk_move_string = trunk_move.getMoveStringToThisPoint(); const cur_move_string = cur_move.getMoveStringToThisPoint(); const variation = cur_move_string.slice(trunk_move_string.length); const key = `${uuid}-${game_id}-${ai_review_id}-${trunk_move.move_number}-${variation}`; if (key in analysis_requests_made) { return; } analysis_requests_made[key] = true; const req = { uuid: uuid, game_id: game_id, ai_review_id: ai_review_id, from: trunk_move.move_number, variation: variation, }; ai_socket.send("ai-analyze-variation", req); }
{ data.unwatch("config.user_jwt", onJwtChange); }
identifier_body
AIReviewStream.tsx
/* * Copyright (C) 2012-2022 Online-Go.com * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Affero General Public License as * published by the Free Software Foundation, either version 3 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Affero General Public License for more details. * * You should have received a copy of the GNU Affero General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ import * as React from "react"; import * as data from "data"; import { ai_socket } from "sockets"; import { MoveTree } from "goban"; import { IdType } from "src/lib/types"; const analysis_requests_made: { [id: string]: boolean } = {}; interface AIReviewStreamProperties { uuid?: string; game_id?: IdType; ai_review_id?: IdType; callback: (data: any) => any; } export function AIReviewStream(props: AIReviewStreamProperties): JSX.Element { const uuid = props.uuid; const game_id = props.game_id; const ai_review_id = props.ai_review_id; React.useEffect(() => { if (!props.uuid) { console.log("No UUID for review stream"); return; } else { ai_socket.on("connect", onConnect); ai_socket.on(uuid, onMessage); if (ai_socket.connected) { onConnect(); } } function
() { const user = data.get("config.user"); const user_jwt = data.get("config.user_jwt"); if (!user.anonymous && user_jwt) { ai_socket.send("authenticate", { jwt: user_jwt }); } } function watch_jwt() { data.watch("config.user_jwt", onJwtChange); } function unwatch_jwt() { data.unwatch("config.user_jwt", onJwtChange); } function onConnect() { ai_socket.send("ai-review-connect", { uuid, game_id, ai_review_id }); watch_jwt(); } function onMessage(data: any) { props.callback(data); } return () => { if (ai_socket.connected) { ai_socket.send("ai-review-disconnect", { uuid }); } ai_socket.off("connect", onConnect); ai_socket.off(uuid, onMessage); unwatch_jwt(); }; }, [uuid]); return null; } export function ai_request_variation_analysis( uuid, game_id, ai_review_id, cur_move: MoveTree, trunk_move: MoveTree, ): void { if (!ai_socket.connected) { console.warn( "Not sending request for variation analysis since we wern't connected to the AI server", ); return; } const trunk_move_string = trunk_move.getMoveStringToThisPoint(); const cur_move_string = cur_move.getMoveStringToThisPoint(); const variation = cur_move_string.slice(trunk_move_string.length); const key = `${uuid}-${game_id}-${ai_review_id}-${trunk_move.move_number}-${variation}`; if (key in analysis_requests_made) { return; } analysis_requests_made[key] = true; const req = { uuid: uuid, game_id: game_id, ai_review_id: ai_review_id, from: trunk_move.move_number, variation: variation, }; ai_socket.send("ai-analyze-variation", req); }
onJwtChange
identifier_name
AIReviewStream.tsx
/* * Copyright (C) 2012-2022 Online-Go.com * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Affero General Public License as * published by the Free Software Foundation, either version 3 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Affero General Public License for more details. * * You should have received a copy of the GNU Affero General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ import * as React from "react"; import * as data from "data"; import { ai_socket } from "sockets"; import { MoveTree } from "goban"; import { IdType } from "src/lib/types"; const analysis_requests_made: { [id: string]: boolean } = {}; interface AIReviewStreamProperties { uuid?: string; game_id?: IdType; ai_review_id?: IdType; callback: (data: any) => any; } export function AIReviewStream(props: AIReviewStreamProperties): JSX.Element { const uuid = props.uuid; const game_id = props.game_id; const ai_review_id = props.ai_review_id; React.useEffect(() => { if (!props.uuid) { console.log("No UUID for review stream"); return; } else { ai_socket.on("connect", onConnect); ai_socket.on(uuid, onMessage); if (ai_socket.connected) { onConnect(); } } function onJwtChange() { const user = data.get("config.user"); const user_jwt = data.get("config.user_jwt"); if (!user.anonymous && user_jwt) { ai_socket.send("authenticate", { jwt: user_jwt }); } } function watch_jwt() { data.watch("config.user_jwt", onJwtChange); } function unwatch_jwt() { data.unwatch("config.user_jwt", onJwtChange); } function onConnect() { ai_socket.send("ai-review-connect", { uuid, game_id, ai_review_id }); watch_jwt(); } function onMessage(data: any) { props.callback(data); } return () => { if (ai_socket.connected) { ai_socket.send("ai-review-disconnect", { uuid }); } ai_socket.off("connect", onConnect); ai_socket.off(uuid, onMessage); unwatch_jwt(); }; }, [uuid]); return null; } export function ai_request_variation_analysis( uuid, game_id, ai_review_id, cur_move: MoveTree, trunk_move: MoveTree, ): void { if (!ai_socket.connected) { console.warn( "Not sending request for variation analysis since we wern't connected to the AI server",
const cur_move_string = cur_move.getMoveStringToThisPoint(); const variation = cur_move_string.slice(trunk_move_string.length); const key = `${uuid}-${game_id}-${ai_review_id}-${trunk_move.move_number}-${variation}`; if (key in analysis_requests_made) { return; } analysis_requests_made[key] = true; const req = { uuid: uuid, game_id: game_id, ai_review_id: ai_review_id, from: trunk_move.move_number, variation: variation, }; ai_socket.send("ai-analyze-variation", req); }
); return; } const trunk_move_string = trunk_move.getMoveStringToThisPoint();
random_line_split
AIReviewStream.tsx
/* * Copyright (C) 2012-2022 Online-Go.com * * This program is free software: you can redistribute it and/or modify * it under the terms of the GNU Affero General Public License as * published by the Free Software Foundation, either version 3 of the * License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU Affero General Public License for more details. * * You should have received a copy of the GNU Affero General Public License * along with this program. If not, see <http://www.gnu.org/licenses/>. */ import * as React from "react"; import * as data from "data"; import { ai_socket } from "sockets"; import { MoveTree } from "goban"; import { IdType } from "src/lib/types"; const analysis_requests_made: { [id: string]: boolean } = {}; interface AIReviewStreamProperties { uuid?: string; game_id?: IdType; ai_review_id?: IdType; callback: (data: any) => any; } export function AIReviewStream(props: AIReviewStreamProperties): JSX.Element { const uuid = props.uuid; const game_id = props.game_id; const ai_review_id = props.ai_review_id; React.useEffect(() => { if (!props.uuid) { console.log("No UUID for review stream"); return; } else
function onJwtChange() { const user = data.get("config.user"); const user_jwt = data.get("config.user_jwt"); if (!user.anonymous && user_jwt) { ai_socket.send("authenticate", { jwt: user_jwt }); } } function watch_jwt() { data.watch("config.user_jwt", onJwtChange); } function unwatch_jwt() { data.unwatch("config.user_jwt", onJwtChange); } function onConnect() { ai_socket.send("ai-review-connect", { uuid, game_id, ai_review_id }); watch_jwt(); } function onMessage(data: any) { props.callback(data); } return () => { if (ai_socket.connected) { ai_socket.send("ai-review-disconnect", { uuid }); } ai_socket.off("connect", onConnect); ai_socket.off(uuid, onMessage); unwatch_jwt(); }; }, [uuid]); return null; } export function ai_request_variation_analysis( uuid, game_id, ai_review_id, cur_move: MoveTree, trunk_move: MoveTree, ): void { if (!ai_socket.connected) { console.warn( "Not sending request for variation analysis since we wern't connected to the AI server", ); return; } const trunk_move_string = trunk_move.getMoveStringToThisPoint(); const cur_move_string = cur_move.getMoveStringToThisPoint(); const variation = cur_move_string.slice(trunk_move_string.length); const key = `${uuid}-${game_id}-${ai_review_id}-${trunk_move.move_number}-${variation}`; if (key in analysis_requests_made) { return; } analysis_requests_made[key] = true; const req = { uuid: uuid, game_id: game_id, ai_review_id: ai_review_id, from: trunk_move.move_number, variation: variation, }; ai_socket.send("ai-analyze-variation", req); }
{ ai_socket.on("connect", onConnect); ai_socket.on(uuid, onMessage); if (ai_socket.connected) { onConnect(); } }
conditional_block
test_backend.py
import json import os import subprocess import uuid import passlib.hash import pytest import gen import gen.build_deploy.aws import release from dcos_installer import backend from dcos_installer.config import Config, make_default_config_if_needed, to_config os.environ["BOOTSTRAP_ID"] = "12345" @pytest.fixture(scope='module') def config(): if not os.path.exists('dcos-release.config.yaml'): pytest.skip("Skipping because there is no configuration in dcos-release.config.yaml") return release.load_config('dcos-release.config.yaml') @pytest.fixture(scope='module') def config_testing(config): if 'testing' not in config: pytest.skip("Skipped because there is no `testing` configuration in dcos-release.config.yaml") return config['testing'] @pytest.fixture(scope='module') def config_aws(config_testing): if 'aws' not in config_testing: pytest.skip("Skipped because there is no `testing.aws` configuration in dcos-release.config.yaml") return config_testing['aws'] def test_password_hash(): """Tests that the password hashing method creates de-cryptable hash """ password = 'DcosTestingPassword!@#' # only reads from STDOUT hash_pw = subprocess.check_output(['dcos_installer', '--hash-password', password]) print(hash_pw) hash_pw = hash_pw.decode('ascii').strip('\n') assert passlib.hash.sha512_crypt.verify(password, hash_pw), 'Hash does not match password' def test_set_superuser_password(tmpdir): """Test that --set-superuser-hash works""" with tmpdir.as_cwd(): tmpdir.join('genconf').ensure(dir=True) # TODO(cmaloney): Add tests for the behavior around a non-existent config.yaml # Setting in a non-empty config.yaml which has no password set make_default_config_if_needed('genconf/config.yaml') assert 'superuser_password_hash' not in Config('genconf/config.yaml').config # Set the password create_fake_build_artifacts(tmpdir) subprocess.check_call(['dcos_installer', '--set-superuser-password', 'foo'], cwd=str(tmpdir)) # Check that config.yaml has the password set config = Config('genconf/config.yaml') assert passlib.hash.sha512_crypt.verify('foo', config['superuser_password_hash']) def test_generate_node_upgrade_script(tmpdir, monkeypatch): upgrade_config = """ --- # The name of your DC/OS cluster. Visable in the DC/OS user interface. cluster_name: 'DC/OS' master_discovery: static exhibitor_storage_backend: 'static' resolvers: - 8.8.8.8 - 8.8.4.4 ssh_port: 22 process_timeout: 10000 bootstrap_url: file:///opt/dcos_install_tmp master_list: ['10.0.0.1', '10.0.0.2', '10.0.0.5'] """ monkeypatch.setenv('BOOTSTRAP_VARIANT', '') create_config(upgrade_config, tmpdir) create_fake_build_artifacts(tmpdir) output = subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script', 'fake'], cwd=str(tmpdir)) assert output.decode('utf-8').splitlines()[-1].split("Node upgrade script URL: ", 1)[1]\ .endswith("dcos_node_upgrade.sh") try: subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script'], cwd=str(tmpdir)) except subprocess.CalledProcessError as e: print(e.output) assert e.output.decode('ascii') == "Must provide the version of the cluster upgrading from\n" else: raise Exception("Test passed, this should not pass without specifying a version number") def test_version(monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'some-variant') version_data = subprocess.check_output(['dcos_installer', '--version']).decode() assert json.loads(version_data) == { 'version': '1.9-dev', 'variant': 'some-variant' } def test_good_create_config_from_post(tmpdir): """ Test that it creates the config """ # Create a temp config workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) temp_ip_detect_path = workspace + '/ip-detect' f = open(temp_ip_detect_path, "w") f.write("#/bin/bash foo") good_post_data = { "agent_list": ["10.0.0.2"], "master_list": ["10.0.0.1"], "cluster_name": "Good Test", "resolvers": ["4.4.4.4"], "ip_detect_filename": temp_ip_detect_path } expected_good_messages = {} create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=good_post_data, config_path=temp_config_path) assert messages == expected_good_messages def test_bad_create_config_from_post(tmpdir): # Create a temp config workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) bad_post_data = { "agent_list": "foo", "master_list": ["foo"], } expected_bad_messages = { "agent_list": "Must be a JSON formatted list, but couldn't be parsed the given value `foo` as " "one because of: Expecting value: line 1 column 1 (char 0)", "master_list": 'Invalid IPv4 addresses in list: foo', } create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=bad_post_data, config_path=temp_config_path) assert messages == expected_bad_messages def test_do_validate_config(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') # Create a temp config genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) temp_config_path = str(genconf_dir.join('config.yaml')) # Initialize with defautls make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) expected_output = { 'ip_detect_contents': 'ip-detect script `genconf/ip-detect` must exist', 'ssh_user': 'Must set ssh_user, no way to calculate value.', 'master_list': 'Must set master_list, no way to calculate value.', 'ssh_key_path': 'could not find ssh private key: genconf/ssh_key' } with tmpdir.as_cwd(): assert Config(config_path='genconf/config.yaml').do_validate(include_ssh=True) == expected_output def test_get_config(tmpdir): workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' expected_data = { 'cluster_name': 'DC/OS', 'master_discovery': 'static', 'exhibitor_storage_backend': 'static', 'resolvers': ['8.8.8.8', '8.8.4.4'], 'ssh_port': 22, 'process_timeout': 10000, 'bootstrap_url': 'file:///opt/dcos_install_tmp' } make_default_config_if_needed(temp_config_path) config = Config(temp_config_path) assert expected_data == config.config def test_determine_config_type(tmpdir): # Ensure the default created config is of simple type workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) got_output = backend.determine_config_type(config_path=temp_config_path) expected_output = { 'message': '', 'type': 'minimal', } assert got_output == expected_output def test_success(): mock_config = to_config({ 'master_list': ['10.0.0.1', '10.0.0.2', '10.0.0.5'], 'agent_list': ['10.0.0.3', '10.0.0.4'] }) expected_output = { "success": "http://10.0.0.1", "master_count": 3, "agent_count": 2 } expected_output_bad = { "success": "", "master_count": 0, "agent_count": 0 } got_output, code = backend.success(mock_config) mock_config.update({'master_list': '', 'agent_list': ''}) bad_out, bad_code = backend.success(mock_config) assert got_output == expected_output assert code == 200 assert bad_out == expected_output_bad assert bad_code == 400 def test_accept_overrides_for_undefined_config_params(tmpdir): temp_config_path = tmpdir.strpath + '/config.yaml' param = ('fake_test_param_name', 'fake_test_param_value') make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=dict([param]), config_path=temp_config_path) assert not messages, "unexpected validation error: {}".format(messages) assert Config(config_path=temp_config_path)[param[0]] == param[1] simple_full_config = """--- cluster_name: DC/OS master_discovery: static exhibitor_storage_backend: static master_list: - 127.0.0.1 bootstrap_url: http://example.com """ def test_do_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(simple_full_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_configure(config_path='genconf/config.yaml') == 0 aws_base_config = """--- # NOTE: Taking advantage of what isn't talked about not being validated so we don't need valid AWS / # s3 credentials in this configuration. aws_template_storage_bucket: psychic aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_region_name: us-west-2 aws_template_upload: false """
def test_do_aws_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(aws_base_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 valid_storage_config = """--- master_list: - 127.0.0.1 aws_template_storage_access_key_id: {key_id} aws_template_storage_bucket: {bucket} aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_secret_access_key: {access_key} aws_template_upload: true """ def test_do_aws_cf_configure_valid_storage_config(config_aws, tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') session = gen.build_deploy.aws.get_test_session(config_aws) s3 = session.resource('s3') bucket = str(uuid.uuid4()) s3_bucket = s3.Bucket(bucket) s3_bucket.create(CreateBucketConfiguration={'LocationConstraint': config_aws['region_name']}) try: config_str = valid_storage_config.format( key_id=config_aws["access_key_id"], bucket=bucket, access_key=config_aws["secret_access_key"]) create_config(config_str, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 # TODO: add an assertion that the config that was resolved inside do_aws_cf_configure # ended up with the correct region where the above testing bucket was created. finally: objects = [{'Key': o.key} for o in s3_bucket.objects.all()] s3_bucket.delete_objects(Delete={'Objects': objects}) s3_bucket.delete() def create_config(config_str, tmpdir): genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) config_path = genconf_dir.join('config.yaml') config_path.write(config_str) genconf_dir.join('ip-detect').write('#!/bin/bash\necho 127.0.0.1') def create_fake_build_artifacts(tmpdir): artifact_dir = tmpdir.join('artifacts/bootstrap') artifact_dir.ensure(dir=True) artifact_dir.join('12345.bootstrap.tar.xz').write('contents_of_bootstrap', ensure=True) artifact_dir.join('12345.active.json').write('["package--version"]', ensure=True) artifact_dir.join('test_variant.bootstrap.latest').write("12345") tmpdir.join('artifacts/complete/test_variant.complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/complete/complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/packages/package/package--version.tar.xz').write('contents_of_package', ensure=True)
random_line_split
test_backend.py
import json import os import subprocess import uuid import passlib.hash import pytest import gen import gen.build_deploy.aws import release from dcos_installer import backend from dcos_installer.config import Config, make_default_config_if_needed, to_config os.environ["BOOTSTRAP_ID"] = "12345" @pytest.fixture(scope='module') def config(): if not os.path.exists('dcos-release.config.yaml'): pytest.skip("Skipping because there is no configuration in dcos-release.config.yaml") return release.load_config('dcos-release.config.yaml') @pytest.fixture(scope='module') def config_testing(config): if 'testing' not in config: pytest.skip("Skipped because there is no `testing` configuration in dcos-release.config.yaml") return config['testing'] @pytest.fixture(scope='module') def config_aws(config_testing): if 'aws' not in config_testing: pytest.skip("Skipped because there is no `testing.aws` configuration in dcos-release.config.yaml") return config_testing['aws'] def test_password_hash(): """Tests that the password hashing method creates de-cryptable hash """ password = 'DcosTestingPassword!@#' # only reads from STDOUT hash_pw = subprocess.check_output(['dcos_installer', '--hash-password', password]) print(hash_pw) hash_pw = hash_pw.decode('ascii').strip('\n') assert passlib.hash.sha512_crypt.verify(password, hash_pw), 'Hash does not match password' def test_set_superuser_password(tmpdir): """Test that --set-superuser-hash works""" with tmpdir.as_cwd(): tmpdir.join('genconf').ensure(dir=True) # TODO(cmaloney): Add tests for the behavior around a non-existent config.yaml # Setting in a non-empty config.yaml which has no password set make_default_config_if_needed('genconf/config.yaml') assert 'superuser_password_hash' not in Config('genconf/config.yaml').config # Set the password create_fake_build_artifacts(tmpdir) subprocess.check_call(['dcos_installer', '--set-superuser-password', 'foo'], cwd=str(tmpdir)) # Check that config.yaml has the password set config = Config('genconf/config.yaml') assert passlib.hash.sha512_crypt.verify('foo', config['superuser_password_hash']) def test_generate_node_upgrade_script(tmpdir, monkeypatch): upgrade_config = """ --- # The name of your DC/OS cluster. Visable in the DC/OS user interface. cluster_name: 'DC/OS' master_discovery: static exhibitor_storage_backend: 'static' resolvers: - 8.8.8.8 - 8.8.4.4 ssh_port: 22 process_timeout: 10000 bootstrap_url: file:///opt/dcos_install_tmp master_list: ['10.0.0.1', '10.0.0.2', '10.0.0.5'] """ monkeypatch.setenv('BOOTSTRAP_VARIANT', '') create_config(upgrade_config, tmpdir) create_fake_build_artifacts(tmpdir) output = subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script', 'fake'], cwd=str(tmpdir)) assert output.decode('utf-8').splitlines()[-1].split("Node upgrade script URL: ", 1)[1]\ .endswith("dcos_node_upgrade.sh") try: subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script'], cwd=str(tmpdir)) except subprocess.CalledProcessError as e: print(e.output) assert e.output.decode('ascii') == "Must provide the version of the cluster upgrading from\n" else: raise Exception("Test passed, this should not pass without specifying a version number") def test_version(monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'some-variant') version_data = subprocess.check_output(['dcos_installer', '--version']).decode() assert json.loads(version_data) == { 'version': '1.9-dev', 'variant': 'some-variant' } def test_good_create_config_from_post(tmpdir): """ Test that it creates the config """ # Create a temp config workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) temp_ip_detect_path = workspace + '/ip-detect' f = open(temp_ip_detect_path, "w") f.write("#/bin/bash foo") good_post_data = { "agent_list": ["10.0.0.2"], "master_list": ["10.0.0.1"], "cluster_name": "Good Test", "resolvers": ["4.4.4.4"], "ip_detect_filename": temp_ip_detect_path } expected_good_messages = {} create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=good_post_data, config_path=temp_config_path) assert messages == expected_good_messages def test_bad_create_config_from_post(tmpdir): # Create a temp config workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) bad_post_data = { "agent_list": "foo", "master_list": ["foo"], } expected_bad_messages = { "agent_list": "Must be a JSON formatted list, but couldn't be parsed the given value `foo` as " "one because of: Expecting value: line 1 column 1 (char 0)", "master_list": 'Invalid IPv4 addresses in list: foo', } create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=bad_post_data, config_path=temp_config_path) assert messages == expected_bad_messages def
