file_name
large_stringlengths
4
140
prefix
large_stringlengths
0
39k
suffix
large_stringlengths
0
36.1k
middle
large_stringlengths
0
29.4k
fim_type
large_stringclasses
4 values
fasta.rs
// Copyright 2014-2016 Johannes Köster, Christopher Schröder. // Licensed under the MIT license (http://opensource.org/licenses/MIT) // This file may not be copied, modified, or distributed // except according to those terms. //! FASTA format reading and writing. //! //! # Example //! //! ``` //! use std::io; //! use bio::io::fasta; //! let reader = fasta::Reader::new(io::stdin()); //! ``` use std::io; use std::io::prelude::*; use std::ascii::AsciiExt; use std::collections; use std::fs; use std::path::Path; use std::convert::AsRef; use csv; use utils::{TextSlice, Text}; /// A FASTA reader. pub struct Reader<R: io::Read> { reader: io::BufReader<R>, line: String, } impl Reader<fs::File> { /// Read FASTA from given file path. pub fn from_file<P: AsRef<Path>>(path: P) -> io::Result<Self> { fs::File::open(path).map(Reader::new) } } impl<R: io::Read> Reader<R> { /// Create a new Fasta reader given an instance of `io::Read`. pub fn new(reader: R) -> Self { Reader { reader: io::BufReader::new(reader), line: String::new(), } } /// Read next FASTA record into the given `Record`. pub fn read(&mut self, record: &mut Record) -> io::Result<()> { record.clear(); if self.line.is_empty() { try!(self.reader.read_line(&mut self.line)); if self.line.is_empty() { return Ok(()); } } if !self.line.starts_with('>') { return Err(io::Error::new(io::ErrorKind::Other, "Expected > at record start.")); } record.header.push_str(&self.line); loop { self.line.clear(); try!(self.reader.read_line(&mut self.line)); if self.line.is_empty() || self.line.starts_with('>') { break; } record.seq.push_str(self.line.trim_right()); } Ok(()) } /// Return an iterator over the records of this FastQ file. pub fn records(self) -> Records<R> { Records { reader: self } } } /// A FASTA index as created by SAMtools (.fai). pub struct Index { inner: collections::HashMap<String, IndexRecord>, seqs: Vec<String>, } impl Index { /// Open a FASTA index from a given `io::Read` instance. pub fn new<R: io::Read>(fai: R) -> csv::Result<Self> { let mut inner = collections::HashMap::new(); let mut seqs = vec![]; let mut fai_reader = csv::Reader::from_reader(fai).delimiter(b'\t').has_headers(false); for row in fai_reader.decode() { let (name, record): (String, IndexRecord) = try!(row); seqs.push(name.clone()); inner.insert(name, record); } Ok(Index { inner: inner, seqs: seqs, }) } /// Open a FASTA index from a given file path. pub fn from_file<P: AsRef<Path>>(path: &P) -> csv::Result<Self> { match fs::File::open(path) { Ok(fai) => Self::new(fai), Err(e) => Err(csv::Error::Io(e)), } } /// Open a FASTA index given the corresponding FASTA file path (e.g. for ref.fasta we expect ref.fasta.fai). pub fn with_fasta_file<P: AsRef<Path>>(fasta_path: &P) -> csv::Result<Self> { let mut ext = fasta_path.as_ref().extension().unwrap().to_str().unwrap().to_owned(); ext.push_str(".fai"); let fai_path = fasta_path.as_ref().with_extension(ext); Self::from_file(&fai_path) } /// Return a vector of sequences described in the index. pub fn sequences(&self) -> Vec<Sequence> { self.seqs .iter() .map(|name| { Sequence { name: name.clone(), len: self.inner.get(name).unwrap().len, } }) .collect() } } /// A FASTA reader with an index as created by SAMtools (.fai). pub struct IndexedReader<R: io::Read + io::Seek> { reader: io::BufReader<R>, pub index: Index, } impl IndexedReader<fs::File> { /// Read from a given file path. This assumes the index ref.fasta.fai to be present for FASTA ref.fasta. pub fn from_file<P: AsRef<Path>>(path: &P) -> csv::Result<Self> { let index = try!(Index::with_fasta_file(path)); match fs::File::open(path) { Ok(fasta) => Ok(IndexedReader::with_index(fasta, index)), Err(e) => Err(csv::Error::Io(e)), } } } impl<R: io::Read + io::Seek> IndexedReader<R> { /// Read from a FASTA and its index, both given as `io::Read`. FASTA has to be `io::Seek` in addition. pub fn new<I: io::Read>(fasta: R, fai: I) -> csv::Result<Self> { let index = try!(Index::new(fai)); Ok(IndexedReader { reader: io::BufReader::new(fasta), index: index, }) } /// Read from a FASTA and its index, the first given as `io::Read`, the second given as index object. pub fn with_index(fasta: R, index: Index) -> Self { IndexedReader { reader: io::BufReader::new(fasta), index: index, } } /// For a given seqname, read the whole sequence into the given vector. pub fn read_all(&mut self, seqname: &str, seq: &mut Text) -> io::Result<()> { match self.index.inner.get(seqname) { Some(&idx) => self.read(seqname, 0, idx.len, seq), None => Err(io::Error::new(io::ErrorKind::Other, "Unknown sequence name.")), } } /// Read the given interval of the given seqname into the given vector (stop position is exclusive). pub fn read(&mut self, seqname: &str, start: u64, stop: u64, seq: &mut Text) -> io::Result<()> { if let Some(idx) = self.index.inner.get(seqname) { seq.clear(); if stop > idx.len { return Err(io::Error::new(io::ErrorKind::Other, "FASTA read interval was out of bounds")); } if start > stop { return Err(io::Error::new(io::ErrorKind::Other, "Invalid query interval")); } let mut line_offset = start % idx.line_bases; let line_start = start / idx.line_bases * idx.line_bytes; let offset = idx.offset + line_start + line_offset; try!(self.reader.seek(io::SeekFrom::Start(offset))); let length = stop - start as u64; let mut buf = vec![0u8; idx.line_bytes as usize]; while (seq.len() as u64) < length { let bases_left = length - seq.len() as u64; let bases_on_line = idx.line_bases - line_offset; let (bytes_to_read, bytes_to_keep) = if bases_on_line < bases_left { (idx.line_bytes - line_offset, bases_on_line) } else { (bases_left, bases_left) }; try!(self.reader.read_exact(&mut buf[..bytes_to_read as usize])); seq.extend_from_slice(&buf[..bytes_to_keep as usize]); line_offset = 0; } Ok(()) } else { Err(io::Error::new(io::ErrorKind::Other, "Unknown sequence name.")) } } } /// Record of a FASTA index. #[derive(RustcDecodable, Debug, Copy, Clone)] struct IndexRecord { len: u64, offset: u64, line_bases: u64, line_bytes: u64, } /// A sequence record returned by the FASTA index. pub struct Sequence { pub name: String, pub len: u64, } /// A Fasta writer. pub struct Writer<W: io::Write> { writer: io::BufWriter<W>, } impl Writer<fs::File> { /// Write to the given file path. pub fn to_file<P: AsRef<Path>>(path: P) -> io::Result<Self> { fs::File::create(path).map(Writer::new) } } impl<W: io::Write> Writer<W> { /// Create a new Fasta writer. pub fn new(writer: W) -> Self { Writer { writer: io::BufWriter::new(writer) } } /// Directly write a Fasta record. pub fn write_record(&mut self, record: &Record) -> io::Result<()> { self.write(record.id().unwrap_or(""), record.desc(), record.seq()) } /// Write a Fasta record with given id, optional description and sequence. pub fn write(&mut self, id: &str, desc: Option<&str>, seq: TextSlice) -> io::Result<()> { try!(self.writer.write(b">")); try!(self.writer.write(id.as_bytes())); if desc.is_some() { try!(self.writer.write(b" ")); try!(self.writer.write(desc.unwrap().as_bytes())); } try!(self.writer.write(b"\n")); try!(self.writer.write(seq)); try!(self.writer.write(b"\n")); Ok(()) } /// Flush the writer, ensuring that everything is written. pub fn flush(&mut self) -> io::Result<()> { self.writer.flush() } } /// A FASTA record. #[derive(Default)] pub struct Record { header: String, seq: String, } impl Record { /// Create a new instance. pub fn new() -> Self { Record { header: String::new(), seq: String::new(), } } /// Check if record is empty. pub fn is_empty(&self) -> bool { self.header.is_empty() && self.seq.is_empty() } /// Check validity of Fasta record. pub fn check(&self) -> Result<(), &str> {
/// Return the id of the record. pub fn id(&self) -> Option<&str> { self.header[1..].trim_right().splitn(2, ' ').next() } /// Return descriptions if present. pub fn desc(&self) -> Option<&str> { self.header[1..].trim_right().splitn(2, ' ').skip(1).next() } /// Return the sequence of the record. pub fn seq(&self) -> TextSlice { self.seq.as_bytes() } /// Clear the record. fn clear(&mut self) { self.header.clear(); self.seq.clear(); } } /// An iterator over the records of a Fasta file. pub struct Records<R: io::Read> { reader: Reader<R>, } impl<R: io::Read> Iterator for Records<R> { type Item = io::Result<Record>; fn next(&mut self) -> Option<io::Result<Record>> { let mut record = Record::new(); match self.reader.read(&mut record) { Ok(()) if record.is_empty() => None, Ok(()) => Some(Ok(record)), Err(err) => Some(Err(err)), } } } #[cfg(test)] mod tests { use super::*; use std::io; const FASTA_FILE: &'static [u8] = b">id desc ACCGTAGGCTGA CCGTAGGCTGAA CGTAGGCTGAAA GTAGGCTGAAAA CCCC >id2 ATTGTTGTTTTA ATTGTTGTTTTA ATTGTTGTTTTA GGGG "; const FAI_FILE: &'static [u8] = b"id\t52\t9\t12\t13 id2\t40\t71\t12\t13 "; const FASTA_FILE_CRLF: &'static [u8] = b">id desc\r ACCGTAGGCTGA\r CCGTAGGCTGAA\r CGTAGGCTGAAA\r GTAGGCTGAAAA\r CCCC\r >id2\r ATTGTTGTTTTA\r ATTGTTGTTTTA\r ATTGTTGTTTTA\r GGGG\r "; const FAI_FILE_CRLF: &'static [u8] = b"id\t52\t10\t12\t14\r id2\t40\t78\t12\t14\r "; const FASTA_FILE_NO_TRAILING_LF : &'static [u8] = b">id desc GTAGGCTGAAAA CCCC"; const FAI_FILE_NO_TRAILING_LF: &'static [u8] = b"id\t16\t9\t12\t13"; const WRITE_FASTA_FILE: &'static [u8] = b">id desc ACCGTAGGCTGA >id2 ATTGTTGTTTTA "; #[test] fn test_reader() { let reader = Reader::new(FASTA_FILE); let ids = [Some("id"), Some("id2")]; let descs = [Some("desc"), None]; let seqs: [&[u8]; 2] = [b"ACCGTAGGCTGACCGTAGGCTGAACGTAGGCTGAAAGTAGGCTGAAAACCCC", b"ATTGTTGTTTTAATTGTTGTTTTAATTGTTGTTTTAGGGG"]; for (i, r) in reader.records().enumerate() { let record = r.ok().expect("Error reading record"); assert_eq!(record.check(), Ok(())); assert_eq!(record.id(), ids[i]); assert_eq!(record.desc(), descs[i]); assert_eq!(record.seq(), seqs[i]); } // let record = records.ok().nth(1).unwrap(); } #[test] fn test_indexed_reader() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE), FAI_FILE) .ok() .expect("Error reading index"); _test_indexed_reader(&mut reader) } #[test] fn test_indexed_reader_crlf() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE_CRLF), FAI_FILE_CRLF) .ok() .expect("Error reading index"); _test_indexed_reader(&mut reader) } fn _test_indexed_reader<T: Seek + Read>(reader: &mut IndexedReader<T>) { let mut seq = Vec::new(); // Test reading various substrings of the sequence reader.read("id", 1, 5, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CCGT"); reader.read("id", 1, 31, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CCGTAGGCTGACCGTAGGCTGAACGTAGGC"); reader.read("id", 13, 23, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"CGTAGGCTGA"); reader.read("id", 36, 52, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"GTAGGCTGAAAACCCC"); reader.read("id2", 12, 40, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"ATTGTTGTTTTAATTGTTGTTTTAGGGG"); reader.read("id2", 12, 12, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b""); reader.read("id2", 12, 13, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"A"); assert!(reader.read("id2", 12, 11, &mut seq).is_err()); assert!(reader.read("id2", 12, 1000, &mut seq).is_err()); } #[test] fn test_indexed_reader_no_trailing_lf() { let mut reader = IndexedReader::new(io::Cursor::new(FASTA_FILE_NO_TRAILING_LF), FAI_FILE_NO_TRAILING_LF) .ok() .expect("Error reading index"); let mut seq = Vec::new(); reader.read("id", 0, 16, &mut seq).ok().expect("Error reading sequence."); assert_eq!(seq, b"GTAGGCTGAAAACCCC"); } #[test] fn test_writer() { let mut writer = Writer::new(Vec::new()); writer.write("id", Some("desc"), b"ACCGTAGGCTGA").ok().expect("Expected successful write"); writer.write("id2", None, b"ATTGTTGTTTTA").ok().expect("Expected successful write"); writer.flush().ok().expect("Expected successful write"); assert_eq!(writer.writer.get_ref(), &WRITE_FASTA_FILE); } }
if self.id().is_none() { return Err("Expecting id for FastQ record."); } if !self.seq.is_ascii() { return Err("Non-ascii character found in sequence."); } Ok(()) }
identifier_body
Svg.ts
import h from './h' function
(tagName: string) { return h.bind(null, tagName) } export default Object.freeze({ a : f('a'), altGlyph : f('altGlyph'), altGlyphDef : f('altGlyphDef'), altGlyphItem : f('altGlyphItem'), animate : f('animate'), animateColor : f('animateColor'), animateMotion : f('animateMotion'), animateTransform : f('animateTransform'), circle : f('circle'), clipPath : f('clipPath'), colorProfile : f('color-profile'), cursor : f('cursor'), defs : f('defs'), desc : f('desc'), ellipse : f('ellipse'), feBlend : f('feBlend'), feColorMatrix : f('feColorMatrix'), feComponentTransfer : f('feComponentTransfer'), feComposite : f('feComposite'), feConvolveMatrix : f('feConvolveMatrix'), feDiffuseLighting : f('feDiffuseLighting'), feDisplacementMap : f('feDisplacementMap'), feDistantLight : f('feDistantLight'), feFlood : f('feFlood'), feFuncA : f('feFuncA'), feFuncB : f('feFuncB'), feFuncG : f('feFuncG'), feFuncR : f('feFuncR'), feGaussianBlur : f('feGaussianBlur'), feImage : f('feImage'), feMerge : f('feMerge'), feMergeNode : f('feMergeNode'), feMorphology : f('feMorphology'), feOffset : f('feOffset'), fePointLight : f('fePointLight'), feSpecularLighting : f('feSpecularLighting'), feSpotLight : f('feSpotLight'), feTile : f('feTile'), feTurbulence : f('feTurbulence'), filter : f('filter'), font : f('font'), foreignObject : f('foreignObject'), g : f('g'), glyph : f('glyph'), glyphRef : f('glyphRef'), hkern : f('hkern'), image : f('image'), line : f('line'), linearGradient : f('linearGradient'), marker : f('marker'), mask : f('mask'), metadata : f('metadata'), mpath : f('mpath'), path : f('path'), pattern : f('pattern'), polygon : f('polygon'), polyline : f('polyline'), radialGradient : f('radialGradient'), rect : f('rect'), script : f('script'), set : f('set'), stop : f('stop'), style : f('style'), svg : f('svg'), switch: f('switch'), symbol : f('symbol'), text : f('text'), textPath : f('textPath'), title : f('title'), tref : f('tref'), tspan : f('tspan'), use : f('use'), view : f('view'), vkern : f('vkern') })
f
identifier_name
Svg.ts
import h from './h' function f(tagName: string) { return h.bind(null, tagName) } export default Object.freeze({ a : f('a'), altGlyph : f('altGlyph'), altGlyphDef : f('altGlyphDef'), altGlyphItem : f('altGlyphItem'), animate : f('animate'), animateColor : f('animateColor'), animateMotion : f('animateMotion'), animateTransform : f('animateTransform'), circle : f('circle'), clipPath : f('clipPath'), colorProfile : f('color-profile'), cursor : f('cursor'), defs : f('defs'), desc : f('desc'), ellipse : f('ellipse'), feBlend : f('feBlend'), feColorMatrix : f('feColorMatrix'), feComponentTransfer : f('feComponentTransfer'), feComposite : f('feComposite'), feConvolveMatrix : f('feConvolveMatrix'),
feDiffuseLighting : f('feDiffuseLighting'), feDisplacementMap : f('feDisplacementMap'), feDistantLight : f('feDistantLight'), feFlood : f('feFlood'), feFuncA : f('feFuncA'), feFuncB : f('feFuncB'), feFuncG : f('feFuncG'), feFuncR : f('feFuncR'), feGaussianBlur : f('feGaussianBlur'), feImage : f('feImage'), feMerge : f('feMerge'), feMergeNode : f('feMergeNode'), feMorphology : f('feMorphology'), feOffset : f('feOffset'), fePointLight : f('fePointLight'), feSpecularLighting : f('feSpecularLighting'), feSpotLight : f('feSpotLight'), feTile : f('feTile'), feTurbulence : f('feTurbulence'), filter : f('filter'), font : f('font'), foreignObject : f('foreignObject'), g : f('g'), glyph : f('glyph'), glyphRef : f('glyphRef'), hkern : f('hkern'), image : f('image'), line : f('line'), linearGradient : f('linearGradient'), marker : f('marker'), mask : f('mask'), metadata : f('metadata'), mpath : f('mpath'), path : f('path'), pattern : f('pattern'), polygon : f('polygon'), polyline : f('polyline'), radialGradient : f('radialGradient'), rect : f('rect'), script : f('script'), set : f('set'), stop : f('stop'), style : f('style'), svg : f('svg'), switch: f('switch'), symbol : f('symbol'), text : f('text'), textPath : f('textPath'), title : f('title'), tref : f('tref'), tspan : f('tspan'), use : f('use'), view : f('view'), vkern : f('vkern') })
random_line_split
Svg.ts
import h from './h' function f(tagName: string)
export default Object.freeze({ a : f('a'), altGlyph : f('altGlyph'), altGlyphDef : f('altGlyphDef'), altGlyphItem : f('altGlyphItem'), animate : f('animate'), animateColor : f('animateColor'), animateMotion : f('animateMotion'), animateTransform : f('animateTransform'), circle : f('circle'), clipPath : f('clipPath'), colorProfile : f('color-profile'), cursor : f('cursor'), defs : f('defs'), desc : f('desc'), ellipse : f('ellipse'), feBlend : f('feBlend'), feColorMatrix : f('feColorMatrix'), feComponentTransfer : f('feComponentTransfer'), feComposite : f('feComposite'), feConvolveMatrix : f('feConvolveMatrix'), feDiffuseLighting : f('feDiffuseLighting'), feDisplacementMap : f('feDisplacementMap'), feDistantLight : f('feDistantLight'), feFlood : f('feFlood'), feFuncA : f('feFuncA'), feFuncB : f('feFuncB'), feFuncG : f('feFuncG'), feFuncR : f('feFuncR'), feGaussianBlur : f('feGaussianBlur'), feImage : f('feImage'), feMerge : f('feMerge'), feMergeNode : f('feMergeNode'), feMorphology : f('feMorphology'), feOffset : f('feOffset'), fePointLight : f('fePointLight'), feSpecularLighting : f('feSpecularLighting'), feSpotLight : f('feSpotLight'), feTile : f('feTile'), feTurbulence : f('feTurbulence'), filter : f('filter'), font : f('font'), foreignObject : f('foreignObject'), g : f('g'), glyph : f('glyph'), glyphRef : f('glyphRef'), hkern : f('hkern'), image : f('image'), line : f('line'), linearGradient : f('linearGradient'), marker : f('marker'), mask : f('mask'), metadata : f('metadata'), mpath : f('mpath'), path : f('path'), pattern : f('pattern'), polygon : f('polygon'), polyline : f('polyline'), radialGradient : f('radialGradient'), rect : f('rect'), script : f('script'), set : f('set'), stop : f('stop'), style : f('style'), svg : f('svg'), switch: f('switch'), symbol : f('symbol'), text : f('text'), textPath : f('textPath'), title : f('title'), tref : f('tref'), tspan : f('tspan'), use : f('use'), view : f('view'), vkern : f('vkern') })
{ return h.bind(null, tagName) }
identifier_body
tier.js
'use strict'; var mongoose = require('mongoose'); var mongoose_uuid = require('mongoose-uuid'); var mongoose_relationship = require('mongoose-relationship'); function tierModel () { var tierSchema = mongoose.Schema({ environment: { type: String, ref: 'Environment', childPath: 'tiers', index: true }, platform: { type: String, ref: 'Platform', childPath: 'tiers', index: true }, machines: [{ type: String, ref: 'Machine' }], cfpersonas: { type: String, ref: 'CfPersonas', index: true }, name: { type: String }, system_name: { type: String }, user_script: { type: String }, base_image: { type: String }, base_package: { type: String }, home_network: { type: String }, networks: [{ type: String }] }, { _id: false, versionKey: false }); tierSchema.plugin(mongoose_uuid.plugin, 'Tier'); tierSchema.plugin(mongoose_relationship, { relationshipPathName: [ 'environment', 'platform' ] }); tierSchema.pre('save', function (next) { var tier = this; if (tier.system_name && tier.system_name.length > 0)
tier.system_name = tier.name.toLowerCase().replace(/\s+/g, '_'); next(); }); return mongoose.model('Tier', tierSchema); } module.exports = new tierModel();
{ next(); return; }
conditional_block
tier.js
'use strict'; var mongoose = require('mongoose'); var mongoose_uuid = require('mongoose-uuid'); var mongoose_relationship = require('mongoose-relationship'); function tierModel () { var tierSchema = mongoose.Schema({ environment: { type: String, ref: 'Environment', childPath: 'tiers', index: true }, platform: { type: String, ref: 'Platform', childPath: 'tiers', index: true }, machines: [{ type: String, ref: 'Machine' }], cfpersonas: { type: String, ref: 'CfPersonas', index: true }, name: { type: String }, system_name: { type: String }, user_script: { type: String }, base_image: { type: String }, base_package: { type: String },
networks: [{ type: String }] }, { _id: false, versionKey: false }); tierSchema.plugin(mongoose_uuid.plugin, 'Tier'); tierSchema.plugin(mongoose_relationship, { relationshipPathName: [ 'environment', 'platform' ] }); tierSchema.pre('save', function (next) { var tier = this; if (tier.system_name && tier.system_name.length > 0) { next(); return; } tier.system_name = tier.name.toLowerCase().replace(/\s+/g, '_'); next(); }); return mongoose.model('Tier', tierSchema); } module.exports = new tierModel();
home_network: { type: String },
random_line_split
tier.js
'use strict'; var mongoose = require('mongoose'); var mongoose_uuid = require('mongoose-uuid'); var mongoose_relationship = require('mongoose-relationship'); function tierModel ()
module.exports = new tierModel();
{ var tierSchema = mongoose.Schema({ environment: { type: String, ref: 'Environment', childPath: 'tiers', index: true }, platform: { type: String, ref: 'Platform', childPath: 'tiers', index: true }, machines: [{ type: String, ref: 'Machine' }], cfpersonas: { type: String, ref: 'CfPersonas', index: true }, name: { type: String }, system_name: { type: String }, user_script: { type: String }, base_image: { type: String }, base_package: { type: String }, home_network: { type: String }, networks: [{ type: String }] }, { _id: false, versionKey: false }); tierSchema.plugin(mongoose_uuid.plugin, 'Tier'); tierSchema.plugin(mongoose_relationship, { relationshipPathName: [ 'environment', 'platform' ] }); tierSchema.pre('save', function (next) { var tier = this; if (tier.system_name && tier.system_name.length > 0) { next(); return; } tier.system_name = tier.name.toLowerCase().replace(/\s+/g, '_'); next(); }); return mongoose.model('Tier', tierSchema); }
identifier_body
tier.js
'use strict'; var mongoose = require('mongoose'); var mongoose_uuid = require('mongoose-uuid'); var mongoose_relationship = require('mongoose-relationship'); function
() { var tierSchema = mongoose.Schema({ environment: { type: String, ref: 'Environment', childPath: 'tiers', index: true }, platform: { type: String, ref: 'Platform', childPath: 'tiers', index: true }, machines: [{ type: String, ref: 'Machine' }], cfpersonas: { type: String, ref: 'CfPersonas', index: true }, name: { type: String }, system_name: { type: String }, user_script: { type: String }, base_image: { type: String }, base_package: { type: String }, home_network: { type: String }, networks: [{ type: String }] }, { _id: false, versionKey: false }); tierSchema.plugin(mongoose_uuid.plugin, 'Tier'); tierSchema.plugin(mongoose_relationship, { relationshipPathName: [ 'environment', 'platform' ] }); tierSchema.pre('save', function (next) { var tier = this; if (tier.system_name && tier.system_name.length > 0) { next(); return; } tier.system_name = tier.name.toLowerCase().replace(/\s+/g, '_'); next(); }); return mongoose.model('Tier', tierSchema); } module.exports = new tierModel();
tierModel
identifier_name
HTPGeoprocessor.py
""" /*************************************************************************** Name : HTP Geoprocessor Description : Tools for processing HTP geospatial data Date : 29/Mar/12 copyright : (C) 2012 by Dr. Kelly Thorp, USDA-ARS email : kelly.thorp@ars.usda.gov ***************************************************************************/ /*************************************************************************** * * * This program is free software; you can redistribute it and/or modify * * it under the terms of the GNU General Public License as published by * * the Free Software Foundation; either version 2 of the License, or * * (at your option) any later version. * * * ***************************************************************************/ """ # Import the PyQt and QGIS libraries from PyQt4.QtCore import * from PyQt4.QtGui import * #from qgis.core import * # Initialize Qt resources from file resources.py import resources import os import sys # Import the code for the dialogs from MapCreatorDlg import MapCreatorDlg from GeoprocessorDlg import GeoprocessorDlg from PreprocessorDlg import PreprocessorDlg class HTPGeoprocessor: def __init__(self, iface): # Save reference to the QGIS interface self.iface = iface # initialize plugin directory self.plugin_dir = os.path.dirname(__file__) # initialize locale locale = QSettings().value("locale/userLocale")[0:2] localePath = os.path.join(self.plugin_dir, 'i18n', 'htpgeoprocessor_{}.qm'.format(locale)) if os.path.exists(localePath): self.translator = QTranslator() self.translator.load(localePath) if qVersion() > '4.3.3': QCoreApplication.installTranslator(self.translator) def initGui(self): # Create action that will start plugin configuration icon = QIcon(":/plugins/htpgeoprocessor/icon.png") self.createmap = QAction(icon,u"Map Creator", self.iface.mainWindow()) self.preprocess = QAction(icon,u"Preprocessor", self.iface.mainWindow()) self.geoprocess = QAction(icon,u"Geoprocessor", self.iface.mainWindow()) self.helpme = QAction(icon, u"Help", self.iface.mainWindow()) # connect the action to a method self.createmap.triggered.connect(self.CreateMap) self.preprocess.triggered.connect(self.Preprocess) self.geoprocess.triggered.connect(self.Geoprocess) self.helpme.triggered.connect(self.Help) # Add toolbar button and menu item self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.createmap) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.helpme) def unload(self): # Remove the plugin menu item and icon self.iface.removePluginMenu(u"&HTP Geoprocessor", self.createmap) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.helpme) # run methods that perform all the real work def CreateMap(self): dlg = MapCreatorDlg(self.iface) dlg.exec_() def Preprocess(self): dlg = PreprocessorDlg() dlg.exec_() def Geoprocess(self): # create and show the dialog dlg = GeoprocessorDlg(self.iface) # show the dialog #dlg.show() #Modeless dialog dlg.exec_() #Modal dialog def Help(self): path = os.path.dirname(sys.modules[__name__].__file__) if sys.platform == 'linux': os.system(path+"//HTP Geoprocessor README.pdf") elif sys.platform == 'win32':
else: QMessageBox.critical(self.iface.mainWindow(),'Help','Error opening document. Look in plug-in install directory for PDF.')
os.startfile(path+"\\HTP Geoprocessor README.pdf")
conditional_block
HTPGeoprocessor.py
""" /*************************************************************************** Name : HTP Geoprocessor Description : Tools for processing HTP geospatial data Date : 29/Mar/12 copyright : (C) 2012 by Dr. Kelly Thorp, USDA-ARS email : kelly.thorp@ars.usda.gov ***************************************************************************/ /*************************************************************************** * * * This program is free software; you can redistribute it and/or modify * * it under the terms of the GNU General Public License as published by * * the Free Software Foundation; either version 2 of the License, or * * (at your option) any later version. * * * ***************************************************************************/ """ # Import the PyQt and QGIS libraries from PyQt4.QtCore import * from PyQt4.QtGui import * #from qgis.core import * # Initialize Qt resources from file resources.py import resources import os import sys # Import the code for the dialogs from MapCreatorDlg import MapCreatorDlg from GeoprocessorDlg import GeoprocessorDlg from PreprocessorDlg import PreprocessorDlg class HTPGeoprocessor: def __init__(self, iface): # Save reference to the QGIS interface self.iface = iface # initialize plugin directory self.plugin_dir = os.path.dirname(__file__) # initialize locale locale = QSettings().value("locale/userLocale")[0:2] localePath = os.path.join(self.plugin_dir, 'i18n', 'htpgeoprocessor_{}.qm'.format(locale)) if os.path.exists(localePath): self.translator = QTranslator() self.translator.load(localePath) if qVersion() > '4.3.3': QCoreApplication.installTranslator(self.translator) def initGui(self): # Create action that will start plugin configuration icon = QIcon(":/plugins/htpgeoprocessor/icon.png") self.createmap = QAction(icon,u"Map Creator", self.iface.mainWindow()) self.preprocess = QAction(icon,u"Preprocessor", self.iface.mainWindow()) self.geoprocess = QAction(icon,u"Geoprocessor", self.iface.mainWindow()) self.helpme = QAction(icon, u"Help", self.iface.mainWindow()) # connect the action to a method self.createmap.triggered.connect(self.CreateMap) self.preprocess.triggered.connect(self.Preprocess) self.geoprocess.triggered.connect(self.Geoprocess) self.helpme.triggered.connect(self.Help) # Add toolbar button and menu item self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.createmap) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.helpme) def unload(self): # Remove the plugin menu item and icon self.iface.removePluginMenu(u"&HTP Geoprocessor", self.createmap) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.helpme) # run methods that perform all the real work def CreateMap(self): dlg = MapCreatorDlg(self.iface) dlg.exec_() def Preprocess(self):
def Geoprocess(self): # create and show the dialog dlg = GeoprocessorDlg(self.iface) # show the dialog #dlg.show() #Modeless dialog dlg.exec_() #Modal dialog def Help(self): path = os.path.dirname(sys.modules[__name__].__file__) if sys.platform == 'linux': os.system(path+"//HTP Geoprocessor README.pdf") elif sys.platform == 'win32': os.startfile(path+"\\HTP Geoprocessor README.pdf") else: QMessageBox.critical(self.iface.mainWindow(),'Help','Error opening document. Look in plug-in install directory for PDF.')
dlg = PreprocessorDlg() dlg.exec_()
random_line_split
HTPGeoprocessor.py
""" /*************************************************************************** Name : HTP Geoprocessor Description : Tools for processing HTP geospatial data Date : 29/Mar/12 copyright : (C) 2012 by Dr. Kelly Thorp, USDA-ARS email : kelly.thorp@ars.usda.gov ***************************************************************************/ /*************************************************************************** * * * This program is free software; you can redistribute it and/or modify * * it under the terms of the GNU General Public License as published by * * the Free Software Foundation; either version 2 of the License, or * * (at your option) any later version. * * * ***************************************************************************/ """ # Import the PyQt and QGIS libraries from PyQt4.QtCore import * from PyQt4.QtGui import * #from qgis.core import * # Initialize Qt resources from file resources.py import resources import os import sys # Import the code for the dialogs from MapCreatorDlg import MapCreatorDlg from GeoprocessorDlg import GeoprocessorDlg from PreprocessorDlg import PreprocessorDlg class HTPGeoprocessor: def __init__(self, iface): # Save reference to the QGIS interface self.iface = iface # initialize plugin directory self.plugin_dir = os.path.dirname(__file__) # initialize locale locale = QSettings().value("locale/userLocale")[0:2] localePath = os.path.join(self.plugin_dir, 'i18n', 'htpgeoprocessor_{}.qm'.format(locale)) if os.path.exists(localePath): self.translator = QTranslator() self.translator.load(localePath) if qVersion() > '4.3.3': QCoreApplication.installTranslator(self.translator) def initGui(self): # Create action that will start plugin configuration icon = QIcon(":/plugins/htpgeoprocessor/icon.png") self.createmap = QAction(icon,u"Map Creator", self.iface.mainWindow()) self.preprocess = QAction(icon,u"Preprocessor", self.iface.mainWindow()) self.geoprocess = QAction(icon,u"Geoprocessor", self.iface.mainWindow()) self.helpme = QAction(icon, u"Help", self.iface.mainWindow()) # connect the action to a method self.createmap.triggered.connect(self.CreateMap) self.preprocess.triggered.connect(self.Preprocess) self.geoprocess.triggered.connect(self.Geoprocess) self.helpme.triggered.connect(self.Help) # Add toolbar button and menu item self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.createmap) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.helpme) def unload(self): # Remove the plugin menu item and icon self.iface.removePluginMenu(u"&HTP Geoprocessor", self.createmap) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.helpme) # run methods that perform all the real work def CreateMap(self): dlg = MapCreatorDlg(self.iface) dlg.exec_() def Preprocess(self):
def Geoprocess(self): # create and show the dialog dlg = GeoprocessorDlg(self.iface) # show the dialog #dlg.show() #Modeless dialog dlg.exec_() #Modal dialog def Help(self): path = os.path.dirname(sys.modules[__name__].__file__) if sys.platform == 'linux': os.system(path+"//HTP Geoprocessor README.pdf") elif sys.platform == 'win32': os.startfile(path+"\\HTP Geoprocessor README.pdf") else: QMessageBox.critical(self.iface.mainWindow(),'Help','Error opening document. Look in plug-in install directory for PDF.')
dlg = PreprocessorDlg() dlg.exec_()
identifier_body
HTPGeoprocessor.py
""" /*************************************************************************** Name : HTP Geoprocessor Description : Tools for processing HTP geospatial data Date : 29/Mar/12 copyright : (C) 2012 by Dr. Kelly Thorp, USDA-ARS email : kelly.thorp@ars.usda.gov ***************************************************************************/ /*************************************************************************** * * * This program is free software; you can redistribute it and/or modify * * it under the terms of the GNU General Public License as published by * * the Free Software Foundation; either version 2 of the License, or * * (at your option) any later version. * * * ***************************************************************************/ """ # Import the PyQt and QGIS libraries from PyQt4.QtCore import * from PyQt4.QtGui import * #from qgis.core import * # Initialize Qt resources from file resources.py import resources import os import sys # Import the code for the dialogs from MapCreatorDlg import MapCreatorDlg from GeoprocessorDlg import GeoprocessorDlg from PreprocessorDlg import PreprocessorDlg class HTPGeoprocessor: def __init__(self, iface): # Save reference to the QGIS interface self.iface = iface # initialize plugin directory self.plugin_dir = os.path.dirname(__file__) # initialize locale locale = QSettings().value("locale/userLocale")[0:2] localePath = os.path.join(self.plugin_dir, 'i18n', 'htpgeoprocessor_{}.qm'.format(locale)) if os.path.exists(localePath): self.translator = QTranslator() self.translator.load(localePath) if qVersion() > '4.3.3': QCoreApplication.installTranslator(self.translator) def initGui(self): # Create action that will start plugin configuration icon = QIcon(":/plugins/htpgeoprocessor/icon.png") self.createmap = QAction(icon,u"Map Creator", self.iface.mainWindow()) self.preprocess = QAction(icon,u"Preprocessor", self.iface.mainWindow()) self.geoprocess = QAction(icon,u"Geoprocessor", self.iface.mainWindow()) self.helpme = QAction(icon, u"Help", self.iface.mainWindow()) # connect the action to a method self.createmap.triggered.connect(self.CreateMap) self.preprocess.triggered.connect(self.Preprocess) self.geoprocess.triggered.connect(self.Geoprocess) self.helpme.triggered.connect(self.Help) # Add toolbar button and menu item self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.createmap) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.addPluginToMenu(u"&HTP Geoprocessor", self.helpme) def unload(self): # Remove the plugin menu item and icon self.iface.removePluginMenu(u"&HTP Geoprocessor", self.createmap) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.preprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.geoprocess) self.iface.removePluginMenu(u"&HTP Geoprocessor", self.helpme) # run methods that perform all the real work def CreateMap(self): dlg = MapCreatorDlg(self.iface) dlg.exec_() def Preprocess(self): dlg = PreprocessorDlg() dlg.exec_() def Geoprocess(self): # create and show the dialog dlg = GeoprocessorDlg(self.iface) # show the dialog #dlg.show() #Modeless dialog dlg.exec_() #Modal dialog def
(self): path = os.path.dirname(sys.modules[__name__].__file__) if sys.platform == 'linux': os.system(path+"//HTP Geoprocessor README.pdf") elif sys.platform == 'win32': os.startfile(path+"\\HTP Geoprocessor README.pdf") else: QMessageBox.critical(self.iface.mainWindow(),'Help','Error opening document. Look in plug-in install directory for PDF.')
Help
identifier_name
private-match.js
(function(){ 'use strict'; var _ = require('lodash'); var PrivateMatch = function() { this.waitingText = null;
this.nextDot = 0; }; PrivateMatch.prototype.create = function() { this.game.socketHandler.startPrivateMatch(); this.game.stage.backgroundColor = '#C8F7C5'; this.sendLinkText = this.add.text( this.world.centerX, this.world.centerY - 150, 'Send this link to your opponent:', { font: '45pt hallo_sansblack', fill: '#e67e22', align: 'center' } ); this.sendLinkText.anchor.setTo(0.5, 0.5); this.waitingText = this.add.text( -999, this.world.centerY+250, 'Waiting for a player to join', { font: '30pt hallo_sansblack', fill: '#f1c40f', align: 'center' } ); // Can't anchor it as it would move around when the dots are added to its string. this.waitingText.x = this.world.width/2 - this.waitingText.width/2; this.matchInput = document.querySelector('#match-input'); this.matchInput.style.display = 'inline'; this.matchInput.focus(); this.smallMenuButton = this.add.button(this.world.centerX, this.world.centerY+170, 'menuButton', this.startMenu, this, 1, 0, 0); this.smallMenuButton.scale.setTo(0.6, 0,6); this.smallMenuButton.anchor.setTo(0.5, 0.5); }; PrivateMatch.prototype.setLink = function(matchID) { window.location.hash = matchID; this.matchInput.value = window.location.href; }; PrivateMatch.prototype.update = function() { if (this.time.now > this.nextDot) { if (this.dots === 3) { this.dots = 0; } this.dots++; var dotString = ''; for (var i = 0; i < this.dots; i++) { dotString += '.'; } this.waitingText.setText('Waiting for a player to join' + dotString); this.nextDot = this.time.now + 500; } }; PrivateMatch.prototype.shutdown = function() { this.matchInput.style.display = 'none'; }; PrivateMatch.prototype.startMenu = function() { this.game.socketHandler.stopPrivateMatch(); window.location.hash = ''; this.game.state.start('Menu'); }; module.exports = PrivateMatch; })();
this.dots = 0;
random_line_split
private-match.js
(function(){ 'use strict'; var _ = require('lodash'); var PrivateMatch = function() { this.waitingText = null; this.dots = 0; this.nextDot = 0; }; PrivateMatch.prototype.create = function() { this.game.socketHandler.startPrivateMatch(); this.game.stage.backgroundColor = '#C8F7C5'; this.sendLinkText = this.add.text( this.world.centerX, this.world.centerY - 150, 'Send this link to your opponent:', { font: '45pt hallo_sansblack', fill: '#e67e22', align: 'center' } ); this.sendLinkText.anchor.setTo(0.5, 0.5); this.waitingText = this.add.text( -999, this.world.centerY+250, 'Waiting for a player to join', { font: '30pt hallo_sansblack', fill: '#f1c40f', align: 'center' } ); // Can't anchor it as it would move around when the dots are added to its string. this.waitingText.x = this.world.width/2 - this.waitingText.width/2; this.matchInput = document.querySelector('#match-input'); this.matchInput.style.display = 'inline'; this.matchInput.focus(); this.smallMenuButton = this.add.button(this.world.centerX, this.world.centerY+170, 'menuButton', this.startMenu, this, 1, 0, 0); this.smallMenuButton.scale.setTo(0.6, 0,6); this.smallMenuButton.anchor.setTo(0.5, 0.5); }; PrivateMatch.prototype.setLink = function(matchID) { window.location.hash = matchID; this.matchInput.value = window.location.href; }; PrivateMatch.prototype.update = function() { if (this.time.now > this.nextDot)
}; PrivateMatch.prototype.shutdown = function() { this.matchInput.style.display = 'none'; }; PrivateMatch.prototype.startMenu = function() { this.game.socketHandler.stopPrivateMatch(); window.location.hash = ''; this.game.state.start('Menu'); }; module.exports = PrivateMatch; })();
{ if (this.dots === 3) { this.dots = 0; } this.dots++; var dotString = ''; for (var i = 0; i < this.dots; i++) { dotString += '.'; } this.waitingText.setText('Waiting for a player to join' + dotString); this.nextDot = this.time.now + 500; }
conditional_block
menudata.js
/* @licstart The following is the entire license notice for the JavaScript code in this file. Copyright (C) 1997-2019 by Dimitri van Heesch
This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. @licend The above is the entire license notice for the JavaScript code in this file */ var menudata={children:[ {text:"Introduction",url:"index.html"}, {text:"Tutorial",url:"quick_guide.html"}, {text:"Guides",url:"pages.html"}, {text:"Reference",url:"modules.html"}, {text:"Files",url:"files.html"}]}
This program is free software; you can redistribute it and/or modify it under the terms of version 2 of the GNU General Public License as published by the Free Software Foundation
random_line_split
poly.py
#!/usr/bin/env python from sys import path import os.path thisrep = os.path.dirname(os.path.abspath(__file__)) path.append(os.path.dirname(thisrep)) from random import randint from pygame import * from pygame import gfxdraw from EasyGame import pathgetter,confirm controls = """hold the left mouse button to draw d = undo s = save""" scr = display.set_mode((800,800)) confirm(controls,fontsize=14,mode=1) a = [] c = [] color = [randint(0,255) for i in (1,2,3)]+[50] while 1: ev = event.wait() if ev.type == MOUSEBUTTONDOWN and ev.button == 1: a.append([ev.pos]) c.append(color) if ev.type == MOUSEMOTION and ev.buttons[0]:
if ev.type == MOUSEBUTTONUP and ev.button == 1: if len(a[-1]) >= 2: draw.aaline(scr,color,a[-1][0],a[-1][-1],1) gfxdraw.filled_polygon(scr,a[-1],color) display.flip() color = [randint(0,255) for i in (1,2,3)]+[50] if ev.type == QUIT: break if ev.type == KEYDOWN and ev.key == K_s: p = pathgetter() if p: image.save(scr,p) if ev.type == KEYDOWN and ev.key == K_d and a: a.pop() c.pop() scr.fill(0) for lines,color in zip(a,c): draw.aalines(scr,color,1,lines,1) gfxdraw.filled_polygon(scr,lines,color) display.flip() if ev.type == KEYDOWN and ev.key == K_p: a = [[(x//10*10,y//10*10) for x,y in i] for i in a] scr.fill(0) for lines,col in zip(a,c): if len(lines) > 1: draw.aalines(scr,col,1,lines,1) gfxdraw.filled_polygon(scr,lines,col) display.flip()
a[-1].append(ev.pos) if len(a[-1]) >= 2: draw.aaline(scr,color,a[-1][-1],a[-1][-2],1) display.flip()
conditional_block
poly.py
#!/usr/bin/env python from sys import path import os.path thisrep = os.path.dirname(os.path.abspath(__file__)) path.append(os.path.dirname(thisrep)) from random import randint from pygame import * from pygame import gfxdraw from EasyGame import pathgetter,confirm controls = """hold the left mouse button to draw d = undo s = save""" scr = display.set_mode((800,800)) confirm(controls,fontsize=14,mode=1) a = [] c = [] color = [randint(0,255) for i in (1,2,3)]+[50] while 1: ev = event.wait() if ev.type == MOUSEBUTTONDOWN and ev.button == 1: a.append([ev.pos]) c.append(color) if ev.type == MOUSEMOTION and ev.buttons[0]: a[-1].append(ev.pos) if len(a[-1]) >= 2:
display.flip() if ev.type == MOUSEBUTTONUP and ev.button == 1: if len(a[-1]) >= 2: draw.aaline(scr,color,a[-1][0],a[-1][-1],1) gfxdraw.filled_polygon(scr,a[-1],color) display.flip() color = [randint(0,255) for i in (1,2,3)]+[50] if ev.type == QUIT: break if ev.type == KEYDOWN and ev.key == K_s: p = pathgetter() if p: image.save(scr,p) if ev.type == KEYDOWN and ev.key == K_d and a: a.pop() c.pop() scr.fill(0) for lines,color in zip(a,c): draw.aalines(scr,color,1,lines,1) gfxdraw.filled_polygon(scr,lines,color) display.flip() if ev.type == KEYDOWN and ev.key == K_p: a = [[(x//10*10,y//10*10) for x,y in i] for i in a] scr.fill(0) for lines,col in zip(a,c): if len(lines) > 1: draw.aalines(scr,col,1,lines,1) gfxdraw.filled_polygon(scr,lines,col) display.flip()
draw.aaline(scr,color,a[-1][-1],a[-1][-2],1)
random_line_split
add_multi_asset_responsive_display_ad.py
#!/usr/bin/env python # # Copyright 2018 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This example adds a responsive display ad to an ad group. Image assets are uploaded using AssetService. To get ad groups, run get_ad_groups.py. The LoadFromStorage method is pulling credentials and properties from a "googleads.yaml" file. By default, it looks for this file in your home directory. For more information, see the "Caching authentication information" section of our README. """ from googleads import adwords import requests AD_GROUP_ID = 'INSERT_AD_GROUP_ID_HERE' def UploadImageAsset(client, url): """Uploads the image from the specified url. Args: client: An AdWordsClient instance. url: The image URL. Returns: The ID of the uploaded image. """ # Initialize appropriate service. asset_service = client.GetService('AssetService', version='v201809') # Download the image. image_request = requests.get(url) # Create the image asset. image_asset = { 'xsi_type': 'ImageAsset', 'imageData': image_request.content, # This field is optional, and if provided should be unique. # 'assetName': 'Image asset ' + str(uuid.uuid4()), } # Create the operation. operation = { 'operator': 'ADD', 'operand': image_asset } # Create the asset and return the ID. result = asset_service.mutate([operation]) return result['value'][0]['assetId'] def main(client, ad_group_id): # Initialize appropriate service. ad_group_ad_service = client.GetService('AdGroupAdService', version='v201809') # Create the ad. multi_asset_responsive_display_ad = { 'xsi_type': 'MultiAssetResponsiveDisplayAd', 'headlines': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Mars' } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Jupiter', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Pluto' } }], 'descriptions': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'See the planet in style.', } }], 'businessName': 'Galactic Luxury Cruises', 'longHeadline': { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, # This ad format does not allow the creation of an image asset by setting # the asset.imageData field. An image asset must first be created using # the AssetService, and asset.assetId must be populated when creating # the ad. 'marketingImages': [{
}], 'squareMarketingImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }], # Optional values 'finalUrls': ['http://www.example.com'], 'callToActionText': 'Shop Now', # Set color settings using hexadecimal values. Set allowFlexibleColor to # false if you want your ads to render by always using your colors # strictly. 'mainColor': '#0000ff', 'accentColor': '#ffff00', 'allowFlexibleColor': False, 'formatSetting': 'NON_NATIVE', # Set dynamic display ad settings, composed of landscape logo image, # promotion text, and price prefix. 'dynamicSettingsPricePrefix': 'as low as', 'dynamicSettingsPromoText': 'Free shipping!', 'logoImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }] } # Create ad group ad. ad_group_ad = { 'adGroupId': ad_group_id, 'ad': multi_asset_responsive_display_ad, # Optional. 'status': 'PAUSED' } # Add ad. ads = ad_group_ad_service.mutate([ {'operator': 'ADD', 'operand': ad_group_ad} ]) # Display results. if 'value' in ads: for ad in ads['value']: print ('Added new responsive display ad ad with ID "%d" ' 'and long headline "%s".' % (ad['ad']['id'], ad['ad']['longHeadline']['asset']['assetText'])) else: print 'No ads were added.' if __name__ == '__main__': # Initialize client object. adwords_client = adwords.AdWordsClient.LoadFromStorage() main(adwords_client, AD_GROUP_ID)
'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/3b9Wfh') }
random_line_split
add_multi_asset_responsive_display_ad.py
#!/usr/bin/env python # # Copyright 2018 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This example adds a responsive display ad to an ad group. Image assets are uploaded using AssetService. To get ad groups, run get_ad_groups.py. The LoadFromStorage method is pulling credentials and properties from a "googleads.yaml" file. By default, it looks for this file in your home directory. For more information, see the "Caching authentication information" section of our README. """ from googleads import adwords import requests AD_GROUP_ID = 'INSERT_AD_GROUP_ID_HERE' def UploadImageAsset(client, url): """Uploads the image from the specified url. Args: client: An AdWordsClient instance. url: The image URL. Returns: The ID of the uploaded image. """ # Initialize appropriate service. asset_service = client.GetService('AssetService', version='v201809') # Download the image. image_request = requests.get(url) # Create the image asset. image_asset = { 'xsi_type': 'ImageAsset', 'imageData': image_request.content, # This field is optional, and if provided should be unique. # 'assetName': 'Image asset ' + str(uuid.uuid4()), } # Create the operation. operation = { 'operator': 'ADD', 'operand': image_asset } # Create the asset and return the ID. result = asset_service.mutate([operation]) return result['value'][0]['assetId'] def main(client, ad_group_id): # Initialize appropriate service. ad_group_ad_service = client.GetService('AdGroupAdService', version='v201809') # Create the ad. multi_asset_responsive_display_ad = { 'xsi_type': 'MultiAssetResponsiveDisplayAd', 'headlines': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Mars' } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Jupiter', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Pluto' } }], 'descriptions': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'See the planet in style.', } }], 'businessName': 'Galactic Luxury Cruises', 'longHeadline': { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, # This ad format does not allow the creation of an image asset by setting # the asset.imageData field. An image asset must first be created using # the AssetService, and asset.assetId must be populated when creating # the ad. 'marketingImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/3b9Wfh') } }], 'squareMarketingImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }], # Optional values 'finalUrls': ['http://www.example.com'], 'callToActionText': 'Shop Now', # Set color settings using hexadecimal values. Set allowFlexibleColor to # false if you want your ads to render by always using your colors # strictly. 'mainColor': '#0000ff', 'accentColor': '#ffff00', 'allowFlexibleColor': False, 'formatSetting': 'NON_NATIVE', # Set dynamic display ad settings, composed of landscape logo image, # promotion text, and price prefix. 'dynamicSettingsPricePrefix': 'as low as', 'dynamicSettingsPromoText': 'Free shipping!', 'logoImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }] } # Create ad group ad. ad_group_ad = { 'adGroupId': ad_group_id, 'ad': multi_asset_responsive_display_ad, # Optional. 'status': 'PAUSED' } # Add ad. ads = ad_group_ad_service.mutate([ {'operator': 'ADD', 'operand': ad_group_ad} ]) # Display results. if 'value' in ads: for ad in ads['value']: print ('Added new responsive display ad ad with ID "%d" ' 'and long headline "%s".' % (ad['ad']['id'], ad['ad']['longHeadline']['asset']['assetText'])) else:
if __name__ == '__main__': # Initialize client object. adwords_client = adwords.AdWordsClient.LoadFromStorage() main(adwords_client, AD_GROUP_ID)
print 'No ads were added.'