(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') # Create a temp config genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) temp_config_path = str(genconf_dir.join('config.yaml')) # Initialize with defautls make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) expected_output = { 'ip_detect_contents': 'ip-detect script `genconf/ip-detect` must exist', 'ssh_user': 'Must set ssh_user, no way to calculate value.', 'master_list': 'Must set master_list, no way to calculate value.', 'ssh_key_path': 'could not find ssh private key: genconf/ssh_key' } with tmpdir.as_cwd(): assert Config(config_path='genconf/config.yaml').do_validate(include_ssh=True) == expected_output def test_get_config(tmpdir): workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' expected_data = { 'cluster_name': 'DC/OS', 'master_discovery': 'static', 'exhibitor_storage_backend': 'static', 'resolvers': ['8.8.8.8', '8.8.4.4'], 'ssh_port': 22, 'process_timeout': 10000, 'bootstrap_url': 'file:///opt/dcos_install_tmp' } make_default_config_if_needed(temp_config_path) config = Config(temp_config_path) assert expected_data == config.config def test_determine_config_type(tmpdir): # Ensure the default created config is of simple type workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) got_output = backend.determine_config_type(config_path=temp_config_path) expected_output = { 'message': '', 'type': 'minimal', } assert got_output == expected_output def test_success(): mock_config = to_config({ 'master_list': ['10.0.0.1', '10.0.0.2', '10.0.0.5'], 'agent_list': ['10.0.0.3', '10.0.0.4'] }) expected_output = { "success": "http://10.0.0.1", "master_count": 3, "agent_count": 2 } expected_output_bad = { "success": "", "master_count": 0, "agent_count": 0 } got_output, code = backend.success(mock_config) mock_config.update({'master_list': '', 'agent_list': ''}) bad_out, bad_code = backend.success(mock_config) assert got_output == expected_output assert code == 200 assert bad_out == expected_output_bad assert bad_code == 400 def test_accept_overrides_for_undefined_config_params(tmpdir): temp_config_path = tmpdir.strpath + '/config.yaml' param = ('fake_test_param_name', 'fake_test_param_value') make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=dict([param]), config_path=temp_config_path) assert not messages, "unexpected validation error: {}".format(messages) assert Config(config_path=temp_config_path)[param[0]] == param[1] simple_full_config = """--- cluster_name: DC/OS master_discovery: static exhibitor_storage_backend: static master_list: - 127.0.0.1 bootstrap_url: http://example.com """ def test_do_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(simple_full_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_configure(config_path='genconf/config.yaml') == 0 aws_base_config = """--- # NOTE: Taking advantage of what isn't talked about not being validated so we don't need valid AWS / # s3 credentials in this configuration. aws_template_storage_bucket: psychic aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_region_name: us-west-2 aws_template_upload: false """ def test_do_aws_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(aws_base_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 valid_storage_config = """--- master_list: - 127.0.0.1 aws_template_storage_access_key_id: {key_id} aws_template_storage_bucket: {bucket} aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_secret_access_key: {access_key} aws_template_upload: true """ def test_do_aws_cf_configure_valid_storage_config(config_aws, tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') session = gen.build_deploy.aws.get_test_session(config_aws) s3 = session.resource('s3') bucket = str(uuid.uuid4()) s3_bucket = s3.Bucket(bucket) s3_bucket.create(CreateBucketConfiguration={'LocationConstraint': config_aws['region_name']}) try: config_str = valid_storage_config.format( key_id=config_aws["access_key_id"], bucket=bucket, access_key=config_aws["secret_access_key"]) create_config(config_str, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 # TODO: add an assertion that the config that was resolved inside do_aws_cf_configure # ended up with the correct region where the above testing bucket was created. finally: objects = [{'Key': o.key} for o in s3_bucket.objects.all()] s3_bucket.delete_objects(Delete={'Objects': objects}) s3_bucket.delete() def create_config(config_str, tmpdir): genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) config_path = genconf_dir.join('config.yaml') config_path.write(config_str) genconf_dir.join('ip-detect').write('#!/bin/bash\necho 127.0.0.1') def create_fake_build_artifacts(tmpdir): artifact_dir = tmpdir.join('artifacts/bootstrap') artifact_dir.ensure(dir=True) artifact_dir.join('12345.bootstrap.tar.xz').write('contents_of_bootstrap', ensure=True) artifact_dir.join('12345.active.json').write('["package--version"]', ensure=True) artifact_dir.join('test_variant.bootstrap.latest').write("12345") tmpdir.join('artifacts/complete/test_variant.complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/complete/complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/packages/package/package--version.tar.xz').write('contents_of_package', ensure=True)
test_do_validate_config
identifier_name
test_backend.py
import json import os import subprocess import uuid import passlib.hash import pytest import gen import gen.build_deploy.aws import release from dcos_installer import backend from dcos_installer.config import Config, make_default_config_if_needed, to_config os.environ["BOOTSTRAP_ID"] = "12345" @pytest.fixture(scope='module') def config(): if not os.path.exists('dcos-release.config.yaml'): pytest.skip("Skipping because there is no configuration in dcos-release.config.yaml") return release.load_config('dcos-release.config.yaml') @pytest.fixture(scope='module') def config_testing(config): if 'testing' not in config: pytest.skip("Skipped because there is no `testing` configuration in dcos-release.config.yaml") return config['testing'] @pytest.fixture(scope='module') def config_aws(config_testing): if 'aws' not in config_testing: pytest.skip("Skipped because there is no `testing.aws` configuration in dcos-release.config.yaml") return config_testing['aws'] def test_password_hash(): """Tests that the password hashing method creates de-cryptable hash """ password = 'DcosTestingPassword!@#' # only reads from STDOUT hash_pw = subprocess.check_output(['dcos_installer', '--hash-password', password]) print(hash_pw) hash_pw = hash_pw.decode('ascii').strip('\n') assert passlib.hash.sha512_crypt.verify(password, hash_pw), 'Hash does not match password' def test_set_superuser_password(tmpdir): """Test that --set-superuser-hash works""" with tmpdir.as_cwd(): tmpdir.join('genconf').ensure(dir=True) # TODO(cmaloney): Add tests for the behavior around a non-existent config.yaml # Setting in a non-empty config.yaml which has no password set make_default_config_if_needed('genconf/config.yaml') assert 'superuser_password_hash' not in Config('genconf/config.yaml').config # Set the password create_fake_build_artifacts(tmpdir) subprocess.check_call(['dcos_installer', '--set-superuser-password', 'foo'], cwd=str(tmpdir)) # Check that config.yaml has the password set config = Config('genconf/config.yaml') assert passlib.hash.sha512_crypt.verify('foo', config['superuser_password_hash']) def test_generate_node_upgrade_script(tmpdir, monkeypatch): upgrade_config = """ --- # The name of your DC/OS cluster. Visable in the DC/OS user interface. cluster_name: 'DC/OS' master_discovery: static exhibitor_storage_backend: 'static' resolvers: - 8.8.8.8 - 8.8.4.4 ssh_port: 22 process_timeout: 10000 bootstrap_url: file:///opt/dcos_install_tmp master_list: ['10.0.0.1', '10.0.0.2', '10.0.0.5'] """ monkeypatch.setenv('BOOTSTRAP_VARIANT', '') create_config(upgrade_config, tmpdir) create_fake_build_artifacts(tmpdir) output = subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script', 'fake'], cwd=str(tmpdir)) assert output.decode('utf-8').splitlines()[-1].split("Node upgrade script URL: ", 1)[1]\ .endswith("dcos_node_upgrade.sh") try: subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script'], cwd=str(tmpdir)) except subprocess.CalledProcessError as e: print(e.output) assert e.output.decode('ascii') == "Must provide the version of the cluster upgrading from\n" else: raise Exception("Test passed, this should not pass without specifying a version number") def test_version(monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'some-variant') version_data = subprocess.check_output(['dcos_installer', '--version']).decode() assert json.loads(version_data) == { 'version': '1.9-dev', 'variant': 'some-variant' } def test_good_create_config_from_post(tmpdir): """ Test that it creates the config """ # Create a temp config workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) temp_ip_detect_path = workspace + '/ip-detect' f = open(temp_ip_detect_path, "w") f.write("#/bin/bash foo") good_post_data = { "agent_list": ["10.0.0.2"], "master_list": ["10.0.0.1"], "cluster_name": "Good Test", "resolvers": ["4.4.4.4"], "ip_detect_filename": temp_ip_detect_path } expected_good_messages = {} create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=good_post_data, config_path=temp_config_path) assert messages == expected_good_messages def test_bad_create_config_from_post(tmpdir): # Create a temp config
def test_do_validate_config(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') # Create a temp config genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) temp_config_path = str(genconf_dir.join('config.yaml')) # Initialize with defautls make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) expected_output = { 'ip_detect_contents': 'ip-detect script `genconf/ip-detect` must exist', 'ssh_user': 'Must set ssh_user, no way to calculate value.', 'master_list': 'Must set master_list, no way to calculate value.', 'ssh_key_path': 'could not find ssh private key: genconf/ssh_key' } with tmpdir.as_cwd(): assert Config(config_path='genconf/config.yaml').do_validate(include_ssh=True) == expected_output def test_get_config(tmpdir): workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' expected_data = { 'cluster_name': 'DC/OS', 'master_discovery': 'static', 'exhibitor_storage_backend': 'static', 'resolvers': ['8.8.8.8', '8.8.4.4'], 'ssh_port': 22, 'process_timeout': 10000, 'bootstrap_url': 'file:///opt/dcos_install_tmp' } make_default_config_if_needed(temp_config_path) config = Config(temp_config_path) assert expected_data == config.config def test_determine_config_type(tmpdir): # Ensure the default created config is of simple type workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) got_output = backend.determine_config_type(config_path=temp_config_path) expected_output = { 'message': '', 'type': 'minimal', } assert got_output == expected_output def test_success(): mock_config = to_config({ 'master_list': ['10.0.0.1', '10.0.0.2', '10.0.0.5'], 'agent_list': ['10.0.0.3', '10.0.0.4'] }) expected_output = { "success": "http://10.0.0.1", "master_count": 3, "agent_count": 2 } expected_output_bad = { "success": "", "master_count": 0, "agent_count": 0 } got_output, code = backend.success(mock_config) mock_config.update({'master_list': '', 'agent_list': ''}) bad_out, bad_code = backend.success(mock_config) assert got_output == expected_output assert code == 200 assert bad_out == expected_output_bad assert bad_code == 400 def test_accept_overrides_for_undefined_config_params(tmpdir): temp_config_path = tmpdir.strpath + '/config.yaml' param = ('fake_test_param_name', 'fake_test_param_value') make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=dict([param]), config_path=temp_config_path) assert not messages, "unexpected validation error: {}".format(messages) assert Config(config_path=temp_config_path)[param[0]] == param[1] simple_full_config = """--- cluster_name: DC/OS master_discovery: static exhibitor_storage_backend: static master_list: - 127.0.0.1 bootstrap_url: http://example.com """ def test_do_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(simple_full_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_configure(config_path='genconf/config.yaml') == 0 aws_base_config = """--- # NOTE: Taking advantage of what isn't talked about not being validated so we don't need valid AWS / # s3 credentials in this configuration. aws_template_storage_bucket: psychic aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_region_name: us-west-2 aws_template_upload: false """ def test_do_aws_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(aws_base_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 valid_storage_config = """--- master_list: - 127.0.0.1 aws_template_storage_access_key_id: {key_id} aws_template_storage_bucket: {bucket} aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_secret_access_key: {access_key} aws_template_upload: true """ def test_do_aws_cf_configure_valid_storage_config(config_aws, tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') session = gen.build_deploy.aws.get_test_session(config_aws) s3 = session.resource('s3') bucket = str(uuid.uuid4()) s3_bucket = s3.Bucket(bucket) s3_bucket.create(CreateBucketConfiguration={'LocationConstraint': config_aws['region_name']}) try: config_str = valid_storage_config.format( key_id=config_aws["access_key_id"], bucket=bucket, access_key=config_aws["secret_access_key"]) create_config(config_str, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 # TODO: add an assertion that the config that was resolved inside do_aws_cf_configure # ended up with the correct region where the above testing bucket was created. finally: objects = [{'Key': o.key} for o in s3_bucket.objects.all()] s3_bucket.delete_objects(Delete={'Objects': objects}) s3_bucket.delete() def create_config(config_str, tmpdir): genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) config_path = genconf_dir.join('config.yaml') config_path.write(config_str) genconf_dir.join('ip-detect').write('#!/bin/bash\necho 127.0.0.1') def create_fake_build_artifacts(tmpdir): artifact_dir = tmpdir.join('artifacts/bootstrap') artifact_dir.ensure(dir=True) artifact_dir.join('12345.bootstrap.tar.xz').write('contents_of_bootstrap', ensure=True) artifact_dir.join('12345.active.json').write('["package--version"]', ensure=True) artifact_dir.join('test_variant.bootstrap.latest').write("12345") tmpdir.join('artifacts/complete/test_variant.complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/complete/complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/packages/package/package--version.tar.xz').write('contents_of_package', ensure=True)
workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) bad_post_data = { "agent_list": "foo", "master_list": ["foo"], } expected_bad_messages = { "agent_list": "Must be a JSON formatted list, but couldn't be parsed the given value `foo` as " "one because of: Expecting value: line 1 column 1 (char 0)", "master_list": 'Invalid IPv4 addresses in list: foo', } create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=bad_post_data, config_path=temp_config_path) assert messages == expected_bad_messages
identifier_body
test_backend.py
import json import os import subprocess import uuid import passlib.hash import pytest import gen import gen.build_deploy.aws import release from dcos_installer import backend from dcos_installer.config import Config, make_default_config_if_needed, to_config os.environ["BOOTSTRAP_ID"] = "12345" @pytest.fixture(scope='module') def config(): if not os.path.exists('dcos-release.config.yaml'):
return release.load_config('dcos-release.config.yaml') @pytest.fixture(scope='module') def config_testing(config): if 'testing' not in config: pytest.skip("Skipped because there is no `testing` configuration in dcos-release.config.yaml") return config['testing'] @pytest.fixture(scope='module') def config_aws(config_testing): if 'aws' not in config_testing: pytest.skip("Skipped because there is no `testing.aws` configuration in dcos-release.config.yaml") return config_testing['aws'] def test_password_hash(): """Tests that the password hashing method creates de-cryptable hash """ password = 'DcosTestingPassword!@#' # only reads from STDOUT hash_pw = subprocess.check_output(['dcos_installer', '--hash-password', password]) print(hash_pw) hash_pw = hash_pw.decode('ascii').strip('\n') assert passlib.hash.sha512_crypt.verify(password, hash_pw), 'Hash does not match password' def test_set_superuser_password(tmpdir): """Test that --set-superuser-hash works""" with tmpdir.as_cwd(): tmpdir.join('genconf').ensure(dir=True) # TODO(cmaloney): Add tests for the behavior around a non-existent config.yaml # Setting in a non-empty config.yaml which has no password set make_default_config_if_needed('genconf/config.yaml') assert 'superuser_password_hash' not in Config('genconf/config.yaml').config # Set the password create_fake_build_artifacts(tmpdir) subprocess.check_call(['dcos_installer', '--set-superuser-password', 'foo'], cwd=str(tmpdir)) # Check that config.yaml has the password set config = Config('genconf/config.yaml') assert passlib.hash.sha512_crypt.verify('foo', config['superuser_password_hash']) def test_generate_node_upgrade_script(tmpdir, monkeypatch): upgrade_config = """ --- # The name of your DC/OS cluster. Visable in the DC/OS user interface. cluster_name: 'DC/OS' master_discovery: static exhibitor_storage_backend: 'static' resolvers: - 8.8.8.8 - 8.8.4.4 ssh_port: 22 process_timeout: 10000 bootstrap_url: file:///opt/dcos_install_tmp master_list: ['10.0.0.1', '10.0.0.2', '10.0.0.5'] """ monkeypatch.setenv('BOOTSTRAP_VARIANT', '') create_config(upgrade_config, tmpdir) create_fake_build_artifacts(tmpdir) output = subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script', 'fake'], cwd=str(tmpdir)) assert output.decode('utf-8').splitlines()[-1].split("Node upgrade script URL: ", 1)[1]\ .endswith("dcos_node_upgrade.sh") try: subprocess.check_output(['dcos_installer', '--generate-node-upgrade-script'], cwd=str(tmpdir)) except subprocess.CalledProcessError as e: print(e.output) assert e.output.decode('ascii') == "Must provide the version of the cluster upgrading from\n" else: raise Exception("Test passed, this should not pass without specifying a version number") def test_version(monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'some-variant') version_data = subprocess.check_output(['dcos_installer', '--version']).decode() assert json.loads(version_data) == { 'version': '1.9-dev', 'variant': 'some-variant' } def test_good_create_config_from_post(tmpdir): """ Test that it creates the config """ # Create a temp config workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) temp_ip_detect_path = workspace + '/ip-detect' f = open(temp_ip_detect_path, "w") f.write("#/bin/bash foo") good_post_data = { "agent_list": ["10.0.0.2"], "master_list": ["10.0.0.1"], "cluster_name": "Good Test", "resolvers": ["4.4.4.4"], "ip_detect_filename": temp_ip_detect_path } expected_good_messages = {} create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=good_post_data, config_path=temp_config_path) assert messages == expected_good_messages def test_bad_create_config_from_post(tmpdir): # Create a temp config workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) bad_post_data = { "agent_list": "foo", "master_list": ["foo"], } expected_bad_messages = { "agent_list": "Must be a JSON formatted list, but couldn't be parsed the given value `foo` as " "one because of: Expecting value: line 1 column 1 (char 0)", "master_list": 'Invalid IPv4 addresses in list: foo', } create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=bad_post_data, config_path=temp_config_path) assert messages == expected_bad_messages def test_do_validate_config(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') # Create a temp config genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) temp_config_path = str(genconf_dir.join('config.yaml')) # Initialize with defautls make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) expected_output = { 'ip_detect_contents': 'ip-detect script `genconf/ip-detect` must exist', 'ssh_user': 'Must set ssh_user, no way to calculate value.', 'master_list': 'Must set master_list, no way to calculate value.', 'ssh_key_path': 'could not find ssh private key: genconf/ssh_key' } with tmpdir.as_cwd(): assert Config(config_path='genconf/config.yaml').do_validate(include_ssh=True) == expected_output def test_get_config(tmpdir): workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' expected_data = { 'cluster_name': 'DC/OS', 'master_discovery': 'static', 'exhibitor_storage_backend': 'static', 'resolvers': ['8.8.8.8', '8.8.4.4'], 'ssh_port': 22, 'process_timeout': 10000, 'bootstrap_url': 'file:///opt/dcos_install_tmp' } make_default_config_if_needed(temp_config_path) config = Config(temp_config_path) assert expected_data == config.config def test_determine_config_type(tmpdir): # Ensure the default created config is of simple type workspace = tmpdir.strpath temp_config_path = workspace + '/config.yaml' make_default_config_if_needed(temp_config_path) got_output = backend.determine_config_type(config_path=temp_config_path) expected_output = { 'message': '', 'type': 'minimal', } assert got_output == expected_output def test_success(): mock_config = to_config({ 'master_list': ['10.0.0.1', '10.0.0.2', '10.0.0.5'], 'agent_list': ['10.0.0.3', '10.0.0.4'] }) expected_output = { "success": "http://10.0.0.1", "master_count": 3, "agent_count": 2 } expected_output_bad = { "success": "", "master_count": 0, "agent_count": 0 } got_output, code = backend.success(mock_config) mock_config.update({'master_list': '', 'agent_list': ''}) bad_out, bad_code = backend.success(mock_config) assert got_output == expected_output assert code == 200 assert bad_out == expected_output_bad assert bad_code == 400 def test_accept_overrides_for_undefined_config_params(tmpdir): temp_config_path = tmpdir.strpath + '/config.yaml' param = ('fake_test_param_name', 'fake_test_param_value') make_default_config_if_needed(temp_config_path) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): messages = backend.create_config_from_post( post_data=dict([param]), config_path=temp_config_path) assert not messages, "unexpected validation error: {}".format(messages) assert Config(config_path=temp_config_path)[param[0]] == param[1] simple_full_config = """--- cluster_name: DC/OS master_discovery: static exhibitor_storage_backend: static master_list: - 127.0.0.1 bootstrap_url: http://example.com """ def test_do_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(simple_full_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_configure(config_path='genconf/config.yaml') == 0 aws_base_config = """--- # NOTE: Taking advantage of what isn't talked about not being validated so we don't need valid AWS / # s3 credentials in this configuration. aws_template_storage_bucket: psychic aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_region_name: us-west-2 aws_template_upload: false """ def test_do_aws_configure(tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') create_config(aws_base_config, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 valid_storage_config = """--- master_list: - 127.0.0.1 aws_template_storage_access_key_id: {key_id} aws_template_storage_bucket: {bucket} aws_template_storage_bucket_path: mofo-the-gorilla aws_template_storage_secret_access_key: {access_key} aws_template_upload: true """ def test_do_aws_cf_configure_valid_storage_config(config_aws, tmpdir, monkeypatch): monkeypatch.setenv('BOOTSTRAP_VARIANT', 'test_variant') session = gen.build_deploy.aws.get_test_session(config_aws) s3 = session.resource('s3') bucket = str(uuid.uuid4()) s3_bucket = s3.Bucket(bucket) s3_bucket.create(CreateBucketConfiguration={'LocationConstraint': config_aws['region_name']}) try: config_str = valid_storage_config.format( key_id=config_aws["access_key_id"], bucket=bucket, access_key=config_aws["secret_access_key"]) create_config(config_str, tmpdir) create_fake_build_artifacts(tmpdir) with tmpdir.as_cwd(): assert backend.do_aws_cf_configure() == 0 # TODO: add an assertion that the config that was resolved inside do_aws_cf_configure # ended up with the correct region where the above testing bucket was created. finally: objects = [{'Key': o.key} for o in s3_bucket.objects.all()] s3_bucket.delete_objects(Delete={'Objects': objects}) s3_bucket.delete() def create_config(config_str, tmpdir): genconf_dir = tmpdir.join('genconf') genconf_dir.ensure(dir=True) config_path = genconf_dir.join('config.yaml') config_path.write(config_str) genconf_dir.join('ip-detect').write('#!/bin/bash\necho 127.0.0.1') def create_fake_build_artifacts(tmpdir): artifact_dir = tmpdir.join('artifacts/bootstrap') artifact_dir.ensure(dir=True) artifact_dir.join('12345.bootstrap.tar.xz').write('contents_of_bootstrap', ensure=True) artifact_dir.join('12345.active.json').write('["package--version"]', ensure=True) artifact_dir.join('test_variant.bootstrap.latest').write("12345") tmpdir.join('artifacts/complete/test_variant.complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/complete/complete.latest.json').write( '{"bootstrap": "12345", "packages": ["package--version"]}', ensure=True, ) tmpdir.join('artifacts/packages/package/package--version.tar.xz').write('contents_of_package', ensure=True)
pytest.skip("Skipping because there is no configuration in dcos-release.config.yaml")
conditional_block
ImageEnhance.py
# # The Python Imaging Library. # $Id$ # # image enhancement classes # # For a background, see "Image Processing By Interpolation and # Extrapolation", Paul Haeberli and Douglas Voorhies. Available # at http://www.sgi.com/grafica/interp/index.html # # History: # 1996-03-23 fl Created # 2009-06-16 fl Fixed mean calculation # # Copyright (c) Secret Labs AB 1997. # Copyright (c) Fredrik Lundh 1996. # # See the README file for information on usage and redistribution. # from PIL import Image, ImageFilter, ImageStat class _Enhance: def enhance(self, factor): """ Returns an enhanced image. :param factor: A floating point value controlling the enhancement. Factor 1.0 always returns a copy of the original image, lower factors mean less color (brightness, contrast, etc), and higher values more. There are no restrictions on this value. :rtype: :py:class:`~PIL.Image.Image` """ return Image.blend(self.degenerate, self.image, factor) class Color(_Enhance): """Adjust image color balance. This class can be used to adjust the colour balance of an image, in a manner similar to the controls on a colour TV set. An enhancement factor of 0.0 gives a black and white image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image self.degenerate = image.convert("L").convert(image.mode) class Contrast(_Enhance): """Adjust image contrast. This class can be used to control the contrast of an image, similar to the contrast control on a TV set. An enhancement factor of 0.0 gives a solid grey image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image mean = int(ImageStat.Stat(image.convert("L")).mean[0] + 0.5) self.degenerate = Image.new("L", image.size, mean).convert(image.mode) class Brightness(_Enhance): """Adjust image brightness. This class can be used to control the brighntess of an image. An enhancement factor of 0.0 gives a black image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image self.degenerate = Image.new(image.mode, image.size, 0) class
(_Enhance): """Adjust image sharpness. This class can be used to adjust the sharpness of an image. An enhancement factor of 0.0 gives a blurred image, a factor of 1.0 gives the original image, and a factor of 2.0 gives a sharpened image. """ def __init__(self, image): self.image = image self.degenerate = image.filter(ImageFilter.SMOOTH)
Sharpness
identifier_name
ImageEnhance.py