conditional_block
add_multi_asset_responsive_display_ad.py
#!/usr/bin/env python # # Copyright 2018 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This example adds a responsive display ad to an ad group. Image assets are uploaded using AssetService. To get ad groups, run get_ad_groups.py. The LoadFromStorage method is pulling credentials and properties from a "googleads.yaml" file. By default, it looks for this file in your home directory. For more information, see the "Caching authentication information" section of our README. """ from googleads import adwords import requests AD_GROUP_ID = 'INSERT_AD_GROUP_ID_HERE' def UploadImageAsset(client, url): """Uploads the image from the specified url. Args: client: An AdWordsClient instance. url: The image URL. Returns: The ID of the uploaded image. """ # Initialize appropriate service. asset_service = client.GetService('AssetService', version='v201809') # Download the image. image_request = requests.get(url) # Create the image asset. image_asset = { 'xsi_type': 'ImageAsset', 'imageData': image_request.content, # This field is optional, and if provided should be unique. # 'assetName': 'Image asset ' + str(uuid.uuid4()), } # Create the operation. operation = { 'operator': 'ADD', 'operand': image_asset } # Create the asset and return the ID. result = asset_service.mutate([operation]) return result['value'][0]['assetId'] def
(client, ad_group_id): # Initialize appropriate service. ad_group_ad_service = client.GetService('AdGroupAdService', version='v201809') # Create the ad. multi_asset_responsive_display_ad = { 'xsi_type': 'MultiAssetResponsiveDisplayAd', 'headlines': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Mars' } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Jupiter', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Pluto' } }], 'descriptions': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'See the planet in style.', } }], 'businessName': 'Galactic Luxury Cruises', 'longHeadline': { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, # This ad format does not allow the creation of an image asset by setting # the asset.imageData field. An image asset must first be created using # the AssetService, and asset.assetId must be populated when creating # the ad. 'marketingImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/3b9Wfh') } }], 'squareMarketingImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }], # Optional values 'finalUrls': ['http://www.example.com'], 'callToActionText': 'Shop Now', # Set color settings using hexadecimal values. Set allowFlexibleColor to # false if you want your ads to render by always using your colors # strictly. 'mainColor': '#0000ff', 'accentColor': '#ffff00', 'allowFlexibleColor': False, 'formatSetting': 'NON_NATIVE', # Set dynamic display ad settings, composed of landscape logo image, # promotion text, and price prefix. 'dynamicSettingsPricePrefix': 'as low as', 'dynamicSettingsPromoText': 'Free shipping!', 'logoImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }] } # Create ad group ad. ad_group_ad = { 'adGroupId': ad_group_id, 'ad': multi_asset_responsive_display_ad, # Optional. 'status': 'PAUSED' } # Add ad. ads = ad_group_ad_service.mutate([ {'operator': 'ADD', 'operand': ad_group_ad} ]) # Display results. if 'value' in ads: for ad in ads['value']: print ('Added new responsive display ad ad with ID "%d" ' 'and long headline "%s".' % (ad['ad']['id'], ad['ad']['longHeadline']['asset']['assetText'])) else: print 'No ads were added.' if __name__ == '__main__': # Initialize client object. adwords_client = adwords.AdWordsClient.LoadFromStorage() main(adwords_client, AD_GROUP_ID)
main
identifier_name
add_multi_asset_responsive_display_ad.py
#!/usr/bin/env python # # Copyright 2018 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This example adds a responsive display ad to an ad group. Image assets are uploaded using AssetService. To get ad groups, run get_ad_groups.py. The LoadFromStorage method is pulling credentials and properties from a "googleads.yaml" file. By default, it looks for this file in your home directory. For more information, see the "Caching authentication information" section of our README. """ from googleads import adwords import requests AD_GROUP_ID = 'INSERT_AD_GROUP_ID_HERE' def UploadImageAsset(client, url):
def main(client, ad_group_id): # Initialize appropriate service. ad_group_ad_service = client.GetService('AdGroupAdService', version='v201809') # Create the ad. multi_asset_responsive_display_ad = { 'xsi_type': 'MultiAssetResponsiveDisplayAd', 'headlines': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Mars' } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Jupiter', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Travel to Pluto' } }], 'descriptions': [{ 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'See the planet in style.', } }], 'businessName': 'Galactic Luxury Cruises', 'longHeadline': { 'asset': { 'xsi_type': 'TextAsset', 'assetText': 'Visit the planet in a luxury spaceship.', } }, # This ad format does not allow the creation of an image asset by setting # the asset.imageData field. An image asset must first be created using # the AssetService, and asset.assetId must be populated when creating # the ad. 'marketingImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/3b9Wfh') } }], 'squareMarketingImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }], # Optional values 'finalUrls': ['http://www.example.com'], 'callToActionText': 'Shop Now', # Set color settings using hexadecimal values. Set allowFlexibleColor to # false if you want your ads to render by always using your colors # strictly. 'mainColor': '#0000ff', 'accentColor': '#ffff00', 'allowFlexibleColor': False, 'formatSetting': 'NON_NATIVE', # Set dynamic display ad settings, composed of landscape logo image, # promotion text, and price prefix. 'dynamicSettingsPricePrefix': 'as low as', 'dynamicSettingsPromoText': 'Free shipping!', 'logoImages': [{ 'asset': { 'xsi_type': 'ImageAsset', 'assetId': UploadImageAsset(client, 'https://goo.gl/mtt54n') } }] } # Create ad group ad. ad_group_ad = { 'adGroupId': ad_group_id, 'ad': multi_asset_responsive_display_ad, # Optional. 'status': 'PAUSED' } # Add ad. ads = ad_group_ad_service.mutate([ {'operator': 'ADD', 'operand': ad_group_ad} ]) # Display results. if 'value' in ads: for ad in ads['value']: print ('Added new responsive display ad ad with ID "%d" ' 'and long headline "%s".' % (ad['ad']['id'], ad['ad']['longHeadline']['asset']['assetText'])) else: print 'No ads were added.' if __name__ == '__main__': # Initialize client object. adwords_client = adwords.AdWordsClient.LoadFromStorage() main(adwords_client, AD_GROUP_ID)
"""Uploads the image from the specified url. Args: client: An AdWordsClient instance. url: The image URL. Returns: The ID of the uploaded image. """ # Initialize appropriate service. asset_service = client.GetService('AssetService', version='v201809') # Download the image. image_request = requests.get(url) # Create the image asset. image_asset = { 'xsi_type': 'ImageAsset', 'imageData': image_request.content, # This field is optional, and if provided should be unique. # 'assetName': 'Image asset ' + str(uuid.uuid4()), } # Create the operation. operation = { 'operator': 'ADD', 'operand': image_asset } # Create the asset and return the ID. result = asset_service.mutate([operation]) return result['value'][0]['assetId']
identifier_body
content-object-list.component.spec.ts
import { Observable, of } from 'rxjs'; import { ContentService, FileUrlParameters } from '../shared/content.service'; import { ContentItem } from '../shared/model/content-item'; import { Config, ContentConfig } from '../../core/shared/model/config'; import { ContentObjectListComponent } from './content-object-list.component'; import { ComponentFixture, TestBed } from '@angular/core/testing'; import { Field } from '../../core/shared/model/field'; import { User } from '../../user/shared/user'; import { MatButtonModule } from '@angular/material/button'; import { MatSnackBar } from '@angular/material/snack-bar'; import { MatTooltipModule } from '@angular/material/tooltip'; import { FormBuilder, FormGroup, FormsModule, ReactiveFormsModule } from '@angular/forms'; import { ActivatedRoute } from '@angular/router'; import { UserService } from '../../user/shared/user.service'; import { Title } from '@angular/platform-browser'; import { LiveAnnouncer } from '@angular/cdk/a11y'; import { MaterialConfigModule } from '../../routing/material-config.module'; import { FileUploadComponent } from '../../shared/widgets/file-upload/file-upload.component'; import { TruncatePipe } from '../../shared/pipes/truncate.pipe'; import { ActivatedRouteStub } from '../../../testing/router-stubs'; import { RouterTestingModule } from '@angular/router/testing'; import { ContentPageConfig } from '../../core/shared/model/content-page-config'; import { NoopAnimationsModule } from '@angular/platform-browser/animations'; import { HttpClientModule } from '@angular/common/http'; import { FocusDirective } from '../../shared/directives/focus/focus.directive'; import { FieldOption } from '../../core/shared/model/field/field-option'; import { NotificationService } from '../../shared/providers/notification.service'; import { first } from 'rxjs/operators'; const testFile = new File(['This is a test file'], 'test.pdf', { type: 'application/pdf' }); const testFormData = { metadata: { 1: 'asdf', }, }; class
extends ContentService { constructor() { super(null, null, null); } create(contentItem: ContentItem, file: File): Observable<ContentItem> { return of(contentItem); } getFileUrl({ itemId, webViewable, useOriginalFilename, disposition }: FileUrlParameters): string { return 'testUrl/' + itemId; } } class MockUserService extends UserService { constructor() { super(null, null, null); } getUser(): User { return new User('testUser'); } } describe('ContentObjectList', () => { let mockContentService: ContentService; let mockUserService: MockUserService; let activatedRoute: ActivatedRouteStub; let component: ContentObjectListComponent; let fixture: ComponentFixture<ContentObjectListComponent>; const sourceItem: ContentItem = null; const config = new Config(); config.contentConfig = new ContentConfig(); config.contentConfig.profile = 'testProfile'; const formModel = { metadata: { 1: 'test', }, }; const field = new Field(); field.key = '1'; const fields = new Array<Field>(); fields.push(field); const user = new User('testUser'); beforeEach(() => { activatedRoute = new ActivatedRouteStub(); mockContentService = new MockContentService(); mockUserService = new MockUserService(); TestBed.configureTestingModule({ imports: [ FormsModule, HttpClientModule, MaterialConfigModule, MatButtonModule, MatTooltipModule, ReactiveFormsModule, RouterTestingModule, NoopAnimationsModule, ], providers: [ { provide: ActivatedRoute, useValue: activatedRoute }, { provide: ContentService, useValue: mockContentService }, { provide: UserService, useValue: mockUserService }, Title, FormBuilder, LiveAnnouncer, MatSnackBar, NotificationService, ], declarations: [FileUploadComponent, ContentObjectListComponent, TruncatePipe, FocusDirective], }).compileComponents(); fixture = TestBed.createComponent(ContentObjectListComponent); component = fixture.componentInstance; component.formGroup = new FormGroup({}); component.contentItem = undefined; component.page = undefined; const editPageConfig = new ContentPageConfig(); editPageConfig.pageName = 'test-edit-page'; editPageConfig.fieldsToDisplay = [ Object.assign(new Field(), { key: '1', label: 'First' }), Object.assign(new Field(), { key: '2', label: 'Second' }), Object.assign(new Field(), { key: '3', label: 'Third' }), Object.assign(new Field(), { key: 'a', label: 'a' }), Object.assign(new Field(), { key: 'd', label: 'd', displayType: 'date' }), Object.assign(new Field(), { key: 't', label: 't', displayType: 'autocomplete', options: [new FieldOption('o1'), new FieldOption('o2'), new FieldOption('o3')], }), ]; editPageConfig.viewPanel = false; config.pages['edit'] = editPageConfig; activatedRoute.testData = { config: config }; component.ngOnInit(); fixture.detectChanges(); }); it('should be created', () => { expect(component).toBeTruthy(); }); it('should correctly populate the profileId when preparing to save', () => { const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user); expect(contentItem.metadata['ProfileId']).toBe('testProfile'); }); it('should populate the account when preparing to save', () => { config.contentConfig.account = 'testAccount'; const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user); expect(contentItem.metadata['Account']).toBe('testAccount'); }); it('should populate the account replacing user template when preparing to save', () => { config.contentConfig.account = 'testAccount/${user}'; const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user); expect(contentItem.metadata['Account']).toBe('testAccount/testUser'); }); it('should add the specified metadata overrides when preparing to save', () => { const metadataOverrides = [ { name: 'PublishStatus', value: 'Published' }, { name: 'AnotherOnSave', value: 'Value' }, ]; const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user, metadataOverrides); expect(contentItem.metadata['PublishStatus']).toBe('Published'); expect(contentItem.metadata['AnotherOnSave']).toBe('Value'); }); it('should create a content object with an initialized contentItemUrl', () => { const contentItem = new ContentItem(); contentItem.id = '123'; const index = component.addItem(contentItem); const contentObject = component.contentObjects[index]; component.onDisplayType(contentObject, 'anyvalue'); expect(contentObject.url).toBe('testUrl/123'); }); it('should add a file to the transaction and select the object', () => { const properties = { type: 'application/pdf', }; const file = new File(['This is a test file'], 'test.pdf', properties); const index = component.addFile(file); expect(component.contentObjects.length).toBe(1); component.removeObject(undefined, index); }); it('should replace a file on a persisted content item', () => { const properties = { type: 'application/pdf', }; const item = new ContentItem(); item.id = '123'; item.metadata = new Map<string, string>(); item.metadata.set('MimeType', 'application/pdf'); item.metadata.set('FileSize', '2000'); item.metadata.set('OriginalFileName', 'file123.pdf'); const index = component.addItem(item); const co = component.contentObjects[index]; const file = new File(['This is a test file'], 'test.pdf', properties); component.replace(co, file); expect(component.contentObjects.length).toBe(1); expect(co.file).toBe(file); expect(co.url).toBe('testUrl/123'); component.removeContentObject(index); }); it('should create item on save', () => { const properties = { type: 'application/pdf', }; const file = new File(['This is a test file'], 'test.pdf', properties); component.addFile(file); expect(component.contentObjects.length).toBe(1); const formData = { metadata: { 1: 'asdf', }, }; const metadataOverrides = new Array<any>(); const mockContentServiceCreate = spyOn(mockContentService, 'create'); component.saveItem(fields, formData, metadataOverrides); expect(mockContentServiceCreate).toHaveBeenCalled(); }); /** * Addresses bug CAB-4036: New revision was created sometimes when only metadata was changed */ it('should update item and clear file on save', (done: DoneFn) => { const contentItem = new ContentItem(); const metadataOverrides = new Array<any>(); const mockContentServiceUpdate = spyOn(mockContentService, 'update').and.returnValue(of(contentItem)); // Setup a document update by loading the content item and replacing the file. component.addItem(contentItem); component.replace(component.contentObjects[0], testFile); // Update the document. component.saveItem(fields, testFormData, metadataOverrides); // Subscribe to event when saving is completed (can be done here because 'saveItem' is asynchronous). const subscription = component.saving.pipe(first((val) => !val)).subscribe(() => { subscription.unsubscribe(); // Verify the replaced file is supplied to service. expect(mockContentServiceUpdate).toHaveBeenCalledWith(jasmine.anything(), testFile); // Update document again, verify that file is NOT supplied to service. mockContentServiceUpdate.calls.reset(); component.saveItem(fields, testFormData, metadataOverrides); expect(mockContentServiceUpdate).toHaveBeenCalledWith(jasmine.anything(), null); done(); }); }); it('should emit saving event on save', () => { const formData = { metadata: { 1: 'asdf', }, }; const metadataOverrides = new Array<any>(); spyOn(component.saving, 'emit'); component.saveItem(fields, formData, metadataOverrides); expect(component.saving.emit).toHaveBeenCalledWith(true); }); });
MockContentService
identifier_name
content-object-list.component.spec.ts
import { Observable, of } from 'rxjs'; import { ContentService, FileUrlParameters } from '../shared/content.service'; import { ContentItem } from '../shared/model/content-item'; import { Config, ContentConfig } from '../../core/shared/model/config'; import { ContentObjectListComponent } from './content-object-list.component'; import { ComponentFixture, TestBed } from '@angular/core/testing'; import { Field } from '../../core/shared/model/field'; import { User } from '../../user/shared/user'; import { MatButtonModule } from '@angular/material/button'; import { MatSnackBar } from '@angular/material/snack-bar'; import { MatTooltipModule } from '@angular/material/tooltip'; import { FormBuilder, FormGroup, FormsModule, ReactiveFormsModule } from '@angular/forms'; import { ActivatedRoute } from '@angular/router'; import { UserService } from '../../user/shared/user.service'; import { Title } from '@angular/platform-browser'; import { LiveAnnouncer } from '@angular/cdk/a11y'; import { MaterialConfigModule } from '../../routing/material-config.module'; import { FileUploadComponent } from '../../shared/widgets/file-upload/file-upload.component'; import { TruncatePipe } from '../../shared/pipes/truncate.pipe'; import { ActivatedRouteStub } from '../../../testing/router-stubs'; import { RouterTestingModule } from '@angular/router/testing'; import { ContentPageConfig } from '../../core/shared/model/content-page-config'; import { NoopAnimationsModule } from '@angular/platform-browser/animations'; import { HttpClientModule } from '@angular/common/http'; import { FocusDirective } from '../../shared/directives/focus/focus.directive'; import { FieldOption } from '../../core/shared/model/field/field-option'; import { NotificationService } from '../../shared/providers/notification.service'; import { first } from 'rxjs/operators'; const testFile = new File(['This is a test file'], 'test.pdf', { type: 'application/pdf' }); const testFormData = { metadata: { 1: 'asdf', }, }; class MockContentService extends ContentService { constructor() { super(null, null, null); } create(contentItem: ContentItem, file: File): Observable<ContentItem> { return of(contentItem); }
} class MockUserService extends UserService { constructor() { super(null, null, null); } getUser(): User { return new User('testUser'); } } describe('ContentObjectList', () => { let mockContentService: ContentService; let mockUserService: MockUserService; let activatedRoute: ActivatedRouteStub; let component: ContentObjectListComponent; let fixture: ComponentFixture<ContentObjectListComponent>; const sourceItem: ContentItem = null; const config = new Config(); config.contentConfig = new ContentConfig(); config.contentConfig.profile = 'testProfile'; const formModel = { metadata: { 1: 'test', }, }; const field = new Field(); field.key = '1'; const fields = new Array<Field>(); fields.push(field); const user = new User('testUser'); beforeEach(() => { activatedRoute = new ActivatedRouteStub(); mockContentService = new MockContentService(); mockUserService = new MockUserService(); TestBed.configureTestingModule({ imports: [ FormsModule, HttpClientModule, MaterialConfigModule, MatButtonModule, MatTooltipModule, ReactiveFormsModule, RouterTestingModule, NoopAnimationsModule, ], providers: [ { provide: ActivatedRoute, useValue: activatedRoute }, { provide: ContentService, useValue: mockContentService }, { provide: UserService, useValue: mockUserService }, Title, FormBuilder, LiveAnnouncer, MatSnackBar, NotificationService, ], declarations: [FileUploadComponent, ContentObjectListComponent, TruncatePipe, FocusDirective], }).compileComponents(); fixture = TestBed.createComponent(ContentObjectListComponent); component = fixture.componentInstance; component.formGroup = new FormGroup({}); component.contentItem = undefined; component.page = undefined; const editPageConfig = new ContentPageConfig(); editPageConfig.pageName = 'test-edit-page'; editPageConfig.fieldsToDisplay = [ Object.assign(new Field(), { key: '1', label: 'First' }), Object.assign(new Field(), { key: '2', label: 'Second' }), Object.assign(new Field(), { key: '3', label: 'Third' }), Object.assign(new Field(), { key: 'a', label: 'a' }), Object.assign(new Field(), { key: 'd', label: 'd', displayType: 'date' }), Object.assign(new Field(), { key: 't', label: 't', displayType: 'autocomplete', options: [new FieldOption('o1'), new FieldOption('o2'), new FieldOption('o3')], }), ]; editPageConfig.viewPanel = false; config.pages['edit'] = editPageConfig; activatedRoute.testData = { config: config }; component.ngOnInit(); fixture.detectChanges(); }); it('should be created', () => { expect(component).toBeTruthy(); }); it('should correctly populate the profileId when preparing to save', () => { const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user); expect(contentItem.metadata['ProfileId']).toBe('testProfile'); }); it('should populate the account when preparing to save', () => { config.contentConfig.account = 'testAccount'; const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user); expect(contentItem.metadata['Account']).toBe('testAccount'); }); it('should populate the account replacing user template when preparing to save', () => { config.contentConfig.account = 'testAccount/${user}'; const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user); expect(contentItem.metadata['Account']).toBe('testAccount/testUser'); }); it('should add the specified metadata overrides when preparing to save', () => { const metadataOverrides = [ { name: 'PublishStatus', value: 'Published' }, { name: 'AnotherOnSave', value: 'Value' }, ]; const contentItem = component.prepareItem(sourceItem, fields, formModel, config, user, metadataOverrides); expect(contentItem.metadata['PublishStatus']).toBe('Published'); expect(contentItem.metadata['AnotherOnSave']).toBe('Value'); }); it('should create a content object with an initialized contentItemUrl', () => { const contentItem = new ContentItem(); contentItem.id = '123'; const index = component.addItem(contentItem); const contentObject = component.contentObjects[index]; component.onDisplayType(contentObject, 'anyvalue'); expect(contentObject.url).toBe('testUrl/123'); }); it('should add a file to the transaction and select the object', () => { const properties = { type: 'application/pdf', }; const file = new File(['This is a test file'], 'test.pdf', properties); const index = component.addFile(file); expect(component.contentObjects.length).toBe(1); component.removeObject(undefined, index); }); it('should replace a file on a persisted content item', () => { const properties = { type: 'application/pdf', }; const item = new ContentItem(); item.id = '123'; item.metadata = new Map<string, string>(); item.metadata.set('MimeType', 'application/pdf'); item.metadata.set('FileSize', '2000'); item.metadata.set('OriginalFileName', 'file123.pdf'); const index = component.addItem(item); const co = component.contentObjects[index]; const file = new File(['This is a test file'], 'test.pdf', properties); component.replace(co, file); expect(component.contentObjects.length).toBe(1); expect(co.file).toBe(file); expect(co.url).toBe('testUrl/123'); component.removeContentObject(index); }); it('should create item on save', () => { const properties = { type: 'application/pdf', }; const file = new File(['This is a test file'], 'test.pdf', properties); component.addFile(file); expect(component.contentObjects.length).toBe(1); const formData = { metadata: { 1: 'asdf', }, }; const metadataOverrides = new Array<any>(); const mockContentServiceCreate = spyOn(mockContentService, 'create'); component.saveItem(fields, formData, metadataOverrides); expect(mockContentServiceCreate).toHaveBeenCalled(); }); /** * Addresses bug CAB-4036: New revision was created sometimes when only metadata was changed */ it('should update item and clear file on save', (done: DoneFn) => { const contentItem = new ContentItem(); const metadataOverrides = new Array<any>(); const mockContentServiceUpdate = spyOn(mockContentService, 'update').and.returnValue(of(contentItem)); // Setup a document update by loading the content item and replacing the file. component.addItem(contentItem); component.replace(component.contentObjects[0], testFile); // Update the document. component.saveItem(fields, testFormData, metadataOverrides); // Subscribe to event when saving is completed (can be done here because 'saveItem' is asynchronous). const subscription = component.saving.pipe(first((val) => !val)).subscribe(() => { subscription.unsubscribe(); // Verify the replaced file is supplied to service. expect(mockContentServiceUpdate).toHaveBeenCalledWith(jasmine.anything(), testFile); // Update document again, verify that file is NOT supplied to service. mockContentServiceUpdate.calls.reset(); component.saveItem(fields, testFormData, metadataOverrides); expect(mockContentServiceUpdate).toHaveBeenCalledWith(jasmine.anything(), null); done(); }); }); it('should emit saving event on save', () => { const formData = { metadata: { 1: 'asdf', }, }; const metadataOverrides = new Array<any>(); spyOn(component.saving, 'emit'); component.saveItem(fields, formData, metadataOverrides); expect(component.saving.emit).toHaveBeenCalledWith(true); }); });
getFileUrl({ itemId, webViewable, useOriginalFilename, disposition }: FileUrlParameters): string { return 'testUrl/' + itemId; }
random_line_split
sim.worker.jetstream.js
/* 6 sectors * 512 lines * 60 vertices, t=threads, m=stamps jetstream t: 1 m: 10 ms: 15651 jetstream t: 2 m: 10 ms: 9348 jetstream t: 3 m: 10 ms: 8583 jetstream t: 4 m: 10 ms: 7969 jetstream t: 5 m: 10 ms: 7891 jetstream t: 6 m: 10 ms: 8037 jetstream t: 7 m: 10 ms: 7981 jetstream t: 8 m: 10 ms: 8594 jetstream t: 9 m: 10 ms: 9060 jetstream t: 10 m: 10 ms: 8797 */ if( typeof importScripts === 'function') { const PI = Math.PI, TAU = 2 * PI, PI2 = PI / 2, RADIUS = 1.0, DEGRAD = PI / 180.0 ; var name = 'jet.worker', cfg, topics, doe, pool, datagrams = { ugrdprs: null, vgrdprs: null }, prelines = null, // pos, wid, col per sector multilines = null, // lines per sector sectors = null // with attributes per sector ; function vec3toLat (v, radius) {return 90 - (Math.acos(v.y / radius)) * 180 / PI;} function vec3toLon (v, radius) {return ((270 + (Math.atan2(v.x , v.z)) * 180 / PI) % 360);} function vector3ToLatLong (v, radius) { return { lat: 90 - (Math.acos(v.y / radius)) * 180 / Math.PI, lon: ((270 + (Math.atan2(v.x , v.z)) * 180 / Math.PI) % 360) }; } function latLonRadToVector3 (lat, lon, radius) { var phi = lat * Math.PI / 180; var theta = (lon - 180) * Math.PI / 180; var x = -radius * Math.cos(phi) * Math.cos(theta); var y = radius * Math.sin(phi); var z = radius * Math.cos(phi) * Math.sin(theta); return new Vector3(x, y, z); } function filterPool (sector, amount) { var i, j = 0, coord, out = [], len = pool.length; for (i=0; j<amount && i<len; i++) { coord = pool[i]; if ( coord.lat < sector[0] && coord.lon > sector[1] && coord.lat > sector[2] && coord.lon < sector[3] ) { out.push(coord); j += 1; } } return out; } function onmessage (event) { var id = event.data.id, topic = event.data.topic, payload = event.data.payload, callback = function (id, result, transferables) { postMessage({id, result}, transferables); } ; if (topics[topic]) { topics[topic](id, payload, callback); } else { console.warn(name + ': unknown topic', topic); } } topics = { importScripts: function (id, payload, callback) { importScripts.apply(null, payload.scripts); callback(id, null); }, retrieve: function (id, payload, callback) { var datagramm; cfg = payload.cfg; doe = payload.doe; pool = payload.pool; RES.load({ urls: payload.urls, onFinish: function (err, responses) { if (err) { throw err } else { responses.forEach(function (response) { datagramm = new SIM.Datagram(response.data); datagrams[datagramm.vari] = datagramm; }); topics.prepare(id, payload, function () { topics.process(id, payload, function () { topics.combine(id, payload, function (id, result, transferables) { callback(id, result, transferables) }); }); }); } }}); }, prepare: function (id, payload, callback) { var t0 = Date.now(), i, j, u, v, speed, width, pool, lat, lon, color, vec3, seeds, positions, widths, colors, seeds, sat = 0.4, spcl = new Spherical(), length = cfg.length, amount = NaN, filler = () => [], counter = (a, b) => a + b.positions.length ; // over sectors prelines = cfg.sim.sectors.map( sector => { seeds = []; pool = filterPool(sector, cfg.amount); amount = pool.length; positions = new Array(amount).fill(0).map(filler); colors = new Array(amount).fill(0).map(filler); widths = new Array(amount).fill(0).map(filler); // over lines for (i=0; i<amount; i++) { lat = pool[i].lat; lon = pool[i].lon; vec3 = latLonRadToVector3(lat, lon, cfg.radius); // keep start point seeds.push(vec3.x, vec3.y, vec3.z); // over vertices for (j=0; j<length; j++) { u = datagrams.ugrdprs.linearXY(doe, lat, lon); v = datagrams.vgrdprs.linearXY(doe, lat, lon); speed = Math.hypot(u, v); u /= Math.cos(lat * DEGRAD); color = new Color().setHSL(cfg.hue, sat, speed / 100); width = H.clampScale(speed, 0, 50, 0.5, 2.0);
widths[i].push(width); spcl.setFromVector3(vec3); spcl.theta += u * cfg.factor; // east-direction spcl.phi -= v * cfg.factor; // north-direction vec3 = vec3.setFromSpherical(spcl).clone(); lat = vec3toLat(vec3, cfg.radius); lon = vec3toLon(vec3, cfg.radius); } } return { seeds: new Float32Array(seeds), positions, colors, widths }; }); // debugger; // console.log(name + ': prepare', id, Date.now() - t0, prelines.reduce(counter, 0)); callback(id, {}, []) }, process: function (id, payload, callback) { var t0 = Date.now(), counter = (a, b) => a + b.length ; multilines = prelines.map(preline => { var idx = 0, multiline = H.zip( preline.positions, preline.colors, preline.widths, (vectors, colors, widths) => new Multiline(idx++, vectors, colors, widths) ) ; multiline.seeds = preline.seeds; return multiline; }); // debugger; // console.log(name + ': process', id, Date.now() - t0, multilines.reduce(counter, 0)); callback(id, {}, []); }, combine: function (id, payload, callback) { var transferables, attributeTypes = { colors: Float32Array, index: Uint16Array, lineIndex: Float32Array, next: Float32Array, position: Float32Array, previous: Float32Array, side: Float32Array, width: Float32Array, }, textures = { u: datagrams.ugrdprs.data[doe], v: datagrams.vgrdprs.data[doe], } ; // debugger; // over sectors (n=6) sectors = multilines.map( lines => { var length, attributes = {}, uniforms = { seeds: lines.seeds } ; delete lines.seeds; // prepare attributes H.each(attributeTypes, (name, type) => { length = lines[0].attributes[name].length * lines.length; attributes[name] = new type(length); }); // over attributes (n=8) H.each(attributeTypes, (name) => { // debugger; // if (name === 'seeds') { return; } var i, source, length, pointer = 0, indexOffset = 0, positLength = lines[0].attributes['position'].length / 3, target = attributes[name] ; // over lines (n=512) H.each(lines, (_, line) => { source = line.attributes[name]; length = source.length; if (name === 'index'){ for (i=0; i<length; i++) { target[pointer + i] = source[i] + indexOffset; } } else if (name !== 'seeds') { for (i=0; i<length; i++) { target[pointer + i] = source[i]; } } pointer += length; indexOffset += positLength; }); }); return { attributes, uniforms }; }); // finish transferables transferables = [textures.u.buffer, textures.v.buffer]; H.each(sectors, (_, sector) => { transferables.push(sector.uniforms.seeds.buffer); H.each(attributeTypes, (name) => { transferables.push(sector.attributes[name].buffer); }); }); // TODO: check edge + transferable callback(id, {sectors, textures}, transferables); } }; } function Multiline ( idx, vertices, colors, widths ) { this.idx = idx; this.index = []; this.lineIndex = []; this.next = []; this.positions = []; this.previous = []; this.side = []; this.widths = []; this.colors = []; this.length = vertices.length; this.init(vertices, colors, widths); this.process(); // TODO: Needed? ~15% faster this.attributes = { index: new Uint16Array( this.index ), lineIndex: new Float32Array( this.lineIndex ), next: new Float32Array( this.next ), position: new Float32Array( this.positions ), previous: new Float32Array( this.previous ), side: new Float32Array( this.side ), width: new Float32Array( this.widths ), colors: new Float32Array( this.colors ), } }; Multiline.prototype = { constructor: Multiline, compareV3: function( a, b ) { var aa = a * 6, ab = b * 6; return ( ( this.positions[ aa ] === this.positions[ ab ] ) && ( this.positions[ aa + 1 ] === this.positions[ ab + 1 ] ) && ( this.positions[ aa + 2 ] === this.positions[ ab + 2 ] ) ); }, copyV3: function( a ) { var aa = a * 6; return [ this.positions[ aa ], this.positions[ aa + 1 ], this.positions[ aa + 2 ] ]; }, init: function( vertices, colors, widths ) { var j, ver, cnt, col, wid, n, len = this.length; for( j = 0; j < len; j++ ) { ver = vertices[ j ]; col = colors[ j ]; wid = widths[ j ]; cnt = j / vertices.length; this.positions.push( ver.x, ver.y, ver.z ); this.positions.push( ver.x, ver.y, ver.z ); this.lineIndex.push(this.idx + cnt); this.lineIndex.push(this.idx + cnt); this.colors.push(col.r, col.g, col.b); this.colors.push(col.r, col.g, col.b); this.widths.push(wid); this.widths.push(wid); this.side.push( 1 ); this.side.push( -1 ); } for( j = 0; j < len - 1; j++ ) { n = j + j; this.index.push( n, n + 1, n + 2 ); this.index.push( n + 2, n + 1, n + 3 ); } }, process: function() { var j, v, l = this.positions.length / 6; v = this.compareV3( 0, l - 1 ) ? this.copyV3( l - 2 ) : this.copyV3( 0 ) ; this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); for( j = 0; j < l - 1; j++ ) { v = this.copyV3( j ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } for( j = 1; j < l; j++ ) { v = this.copyV3( j ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } v = this.compareV3( l - 1, 0 ) ? this.copyV3( 1 ) : this.copyV3( l - 1 ) ; this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } };
positions[i].push(vec3); colors[i].push(color);
random_line_split
sim.worker.jetstream.js
/* 6 sectors * 512 lines * 60 vertices, t=threads, m=stamps jetstream t: 1 m: 10 ms: 15651 jetstream t: 2 m: 10 ms: 9348 jetstream t: 3 m: 10 ms: 8583 jetstream t: 4 m: 10 ms: 7969 jetstream t: 5 m: 10 ms: 7891 jetstream t: 6 m: 10 ms: 8037 jetstream t: 7 m: 10 ms: 7981 jetstream t: 8 m: 10 ms: 8594 jetstream t: 9 m: 10 ms: 9060 jetstream t: 10 m: 10 ms: 8797 */ if( typeof importScripts === 'function') { const PI = Math.PI, TAU = 2 * PI, PI2 = PI / 2, RADIUS = 1.0, DEGRAD = PI / 180.0 ; var name = 'jet.worker', cfg, topics, doe, pool, datagrams = { ugrdprs: null, vgrdprs: null }, prelines = null, // pos, wid, col per sector multilines = null, // lines per sector sectors = null // with attributes per sector ; function vec3toLat (v, radius) {return 90 - (Math.acos(v.y / radius)) * 180 / PI;} function vec3toLon (v, radius) {return ((270 + (Math.atan2(v.x , v.z)) * 180 / PI) % 360);} function vector3ToLatLong (v, radius) { return { lat: 90 - (Math.acos(v.y / radius)) * 180 / Math.PI, lon: ((270 + (Math.atan2(v.x , v.z)) * 180 / Math.PI) % 360) }; } function latLonRadToVector3 (lat, lon, radius) { var phi = lat * Math.PI / 180; var theta = (lon - 180) * Math.PI / 180; var x = -radius * Math.cos(phi) * Math.cos(theta); var y = radius * Math.sin(phi); var z = radius * Math.cos(phi) * Math.sin(theta); return new Vector3(x, y, z); } function filterPool (sector, amount) { var i, j = 0, coord, out = [], len = pool.length; for (i=0; j<amount && i<len; i++) { coord = pool[i]; if ( coord.lat < sector[0] && coord.lon > sector[1] && coord.lat > sector[2] && coord.lon < sector[3] ) { out.push(coord); j += 1; } } return out; } function onmessage (event) { var id = event.data.id, topic = event.data.topic, payload = event.data.payload, callback = function (id, result, transferables) { postMessage({id, result}, transferables); } ; if (topics[topic]) { topics[topic](id, payload, callback); } else { console.warn(name + ': unknown topic', topic); } } topics = { importScripts: function (id, payload, callback) { importScripts.apply(null, payload.scripts); callback(id, null); }, retrieve: function (id, payload, callback) { var datagramm; cfg = payload.cfg; doe = payload.doe; pool = payload.pool; RES.load({ urls: payload.urls, onFinish: function (err, responses) { if (err) { throw err } else { responses.forEach(function (response) { datagramm = new SIM.Datagram(response.data); datagrams[datagramm.vari] = datagramm; }); topics.prepare(id, payload, function () { topics.process(id, payload, function () { topics.combine(id, payload, function (id, result, transferables) { callback(id, result, transferables) }); }); }); } }}); }, prepare: function (id, payload, callback) { var t0 = Date.now(), i, j, u, v, speed, width, pool, lat, lon, color, vec3, seeds, positions, widths, colors, seeds, sat = 0.4, spcl = new Spherical(), length = cfg.length, amount = NaN, filler = () => [], counter = (a, b) => a + b.positions.length ; // over sectors prelines = cfg.sim.sectors.map( sector => { seeds = []; pool = filterPool(sector, cfg.amount); amount = pool.length; positions = new Array(amount).fill(0).map(filler); colors = new Array(amount).fill(0).map(filler); widths = new Array(amount).fill(0).map(filler); // over lines for (i=0; i<amount; i++)
return { seeds: new Float32Array(seeds), positions, colors, widths }; }); // debugger; // console.log(name + ': prepare', id, Date.now() - t0, prelines.reduce(counter, 0)); callback(id, {}, []) }, process: function (id, payload, callback) { var t0 = Date.now(), counter = (a, b) => a + b.length ; multilines = prelines.map(preline => { var idx = 0, multiline = H.zip( preline.positions, preline.colors, preline.widths, (vectors, colors, widths) => new Multiline(idx++, vectors, colors, widths) ) ; multiline.seeds = preline.seeds; return multiline; }); // debugger; // console.log(name + ': process', id, Date.now() - t0, multilines.reduce(counter, 0)); callback(id, {}, []); }, combine: function (id, payload, callback) { var transferables, attributeTypes = { colors: Float32Array, index: Uint16Array, lineIndex: Float32Array, next: Float32Array, position: Float32Array, previous: Float32Array, side: Float32Array, width: Float32Array, }, textures = { u: datagrams.ugrdprs.data[doe], v: datagrams.vgrdprs.data[doe], } ; // debugger; // over sectors (n=6) sectors = multilines.map( lines => { var length, attributes = {}, uniforms = { seeds: lines.seeds } ; delete lines.seeds; // prepare attributes H.each(attributeTypes, (name, type) => { length = lines[0].attributes[name].length * lines.length; attributes[name] = new type(length); }); // over attributes (n=8) H.each(attributeTypes, (name) => { // debugger; // if (name === 'seeds') { return; } var i, source, length, pointer = 0, indexOffset = 0, positLength = lines[0].attributes['position'].length / 3, target = attributes[name] ; // over lines (n=512) H.each(lines, (_, line) => { source = line.attributes[name]; length = source.length; if (name === 'index'){ for (i=0; i<length; i++) { target[pointer + i] = source[i] + indexOffset; } } else if (name !== 'seeds') { for (i=0; i<length; i++) { target[pointer + i] = source[i]; } } pointer += length; indexOffset += positLength; }); }); return { attributes, uniforms }; }); // finish transferables transferables = [textures.u.buffer, textures.v.buffer]; H.each(sectors, (_, sector) => { transferables.push(sector.uniforms.seeds.buffer); H.each(attributeTypes, (name) => { transferables.push(sector.attributes[name].buffer); }); }); // TODO: check edge + transferable callback(id, {sectors, textures}, transferables); } }; } function Multiline ( idx, vertices, colors, widths ) { this.idx = idx; this.index = []; this.lineIndex = []; this.next = []; this.positions = []; this.previous = []; this.side = []; this.widths = []; this.colors = []; this.length = vertices.length; this.init(vertices, colors, widths); this.process(); // TODO: Needed? ~15% faster this.attributes = { index: new Uint16Array( this.index ), lineIndex: new Float32Array( this.lineIndex ), next: new Float32Array( this.next ), position: new Float32Array( this.positions ), previous: new Float32Array( this.previous ), side: new Float32Array( this.side ), width: new Float32Array( this.widths ), colors: new Float32Array( this.colors ), } }; Multiline.prototype = { constructor: Multiline, compareV3: function( a, b ) { var aa = a * 6, ab = b * 6; return ( ( this.positions[ aa ] === this.positions[ ab ] ) && ( this.positions[ aa + 1 ] === this.positions[ ab + 1 ] ) && ( this.positions[ aa + 2 ] === this.positions[ ab + 2 ] ) ); }, copyV3: function( a ) { var aa = a * 6; return [ this.positions[ aa ], this.positions[ aa + 1 ], this.positions[ aa + 2 ] ]; }, init: function( vertices, colors, widths ) { var j, ver, cnt, col, wid, n, len = this.length; for( j = 0; j < len; j++ ) { ver = vertices[ j ]; col = colors[ j ]; wid = widths[ j ]; cnt = j / vertices.length; this.positions.push( ver.x, ver.y, ver.z ); this.positions.push( ver.x, ver.y, ver.z ); this.lineIndex.push(this.idx + cnt); this.lineIndex.push(this.idx + cnt); this.colors.push(col.r, col.g, col.b); this.colors.push(col.r, col.g, col.b); this.widths.push(wid); this.widths.push(wid); this.side.push( 1 ); this.side.push( -1 ); } for( j = 0; j < len - 1; j++ ) { n = j + j; this.index.push( n, n + 1, n + 2 ); this.index.push( n + 2, n + 1, n + 3 ); } }, process: function() { var j, v, l = this.positions.length / 6; v = this.compareV3( 0, l - 1 ) ? this.copyV3( l - 2 ) : this.copyV3( 0 ) ; this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); for( j = 0; j < l - 1; j++ ) { v = this.copyV3( j ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } for( j = 1; j < l; j++ ) { v = this.copyV3( j ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } v = this.compareV3( l - 1, 0 ) ? this.copyV3( 1 ) : this.copyV3( l - 1 ) ; this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } };
{ lat = pool[i].lat; lon = pool[i].lon; vec3 = latLonRadToVector3(lat, lon, cfg.radius); // keep start point seeds.push(vec3.x, vec3.y, vec3.z); // over vertices for (j=0; j<length; j++) { u = datagrams.ugrdprs.linearXY(doe, lat, lon); v = datagrams.vgrdprs.linearXY(doe, lat, lon); speed = Math.hypot(u, v); u /= Math.cos(lat * DEGRAD); color = new Color().setHSL(cfg.hue, sat, speed / 100); width = H.clampScale(speed, 0, 50, 0.5, 2.0); positions[i].push(vec3); colors[i].push(color); widths[i].push(width); spcl.setFromVector3(vec3); spcl.theta += u * cfg.factor; // east-direction spcl.phi -= v * cfg.factor; // north-direction vec3 = vec3.setFromSpherical(spcl).clone(); lat = vec3toLat(vec3, cfg.radius); lon = vec3toLon(vec3, cfg.radius); } }
conditional_block
sim.worker.jetstream.js
/* 6 sectors * 512 lines * 60 vertices, t=threads, m=stamps jetstream t: 1 m: 10 ms: 15651 jetstream t: 2 m: 10 ms: 9348 jetstream t: 3 m: 10 ms: 8583 jetstream t: 4 m: 10 ms: 7969 jetstream t: 5 m: 10 ms: 7891 jetstream t: 6 m: 10 ms: 8037 jetstream t: 7 m: 10 ms: 7981 jetstream t: 8 m: 10 ms: 8594 jetstream t: 9 m: 10 ms: 9060 jetstream t: 10 m: 10 ms: 8797 */ if( typeof importScripts === 'function') { const PI = Math.PI, TAU = 2 * PI, PI2 = PI / 2, RADIUS = 1.0, DEGRAD = PI / 180.0 ; var name = 'jet.worker', cfg, topics, doe, pool, datagrams = { ugrdprs: null, vgrdprs: null }, prelines = null, // pos, wid, col per sector multilines = null, // lines per sector sectors = null // with attributes per sector ; function vec3toLat (v, radius) {return 90 - (Math.acos(v.y / radius)) * 180 / PI;} function vec3toLon (v, radius) {return ((270 + (Math.atan2(v.x , v.z)) * 180 / PI) % 360);} function vector3ToLatLong (v, radius) { return { lat: 90 - (Math.acos(v.y / radius)) * 180 / Math.PI, lon: ((270 + (Math.atan2(v.x , v.z)) * 180 / Math.PI) % 360) }; } function latLonRadToVector3 (lat, lon, radius) { var phi = lat * Math.PI / 180; var theta = (lon - 180) * Math.PI / 180; var x = -radius * Math.cos(phi) * Math.cos(theta); var y = radius * Math.sin(phi); var z = radius * Math.cos(phi) * Math.sin(theta); return new Vector3(x, y, z); } function
(sector, amount) { var i, j = 0, coord, out = [], len = pool.length; for (i=0; j<amount && i<len; i++) { coord = pool[i]; if ( coord.lat < sector[0] && coord.lon > sector[1] && coord.lat > sector[2] && coord.lon < sector[3] ) { out.push(coord); j += 1; } } return out; } function onmessage (event) { var id = event.data.id, topic = event.data.topic, payload = event.data.payload, callback = function (id, result, transferables) { postMessage({id, result}, transferables); } ; if (topics[topic]) { topics[topic](id, payload, callback); } else { console.warn(name + ': unknown topic', topic); } } topics = { importScripts: function (id, payload, callback) { importScripts.apply(null, payload.scripts); callback(id, null); }, retrieve: function (id, payload, callback) { var datagramm; cfg = payload.cfg; doe = payload.doe; pool = payload.pool; RES.load({ urls: payload.urls, onFinish: function (err, responses) { if (err) { throw err } else { responses.forEach(function (response) { datagramm = new SIM.Datagram(response.data); datagrams[datagramm.vari] = datagramm; }); topics.prepare(id, payload, function () { topics.process(id, payload, function () { topics.combine(id, payload, function (id, result, transferables) { callback(id, result, transferables) }); }); }); } }}); }, prepare: function (id, payload, callback) { var t0 = Date.now(), i, j, u, v, speed, width, pool, lat, lon, color, vec3, seeds, positions, widths, colors, seeds, sat = 0.4, spcl = new Spherical(), length = cfg.length, amount = NaN, filler = () => [], counter = (a, b) => a + b.positions.length ; // over sectors prelines = cfg.sim.sectors.map( sector => { seeds = []; pool = filterPool(sector, cfg.amount); amount = pool.length; positions = new Array(amount).fill(0).map(filler); colors = new Array(amount).fill(0).map(filler); widths = new Array(amount).fill(0).map(filler); // over lines for (i=0; i<amount; i++) { lat = pool[i].lat; lon = pool[i].lon; vec3 = latLonRadToVector3(lat, lon, cfg.radius); // keep start point seeds.push(vec3.x, vec3.y, vec3.z); // over vertices for (j=0; j<length; j++) { u = datagrams.ugrdprs.linearXY(doe, lat, lon); v = datagrams.vgrdprs.linearXY(doe, lat, lon); speed = Math.hypot(u, v); u /= Math.cos(lat * DEGRAD); color = new Color().setHSL(cfg.hue, sat, speed / 100); width = H.clampScale(speed, 0, 50, 0.5, 2.0); positions[i].push(vec3); colors[i].push(color); widths[i].push(width); spcl.setFromVector3(vec3); spcl.theta += u * cfg.factor; // east-direction spcl.phi -= v * cfg.factor; // north-direction vec3 = vec3.setFromSpherical(spcl).clone(); lat = vec3toLat(vec3, cfg.radius); lon = vec3toLon(vec3, cfg.radius); } } return { seeds: new Float32Array(seeds), positions, colors, widths }; }); // debugger; // console.log(name + ': prepare', id, Date.now() - t0, prelines.reduce(counter, 0)); callback(id, {}, []) }, process: function (id, payload, callback) { var t0 = Date.now(), counter = (a, b) => a + b.length ; multilines = prelines.map(preline => { var idx = 0, multiline = H.zip( preline.positions, preline.colors, preline.widths, (vectors, colors, widths) => new Multiline(idx++, vectors, colors, widths) ) ; multiline.seeds = preline.seeds; return multiline; }); // debugger; // console.log(name + ': process', id, Date.now() - t0, multilines.reduce(counter, 0)); callback(id, {}, []); }, combine: function (id, payload, callback) { var transferables, attributeTypes = { colors: Float32Array, index: Uint16Array, lineIndex: Float32Array, next: Float32Array, position: Float32Array, previous: Float32Array, side: Float32Array, width: Float32Array, }, textures = { u: datagrams.ugrdprs.data[doe], v: datagrams.vgrdprs.data[doe], } ; // debugger; // over sectors (n=6) sectors = multilines.map( lines => { var length, attributes = {}, uniforms = { seeds: lines.seeds } ; delete lines.seeds; // prepare attributes H.each(attributeTypes, (name, type) => { length = lines[0].attributes[name].length * lines.length; attributes[name] = new type(length); }); // over attributes (n=8) H.each(attributeTypes, (name) => { // debugger; // if (name === 'seeds') { return; } var i, source, length, pointer = 0, indexOffset = 0, positLength = lines[0].attributes['position'].length / 3, target = attributes[name] ; // over lines (n=512) H.each(lines, (_, line) => { source = line.attributes[name]; length = source.length; if (name === 'index'){ for (i=0; i<length; i++) { target[pointer + i] = source[i] + indexOffset; } } else if (name !== 'seeds') { for (i=0; i<length; i++) { target[pointer + i] = source[i]; } } pointer += length; indexOffset += positLength; }); }); return { attributes, uniforms }; }); // finish transferables transferables = [textures.u.buffer, textures.v.buffer]; H.each(sectors, (_, sector) => { transferables.push(sector.uniforms.seeds.buffer); H.each(attributeTypes, (name) => { transferables.push(sector.attributes[name].buffer); }); }); // TODO: check edge + transferable callback(id, {sectors, textures}, transferables); } }; } function Multiline ( idx, vertices, colors, widths ) { this.idx = idx; this.index = []; this.lineIndex = []; this.next = []; this.positions = []; this.previous = []; this.side = []; this.widths = []; this.colors = []; this.length = vertices.length; this.init(vertices, colors, widths); this.process(); // TODO: Needed? ~15% faster this.attributes = { index: new Uint16Array( this.index ), lineIndex: new Float32Array( this.lineIndex ), next: new Float32Array( this.next ), position: new Float32Array( this.positions ), previous: new Float32Array( this.previous ), side: new Float32Array( this.side ), width: new Float32Array( this.widths ), colors: new Float32Array( this.colors ), } }; Multiline.prototype = { constructor: Multiline, compareV3: function( a, b ) { var aa = a * 6, ab = b * 6; return ( ( this.positions[ aa ] === this.positions[ ab ] ) && ( this.positions[ aa + 1 ] === this.positions[ ab + 1 ] ) && ( this.positions[ aa + 2 ] === this.positions[ ab + 2 ] ) ); }, copyV3: function( a ) { var aa = a * 6; return [ this.positions[ aa ], this.positions[ aa + 1 ], this.positions[ aa + 2 ] ]; }, init: function( vertices, colors, widths ) { var j, ver, cnt, col, wid, n, len = this.length; for( j = 0; j < len; j++ ) { ver = vertices[ j ]; col = colors[ j ]; wid = widths[ j ]; cnt = j / vertices.length; this.positions.push( ver.x, ver.y, ver.z ); this.positions.push( ver.x, ver.y, ver.z ); this.lineIndex.push(this.idx + cnt); this.lineIndex.push(this.idx + cnt); this.colors.push(col.r, col.g, col.b); this.colors.push(col.r, col.g, col.b); this.widths.push(wid); this.widths.push(wid); this.side.push( 1 ); this.side.push( -1 ); } for( j = 0; j < len - 1; j++ ) { n = j + j; this.index.push( n, n + 1, n + 2 ); this.index.push( n + 2, n + 1, n + 3 ); } }, process: function() { var j, v, l = this.positions.length / 6; v = this.compareV3( 0, l - 1 ) ? this.copyV3( l - 2 ) : this.copyV3( 0 ) ; this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); for( j = 0; j < l - 1; j++ ) { v = this.copyV3( j ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } for( j = 1; j < l; j++ ) { v = this.copyV3( j ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } v = this.compareV3( l - 1, 0 ) ? this.copyV3( 1 ) : this.copyV3( l - 1 ) ; this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } };
filterPool
identifier_name
sim.worker.jetstream.js
/* 6 sectors * 512 lines * 60 vertices, t=threads, m=stamps jetstream t: 1 m: 10 ms: 15651 jetstream t: 2 m: 10 ms: 9348 jetstream t: 3 m: 10 ms: 8583 jetstream t: 4 m: 10 ms: 7969 jetstream t: 5 m: 10 ms: 7891 jetstream t: 6 m: 10 ms: 8037 jetstream t: 7 m: 10 ms: 7981 jetstream t: 8 m: 10 ms: 8594 jetstream t: 9 m: 10 ms: 9060 jetstream t: 10 m: 10 ms: 8797 */ if( typeof importScripts === 'function') { const PI = Math.PI, TAU = 2 * PI, PI2 = PI / 2, RADIUS = 1.0, DEGRAD = PI / 180.0 ; var name = 'jet.worker', cfg, topics, doe, pool, datagrams = { ugrdprs: null, vgrdprs: null }, prelines = null, // pos, wid, col per sector multilines = null, // lines per sector sectors = null // with attributes per sector ; function vec3toLat (v, radius) {return 90 - (Math.acos(v.y / radius)) * 180 / PI;} function vec3toLon (v, radius) {return ((270 + (Math.atan2(v.x , v.z)) * 180 / PI) % 360);} function vector3ToLatLong (v, radius)
function latLonRadToVector3 (lat, lon, radius) { var phi = lat * Math.PI / 180; var theta = (lon - 180) * Math.PI / 180; var x = -radius * Math.cos(phi) * Math.cos(theta); var y = radius * Math.sin(phi); var z = radius * Math.cos(phi) * Math.sin(theta); return new Vector3(x, y, z); } function filterPool (sector, amount) { var i, j = 0, coord, out = [], len = pool.length; for (i=0; j<amount && i<len; i++) { coord = pool[i]; if ( coord.lat < sector[0] && coord.lon > sector[1] && coord.lat > sector[2] && coord.lon < sector[3] ) { out.push(coord); j += 1; } } return out; } function onmessage (event) { var id = event.data.id, topic = event.data.topic, payload = event.data.payload, callback = function (id, result, transferables) { postMessage({id, result}, transferables); } ; if (topics[topic]) { topics[topic](id, payload, callback); } else { console.warn(name + ': unknown topic', topic); } } topics = { importScripts: function (id, payload, callback) { importScripts.apply(null, payload.scripts); callback(id, null); }, retrieve: function (id, payload, callback) { var datagramm; cfg = payload.cfg; doe = payload.doe; pool = payload.pool; RES.load({ urls: payload.urls, onFinish: function (err, responses) { if (err) { throw err } else { responses.forEach(function (response) { datagramm = new SIM.Datagram(response.data); datagrams[datagramm.vari] = datagramm; }); topics.prepare(id, payload, function () { topics.process(id, payload, function () { topics.combine(id, payload, function (id, result, transferables) { callback(id, result, transferables) }); }); }); } }}); }, prepare: function (id, payload, callback) { var t0 = Date.now(), i, j, u, v, speed, width, pool, lat, lon, color, vec3, seeds, positions, widths, colors, seeds, sat = 0.4, spcl = new Spherical(), length = cfg.length, amount = NaN, filler = () => [], counter = (a, b) => a + b.positions.length ; // over sectors prelines = cfg.sim.sectors.map( sector => { seeds = []; pool = filterPool(sector, cfg.amount); amount = pool.length; positions = new Array(amount).fill(0).map(filler); colors = new Array(amount).fill(0).map(filler); widths = new Array(amount).fill(0).map(filler); // over lines for (i=0; i<amount; i++) { lat = pool[i].lat; lon = pool[i].lon; vec3 = latLonRadToVector3(lat, lon, cfg.radius); // keep start point seeds.push(vec3.x, vec3.y, vec3.z); // over vertices for (j=0; j<length; j++) { u = datagrams.ugrdprs.linearXY(doe, lat, lon); v = datagrams.vgrdprs.linearXY(doe, lat, lon); speed = Math.hypot(u, v); u /= Math.cos(lat * DEGRAD); color = new Color().setHSL(cfg.hue, sat, speed / 100); width = H.clampScale(speed, 0, 50, 0.5, 2.0); positions[i].push(vec3); colors[i].push(color); widths[i].push(width); spcl.setFromVector3(vec3); spcl.theta += u * cfg.factor; // east-direction spcl.phi -= v * cfg.factor; // north-direction vec3 = vec3.setFromSpherical(spcl).clone(); lat = vec3toLat(vec3, cfg.radius); lon = vec3toLon(vec3, cfg.radius); } } return { seeds: new Float32Array(seeds), positions, colors, widths }; }); // debugger; // console.log(name + ': prepare', id, Date.now() - t0, prelines.reduce(counter, 0)); callback(id, {}, []) }, process: function (id, payload, callback) { var t0 = Date.now(), counter = (a, b) => a + b.length ; multilines = prelines.map(preline => { var idx = 0, multiline = H.zip( preline.positions, preline.colors, preline.widths, (vectors, colors, widths) => new Multiline(idx++, vectors, colors, widths) ) ; multiline.seeds = preline.seeds; return multiline; }); // debugger; // console.log(name + ': process', id, Date.now() - t0, multilines.reduce(counter, 0)); callback(id, {}, []); }, combine: function (id, payload, callback) { var transferables, attributeTypes = { colors: Float32Array, index: Uint16Array, lineIndex: Float32Array, next: Float32Array, position: Float32Array, previous: Float32Array, side: Float32Array, width: Float32Array, }, textures = { u: datagrams.ugrdprs.data[doe], v: datagrams.vgrdprs.data[doe], } ; // debugger; // over sectors (n=6) sectors = multilines.map( lines => { var length, attributes = {}, uniforms = { seeds: lines.seeds } ; delete lines.seeds; // prepare attributes H.each(attributeTypes, (name, type) => { length = lines[0].attributes[name].length * lines.length; attributes[name] = new type(length); }); // over attributes (n=8) H.each(attributeTypes, (name) => { // debugger; // if (name === 'seeds') { return; } var i, source, length, pointer = 0, indexOffset = 0, positLength = lines[0].attributes['position'].length / 3, target = attributes[name] ; // over lines (n=512) H.each(lines, (_, line) => { source = line.attributes[name]; length = source.length; if (name === 'index'){ for (i=0; i<length; i++) { target[pointer + i] = source[i] + indexOffset; } } else if (name !== 'seeds') { for (i=0; i<length; i++) { target[pointer + i] = source[i]; } } pointer += length; indexOffset += positLength; }); }); return { attributes, uniforms }; }); // finish transferables transferables = [textures.u.buffer, textures.v.buffer]; H.each(sectors, (_, sector) => { transferables.push(sector.uniforms.seeds.buffer); H.each(attributeTypes, (name) => { transferables.push(sector.attributes[name].buffer); }); }); // TODO: check edge + transferable callback(id, {sectors, textures}, transferables); } }; } function Multiline ( idx, vertices, colors, widths ) { this.idx = idx; this.index = []; this.lineIndex = []; this.next = []; this.positions = []; this.previous = []; this.side = []; this.widths = []; this.colors = []; this.length = vertices.length; this.init(vertices, colors, widths); this.process(); // TODO: Needed? ~15% faster this.attributes = { index: new Uint16Array( this.index ), lineIndex: new Float32Array( this.lineIndex ), next: new Float32Array( this.next ), position: new Float32Array( this.positions ), previous: new Float32Array( this.previous ), side: new Float32Array( this.side ), width: new Float32Array( this.widths ), colors: new Float32Array( this.colors ), } }; Multiline.prototype = { constructor: Multiline, compareV3: function( a, b ) { var aa = a * 6, ab = b * 6; return ( ( this.positions[ aa ] === this.positions[ ab ] ) && ( this.positions[ aa + 1 ] === this.positions[ ab + 1 ] ) && ( this.positions[ aa + 2 ] === this.positions[ ab + 2 ] ) ); }, copyV3: function( a ) { var aa = a * 6; return [ this.positions[ aa ], this.positions[ aa + 1 ], this.positions[ aa + 2 ] ]; }, init: function( vertices, colors, widths ) { var j, ver, cnt, col, wid, n, len = this.length; for( j = 0; j < len; j++ ) { ver = vertices[ j ]; col = colors[ j ]; wid = widths[ j ]; cnt = j / vertices.length; this.positions.push( ver.x, ver.y, ver.z ); this.positions.push( ver.x, ver.y, ver.z ); this.lineIndex.push(this.idx + cnt); this.lineIndex.push(this.idx + cnt); this.colors.push(col.r, col.g, col.b); this.colors.push(col.r, col.g, col.b); this.widths.push(wid); this.widths.push(wid); this.side.push( 1 ); this.side.push( -1 ); } for( j = 0; j < len - 1; j++ ) { n = j + j; this.index.push( n, n + 1, n + 2 ); this.index.push( n + 2, n + 1, n + 3 ); } }, process: function() { var j, v, l = this.positions.length / 6; v = this.compareV3( 0, l - 1 ) ? this.copyV3( l - 2 ) : this.copyV3( 0 ) ; this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); for( j = 0; j < l - 1; j++ ) { v = this.copyV3( j ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.previous.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } for( j = 1; j < l; j++ ) { v = this.copyV3( j ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } v = this.compareV3( l - 1, 0 ) ? this.copyV3( 1 ) : this.copyV3( l - 1 ) ; this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); this.next.push( v[ 0 ], v[ 1 ], v[ 2 ] ); } };