# # The Python Imaging Library. # $Id$ # # image enhancement classes # # For a background, see "Image Processing By Interpolation and # Extrapolation", Paul Haeberli and Douglas Voorhies. Available # at http://www.sgi.com/grafica/interp/index.html # # History: # 1996-03-23 fl Created # 2009-06-16 fl Fixed mean calculation # # Copyright (c) Secret Labs AB 1997. # Copyright (c) Fredrik Lundh 1996. # # See the README file for information on usage and redistribution. # from PIL import Image, ImageFilter, ImageStat class _Enhance: def enhance(self, factor): """ Returns an enhanced image. :param factor: A floating point value controlling the enhancement. Factor 1.0 always returns a copy of the original image, lower factors mean less color (brightness, contrast, etc), and higher values more. There are no restrictions on this value. :rtype: :py:class:`~PIL.Image.Image` """ return Image.blend(self.degenerate, self.image, factor) class Color(_Enhance): """Adjust image color balance. This class can be used to adjust the colour balance of an image, in a manner similar to the controls on a colour TV set. An enhancement factor of 0.0 gives a black and white image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image self.degenerate = image.convert("L").convert(image.mode) class Contrast(_Enhance): """Adjust image contrast. This class can be used to control the contrast of an image, similar to the contrast control on a TV set. An enhancement factor of 0.0 gives a solid grey image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image mean = int(ImageStat.Stat(image.convert("L")).mean[0] + 0.5) self.degenerate = Image.new("L", image.size, mean).convert(image.mode) class Brightness(_Enhance): """Adjust image brightness. This class can be used to control the brighntess of an image. An enhancement factor of 0.0 gives a black image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image self.degenerate = Image.new(image.mode, image.size, 0) class Sharpness(_Enhance): """Adjust image sharpness. This class can be used to adjust the sharpness of an image. An enhancement factor of 0.0 gives a blurred image, a factor of 1.0 gives the original image, and a factor of 2.0 gives a sharpened image. """ def __init__(self, image):
self.image = image self.degenerate = image.filter(ImageFilter.SMOOTH)
identifier_body
ImageEnhance.py
# # The Python Imaging Library. # $Id$ # # image enhancement classes # # For a background, see "Image Processing By Interpolation and # Extrapolation", Paul Haeberli and Douglas Voorhies. Available # at http://www.sgi.com/grafica/interp/index.html # # History: # 1996-03-23 fl Created # 2009-06-16 fl Fixed mean calculation # # Copyright (c) Secret Labs AB 1997. # Copyright (c) Fredrik Lundh 1996. # # See the README file for information on usage and redistribution. # from PIL import Image, ImageFilter, ImageStat class _Enhance: def enhance(self, factor): """ Returns an enhanced image. :param factor: A floating point value controlling the enhancement. Factor 1.0 always returns a copy of the original image, lower factors mean less color (brightness, contrast, etc), and higher values more. There are no restrictions on this value. :rtype: :py:class:`~PIL.Image.Image` """ return Image.blend(self.degenerate, self.image, factor) class Color(_Enhance): """Adjust image color balance. This class can be used to adjust the colour balance of an image, in a manner similar to the controls on a colour TV set. An enhancement factor of 0.0 gives a black and white image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image self.degenerate = image.convert("L").convert(image.mode) class Contrast(_Enhance): """Adjust image contrast. This class can be used to control the contrast of an image, similar to the contrast control on a TV set. An enhancement factor of 0.0 gives a solid grey image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image mean = int(ImageStat.Stat(image.convert("L")).mean[0] + 0.5) self.degenerate = Image.new("L", image.size, mean).convert(image.mode)
class Brightness(_Enhance): """Adjust image brightness. This class can be used to control the brighntess of an image. An enhancement factor of 0.0 gives a black image. A factor of 1.0 gives the original image. """ def __init__(self, image): self.image = image self.degenerate = Image.new(image.mode, image.size, 0) class Sharpness(_Enhance): """Adjust image sharpness. This class can be used to adjust the sharpness of an image. An enhancement factor of 0.0 gives a blurred image, a factor of 1.0 gives the original image, and a factor of 2.0 gives a sharpened image. """ def __init__(self, image): self.image = image self.degenerate = image.filter(ImageFilter.SMOOTH)
random_line_split
rbawz2.py
#!/usr/bin/env python # # Computation of the rate-distortion function for source coding with side # information at the decoder using the Blahut-Arimoto algorithm. # # Formulation similar to R.E. Blahut "Computation of Channel Capacity and # Rate-Distortion Functions," IEEE Transactions on Information Theory, 18, # no. 4, 1972. # # Author: Christophe Ramananjaona # (c) 2005, Department of Electrical and Computer Engineering, Duke University. # (c) 2017, Isloux, for the Python version. from numpy import shape,sum,zeros,ones,arange,log,exp,array,longdouble,finfo from sys import float_info from os.path import isfile from sys import argv #from code_generator0 import code_generator from code_generator import code_generator def distortion_measure(n): # Hamming distance D=ones((n,n),dtype='longdouble') for i in range(n): D[i][i]=0.0 return(D) def blahut_arimoto(q): nx,ny=shape(q) qx=[] for i in range(nx): qx.append(longdouble(sum(q[i,:]))) qy=[] for j in range(ny): qy.append(longdouble(sum(q[:,j]))) nz=nx #%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% # The array t contains all the possible codes that map Y into Z nt=nx+1 t,nt=code_generator(nz,ny) # If nx!=nz there is a problem D=distortion_measure(max(nx,ny)) npoints=100 ds=arange(-10.0,0.0,0.1) c=zeros((nx,nt),dtype='longdouble') vtx=zeros((nt,nx),dtype='longdouble') sexp=zeros(nt,dtype='longdouble') #epsilon=finfo(longdouble(1.0)).eps epsilon=1.0e-7 for s in range(npoints): qty=ones((nt,ny),dtype='longdouble') qty=qty/nt/ny # Initialise stop test stop=longdouble(1.0e5) n=0 while stop>epsilon: n=n+1 for i in range(nx): if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssum=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssum+=q[i][j]*qxid*log(qty[k][j]) else: ssum+=qy[j]*log(qty[k][j]) c[i][k]=exp(ssum) for i in range(nx): sexp=zeros(nt,dtype='longdouble') sd=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): for j in range(ny): if qx[i]!=0.0: sexp[k]+=q[i][j]*qxid*D[i,t[2][k,j]] else: sexp[k]+=qy[j]*D[i,t[2][k,j]] sd+=c[i][k]*exp(ds[s]*sexp[k]) sd=longdouble(1.0)/sd for k in range(nt): vtx[k][i]=c[i][k]*exp(ds[s]*sexp[k])*sd qtym=qty qty=zeros((nt,ny),dtype='longdouble') stop=longdouble(0.0) for j in range(ny): qyjd=longdouble(1.0)/qy[j] for k in range(nt): for i in range(nx): qty[k][j]+=q[i][j]*qyjd*vtx[k][i] stop+=qy[j]*qty[k][j]*log(qty[k][j]/qtym[k][j]) ssum=longdouble(0.0) dv=longdouble(0.0) for i in range(nx): ssum2=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssexp=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssexp+=q[i][j]*qxid*D[i,t[2][k,j]] else: ssexp+=qy[j]*D[i,t[2][k,j]] dv+=q[i][j]*vtx[k][i]*D[i,t[2][k,j]] ssum2+=c[i][k]*exp(ds[s]*ssexp) ssum+=qx[i]*log(ssum2) R=ds[s]*dv-ssum print dv,R,n def readinputfile(inputfile): a=[ line.split() for line in file(inputfile) ] nx=len(a) # Number of lines ny=len(a[0]) # Number of columns q=zeros((nx,ny),dtype='longdouble') for i in range(nx): for j in range(ny): q[i][j]=a[i][j] return(q) def main(inputfile="q.txt"):
if __name__=="__main__": if len(argv)>1: main(argv[1]) else: main()
if isfile(inputfile): q=readinputfile(inputfile) else: nx=2 ny=2 q=array([[0.3,0.2],[0.24,0.26]],dtype='longdouble') blahut_arimoto(q)
identifier_body
rbawz2.py
#!/usr/bin/env python # # Computation of the rate-distortion function for source coding with side # information at the decoder using the Blahut-Arimoto algorithm. # # Formulation similar to R.E. Blahut "Computation of Channel Capacity and # Rate-Distortion Functions," IEEE Transactions on Information Theory, 18, # no. 4, 1972. # # Author: Christophe Ramananjaona # (c) 2005, Department of Electrical and Computer Engineering, Duke University. # (c) 2017, Isloux, for the Python version. from numpy import shape,sum,zeros,ones,arange,log,exp,array,longdouble,finfo from sys import float_info from os.path import isfile from sys import argv #from code_generator0 import code_generator from code_generator import code_generator def distortion_measure(n): # Hamming distance D=ones((n,n),dtype='longdouble') for i in range(n): D[i][i]=0.0 return(D) def blahut_arimoto(q): nx,ny=shape(q) qx=[] for i in range(nx): qx.append(longdouble(sum(q[i,:]))) qy=[] for j in range(ny): qy.append(longdouble(sum(q[:,j]))) nz=nx #%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% # The array t contains all the possible codes that map Y into Z nt=nx+1 t,nt=code_generator(nz,ny) # If nx!=nz there is a problem D=distortion_measure(max(nx,ny)) npoints=100 ds=arange(-10.0,0.0,0.1) c=zeros((nx,nt),dtype='longdouble') vtx=zeros((nt,nx),dtype='longdouble') sexp=zeros(nt,dtype='longdouble') #epsilon=finfo(longdouble(1.0)).eps epsilon=1.0e-7 for s in range(npoints): qty=ones((nt,ny),dtype='longdouble') qty=qty/nt/ny # Initialise stop test stop=longdouble(1.0e5) n=0 while stop>epsilon: n=n+1 for i in range(nx): if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssum=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssum+=q[i][j]*qxid*log(qty[k][j]) else: ssum+=qy[j]*log(qty[k][j]) c[i][k]=exp(ssum) for i in range(nx): sexp=zeros(nt,dtype='longdouble') sd=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): for j in range(ny): if qx[i]!=0.0: sexp[k]+=q[i][j]*qxid*D[i,t[2][k,j]] else: sexp[k]+=qy[j]*D[i,t[2][k,j]] sd+=c[i][k]*exp(ds[s]*sexp[k]) sd=longdouble(1.0)/sd for k in range(nt): vtx[k][i]=c[i][k]*exp(ds[s]*sexp[k])*sd qtym=qty qty=zeros((nt,ny),dtype='longdouble') stop=longdouble(0.0) for j in range(ny): qyjd=longdouble(1.0)/qy[j] for k in range(nt): for i in range(nx): qty[k][j]+=q[i][j]*qyjd*vtx[k][i] stop+=qy[j]*qty[k][j]*log(qty[k][j]/qtym[k][j]) ssum=longdouble(0.0) dv=longdouble(0.0) for i in range(nx): ssum2=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssexp=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssexp+=q[i][j]*qxid*D[i,t[2][k,j]] else: ssexp+=qy[j]*D[i,t[2][k,j]] dv+=q[i][j]*vtx[k][i]*D[i,t[2][k,j]] ssum2+=c[i][k]*exp(ds[s]*ssexp) ssum+=qx[i]*log(ssum2) R=ds[s]*dv-ssum print dv,R,n def
(inputfile): a=[ line.split() for line in file(inputfile) ] nx=len(a) # Number of lines ny=len(a[0]) # Number of columns q=zeros((nx,ny),dtype='longdouble') for i in range(nx): for j in range(ny): q[i][j]=a[i][j] return(q) def main(inputfile="q.txt"): if isfile(inputfile): q=readinputfile(inputfile) else: nx=2 ny=2 q=array([[0.3,0.2],[0.24,0.26]],dtype='longdouble') blahut_arimoto(q) if __name__=="__main__": if len(argv)>1: main(argv[1]) else: main()
readinputfile
identifier_name
rbawz2.py
#!/usr/bin/env python # # Computation of the rate-distortion function for source coding with side # information at the decoder using the Blahut-Arimoto algorithm. # # Formulation similar to R.E. Blahut "Computation of Channel Capacity and # Rate-Distortion Functions," IEEE Transactions on Information Theory, 18, # no. 4, 1972. # # Author: Christophe Ramananjaona # (c) 2005, Department of Electrical and Computer Engineering, Duke University. # (c) 2017, Isloux, for the Python version. from numpy import shape,sum,zeros,ones,arange,log,exp,array,longdouble,finfo from sys import float_info from os.path import isfile from sys import argv #from code_generator0 import code_generator from code_generator import code_generator def distortion_measure(n): # Hamming distance D=ones((n,n),dtype='longdouble') for i in range(n): D[i][i]=0.0 return(D)
def blahut_arimoto(q): nx,ny=shape(q) qx=[] for i in range(nx): qx.append(longdouble(sum(q[i,:]))) qy=[] for j in range(ny): qy.append(longdouble(sum(q[:,j]))) nz=nx #%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% # The array t contains all the possible codes that map Y into Z nt=nx+1 t,nt=code_generator(nz,ny) # If nx!=nz there is a problem D=distortion_measure(max(nx,ny)) npoints=100 ds=arange(-10.0,0.0,0.1) c=zeros((nx,nt),dtype='longdouble') vtx=zeros((nt,nx),dtype='longdouble') sexp=zeros(nt,dtype='longdouble') #epsilon=finfo(longdouble(1.0)).eps epsilon=1.0e-7 for s in range(npoints): qty=ones((nt,ny),dtype='longdouble') qty=qty/nt/ny # Initialise stop test stop=longdouble(1.0e5) n=0 while stop>epsilon: n=n+1 for i in range(nx): if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssum=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssum+=q[i][j]*qxid*log(qty[k][j]) else: ssum+=qy[j]*log(qty[k][j]) c[i][k]=exp(ssum) for i in range(nx): sexp=zeros(nt,dtype='longdouble') sd=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): for j in range(ny): if qx[i]!=0.0: sexp[k]+=q[i][j]*qxid*D[i,t[2][k,j]] else: sexp[k]+=qy[j]*D[i,t[2][k,j]] sd+=c[i][k]*exp(ds[s]*sexp[k]) sd=longdouble(1.0)/sd for k in range(nt): vtx[k][i]=c[i][k]*exp(ds[s]*sexp[k])*sd qtym=qty qty=zeros((nt,ny),dtype='longdouble') stop=longdouble(0.0) for j in range(ny): qyjd=longdouble(1.0)/qy[j] for k in range(nt): for i in range(nx): qty[k][j]+=q[i][j]*qyjd*vtx[k][i] stop+=qy[j]*qty[k][j]*log(qty[k][j]/qtym[k][j]) ssum=longdouble(0.0) dv=longdouble(0.0) for i in range(nx): ssum2=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssexp=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssexp+=q[i][j]*qxid*D[i,t[2][k,j]] else: ssexp+=qy[j]*D[i,t[2][k,j]] dv+=q[i][j]*vtx[k][i]*D[i,t[2][k,j]] ssum2+=c[i][k]*exp(ds[s]*ssexp) ssum+=qx[i]*log(ssum2) R=ds[s]*dv-ssum print dv,R,n def readinputfile(inputfile): a=[ line.split() for line in file(inputfile) ] nx=len(a) # Number of lines ny=len(a[0]) # Number of columns q=zeros((nx,ny),dtype='longdouble') for i in range(nx): for j in range(ny): q[i][j]=a[i][j] return(q) def main(inputfile="q.txt"): if isfile(inputfile): q=readinputfile(inputfile) else: nx=2 ny=2 q=array([[0.3,0.2],[0.24,0.26]],dtype='longdouble') blahut_arimoto(q) if __name__=="__main__": if len(argv)>1: main(argv[1]) else: main()
random_line_split
rbawz2.py
#!/usr/bin/env python # # Computation of the rate-distortion function for source coding with side # information at the decoder using the Blahut-Arimoto algorithm. # # Formulation similar to R.E. Blahut "Computation of Channel Capacity and # Rate-Distortion Functions," IEEE Transactions on Information Theory, 18, # no. 4, 1972. # # Author: Christophe Ramananjaona # (c) 2005, Department of Electrical and Computer Engineering, Duke University. # (c) 2017, Isloux, for the Python version. from numpy import shape,sum,zeros,ones,arange,log,exp,array,longdouble,finfo from sys import float_info from os.path import isfile from sys import argv #from code_generator0 import code_generator from code_generator import code_generator def distortion_measure(n): # Hamming distance D=ones((n,n),dtype='longdouble') for i in range(n): D[i][i]=0.0 return(D) def blahut_arimoto(q): nx,ny=shape(q) qx=[] for i in range(nx): qx.append(longdouble(sum(q[i,:]))) qy=[] for j in range(ny): qy.append(longdouble(sum(q[:,j]))) nz=nx #%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% # The array t contains all the possible codes that map Y into Z nt=nx+1 t,nt=code_generator(nz,ny) # If nx!=nz there is a problem D=distortion_measure(max(nx,ny)) npoints=100 ds=arange(-10.0,0.0,0.1) c=zeros((nx,nt),dtype='longdouble') vtx=zeros((nt,nx),dtype='longdouble') sexp=zeros(nt,dtype='longdouble') #epsilon=finfo(longdouble(1.0)).eps epsilon=1.0e-7 for s in range(npoints): qty=ones((nt,ny),dtype='longdouble') qty=qty/nt/ny # Initialise stop test stop=longdouble(1.0e5) n=0 while stop>epsilon: n=n+1 for i in range(nx): if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssum=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssum+=q[i][j]*qxid*log(qty[k][j]) else: ssum+=qy[j]*log(qty[k][j]) c[i][k]=exp(ssum) for i in range(nx): sexp=zeros(nt,dtype='longdouble') sd=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): for j in range(ny): if qx[i]!=0.0: sexp[k]+=q[i][j]*qxid*D[i,t[2][k,j]] else: sexp[k]+=qy[j]*D[i,t[2][k,j]] sd+=c[i][k]*exp(ds[s]*sexp[k]) sd=longdouble(1.0)/sd for k in range(nt): vtx[k][i]=c[i][k]*exp(ds[s]*sexp[k])*sd qtym=qty qty=zeros((nt,ny),dtype='longdouble') stop=longdouble(0.0) for j in range(ny): qyjd=longdouble(1.0)/qy[j] for k in range(nt): for i in range(nx): qty[k][j]+=q[i][j]*qyjd*vtx[k][i] stop+=qy[j]*qty[k][j]*log(qty[k][j]/qtym[k][j]) ssum=longdouble(0.0) dv=longdouble(0.0) for i in range(nx): ssum2=longdouble(0.0) if qx[i]!=0.0: qxid=longdouble(1.0)/qx[i] for k in range(nt): ssexp=longdouble(0.0) for j in range(ny): if qx[i]!=0.0: ssexp+=q[i][j]*qxid*D[i,t[2][k,j]] else: ssexp+=qy[j]*D[i,t[2][k,j]] dv+=q[i][j]*vtx[k][i]*D[i,t[2][k,j]] ssum2+=c[i][k]*exp(ds[s]*ssexp) ssum+=qx[i]*log(ssum2) R=ds[s]*dv-ssum print dv,R,n def readinputfile(inputfile): a=[ line.split() for line in file(inputfile) ] nx=len(a) # Number of lines ny=len(a[0]) # Number of columns q=zeros((nx,ny),dtype='longdouble') for i in range(nx): for j in range(ny): q[i][j]=a[i][j] return(q) def main(inputfile="q.txt"): if isfile(inputfile): q=readinputfile(inputfile) else: nx=2 ny=2 q=array([[0.3,0.2],[0.24,0.26]],dtype='longdouble') blahut_arimoto(q) if __name__=="__main__":
if len(argv)>1: main(argv[1]) else: main()
conditional_block
URITemplate.js
/*! * URI.js - Mutating URLs * URI Template Support - http://tools.ietf.org/html/rfc6570 * * Version: 1.16.0 * * Author: Rodney Rehm * Web: http://medialize.github.io/URI.js/ * * Licensed under * MIT License http://www.opensource.org/licenses/mit-license * GPL v3 http://opensource.org/licenses/GPL-3.0 * */ (function (root, factory) { 'use strict'; // https://github.com/umdjs/umd/blob/master/returnExports.js if (typeof exports === 'object') { // Node module.exports = factory(require('./URI')); } else if (typeof define === 'function' && define.amd) { // AMD. Register as an anonymous module. define(['./URI'], factory); } else { // Browser globals (root is window) root.URITemplate = factory(root.URI, root); } }(this, function (URI, root) { 'use strict'; // FIXME: v2.0.0 renamce non-camelCase properties to uppercase /*jshint camelcase: false */ // save current URITemplate variable, if any var _URITemplate = root && root.URITemplate; var hasOwn = Object.prototype.hasOwnProperty; function URITemplate(expression) { // serve from cache where possible if (URITemplate._cache[expression]) { return URITemplate._cache[expression]; } // Allow instantiation without the 'new' keyword if (!(this instanceof URITemplate)) { return new URITemplate(expression); } this.expression = expression; URITemplate._cache[expression] = this; return this; } function Data(data) { this.data = data; this.cache = {}; } var p = URITemplate.prototype; // list of operators and their defined options var operators = { // Simple string expansion '' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encode' }, // Reserved character strings '+' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Fragment identifiers prefixed by '#' '#' : { prefix: '#', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Name labels or extensions prefixed by '.' '.' : { prefix: '.', separator: '.', named: false, empty_name_separator: false, encode : 'encode' }, // Path segments prefixed by '/' '/' : { prefix: '/', separator: '/', named: false, empty_name_separator: false, encode : 'encode' }, // Path parameter name or name=value pairs prefixed by ';' ';' : { prefix: ';', separator: ';', named: true, empty_name_separator: false, encode : 'encode' }, // Query component beginning with '?' and consisting // of name=value pairs separated by '&'; an '?' : { prefix: '?', separator: '&', named: true, empty_name_separator: true, encode : 'encode' }, // Continuation of query-style &name=value pairs // within a literal query component. '&' : { prefix: '&', separator: '&', named: true, empty_name_separator: true, encode : 'encode' } // The operator characters equals ("="), comma (","), exclamation ("!"), // at sign ("@"), and pipe ("|") are reserved for future extensions. }; // storage for already parsed templates URITemplate._cache = {}; // pattern to identify expressions [operator, variable-list] in template URITemplate.EXPRESSION_PATTERN = /\{([^a-zA-Z0-9%_]?)([^\}]+)(\}|$)/g; // pattern to identify variables [name, explode, maxlength] in variable-list URITemplate.VARIABLE_PATTERN = /^([^*:]+)((\*)|:(\d+))?$/; // pattern to verify variable name integrity URITemplate.VARIABLE_NAME_PATTERN = /[^a-zA-Z0-9%_]/; // expand parsed expression (expression, not template!) URITemplate.expand = function(expression, data) { // container for defined options for the given operator var options = operators[expression.operator]; // expansion type (include keys or not) var type = options.named ? 'Named' : 'Unnamed'; // list of variables within the expression var variables = expression.variables; // result buffer for evaluating the expression var buffer = []; var d, variable, i; for (i = 0; (variable = variables[i]); i++) { // fetch simplified data source d = data.get(variable.name); if (!d.val.length) { if (d.type) { // empty variables (empty string) // still lead to a separator being appended! buffer.push(''); } // no data, no action continue; } // expand the given variable buffer.push(URITemplate['expand' + type]( d, options, variable.explode, variable.explode && options.separator || ',', variable.maxlength, variable.name )); } if (buffer.length) { return options.prefix + buffer.join(options.separator); } else { // prefix is not prepended for empty expressions return ''; } }; // expand a named variable URITemplate.expandNamed = function(d, options, explode, separator, length, name) { // variable result buffer var result = ''; // peformance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; // key for named expansion var _name = d.type === 2 ? '': URI[encode](name); var _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); if (d.type === 2) { // apply maxlength to keys of objects as well _name = URI[encode](d.val[i][0].substring(0, length)); } } else if (_encode) { // encode value _value = URI[encode](d.val[i][1]); if (d.type === 2) { // encode name and cache encoded value _name = URI[encode](d.val[i][0]); d[encode].push([_name, _value]); } else { // cache encoded value d[encode].push([undefined, _value]); } } else { // values are already encoded and can be pulled from cache _value = d[encode][i][1]; if (d.type === 2) { _name = d[encode][i][0]; } } if (result) { // unless we're the first value, prepend the separator result += separator; } if (!explode) { if (!i)
if (d.type === 2) { // without explode-modifier, keys of objects are returned comma-separated result += _name + ','; } result += _value; } else { // only add the = if it is either default (?&) or there actually is a value (;) result += _name + (empty_name_separator || _value ? '=' : '') + _value; } } return result; }; // expand an unnamed variable URITemplate.expandUnnamed = function(d, options, explode, separator, length) { // variable result buffer var result = ''; // performance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; var _name, _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); } else if (_encode) { // encode and cache value _value = URI[encode](d.val[i][1]); d[encode].push([ d.type === 2 ? URI[encode](d.val[i][0]) : undefined, _value ]); } else { // value already encoded, pull from cache _value = d[encode][i][1]; } if (result) { // unless we're the first value, prepend the separator result += separator; } if (d.type === 2) { if (length) { // maxlength also applies to keys of objects _name = URI[encode](d.val[i][0].substring(0, length)); } else { // at this point the name must already be encoded _name = d[encode][i][0]; } result += _name; if (explode) { // explode-modifier separates name and value by "=" result += (empty_name_separator || _value ? '=' : ''); } else { // no explode-modifier separates name and value by "," result += ','; } } result += _value; } return result; }; URITemplate.noConflict = function() { if (root.URITemplate === URITemplate) { root.URITemplate = _URITemplate; } return URITemplate; }; // expand template through given data map p.expand = function(data) { var result = ''; if (!this.parts || !this.parts.length) { // lazilyy parse the template this.parse(); } if (!(data instanceof Data)) { // make given data available through the // optimized data handling thingie data = new Data(data); } for (var i = 0, l = this.parts.length; i < l; i++) { /*jshint laxbreak: true */ result += typeof this.parts[i] === 'string' // literal string ? this.parts[i] // expression : URITemplate.expand(this.parts[i], data); /*jshint laxbreak: false */ } return result; }; // parse template into action tokens p.parse = function() { // performance crap var expression = this.expression; var ePattern = URITemplate.EXPRESSION_PATTERN; var vPattern = URITemplate.VARIABLE_PATTERN; var nPattern = URITemplate.VARIABLE_NAME_PATTERN; // token result buffer var parts = []; // position within source template var pos = 0; var variables, eMatch, vMatch; // RegExp is shared accross all templates, // which requires a manual reset ePattern.lastIndex = 0; // I don't like while(foo = bar()) loops, // to make things simpler I go while(true) and break when required while (true) { eMatch = ePattern.exec(expression); if (eMatch === null) { // push trailing literal parts.push(expression.substring(pos)); break; } else { // push leading literal parts.push(expression.substring(pos, eMatch.index)); pos = eMatch.index + eMatch[0].length; } if (!operators[eMatch[1]]) { throw new Error('Unknown Operator "' + eMatch[1] + '" in "' + eMatch[0] + '"'); } else if (!eMatch[3]) { throw new Error('Unclosed Expression "' + eMatch[0] + '"'); } // parse variable-list variables = eMatch[2].split(','); for (var i = 0, l = variables.length; i < l; i++) { vMatch = variables[i].match(vPattern); if (vMatch === null) { throw new Error('Invalid Variable "' + variables[i] + '" in "' + eMatch[0] + '"'); } else if (vMatch[1].match(nPattern)) { throw new Error('Invalid Variable Name "' + vMatch[1] + '" in "' + eMatch[0] + '"'); } variables[i] = { name: vMatch[1], explode: !!vMatch[3], maxlength: vMatch[4] && parseInt(vMatch[4], 10) }; } if (!variables.length) { throw new Error('Expression Missing Variable(s) "' + eMatch[0] + '"'); } parts.push({ expression: eMatch[0], operator: eMatch[1], variables: variables }); } if (!parts.length) { // template doesn't contain any expressions // so it is a simple literal string // this probably should fire a warning or something? parts.push(expression); } this.parts = parts; return this; }; // simplify data structures Data.prototype.get = function(key) { // performance crap var data = this.data; // cache for processed data-point var d = { // type of data 0: undefined/null, 1: string, 2: object, 3: array type: 0, // original values (except undefined/null) val: [], // cache for encoded values (only for non-maxlength expansion) encode: [], encodeReserved: [] }; var i, l, value; if (this.cache[key] !== undefined) { // we've already processed this key return this.cache[key]; } this.cache[key] = d; if (String(Object.prototype.toString.call(data)) === '[object Function]') { // data itself is a callback (global callback) value = data(key); } else if (String(Object.prototype.toString.call(data[key])) === '[object Function]') { // data is a map of callbacks (local callback) value = data[key](key); } else { // data is a map of data value = data[key]; } // generalize input into [ [name1, value1], [name2, value2], … ] // so expansion has to deal with a single data structure only if (value === undefined || value === null) { // undefined and null values are to be ignored completely return d; } else if (String(Object.prototype.toString.call(value)) === '[object Array]') { for (i = 0, l = value.length; i < l; i++) { if (value[i] !== undefined && value[i] !== null) { // arrays don't have names d.val.push([undefined, String(value[i])]); } } if (d.val.length) { // only treat non-empty arrays as arrays d.type = 3; // array } } else if (String(Object.prototype.toString.call(value)) === '[object Object]') { for (i in value) { if (hasOwn.call(value, i) && value[i] !== undefined && value[i] !== null) { // objects have keys, remember them for named expansion d.val.push([i, String(value[i])]); } } if (d.val.length) { // only treat non-empty objects as objects d.type = 2; // object } } else { d.type = 1; // primitive string (could've been string, number, boolean and objects with a toString()) // arrays don't have names d.val.push([undefined, String(value)]); } return d; }; // hook into URI for fluid access URI.expand = function(expression, data) { var template = new URITemplate(expression); var expansion = template.expand(data); return new URI(expansion); }; return URITemplate; }));