{ return { lat: 90 - (Math.acos(v.y / radius)) * 180 / Math.PI, lon: ((270 + (Math.atan2(v.x , v.z)) * 180 / Math.PI) % 360) }; }
identifier_body
Material.d.ts
import { Base } from './core/Base'; import { IDictionary } from './core/container'; import { Shader, IShaderUniform } from './Shader'; import { Renderer } from './Renderer'; interface IMaterialOption { name?: string; shader?: Shader; depthTest?: boolean; depthMask?: boolean; transparent?: boolean; blend?: (gl: WebGLRenderingContext) => void; } export class Material extends Base { constructor(option?: IMaterialOption); name: string;
uniforms: IDictionary<IShaderUniform>; shader: Shader; depthTest: boolean; depthMask: boolean; transparent: boolean; precision: string; blend: (renderer: Renderer) => void; bind(renderer: Renderer): void; setUniform(symbol: string, value: any): void; setUniforms(object: Object): void; enableUniform(symbol: string): void; disableUniform(symbol: string): void; isUniformEnabled(symbol: string): void; set(symbol: string, value: any): void; set(object: Object): void; get(symbol: string): any; attachShader(shader: Shader, keepUniform?: boolean): void; detachShader(): void; define(shaderType: string, symbol: string, val?: number): void; unDefine(shaderType: string, symbol: string): void; isDefined(shaderType: string, symbol: string): void; getDefine(shaderType: string, symbol: string): number; enableTexture(symbol: string): void; enableTexturesAll(): void; disableTexture(symbol: string): void; disableTexturesAll(): void; isTextureEnabled(symbol: string): boolean; hasUniform(symbol: string): boolean; setUniform(gl: WebGLRenderingContext, type: string, symbol: string, value: any): boolean; setUniformBySemantic(gl: WebGLRenderingContext, semantic: string, val: any): boolean; }
random_line_split
Material.d.ts
import { Base } from './core/Base'; import { IDictionary } from './core/container'; import { Shader, IShaderUniform } from './Shader'; import { Renderer } from './Renderer'; interface IMaterialOption { name?: string; shader?: Shader; depthTest?: boolean; depthMask?: boolean; transparent?: boolean; blend?: (gl: WebGLRenderingContext) => void; } export class
extends Base { constructor(option?: IMaterialOption); name: string; uniforms: IDictionary<IShaderUniform>; shader: Shader; depthTest: boolean; depthMask: boolean; transparent: boolean; precision: string; blend: (renderer: Renderer) => void; bind(renderer: Renderer): void; setUniform(symbol: string, value: any): void; setUniforms(object: Object): void; enableUniform(symbol: string): void; disableUniform(symbol: string): void; isUniformEnabled(symbol: string): void; set(symbol: string, value: any): void; set(object: Object): void; get(symbol: string): any; attachShader(shader: Shader, keepUniform?: boolean): void; detachShader(): void; define(shaderType: string, symbol: string, val?: number): void; unDefine(shaderType: string, symbol: string): void; isDefined(shaderType: string, symbol: string): void; getDefine(shaderType: string, symbol: string): number; enableTexture(symbol: string): void; enableTexturesAll(): void; disableTexture(symbol: string): void; disableTexturesAll(): void; isTextureEnabled(symbol: string): boolean; hasUniform(symbol: string): boolean; setUniform(gl: WebGLRenderingContext, type: string, symbol: string, value: any): boolean; setUniformBySemantic(gl: WebGLRenderingContext, semantic: string, val: any): boolean; }
Material
identifier_name
hearthisat.py
# coding: utf-8 from __future__ import unicode_literals import re from .common import InfoExtractor from ..compat import compat_urlparse from ..utils import ( HEADRequest, KNOWN_EXTENSIONS, sanitized_Request, str_to_int, urlencode_postdata, urlhandle_detect_ext, ) class HearThisAtIE(InfoExtractor): _VALID_URL = r'https?://(?:www\.)?hearthis\.at/(?P<artist>[^/]+)/(?P<title>[A-Za-z0-9\-]+)/?$' _PLAYLIST_URL = 'https://hearthis.at/playlist.php' _TESTS = [{ 'url': 'https://hearthis.at/moofi/dr-kreep', 'md5': 'ab6ec33c8fed6556029337c7885eb4e0', 'info_dict': { 'id': '150939', 'ext': 'wav', 'title': 'Moofi - Dr. Kreep', 'thumbnail': r're:^https?://.*\.jpg$', 'timestamp': 1421564134, 'description': 'Listen to Dr. Kreep by Moofi on hearthis.at - Modular, Eurorack, Mutable Intruments Braids, Valhalla-DSP', 'upload_date': '20150118', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 71, 'categories': ['Experimental'], } }, { # 'download' link redirects to the original webpage 'url': 'https://hearthis.at/twitchsf/dj-jim-hopkins-totally-bitchin-80s-dance-mix/', 'md5': '5980ceb7c461605d30f1f039df160c6e', 'info_dict': { 'id': '811296', 'ext': 'mp3', 'title': 'TwitchSF - DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix!', 'description': 'Listen to DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix! by TwitchSF on hearthis.at - Dance', 'upload_date': '20160328', 'timestamp': 1459186146, 'thumbnail': r're:^https?://.*\.jpg$', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 4360, 'categories': ['Dance'], }, }] def _real_extract(self, url): m = re.match(self._VALID_URL, url) display_id = '{artist:s} - {title:s}'.format(**m.groupdict()) webpage = self._download_webpage(url, display_id) track_id = self._search_regex( r'intTrackId\s*=\s*(\d+)', webpage, 'track ID') payload = urlencode_postdata({'tracks[]': track_id}) req = sanitized_Request(self._PLAYLIST_URL, payload) req.add_header('Content-type', 'application/x-www-form-urlencoded') track = self._download_json(req, track_id, 'Downloading playlist')[0] title = '{artist:s} - {title:s}'.format(**track) categories = None if track.get('category'): categories = [track['category']] description = self._og_search_description(webpage) thumbnail = self._og_search_thumbnail(webpage) meta_span = r'<span[^>]+class="%s".*?</i>([^<]+)</span>' view_count = str_to_int(self._search_regex( meta_span % 'plays_count', webpage, 'view count', fatal=False)) like_count = str_to_int(self._search_regex( meta_span % 'likes_count', webpage, 'like count', fatal=False)) comment_count = str_to_int(self._search_regex( meta_span % 'comment_count', webpage, 'comment count', fatal=False)) duration = str_to_int(self._search_regex( r'data-length="(\d+)', webpage, 'duration', fatal=False)) timestamp = str_to_int(self._search_regex( r'<span[^>]+class="calctime"[^>]+data-time="(\d+)', webpage, 'timestamp', fatal=False)) formats = [] mp3_url = self._search_regex(
'vcodec': 'none', 'acodec': 'mp3', 'url': mp3_url, }) download_path = self._search_regex( r'<a class="[^"]*download_fct[^"]*"\s+href="([^"]+)"', webpage, 'download URL', default=None) if download_path: download_url = compat_urlparse.urljoin(url, download_path) ext_req = HEADRequest(download_url) ext_handle = self._request_webpage( ext_req, display_id, note='Determining extension') ext = urlhandle_detect_ext(ext_handle) if ext in KNOWN_EXTENSIONS: formats.append({ 'format_id': 'download', 'vcodec': 'none', 'ext': ext, 'url': download_url, 'preference': 2, # Usually better quality }) self._sort_formats(formats) return { 'id': track_id, 'display_id': display_id, 'title': title, 'formats': formats, 'thumbnail': thumbnail, 'description': description, 'duration': duration, 'timestamp': timestamp, 'view_count': view_count, 'comment_count': comment_count, 'like_count': like_count, 'categories': categories, }
r'(?s)<a class="player-link"\s+(?:[a-zA-Z0-9_:-]+="[^"]+"\s+)*?data-mp3="([^"]+)"', webpage, 'mp3 URL', fatal=False) if mp3_url: formats.append({ 'format_id': 'mp3',
random_line_split
hearthisat.py
# coding: utf-8 from __future__ import unicode_literals import re from .common import InfoExtractor from ..compat import compat_urlparse from ..utils import ( HEADRequest, KNOWN_EXTENSIONS, sanitized_Request, str_to_int, urlencode_postdata, urlhandle_detect_ext, ) class HearThisAtIE(InfoExtractor): _VALID_URL = r'https?://(?:www\.)?hearthis\.at/(?P<artist>[^/]+)/(?P<title>[A-Za-z0-9\-]+)/?$' _PLAYLIST_URL = 'https://hearthis.at/playlist.php' _TESTS = [{ 'url': 'https://hearthis.at/moofi/dr-kreep', 'md5': 'ab6ec33c8fed6556029337c7885eb4e0', 'info_dict': { 'id': '150939', 'ext': 'wav', 'title': 'Moofi - Dr. Kreep', 'thumbnail': r're:^https?://.*\.jpg$', 'timestamp': 1421564134, 'description': 'Listen to Dr. Kreep by Moofi on hearthis.at - Modular, Eurorack, Mutable Intruments Braids, Valhalla-DSP', 'upload_date': '20150118', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 71, 'categories': ['Experimental'], } }, { # 'download' link redirects to the original webpage 'url': 'https://hearthis.at/twitchsf/dj-jim-hopkins-totally-bitchin-80s-dance-mix/', 'md5': '5980ceb7c461605d30f1f039df160c6e', 'info_dict': { 'id': '811296', 'ext': 'mp3', 'title': 'TwitchSF - DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix!', 'description': 'Listen to DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix! by TwitchSF on hearthis.at - Dance', 'upload_date': '20160328', 'timestamp': 1459186146, 'thumbnail': r're:^https?://.*\.jpg$', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 4360, 'categories': ['Dance'], }, }] def _real_extract(self, url): m = re.match(self._VALID_URL, url) display_id = '{artist:s} - {title:s}'.format(**m.groupdict()) webpage = self._download_webpage(url, display_id) track_id = self._search_regex( r'intTrackId\s*=\s*(\d+)', webpage, 'track ID') payload = urlencode_postdata({'tracks[]': track_id}) req = sanitized_Request(self._PLAYLIST_URL, payload) req.add_header('Content-type', 'application/x-www-form-urlencoded') track = self._download_json(req, track_id, 'Downloading playlist')[0] title = '{artist:s} - {title:s}'.format(**track) categories = None if track.get('category'): categories = [track['category']] description = self._og_search_description(webpage) thumbnail = self._og_search_thumbnail(webpage) meta_span = r'<span[^>]+class="%s".*?</i>([^<]+)</span>' view_count = str_to_int(self._search_regex( meta_span % 'plays_count', webpage, 'view count', fatal=False)) like_count = str_to_int(self._search_regex( meta_span % 'likes_count', webpage, 'like count', fatal=False)) comment_count = str_to_int(self._search_regex( meta_span % 'comment_count', webpage, 'comment count', fatal=False)) duration = str_to_int(self._search_regex( r'data-length="(\d+)', webpage, 'duration', fatal=False)) timestamp = str_to_int(self._search_regex( r'<span[^>]+class="calctime"[^>]+data-time="(\d+)', webpage, 'timestamp', fatal=False)) formats = [] mp3_url = self._search_regex( r'(?s)<a class="player-link"\s+(?:[a-zA-Z0-9_:-]+="[^"]+"\s+)*?data-mp3="([^"]+)"', webpage, 'mp3 URL', fatal=False) if mp3_url: formats.append({ 'format_id': 'mp3', 'vcodec': 'none', 'acodec': 'mp3', 'url': mp3_url, }) download_path = self._search_regex( r'<a class="[^"]*download_fct[^"]*"\s+href="([^"]+)"', webpage, 'download URL', default=None) if download_path:
self._sort_formats(formats) return { 'id': track_id, 'display_id': display_id, 'title': title, 'formats': formats, 'thumbnail': thumbnail, 'description': description, 'duration': duration, 'timestamp': timestamp, 'view_count': view_count, 'comment_count': comment_count, 'like_count': like_count, 'categories': categories, }
download_url = compat_urlparse.urljoin(url, download_path) ext_req = HEADRequest(download_url) ext_handle = self._request_webpage( ext_req, display_id, note='Determining extension') ext = urlhandle_detect_ext(ext_handle) if ext in KNOWN_EXTENSIONS: formats.append({ 'format_id': 'download', 'vcodec': 'none', 'ext': ext, 'url': download_url, 'preference': 2, # Usually better quality })
conditional_block
hearthisat.py
# coding: utf-8 from __future__ import unicode_literals import re from .common import InfoExtractor from ..compat import compat_urlparse from ..utils import ( HEADRequest, KNOWN_EXTENSIONS, sanitized_Request, str_to_int, urlencode_postdata, urlhandle_detect_ext, ) class HearThisAtIE(InfoExtractor): _VALID_URL = r'https?://(?:www\.)?hearthis\.at/(?P<artist>[^/]+)/(?P<title>[A-Za-z0-9\-]+)/?$' _PLAYLIST_URL = 'https://hearthis.at/playlist.php' _TESTS = [{ 'url': 'https://hearthis.at/moofi/dr-kreep', 'md5': 'ab6ec33c8fed6556029337c7885eb4e0', 'info_dict': { 'id': '150939', 'ext': 'wav', 'title': 'Moofi - Dr. Kreep', 'thumbnail': r're:^https?://.*\.jpg$', 'timestamp': 1421564134, 'description': 'Listen to Dr. Kreep by Moofi on hearthis.at - Modular, Eurorack, Mutable Intruments Braids, Valhalla-DSP', 'upload_date': '20150118', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 71, 'categories': ['Experimental'], } }, { # 'download' link redirects to the original webpage 'url': 'https://hearthis.at/twitchsf/dj-jim-hopkins-totally-bitchin-80s-dance-mix/', 'md5': '5980ceb7c461605d30f1f039df160c6e', 'info_dict': { 'id': '811296', 'ext': 'mp3', 'title': 'TwitchSF - DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix!', 'description': 'Listen to DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix! by TwitchSF on hearthis.at - Dance', 'upload_date': '20160328', 'timestamp': 1459186146, 'thumbnail': r're:^https?://.*\.jpg$', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 4360, 'categories': ['Dance'], }, }] def
(self, url): m = re.match(self._VALID_URL, url) display_id = '{artist:s} - {title:s}'.format(**m.groupdict()) webpage = self._download_webpage(url, display_id) track_id = self._search_regex( r'intTrackId\s*=\s*(\d+)', webpage, 'track ID') payload = urlencode_postdata({'tracks[]': track_id}) req = sanitized_Request(self._PLAYLIST_URL, payload) req.add_header('Content-type', 'application/x-www-form-urlencoded') track = self._download_json(req, track_id, 'Downloading playlist')[0] title = '{artist:s} - {title:s}'.format(**track) categories = None if track.get('category'): categories = [track['category']] description = self._og_search_description(webpage) thumbnail = self._og_search_thumbnail(webpage) meta_span = r'<span[^>]+class="%s".*?</i>([^<]+)</span>' view_count = str_to_int(self._search_regex( meta_span % 'plays_count', webpage, 'view count', fatal=False)) like_count = str_to_int(self._search_regex( meta_span % 'likes_count', webpage, 'like count', fatal=False)) comment_count = str_to_int(self._search_regex( meta_span % 'comment_count', webpage, 'comment count', fatal=False)) duration = str_to_int(self._search_regex( r'data-length="(\d+)', webpage, 'duration', fatal=False)) timestamp = str_to_int(self._search_regex( r'<span[^>]+class="calctime"[^>]+data-time="(\d+)', webpage, 'timestamp', fatal=False)) formats = [] mp3_url = self._search_regex( r'(?s)<a class="player-link"\s+(?:[a-zA-Z0-9_:-]+="[^"]+"\s+)*?data-mp3="([^"]+)"', webpage, 'mp3 URL', fatal=False) if mp3_url: formats.append({ 'format_id': 'mp3', 'vcodec': 'none', 'acodec': 'mp3', 'url': mp3_url, }) download_path = self._search_regex( r'<a class="[^"]*download_fct[^"]*"\s+href="([^"]+)"', webpage, 'download URL', default=None) if download_path: download_url = compat_urlparse.urljoin(url, download_path) ext_req = HEADRequest(download_url) ext_handle = self._request_webpage( ext_req, display_id, note='Determining extension') ext = urlhandle_detect_ext(ext_handle) if ext in KNOWN_EXTENSIONS: formats.append({ 'format_id': 'download', 'vcodec': 'none', 'ext': ext, 'url': download_url, 'preference': 2, # Usually better quality }) self._sort_formats(formats) return { 'id': track_id, 'display_id': display_id, 'title': title, 'formats': formats, 'thumbnail': thumbnail, 'description': description, 'duration': duration, 'timestamp': timestamp, 'view_count': view_count, 'comment_count': comment_count, 'like_count': like_count, 'categories': categories, }
_real_extract
identifier_name
hearthisat.py
# coding: utf-8 from __future__ import unicode_literals import re from .common import InfoExtractor from ..compat import compat_urlparse from ..utils import ( HEADRequest, KNOWN_EXTENSIONS, sanitized_Request, str_to_int, urlencode_postdata, urlhandle_detect_ext, ) class HearThisAtIE(InfoExtractor): _VALID_URL = r'https?://(?:www\.)?hearthis\.at/(?P<artist>[^/]+)/(?P<title>[A-Za-z0-9\-]+)/?$' _PLAYLIST_URL = 'https://hearthis.at/playlist.php' _TESTS = [{ 'url': 'https://hearthis.at/moofi/dr-kreep', 'md5': 'ab6ec33c8fed6556029337c7885eb4e0', 'info_dict': { 'id': '150939', 'ext': 'wav', 'title': 'Moofi - Dr. Kreep', 'thumbnail': r're:^https?://.*\.jpg$', 'timestamp': 1421564134, 'description': 'Listen to Dr. Kreep by Moofi on hearthis.at - Modular, Eurorack, Mutable Intruments Braids, Valhalla-DSP', 'upload_date': '20150118', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 71, 'categories': ['Experimental'], } }, { # 'download' link redirects to the original webpage 'url': 'https://hearthis.at/twitchsf/dj-jim-hopkins-totally-bitchin-80s-dance-mix/', 'md5': '5980ceb7c461605d30f1f039df160c6e', 'info_dict': { 'id': '811296', 'ext': 'mp3', 'title': 'TwitchSF - DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix!', 'description': 'Listen to DJ Jim Hopkins - Totally Bitchin\' 80\'s Dance Mix! by TwitchSF on hearthis.at - Dance', 'upload_date': '20160328', 'timestamp': 1459186146, 'thumbnail': r're:^https?://.*\.jpg$', 'comment_count': int, 'view_count': int, 'like_count': int, 'duration': 4360, 'categories': ['Dance'], }, }] def _real_extract(self, url):
m = re.match(self._VALID_URL, url) display_id = '{artist:s} - {title:s}'.format(**m.groupdict()) webpage = self._download_webpage(url, display_id) track_id = self._search_regex( r'intTrackId\s*=\s*(\d+)', webpage, 'track ID') payload = urlencode_postdata({'tracks[]': track_id}) req = sanitized_Request(self._PLAYLIST_URL, payload) req.add_header('Content-type', 'application/x-www-form-urlencoded') track = self._download_json(req, track_id, 'Downloading playlist')[0] title = '{artist:s} - {title:s}'.format(**track) categories = None if track.get('category'): categories = [track['category']] description = self._og_search_description(webpage) thumbnail = self._og_search_thumbnail(webpage) meta_span = r'<span[^>]+class="%s".*?</i>([^<]+)</span>' view_count = str_to_int(self._search_regex( meta_span % 'plays_count', webpage, 'view count', fatal=False)) like_count = str_to_int(self._search_regex( meta_span % 'likes_count', webpage, 'like count', fatal=False)) comment_count = str_to_int(self._search_regex( meta_span % 'comment_count', webpage, 'comment count', fatal=False)) duration = str_to_int(self._search_regex( r'data-length="(\d+)', webpage, 'duration', fatal=False)) timestamp = str_to_int(self._search_regex( r'<span[^>]+class="calctime"[^>]+data-time="(\d+)', webpage, 'timestamp', fatal=False)) formats = [] mp3_url = self._search_regex( r'(?s)<a class="player-link"\s+(?:[a-zA-Z0-9_:-]+="[^"]+"\s+)*?data-mp3="([^"]+)"', webpage, 'mp3 URL', fatal=False) if mp3_url: formats.append({ 'format_id': 'mp3', 'vcodec': 'none', 'acodec': 'mp3', 'url': mp3_url, }) download_path = self._search_regex( r'<a class="[^"]*download_fct[^"]*"\s+href="([^"]+)"', webpage, 'download URL', default=None) if download_path: download_url = compat_urlparse.urljoin(url, download_path) ext_req = HEADRequest(download_url) ext_handle = self._request_webpage( ext_req, display_id, note='Determining extension') ext = urlhandle_detect_ext(ext_handle) if ext in KNOWN_EXTENSIONS: formats.append({ 'format_id': 'download', 'vcodec': 'none', 'ext': ext, 'url': download_url, 'preference': 2, # Usually better quality }) self._sort_formats(formats) return { 'id': track_id, 'display_id': display_id, 'title': title, 'formats': formats, 'thumbnail': thumbnail, 'description': description, 'duration': duration, 'timestamp': timestamp, 'view_count': view_count, 'comment_count': comment_count, 'like_count': like_count, 'categories': categories, }
identifier_body
webpack.config.js
const path = require('path') module.exports = { context: __dirname, entry: './js/ClientApp.js', devtool: 'eval', output: { path: path.join(__dirname, '/public'), publicPath: '/public/', filename: 'bundle.js' }, devServer: { publicPath: '/public/', historyApiFallback: true }, resolve: { extensions: ['.js', '.json'] }, stats: { colors: true, reasons: true, chunks: true }, module: { rules: [ { enforce: 'pre', test: /\.js$/, loader: 'eslint-loader', exclude: /node_modlues/ }, { test: /\.json$/, loader: 'json-loader' }, { include: path.resolve(__dirname, 'js'), test: /\.js$/, loader: 'babel-loader' }, { test: /\.css$/, use: [ 'style-loader',
options: { url: false } } ] }, { test: /\.scss$/, loader: 'style-loader!css-loader!autoprefixer-loader!sass-loader' }, { test: /\.otf$/, loader: 'file-loader?name=fonts/[name].[ext]' } ] } }
{ loader: 'css-loader',
random_line_split
FieldWithComponentProp.js
import React from 'react'; import { Box, Button, CheckBox, FileInput,
Form, FormField, Grommet, RadioButtonGroup, RangeInput, Select, TextArea, } from 'grommet'; import { grommet } from 'grommet/themes'; export const FieldWithComponentProp = () => ( <Grommet full theme={grommet}> <Box fill overflow="auto" align="center" justify="center" pad="large"> <Box flex={false} width="medium"> <Form onReset={event => console.log(event)} onSubmit={({ value, touched }) => console.log('Submit', value, touched) } > <FormField label="Name" name="name" required validate={[ { regexp: /^[a-z]/i }, name => { if (name && name.length === 1) return 'must be >1 character'; return undefined; }, name => { if (name && name.length <= 2) return { message: "that's short", status: 'info' }; return undefined; }, ]} /> <FormField label="Email" name="email" type="email" required /> <FormField label="Employee ID" name="employeeId" required validate={{ regexp: /^[0-9]{4,6}$/, message: '4-6 digits' }} /> <FormField name="subscribe" component={CheckBox} label="Subscribe?" /> <FormField name="ampm" component={RadioButtonGroup} options={['morning', 'evening']} /> <FormField label="Size" name="size" component={Select} onChange={event => console.log(event)} options={['small', 'medium', 'large', 'xlarge']} /> <FormField label="Comments" name="comments" component={TextArea} /> <FormField label="Age" name="age" component={RangeInput} pad min={15} max={75} /> <FormField label="File" name="file" component={FileInput} /> <FormField label="Custom" name="custom" component={props => <input {...props} />} /> <Box direction="row" justify="between" margin={{ top: 'medium' }}> <Button label="Cancel" /> <Button type="reset" label="Reset" /> <Button type="submit" label="Update" primary /> </Box> </Form> </Box> </Box> </Grommet> ); FieldWithComponentProp.storyName = 'Field with component prop'; export default { title: 'Input/Form/Field with component prop', };
random_line_split
queues.js
import React from "react"; import {map, sortBy, filter} from "lodash"; import BaseComponent from "../base-component"; import Config from "../../tools/config"; const cx = require("classnames"); var navigate = require('react-mini-router').navigate; const EMPTY_QUEUE_CONFIG_KEY = "home.queues.empty"; export default class QueueList extends BaseComponent { constructor(props) { super(props); this.state = { query: "", empty: Config.get(EMPTY_QUEUE_CONFIG_KEY, false) }; this.bindThiz("getQueueRows", "doesQueueMatchQuery", "onQueryChange", "onRowClick", "changeEmpty") } onQueryChange(query) { this.assignState({query: query}); } onRowClick(queue) { navigate(`/queues/${queue.name}`) } getQueueRows() { if (!this.props.queues) { return <tr/> } let queues = this.props.queues; if (!this.state.empty) { queues = filter(queues, (q)=> { return q.size > 0 }) } queues = sortBy(queues, "size").reverse(); queues = filter(queues, (q) => { return this.doesQueueMatchQuery(q) }); return map(queues, (q)=> { return ( <tr className="clickable" key={q.name} onClick={()=> { this.onRowClick(q) }}> <td>{q.name}</td> <td>{q.delayed ? q.size + " (" + q.pending + ")" : q.size}</td> </tr> ) }) } doesQueueMatchQuery(queue)
changeEmpty() { this.assignState({empty: !this.state.empty}, ()=> { Config.set(EMPTY_QUEUE_CONFIG_KEY, this.state.empty) }) } render() { let failedClasses = cx('clickable', {danger: this.props.failed > 0, info: this.props.failed === 0}); return ( <div className="queue-list"> <div className="page-header"> <h3>Queues</h3> Jobs processed: {this.props.processed} </div> <div className="filter-form"> <div className="filter"> <input className="form-control" placeholder="Search for Queue name" type="text" value={this.state.query} onChange={(e)=> { this.onQueryChange(e.target.value) }}/> </div> <div className="filter"> <label htmlFor="empty"> <input id="empty" type="checkbox" checked={this.state.empty} onChange={(e)=> { this.changeEmpty(e.target.checked) }}/> Show empty queues </label> </div> </div> <table className="table table-condensed table-striped table-hover"> <thead> <tr> <th>Name</th> <th>Size</th> </tr> </thead> <tbody> <tr> <td>All</td> <td>{this.props.pending}</td> </tr> {this.getQueueRows()} <tr className={failedClasses} onClick={()=> { navigate('/jobs/failed/') }}> <td>Failed</td> <td>{this.props.failed}</td> </tr> </tbody> </table> </div> ) } }
{ if (this.state.query === "") { return true } let q = this.state.query.toLowerCase(); let name = queue.name.toLowerCase(); return name.indexOf(q) > -1 }
identifier_body
queues.js