{ // first element, so prepend variable name result += URI[encode](name) + (empty_name_separator || _value ? '=' : ''); }
conditional_block
URITemplate.js
/*! * URI.js - Mutating URLs * URI Template Support - http://tools.ietf.org/html/rfc6570 * * Version: 1.16.0 * * Author: Rodney Rehm * Web: http://medialize.github.io/URI.js/ * * Licensed under * MIT License http://www.opensource.org/licenses/mit-license * GPL v3 http://opensource.org/licenses/GPL-3.0 * */ (function (root, factory) { 'use strict'; // https://github.com/umdjs/umd/blob/master/returnExports.js if (typeof exports === 'object') { // Node module.exports = factory(require('./URI')); } else if (typeof define === 'function' && define.amd) { // AMD. Register as an anonymous module. define(['./URI'], factory); } else { // Browser globals (root is window) root.URITemplate = factory(root.URI, root); } }(this, function (URI, root) { 'use strict'; // FIXME: v2.0.0 renamce non-camelCase properties to uppercase /*jshint camelcase: false */ // save current URITemplate variable, if any var _URITemplate = root && root.URITemplate; var hasOwn = Object.prototype.hasOwnProperty; function URITemplate(expression) { // serve from cache where possible if (URITemplate._cache[expression]) { return URITemplate._cache[expression]; } // Allow instantiation without the 'new' keyword if (!(this instanceof URITemplate)) { return new URITemplate(expression); } this.expression = expression; URITemplate._cache[expression] = this; return this; } function Data(data) { this.data = data; this.cache = {}; } var p = URITemplate.prototype; // list of operators and their defined options var operators = { // Simple string expansion '' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encode' }, // Reserved character strings '+' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Fragment identifiers prefixed by '#' '#' : { prefix: '#', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Name labels or extensions prefixed by '.' '.' : { prefix: '.', separator: '.', named: false, empty_name_separator: false, encode : 'encode' }, // Path segments prefixed by '/' '/' : { prefix: '/', separator: '/', named: false, empty_name_separator: false, encode : 'encode' }, // Path parameter name or name=value pairs prefixed by ';' ';' : { prefix: ';', separator: ';', named: true, empty_name_separator: false, encode : 'encode' }, // Query component beginning with '?' and consisting // of name=value pairs separated by '&'; an '?' : { prefix: '?', separator: '&', named: true, empty_name_separator: true, encode : 'encode' }, // Continuation of query-style &name=value pairs // within a literal query component. '&' : { prefix: '&', separator: '&', named: true, empty_name_separator: true, encode : 'encode' } // The operator characters equals ("="), comma (","), exclamation ("!"), // at sign ("@"), and pipe ("|") are reserved for future extensions. }; // storage for already parsed templates URITemplate._cache = {}; // pattern to identify expressions [operator, variable-list] in template URITemplate.EXPRESSION_PATTERN = /\{([^a-zA-Z0-9%_]?)([^\}]+)(\}|$)/g; // pattern to identify variables [name, explode, maxlength] in variable-list URITemplate.VARIABLE_PATTERN = /^([^*:]+)((\*)|:(\d+))?$/; // pattern to verify variable name integrity URITemplate.VARIABLE_NAME_PATTERN = /[^a-zA-Z0-9%_]/; // expand parsed expression (expression, not template!) URITemplate.expand = function(expression, data) { // container for defined options for the given operator var options = operators[expression.operator]; // expansion type (include keys or not) var type = options.named ? 'Named' : 'Unnamed'; // list of variables within the expression var variables = expression.variables; // result buffer for evaluating the expression var buffer = []; var d, variable, i; for (i = 0; (variable = variables[i]); i++) { // fetch simplified data source d = data.get(variable.name); if (!d.val.length) { if (d.type) { // empty variables (empty string) // still lead to a separator being appended! buffer.push(''); } // no data, no action continue; } // expand the given variable buffer.push(URITemplate['expand' + type]( d, options, variable.explode, variable.explode && options.separator || ',', variable.maxlength, variable.name )); } if (buffer.length) { return options.prefix + buffer.join(options.separator); } else { // prefix is not prepended for empty expressions return ''; } }; // expand a named variable URITemplate.expandNamed = function(d, options, explode, separator, length, name) { // variable result buffer var result = ''; // peformance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; // key for named expansion var _name = d.type === 2 ? '': URI[encode](name); var _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); if (d.type === 2) { // apply maxlength to keys of objects as well _name = URI[encode](d.val[i][0].substring(0, length)); } } else if (_encode) { // encode value _value = URI[encode](d.val[i][1]); if (d.type === 2) { // encode name and cache encoded value _name = URI[encode](d.val[i][0]); d[encode].push([_name, _value]); } else { // cache encoded value d[encode].push([undefined, _value]); } } else { // values are already encoded and can be pulled from cache _value = d[encode][i][1]; if (d.type === 2) { _name = d[encode][i][0]; } } if (result) { // unless we're the first value, prepend the separator result += separator; } if (!explode) { if (!i) { // first element, so prepend variable name result += URI[encode](name) + (empty_name_separator || _value ? '=' : ''); } if (d.type === 2) { // without explode-modifier, keys of objects are returned comma-separated result += _name + ',';
// only add the = if it is either default (?&) or there actually is a value (;) result += _name + (empty_name_separator || _value ? '=' : '') + _value; } } return result; }; // expand an unnamed variable URITemplate.expandUnnamed = function(d, options, explode, separator, length) { // variable result buffer var result = ''; // performance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; var _name, _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); } else if (_encode) { // encode and cache value _value = URI[encode](d.val[i][1]); d[encode].push([ d.type === 2 ? URI[encode](d.val[i][0]) : undefined, _value ]); } else { // value already encoded, pull from cache _value = d[encode][i][1]; } if (result) { // unless we're the first value, prepend the separator result += separator; } if (d.type === 2) { if (length) { // maxlength also applies to keys of objects _name = URI[encode](d.val[i][0].substring(0, length)); } else { // at this point the name must already be encoded _name = d[encode][i][0]; } result += _name; if (explode) { // explode-modifier separates name and value by "=" result += (empty_name_separator || _value ? '=' : ''); } else { // no explode-modifier separates name and value by "," result += ','; } } result += _value; } return result; }; URITemplate.noConflict = function() { if (root.URITemplate === URITemplate) { root.URITemplate = _URITemplate; } return URITemplate; }; // expand template through given data map p.expand = function(data) { var result = ''; if (!this.parts || !this.parts.length) { // lazilyy parse the template this.parse(); } if (!(data instanceof Data)) { // make given data available through the // optimized data handling thingie data = new Data(data); } for (var i = 0, l = this.parts.length; i < l; i++) { /*jshint laxbreak: true */ result += typeof this.parts[i] === 'string' // literal string ? this.parts[i] // expression : URITemplate.expand(this.parts[i], data); /*jshint laxbreak: false */ } return result; }; // parse template into action tokens p.parse = function() { // performance crap var expression = this.expression; var ePattern = URITemplate.EXPRESSION_PATTERN; var vPattern = URITemplate.VARIABLE_PATTERN; var nPattern = URITemplate.VARIABLE_NAME_PATTERN; // token result buffer var parts = []; // position within source template var pos = 0; var variables, eMatch, vMatch; // RegExp is shared accross all templates, // which requires a manual reset ePattern.lastIndex = 0; // I don't like while(foo = bar()) loops, // to make things simpler I go while(true) and break when required while (true) { eMatch = ePattern.exec(expression); if (eMatch === null) { // push trailing literal parts.push(expression.substring(pos)); break; } else { // push leading literal parts.push(expression.substring(pos, eMatch.index)); pos = eMatch.index + eMatch[0].length; } if (!operators[eMatch[1]]) { throw new Error('Unknown Operator "' + eMatch[1] + '" in "' + eMatch[0] + '"'); } else if (!eMatch[3]) { throw new Error('Unclosed Expression "' + eMatch[0] + '"'); } // parse variable-list variables = eMatch[2].split(','); for (var i = 0, l = variables.length; i < l; i++) { vMatch = variables[i].match(vPattern); if (vMatch === null) { throw new Error('Invalid Variable "' + variables[i] + '" in "' + eMatch[0] + '"'); } else if (vMatch[1].match(nPattern)) { throw new Error('Invalid Variable Name "' + vMatch[1] + '" in "' + eMatch[0] + '"'); } variables[i] = { name: vMatch[1], explode: !!vMatch[3], maxlength: vMatch[4] && parseInt(vMatch[4], 10) }; } if (!variables.length) { throw new Error('Expression Missing Variable(s) "' + eMatch[0] + '"'); } parts.push({ expression: eMatch[0], operator: eMatch[1], variables: variables }); } if (!parts.length) { // template doesn't contain any expressions // so it is a simple literal string // this probably should fire a warning or something? parts.push(expression); } this.parts = parts; return this; }; // simplify data structures Data.prototype.get = function(key) { // performance crap var data = this.data; // cache for processed data-point var d = { // type of data 0: undefined/null, 1: string, 2: object, 3: array type: 0, // original values (except undefined/null) val: [], // cache for encoded values (only for non-maxlength expansion) encode: [], encodeReserved: [] }; var i, l, value; if (this.cache[key] !== undefined) { // we've already processed this key return this.cache[key]; } this.cache[key] = d; if (String(Object.prototype.toString.call(data)) === '[object Function]') { // data itself is a callback (global callback) value = data(key); } else if (String(Object.prototype.toString.call(data[key])) === '[object Function]') { // data is a map of callbacks (local callback) value = data[key](key); } else { // data is a map of data value = data[key]; } // generalize input into [ [name1, value1], [name2, value2], … ] // so expansion has to deal with a single data structure only if (value === undefined || value === null) { // undefined and null values are to be ignored completely return d; } else if (String(Object.prototype.toString.call(value)) === '[object Array]') { for (i = 0, l = value.length; i < l; i++) { if (value[i] !== undefined && value[i] !== null) { // arrays don't have names d.val.push([undefined, String(value[i])]); } } if (d.val.length) { // only treat non-empty arrays as arrays d.type = 3; // array } } else if (String(Object.prototype.toString.call(value)) === '[object Object]') { for (i in value) { if (hasOwn.call(value, i) && value[i] !== undefined && value[i] !== null) { // objects have keys, remember them for named expansion d.val.push([i, String(value[i])]); } } if (d.val.length) { // only treat non-empty objects as objects d.type = 2; // object } } else { d.type = 1; // primitive string (could've been string, number, boolean and objects with a toString()) // arrays don't have names d.val.push([undefined, String(value)]); } return d; }; // hook into URI for fluid access URI.expand = function(expression, data) { var template = new URITemplate(expression); var expansion = template.expand(data); return new URI(expansion); }; return URITemplate; }));
} result += _value; } else {
random_line_split
URITemplate.js
/*! * URI.js - Mutating URLs * URI Template Support - http://tools.ietf.org/html/rfc6570 * * Version: 1.16.0 * * Author: Rodney Rehm * Web: http://medialize.github.io/URI.js/ * * Licensed under * MIT License http://www.opensource.org/licenses/mit-license * GPL v3 http://opensource.org/licenses/GPL-3.0 * */ (function (root, factory) { 'use strict'; // https://github.com/umdjs/umd/blob/master/returnExports.js if (typeof exports === 'object') { // Node module.exports = factory(require('./URI')); } else if (typeof define === 'function' && define.amd) { // AMD. Register as an anonymous module. define(['./URI'], factory); } else { // Browser globals (root is window) root.URITemplate = factory(root.URI, root); } }(this, function (URI, root) { 'use strict'; // FIXME: v2.0.0 renamce non-camelCase properties to uppercase /*jshint camelcase: false */ // save current URITemplate variable, if any var _URITemplate = root && root.URITemplate; var hasOwn = Object.prototype.hasOwnProperty; function
(expression) { // serve from cache where possible if (URITemplate._cache[expression]) { return URITemplate._cache[expression]; } // Allow instantiation without the 'new' keyword if (!(this instanceof URITemplate)) { return new URITemplate(expression); } this.expression = expression; URITemplate._cache[expression] = this; return this; } function Data(data) { this.data = data; this.cache = {}; } var p = URITemplate.prototype; // list of operators and their defined options var operators = { // Simple string expansion '' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encode' }, // Reserved character strings '+' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Fragment identifiers prefixed by '#' '#' : { prefix: '#', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Name labels or extensions prefixed by '.' '.' : { prefix: '.', separator: '.', named: false, empty_name_separator: false, encode : 'encode' }, // Path segments prefixed by '/' '/' : { prefix: '/', separator: '/', named: false, empty_name_separator: false, encode : 'encode' }, // Path parameter name or name=value pairs prefixed by ';' ';' : { prefix: ';', separator: ';', named: true, empty_name_separator: false, encode : 'encode' }, // Query component beginning with '?' and consisting // of name=value pairs separated by '&'; an '?' : { prefix: '?', separator: '&', named: true, empty_name_separator: true, encode : 'encode' }, // Continuation of query-style &name=value pairs // within a literal query component. '&' : { prefix: '&', separator: '&', named: true, empty_name_separator: true, encode : 'encode' } // The operator characters equals ("="), comma (","), exclamation ("!"), // at sign ("@"), and pipe ("|") are reserved for future extensions. }; // storage for already parsed templates URITemplate._cache = {}; // pattern to identify expressions [operator, variable-list] in template URITemplate.EXPRESSION_PATTERN = /\{([^a-zA-Z0-9%_]?)([^\}]+)(\}|$)/g; // pattern to identify variables [name, explode, maxlength] in variable-list URITemplate.VARIABLE_PATTERN = /^([^*:]+)((\*)|:(\d+))?$/; // pattern to verify variable name integrity URITemplate.VARIABLE_NAME_PATTERN = /[^a-zA-Z0-9%_]/; // expand parsed expression (expression, not template!) URITemplate.expand = function(expression, data) { // container for defined options for the given operator var options = operators[expression.operator]; // expansion type (include keys or not) var type = options.named ? 'Named' : 'Unnamed'; // list of variables within the expression var variables = expression.variables; // result buffer for evaluating the expression var buffer = []; var d, variable, i; for (i = 0; (variable = variables[i]); i++) { // fetch simplified data source d = data.get(variable.name); if (!d.val.length) { if (d.type) { // empty variables (empty string) // still lead to a separator being appended! buffer.push(''); } // no data, no action continue; } // expand the given variable buffer.push(URITemplate['expand' + type]( d, options, variable.explode, variable.explode && options.separator || ',', variable.maxlength, variable.name )); } if (buffer.length) { return options.prefix + buffer.join(options.separator); } else { // prefix is not prepended for empty expressions return ''; } }; // expand a named variable URITemplate.expandNamed = function(d, options, explode, separator, length, name) { // variable result buffer var result = ''; // peformance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; // key for named expansion var _name = d.type === 2 ? '': URI[encode](name); var _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); if (d.type === 2) { // apply maxlength to keys of objects as well _name = URI[encode](d.val[i][0].substring(0, length)); } } else if (_encode) { // encode value _value = URI[encode](d.val[i][1]); if (d.type === 2) { // encode name and cache encoded value _name = URI[encode](d.val[i][0]); d[encode].push([_name, _value]); } else { // cache encoded value d[encode].push([undefined, _value]); } } else { // values are already encoded and can be pulled from cache _value = d[encode][i][1]; if (d.type === 2) { _name = d[encode][i][0]; } } if (result) { // unless we're the first value, prepend the separator result += separator; } if (!explode) { if (!i) { // first element, so prepend variable name result += URI[encode](name) + (empty_name_separator || _value ? '=' : ''); } if (d.type === 2) { // without explode-modifier, keys of objects are returned comma-separated result += _name + ','; } result += _value; } else { // only add the = if it is either default (?&) or there actually is a value (;) result += _name + (empty_name_separator || _value ? '=' : '') + _value; } } return result; }; // expand an unnamed variable URITemplate.expandUnnamed = function(d, options, explode, separator, length) { // variable result buffer var result = ''; // performance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; var _name, _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); } else if (_encode) { // encode and cache value _value = URI[encode](d.val[i][1]); d[encode].push([ d.type === 2 ? URI[encode](d.val[i][0]) : undefined, _value ]); } else { // value already encoded, pull from cache _value = d[encode][i][1]; } if (result) { // unless we're the first value, prepend the separator result += separator; } if (d.type === 2) { if (length) { // maxlength also applies to keys of objects _name = URI[encode](d.val[i][0].substring(0, length)); } else { // at this point the name must already be encoded _name = d[encode][i][0]; } result += _name; if (explode) { // explode-modifier separates name and value by "=" result += (empty_name_separator || _value ? '=' : ''); } else { // no explode-modifier separates name and value by "," result += ','; } } result += _value; } return result; }; URITemplate.noConflict = function() { if (root.URITemplate === URITemplate) { root.URITemplate = _URITemplate; } return URITemplate; }; // expand template through given data map p.expand = function(data) { var result = ''; if (!this.parts || !this.parts.length) { // lazilyy parse the template this.parse(); } if (!(data instanceof Data)) { // make given data available through the // optimized data handling thingie data = new Data(data); } for (var i = 0, l = this.parts.length; i < l; i++) { /*jshint laxbreak: true */ result += typeof this.parts[i] === 'string' // literal string ? this.parts[i] // expression : URITemplate.expand(this.parts[i], data); /*jshint laxbreak: false */ } return result; }; // parse template into action tokens p.parse = function() { // performance crap var expression = this.expression; var ePattern = URITemplate.EXPRESSION_PATTERN; var vPattern = URITemplate.VARIABLE_PATTERN; var nPattern = URITemplate.VARIABLE_NAME_PATTERN; // token result buffer var parts = []; // position within source template var pos = 0; var variables, eMatch, vMatch; // RegExp is shared accross all templates, // which requires a manual reset ePattern.lastIndex = 0; // I don't like while(foo = bar()) loops, // to make things simpler I go while(true) and break when required while (true) { eMatch = ePattern.exec(expression); if (eMatch === null) { // push trailing literal parts.push(expression.substring(pos)); break; } else { // push leading literal parts.push(expression.substring(pos, eMatch.index)); pos = eMatch.index + eMatch[0].length; } if (!operators[eMatch[1]]) { throw new Error('Unknown Operator "' + eMatch[1] + '" in "' + eMatch[0] + '"'); } else if (!eMatch[3]) { throw new Error('Unclosed Expression "' + eMatch[0] + '"'); } // parse variable-list variables = eMatch[2].split(','); for (var i = 0, l = variables.length; i < l; i++) { vMatch = variables[i].match(vPattern); if (vMatch === null) { throw new Error('Invalid Variable "' + variables[i] + '" in "' + eMatch[0] + '"'); } else if (vMatch[1].match(nPattern)) { throw new Error('Invalid Variable Name "' + vMatch[1] + '" in "' + eMatch[0] + '"'); } variables[i] = { name: vMatch[1], explode: !!vMatch[3], maxlength: vMatch[4] && parseInt(vMatch[4], 10) }; } if (!variables.length) { throw new Error('Expression Missing Variable(s) "' + eMatch[0] + '"'); } parts.push({ expression: eMatch[0], operator: eMatch[1], variables: variables }); } if (!parts.length) { // template doesn't contain any expressions // so it is a simple literal string // this probably should fire a warning or something? parts.push(expression); } this.parts = parts; return this; }; // simplify data structures Data.prototype.get = function(key) { // performance crap var data = this.data; // cache for processed data-point var d = { // type of data 0: undefined/null, 1: string, 2: object, 3: array type: 0, // original values (except undefined/null) val: [], // cache for encoded values (only for non-maxlength expansion) encode: [], encodeReserved: [] }; var i, l, value; if (this.cache[key] !== undefined) { // we've already processed this key return this.cache[key]; } this.cache[key] = d; if (String(Object.prototype.toString.call(data)) === '[object Function]') { // data itself is a callback (global callback) value = data(key); } else if (String(Object.prototype.toString.call(data[key])) === '[object Function]') { // data is a map of callbacks (local callback) value = data[key](key); } else { // data is a map of data value = data[key]; } // generalize input into [ [name1, value1], [name2, value2], … ] // so expansion has to deal with a single data structure only if (value === undefined || value === null) { // undefined and null values are to be ignored completely return d; } else if (String(Object.prototype.toString.call(value)) === '[object Array]') { for (i = 0, l = value.length; i < l; i++) { if (value[i] !== undefined && value[i] !== null) { // arrays don't have names d.val.push([undefined, String(value[i])]); } } if (d.val.length) { // only treat non-empty arrays as arrays d.type = 3; // array } } else if (String(Object.prototype.toString.call(value)) === '[object Object]') { for (i in value) { if (hasOwn.call(value, i) && value[i] !== undefined && value[i] !== null) { // objects have keys, remember them for named expansion d.val.push([i, String(value[i])]); } } if (d.val.length) { // only treat non-empty objects as objects d.type = 2; // object } } else { d.type = 1; // primitive string (could've been string, number, boolean and objects with a toString()) // arrays don't have names d.val.push([undefined, String(value)]); } return d; }; // hook into URI for fluid access URI.expand = function(expression, data) { var template = new URITemplate(expression); var expansion = template.expand(data); return new URI(expansion); }; return URITemplate; }));