import React from "react"; import {map, sortBy, filter} from "lodash"; import BaseComponent from "../base-component"; import Config from "../../tools/config"; const cx = require("classnames"); var navigate = require('react-mini-router').navigate; const EMPTY_QUEUE_CONFIG_KEY = "home.queues.empty"; export default class QueueList extends BaseComponent { constructor(props) { super(props); this.state = { query: "", empty: Config.get(EMPTY_QUEUE_CONFIG_KEY, false) }; this.bindThiz("getQueueRows", "doesQueueMatchQuery", "onQueryChange", "onRowClick", "changeEmpty") } onQueryChange(query) { this.assignState({query: query}); } onRowClick(queue) { navigate(`/queues/${queue.name}`) } getQueueRows() { if (!this.props.queues) { return <tr/> } let queues = this.props.queues; if (!this.state.empty) { queues = filter(queues, (q)=> { return q.size > 0 }) } queues = sortBy(queues, "size").reverse(); queues = filter(queues, (q) => { return this.doesQueueMatchQuery(q) }); return map(queues, (q)=> { return ( <tr className="clickable" key={q.name} onClick={()=> { this.onRowClick(q) }}> <td>{q.name}</td> <td>{q.delayed ? q.size + " (" + q.pending + ")" : q.size}</td> </tr> ) }) } doesQueueMatchQuery(queue) { if (this.state.query === "")
let q = this.state.query.toLowerCase(); let name = queue.name.toLowerCase(); return name.indexOf(q) > -1 } changeEmpty() { this.assignState({empty: !this.state.empty}, ()=> { Config.set(EMPTY_QUEUE_CONFIG_KEY, this.state.empty) }) } render() { let failedClasses = cx('clickable', {danger: this.props.failed > 0, info: this.props.failed === 0}); return ( <div className="queue-list"> <div className="page-header"> <h3>Queues</h3> Jobs processed: {this.props.processed} </div> <div className="filter-form"> <div className="filter"> <input className="form-control" placeholder="Search for Queue name" type="text" value={this.state.query} onChange={(e)=> { this.onQueryChange(e.target.value) }}/> </div> <div className="filter"> <label htmlFor="empty"> <input id="empty" type="checkbox" checked={this.state.empty} onChange={(e)=> { this.changeEmpty(e.target.checked) }}/> Show empty queues </label> </div> </div> <table className="table table-condensed table-striped table-hover"> <thead> <tr> <th>Name</th> <th>Size</th> </tr> </thead> <tbody> <tr> <td>All</td> <td>{this.props.pending}</td> </tr> {this.getQueueRows()} <tr className={failedClasses} onClick={()=> { navigate('/jobs/failed/') }}> <td>Failed</td> <td>{this.props.failed}</td> </tr> </tbody> </table> </div> ) } }
{ return true }
conditional_block
queues.js
import React from "react"; import {map, sortBy, filter} from "lodash"; import BaseComponent from "../base-component"; import Config from "../../tools/config"; const cx = require("classnames"); var navigate = require('react-mini-router').navigate; const EMPTY_QUEUE_CONFIG_KEY = "home.queues.empty"; export default class QueueList extends BaseComponent { constructor(props) { super(props); this.state = { query: "", empty: Config.get(EMPTY_QUEUE_CONFIG_KEY, false) }; this.bindThiz("getQueueRows", "doesQueueMatchQuery", "onQueryChange", "onRowClick", "changeEmpty") }
onRowClick(queue) { navigate(`/queues/${queue.name}`) } getQueueRows() { if (!this.props.queues) { return <tr/> } let queues = this.props.queues; if (!this.state.empty) { queues = filter(queues, (q)=> { return q.size > 0 }) } queues = sortBy(queues, "size").reverse(); queues = filter(queues, (q) => { return this.doesQueueMatchQuery(q) }); return map(queues, (q)=> { return ( <tr className="clickable" key={q.name} onClick={()=> { this.onRowClick(q) }}> <td>{q.name}</td> <td>{q.delayed ? q.size + " (" + q.pending + ")" : q.size}</td> </tr> ) }) } doesQueueMatchQuery(queue) { if (this.state.query === "") { return true } let q = this.state.query.toLowerCase(); let name = queue.name.toLowerCase(); return name.indexOf(q) > -1 } changeEmpty() { this.assignState({empty: !this.state.empty}, ()=> { Config.set(EMPTY_QUEUE_CONFIG_KEY, this.state.empty) }) } render() { let failedClasses = cx('clickable', {danger: this.props.failed > 0, info: this.props.failed === 0}); return ( <div className="queue-list"> <div className="page-header"> <h3>Queues</h3> Jobs processed: {this.props.processed} </div> <div className="filter-form"> <div className="filter"> <input className="form-control" placeholder="Search for Queue name" type="text" value={this.state.query} onChange={(e)=> { this.onQueryChange(e.target.value) }}/> </div> <div className="filter"> <label htmlFor="empty"> <input id="empty" type="checkbox" checked={this.state.empty} onChange={(e)=> { this.changeEmpty(e.target.checked) }}/> Show empty queues </label> </div> </div> <table className="table table-condensed table-striped table-hover"> <thead> <tr> <th>Name</th> <th>Size</th> </tr> </thead> <tbody> <tr> <td>All</td> <td>{this.props.pending}</td> </tr> {this.getQueueRows()} <tr className={failedClasses} onClick={()=> { navigate('/jobs/failed/') }}> <td>Failed</td> <td>{this.props.failed}</td> </tr> </tbody> </table> </div> ) } }
onQueryChange(query) { this.assignState({query: query}); }
random_line_split
queues.js
import React from "react"; import {map, sortBy, filter} from "lodash"; import BaseComponent from "../base-component"; import Config from "../../tools/config"; const cx = require("classnames"); var navigate = require('react-mini-router').navigate; const EMPTY_QUEUE_CONFIG_KEY = "home.queues.empty"; export default class QueueList extends BaseComponent {
(props) { super(props); this.state = { query: "", empty: Config.get(EMPTY_QUEUE_CONFIG_KEY, false) }; this.bindThiz("getQueueRows", "doesQueueMatchQuery", "onQueryChange", "onRowClick", "changeEmpty") } onQueryChange(query) { this.assignState({query: query}); } onRowClick(queue) { navigate(`/queues/${queue.name}`) } getQueueRows() { if (!this.props.queues) { return <tr/> } let queues = this.props.queues; if (!this.state.empty) { queues = filter(queues, (q)=> { return q.size > 0 }) } queues = sortBy(queues, "size").reverse(); queues = filter(queues, (q) => { return this.doesQueueMatchQuery(q) }); return map(queues, (q)=> { return ( <tr className="clickable" key={q.name} onClick={()=> { this.onRowClick(q) }}> <td>{q.name}</td> <td>{q.delayed ? q.size + " (" + q.pending + ")" : q.size}</td> </tr> ) }) } doesQueueMatchQuery(queue) { if (this.state.query === "") { return true } let q = this.state.query.toLowerCase(); let name = queue.name.toLowerCase(); return name.indexOf(q) > -1 } changeEmpty() { this.assignState({empty: !this.state.empty}, ()=> { Config.set(EMPTY_QUEUE_CONFIG_KEY, this.state.empty) }) } render() { let failedClasses = cx('clickable', {danger: this.props.failed > 0, info: this.props.failed === 0}); return ( <div className="queue-list"> <div className="page-header"> <h3>Queues</h3> Jobs processed: {this.props.processed} </div> <div className="filter-form"> <div className="filter"> <input className="form-control" placeholder="Search for Queue name" type="text" value={this.state.query} onChange={(e)=> { this.onQueryChange(e.target.value) }}/> </div> <div className="filter"> <label htmlFor="empty"> <input id="empty" type="checkbox" checked={this.state.empty} onChange={(e)=> { this.changeEmpty(e.target.checked) }}/> Show empty queues </label> </div> </div> <table className="table table-condensed table-striped table-hover"> <thead> <tr> <th>Name</th> <th>Size</th> </tr> </thead> <tbody> <tr> <td>All</td> <td>{this.props.pending}</td> </tr> {this.getQueueRows()} <tr className={failedClasses} onClick={()=> { navigate('/jobs/failed/') }}> <td>Failed</td> <td>{this.props.failed}</td> </tr> </tbody> </table> </div> ) } }
constructor
identifier_name
acfun.py
#!/usr/bin/env python __all__ = ['acfun_download'] from ..common import * from .letv import letvcloud_download_by_vu from .qq import qq_download_by_vid from .sina import sina_download_by_vid from .tudou import tudou_download_by_iid from .youku import youku_download_by_vid import json, re def get_srt_json(id): url = 'http://danmu.aixifan.com/V2/%s' % id return get_html(url) def acfun_download_by_vid(vid, title, output_dir='.', merge=True, info_only=False, **kwargs): info = json.loads(get_html('http://www.acfun.tv/video/getVideo.aspx?id=' + vid)) sourceType = info['sourceType'] if 'sourceId' in info: sourceId = info['sourceId'] # danmakuId = info['danmakuId'] if sourceType == 'sina': sina_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'youku':
elif sourceType == 'tudou': tudou_download_by_iid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'qq': qq_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'letv': letvcloud_download_by_vu(sourceId, '2d8c027396', title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'zhuzhan': a = 'http://api.aixifan.com/plays/%s/realSource' % vid s = json.loads(get_content(a, headers={'deviceType': '1'})) urls = s['data']['files'][-1]['url'] size = urls_size(urls) print_info(site_info, title, 'mp4', size) if not info_only: download_urls(urls, title, 'mp4', size, output_dir=output_dir, merge=merge) else: raise NotImplementedError(sourceType) if not info_only and not dry_run: if not kwargs['caption']: print('Skipping danmaku.') return try: title = get_filename(title) print('Downloading %s ...\n' % (title + '.cmt.json')) cmt = get_srt_json(vid) with open(os.path.join(output_dir, title + '.cmt.json'), 'w', encoding='utf-8') as x: x.write(cmt) except: pass def acfun_download(url, output_dir='.', merge=True, info_only=False, **kwargs): assert re.match(r'http://[^\.]+.acfun.[^\.]+/\D/\D\D(\d+)', url) html = get_html(url) title = r1(r'<h1 id="txt-title-view">([^<>]+)<', html) title = unescape_html(title) title = escape_file_path(title) assert title videos = re.findall("data-vid=\"(\d+)\".*href=\"[^\"]+\".*title=\"([^\"]+)\"", html) for video in videos: p_vid = video[0] p_title = title + " - " + video[1] if video[1] != '删除标签' else title acfun_download_by_vid(p_vid, p_title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs) site_info = "AcFun.tv" download = acfun_download download_playlist = playlist_not_supported('acfun')
youku_download_by_vid(sourceId, title=title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs)
conditional_block
acfun.py
#!/usr/bin/env python __all__ = ['acfun_download'] from ..common import *
from .letv import letvcloud_download_by_vu from .qq import qq_download_by_vid from .sina import sina_download_by_vid from .tudou import tudou_download_by_iid from .youku import youku_download_by_vid import json, re def get_srt_json(id): url = 'http://danmu.aixifan.com/V2/%s' % id return get_html(url) def acfun_download_by_vid(vid, title, output_dir='.', merge=True, info_only=False, **kwargs): info = json.loads(get_html('http://www.acfun.tv/video/getVideo.aspx?id=' + vid)) sourceType = info['sourceType'] if 'sourceId' in info: sourceId = info['sourceId'] # danmakuId = info['danmakuId'] if sourceType == 'sina': sina_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'youku': youku_download_by_vid(sourceId, title=title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs) elif sourceType == 'tudou': tudou_download_by_iid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'qq': qq_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'letv': letvcloud_download_by_vu(sourceId, '2d8c027396', title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'zhuzhan': a = 'http://api.aixifan.com/plays/%s/realSource' % vid s = json.loads(get_content(a, headers={'deviceType': '1'})) urls = s['data']['files'][-1]['url'] size = urls_size(urls) print_info(site_info, title, 'mp4', size) if not info_only: download_urls(urls, title, 'mp4', size, output_dir=output_dir, merge=merge) else: raise NotImplementedError(sourceType) if not info_only and not dry_run: if not kwargs['caption']: print('Skipping danmaku.') return try: title = get_filename(title) print('Downloading %s ...\n' % (title + '.cmt.json')) cmt = get_srt_json(vid) with open(os.path.join(output_dir, title + '.cmt.json'), 'w', encoding='utf-8') as x: x.write(cmt) except: pass def acfun_download(url, output_dir='.', merge=True, info_only=False, **kwargs): assert re.match(r'http://[^\.]+.acfun.[^\.]+/\D/\D\D(\d+)', url) html = get_html(url) title = r1(r'<h1 id="txt-title-view">([^<>]+)<', html) title = unescape_html(title) title = escape_file_path(title) assert title videos = re.findall("data-vid=\"(\d+)\".*href=\"[^\"]+\".*title=\"([^\"]+)\"", html) for video in videos: p_vid = video[0] p_title = title + " - " + video[1] if video[1] != '删除标签' else title acfun_download_by_vid(p_vid, p_title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs) site_info = "AcFun.tv" download = acfun_download download_playlist = playlist_not_supported('acfun')
random_line_split
acfun.py
#!/usr/bin/env python __all__ = ['acfun_download'] from ..common import * from .letv import letvcloud_download_by_vu from .qq import qq_download_by_vid from .sina import sina_download_by_vid from .tudou import tudou_download_by_iid from .youku import youku_download_by_vid import json, re def get_srt_json(id): url = 'http://danmu.aixifan.com/V2/%s' % id return get_html(url) def acfun_download_by_vid(vid, title, output_dir='.', merge=True, info_only=False, **kwargs): info = json.loads(get_html('http://www.acfun.tv/video/getVideo.aspx?id=' + vid)) sourceType = info['sourceType'] if 'sourceId' in info: sourceId = info['sourceId'] # danmakuId = info['danmakuId'] if sourceType == 'sina': sina_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'youku': youku_download_by_vid(sourceId, title=title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs) elif sourceType == 'tudou': tudou_download_by_iid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'qq': qq_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'letv': letvcloud_download_by_vu(sourceId, '2d8c027396', title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'zhuzhan': a = 'http://api.aixifan.com/plays/%s/realSource' % vid s = json.loads(get_content(a, headers={'deviceType': '1'})) urls = s['data']['files'][-1]['url'] size = urls_size(urls) print_info(site_info, title, 'mp4', size) if not info_only: download_urls(urls, title, 'mp4', size, output_dir=output_dir, merge=merge) else: raise NotImplementedError(sourceType) if not info_only and not dry_run: if not kwargs['caption']: print('Skipping danmaku.') return try: title = get_filename(title) print('Downloading %s ...\n' % (title + '.cmt.json')) cmt = get_srt_json(vid) with open(os.path.join(output_dir, title + '.cmt.json'), 'w', encoding='utf-8') as x: x.write(cmt) except: pass def acfun_download(url, output_dir='.', merge=True, info_only=False, **kwargs):
nfo = "AcFun.tv" download = acfun_download download_playlist = playlist_not_supported('acfun')
assert re.match(r'http://[^\.]+.acfun.[^\.]+/\D/\D\D(\d+)', url) html = get_html(url) title = r1(r'<h1 id="txt-title-view">([^<>]+)<', html) title = unescape_html(title) title = escape_file_path(title) assert title videos = re.findall("data-vid=\"(\d+)\".*href=\"[^\"]+\".*title=\"([^\"]+)\"", html) for video in videos: p_vid = video[0] p_title = title + " - " + video[1] if video[1] != '删除标签' else title acfun_download_by_vid(p_vid, p_title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs) site_i
identifier_body
acfun.py
#!/usr/bin/env python __all__ = ['acfun_download'] from ..common import * from .letv import letvcloud_download_by_vu from .qq import qq_download_by_vid from .sina import sina_download_by_vid from .tudou import tudou_download_by_iid from .youku import youku_download_by_vid import json, re def get_srt_json(id): url = 'http://danmu.aixifan.com/V2/%s' % id return get_html(url) def acfun_download_by_vid(vid, title, output_dir='.', merge=True, info_only=False, **kwargs): info = json.loads(get_html('http://www.acfun.tv/video/getVideo.aspx?id=' + vid)) sourceType = info['sourceType'] if 'sourceId' in info: sourceId = info['sourceId'] # danmakuId = info['danmakuId'] if sourceType == 'sina': sina_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'youku': youku_download_by_vid(sourceId, title=title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs) elif sourceType == 'tudou': tudou_download_by_iid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'qq': qq_download_by_vid(sourceId, title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'letv': letvcloud_download_by_vu(sourceId, '2d8c027396', title, output_dir=output_dir, merge=merge, info_only=info_only) elif sourceType == 'zhuzhan': a = 'http://api.aixifan.com/plays/%s/realSource' % vid s = json.loads(get_content(a, headers={'deviceType': '1'})) urls = s['data']['files'][-1]['url'] size = urls_size(urls) print_info(site_info, title, 'mp4', size) if not info_only: download_urls(urls, title, 'mp4', size, output_dir=output_dir, merge=merge) else: raise NotImplementedError(sourceType) if not info_only and not dry_run: if not kwargs['caption']: print('Skipping danmaku.') return try: title = get_filename(title) print('Downloading %s ...\n' % (title + '.cmt.json')) cmt = get_srt_json(vid) with open(os.path.join(output_dir, title + '.cmt.json'), 'w', encoding='utf-8') as x: x.write(cmt) except: pass def
(url, output_dir='.', merge=True, info_only=False, **kwargs): assert re.match(r'http://[^\.]+.acfun.[^\.]+/\D/\D\D(\d+)', url) html = get_html(url) title = r1(r'<h1 id="txt-title-view">([^<>]+)<', html) title = unescape_html(title) title = escape_file_path(title) assert title videos = re.findall("data-vid=\"(\d+)\".*href=\"[^\"]+\".*title=\"([^\"]+)\"", html) for video in videos: p_vid = video[0] p_title = title + " - " + video[1] if video[1] != '删除标签' else title acfun_download_by_vid(p_vid, p_title, output_dir=output_dir, merge=merge, info_only=info_only, **kwargs) site_info = "AcFun.tv" download = acfun_download download_playlist = playlist_not_supported('acfun')
acfun_download
identifier_name
one-use-in-struct.rs
// Copyright 2016 The Rust Project Developers. See the COPYRIGHT // file at the top-level directory of this distribution and at // http://rust-lang.org/COPYRIGHT. // // Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or // http://www.apache.org/licenses/LICENSE-2.0> or the MIT license // <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your // option. This file may not be copied, modified, or distributed // except according to those terms. // Test that we do not warn for named lifetimes in structs, // even when they are only used once (since to not use a named // lifetime is illegal!) // // compile-pass #![deny(single_use_lifetimes)]
data: &'f u32 } enum Bar<'f> { Data(&'f u32) } trait Baz<'f> { } fn main() { }
#![allow(dead_code)] #![allow(unused_variables)] struct Foo<'f> {
random_line_split
one-use-in-struct.rs
// Copyright 2016 The Rust Project Developers. See the COPYRIGHT // file at the top-level directory of this distribution and at // http://rust-lang.org/COPYRIGHT. // // Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or // http://www.apache.org/licenses/LICENSE-2.0> or the MIT license // <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your // option. This file may not be copied, modified, or distributed // except according to those terms. // Test that we do not warn for named lifetimes in structs, // even when they are only used once (since to not use a named // lifetime is illegal!) // // compile-pass #![deny(single_use_lifetimes)] #![allow(dead_code)] #![allow(unused_variables)] struct Foo<'f> { data: &'f u32 } enum Bar<'f> { Data(&'f u32) } trait Baz<'f> { } fn
() { }
main
identifier_name
widgetfactory.ts
// Copyright (c) Jupyter Development Team. // Distributed under the terms of the Modified BSD License. 'use strict'; import { IKernelId } from 'jupyter-js-services'; import { IWidgetFactory, IDocumentContext, findKernel } from 'jupyter-js-ui/lib/docmanager'; import { RenderMime } from 'jupyter-js-ui/lib/rendermime'; import { MimeData as IClipboard } from 'phosphor-dragdrop'; import { Widget } from 'phosphor-widget'; import { ToolbarItems } from './default-toolbar';
import { INotebookModel } from './model'; import { NotebookPanel } from './panel'; /** * A widget factory for notebook panels. */ export class NotebookWidgetFactory implements IWidgetFactory<NotebookPanel> { /** * Construct a new notebook widget factory. */ constructor(rendermime: RenderMime<Widget>, clipboard: IClipboard) { this._rendermime = rendermime.clone(); this._clipboard = clipboard; } /** * Get whether the factory has been disposed. */ get isDisposed(): boolean { return this._rendermime === null; } /** * Dispose of the resources used by the factory. */ dispose(): void { this._rendermime = null; this._clipboard = null; } /** * Create a new widget. */ createNew(model: INotebookModel, context: IDocumentContext, kernel?: IKernelId): NotebookPanel { let rendermime = this._rendermime.clone(); if (kernel) { context.changeKernel(kernel); } else { let name = findKernel(model.defaultKernelName, model.defaultKernelLanguage, context.kernelspecs); context.changeKernel({ name }); } let panel = new NotebookPanel(model, rendermime, context, this._clipboard); ToolbarItems.populateDefaults(panel); return panel; } /** * Take an action on a widget before closing it. * * @returns A promise that resolves to true if the document should close * and false otherwise. */ beforeClose(model: INotebookModel, context: IDocumentContext, widget: NotebookPanel): Promise<boolean> { // No special action required. return Promise.resolve(true); } private _rendermime: RenderMime<Widget> = null; private _clipboard: IClipboard = null; }
random_line_split
widgetfactory.ts
// Copyright (c) Jupyter Development Team. // Distributed under the terms of the Modified BSD License. 'use strict'; import { IKernelId } from 'jupyter-js-services'; import { IWidgetFactory, IDocumentContext, findKernel } from 'jupyter-js-ui/lib/docmanager'; import { RenderMime } from 'jupyter-js-ui/lib/rendermime'; import { MimeData as IClipboard } from 'phosphor-dragdrop'; import { Widget } from 'phosphor-widget'; import { ToolbarItems } from './default-toolbar'; import { INotebookModel } from './model'; import { NotebookPanel } from './panel'; /** * A widget factory for notebook panels. */ export class NotebookWidgetFactory implements IWidgetFactory<NotebookPanel> { /** * Construct a new notebook widget factory. */ constructor(rendermime: RenderMime<Widget>, clipboard: IClipboard) { this._rendermime = rendermime.clone(); this._clipboard = clipboard; } /** * Get whether the factory has been disposed. */ get isDisposed(): boolean { return this._rendermime === null; } /** * Dispose of the resources used by the factory. */ dispose(): void
/** * Create a new widget. */ createNew(model: INotebookModel, context: IDocumentContext, kernel?: IKernelId): NotebookPanel { let rendermime = this._rendermime.clone(); if (kernel) { context.changeKernel(kernel); } else { let name = findKernel(model.defaultKernelName, model.defaultKernelLanguage, context.kernelspecs); context.changeKernel({ name }); } let panel = new NotebookPanel(model, rendermime, context, this._clipboard); ToolbarItems.populateDefaults(panel); return panel; } /** * Take an action on a widget before closing it. * * @returns A promise that resolves to true if the document should close * and false otherwise. */ beforeClose(model: INotebookModel, context: IDocumentContext, widget: NotebookPanel): Promise<boolean> { // No special action required. return Promise.resolve(true); } private _rendermime: RenderMime<Widget> = null; private _clipboard: IClipboard = null; }
{ this._rendermime = null; this._clipboard = null; }
identifier_body
widgetfactory.ts
// Copyright (c) Jupyter Development Team. // Distributed under the terms of the Modified BSD License. 'use strict'; import { IKernelId } from 'jupyter-js-services'; import { IWidgetFactory, IDocumentContext, findKernel } from 'jupyter-js-ui/lib/docmanager'; import { RenderMime } from 'jupyter-js-ui/lib/rendermime'; import { MimeData as IClipboard } from 'phosphor-dragdrop'; import { Widget } from 'phosphor-widget'; import { ToolbarItems } from './default-toolbar'; import { INotebookModel } from './model'; import { NotebookPanel } from './panel'; /** * A widget factory for notebook panels. */ export class NotebookWidgetFactory implements IWidgetFactory<NotebookPanel> { /** * Construct a new notebook widget factory. */
(rendermime: RenderMime<Widget>, clipboard: IClipboard) { this._rendermime = rendermime.clone(); this._clipboard = clipboard; } /** * Get whether the factory has been disposed. */ get isDisposed(): boolean { return this._rendermime === null; } /** * Dispose of the resources used by the factory. */ dispose(): void { this._rendermime = null; this._clipboard = null; } /** * Create a new widget. */ createNew(model: INotebookModel, context: IDocumentContext, kernel?: IKernelId): NotebookPanel { let rendermime = this._rendermime.clone(); if (kernel) { context.changeKernel(kernel); } else { let name = findKernel(model.defaultKernelName, model.defaultKernelLanguage, context.kernelspecs); context.changeKernel({ name }); } let panel = new NotebookPanel(model, rendermime, context, this._clipboard); ToolbarItems.populateDefaults(panel); return panel; } /** * Take an action on a widget before closing it. * * @returns A promise that resolves to true if the document should close * and false otherwise. */ beforeClose(model: INotebookModel, context: IDocumentContext, widget: NotebookPanel): Promise<boolean> { // No special action required. return Promise.resolve(true); } private _rendermime: RenderMime<Widget> = null; private _clipboard: IClipboard = null; }
constructor
identifier_name
widgetfactory.ts
// Copyright (c) Jupyter Development Team. // Distributed under the terms of the Modified BSD License. 'use strict'; import { IKernelId } from 'jupyter-js-services'; import { IWidgetFactory, IDocumentContext, findKernel } from 'jupyter-js-ui/lib/docmanager'; import { RenderMime } from 'jupyter-js-ui/lib/rendermime'; import { MimeData as IClipboard } from 'phosphor-dragdrop'; import { Widget } from 'phosphor-widget'; import { ToolbarItems } from './default-toolbar'; import { INotebookModel } from './model'; import { NotebookPanel } from './panel'; /** * A widget factory for notebook panels. */ export class NotebookWidgetFactory implements IWidgetFactory<NotebookPanel> { /** * Construct a new notebook widget factory. */ constructor(rendermime: RenderMime<Widget>, clipboard: IClipboard) { this._rendermime = rendermime.clone(); this._clipboard = clipboard; } /** * Get whether the factory has been disposed. */ get isDisposed(): boolean { return this._rendermime === null; } /** * Dispose of the resources used by the factory. */ dispose(): void { this._rendermime = null; this._clipboard = null; } /** * Create a new widget. */ createNew(model: INotebookModel, context: IDocumentContext, kernel?: IKernelId): NotebookPanel { let rendermime = this._rendermime.clone(); if (kernel) { context.changeKernel(kernel); } else
let panel = new NotebookPanel(model, rendermime, context, this._clipboard); ToolbarItems.populateDefaults(panel); return panel; } /** * Take an action on a widget before closing it. * * @returns A promise that resolves to true if the document should close * and false otherwise. */ beforeClose(model: INotebookModel, context: IDocumentContext, widget: NotebookPanel): Promise<boolean> { // No special action required. return Promise.resolve(true); } private _rendermime: RenderMime<Widget> = null; private _clipboard: IClipboard = null; }
{ let name = findKernel(model.defaultKernelName, model.defaultKernelLanguage, context.kernelspecs); context.changeKernel({ name }); }
conditional_block
test_pdfbase_encodings.py
from reportlab.test import unittest from reportlab.test.utils import makeSuiteForClasses, outputfile, printLocation, NearTestCase from reportlab.pdfgen.canvas import Canvas from reportlab.pdfbase import pdfmetrics from reportlab.pdfbase.ttfonts import TTFont from reportlab.pdfbase import pdfutils from reportlab.platypus.paragraph import Paragraph from reportlab.lib.styles import ParagraphStyle from reportlab.graphics.shapes import Drawing, String, Ellipse import re import codecs textPat = re.compile(r'\([^(]*\)') #test sentences testCp1252 = 'copyright %s trademark %s registered %s ReportLab! Ol%s!' % (chr(169), chr(153),chr(174), chr(0xe9)) testUni = unicode(testCp1252, 'cp1252') testUTF8 = testUni.encode('utf-8') # expected result is octal-escaped text in the PDF expectedCp1252 = pdfutils._escape(testCp1252) def extractText(pdfOps): """Utility to rip out the PDF text within a block of PDF operators. PDF will show a string draw as something like "(Hello World) Tj" i.e. text is in curved brackets. Crude and dirty, probably fails on escaped brackets. """ found = textPat.findall(pdfOps) #chop off '(' and ')' return map(lambda x:x[1:-1], found) def subsetToUnicode(ttf, subsetCodeStr): """Return unicode string represented by given subsetCode string as found when TrueType font rendered to PDF, ttf must be the font object that was used.""" # This relies on TTFont internals and uses the first document # and subset it finds subset = ttf.state.values()[0].subsets[0] chrs = [] for codeStr in subsetCodeStr.split('\\'):