URITemplate
identifier_name
URITemplate.js
/*! * URI.js - Mutating URLs * URI Template Support - http://tools.ietf.org/html/rfc6570 * * Version: 1.16.0 * * Author: Rodney Rehm * Web: http://medialize.github.io/URI.js/ * * Licensed under * MIT License http://www.opensource.org/licenses/mit-license * GPL v3 http://opensource.org/licenses/GPL-3.0 * */ (function (root, factory) { 'use strict'; // https://github.com/umdjs/umd/blob/master/returnExports.js if (typeof exports === 'object') { // Node module.exports = factory(require('./URI')); } else if (typeof define === 'function' && define.amd) { // AMD. Register as an anonymous module. define(['./URI'], factory); } else { // Browser globals (root is window) root.URITemplate = factory(root.URI, root); } }(this, function (URI, root) { 'use strict'; // FIXME: v2.0.0 renamce non-camelCase properties to uppercase /*jshint camelcase: false */ // save current URITemplate variable, if any var _URITemplate = root && root.URITemplate; var hasOwn = Object.prototype.hasOwnProperty; function URITemplate(expression) { // serve from cache where possible if (URITemplate._cache[expression]) { return URITemplate._cache[expression]; } // Allow instantiation without the 'new' keyword if (!(this instanceof URITemplate)) { return new URITemplate(expression); } this.expression = expression; URITemplate._cache[expression] = this; return this; } function Data(data)
var p = URITemplate.prototype; // list of operators and their defined options var operators = { // Simple string expansion '' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encode' }, // Reserved character strings '+' : { prefix: '', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Fragment identifiers prefixed by '#' '#' : { prefix: '#', separator: ',', named: false, empty_name_separator: false, encode : 'encodeReserved' }, // Name labels or extensions prefixed by '.' '.' : { prefix: '.', separator: '.', named: false, empty_name_separator: false, encode : 'encode' }, // Path segments prefixed by '/' '/' : { prefix: '/', separator: '/', named: false, empty_name_separator: false, encode : 'encode' }, // Path parameter name or name=value pairs prefixed by ';' ';' : { prefix: ';', separator: ';', named: true, empty_name_separator: false, encode : 'encode' }, // Query component beginning with '?' and consisting // of name=value pairs separated by '&'; an '?' : { prefix: '?', separator: '&', named: true, empty_name_separator: true, encode : 'encode' }, // Continuation of query-style &name=value pairs // within a literal query component. '&' : { prefix: '&', separator: '&', named: true, empty_name_separator: true, encode : 'encode' } // The operator characters equals ("="), comma (","), exclamation ("!"), // at sign ("@"), and pipe ("|") are reserved for future extensions. }; // storage for already parsed templates URITemplate._cache = {}; // pattern to identify expressions [operator, variable-list] in template URITemplate.EXPRESSION_PATTERN = /\{([^a-zA-Z0-9%_]?)([^\}]+)(\}|$)/g; // pattern to identify variables [name, explode, maxlength] in variable-list URITemplate.VARIABLE_PATTERN = /^([^*:]+)((\*)|:(\d+))?$/; // pattern to verify variable name integrity URITemplate.VARIABLE_NAME_PATTERN = /[^a-zA-Z0-9%_]/; // expand parsed expression (expression, not template!) URITemplate.expand = function(expression, data) { // container for defined options for the given operator var options = operators[expression.operator]; // expansion type (include keys or not) var type = options.named ? 'Named' : 'Unnamed'; // list of variables within the expression var variables = expression.variables; // result buffer for evaluating the expression var buffer = []; var d, variable, i; for (i = 0; (variable = variables[i]); i++) { // fetch simplified data source d = data.get(variable.name); if (!d.val.length) { if (d.type) { // empty variables (empty string) // still lead to a separator being appended! buffer.push(''); } // no data, no action continue; } // expand the given variable buffer.push(URITemplate['expand' + type]( d, options, variable.explode, variable.explode && options.separator || ',', variable.maxlength, variable.name )); } if (buffer.length) { return options.prefix + buffer.join(options.separator); } else { // prefix is not prepended for empty expressions return ''; } }; // expand a named variable URITemplate.expandNamed = function(d, options, explode, separator, length, name) { // variable result buffer var result = ''; // peformance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; // key for named expansion var _name = d.type === 2 ? '': URI[encode](name); var _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); if (d.type === 2) { // apply maxlength to keys of objects as well _name = URI[encode](d.val[i][0].substring(0, length)); } } else if (_encode) { // encode value _value = URI[encode](d.val[i][1]); if (d.type === 2) { // encode name and cache encoded value _name = URI[encode](d.val[i][0]); d[encode].push([_name, _value]); } else { // cache encoded value d[encode].push([undefined, _value]); } } else { // values are already encoded and can be pulled from cache _value = d[encode][i][1]; if (d.type === 2) { _name = d[encode][i][0]; } } if (result) { // unless we're the first value, prepend the separator result += separator; } if (!explode) { if (!i) { // first element, so prepend variable name result += URI[encode](name) + (empty_name_separator || _value ? '=' : ''); } if (d.type === 2) { // without explode-modifier, keys of objects are returned comma-separated result += _name + ','; } result += _value; } else { // only add the = if it is either default (?&) or there actually is a value (;) result += _name + (empty_name_separator || _value ? '=' : '') + _value; } } return result; }; // expand an unnamed variable URITemplate.expandUnnamed = function(d, options, explode, separator, length) { // variable result buffer var result = ''; // performance crap var encode = options.encode; var empty_name_separator = options.empty_name_separator; // flag noting if values are already encoded var _encode = !d[encode].length; var _name, _value, i, l; // for each found value for (i = 0, l = d.val.length; i < l; i++) { if (length) { // maxlength must be determined before encoding can happen _value = URI[encode](d.val[i][1].substring(0, length)); } else if (_encode) { // encode and cache value _value = URI[encode](d.val[i][1]); d[encode].push([ d.type === 2 ? URI[encode](d.val[i][0]) : undefined, _value ]); } else { // value already encoded, pull from cache _value = d[encode][i][1]; } if (result) { // unless we're the first value, prepend the separator result += separator; } if (d.type === 2) { if (length) { // maxlength also applies to keys of objects _name = URI[encode](d.val[i][0].substring(0, length)); } else { // at this point the name must already be encoded _name = d[encode][i][0]; } result += _name; if (explode) { // explode-modifier separates name and value by "=" result += (empty_name_separator || _value ? '=' : ''); } else { // no explode-modifier separates name and value by "," result += ','; } } result += _value; } return result; }; URITemplate.noConflict = function() { if (root.URITemplate === URITemplate) { root.URITemplate = _URITemplate; } return URITemplate; }; // expand template through given data map p.expand = function(data) { var result = ''; if (!this.parts || !this.parts.length) { // lazilyy parse the template this.parse(); } if (!(data instanceof Data)) { // make given data available through the // optimized data handling thingie data = new Data(data); } for (var i = 0, l = this.parts.length; i < l; i++) { /*jshint laxbreak: true */ result += typeof this.parts[i] === 'string' // literal string ? this.parts[i] // expression : URITemplate.expand(this.parts[i], data); /*jshint laxbreak: false */ } return result; }; // parse template into action tokens p.parse = function() { // performance crap var expression = this.expression; var ePattern = URITemplate.EXPRESSION_PATTERN; var vPattern = URITemplate.VARIABLE_PATTERN; var nPattern = URITemplate.VARIABLE_NAME_PATTERN; // token result buffer var parts = []; // position within source template var pos = 0; var variables, eMatch, vMatch; // RegExp is shared accross all templates, // which requires a manual reset ePattern.lastIndex = 0; // I don't like while(foo = bar()) loops, // to make things simpler I go while(true) and break when required while (true) { eMatch = ePattern.exec(expression); if (eMatch === null) { // push trailing literal parts.push(expression.substring(pos)); break; } else { // push leading literal parts.push(expression.substring(pos, eMatch.index)); pos = eMatch.index + eMatch[0].length; } if (!operators[eMatch[1]]) { throw new Error('Unknown Operator "' + eMatch[1] + '" in "' + eMatch[0] + '"'); } else if (!eMatch[3]) { throw new Error('Unclosed Expression "' + eMatch[0] + '"'); } // parse variable-list variables = eMatch[2].split(','); for (var i = 0, l = variables.length; i < l; i++) { vMatch = variables[i].match(vPattern); if (vMatch === null) { throw new Error('Invalid Variable "' + variables[i] + '" in "' + eMatch[0] + '"'); } else if (vMatch[1].match(nPattern)) { throw new Error('Invalid Variable Name "' + vMatch[1] + '" in "' + eMatch[0] + '"'); } variables[i] = { name: vMatch[1], explode: !!vMatch[3], maxlength: vMatch[4] && parseInt(vMatch[4], 10) }; } if (!variables.length) { throw new Error('Expression Missing Variable(s) "' + eMatch[0] + '"'); } parts.push({ expression: eMatch[0], operator: eMatch[1], variables: variables }); } if (!parts.length) { // template doesn't contain any expressions // so it is a simple literal string // this probably should fire a warning or something? parts.push(expression); } this.parts = parts; return this; }; // simplify data structures Data.prototype.get = function(key) { // performance crap var data = this.data; // cache for processed data-point var d = { // type of data 0: undefined/null, 1: string, 2: object, 3: array type: 0, // original values (except undefined/null) val: [], // cache for encoded values (only for non-maxlength expansion) encode: [], encodeReserved: [] }; var i, l, value; if (this.cache[key] !== undefined) { // we've already processed this key return this.cache[key]; } this.cache[key] = d; if (String(Object.prototype.toString.call(data)) === '[object Function]') { // data itself is a callback (global callback) value = data(key); } else if (String(Object.prototype.toString.call(data[key])) === '[object Function]') { // data is a map of callbacks (local callback) value = data[key](key); } else { // data is a map of data value = data[key]; } // generalize input into [ [name1, value1], [name2, value2], … ] // so expansion has to deal with a single data structure only if (value === undefined || value === null) { // undefined and null values are to be ignored completely return d; } else if (String(Object.prototype.toString.call(value)) === '[object Array]') { for (i = 0, l = value.length; i < l; i++) { if (value[i] !== undefined && value[i] !== null) { // arrays don't have names d.val.push([undefined, String(value[i])]); } } if (d.val.length) { // only treat non-empty arrays as arrays d.type = 3; // array } } else if (String(Object.prototype.toString.call(value)) === '[object Object]') { for (i in value) { if (hasOwn.call(value, i) && value[i] !== undefined && value[i] !== null) { // objects have keys, remember them for named expansion d.val.push([i, String(value[i])]); } } if (d.val.length) { // only treat non-empty objects as objects d.type = 2; // object } } else { d.type = 1; // primitive string (could've been string, number, boolean and objects with a toString()) // arrays don't have names d.val.push([undefined, String(value)]); } return d; }; // hook into URI for fluid access URI.expand = function(expression, data) { var template = new URITemplate(expression); var expansion = template.expand(data); return new URI(expansion); }; return URITemplate; }));
{ this.data = data; this.cache = {}; }
identifier_body
canvas_msg.rs
/* This Source Code Form is subject to the terms of the Mozilla Public * License, v. 2.0. If a copy of the MPL was not distributed with this * file, You can obtain one at http://mozilla.org/MPL/2.0/. */ use canvas_paint_task::{FillOrStrokeStyle, LineCapStyle, LineJoinStyle, CompositionOrBlending}; use geom::matrix2d::Matrix2D; use geom::point::Point2D; use geom::rect::Rect; use geom::size::Size2D; use std::sync::mpsc::{Sender}; #[derive(Clone)] pub enum
{ Canvas2d(Canvas2dMsg), Common(CanvasCommonMsg), WebGL(CanvasWebGLMsg), } #[derive(Clone)] pub enum Canvas2dMsg { Arc(Point2D<f32>, f32, f32, f32, bool), ArcTo(Point2D<f32>, Point2D<f32>, f32), DrawImage(Vec<u8>, Size2D<f64>, Rect<f64>, Rect<f64>, bool), DrawImageSelf(Size2D<f64>, Rect<f64>, Rect<f64>, bool), BeginPath, BezierCurveTo(Point2D<f32>, Point2D<f32>, Point2D<f32>), ClearRect(Rect<f32>), Clip, ClosePath, Fill, FillRect(Rect<f32>), GetImageData(Rect<f64>, Size2D<f64>, Sender<Vec<u8>>), LineTo(Point2D<f32>), MoveTo(Point2D<f32>), PutImageData(Vec<u8>, Rect<f64>, Option<Rect<f64>>), QuadraticCurveTo(Point2D<f32>, Point2D<f32>), Rect(Rect<f32>), RestoreContext, SaveContext, StrokeRect(Rect<f32>), Stroke, SetFillStyle(FillOrStrokeStyle), SetStrokeStyle(FillOrStrokeStyle), SetLineWidth(f32), SetLineCap(LineCapStyle), SetLineJoin(LineJoinStyle), SetMiterLimit(f32), SetGlobalAlpha(f32), SetGlobalComposition(CompositionOrBlending), SetTransform(Matrix2D<f32>), } #[derive(Clone)] pub enum CanvasWebGLMsg { AttachShader(u32, u32), BindBuffer(u32, u32), BufferData(u32, Vec<f32>, u32), Clear(u32), ClearColor(f32, f32, f32, f32), CompileShader(u32), CreateBuffer(Sender<u32>), CreateProgram(Sender<u32>), CreateShader(u32, Sender<u32>), DrawArrays(u32, i32, i32), EnableVertexAttribArray(u32), GetAttribLocation(u32, String, Sender<i32>), GetShaderInfoLog(u32, Sender<String>), GetShaderParameter(u32, u32, Sender<i32>), GetUniformLocation(u32, String, Sender<u32>), LinkProgram(u32), ShaderSource(u32, Vec<String>), Uniform4fv(u32, Vec<f32>), UseProgram(u32), VertexAttribPointer2f(u32, i32, bool, i32, i64), Viewport(i32, i32, i32, i32), } #[derive(Clone)] pub enum CanvasCommonMsg { Close, Recreate(Size2D<i32>), SendPixelContents(Sender<Vec<u8>>), }
CanvasMsg
identifier_name
canvas_msg.rs
/* This Source Code Form is subject to the terms of the Mozilla Public * License, v. 2.0. If a copy of the MPL was not distributed with this * file, You can obtain one at http://mozilla.org/MPL/2.0/. */ use canvas_paint_task::{FillOrStrokeStyle, LineCapStyle, LineJoinStyle, CompositionOrBlending}; use geom::matrix2d::Matrix2D; use geom::point::Point2D; use geom::rect::Rect; use geom::size::Size2D; use std::sync::mpsc::{Sender}; #[derive(Clone)] pub enum CanvasMsg { Canvas2d(Canvas2dMsg), Common(CanvasCommonMsg), WebGL(CanvasWebGLMsg), } #[derive(Clone)] pub enum Canvas2dMsg { Arc(Point2D<f32>, f32, f32, f32, bool), ArcTo(Point2D<f32>, Point2D<f32>, f32), DrawImage(Vec<u8>, Size2D<f64>, Rect<f64>, Rect<f64>, bool), DrawImageSelf(Size2D<f64>, Rect<f64>, Rect<f64>, bool), BeginPath, BezierCurveTo(Point2D<f32>, Point2D<f32>, Point2D<f32>), ClearRect(Rect<f32>),
LineTo(Point2D<f32>), MoveTo(Point2D<f32>), PutImageData(Vec<u8>, Rect<f64>, Option<Rect<f64>>), QuadraticCurveTo(Point2D<f32>, Point2D<f32>), Rect(Rect<f32>), RestoreContext, SaveContext, StrokeRect(Rect<f32>), Stroke, SetFillStyle(FillOrStrokeStyle), SetStrokeStyle(FillOrStrokeStyle), SetLineWidth(f32), SetLineCap(LineCapStyle), SetLineJoin(LineJoinStyle), SetMiterLimit(f32), SetGlobalAlpha(f32), SetGlobalComposition(CompositionOrBlending), SetTransform(Matrix2D<f32>), } #[derive(Clone)] pub enum CanvasWebGLMsg { AttachShader(u32, u32), BindBuffer(u32, u32), BufferData(u32, Vec<f32>, u32), Clear(u32), ClearColor(f32, f32, f32, f32), CompileShader(u32), CreateBuffer(Sender<u32>), CreateProgram(Sender<u32>), CreateShader(u32, Sender<u32>), DrawArrays(u32, i32, i32), EnableVertexAttribArray(u32), GetAttribLocation(u32, String, Sender<i32>), GetShaderInfoLog(u32, Sender<String>), GetShaderParameter(u32, u32, Sender<i32>), GetUniformLocation(u32, String, Sender<u32>), LinkProgram(u32), ShaderSource(u32, Vec<String>), Uniform4fv(u32, Vec<f32>), UseProgram(u32), VertexAttribPointer2f(u32, i32, bool, i32, i64), Viewport(i32, i32, i32, i32), } #[derive(Clone)] pub enum CanvasCommonMsg { Close, Recreate(Size2D<i32>), SendPixelContents(Sender<Vec<u8>>), }
Clip, ClosePath, Fill, FillRect(Rect<f32>), GetImageData(Rect<f64>, Size2D<f64>, Sender<Vec<u8>>),
random_line_split
ShareSharp.js
import React from 'react';
export default createSvgIcon( <path d="M18 16.08c-.76 0-1.44.3-1.96.77L8.91 12.7c.05-.23.09-.46.09-.7s-.04-.47-.09-.7l7.05-4.11c.54.5 1.25.81 2.04.81 1.66 0 3-1.34 3-3s-1.34-3-3-3-3 1.34-3 3c0 .24.04.47.09.7L8.04 9.81C7.5 9.31 6.79 9 6 9c-1.66 0-3 1.34-3 3s1.34 3 3 3c.79 0 1.5-.31 2.04-.81l7.12 4.16c-.05.21-.08.43-.08.65 0 1.61 1.31 2.92 2.92 2.92s2.92-1.31 2.92-2.92-1.31-2.92-2.92-2.92z" /> , 'ShareSharp');
import createSvgIcon from './utils/createSvgIcon';
random_line_split
runner.rs
// Copyright (C) 2019, Cloudflare, Inc. // All rights reserved. // // Redistribution and use in source and binary forms, with or without // modification, are permitted provided that the following conditions are // met: // // * Redistributions of source code must retain the above copyright notice, // this list of conditions and the following disclaimer. // // * Redistributions in binary form must reproduce the above copyright // notice, this list of conditions and the following disclaimer in the // documentation and/or other materials provided with the distribution. // // THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS // IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, // THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR // PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR // CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, // EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, // PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR // PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF // LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING // NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS // SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. use quiche::h3::NameValue; use ring::rand::*; use crate::Http3TestError; pub fn run( test: &mut crate::Http3Test, peer_addr: std::net::SocketAddr, verify_peer: bool, idle_timeout: u64, max_data: u64, early_data: bool, session_file: Option<String>, ) -> Result<(), Http3TestError> { const MAX_DATAGRAM_SIZE: usize = 1350; let mut buf = [0; 65535]; let mut out = [0; MAX_DATAGRAM_SIZE]; let max_stream_data = max_data; let version = if let Some(v) = std::env::var_os("QUIC_VERSION") { match v.to_str() { Some("current") => quiche::PROTOCOL_VERSION, Some(v) => u32::from_str_radix(v, 16).unwrap(), _ => 0xbaba_baba, } } else { 0xbaba_baba }; let mut reqs_count = 0; let mut reqs_complete = 0; // Setup the event loop. let poll = mio::Poll::new().unwrap(); let mut events = mio::Events::with_capacity(1024); info!("connecting to {:}", peer_addr); // Bind to INADDR_ANY or IN6ADDR_ANY depending on the IP family of the // server address. This is needed on macOS and BSD variants that don't // support binding to IN6ADDR_ANY for both v4 and v6. let bind_addr = match peer_addr { std::net::SocketAddr::V4(_) => "0.0.0.0:0", std::net::SocketAddr::V6(_) => "[::]:0", }; // Create the UDP socket backing the QUIC connection, and register it with // the event loop. let socket = std::net::UdpSocket::bind(bind_addr).unwrap(); let socket = mio::net::UdpSocket::from_socket(socket).unwrap(); poll.register( &socket, mio::Token(0), mio::Ready::readable(), mio::PollOpt::edge(), ) .unwrap(); // Create the configuration for the QUIC connection. let mut config = quiche::Config::new(version).unwrap(); config.verify_peer(verify_peer); config .set_application_protos(quiche::h3::APPLICATION_PROTOCOL) .unwrap(); config.set_max_idle_timeout(idle_timeout); config.set_max_recv_udp_payload_size(MAX_DATAGRAM_SIZE); config.set_initial_max_data(max_data); config.set_initial_max_stream_data_bidi_local(max_stream_data); config.set_initial_max_stream_data_bidi_remote(max_stream_data); config.set_initial_max_stream_data_uni(max_stream_data); config.set_initial_max_streams_bidi(100); config.set_initial_max_streams_uni(100); config.set_disable_active_migration(true); if early_data { config.enable_early_data(); debug!("early data enabled"); } let mut http3_conn = None; if std::env::var_os("SSLKEYLOGFILE").is_some() { config.log_keys(); } // Generate a random source connection ID for the connection. let mut scid = [0; quiche::MAX_CONN_ID_LEN]; SystemRandom::new().fill(&mut scid[..]).unwrap(); let scid = quiche::ConnectionId::from_ref(&scid); // Create a QUIC connection and initiate handshake. let url = &test.endpoint(); let mut conn = quiche::connect(url.domain(), &scid, peer_addr, &mut config).unwrap(); if let Some(session_file) = &session_file { if let Ok(session) = std::fs::read(session_file) { conn.set_session(&session).ok(); } } let (write, send_info) = conn.send(&mut out).expect("initial send failed"); while let Err(e) = socket.send_to(&out[..write], &send_info.to) { if e.kind() == std::io::ErrorKind::WouldBlock { debug!("send() would block"); continue; } return Err(Http3TestError::Other(format!("send() failed: {:?}", e))); } debug!("written {}", write); let req_start = std::time::Instant::now(); loop { if !conn.is_in_early_data() || http3_conn.is_some() { poll.poll(&mut events, conn.timeout()).unwrap(); } // Read incoming UDP packets from the socket and feed them to quiche, // until there are no more packets to read. 'read: loop { // If the event loop reported no events, it means that the timeout // has expired, so handle it without attempting to read packets. We // will then proceed with the send loop. if events.is_empty() { debug!("timed out"); conn.on_timeout(); break 'read; } let (len, from) = match socket.recv_from(&mut buf) { Ok(v) => v, Err(e) => { // There are no more UDP packets to read, so end the read // loop. if e.kind() == std::io::ErrorKind::WouldBlock { debug!("recv() would block"); break 'read; } return Err(Http3TestError::Other(format!( "recv() failed: {:?}", e ))); }, }; debug!("got {} bytes", len); let recv_info = quiche::RecvInfo { from }; // Process potentially coalesced packets. let read = match conn.recv(&mut buf[..len], recv_info) { Ok(v) => v, Err(quiche::Error::Done) => { debug!("done reading"); break; }, Err(e) => { error!("recv failed: {:?}", e); break 'read; }, }; debug!("processed {} bytes", read); } if conn.is_closed() { info!("connection closed, {:?}", conn.stats()); if !conn.is_established() { error!("connection timed out after {:?}", req_start.elapsed(),); return Err(Http3TestError::HandshakeFail); } if reqs_complete != reqs_count { error!("Client timed out after {:?} and only completed {}/{} requests", req_start.elapsed(), reqs_complete, reqs_count); return Err(Http3TestError::HttpFail); } if let Some(session_file) = session_file { if let Some(session) = conn.session() { std::fs::write(session_file, &session).ok(); } } break; } // Create a new HTTP/3 connection and end an HTTP request as soon as // the QUIC connection is established. if (conn.is_established() || conn.is_in_early_data()) && http3_conn.is_none() { let h3_config = quiche::h3::Config::new().unwrap(); let mut h3_conn = quiche::h3::Connection::with_transport(&mut conn, &h3_config) .unwrap(); reqs_count = test.requests_count(); match test.send_requests(&mut conn, &mut h3_conn) { Ok(_) => (), Err(quiche::h3::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error sending: {:?}", e ))); }, }; http3_conn = Some(h3_conn); } if let Some(http3_conn) = &mut http3_conn { // Process HTTP/3 events. loop { match http3_conn.poll(&mut conn) { Ok((stream_id, quiche::h3::Event::Headers { list, .. })) => { info!( "got response headers {:?} on stream id {}", hdrs_to_strings(&list), stream_id ); test.add_response_headers(stream_id, &list); }, Ok((stream_id, quiche::h3::Event::Data)) => { if let Ok(read) = http3_conn.recv_body(&mut conn, stream_id, &mut buf) { info!( "got {} bytes of response data on stream {}", read, stream_id ); test.add_response_body(stream_id, &buf, read); } }, Ok((_stream_id, quiche::h3::Event::Finished)) => { reqs_complete += 1; info!( "{}/{} responses received", reqs_complete, reqs_count ); if reqs_complete == reqs_count { info!( "Completed test run. {}/{} response(s) received in {:?}, closing...", reqs_complete, reqs_count, req_start.elapsed() ); match conn.close(true, 0x00, b"kthxbye") { // Already closed. Ok(_) | Err(quiche::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error closing conn: {:?}", e ))); }, } test.assert(); break; } match test.send_requests(&mut conn, http3_conn) { Ok(_) => (), Err(quiche::h3::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error sending request: {:?}", e ))); }, } }, Ok((stream_id, quiche::h3::Event::Reset(e))) => { reqs_complete += 1; info!("request was reset by peer with {}", e); test.set_reset_stream_error(stream_id, e); if reqs_complete == reqs_count { info!( "Completed test run. {}/{} response(s) received in {:?}, closing...", reqs_complete, reqs_count, req_start.elapsed() ); match conn.close(true, 0x00, b"kthxbye") { // Already closed. Ok(_) | Err(quiche::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error closing conn: {:?}", e ))); }, } test.assert(); break; } }, Ok((_flow_id, quiche::h3::Event::Datagram)) => (), Ok((_goaway_id, quiche::h3::Event::GoAway)) => (), Err(quiche::h3::Error::Done) => { break; }, Err(e) => { error!("HTTP/3 processing failed: {:?}", e); break;
// Generate outgoing QUIC packets and send them on the UDP socket, until // quiche reports that there are no more packets to be sent. loop { let (write, send_info) = match conn.send(&mut out) { Ok(v) => v, Err(quiche::Error::Done) => { debug!("done writing"); break; }, Err(e) => { error!("send failed: {:?}", e); conn.close(false, 0x1, b"fail").ok(); break; }, }; if let Err(e) = socket.send_to(&out[..write], &send_info.to) { if e.kind() == std::io::ErrorKind::WouldBlock { debug!("send() would block"); break; } return Err(Http3TestError::Other(format!( "send() failed: {:?}", e ))); } debug!("written {}", write); } if conn.is_closed() { info!("connection closed, {:?}", conn.stats()); if reqs_complete != reqs_count { error!("Client timed out after {:?} and only completed {}/{} requests", req_start.elapsed(), reqs_complete, reqs_count); return Err(Http3TestError::HttpFail); } if let Some(session_file) = session_file { if let Some(session) = conn.session() { std::fs::write(session_file, &session).ok(); } } break; } } Ok(()) } fn hdrs_to_strings(hdrs: &[quiche::h3::Header]) -> Vec<(String, String)> { hdrs.iter() .map(|h| { ( String::from_utf8(h.name().into()).unwrap(), String::from_utf8(h.value().into()).unwrap(), ) }) .collect() }
}, } } }
random_line_split
runner.rs
// Copyright (C) 2019, Cloudflare, Inc. // All rights reserved. // // Redistribution and use in source and binary forms, with or without // modification, are permitted provided that the following conditions are // met: // // * Redistributions of source code must retain the above copyright notice, // this list of conditions and the following disclaimer. // // * Redistributions in binary form must reproduce the above copyright // notice, this list of conditions and the following disclaimer in the // documentation and/or other materials provided with the distribution. // // THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS // IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, // THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR // PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR // CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, // EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, // PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR // PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF // LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING // NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS // SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. use quiche::h3::NameValue; use ring::rand::*; use crate::Http3TestError; pub fn run( test: &mut crate::Http3Test, peer_addr: std::net::SocketAddr, verify_peer: bool, idle_timeout: u64, max_data: u64, early_data: bool, session_file: Option<String>, ) -> Result<(), Http3TestError> { const MAX_DATAGRAM_SIZE: usize = 1350; let mut buf = [0; 65535]; let mut out = [0; MAX_DATAGRAM_SIZE]; let max_stream_data = max_data; let version = if let Some(v) = std::env::var_os("QUIC_VERSION") { match v.to_str() { Some("current") => quiche::PROTOCOL_VERSION, Some(v) => u32::from_str_radix(v, 16).unwrap(), _ => 0xbaba_baba, } } else { 0xbaba_baba }; let mut reqs_count = 0; let mut reqs_complete = 0; // Setup the event loop. let poll = mio::Poll::new().unwrap(); let mut events = mio::Events::with_capacity(1024); info!("connecting to {:}", peer_addr); // Bind to INADDR_ANY or IN6ADDR_ANY depending on the IP family of the // server address. This is needed on macOS and BSD variants that don't // support binding to IN6ADDR_ANY for both v4 and v6. let bind_addr = match peer_addr { std::net::SocketAddr::V4(_) => "0.0.0.0:0", std::net::SocketAddr::V6(_) => "[::]:0", }; // Create the UDP socket backing the QUIC connection, and register it with // the event loop. let socket = std::net::UdpSocket::bind(bind_addr).unwrap(); let socket = mio::net::UdpSocket::from_socket(socket).unwrap(); poll.register( &socket, mio::Token(0), mio::Ready::readable(), mio::PollOpt::edge(), ) .unwrap(); // Create the configuration for the QUIC connection. let mut config = quiche::Config::new(version).unwrap(); config.verify_peer(verify_peer); config .set_application_protos(quiche::h3::APPLICATION_PROTOCOL) .unwrap(); config.set_max_idle_timeout(idle_timeout); config.set_max_recv_udp_payload_size(MAX_DATAGRAM_SIZE); config.set_initial_max_data(max_data); config.set_initial_max_stream_data_bidi_local(max_stream_data); config.set_initial_max_stream_data_bidi_remote(max_stream_data); config.set_initial_max_stream_data_uni(max_stream_data); config.set_initial_max_streams_bidi(100); config.set_initial_max_streams_uni(100); config.set_disable_active_migration(true); if early_data { config.enable_early_data(); debug!("early data enabled"); } let mut http3_conn = None; if std::env::var_os("SSLKEYLOGFILE").is_some() { config.log_keys(); } // Generate a random source connection ID for the connection. let mut scid = [0; quiche::MAX_CONN_ID_LEN]; SystemRandom::new().fill(&mut scid[..]).unwrap(); let scid = quiche::ConnectionId::from_ref(&scid); // Create a QUIC connection and initiate handshake. let url = &test.endpoint(); let mut conn = quiche::connect(url.domain(), &scid, peer_addr, &mut config).unwrap(); if let Some(session_file) = &session_file { if let Ok(session) = std::fs::read(session_file) { conn.set_session(&session).ok(); } } let (write, send_info) = conn.send(&mut out).expect("initial send failed"); while let Err(e) = socket.send_to(&out[..write], &send_info.to) { if e.kind() == std::io::ErrorKind::WouldBlock { debug!("send() would block"); continue; } return Err(Http3TestError::Other(format!("send() failed: {:?}", e))); } debug!("written {}", write); let req_start = std::time::Instant::now(); loop { if !conn.is_in_early_data() || http3_conn.is_some() { poll.poll(&mut events, conn.timeout()).unwrap(); } // Read incoming UDP packets from the socket and feed them to quiche, // until there are no more packets to read. 'read: loop { // If the event loop reported no events, it means that the timeout // has expired, so handle it without attempting to read packets. We // will then proceed with the send loop. if events.is_empty() { debug!("timed out"); conn.on_timeout(); break 'read; } let (len, from) = match socket.recv_from(&mut buf) { Ok(v) => v, Err(e) => { // There are no more UDP packets to read, so end the read // loop. if e.kind() == std::io::ErrorKind::WouldBlock { debug!("recv() would block"); break 'read; } return Err(Http3TestError::Other(format!( "recv() failed: {:?}", e ))); }, }; debug!("got {} bytes", len); let recv_info = quiche::RecvInfo { from }; // Process potentially coalesced packets. let read = match conn.recv(&mut buf[..len], recv_info) { Ok(v) => v, Err(quiche::Error::Done) => { debug!("done reading"); break; }, Err(e) => { error!("recv failed: {:?}", e); break 'read; }, }; debug!("processed {} bytes", read); } if conn.is_closed() { info!("connection closed, {:?}", conn.stats()); if !conn.is_established() { error!("connection timed out after {:?}", req_start.elapsed(),); return Err(Http3TestError::HandshakeFail); } if reqs_complete != reqs_count { error!("Client timed out after {:?} and only completed {}/{} requests", req_start.elapsed(), reqs_complete, reqs_count); return Err(Http3TestError::HttpFail); } if let Some(session_file) = session_file { if let Some(session) = conn.session() { std::fs::write(session_file, &session).ok(); } } break; } // Create a new HTTP/3 connection and end an HTTP request as soon as // the QUIC connection is established. if (conn.is_established() || conn.is_in_early_data()) && http3_conn.is_none() { let h3_config = quiche::h3::Config::new().unwrap(); let mut h3_conn = quiche::h3::Connection::with_transport(&mut conn, &h3_config) .unwrap(); reqs_count = test.requests_count(); match test.send_requests(&mut conn, &mut h3_conn) { Ok(_) => (), Err(quiche::h3::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error sending: {:?}", e ))); }, }; http3_conn = Some(h3_conn); } if let Some(http3_conn) = &mut http3_conn { // Process HTTP/3 events. loop { match http3_conn.poll(&mut conn) { Ok((stream_id, quiche::h3::Event::Headers { list, .. })) => { info!( "got response headers {:?} on stream id {}", hdrs_to_strings(&list), stream_id ); test.add_response_headers(stream_id, &list); }, Ok((stream_id, quiche::h3::Event::Data)) => { if let Ok(read) = http3_conn.recv_body(&mut conn, stream_id, &mut buf) { info!( "got {} bytes of response data on stream {}", read, stream_id ); test.add_response_body(stream_id, &buf, read); } }, Ok((_stream_id, quiche::h3::Event::Finished)) => { reqs_complete += 1; info!( "{}/{} responses received", reqs_complete, reqs_count ); if reqs_complete == reqs_count { info!( "Completed test run. {}/{} response(s) received in {:?}, closing...", reqs_complete, reqs_count, req_start.elapsed() ); match conn.close(true, 0x00, b"kthxbye") { // Already closed. Ok(_) | Err(quiche::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error closing conn: {:?}", e ))); }, } test.assert(); break; } match test.send_requests(&mut conn, http3_conn) { Ok(_) => (), Err(quiche::h3::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error sending request: {:?}", e ))); }, } }, Ok((stream_id, quiche::h3::Event::Reset(e))) => { reqs_complete += 1; info!("request was reset by peer with {}", e); test.set_reset_stream_error(stream_id, e); if reqs_complete == reqs_count { info!( "Completed test run. {}/{} response(s) received in {:?}, closing...", reqs_complete, reqs_count, req_start.elapsed() ); match conn.close(true, 0x00, b"kthxbye") { // Already closed. Ok(_) | Err(quiche::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error closing conn: {:?}", e ))); }, } test.assert(); break; } }, Ok((_flow_id, quiche::h3::Event::Datagram)) => (), Ok((_goaway_id, quiche::h3::Event::GoAway)) => (), Err(quiche::h3::Error::Done) => { break; }, Err(e) => { error!("HTTP/3 processing failed: {:?}", e); break; }, } } } // Generate outgoing QUIC packets and send them on the UDP socket, until // quiche reports that there are no more packets to be sent. loop { let (write, send_info) = match conn.send(&mut out) { Ok(v) => v, Err(quiche::Error::Done) => { debug!("done writing"); break; }, Err(e) => { error!("send failed: {:?}", e); conn.close(false, 0x1, b"fail").ok(); break; }, }; if let Err(e) = socket.send_to(&out[..write], &send_info.to) { if e.kind() == std::io::ErrorKind::WouldBlock { debug!("send() would block"); break; } return Err(Http3TestError::Other(format!( "send() failed: {:?}", e ))); } debug!("written {}", write); } if conn.is_closed() { info!("connection closed, {:?}", conn.stats()); if reqs_complete != reqs_count { error!("Client timed out after {:?} and only completed {}/{} requests", req_start.elapsed(), reqs_complete, reqs_count); return Err(Http3TestError::HttpFail); } if let Some(session_file) = session_file { if let Some(session) = conn.session() { std::fs::write(session_file, &session).ok(); } } break; } } Ok(()) } fn hdrs_to_strings(hdrs: &[quiche::h3::Header]) -> Vec<(String, String)>
{ hdrs.iter() .map(|h| { ( String::from_utf8(h.name().into()).unwrap(), String::from_utf8(h.value().into()).unwrap(), ) }) .collect() }
identifier_body
runner.rs
// Copyright (C) 2019, Cloudflare, Inc. // All rights reserved. // // Redistribution and use in source and binary forms, with or without // modification, are permitted provided that the following conditions are // met: // // * Redistributions of source code must retain the above copyright notice, // this list of conditions and the following disclaimer. // // * Redistributions in binary form must reproduce the above copyright // notice, this list of conditions and the following disclaimer in the // documentation and/or other materials provided with the distribution. // // THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS // IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, // THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR // PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR // CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, // EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, // PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR // PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF // LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING // NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS // SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. use quiche::h3::NameValue; use ring::rand::*; use crate::Http3TestError; pub fn
( test: &mut crate::Http3Test, peer_addr: std::net::SocketAddr, verify_peer: bool, idle_timeout: u64, max_data: u64, early_data: bool, session_file: Option<String>, ) -> Result<(), Http3TestError> { const MAX_DATAGRAM_SIZE: usize = 1350; let mut buf = [0; 65535]; let mut out = [0; MAX_DATAGRAM_SIZE]; let max_stream_data = max_data; let version = if let Some(v) = std::env::var_os("QUIC_VERSION") { match v.to_str() { Some("current") => quiche::PROTOCOL_VERSION, Some(v) => u32::from_str_radix(v, 16).unwrap(), _ => 0xbaba_baba, } } else { 0xbaba_baba }; let mut reqs_count = 0; let mut reqs_complete = 0; // Setup the event loop. let poll = mio::Poll::new().unwrap(); let mut events = mio::Events::with_capacity(1024); info!("connecting to {:}", peer_addr); // Bind to INADDR_ANY or IN6ADDR_ANY depending on the IP family of the // server address. This is needed on macOS and BSD variants that don't // support binding to IN6ADDR_ANY for both v4 and v6. let bind_addr = match peer_addr { std::net::SocketAddr::V4(_) => "0.0.0.0:0", std::net::SocketAddr::V6(_) => "[::]:0", }; // Create the UDP socket backing the QUIC connection, and register it with // the event loop. let socket = std::net::UdpSocket::bind(bind_addr).unwrap(); let socket = mio::net::UdpSocket::from_socket(socket).unwrap(); poll.register( &socket, mio::Token(0), mio::Ready::readable(), mio::PollOpt::edge(), ) .unwrap(); // Create the configuration for the QUIC connection. let mut config = quiche::Config::new(version).unwrap(); config.verify_peer(verify_peer); config .set_application_protos(quiche::h3::APPLICATION_PROTOCOL) .unwrap(); config.set_max_idle_timeout(idle_timeout); config.set_max_recv_udp_payload_size(MAX_DATAGRAM_SIZE); config.set_initial_max_data(max_data); config.set_initial_max_stream_data_bidi_local(max_stream_data); config.set_initial_max_stream_data_bidi_remote(max_stream_data); config.set_initial_max_stream_data_uni(max_stream_data); config.set_initial_max_streams_bidi(100); config.set_initial_max_streams_uni(100); config.set_disable_active_migration(true); if early_data { config.enable_early_data(); debug!("early data enabled"); } let mut http3_conn = None; if std::env::var_os("SSLKEYLOGFILE").is_some() { config.log_keys(); } // Generate a random source connection ID for the connection. let mut scid = [0; quiche::MAX_CONN_ID_LEN]; SystemRandom::new().fill(&mut scid[..]).unwrap(); let scid = quiche::ConnectionId::from_ref(&scid); // Create a QUIC connection and initiate handshake. let url = &test.endpoint(); let mut conn = quiche::connect(url.domain(), &scid, peer_addr, &mut config).unwrap(); if let Some(session_file) = &session_file { if let Ok(session) = std::fs::read(session_file) { conn.set_session(&session).ok(); } } let (write, send_info) = conn.send(&mut out).expect("initial send failed"); while let Err(e) = socket.send_to(&out[..write], &send_info.to) { if e.kind() == std::io::ErrorKind::WouldBlock { debug!("send() would block"); continue; } return Err(Http3TestError::Other(format!("send() failed: {:?}", e))); } debug!("written {}", write); let req_start = std::time::Instant::now(); loop { if !conn.is_in_early_data() || http3_conn.is_some() { poll.poll(&mut events, conn.timeout()).unwrap(); } // Read incoming UDP packets from the socket and feed them to quiche, // until there are no more packets to read. 'read: loop { // If the event loop reported no events, it means that the timeout // has expired, so handle it without attempting to read packets. We // will then proceed with the send loop. if events.is_empty() { debug!("timed out"); conn.on_timeout(); break 'read; } let (len, from) = match socket.recv_from(&mut buf) { Ok(v) => v, Err(e) => { // There are no more UDP packets to read, so end the read // loop. if e.kind() == std::io::ErrorKind::WouldBlock { debug!("recv() would block"); break 'read; } return Err(Http3TestError::Other(format!( "recv() failed: {:?}", e ))); }, }; debug!("got {} bytes", len); let recv_info = quiche::RecvInfo { from }; // Process potentially coalesced packets. let read = match conn.recv(&mut buf[..len], recv_info) { Ok(v) => v, Err(quiche::Error::Done) => { debug!("done reading"); break; }, Err(e) => { error!("recv failed: {:?}", e); break 'read; }, }; debug!("processed {} bytes", read); } if conn.is_closed() { info!("connection closed, {:?}", conn.stats()); if !conn.is_established() { error!("connection timed out after {:?}", req_start.elapsed(),); return Err(Http3TestError::HandshakeFail); } if reqs_complete != reqs_count { error!("Client timed out after {:?} and only completed {}/{} requests", req_start.elapsed(), reqs_complete, reqs_count); return Err(Http3TestError::HttpFail); } if let Some(session_file) = session_file { if let Some(session) = conn.session() { std::fs::write(session_file, &session).ok(); } } break; } // Create a new HTTP/3 connection and end an HTTP request as soon as // the QUIC connection is established. if (conn.is_established() || conn.is_in_early_data()) && http3_conn.is_none() { let h3_config = quiche::h3::Config::new().unwrap(); let mut h3_conn = quiche::h3::Connection::with_transport(&mut conn, &h3_config) .unwrap(); reqs_count = test.requests_count(); match test.send_requests(&mut conn, &mut h3_conn) { Ok(_) => (), Err(quiche::h3::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error sending: {:?}", e ))); }, }; http3_conn = Some(h3_conn); } if let Some(http3_conn) = &mut http3_conn { // Process HTTP/3 events. loop { match http3_conn.poll(&mut conn) { Ok((stream_id, quiche::h3::Event::Headers { list, .. })) => { info!( "got response headers {:?} on stream id {}", hdrs_to_strings(&list), stream_id ); test.add_response_headers(stream_id, &list); }, Ok((stream_id, quiche::h3::Event::Data)) => { if let Ok(read) = http3_conn.recv_body(&mut conn, stream_id, &mut buf) { info!( "got {} bytes of response data on stream {}", read, stream_id ); test.add_response_body(stream_id, &buf, read); } }, Ok((_stream_id, quiche::h3::Event::Finished)) => { reqs_complete += 1; info!( "{}/{} responses received", reqs_complete, reqs_count ); if reqs_complete == reqs_count { info!( "Completed test run. {}/{} response(s) received in {:?}, closing...", reqs_complete, reqs_count, req_start.elapsed() ); match conn.close(true, 0x00, b"kthxbye") { // Already closed. Ok(_) | Err(quiche::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error closing conn: {:?}", e ))); }, } test.assert(); break; } match test.send_requests(&mut conn, http3_conn) { Ok(_) => (), Err(quiche::h3::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error sending request: {:?}", e ))); }, } }, Ok((stream_id, quiche::h3::Event::Reset(e))) => { reqs_complete += 1; info!("request was reset by peer with {}", e); test.set_reset_stream_error(stream_id, e); if reqs_complete == reqs_count { info!( "Completed test run. {}/{} response(s) received in {:?}, closing...", reqs_complete, reqs_count, req_start.elapsed() ); match conn.close(true, 0x00, b"kthxbye") { // Already closed. Ok(_) | Err(quiche::Error::Done) => (), Err(e) => { return Err(Http3TestError::Other(format!( "error closing conn: {:?}", e ))); }, } test.assert(); break; } }, Ok((_flow_id, quiche::h3::Event::Datagram)) => (), Ok((_goaway_id, quiche::h3::Event::GoAway)) => (), Err(quiche::h3::Error::Done) => { break; }, Err(e) => { error!("HTTP/3 processing failed: {:?}", e); break; }, } } } // Generate outgoing QUIC packets and send them on the UDP socket, until // quiche reports that there are no more packets to be sent. loop { let (write, send_info) = match conn.send(&mut out) { Ok(v) => v, Err(quiche::Error::Done) => { debug!("done writing"); break; }, Err(e) => { error!("send failed: {:?}", e); conn.close(false, 0x1, b"fail").ok(); break; }, }; if let Err(e) = socket.send_to(&out[..write], &send_info.to) { if e.kind() == std::io::ErrorKind::WouldBlock { debug!("send() would block"); break; } return Err(Http3TestError::Other(format!( "send() failed: {:?}", e ))); } debug!("written {}", write); } if conn.is_closed() { info!("connection closed, {:?}", conn.stats()); if reqs_complete != reqs_count { error!("Client timed out after {:?} and only completed {}/{} requests", req_start.elapsed(), reqs_complete, reqs_count); return Err(Http3TestError::HttpFail); } if let Some(session_file) = session_file { if let Some(session) = conn.session() { std::fs::write(session_file, &session).ok(); } } break; } } Ok(()) } fn hdrs_to_strings(hdrs: &[quiche::h3::Header]) -> Vec<(String, String)> { hdrs.iter() .map(|h| { ( String::from_utf8(h.name().into()).unwrap(), String::from_utf8(h.value().into()).unwrap(), ) }) .collect() }
run
identifier_name
unet.py
# The contents of this file are subject to the BitTorrent Open Source License # Version 1.1 (the License). You may not copy or use this file, in either # source code or executable form, except in compliance with the License. You # may obtain a copy of the License at http://www.bittorrent.com/license/. # # Software distributed under the License is distributed on an AS IS basis, # WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License # for the specific language governing rights and limitations under the # License. # # knet.py # create a network of khashmir nodes # usage: knet.py <num_nodes> <start_port> <ip_address> from utkhashmir import UTKhashmir from BitTorrent.RawServer_magic import RawServer from BitTorrent.defaultargs import common_options, rare_options from random import randrange from threading import Event import sys, os from krpc import KRPC KRPC.noisy = 1 class Network: def __init__(self, size=0, startport=5555, localip='127.0.0.1'): self.num = size self.startport = startport self.localip = localip def _done(self, val): self.done = 1 def simpleSetUp(self): #self.kfiles() d = dict([(x[0],x[1]) for x in common_options + rare_options]) self.r = RawServer(Event(), d) self.l = [] for i in range(self.num): self.l.append(UTKhashmir('', self.startport + i, 'kh%s.db' % (self.startport + i), self.r)) for i in self.l: i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) self.r.listen_once(1) self.r.listen_once(1) self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done: self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done:
def tearDown(self): for i in self.l: i.rawserver.stop_listening_udp(i.socket) i.socket.close() #self.kfiles() def kfiles(self): for i in range(self.startport, self.startport+self.num): try: os.unlink('kh%s.db' % i) except: pass self.r.listen_once(1) if __name__ == "__main__": n = Network(int(sys.argv[1]), int(sys.argv[2])) n.simpleSetUp() print ">>> network ready" try: n.r.listen_forever() finally: n.tearDown()
self.r.listen_once(1)
conditional_block
unet.py
# The contents of this file are subject to the BitTorrent Open Source License # Version 1.1 (the License). You may not copy or use this file, in either # source code or executable form, except in compliance with the License. You # may obtain a copy of the License at http://www.bittorrent.com/license/. # # Software distributed under the License is distributed on an AS IS basis, # WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License # for the specific language governing rights and limitations under the # License. # # knet.py # create a network of khashmir nodes # usage: knet.py <num_nodes> <start_port> <ip_address> from utkhashmir import UTKhashmir from BitTorrent.RawServer_magic import RawServer from BitTorrent.defaultargs import common_options, rare_options
import sys, os from krpc import KRPC KRPC.noisy = 1 class Network: def __init__(self, size=0, startport=5555, localip='127.0.0.1'): self.num = size self.startport = startport self.localip = localip def _done(self, val): self.done = 1 def simpleSetUp(self): #self.kfiles() d = dict([(x[0],x[1]) for x in common_options + rare_options]) self.r = RawServer(Event(), d) self.l = [] for i in range(self.num): self.l.append(UTKhashmir('', self.startport + i, 'kh%s.db' % (self.startport + i), self.r)) for i in self.l: i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) self.r.listen_once(1) self.r.listen_once(1) self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done: self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done: self.r.listen_once(1) def tearDown(self): for i in self.l: i.rawserver.stop_listening_udp(i.socket) i.socket.close() #self.kfiles() def kfiles(self): for i in range(self.startport, self.startport+self.num): try: os.unlink('kh%s.db' % i) except: pass self.r.listen_once(1) if __name__ == "__main__": n = Network(int(sys.argv[1]), int(sys.argv[2])) n.simpleSetUp() print ">>> network ready" try: n.r.listen_forever() finally: n.tearDown()
from random import randrange from threading import Event
random_line_split
unet.py