return u''.join(chrs) class TextEncodingTestCase(NearTestCase): """Tests of expected Unicode and encoding behaviour """ def setUp(self): self.luxi = TTFont("Luxi", "luxiserif.ttf") pdfmetrics.registerFont(self.luxi) self.styNormal = ParagraphStyle(name='Helvetica', fontName='Helvetica-Oblique') self.styTrueType = ParagraphStyle(name='TrueType', fontName='luxi') def testStringWidth(self): msg = 'Hello World' self.assertNear(pdfmetrics.stringWidth(msg, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(msg, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(msg, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(msg, 'Luxi', 10),50.263671875) uniMsg1 = u"Hello World" self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Luxi', 10),50.263671875) # Courier are all 600 ems wide. So if one 'measures as utf8' one will # get a wrong width as extra characters are seen self.assertEquals(len(testCp1252),52) self.assertNear(pdfmetrics.stringWidth(testCp1252, 'Courier', 10, 'cp1252'),312.0) # the test string has 5 more bytes and so "measures too long" if passed to # a single-byte font which treats it as a single-byte string. self.assertEquals(len(testUTF8),57) self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Courier', 10),312.0) self.assertEquals(len(testUni),52) self.assertNear(pdfmetrics.stringWidth(testUni, 'Courier', 10),312.0) # now try a TrueType font. Should be able to accept Unicode or UTF8 self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Luxi', 10),224.638671875) self.assertNear(pdfmetrics.stringWidth(testUni, 'Luxi', 10),224.638671875) def testUtf8Canvas(self): """Verify canvas declared as utf8 autoconverts. This assumes utf8 input. It converts to the encoding of the underlying font, so both text lines APPEAR the same.""" c = Canvas(outputfile('test_pdfbase_encodings_utf8.pdf')) c.drawString(100,700, testUTF8) # Set a font with UTF8 encoding c.setFont('Luxi', 12) # This should pass the UTF8 through unchanged c.drawString(100,600, testUTF8) # and this should convert from Unicode to UTF8 c.drawString(100,500, testUni) # now add a paragraph in Latin-1 in the latin-1 style p = Paragraph(testUTF8, style=self.styNormal, encoding="utf-8") w, h = p.wrap(150, 100) p.drawOn(c, 100, 400) #3 c.rect(100,300,w,h) # now add a paragraph in UTF-8 in the UTF-8 style p2 = Paragraph(testUTF8, style=self.styTrueType, encoding="utf-8") w, h = p2.wrap(150, 100) p2.drawOn(c, 300, 400) #4 c.rect(100,300,w,h) # now add a paragraph in Unicode in the latin-1 style p3 = Paragraph(testUni, style=self.styNormal) w, h = p3.wrap(150, 100) p3.drawOn(c, 100, 300) c.rect(100,300,w,h) # now add a paragraph in Unicode in the UTF-8 style p4 = Paragraph(testUni, style=self.styTrueType) p4.wrap(150, 100) p4.drawOn(c, 300, 300) c.rect(300,300,w,h) # now a graphic d1 = Drawing(400,50) d1.add(Ellipse(200,25,200,12.5, fillColor=None)) d1.add(String(200,25,testUTF8, textAnchor='middle', encoding='utf-8')) d1.drawOn(c, 100, 150) # now a graphic in utf8 d2 = Drawing(400,50) d2.add(Ellipse(200,25,200,12.5, fillColor=None)) d2.add(String(200,25,testUTF8, fontName='Luxi', textAnchor='middle', encoding='utf-8')) d2.drawOn(c, 100, 100) # now a graphic in Unicode with T1 font d3 = Drawing(400,50) d3.add(Ellipse(200,25,200,12.5, fillColor=None)) d3.add(String(200,25,testUni, textAnchor='middle')) d3.drawOn(c, 100, 50) # now a graphic in Unicode with TT font d4 = Drawing(400,50) d4.add(Ellipse(200,25,200,12.5, fillColor=None)) d4.add(String(200,25,testUni, fontName='Luxi', textAnchor='middle')) d4.drawOn(c, 100, 0) extracted = extractText(c.getCurrentPageContent()) self.assertEquals(extracted[0], expectedCp1252) self.assertEquals(extracted[1], extracted[2]) #self.assertEquals(subsetToUnicode(self.luxi, extracted[1]), testUni) c.save() class FontEncodingTestCase(unittest.TestCase): """Make documents with custom encodings of Type 1 built-in fonts. Nothing really to do with character encodings; this is about hacking the font itself""" def test0(self): "Make custom encodings of standard fonts" # make a custom encoded font. c = Canvas(outputfile('test_pdfbase_encodings.pdf')) c.setPageCompression(0) c.setFont('Helvetica', 12) c.drawString(100, 700, 'The text below should be in a custom encoding in which all vowels become "z"') # invent a new language where vowels are replaced with letter 'z' zenc = pdfmetrics.Encoding('EncodingWithoutVowels', 'WinAnsiEncoding') for ch in 'aeiou': zenc[ord(ch)] = 'z' for ch in 'AEIOU': zenc[ord(ch)] = 'Z' pdfmetrics.registerEncoding(zenc) # now we can make a font based on this encoding # AR hack/workaround: the name of the encoding must be a Python codec! f = pdfmetrics.Font('FontWithoutVowels', 'Helvetica-Oblique', 'EncodingWithoutVowels') pdfmetrics.registerFont(f) c.setFont('FontWithoutVowels', 12) c.drawString(125, 675, "The magic word is squamish ossifrage") # now demonstrate adding a Euro to MacRoman, which lacks one c.setFont('Helvetica', 12) c.drawString(100, 650, "MacRoman encoding lacks a Euro. We'll make a Mac font with the Euro at #219:") # WinAnsi Helvetica pdfmetrics.registerFont(pdfmetrics.Font('Helvetica-WinAnsi', 'Helvetica-Oblique', 'WinAnsiEncoding')) c.setFont('Helvetica-WinAnsi', 12) c.drawString(125, 625, 'WinAnsi with Euro: character 128 = "\200"') pdfmetrics.registerFont(pdfmetrics.Font('MacHelvNoEuro', 'Helvetica-Oblique', 'MacRomanEncoding')) c.setFont('MacHelvNoEuro', 12) c.drawString(125, 600, 'Standard MacRoman, no Euro: Character 219 = "\333"') # oct(219)=0333 # now make our hacked encoding euroMac = pdfmetrics.Encoding('MacWithEuro', 'MacRomanEncoding') euroMac[219] = 'Euro' pdfmetrics.registerEncoding(euroMac) pdfmetrics.registerFont(pdfmetrics.Font('MacHelvWithEuro', 'Helvetica-Oblique', 'MacWithEuro')) c.setFont('MacHelvWithEuro', 12) c.drawString(125, 575, 'Hacked MacRoman with Euro: Character 219 = "\333"') # oct(219)=0333 # now test width setting with and without _rl_accel - harder # make an encoding where 'm' becomes 'i' c.setFont('Helvetica', 12) c.drawString(100, 500, "Recode 'm' to 'i' and check we can measure widths. Boxes should surround letters.") sample = 'Mmmmm. ' * 6 + 'Mmmm' c.setFont('Helvetica-Oblique',12) c.drawString(125, 475, sample) w = c.stringWidth(sample, 'Helvetica-Oblique', 12) c.rect(125, 475, w, 12) narrowEnc = pdfmetrics.Encoding('m-to-i') narrowEnc[ord('m')] = 'i' narrowEnc[ord('M')] = 'I' pdfmetrics.registerEncoding(narrowEnc) pdfmetrics.registerFont(pdfmetrics.Font('narrow', 'Helvetica-Oblique', 'm-to-i')) c.setFont('narrow', 12) c.drawString(125, 450, sample) w = c.stringWidth(sample, 'narrow', 12) c.rect(125, 450, w, 12) c.setFont('Helvetica', 12) c.drawString(100, 400, "Symbol & Dingbats fonts - check we still get valid PDF in StandardEncoding") c.setFont('Symbol', 12) c.drawString(100, 375, 'abcdefghijklmn') c.setFont('ZapfDingbats', 12) c.drawString(300, 375, 'abcdefghijklmn') c.save() def makeSuite(): return makeSuiteForClasses( TextEncodingTestCase, #FontEncodingTestCase - nobbled for now due to old stuff which needs removing. ) #noruntests if __name__ == "__main__": unittest.TextTestRunner().run(makeSuite()) printLocation()
if codeStr: chrs.append(unichr(subset[int(codeStr[1:], 8)]))
conditional_block
test_pdfbase_encodings.py
from reportlab.test import unittest from reportlab.test.utils import makeSuiteForClasses, outputfile, printLocation, NearTestCase from reportlab.pdfgen.canvas import Canvas from reportlab.pdfbase import pdfmetrics from reportlab.pdfbase.ttfonts import TTFont from reportlab.pdfbase import pdfutils from reportlab.platypus.paragraph import Paragraph from reportlab.lib.styles import ParagraphStyle from reportlab.graphics.shapes import Drawing, String, Ellipse import re import codecs textPat = re.compile(r'\([^(]*\)') #test sentences testCp1252 = 'copyright %s trademark %s registered %s ReportLab! Ol%s!' % (chr(169), chr(153),chr(174), chr(0xe9)) testUni = unicode(testCp1252, 'cp1252') testUTF8 = testUni.encode('utf-8') # expected result is octal-escaped text in the PDF expectedCp1252 = pdfutils._escape(testCp1252) def extractText(pdfOps): """Utility to rip out the PDF text within a block of PDF operators. PDF will show a string draw as something like "(Hello World) Tj" i.e. text is in curved brackets. Crude and dirty, probably fails on escaped brackets. """ found = textPat.findall(pdfOps) #chop off '(' and ')' return map(lambda x:x[1:-1], found) def subsetToUnicode(ttf, subsetCodeStr): """Return unicode string represented by given subsetCode string as found when TrueType font rendered to PDF, ttf must be the font object that was used.""" # This relies on TTFont internals and uses the first document # and subset it finds subset = ttf.state.values()[0].subsets[0] chrs = [] for codeStr in subsetCodeStr.split('\\'): if codeStr: chrs.append(unichr(subset[int(codeStr[1:], 8)])) return u''.join(chrs) class TextEncodingTestCase(NearTestCase): """Tests of expected Unicode and encoding behaviour """ def setUp(self): self.luxi = TTFont("Luxi", "luxiserif.ttf") pdfmetrics.registerFont(self.luxi) self.styNormal = ParagraphStyle(name='Helvetica', fontName='Helvetica-Oblique') self.styTrueType = ParagraphStyle(name='TrueType', fontName='luxi') def testStringWidth(self): msg = 'Hello World' self.assertNear(pdfmetrics.stringWidth(msg, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(msg, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(msg, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(msg, 'Luxi', 10),50.263671875) uniMsg1 = u"Hello World" self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Luxi', 10),50.263671875) # Courier are all 600 ems wide. So if one 'measures as utf8' one will # get a wrong width as extra characters are seen self.assertEquals(len(testCp1252),52) self.assertNear(pdfmetrics.stringWidth(testCp1252, 'Courier', 10, 'cp1252'),312.0) # the test string has 5 more bytes and so "measures too long" if passed to # a single-byte font which treats it as a single-byte string. self.assertEquals(len(testUTF8),57) self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Courier', 10),312.0) self.assertEquals(len(testUni),52) self.assertNear(pdfmetrics.stringWidth(testUni, 'Courier', 10),312.0) # now try a TrueType font. Should be able to accept Unicode or UTF8 self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Luxi', 10),224.638671875) self.assertNear(pdfmetrics.stringWidth(testUni, 'Luxi', 10),224.638671875) def testUtf8Canvas(self): """Verify canvas declared as utf8 autoconverts. This assumes utf8 input. It converts to the encoding of the underlying font, so both text lines APPEAR the same.""" c = Canvas(outputfile('test_pdfbase_encodings_utf8.pdf')) c.drawString(100,700, testUTF8) # Set a font with UTF8 encoding c.setFont('Luxi', 12) # This should pass the UTF8 through unchanged c.drawString(100,600, testUTF8) # and this should convert from Unicode to UTF8 c.drawString(100,500, testUni) # now add a paragraph in Latin-1 in the latin-1 style p = Paragraph(testUTF8, style=self.styNormal, encoding="utf-8") w, h = p.wrap(150, 100) p.drawOn(c, 100, 400) #3 c.rect(100,300,w,h) # now add a paragraph in UTF-8 in the UTF-8 style p2 = Paragraph(testUTF8, style=self.styTrueType, encoding="utf-8") w, h = p2.wrap(150, 100) p2.drawOn(c, 300, 400) #4 c.rect(100,300,w,h) # now add a paragraph in Unicode in the latin-1 style p3 = Paragraph(testUni, style=self.styNormal) w, h = p3.wrap(150, 100) p3.drawOn(c, 100, 300) c.rect(100,300,w,h) # now add a paragraph in Unicode in the UTF-8 style p4 = Paragraph(testUni, style=self.styTrueType) p4.wrap(150, 100) p4.drawOn(c, 300, 300) c.rect(300,300,w,h) # now a graphic d1 = Drawing(400,50) d1.add(Ellipse(200,25,200,12.5, fillColor=None)) d1.add(String(200,25,testUTF8, textAnchor='middle', encoding='utf-8')) d1.drawOn(c, 100, 150) # now a graphic in utf8 d2 = Drawing(400,50) d2.add(Ellipse(200,25,200,12.5, fillColor=None)) d2.add(String(200,25,testUTF8, fontName='Luxi', textAnchor='middle', encoding='utf-8')) d2.drawOn(c, 100, 100) # now a graphic in Unicode with T1 font d3 = Drawing(400,50) d3.add(Ellipse(200,25,200,12.5, fillColor=None)) d3.add(String(200,25,testUni, textAnchor='middle')) d3.drawOn(c, 100, 50) # now a graphic in Unicode with TT font d4 = Drawing(400,50) d4.add(Ellipse(200,25,200,12.5, fillColor=None)) d4.add(String(200,25,testUni, fontName='Luxi', textAnchor='middle')) d4.drawOn(c, 100, 0) extracted = extractText(c.getCurrentPageContent()) self.assertEquals(extracted[0], expectedCp1252) self.assertEquals(extracted[1], extracted[2]) #self.assertEquals(subsetToUnicode(self.luxi, extracted[1]), testUni) c.save() class FontEncodingTestCase(unittest.TestCase): """Make documents with custom encodings of Type 1 built-in fonts. Nothing really to do with character encodings; this is about hacking the font itself""" def test0(self): "Make custom encodings of standard fonts" # make a custom encoded font. c = Canvas(outputfile('test_pdfbase_encodings.pdf')) c.setPageCompression(0) c.setFont('Helvetica', 12) c.drawString(100, 700, 'The text below should be in a custom encoding in which all vowels become "z"') # invent a new language where vowels are replaced with letter 'z' zenc = pdfmetrics.Encoding('EncodingWithoutVowels', 'WinAnsiEncoding') for ch in 'aeiou': zenc[ord(ch)] = 'z' for ch in 'AEIOU': zenc[ord(ch)] = 'Z' pdfmetrics.registerEncoding(zenc) # now we can make a font based on this encoding # AR hack/workaround: the name of the encoding must be a Python codec! f = pdfmetrics.Font('FontWithoutVowels', 'Helvetica-Oblique', 'EncodingWithoutVowels') pdfmetrics.registerFont(f) c.setFont('FontWithoutVowels', 12) c.drawString(125, 675, "The magic word is squamish ossifrage") # now demonstrate adding a Euro to MacRoman, which lacks one c.setFont('Helvetica', 12) c.drawString(100, 650, "MacRoman encoding lacks a Euro. We'll make a Mac font with the Euro at #219:") # WinAnsi Helvetica pdfmetrics.registerFont(pdfmetrics.Font('Helvetica-WinAnsi', 'Helvetica-Oblique', 'WinAnsiEncoding')) c.setFont('Helvetica-WinAnsi', 12) c.drawString(125, 625, 'WinAnsi with Euro: character 128 = "\200"') pdfmetrics.registerFont(pdfmetrics.Font('MacHelvNoEuro', 'Helvetica-Oblique', 'MacRomanEncoding')) c.setFont('MacHelvNoEuro', 12) c.drawString(125, 600, 'Standard MacRoman, no Euro: Character 219 = "\333"') # oct(219)=0333 # now make our hacked encoding euroMac = pdfmetrics.Encoding('MacWithEuro', 'MacRomanEncoding') euroMac[219] = 'Euro' pdfmetrics.registerEncoding(euroMac) pdfmetrics.registerFont(pdfmetrics.Font('MacHelvWithEuro', 'Helvetica-Oblique', 'MacWithEuro')) c.setFont('MacHelvWithEuro', 12) c.drawString(125, 575, 'Hacked MacRoman with Euro: Character 219 = "\333"') # oct(219)=0333 # now test width setting with and without _rl_accel - harder # make an encoding where 'm' becomes 'i' c.setFont('Helvetica', 12) c.drawString(100, 500, "Recode 'm' to 'i' and check we can measure widths. Boxes should surround letters.") sample = 'Mmmmm. ' * 6 + 'Mmmm' c.setFont('Helvetica-Oblique',12) c.drawString(125, 475, sample) w = c.stringWidth(sample, 'Helvetica-Oblique', 12) c.rect(125, 475, w, 12) narrowEnc = pdfmetrics.Encoding('m-to-i') narrowEnc[ord('m')] = 'i' narrowEnc[ord('M')] = 'I' pdfmetrics.registerEncoding(narrowEnc) pdfmetrics.registerFont(pdfmetrics.Font('narrow', 'Helvetica-Oblique', 'm-to-i')) c.setFont('narrow', 12) c.drawString(125, 450, sample) w = c.stringWidth(sample, 'narrow', 12) c.rect(125, 450, w, 12) c.setFont('Helvetica', 12) c.drawString(100, 400, "Symbol & Dingbats fonts - check we still get valid PDF in StandardEncoding") c.setFont('Symbol', 12) c.drawString(100, 375, 'abcdefghijklmn') c.setFont('ZapfDingbats', 12) c.drawString(300, 375, 'abcdefghijklmn') c.save() def makeSuite():
#noruntests if __name__ == "__main__": unittest.TextTestRunner().run(makeSuite()) printLocation()
return makeSuiteForClasses( TextEncodingTestCase, #FontEncodingTestCase - nobbled for now due to old stuff which needs removing. )
identifier_body
test_pdfbase_encodings.py
from reportlab.test import unittest from reportlab.test.utils import makeSuiteForClasses, outputfile, printLocation, NearTestCase from reportlab.pdfgen.canvas import Canvas from reportlab.pdfbase import pdfmetrics from reportlab.pdfbase.ttfonts import TTFont from reportlab.pdfbase import pdfutils from reportlab.platypus.paragraph import Paragraph from reportlab.lib.styles import ParagraphStyle from reportlab.graphics.shapes import Drawing, String, Ellipse import re import codecs textPat = re.compile(r'\([^(]*\)') #test sentences testCp1252 = 'copyright %s trademark %s registered %s ReportLab! Ol%s!' % (chr(169), chr(153),chr(174), chr(0xe9)) testUni = unicode(testCp1252, 'cp1252') testUTF8 = testUni.encode('utf-8') # expected result is octal-escaped text in the PDF expectedCp1252 = pdfutils._escape(testCp1252) def extractText(pdfOps): """Utility to rip out the PDF text within a block of PDF operators.
found = textPat.findall(pdfOps) #chop off '(' and ')' return map(lambda x:x[1:-1], found) def subsetToUnicode(ttf, subsetCodeStr): """Return unicode string represented by given subsetCode string as found when TrueType font rendered to PDF, ttf must be the font object that was used.""" # This relies on TTFont internals and uses the first document # and subset it finds subset = ttf.state.values()[0].subsets[0] chrs = [] for codeStr in subsetCodeStr.split('\\'): if codeStr: chrs.append(unichr(subset[int(codeStr[1:], 8)])) return u''.join(chrs) class TextEncodingTestCase(NearTestCase): """Tests of expected Unicode and encoding behaviour """ def setUp(self): self.luxi = TTFont("Luxi", "luxiserif.ttf") pdfmetrics.registerFont(self.luxi) self.styNormal = ParagraphStyle(name='Helvetica', fontName='Helvetica-Oblique') self.styTrueType = ParagraphStyle(name='TrueType', fontName='luxi') def testStringWidth(self): msg = 'Hello World' self.assertNear(pdfmetrics.stringWidth(msg, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(msg, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(msg, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(msg, 'Luxi', 10),50.263671875) uniMsg1 = u"Hello World" self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Luxi', 10),50.263671875) # Courier are all 600 ems wide. So if one 'measures as utf8' one will # get a wrong width as extra characters are seen self.assertEquals(len(testCp1252),52) self.assertNear(pdfmetrics.stringWidth(testCp1252, 'Courier', 10, 'cp1252'),312.0) # the test string has 5 more bytes and so "measures too long" if passed to # a single-byte font which treats it as a single-byte string. self.assertEquals(len(testUTF8),57) self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Courier', 10),312.0) self.assertEquals(len(testUni),52) self.assertNear(pdfmetrics.stringWidth(testUni, 'Courier', 10),312.0) # now try a TrueType font. Should be able to accept Unicode or UTF8 self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Luxi', 10),224.638671875) self.assertNear(pdfmetrics.stringWidth(testUni, 'Luxi', 10),224.638671875) def testUtf8Canvas(self): """Verify canvas declared as utf8 autoconverts. This assumes utf8 input. It converts to the encoding of the underlying font, so both text lines APPEAR the same.""" c = Canvas(outputfile('test_pdfbase_encodings_utf8.pdf')) c.drawString(100,700, testUTF8) # Set a font with UTF8 encoding c.setFont('Luxi', 12) # This should pass the UTF8 through unchanged c.drawString(100,600, testUTF8) # and this should convert from Unicode to UTF8 c.drawString(100,500, testUni) # now add a paragraph in Latin-1 in the latin-1 style p = Paragraph(testUTF8, style=self.styNormal, encoding="utf-8") w, h = p.wrap(150, 100) p.drawOn(c, 100, 400) #3 c.rect(100,300,w,h) # now add a paragraph in UTF-8 in the UTF-8 style p2 = Paragraph(testUTF8, style=self.styTrueType, encoding="utf-8") w, h = p2.wrap(150, 100) p2.drawOn(c, 300, 400) #4 c.rect(100,300,w,h) # now add a paragraph in Unicode in the latin-1 style p3 = Paragraph(testUni, style=self.styNormal) w, h = p3.wrap(150, 100) p3.drawOn(c, 100, 300) c.rect(100,300,w,h) # now add a paragraph in Unicode in the UTF-8 style p4 = Paragraph(testUni, style=self.styTrueType) p4.wrap(150, 100) p4.drawOn(c, 300, 300) c.rect(300,300,w,h) # now a graphic d1 = Drawing(400,50) d1.add(Ellipse(200,25,200,12.5, fillColor=None)) d1.add(String(200,25,testUTF8, textAnchor='middle', encoding='utf-8')) d1.drawOn(c, 100, 150) # now a graphic in utf8 d2 = Drawing(400,50) d2.add(Ellipse(200,25,200,12.5, fillColor=None)) d2.add(String(200,25,testUTF8, fontName='Luxi', textAnchor='middle', encoding='utf-8')) d2.drawOn(c, 100, 100) # now a graphic in Unicode with T1 font d3 = Drawing(400,50) d3.add(Ellipse(200,25,200,12.5, fillColor=None)) d3.add(String(200,25,testUni, textAnchor='middle')) d3.drawOn(c, 100, 50) # now a graphic in Unicode with TT font d4 = Drawing(400,50) d4.add(Ellipse(200,25,200,12.5, fillColor=None)) d4.add(String(200,25,testUni, fontName='Luxi', textAnchor='middle')) d4.drawOn(c, 100, 0) extracted = extractText(c.getCurrentPageContent()) self.assertEquals(extracted[0], expectedCp1252) self.assertEquals(extracted[1], extracted[2]) #self.assertEquals(subsetToUnicode(self.luxi, extracted[1]), testUni) c.save() class FontEncodingTestCase(unittest.TestCase): """Make documents with custom encodings of Type 1 built-in fonts. Nothing really to do with character encodings; this is about hacking the font itself""" def test0(self): "Make custom encodings of standard fonts" # make a custom encoded font. c = Canvas(outputfile('test_pdfbase_encodings.pdf')) c.setPageCompression(0) c.setFont('Helvetica', 12) c.drawString(100, 700, 'The text below should be in a custom encoding in which all vowels become "z"') # invent a new language where vowels are replaced with letter 'z' zenc = pdfmetrics.Encoding('EncodingWithoutVowels', 'WinAnsiEncoding') for ch in 'aeiou': zenc[ord(ch)] = 'z' for ch in 'AEIOU': zenc[ord(ch)] = 'Z' pdfmetrics.registerEncoding(zenc) # now we can make a font based on this encoding # AR hack/workaround: the name of the encoding must be a Python codec! f = pdfmetrics.Font('FontWithoutVowels', 'Helvetica-Oblique', 'EncodingWithoutVowels') pdfmetrics.registerFont(f) c.setFont('FontWithoutVowels', 12) c.drawString(125, 675, "The magic word is squamish ossifrage") # now demonstrate adding a Euro to MacRoman, which lacks one c.setFont('Helvetica', 12) c.drawString(100, 650, "MacRoman encoding lacks a Euro. We'll make a Mac font with the Euro at #219:") # WinAnsi Helvetica pdfmetrics.registerFont(pdfmetrics.Font('Helvetica-WinAnsi', 'Helvetica-Oblique', 'WinAnsiEncoding')) c.setFont('Helvetica-WinAnsi', 12) c.drawString(125, 625, 'WinAnsi with Euro: character 128 = "\200"') pdfmetrics.registerFont(pdfmetrics.Font('MacHelvNoEuro', 'Helvetica-Oblique', 'MacRomanEncoding')) c.setFont('MacHelvNoEuro', 12) c.drawString(125, 600, 'Standard MacRoman, no Euro: Character 219 = "\333"') # oct(219)=0333 # now make our hacked encoding euroMac = pdfmetrics.Encoding('MacWithEuro', 'MacRomanEncoding') euroMac[219] = 'Euro' pdfmetrics.registerEncoding(euroMac) pdfmetrics.registerFont(pdfmetrics.Font('MacHelvWithEuro', 'Helvetica-Oblique', 'MacWithEuro')) c.setFont('MacHelvWithEuro', 12) c.drawString(125, 575, 'Hacked MacRoman with Euro: Character 219 = "\333"') # oct(219)=0333 # now test width setting with and without _rl_accel - harder # make an encoding where 'm' becomes 'i' c.setFont('Helvetica', 12) c.drawString(100, 500, "Recode 'm' to 'i' and check we can measure widths. Boxes should surround letters.") sample = 'Mmmmm. ' * 6 + 'Mmmm' c.setFont('Helvetica-Oblique',12) c.drawString(125, 475, sample) w = c.stringWidth(sample, 'Helvetica-Oblique', 12) c.rect(125, 475, w, 12) narrowEnc = pdfmetrics.Encoding('m-to-i') narrowEnc[ord('m')] = 'i' narrowEnc[ord('M')] = 'I' pdfmetrics.registerEncoding(narrowEnc) pdfmetrics.registerFont(pdfmetrics.Font('narrow', 'Helvetica-Oblique', 'm-to-i')) c.setFont('narrow', 12) c.drawString(125, 450, sample) w = c.stringWidth(sample, 'narrow', 12) c.rect(125, 450, w, 12) c.setFont('Helvetica', 12) c.drawString(100, 400, "Symbol & Dingbats fonts - check we still get valid PDF in StandardEncoding") c.setFont('Symbol', 12) c.drawString(100, 375, 'abcdefghijklmn') c.setFont('ZapfDingbats', 12) c.drawString(300, 375, 'abcdefghijklmn') c.save() def makeSuite(): return makeSuiteForClasses( TextEncodingTestCase, #FontEncodingTestCase - nobbled for now due to old stuff which needs removing. ) #noruntests if __name__ == "__main__": unittest.TextTestRunner().run(makeSuite()) printLocation()
PDF will show a string draw as something like "(Hello World) Tj" i.e. text is in curved brackets. Crude and dirty, probably fails on escaped brackets. """
random_line_split
test_pdfbase_encodings.py
from reportlab.test import unittest from reportlab.test.utils import makeSuiteForClasses, outputfile, printLocation, NearTestCase from reportlab.pdfgen.canvas import Canvas from reportlab.pdfbase import pdfmetrics from reportlab.pdfbase.ttfonts import TTFont from reportlab.pdfbase import pdfutils from reportlab.platypus.paragraph import Paragraph from reportlab.lib.styles import ParagraphStyle from reportlab.graphics.shapes import Drawing, String, Ellipse import re import codecs textPat = re.compile(r'\([^(]*\)') #test sentences testCp1252 = 'copyright %s trademark %s registered %s ReportLab! Ol%s!' % (chr(169), chr(153),chr(174), chr(0xe9)) testUni = unicode(testCp1252, 'cp1252') testUTF8 = testUni.encode('utf-8') # expected result is octal-escaped text in the PDF expectedCp1252 = pdfutils._escape(testCp1252) def extractText(pdfOps): """Utility to rip out the PDF text within a block of PDF operators. PDF will show a string draw as something like "(Hello World) Tj" i.e. text is in curved brackets. Crude and dirty, probably fails on escaped brackets. """ found = textPat.findall(pdfOps) #chop off '(' and ')' return map(lambda x:x[1:-1], found) def