# The contents of this file are subject to the BitTorrent Open Source License # Version 1.1 (the License). You may not copy or use this file, in either # source code or executable form, except in compliance with the License. You # may obtain a copy of the License at http://www.bittorrent.com/license/. # # Software distributed under the License is distributed on an AS IS basis, # WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License # for the specific language governing rights and limitations under the # License. # # knet.py # create a network of khashmir nodes # usage: knet.py <num_nodes> <start_port> <ip_address> from utkhashmir import UTKhashmir from BitTorrent.RawServer_magic import RawServer from BitTorrent.defaultargs import common_options, rare_options from random import randrange from threading import Event import sys, os from krpc import KRPC KRPC.noisy = 1 class
: def __init__(self, size=0, startport=5555, localip='127.0.0.1'): self.num = size self.startport = startport self.localip = localip def _done(self, val): self.done = 1 def simpleSetUp(self): #self.kfiles() d = dict([(x[0],x[1]) for x in common_options + rare_options]) self.r = RawServer(Event(), d) self.l = [] for i in range(self.num): self.l.append(UTKhashmir('', self.startport + i, 'kh%s.db' % (self.startport + i), self.r)) for i in self.l: i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) self.r.listen_once(1) self.r.listen_once(1) self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done: self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done: self.r.listen_once(1) def tearDown(self): for i in self.l: i.rawserver.stop_listening_udp(i.socket) i.socket.close() #self.kfiles() def kfiles(self): for i in range(self.startport, self.startport+self.num): try: os.unlink('kh%s.db' % i) except: pass self.r.listen_once(1) if __name__ == "__main__": n = Network(int(sys.argv[1]), int(sys.argv[2])) n.simpleSetUp() print ">>> network ready" try: n.r.listen_forever() finally: n.tearDown()
Network
identifier_name
unet.py
# The contents of this file are subject to the BitTorrent Open Source License # Version 1.1 (the License). You may not copy or use this file, in either # source code or executable form, except in compliance with the License. You # may obtain a copy of the License at http://www.bittorrent.com/license/. # # Software distributed under the License is distributed on an AS IS basis, # WITHOUT WARRANTY OF ANY KIND, either express or implied. See the License # for the specific language governing rights and limitations under the # License. # # knet.py # create a network of khashmir nodes # usage: knet.py <num_nodes> <start_port> <ip_address> from utkhashmir import UTKhashmir from BitTorrent.RawServer_magic import RawServer from BitTorrent.defaultargs import common_options, rare_options from random import randrange from threading import Event import sys, os from krpc import KRPC KRPC.noisy = 1 class Network: def __init__(self, size=0, startport=5555, localip='127.0.0.1'): self.num = size self.startport = startport self.localip = localip def _done(self, val):
def simpleSetUp(self): #self.kfiles() d = dict([(x[0],x[1]) for x in common_options + rare_options]) self.r = RawServer(Event(), d) self.l = [] for i in range(self.num): self.l.append(UTKhashmir('', self.startport + i, 'kh%s.db' % (self.startport + i), self.r)) for i in self.l: i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) i.addContact(self.localip, self.l[randrange(0,self.num)].port) self.r.listen_once(1) self.r.listen_once(1) self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done: self.r.listen_once(1) for i in self.l: self.done = 0 i.findCloseNodes(self._done) while not self.done: self.r.listen_once(1) def tearDown(self): for i in self.l: i.rawserver.stop_listening_udp(i.socket) i.socket.close() #self.kfiles() def kfiles(self): for i in range(self.startport, self.startport+self.num): try: os.unlink('kh%s.db' % i) except: pass self.r.listen_once(1) if __name__ == "__main__": n = Network(int(sys.argv[1]), int(sys.argv[2])) n.simpleSetUp() print ">>> network ready" try: n.r.listen_forever() finally: n.tearDown()
self.done = 1
identifier_body
patchDiff.js
import * as R from 'ramda'; import { getPatchPath } from 'xod-project'; import { isAmong } from 'xod-func-tools'; import { def } from './types'; import { CHANGE_TYPES } from './constants';
const createPatchChange = def( 'createPatchChange :: AnyChangeType -> Patch -> AnyPatchChange', (changeType, patch) => R.compose( R.when( () => changeType === CHANGE_TYPES.ADDED || changeType === CHANGE_TYPES.MODIFIED, R.assoc('data', patch) ), R.applySpec({ path: getPatchPath, changeType: R.always(changeType), }) )(patch) ); export const calculateAdded = def( 'calculateAdded :: [Patch] -> [Patch] -> [AddedPatchChange]', R.compose( R.map(createPatchChange(CHANGE_TYPES.ADDED)), R.flip(R.differenceWith(isEqualPatchPaths)) ) ); export const calculateModified = def( 'calculateModified :: [Patch] -> [Patch] -> [ModifiedPatchChange]', (before, after) => { const beforeIds = R.map(getPatchPath, before); return R.compose( R.map(createPatchChange(CHANGE_TYPES.MODIFIED)), R.difference(R.__, before), R.filter(R.compose(isAmong(beforeIds), getPatchPath)) )(after); } ); export const calculateDeleted = def( 'calculateDeleted :: [Patch] -> [Patch] -> [DeletedPatchChange]', R.compose( R.map(createPatchChange(CHANGE_TYPES.DELETED)), R.differenceWith(isEqualPatchPaths) ) ); export const calculateDiff = def( 'calculateDiff :: [Patch] -> [Patch] -> [AnyPatchChange]', R.converge(R.unapply(R.unnest), [ calculateAdded, calculateModified, calculateDeleted, ]) );
const isEqualPatchPaths = def( 'isEqualPatchPaths :: Patch -> Patch -> Boolean', R.useWith(R.equals, [getPatchPath, getPatchPath]) );
random_line_split
require.js
// -- kriskowal Kris Kowal Copyright (C) 2009-2010 MIT License (function (require, exports) { /** * @module */ /*whatsupdoc*/ var Q = require("q"); var has = Object.prototype.hasOwnProperty; var update = function (_object, object) { for (var key in object) { if (has.call(object, key)) { _object[key] = object[key]; } } }; var copy = function (object) { var _object = {}; update(_object, object); return _object; } var enquote = typeof JSON !== "undefined" && JSON.stringify || function (text) { return text; }; /** * Creates a `require` function, and arranges for modules * to be executed and their exports memoized, in a lexical * scope that includes: * * * `require(id)` with support for identifiers relative to * the calling module. * * `require.loader` for direct access to the module * loader, which can be used in nested requirers. * * `require.force(id)` * * `require.once(id, scope)` to execute but not memoize * a module, with an optional object that owns additional * free variables to inject into the module's lexical * scope. * * `module` * * `id` * * `path` * * `exports` * * @param {{loader, modules, debug}} options * @constructor * @returns {require(id)} */ exports.Require = function (options) { options = options || {}; var loader = options.loader; var factories = options.factories || {}; var modules = options.modules || {}; var apis = options.exports || {}; var supportDefine = options.supportDefine; var sharedScope = options.scope || {}; for (var id in apis) if (has.call(apis, id)) modules[id] = {"exports": apis[id]}; var load = function (id) { if (!factories[id]) { if (!loader) { return Q.reject("require: Can't load " + enquote(id)); } else { factories[id] = loader.load(id); } } return factories[id]; }; var require = function (id, baseId, options) { var module, factory, exports, completed, require; options = options || {}; id = resolve(id, baseId); if (has.call(modules, id)) { module = modules[id]; } else if (has.call(factories, id)) { factory = factories[id]; module = Module(id, factory.path); modules[id] = module; exports = modules[id].exports; require = Require(id); scope = {}; update(scope, sharedScope); update(scope, options.scope || {}); update(scope, { "require": require, "exports": exports, "module": module }); if (supportDefine) scope.define = Define(require, exports, module); try { var returned = factory(scope); completed = true; } finally { if (!completed) { delete modules[id]; } } if (typeof returned !== "undefined") { module.exports = returned; } } else { throw new Error("require: Can't load " + enquote(id)); } return module.exports; }; // curries require for a module, so its baseId can be assumed var Require = function (baseId) { var _require = function (id) { return require(id, baseId); }; _require.async = function (id) { return require.async(id, baseId) }; _require.loader = loader; _require.main = modules[options.main]; return _require; }; var Define = function (require, exports, module) { return function () { var callback = arguments[arguments.length - 1]; var returned; if (typeof callback === "function") { returned = callback(require, exports, module); } else { returned = callback; } if (typeof returned !== "undefined") module.exports = returned; return returned; }; }; // creates a module object var Module = function (baseId, path) { var module = {}; module.exports = {}; module.id = baseId; module.path = path; return module; }; // asynchronously adds module factories to a factory list var advanceFactories = function (id, factories) { return Q.when(load(id), function (factory) { return (factory.requirements || []).reduce(function (factories, requirement) { requirement = resolve(requirement, id); return Q.when(factories, function (factories) { if (has.call(modules, requirement) || has.call(factories, requirement)) return factories; return advanceFactories(requirement, factories); }); }, factories); }); }; require.reload = function (id) { return Q.when(advanceFactories(id, {}), function (factories) { return exports.Require({ "loader": loader, "factories": factories }); }); }; require.ensure = function (ids, callback) { var _modules = copy(modules); var _factories = ids.reduce(function (factories, id) { return Q.when(factories, function (factories) { return advanceFactories(id, factories); }); }, copy(factories)); return Q.when(_factories, function (factories) { callback(exports.Require({ "loader": loader, "factories": factories, "modules": _modules })); }, function (reason) { throw new Error(reason.message || reason); }); }; require.async = function (id, baseId) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules }); return _require(id, baseId); }); }; require.exec = function (id, scope) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules, "main": id, "scope": sharedScope,
"supportDefine": supportDefine }); return _require(id, undefined, { "scope": scope }); }); }; require.loader = loader; return require; }; exports.resolve = resolve; function resolve(id, baseId) { id = String(id); var ids = id.split("/"); // assert ids.length >= 1 since "".split("") == [""] var first = ids[0]; if (first === ".." || first === ".") { var baseIds = baseId.split("/"); baseIds.pop(); ids.unshift.apply(ids, baseIds); } var parts = []; while (ids.length) { var part = ids.shift(); if (part === ".") { } else if (part === "..") { parts.pop(); } else { parts.push(part); } } return parts.join("/"); } }).apply({}, typeof exports !== "undefined" ? [ require, exports ] : [ (function (global) { return function (id) { return global["/" + id]; } })(this), this["/require"] = {} ] );
random_line_split
require.js
// -- kriskowal Kris Kowal Copyright (C) 2009-2010 MIT License (function (require, exports) { /** * @module */ /*whatsupdoc*/ var Q = require("q"); var has = Object.prototype.hasOwnProperty; var update = function (_object, object) { for (var key in object) { if (has.call(object, key)) { _object[key] = object[key]; } } }; var copy = function (object) { var _object = {}; update(_object, object); return _object; } var enquote = typeof JSON !== "undefined" && JSON.stringify || function (text) { return text; }; /** * Creates a `require` function, and arranges for modules * to be executed and their exports memoized, in a lexical * scope that includes: * * * `require(id)` with support for identifiers relative to * the calling module. * * `require.loader` for direct access to the module * loader, which can be used in nested requirers. * * `require.force(id)` * * `require.once(id, scope)` to execute but not memoize * a module, with an optional object that owns additional * free variables to inject into the module's lexical * scope. * * `module` * * `id` * * `path` * * `exports` * * @param {{loader, modules, debug}} options * @constructor * @returns {require(id)} */ exports.Require = function (options) { options = options || {}; var loader = options.loader; var factories = options.factories || {}; var modules = options.modules || {}; var apis = options.exports || {}; var supportDefine = options.supportDefine; var sharedScope = options.scope || {}; for (var id in apis) if (has.call(apis, id)) modules[id] = {"exports": apis[id]}; var load = function (id) { if (!factories[id]) { if (!loader) { return Q.reject("require: Can't load " + enquote(id)); } else { factories[id] = loader.load(id); } } return factories[id]; }; var require = function (id, baseId, options) { var module, factory, exports, completed, require; options = options || {}; id = resolve(id, baseId); if (has.call(modules, id)) { module = modules[id]; } else if (has.call(factories, id)) { factory = factories[id]; module = Module(id, factory.path); modules[id] = module; exports = modules[id].exports; require = Require(id); scope = {}; update(scope, sharedScope); update(scope, options.scope || {}); update(scope, { "require": require, "exports": exports, "module": module }); if (supportDefine) scope.define = Define(require, exports, module); try { var returned = factory(scope); completed = true; } finally { if (!completed) { delete modules[id]; } } if (typeof returned !== "undefined") { module.exports = returned; } } else { throw new Error("require: Can't load " + enquote(id)); } return module.exports; }; // curries require for a module, so its baseId can be assumed var Require = function (baseId) { var _require = function (id) { return require(id, baseId); }; _require.async = function (id) { return require.async(id, baseId) }; _require.loader = loader; _require.main = modules[options.main]; return _require; }; var Define = function (require, exports, module) { return function () { var callback = arguments[arguments.length - 1]; var returned; if (typeof callback === "function") { returned = callback(require, exports, module); } else { returned = callback; } if (typeof returned !== "undefined") module.exports = returned; return returned; }; }; // creates a module object var Module = function (baseId, path) { var module = {}; module.exports = {}; module.id = baseId; module.path = path; return module; }; // asynchronously adds module factories to a factory list var advanceFactories = function (id, factories) { return Q.when(load(id), function (factory) { return (factory.requirements || []).reduce(function (factories, requirement) { requirement = resolve(requirement, id); return Q.when(factories, function (factories) { if (has.call(modules, requirement) || has.call(factories, requirement)) return factories; return advanceFactories(requirement, factories); }); }, factories); }); }; require.reload = function (id) { return Q.when(advanceFactories(id, {}), function (factories) { return exports.Require({ "loader": loader, "factories": factories }); }); }; require.ensure = function (ids, callback) { var _modules = copy(modules); var _factories = ids.reduce(function (factories, id) { return Q.when(factories, function (factories) { return advanceFactories(id, factories); }); }, copy(factories)); return Q.when(_factories, function (factories) { callback(exports.Require({ "loader": loader, "factories": factories, "modules": _modules })); }, function (reason) { throw new Error(reason.message || reason); }); }; require.async = function (id, baseId) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules }); return _require(id, baseId); }); }; require.exec = function (id, scope) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules, "main": id, "scope": sharedScope, "supportDefine": supportDefine }); return _require(id, undefined, { "scope": scope }); }); }; require.loader = loader; return require; }; exports.resolve = resolve; function
(id, baseId) { id = String(id); var ids = id.split("/"); // assert ids.length >= 1 since "".split("") == [""] var first = ids[0]; if (first === ".." || first === ".") { var baseIds = baseId.split("/"); baseIds.pop(); ids.unshift.apply(ids, baseIds); } var parts = []; while (ids.length) { var part = ids.shift(); if (part === ".") { } else if (part === "..") { parts.pop(); } else { parts.push(part); } } return parts.join("/"); } }).apply({}, typeof exports !== "undefined" ? [ require, exports ] : [ (function (global) { return function (id) { return global["/" + id]; } })(this), this["/require"] = {} ] );
resolve
identifier_name
require.js
// -- kriskowal Kris Kowal Copyright (C) 2009-2010 MIT License (function (require, exports) { /** * @module */ /*whatsupdoc*/ var Q = require("q"); var has = Object.prototype.hasOwnProperty; var update = function (_object, object) { for (var key in object) { if (has.call(object, key)) { _object[key] = object[key]; } } }; var copy = function (object) { var _object = {}; update(_object, object); return _object; } var enquote = typeof JSON !== "undefined" && JSON.stringify || function (text) { return text; }; /** * Creates a `require` function, and arranges for modules * to be executed and their exports memoized, in a lexical * scope that includes: * * * `require(id)` with support for identifiers relative to * the calling module. * * `require.loader` for direct access to the module * loader, which can be used in nested requirers. * * `require.force(id)` * * `require.once(id, scope)` to execute but not memoize * a module, with an optional object that owns additional * free variables to inject into the module's lexical * scope. * * `module` * * `id` * * `path` * * `exports` * * @param {{loader, modules, debug}} options * @constructor * @returns {require(id)} */ exports.Require = function (options) { options = options || {}; var loader = options.loader; var factories = options.factories || {}; var modules = options.modules || {}; var apis = options.exports || {}; var supportDefine = options.supportDefine; var sharedScope = options.scope || {}; for (var id in apis) if (has.call(apis, id)) modules[id] = {"exports": apis[id]}; var load = function (id) { if (!factories[id]) { if (!loader) { return Q.reject("require: Can't load " + enquote(id)); } else { factories[id] = loader.load(id); } } return factories[id]; }; var require = function (id, baseId, options) { var module, factory, exports, completed, require; options = options || {}; id = resolve(id, baseId); if (has.call(modules, id)) { module = modules[id]; } else if (has.call(factories, id)) { factory = factories[id]; module = Module(id, factory.path); modules[id] = module; exports = modules[id].exports; require = Require(id); scope = {}; update(scope, sharedScope); update(scope, options.scope || {}); update(scope, { "require": require, "exports": exports, "module": module }); if (supportDefine) scope.define = Define(require, exports, module); try { var returned = factory(scope); completed = true; } finally { if (!completed) { delete modules[id]; } } if (typeof returned !== "undefined") { module.exports = returned; } } else { throw new Error("require: Can't load " + enquote(id)); } return module.exports; }; // curries require for a module, so its baseId can be assumed var Require = function (baseId) { var _require = function (id) { return require(id, baseId); }; _require.async = function (id) { return require.async(id, baseId) }; _require.loader = loader; _require.main = modules[options.main]; return _require; }; var Define = function (require, exports, module) { return function () { var callback = arguments[arguments.length - 1]; var returned; if (typeof callback === "function") { returned = callback(require, exports, module); } else { returned = callback; } if (typeof returned !== "undefined") module.exports = returned; return returned; }; }; // creates a module object var Module = function (baseId, path) { var module = {}; module.exports = {}; module.id = baseId; module.path = path; return module; }; // asynchronously adds module factories to a factory list var advanceFactories = function (id, factories) { return Q.when(load(id), function (factory) { return (factory.requirements || []).reduce(function (factories, requirement) { requirement = resolve(requirement, id); return Q.when(factories, function (factories) { if (has.call(modules, requirement) || has.call(factories, requirement)) return factories; return advanceFactories(requirement, factories); }); }, factories); }); }; require.reload = function (id) { return Q.when(advanceFactories(id, {}), function (factories) { return exports.Require({ "loader": loader, "factories": factories }); }); }; require.ensure = function (ids, callback) { var _modules = copy(modules); var _factories = ids.reduce(function (factories, id) { return Q.when(factories, function (factories) { return advanceFactories(id, factories); }); }, copy(factories)); return Q.when(_factories, function (factories) { callback(exports.Require({ "loader": loader, "factories": factories, "modules": _modules })); }, function (reason) { throw new Error(reason.message || reason); }); }; require.async = function (id, baseId) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules }); return _require(id, baseId); }); }; require.exec = function (id, scope) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules, "main": id, "scope": sharedScope, "supportDefine": supportDefine }); return _require(id, undefined, { "scope": scope }); }); }; require.loader = loader; return require; }; exports.resolve = resolve; function resolve(id, baseId)
}).apply({}, typeof exports !== "undefined" ? [ require, exports ] : [ (function (global) { return function (id) { return global["/" + id]; } })(this), this["/require"] = {} ] );
{ id = String(id); var ids = id.split("/"); // assert ids.length >= 1 since "".split("") == [""] var first = ids[0]; if (first === ".." || first === ".") { var baseIds = baseId.split("/"); baseIds.pop(); ids.unshift.apply(ids, baseIds); } var parts = []; while (ids.length) { var part = ids.shift(); if (part === ".") { } else if (part === "..") { parts.pop(); } else { parts.push(part); } } return parts.join("/"); }
identifier_body
require.js
// -- kriskowal Kris Kowal Copyright (C) 2009-2010 MIT License (function (require, exports) { /** * @module */ /*whatsupdoc*/ var Q = require("q"); var has = Object.prototype.hasOwnProperty; var update = function (_object, object) { for (var key in object) { if (has.call(object, key)) { _object[key] = object[key]; } } }; var copy = function (object) { var _object = {}; update(_object, object); return _object; } var enquote = typeof JSON !== "undefined" && JSON.stringify || function (text) { return text; }; /** * Creates a `require` function, and arranges for modules * to be executed and their exports memoized, in a lexical * scope that includes: * * * `require(id)` with support for identifiers relative to * the calling module. * * `require.loader` for direct access to the module * loader, which can be used in nested requirers. * * `require.force(id)` * * `require.once(id, scope)` to execute but not memoize * a module, with an optional object that owns additional * free variables to inject into the module's lexical * scope. * * `module` * * `id` * * `path` * * `exports` * * @param {{loader, modules, debug}} options * @constructor * @returns {require(id)} */ exports.Require = function (options) { options = options || {}; var loader = options.loader; var factories = options.factories || {}; var modules = options.modules || {}; var apis = options.exports || {}; var supportDefine = options.supportDefine; var sharedScope = options.scope || {}; for (var id in apis) if (has.call(apis, id)) modules[id] = {"exports": apis[id]}; var load = function (id) { if (!factories[id]) { if (!loader) { return Q.reject("require: Can't load " + enquote(id)); } else { factories[id] = loader.load(id); } } return factories[id]; }; var require = function (id, baseId, options) { var module, factory, exports, completed, require; options = options || {}; id = resolve(id, baseId); if (has.call(modules, id)) { module = modules[id]; } else if (has.call(factories, id)) { factory = factories[id]; module = Module(id, factory.path); modules[id] = module; exports = modules[id].exports; require = Require(id); scope = {}; update(scope, sharedScope); update(scope, options.scope || {}); update(scope, { "require": require, "exports": exports, "module": module }); if (supportDefine) scope.define = Define(require, exports, module); try { var returned = factory(scope); completed = true; } finally { if (!completed) { delete modules[id]; } } if (typeof returned !== "undefined") { module.exports = returned; } } else
return module.exports; }; // curries require for a module, so its baseId can be assumed var Require = function (baseId) { var _require = function (id) { return require(id, baseId); }; _require.async = function (id) { return require.async(id, baseId) }; _require.loader = loader; _require.main = modules[options.main]; return _require; }; var Define = function (require, exports, module) { return function () { var callback = arguments[arguments.length - 1]; var returned; if (typeof callback === "function") { returned = callback(require, exports, module); } else { returned = callback; } if (typeof returned !== "undefined") module.exports = returned; return returned; }; }; // creates a module object var Module = function (baseId, path) { var module = {}; module.exports = {}; module.id = baseId; module.path = path; return module; }; // asynchronously adds module factories to a factory list var advanceFactories = function (id, factories) { return Q.when(load(id), function (factory) { return (factory.requirements || []).reduce(function (factories, requirement) { requirement = resolve(requirement, id); return Q.when(factories, function (factories) { if (has.call(modules, requirement) || has.call(factories, requirement)) return factories; return advanceFactories(requirement, factories); }); }, factories); }); }; require.reload = function (id) { return Q.when(advanceFactories(id, {}), function (factories) { return exports.Require({ "loader": loader, "factories": factories }); }); }; require.ensure = function (ids, callback) { var _modules = copy(modules); var _factories = ids.reduce(function (factories, id) { return Q.when(factories, function (factories) { return advanceFactories(id, factories); }); }, copy(factories)); return Q.when(_factories, function (factories) { callback(exports.Require({ "loader": loader, "factories": factories, "modules": _modules })); }, function (reason) { throw new Error(reason.message || reason); }); }; require.async = function (id, baseId) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules }); return _require(id, baseId); }); }; require.exec = function (id, scope) { var _factories = copy(factories); var _modules = copy(modules); return Q.when(advanceFactories(id, _factories), function (factories) { var _require = exports.Require({ "loader": loader, "factories": factories, "modules": _modules, "main": id, "scope": sharedScope, "supportDefine": supportDefine }); return _require(id, undefined, { "scope": scope }); }); }; require.loader = loader; return require; }; exports.resolve = resolve; function resolve(id, baseId) { id = String(id); var ids = id.split("/"); // assert ids.length >= 1 since "".split("") == [""] var first = ids[0]; if (first === ".." || first === ".") { var baseIds = baseId.split("/"); baseIds.pop(); ids.unshift.apply(ids, baseIds); } var parts = []; while (ids.length) { var part = ids.shift(); if (part === ".") { } else if (part === "..") { parts.pop(); } else { parts.push(part); } } return parts.join("/"); } }).apply({}, typeof exports !== "undefined" ? [ require, exports ] : [ (function (global) { return function (id) { return global["/" + id]; } })(this), this["/require"] = {} ] );
{ throw new Error("require: Can't load " + enquote(id)); }
conditional_block
fasta.rs
// Copyright 2014-2016 Johannes Köster, Christopher Schröder. // Licensed under the MIT license (http://opensource.org/licenses/MIT) // This file may not be copied, modified, or distributed // except according to those terms. //! FASTA format reading and writing. //! //! # Example //! //! ``` //! use std::io; //! use bio::io::fasta; //! let reader = fasta::Reader::new(io::stdin()); //! ``` use std::io; use std::io::prelude::*; use std::ascii::AsciiExt; use std::collections; use std::fs; use std::path::Path; use std::convert::AsRef; use csv; use utils::{TextSlice, Text}; /// A FASTA reader. pub struct Reader<R: io::Read> { reader: io::BufReader<R>, line: String, } impl Reader<fs::File> { /// Read FASTA from given file path. pub fn from_file<P: AsRef<Path>>(path: P) -> io::Result<Self> { fs::File::open(path).map(Reader::new) } } impl<R: io::Read> Reader<R> { /// Create a new Fasta reader given an instance of `io::Read`. pub fn new(reader: R) -> Self { Reader { reader: io::BufReader::new(reader), line: String::new(), } } /// Read next FASTA record into the given `Record`. pub fn read(&mut self, record: &mut Record) -> io::Result<()> { record.clear(); if self.line.is_empty() { try!(self.reader.read_line(&mut self.line)); if self.line.is_empty() { return Ok(()); } } if !self.line.starts_with('>') { return Err(io::Error::new(io::ErrorKind::Other, "Expected > at record start.")); } record.header.push_str(&self.line); loop { self.line.clear(); try!(self.reader.read_line(&mut self.line)); if self.line.is_empty() || self.line.starts_with('>') { break; } record.seq.push_str(self.line.trim_right()); } Ok(()) } /// Return an iterator over the records of this FastQ file. pub fn records(self) -> Records<R> { Records { reader: self } } } /// A FASTA index as created by SAMtools (.fai). pub struct Index { inner: collections::HashMap<String, IndexRecord>, seqs: Vec<String>, } impl Index { /// Open a FASTA index from a given `io::Read` instance. pub fn new<R: io::Read>(fai: R) -> csv::Result<Self> { let mut inner = collections::HashMap::new(); let mut seqs = vec![]; let mut fai_reader = csv::Reader::from_reader(fai).delimiter(b'\t').has_headers(false); for row in fai_reader.decode() { let (name, record): (String, IndexRecord) = try!(row); seqs.push(name.clone()); inner.insert(name, record); } Ok(Index { inner: inner, seqs: seqs, }) } /// Open a FASTA index from a given file path. pub fn from_file<P: AsRef<Path>>(path: &P) -> csv::Result<Self> { match fs::File::open(path) { Ok(fai) => Self::new(fai), Err(e) => Err(csv::Error::Io(e)), } } /// Open a FASTA index given the corresponding FASTA file path (e.g. for ref.fasta we expect ref.fasta.fai). pub fn with_fasta_file<P: AsRef<Path>>(fasta_path: &P) -> csv::Result<Self> { let mut ext = fasta_path.as_ref().extension().unwrap().to_str().unwrap().to_owned(); ext.push_str(".fai"); let fai_path = fasta_path.as_ref().with_extension(ext); Self::from_file(&fai_path) } /// Return a vector of sequences described in the index. pub fn sequences(&self) -> Vec<Sequence> { self.seqs .iter() .map(|name| { Sequence { name: name.clone(), len: self.inner.get(name).unwrap().len, } }) .collect() } } /// A FASTA reader with an index as created by SAMtools (.fai). pub struct IndexedReader<R: io::Read + io::Seek> { reader: io::BufReader<R>, pub index: Index, } impl IndexedReader<fs::File> { /// Read from a given file path. This assumes the index ref.fasta.fai to be present for FASTA ref.fasta. pub fn from_file<P: AsRef<Path>>(path: &P) -> csv::Result<Self> { let index = try!(Index::with_fasta_file(path)); match fs::File::open(path) { Ok(fasta) => Ok(IndexedReader::with_index(fasta, index)), Err(e) => Err(csv::Error::Io(e)), } } } impl<R: io::Read + io::Seek> IndexedReader<R> { /// Read from a FASTA and its index, both given as `io::Read`. FASTA has to be `io::Seek` in addition. pub fn new<I: io::Read>(fasta: R, fai: I) -> csv::Result<Self> { let index = try!(Index::new(fai)); Ok(IndexedReader { reader: io::BufReader::new(fasta), index: index, }) } /// Read from a FASTA and its index, the first given as `io::Read`, the second given as index object. pub fn with_index(fasta: R, index: Index) -> Self { IndexedReader { reader: io::BufReader::new(fasta), index: index, } } /// For a given seqname, read the whole sequence into the given vector. pub fn read_all(&mut self, seqname: &str, seq: &mut Text) -> io::Result<()> { match self.index.inner.get(seqname) { Some(&idx) => self.read(seqname, 0, idx.len, seq), None => Err(io::Error::new(io::ErrorKind::Other, "Unknown sequence name.")), } } /// Read the given interval of the given seqname into the given vector (stop position is exclusive). pub fn read(&mut self, seqname: &str, start: u64, stop: u64, seq: &mut Text) -> io::Result<()> { if let Some(idx) = self.index.inner.get(seqname) { seq.clear(); if stop > idx.len { return Err(io::Error::new(io::ErrorKind::Other, "FASTA read interval was out of bounds")); } if start > stop { return Err(io::Error::new(io::ErrorKind::Other, "Invalid query interval")); } let mut line_offset = start % idx.line_bases; let line_start = start / idx.line_bases * idx.line_bytes; let offset = idx.offset + line_start + line_offset; try!(self.reader.seek(io::SeekFrom::Start(offset))); let length = stop - start as u64; let mut buf = vec![0u8; idx.line_bytes as usize]; while (seq.len() as u64) < length { let bases_left = length - seq.len() as u64; let bases_on_line = idx.line_bases - line_offset; let (bytes_to_read, bytes_to_keep) = if bases_on_line < bases_left { (idx.line_bytes - line_offset, bases_on_line) } else { (bases_left, bases_left) }; try!(self.reader.read_exact(&mut buf[..bytes_to_read as usize])); seq.extend_from_slice(&buf[..bytes_to_keep as usize]); line_offset = 0; } Ok(()) } else { Err(io::Error::new(io::ErrorKind::Other, "Unknown sequence name.")) } } } /// Record of a FASTA index. #[derive(RustcDecodable, Debug, Copy, Clone)] struct IndexRecord { len: u64, offset: u64, line_bases: u64, line_bytes: u64, } /// A sequence record returned by the FASTA index. pub struct Sequence { pub name: String, pub len: u64, } /// A Fasta writer. pub struct Writer<W: io::Write> { writer: io::BufWriter<W>, } impl Writer<fs::File> { /// Write to the given file path. pub fn to_file<P: AsRef<Path>>(path: P) -> io::Result<Self> { fs::File::create(path).map(Writer::new) } } impl<W: io::Write> Writer<W> { /// Create a new Fasta writer. pub fn new(writer: W) -> Self { Writer { writer: io::BufWriter::new(writer) } } /// Directly write a Fasta record. pub fn write_record(&mut self, record: &Record) -> io::Result<()> { self.write(record.id().unwrap_or(""), record.desc(), record.seq()) } /// Write a Fasta record with given id, optional description and sequence. pub fn write(&mut self, id: &str, desc: Option<&str>, seq: TextSlice) -> io::Result<()> { try!(self.writer.write(b">")); try!(self.writer.write(id.as_bytes())); if desc.is_some() { try!(self.writer.write(b" ")); try!(self.writer.write(desc.unwrap().as_bytes())); } try!(self.writer.write(b"\n")); try!(self.writer.write(seq)); try!(self.writer.write(b"\n")); Ok(()) } /// Flush the writer, ensuring that everything is written. pub fn flush(&mut self) -> io::Result<()> { self.writer.flush() } } /// A FASTA record. #[derive(Default)] pub struct Record { header: String, seq: String, } impl Record { /// Create a new instance. pub fn new() -> Self { Record { header: String::new(), seq: String::new(), } } /// Check if record is empty. pub fn is_empty(&self) -> bool { self.header.is_empty() && self.seq.is_empty() } /// Check validity of Fasta record. pub fn check(&self) -> Result<(), &str> { if self.id().is_none() { return Err("Expecting id for FastQ record."); } if !self.seq.is_ascii() { return Err("Non-ascii character found in sequence."); } Ok(()) } /// Return the id of the record. pub fn id(&self) -> Option<&str> { self.header[1..].trim_right().splitn(2, ' ').next() } /// Return descriptions if present. pub fn desc(&self) -> Option<&str> { self.header[1..].trim_right().splitn(2, ' ').skip(1).next() } /// Return the sequence of the record. pub fn seq(&self) -> TextSlice { self.seq.as_bytes() } /// Clear the record. fn clear(&mut self) { self.header.clear(); self.seq.clear(); } } /// An iterator over the records of a Fasta file. pub struct Records<R: io::Read> { reader: Reader<R>, } impl<R: io::Read> Iterator for Records<R> { type Item = io::Result<Record>; fn next(&mut self) -> Option<io::Result<Record>> { let mut record = Record::new(); match self.reader.read(&mut record) { Ok(()) if record.is_empty() => None, Ok(()) => Some(Ok(record)), Err(err) => Some(Err(err)), } } } #[cfg(test)] mod tests { use super::*; use std::io; const FASTA_FILE: &'static [u8] = b">id desc ACCGTAGGCTGA CCGTAGGCTGAA CGTAGGCTGAAA GTAGGCTGAAAA CCCC >id2 ATTGTTGTTTTA ATTGTTGTTTTA ATTGTTGTTTTA GGGG "; const FAI_FILE: &'static [u8] = b"id\t52\t9\t12\t13 id2\t40\t71\t12\t13 "; const FASTA_FILE_CRLF: &'static [u8] = b">id desc\r ACCGTAGGCTGA\r CCGTAGGCTGAA\r CGTAGGCTGAAA\r GTAGGCTGAAAA\r CCCC\r >id2\r ATTGTTGTTTTA\r ATTGTTGTTTTA\r ATTGTTGTTTTA\r GGGG\r "; const FAI_FILE_CRLF: &'static [u8] = b"id\t52\t10\t12\t14\r id2\t40\t78\t12\t14\r ";
CCCC"; const FAI_FILE_NO_TRAILING_LF: &'static [u8] = b"id\t16\t9\t12\t13"; const WRITE_FASTA_FILE: &'static [u8] = b">id desc ACCGTAGGCTGA >id2 ATTGTTGTTTTA "; #[test] fn test_reader() { let reader = Reader::new(FASTA_FILE); let ids = [Some("id"), Some("id2")]; let descs = [Some("desc"), None]; let seqs: [&[u8]; 2] = [b"ACCGTAGGCTGACCGTAGGCTGAACGTAGGCTGAAAGTAGGCTGAAAACCCC", b"ATTGTTGTTTTAATTGTTGTTTTAATTGTTGTTTTAGGGG"]; for (i, r) in reader.records().enumerate() { let record = r.ok().expect("Error reading record"); assert_eq!(record.check(), Ok(())); assert_eq!(record.id(), ids[i]); assert_eq!(record.desc(), descs[i]); assert_eq!(record.seq(), seqs[i]); } // let record = records.ok().nth(1).unwrap(); } #[test] fn test_indexed_reader() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE), FAI_FILE) .ok() .expect("Error reading index"); _test_indexed_reader(&mut reader) } #[test] fn test_indexed_reader_crlf() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE_CRLF), FAI_FILE_CRLF) .ok() .expect("Error reading index"); _test_indexed_reader(&mut reader) } fn _test_indexed_reader<T: Seek + Read>(reader: &mut IndexedReader<T>) { let mut seq = Vec::new(); // Test reading various substrings of the sequence reader.read("id", 1, 5, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CCGT"); reader.read("id", 1, 31, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CCGTAGGCTGACCGTAGGCTGAACGTAGGC"); reader.read("id", 13, 23, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CGTAGGCTGA"); reader.read("id", 36, 52, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"GTAGGCTGAAAACCCC"); reader.read("id2", 12, 40, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"ATTGTTGTTTTAATTGTTGTTTTAGGGG"); reader.read("id2", 12, 12, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b""); reader.read("id2", 12, 13, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"A"); assert!(reader.read("id2", 12, 11, &mut seq).is_err()); assert!(reader.read("id2", 12, 1000, &mut seq).is_err()); } #[test] fn test_indexed_reader_no_trailing_lf() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE_NO_TRAILING_LF), FAI_FILE_NO_TRAILING_LF) .ok() .expect("Error reading index"); let mut seq = Vec::new(); reader.read("id", 0, 16, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"GTAGGCTGAAAACCCC"); } #[test] fn test_writer() { let mut writer = Writer::new(Vec::new()); writer.write("id", Some("desc"), b"ACCGTAGGCTGA").ok().expect("Expected successful write"); writer.write("id2", None, b"ATTGTTGTTTTA").ok().expect("Expected successful write"); writer.flush().ok().expect("Expected successful write"); assert_eq!(writer.writer.get_ref(), &WRITE_FASTA_FILE); } }
const FASTA_FILE_NO_TRAILING_LF : &'static [u8] = b">id desc GTAGGCTGAAAA
random_line_split
fasta.rs
// Copyright 2014-2016 Johannes Köster, Christopher Schröder. // Licensed under the MIT license (http://opensource.org/licenses/MIT) // This file may not be copied, modified, or distributed // except according to those terms. //! FASTA format reading and writing. //! //! # Example //! //! ``` //! use std::io; //! use bio::io::fasta; //! let reader = fasta::Reader::new(io::stdin()); //! ``` use std::io; use std::io::prelude::*; use std::ascii::AsciiExt; use std::collections; use std::fs; use std::path::Path; use std::convert::AsRef; use csv; use utils::{TextSlice, Text}; /// A FASTA reader. pub struct Reader<R: io::Read> { reader: io::BufReader<R>, line: String, } impl Reader<fs::File> { /// Read FASTA from given file path. pub fn from_file<P: AsRef<Path>>(path: P) -> io::Result<Self> { fs::File::open(path).map(Reader::new) } } impl<R: io::Read> Reader<R> { /// Create a new Fasta reader given an instance of `io::Read`. pub fn new(reader: R) -> Self { Reader { reader: io::BufReader::new(reader), line: String::new(), } } /// Read next FASTA record into the given `Record`. pub fn read(&mut self, record: &mut Record) -> io::Result<()> { record.clear(); if self.line.is_empty() { try!(self.reader.read_line(&mut self.line)); if self.line.is_empty() { return Ok(()); } } if !self.line.starts_with('>') { return Err(io::Error::new(io::ErrorKind::Other, "Expected > at record start.")); } record.header.push_str(&self.line); loop { self.line.clear(); try!(self.reader.read_line(&mut self.line)); if self.line.is_empty() || self.line.starts_with('>') { break; } record.seq.push_str(self.line.trim_right()); } Ok(()) } /// Return an iterator over the records of this FastQ file. pub fn records(self) -> Records<R> { Records { reader: self } } } /// A FASTA index as created by SAMtools (.fai). pub struct Index { inner: collections::HashMap<String, IndexRecord>, seqs: Vec<String>, } impl Index { /// Open a FASTA index from a given `io::Read` instance. pub fn new<R: io::Read>(fai: R) -> csv::Result<Self> { let mut inner = collections::HashMap::new(); let mut seqs = vec![]; let mut fai_reader = csv::Reader::from_reader(fai).delimiter(b'\t').has_headers(false); for row in fai_reader.decode() { let (name, record): (String, IndexRecord) = try!(row); seqs.push(name.clone()); inner.insert(name, record); } Ok(Index { inner: inner, seqs: seqs, }) } /// Open a FASTA index from a given file path. pub fn from_file<P: AsRef<Path>>(path: &P) -> csv::Result<Self> { match fs::File::open(path) { Ok(fai) => Self::new(fai), Err(e) => Err(csv::Error::Io(e)), } } /// Open a FASTA index given the corresponding FASTA file path (e.g. for ref.fasta we expect ref.fasta.fai). pub fn with_fasta_file<P: AsRef<Path>>(fasta_path: &P) -> csv::Result<Self> { let mut ext = fasta_path.as_ref().extension().unwrap().to_str().unwrap().to_owned(); ext.push_str(".fai"); let fai_path = fasta_path.as_ref().with_extension(ext); Self::from_file(&fai_path) } /// Return a vector of sequences described in the index. pub fn sequences(&self) -> Vec<Sequence> { self.seqs .iter() .map(|name| { Sequence { name: name.clone(), len: self.inner.get(name).unwrap().len, } }) .collect() } } /// A FASTA reader with an index as created by SAMtools (.fai). pub struct IndexedReader<R: io::Read + io::Seek> { reader: io::BufReader<R>, pub index: Index, } impl IndexedReader<fs::File> { /// Read from a given file path. This assumes the index ref.fasta.fai to be present for FASTA ref.fasta. pub fn from_file<P: AsRef<Path>>(path: &P) -> csv::Result<Self> { let index = try!(Index::with_fasta_file(path)); match fs::File::open(path) { Ok(fasta) => Ok(IndexedReader::with_index(fasta, index)), Err(e) => Err(csv::Error::Io(e)), } } } impl<R: io::Read + io::Seek> IndexedReader<R> { /// Read from a FASTA and its index, both given as `io::Read`. FASTA has to be `io::Seek` in addition. pub fn new<I: io::Read>(fasta: R, fai: I) -> csv::Result<Self> { let index = try!(Index::new(fai)); Ok(IndexedReader { reader: io::BufReader::new(fasta), index: index, }) } /// Read from a FASTA and its index, the first given as `io::Read`, the second given as index object. pub fn wi
asta: R, index: Index) -> Self { IndexedReader { reader: io::BufReader::new(fasta), index: index, } } /// For a given seqname, read the whole sequence into the given vector. pub fn read_all(&mut self, seqname: &str, seq: &mut Text) -> io::Result<()> { match self.index.inner.get(seqname) { Some(&idx) => self.read(seqname, 0, idx.len, seq), None => Err(io::Error::new(io::ErrorKind::Other, "Unknown sequence name.")), } } /// Read the given interval of the given seqname into the given vector (stop position is exclusive). pub fn read(&mut self, seqname: &str, start: u64, stop: u64, seq: &mut Text) -> io::Result<()> { if let Some(idx) = self.index.inner.get(seqname) { seq.clear(); if stop > idx.len { return Err(io::Error::new(io::ErrorKind::Other, "FASTA read interval was out of bounds")); } if start > stop { return Err(io::Error::new(io::ErrorKind::Other, "Invalid query interval")); } let mut line_offset = start % idx.line_bases; let line_start = start / idx.line_bases * idx.line_bytes; let offset = idx.offset + line_start + line_offset; try!(self.reader.seek(io::SeekFrom::Start(offset))); let length = stop - start as u64; let mut buf = vec![0u8; idx.line_bytes as usize]; while (seq.len() as u64) < length { let bases_left = length - seq.len() as u64; let bases_on_line = idx.line_bases - line_offset; let (bytes_to_read, bytes_to_keep) = if bases_on_line < bases_left { (idx.line_bytes - line_offset, bases_on_line) } else { (bases_left, bases_left) }; try!(self.reader.read_exact(&mut buf[..bytes_to_read as usize])); seq.extend_from_slice(&buf[..bytes_to_keep as usize]); line_offset = 0; } Ok(()) } else { Err(io::Error::new(io::ErrorKind::Other, "Unknown sequence name.")) } } } /// Record of a FASTA index. #[derive(RustcDecodable, Debug, Copy, Clone)] struct IndexRecord { len: u64, offset: u64, line_bases: u64, line_bytes: u64, } /// A sequence record returned by the FASTA index. pub struct Sequence { pub name: String, pub len: u64, } /// A Fasta writer. pub struct Writer<W: io::Write> { writer: io::BufWriter<W>, } impl Writer<fs::File> { /// Write to the given file path. pub fn to_file<P: AsRef<Path>>(path: P) -> io::Result<Self> { fs::File::create(path).map(Writer::new) } } impl<W: io::Write> Writer<W> { /// Create a new Fasta writer. pub fn new(writer: W) -> Self { Writer { writer: io::BufWriter::new(writer) } } /// Directly write a Fasta record. pub fn write_record(&mut self, record: &Record) -> io::Result<()> { self.write(record.id().unwrap_or(""), record.desc(), record.seq()) } /// Write a Fasta record with given id, optional description and sequence. pub fn write(&mut self, id: &str, desc: Option<&str>, seq: TextSlice) -> io::Result<()> { try!(self.writer.write(b">")); try!(self.writer.write(id.as_bytes())); if desc.is_some() { try!(self.writer.write(b" ")); try!(self.writer.write(desc.unwrap().as_bytes())); } try!(self.writer.write(b"\n")); try!(self.writer.write(seq)); try!(self.writer.write(b"\n")); Ok(()) } /// Flush the writer, ensuring that everything is written. pub fn flush(&mut self) -> io::Result<()> { self.writer.flush() } } /// A FASTA record. #[derive(Default)] pub struct Record { header: String, seq: String, } impl Record { /// Create a new instance. pub fn new() -> Self { Record { header: String::new(), seq: String::new(), } } /// Check if record is empty. pub fn is_empty(&self) -> bool { self.header.is_empty() && self.seq.is_empty() } /// Check validity of Fasta record. pub fn check(&self) -> Result<(), &str> { if self.id().is_none() { return Err("Expecting id for FastQ record."); } if !self.seq.is_ascii() { return Err("Non-ascii character found in sequence."); } Ok(()) } /// Return the id of the record. pub fn id(&self) -> Option<&str> { self.header[1..].trim_right().splitn(2, ' ').next() } /// Return descriptions if present. pub fn desc(&self) -> Option<&str> { self.header[1..].trim_right().splitn(2, ' ').skip(1).next() } /// Return the sequence of the record. pub fn seq(&self) -> TextSlice { self.seq.as_bytes() } /// Clear the record. fn clear(&mut self) { self.header.clear(); self.seq.clear(); } } /// An iterator over the records of a Fasta file. pub struct Records<R: io::Read> { reader: Reader<R>, } impl<R: io::Read> Iterator for Records<R> { type Item = io::Result<Record>; fn next(&mut self) -> Option<io::Result<Record>> { let mut record = Record::new(); match self.reader.read(&mut record) { Ok(()) if record.is_empty() => None, Ok(()) => Some(Ok(record)), Err(err) => Some(Err(err)), } } } #[cfg(test)] mod tests { use super::*; use std::io; const FASTA_FILE: &'static [u8] = b">id desc ACCGTAGGCTGA CCGTAGGCTGAA CGTAGGCTGAAA GTAGGCTGAAAA CCCC >id2 ATTGTTGTTTTA ATTGTTGTTTTA ATTGTTGTTTTA GGGG "; const FAI_FILE: &'static [u8] = b"id\t52\t9\t12\t13 id2\t40\t71\t12\t13 "; const FASTA_FILE_CRLF: &'static [u8] = b">id desc\r ACCGTAGGCTGA\r CCGTAGGCTGAA\r CGTAGGCTGAAA\r GTAGGCTGAAAA\r CCCC\r >id2\r ATTGTTGTTTTA\r ATTGTTGTTTTA\r ATTGTTGTTTTA\r GGGG\r "; const FAI_FILE_CRLF: &'static [u8] = b"id\t52\t10\t12\t14\r id2\t40\t78\t12\t14\r "; const FASTA_FILE_NO_TRAILING_LF : &'static [u8] = b">id desc GTAGGCTGAAAA CCCC"; const FAI_FILE_NO_TRAILING_LF: &'static [u8] = b"id\t16\t9\t12\t13"; const WRITE_FASTA_FILE: &'static [u8] = b">id desc ACCGTAGGCTGA >id2 ATTGTTGTTTTA "; #[test] fn test_reader() { let reader = Reader::new(FASTA_FILE); let ids = [Some("id"), Some("id2")]; let descs = [Some("desc"), None]; let seqs: [&[u8]; 2] = [b"ACCGTAGGCTGACCGTAGGCTGAACGTAGGCTGAAAGTAGGCTGAAAACCCC", b"ATTGTTGTTTTAATTGTTGTTTTAATTGTTGTTTTAGGGG"]; for (i, r) in reader.records().enumerate() { let record = r.ok().expect("Error reading record"); assert_eq!(record.check(), Ok(())); assert_eq!(record.id(), ids[i]); assert_eq!(record.desc(), descs[i]); assert_eq!(record.seq(), seqs[i]); } // let record = records.ok().nth(1).unwrap(); } #[test] fn test_indexed_reader() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE), FAI_FILE) .ok() .expect("Error reading index"); _test_indexed_reader(&mut reader) } #[test] fn test_indexed_reader_crlf() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE_CRLF), FAI_FILE_CRLF) .ok() .expect("Error reading index"); _test_indexed_reader(&mut reader) } fn _test_indexed_reader<T: Seek + Read>(reader: &mut IndexedReader<T>) { let mut seq = Vec::new(); // Test reading various substrings of the sequence reader.read("id", 1, 5, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CCGT"); reader.read("id", 1, 31, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CCGTAGGCTGACCGTAGGCTGAACGTAGGC"); reader.read("id", 13, 23, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CGTAGGCTGA"); reader.read("id", 36, 52, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"GTAGGCTGAAAACCCC"); reader.read("id2", 12, 40, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"ATTGTTGTTTTAATTGTTGTTTTAGGGG"); reader.read("id2", 12, 12, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b""); reader.read("id2", 12, 13, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"A"); assert!(reader.read("id2", 12, 11, &mut seq).is_err()); assert!(reader.read("id2", 12, 1000, &mut seq).is_err()); } #[test] fn test_indexed_reader_no_trailing_lf() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE_NO_TRAILING_LF), FAI_FILE_NO_TRAILING_LF) .ok() .expect("Error reading index"); let mut seq = Vec::new(); reader.read("id", 0, 16, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"GTAGGCTGAAAACCCC"); } #[test] fn test_writer() { let mut writer = Writer::new(Vec::new()); writer.write("id", Some("desc"), b"ACCGTAGGCTGA").ok().expect("Expected successful write"); writer.write("id2", None, b"ATTGTTGTTTTA").ok().expect("Expected successful write"); writer.flush().ok().expect("Expected successful write"); assert_eq!(writer.writer.get_ref(), &WRITE_FASTA_FILE); } }
th_index(f
identifier_name