(ttf, subsetCodeStr): """Return unicode string represented by given subsetCode string as found when TrueType font rendered to PDF, ttf must be the font object that was used.""" # This relies on TTFont internals and uses the first document # and subset it finds subset = ttf.state.values()[0].subsets[0] chrs = [] for codeStr in subsetCodeStr.split('\\'): if codeStr: chrs.append(unichr(subset[int(codeStr[1:], 8)])) return u''.join(chrs) class TextEncodingTestCase(NearTestCase): """Tests of expected Unicode and encoding behaviour """ def setUp(self): self.luxi = TTFont("Luxi", "luxiserif.ttf") pdfmetrics.registerFont(self.luxi) self.styNormal = ParagraphStyle(name='Helvetica', fontName='Helvetica-Oblique') self.styTrueType = ParagraphStyle(name='TrueType', fontName='luxi') def testStringWidth(self): msg = 'Hello World' self.assertNear(pdfmetrics.stringWidth(msg, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(msg, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(msg, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(msg, 'Luxi', 10),50.263671875) uniMsg1 = u"Hello World" self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Courier', 10),66.0) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Helvetica', 10),51.67) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Times-Roman', 10),50.27) self.assertNear(pdfmetrics.stringWidth(uniMsg1, 'Luxi', 10),50.263671875) # Courier are all 600 ems wide. So if one 'measures as utf8' one will # get a wrong width as extra characters are seen self.assertEquals(len(testCp1252),52) self.assertNear(pdfmetrics.stringWidth(testCp1252, 'Courier', 10, 'cp1252'),312.0) # the test string has 5 more bytes and so "measures too long" if passed to # a single-byte font which treats it as a single-byte string. self.assertEquals(len(testUTF8),57) self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Courier', 10),312.0) self.assertEquals(len(testUni),52) self.assertNear(pdfmetrics.stringWidth(testUni, 'Courier', 10),312.0) # now try a TrueType font. Should be able to accept Unicode or UTF8 self.assertNear(pdfmetrics.stringWidth(testUTF8, 'Luxi', 10),224.638671875) self.assertNear(pdfmetrics.stringWidth(testUni, 'Luxi', 10),224.638671875) def testUtf8Canvas(self): """Verify canvas declared as utf8 autoconverts. This assumes utf8 input. It converts to the encoding of the underlying font, so both text lines APPEAR the same.""" c = Canvas(outputfile('test_pdfbase_encodings_utf8.pdf')) c.drawString(100,700, testUTF8) # Set a font with UTF8 encoding c.setFont('Luxi', 12) # This should pass the UTF8 through unchanged c.drawString(100,600, testUTF8) # and this should convert from Unicode to UTF8 c.drawString(100,500, testUni) # now add a paragraph in Latin-1 in the latin-1 style p = Paragraph(testUTF8, style=self.styNormal, encoding="utf-8") w, h = p.wrap(150, 100) p.drawOn(c, 100, 400) #3 c.rect(100,300,w,h) # now add a paragraph in UTF-8 in the UTF-8 style p2 = Paragraph(testUTF8, style=self.styTrueType, encoding="utf-8") w, h = p2.wrap(150, 100) p2.drawOn(c, 300, 400) #4 c.rect(100,300,w,h) # now add a paragraph in Unicode in the latin-1 style p3 = Paragraph(testUni, style=self.styNormal) w, h = p3.wrap(150, 100) p3.drawOn(c, 100, 300) c.rect(100,300,w,h) # now add a paragraph in Unicode in the UTF-8 style p4 = Paragraph(testUni, style=self.styTrueType) p4.wrap(150, 100) p4.drawOn(c, 300, 300) c.rect(300,300,w,h) # now a graphic d1 = Drawing(400,50) d1.add(Ellipse(200,25,200,12.5, fillColor=None)) d1.add(String(200,25,testUTF8, textAnchor='middle', encoding='utf-8')) d1.drawOn(c, 100, 150) # now a graphic in utf8 d2 = Drawing(400,50) d2.add(Ellipse(200,25,200,12.5, fillColor=None)) d2.add(String(200,25,testUTF8, fontName='Luxi', textAnchor='middle', encoding='utf-8')) d2.drawOn(c, 100, 100) # now a graphic in Unicode with T1 font d3 = Drawing(400,50) d3.add(Ellipse(200,25,200,12.5, fillColor=None)) d3.add(String(200,25,testUni, textAnchor='middle')) d3.drawOn(c, 100, 50) # now a graphic in Unicode with TT font d4 = Drawing(400,50) d4.add(Ellipse(200,25,200,12.5, fillColor=None)) d4.add(String(200,25,testUni, fontName='Luxi', textAnchor='middle')) d4.drawOn(c, 100, 0) extracted = extractText(c.getCurrentPageContent()) self.assertEquals(extracted[0], expectedCp1252) self.assertEquals(extracted[1], extracted[2]) #self.assertEquals(subsetToUnicode(self.luxi, extracted[1]), testUni) c.save() class FontEncodingTestCase(unittest.TestCase): """Make documents with custom encodings of Type 1 built-in fonts. Nothing really to do with character encodings; this is about hacking the font itself""" def test0(self): "Make custom encodings of standard fonts" # make a custom encoded font. c = Canvas(outputfile('test_pdfbase_encodings.pdf')) c.setPageCompression(0) c.setFont('Helvetica', 12) c.drawString(100, 700, 'The text below should be in a custom encoding in which all vowels become "z"') # invent a new language where vowels are replaced with letter 'z' zenc = pdfmetrics.Encoding('EncodingWithoutVowels', 'WinAnsiEncoding') for ch in 'aeiou': zenc[ord(ch)] = 'z' for ch in 'AEIOU': zenc[ord(ch)] = 'Z' pdfmetrics.registerEncoding(zenc) # now we can make a font based on this encoding # AR hack/workaround: the name of the encoding must be a Python codec! f = pdfmetrics.Font('FontWithoutVowels', 'Helvetica-Oblique', 'EncodingWithoutVowels') pdfmetrics.registerFont(f) c.setFont('FontWithoutVowels', 12) c.drawString(125, 675, "The magic word is squamish ossifrage") # now demonstrate adding a Euro to MacRoman, which lacks one c.setFont('Helvetica', 12) c.drawString(100, 650, "MacRoman encoding lacks a Euro. We'll make a Mac font with the Euro at #219:") # WinAnsi Helvetica pdfmetrics.registerFont(pdfmetrics.Font('Helvetica-WinAnsi', 'Helvetica-Oblique', 'WinAnsiEncoding')) c.setFont('Helvetica-WinAnsi', 12) c.drawString(125, 625, 'WinAnsi with Euro: character 128 = "\200"') pdfmetrics.registerFont(pdfmetrics.Font('MacHelvNoEuro', 'Helvetica-Oblique', 'MacRomanEncoding')) c.setFont('MacHelvNoEuro', 12) c.drawString(125, 600, 'Standard MacRoman, no Euro: Character 219 = "\333"') # oct(219)=0333 # now make our hacked encoding euroMac = pdfmetrics.Encoding('MacWithEuro', 'MacRomanEncoding') euroMac[219] = 'Euro' pdfmetrics.registerEncoding(euroMac) pdfmetrics.registerFont(pdfmetrics.Font('MacHelvWithEuro', 'Helvetica-Oblique', 'MacWithEuro')) c.setFont('MacHelvWithEuro', 12) c.drawString(125, 575, 'Hacked MacRoman with Euro: Character 219 = "\333"') # oct(219)=0333 # now test width setting with and without _rl_accel - harder # make an encoding where 'm' becomes 'i' c.setFont('Helvetica', 12) c.drawString(100, 500, "Recode 'm' to 'i' and check we can measure widths. Boxes should surround letters.") sample = 'Mmmmm. ' * 6 + 'Mmmm' c.setFont('Helvetica-Oblique',12) c.drawString(125, 475, sample) w = c.stringWidth(sample, 'Helvetica-Oblique', 12) c.rect(125, 475, w, 12) narrowEnc = pdfmetrics.Encoding('m-to-i') narrowEnc[ord('m')] = 'i' narrowEnc[ord('M')] = 'I' pdfmetrics.registerEncoding(narrowEnc) pdfmetrics.registerFont(pdfmetrics.Font('narrow', 'Helvetica-Oblique', 'm-to-i')) c.setFont('narrow', 12) c.drawString(125, 450, sample) w = c.stringWidth(sample, 'narrow', 12) c.rect(125, 450, w, 12) c.setFont('Helvetica', 12) c.drawString(100, 400, "Symbol & Dingbats fonts - check we still get valid PDF in StandardEncoding") c.setFont('Symbol', 12) c.drawString(100, 375, 'abcdefghijklmn') c.setFont('ZapfDingbats', 12) c.drawString(300, 375, 'abcdefghijklmn') c.save() def makeSuite(): return makeSuiteForClasses( TextEncodingTestCase, #FontEncodingTestCase - nobbled for now due to old stuff which needs removing. ) #noruntests if __name__ == "__main__": unittest.TextTestRunner().run(makeSuite()) printLocation()
subsetToUnicode
identifier_name
user_defined.py
# Author: Prabhu Ramachandran <prabhu [at] aero . iitb . ac . in> # Copyright (c) 2008, Enthought, Inc. # License: BSD Style. # Enthought library imports. from tvtk.tools.tvtk_doc import TVTKFilterChooser, TVTK_FILTERS # Local imports. from mayavi.filters.filter_base import FilterBase from mayavi.core.common import handle_children_state, error from mayavi.core.pipeline_info import PipelineInfo ################################################################################ # `UserDefined` class. ################################################################################ class UserDefined(FilterBase): """ This filter lets the user define their own filter dynamically/interactively. It is like `FilterBase` but allows a user to specify the class without writing any code. """ # The version of this class. Used for persistence. __version__ = 0 input_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) output_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) ###################################################################### # `object` interface. ###################################################################### def __set_pure_state__(self, state): # Create and set the filter. children = [f for f in [self.filter] if f is not None] handle_children_state(children, [state.filter]) self.filter = children[0] self.update_pipeline() # Restore our state. super(UserDefined, self).__set_pure_state__(state) ###################################################################### # `UserDefined` interface. ###################################################################### def setup_filter(self):
###################################################################### # Non-public interface. ###################################################################### def _choose_filter(self): chooser = TVTKFilterChooser() chooser.edit_traits(kind='livemodal') obj = chooser.object if obj is None: error('Invalid filter chosen! Try again!') return obj def _check_object(self, obj): if obj is None: return False if obj.__class__.__name__ in TVTK_FILTERS: return True return False def _filter_changed(self, old, new): self.name = 'UserDefined:%s'%new.__class__.__name__ super(UserDefined, self)._filter_changed(old, new)
"""Setup the filter if none has been set or check it if it already has been.""" obj = self.filter if not self._check_object(obj): if obj is not None: cname = obj.__class__.__name__ error('Invalid filter %s chosen! Try again!'%cname) obj = self._choose_filter() self.filter = obj
identifier_body
user_defined.py
# Author: Prabhu Ramachandran <prabhu [at] aero . iitb . ac . in> # Copyright (c) 2008, Enthought, Inc. # License: BSD Style. # Enthought library imports. from tvtk.tools.tvtk_doc import TVTKFilterChooser, TVTK_FILTERS # Local imports. from mayavi.filters.filter_base import FilterBase from mayavi.core.common import handle_children_state, error from mayavi.core.pipeline_info import PipelineInfo ################################################################################ # `UserDefined` class. ################################################################################ class UserDefined(FilterBase): """ This filter lets the user define their own filter dynamically/interactively. It is like `FilterBase` but allows a user to specify the class without writing any code. """ # The version of this class. Used for persistence. __version__ = 0 input_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) output_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) ###################################################################### # `object` interface. ###################################################################### def __set_pure_state__(self, state): # Create and set the filter. children = [f for f in [self.filter] if f is not None] handle_children_state(children, [state.filter]) self.filter = children[0] self.update_pipeline() # Restore our state. super(UserDefined, self).__set_pure_state__(state) ###################################################################### # `UserDefined` interface. ###################################################################### def setup_filter(self):
cname = obj.__class__.__name__ error('Invalid filter %s chosen! Try again!'%cname) obj = self._choose_filter() self.filter = obj ###################################################################### # Non-public interface. ###################################################################### def _choose_filter(self): chooser = TVTKFilterChooser() chooser.edit_traits(kind='livemodal') obj = chooser.object if obj is None: error('Invalid filter chosen! Try again!') return obj def _check_object(self, obj): if obj is None: return False if obj.__class__.__name__ in TVTK_FILTERS: return True return False def _filter_changed(self, old, new): self.name = 'UserDefined:%s'%new.__class__.__name__ super(UserDefined, self)._filter_changed(old, new)
"""Setup the filter if none has been set or check it if it already has been.""" obj = self.filter if not self._check_object(obj): if obj is not None:
random_line_split
user_defined.py
# Author: Prabhu Ramachandran <prabhu [at] aero . iitb . ac . in> # Copyright (c) 2008, Enthought, Inc. # License: BSD Style. # Enthought library imports. from tvtk.tools.tvtk_doc import TVTKFilterChooser, TVTK_FILTERS # Local imports. from mayavi.filters.filter_base import FilterBase from mayavi.core.common import handle_children_state, error from mayavi.core.pipeline_info import PipelineInfo ################################################################################ # `UserDefined` class. ################################################################################ class UserDefined(FilterBase): """ This filter lets the user define their own filter dynamically/interactively. It is like `FilterBase` but allows a user to specify the class without writing any code. """ # The version of this class. Used for persistence. __version__ = 0 input_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) output_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) ###################################################################### # `object` interface. ###################################################################### def __set_pure_state__(self, state): # Create and set the filter. children = [f for f in [self.filter] if f is not None] handle_children_state(children, [state.filter]) self.filter = children[0] self.update_pipeline() # Restore our state. super(UserDefined, self).__set_pure_state__(state) ###################################################################### # `UserDefined` interface. ###################################################################### def setup_filter(self): """Setup the filter if none has been set or check it if it already has been.""" obj = self.filter if not self._check_object(obj): if obj is not None: cname = obj.__class__.__name__ error('Invalid filter %s chosen! Try again!'%cname) obj = self._choose_filter() self.filter = obj ###################################################################### # Non-public interface. ###################################################################### def
(self): chooser = TVTKFilterChooser() chooser.edit_traits(kind='livemodal') obj = chooser.object if obj is None: error('Invalid filter chosen! Try again!') return obj def _check_object(self, obj): if obj is None: return False if obj.__class__.__name__ in TVTK_FILTERS: return True return False def _filter_changed(self, old, new): self.name = 'UserDefined:%s'%new.__class__.__name__ super(UserDefined, self)._filter_changed(old, new)
_choose_filter
identifier_name
user_defined.py
# Author: Prabhu Ramachandran <prabhu [at] aero . iitb . ac . in> # Copyright (c) 2008, Enthought, Inc. # License: BSD Style. # Enthought library imports. from tvtk.tools.tvtk_doc import TVTKFilterChooser, TVTK_FILTERS # Local imports. from mayavi.filters.filter_base import FilterBase from mayavi.core.common import handle_children_state, error from mayavi.core.pipeline_info import PipelineInfo ################################################################################ # `UserDefined` class. ################################################################################ class UserDefined(FilterBase): """ This filter lets the user define their own filter dynamically/interactively. It is like `FilterBase` but allows a user to specify the class without writing any code. """ # The version of this class. Used for persistence. __version__ = 0 input_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) output_info = PipelineInfo(datasets=['any'], attribute_types=['any'], attributes=['any']) ###################################################################### # `object` interface. ###################################################################### def __set_pure_state__(self, state): # Create and set the filter. children = [f for f in [self.filter] if f is not None] handle_children_state(children, [state.filter]) self.filter = children[0] self.update_pipeline() # Restore our state. super(UserDefined, self).__set_pure_state__(state) ###################################################################### # `UserDefined` interface. ###################################################################### def setup_filter(self): """Setup the filter if none has been set or check it if it already has been.""" obj = self.filter if not self._check_object(obj): if obj is not None:
obj = self._choose_filter() self.filter = obj ###################################################################### # Non-public interface. ###################################################################### def _choose_filter(self): chooser = TVTKFilterChooser() chooser.edit_traits(kind='livemodal') obj = chooser.object if obj is None: error('Invalid filter chosen! Try again!') return obj def _check_object(self, obj): if obj is None: return False if obj.__class__.__name__ in TVTK_FILTERS: return True return False def _filter_changed(self, old, new): self.name = 'UserDefined:%s'%new.__class__.__name__ super(UserDefined, self)._filter_changed(old, new)
cname = obj.__class__.__name__ error('Invalid filter %s chosen! Try again!'%cname)
conditional_block
_hasnotematchingsubstringof.py
# # gPrime - A web-based genealogy program # # Copyright (C) 2002-2006 Donald N. Allingham # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # #------------------------------------------------------------------------- # # Standard Python modules # #------------------------------------------------------------------------- from ....const import LOCALE as glocale
#------------------------------------------------------------------------- # # Gprime modules # #------------------------------------------------------------------------- from .._hasnotesubstrbase import HasNoteSubstrBase #------------------------------------------------------------------------- # "Media having notes that contain a substring" #------------------------------------------------------------------------- class HasNoteMatchingSubstringOf(HasNoteSubstrBase): """Media having notes containing <substring>""" name = _('Media objects having notes containing <substring>') description = _("Matches media objects whose notes contain text " "matching a substring")
_ = glocale.translation.gettext
random_line_split
_hasnotematchingsubstringof.py
# # gPrime - A web-based genealogy program # # Copyright (C) 2002-2006 Donald N. Allingham # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # #------------------------------------------------------------------------- # # Standard Python modules # #------------------------------------------------------------------------- from ....const import LOCALE as glocale _ = glocale.translation.gettext #------------------------------------------------------------------------- # # Gprime modules # #------------------------------------------------------------------------- from .._hasnotesubstrbase import HasNoteSubstrBase #------------------------------------------------------------------------- # "Media having notes that contain a substring" #------------------------------------------------------------------------- class
(HasNoteSubstrBase): """Media having notes containing <substring>""" name = _('Media objects having notes containing <substring>') description = _("Matches media objects whose notes contain text " "matching a substring")
HasNoteMatchingSubstringOf
identifier_name
_hasnotematchingsubstringof.py
# # gPrime - A web-based genealogy program # # Copyright (C) 2002-2006 Donald N. Allingham # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # #------------------------------------------------------------------------- # # Standard Python modules # #------------------------------------------------------------------------- from ....const import LOCALE as glocale _ = glocale.translation.gettext #------------------------------------------------------------------------- # # Gprime modules # #------------------------------------------------------------------------- from .._hasnotesubstrbase import HasNoteSubstrBase #------------------------------------------------------------------------- # "Media having notes that contain a substring" #------------------------------------------------------------------------- class HasNoteMatchingSubstringOf(HasNoteSubstrBase):
"""Media having notes containing <substring>""" name = _('Media objects having notes containing <substring>') description = _("Matches media objects whose notes contain text " "matching a substring")
identifier_body
membership.js
import React, { Component } from 'react'; import { Menu, Dropdown, Button, Icon, message } from 'antd'; import { Link } from 'react-router'; import EmployeeTable from './table'; import { memberShip, employee, columns } from '../../accessConfig/employeeList'; import DropdownList from './../../commons/dropdown'; import { inject, observer } from 'mobx-react'; function handleButtonClick(e) { message.info('Click on left button.'); console.log('click left button', e); } function handleMenuClick(e) { message.info('Click on menu item.'); console.log('click', e); } const menu = ( <Menu onClick={handleMenuClick}> <Menu.Item key="1">1st menu item</Menu.Item> <Menu.Item key="2">2nd menu item</Menu.Item> <Menu.Item key="3">3d menu item</Menu.Item> </Menu> ); // <DevTools /> @inject('store') @observer export default class MemberShip extends Component { constructor(props, context) { super(props, context); this.state = { current: '1', }; } handleClick(e) { console.log('click ', e); this.setState({ current: e.key, }); } render() { const { memberShipStore } = this.props.store;
</Button> </Dropdown> <Link to="/setemployee">link</Link> <DropdownList dropdownList={memberShipStore.toJS()} mode={1} /> <Link to=""><Button type="primary">新增员工</Button></Link> <EmployeeTable columns={columns} dataSource={employee}/> </div> ) } }
return ( <div> <Dropdown overlay={menu}> <Button type="ghost" style={{ marginLeft: 8 }}> Button <Icon type="down" />
random_line_split
membership.js
import React, { Component } from 'react'; import { Menu, Dropdown, Button, Icon, message } from 'antd'; import { Link } from 'react-router'; import EmployeeTable from './table'; import { memberShip, employee, columns } from '../../accessConfig/employeeList'; import DropdownList from './../../commons/dropdown'; import { inject, observer } from 'mobx-react'; function handleButtonClick(e) { message.info('Click on left button.'); console.log('click left button', e); } function handleMenuClick(e) { message.info('Click on menu item.'); console.log('click', e); } const menu = ( <Menu onClick={handleMenuClick}> <Menu.Item key="1">1st menu item</Menu.Item> <Menu.Item key="2">2nd menu item</Menu.Item> <Menu.Item key="3">3d menu item</Menu.Item> </Menu> ); // <DevTools /> @inject('store') @observer export default class MemberShip extends Component { constructor(props, context) { super(props, context); this.state = { current: '1', }; }
(e) { console.log('click ', e); this.setState({ current: e.key, }); } render() { const { memberShipStore } = this.props.store; return ( <div> <Dropdown overlay={menu}> <Button type="ghost" style={{ marginLeft: 8 }}> Button <Icon type="down" /> </Button> </Dropdown> <Link to="/setemployee">link</Link> <DropdownList dropdownList={memberShipStore.toJS()} mode={1} /> <Link to=""><Button type="primary">新增员工</Button></Link> <EmployeeTable columns={columns} dataSource={employee}/> </div> ) } }
handleClick
identifier_name
membership.js
import React, { Component } from 'react'; import { Menu, Dropdown, Button, Icon, message } from 'antd'; import { Link } from 'react-router'; import EmployeeTable from './table'; import { memberShip, employee, columns } from '../../accessConfig/employeeList'; import DropdownList from './../../commons/dropdown'; import { inject, observer } from 'mobx-react'; function handleButtonClick(e) { message.info('Click on left button.'); console.log('click left button', e); } function handleMenuClick(e) { message.info('Click on menu item.'); console.log('click', e); } const menu = ( <Menu onClick={handleMenuClick}> <Menu.Item key="1">1st menu item</Menu.Item> <Menu.Item key="2">2nd menu item</Menu.Item> <Menu.Item key="3">3d menu item</Menu.Item> </Menu> ); // <DevTools /> @inject('store') @observer export default class MemberShip extends Component { constructor(props, context) { super(props, context); this.state = { current: '1', }; } handleClick(e) { console.log('click ', e); this.setState({ current: e.key, }); } render()
{ const { memberShipStore } = this.props.store; return ( <div> <Dropdown overlay={menu}> <Button type="ghost" style={{ marginLeft: 8 }}> Button <Icon type="down" /> </Button> </Dropdown> <Link to="/setemployee">link</Link> <DropdownList dropdownList={memberShipStore.toJS()} mode={1} /> <Link to=""><Button type="primary">新增员工</Button></Link> <EmployeeTable columns={columns} dataSource={employee}/> </div> ) } }
identifier_body
ed_handler.py
# Copyright (c) 2001-2015, Canal TP and/or its affiliates. All rights reserved. # # This file is part of Navitia, # the software to build cool stuff with public transport. # # Hope you'll enjoy and contribute to this project, # powered by Canal TP (www.canaltp.fr). # Help us simplify mobility and open public transport: # a non ending quest to the responsive locomotion way of traveling! # # LICENCE: This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # # Stay tuned using # twitter @navitia # IRC #navitia on freenode # https://groups.google.com/d/forum/navitia # www.navitia.io from contextlib import contextmanager import glob import os from navitiacommon import utils, launch_exec from navitiacommon.launch_exec import launch_exec import psycopg2 import zipfile import logging ALEMBIC_PATH_ED = os.environ.get('ALEMBIC_PATH', '../sql') ALEMBIC_PATH_CITIES = os.environ.get('ALEMBIC_PATH_CITIES', '../cities') @contextmanager def cd(new_dir): """ small helper to change the current dir """ prev_dir = os.getcwd() os.chdir(os.path.expanduser(new_dir)) try: yield finally: os.chdir(prev_dir) def binarize(ed_db_params, output, ed_component_path, cities_db_params): logger = logging.getLogger(__name__) logger.info('creating data.nav') ed2nav = 'ed2nav' if ed_component_path: ed2nav = os.path.join(ed_component_path, ed2nav) launch_exec( ed2nav, [ "-o", output, "--connection-string", ed_db_params.old_school_cnx_string(), "--cities-connection-string", cities_db_params.old_school_cnx_string(), ], logger, ) logger.info("data.nav is created successfully: {}".format(output)) def import_data(data_dir, db_params, ed_component_path): """ call the right component to import the data in the directory we loop through all files until we recognize one on them """ log = logging.getLogger(__name__) files = glob.glob(data_dir + "/*") data_type, file_to_load = utils.type_of_data(files) if not data_type: log.info('unknown data type for dir {}, skipping'.format(data_dir)) return # Note, we consider that we only have to load one kind of data per directory import_component = data_type + '2ed' if ed_component_path: import_component = os.path.join(ed_component_path, import_component) if file_to_load.endswith('.zip') or file_to_load.endswith('.geopal'): # TODO: handle geopal as non zip # if it's a zip, we unzip it zip_file = zipfile.ZipFile(file_to_load) zip_file.extractall(path=data_dir) file_to_load = data_dir if launch_exec( import_component, ["-i", file_to_load, "--connection-string", db_params.old_school_cnx_string()], log ): raise Exception('Error: problem with running {}, stoping'.format(import_component)) def load_cities(cities_file, cities_db_params, cities_exec_path): logger = logging.getLogger(__name__) cities_exec = os.path.join(cities_exec_path, 'cities') if launch_exec( cities_exec, ["-i", cities_file, "--connection-string", cities_db_params.old_school_cnx_string()], logger ): raise Exception('Error: problem with running {}, stoping'.format(cities_exec)) def load_data(data_dirs, ed_db_params, ed_component_path):
logging.getLogger(__name__).info('loading {}'.format(data_dirs)) for d in data_dirs: import_data(d, ed_db_params, ed_component_path) def update_db(db_params, alembic_path): """ enable postgis on the db and update it's scheme """ cnx_string = db_params.cnx_string() # we need to enable postgis on the db cnx = psycopg2.connect( database=db_params.dbname, user=db_params.user, password=db_params.password, host=db_params.host ) c = cnx.cursor() c.execute("create extension postgis;") c.close() cnx.commit() logging.getLogger(__name__).info('message = {}'.format(c.statusmessage)) with cd(alembic_path): res = os.system('PYTHONPATH=. alembic -x dbname="{cnx}" upgrade head'.format(cnx=cnx_string)) if res: raise Exception('problem with db update') def generate_nav( data_dir, docker_ed, docker_cities, output_file, ed_component_path, cities_exec_path, import_cities ): """ load all data either directly in data_dir if there is no sub dir, or all data in the subdir """ cities_db_params = docker_cities.get_db_params() update_db(cities_db_params, ALEMBIC_PATH_CITIES) ed_db_params = docker_ed.get_db_params() update_db(ed_db_params, ALEMBIC_PATH_ED) if import_cities: if not os.path.exists(import_cities): raise Exception('Error: impossible to find {}, exiting'.format(import_cities)) load_cities(import_cities, cities_db_params, cities_exec_path) if not os.path.exists(data_dir): raise Exception('Error: impossible to find {}, exiting'.format(data_dir)) data_dirs = [ os.path.join(data_dir, sub_dir_name) for sub_dir_name in os.listdir(data_dir) if os.path.isdir(os.path.join(data_dir, sub_dir_name)) ] or [ data_dir ] # if there is no sub dir, we import only the files in the dir load_data(data_dirs, ed_db_params, ed_component_path) binarize(ed_db_params, output_file, ed_component_path, cities_db_params)
random_line_split
ed_handler.py
# Copyright (c) 2001-2015, Canal TP and/or its affiliates. All rights reserved. # # This file is part of Navitia, # the software to build cool stuff with public transport. # # Hope you'll enjoy and contribute to this project, # powered by Canal TP (www.canaltp.fr). # Help us simplify mobility and open public transport: # a non ending quest to the responsive locomotion way of traveling! # # LICENCE: This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # # Stay tuned using # twitter @navitia # IRC #navitia on freenode # https://groups.google.com/d/forum/navitia # www.navitia.io from contextlib import contextmanager import glob import os from navitiacommon import utils, launch_exec from navitiacommon.launch_exec import launch_exec import psycopg2 import zipfile import logging ALEMBIC_PATH_ED = os.environ.get('ALEMBIC_PATH', '../sql') ALEMBIC_PATH_CITIES = os.environ.get('ALEMBIC_PATH_CITIES', '../cities') @contextmanager def cd(new_dir): """ small helper to change the current dir """ prev_dir = os.getcwd() os.chdir(os.path.expanduser(new_dir)) try: yield finally: os.chdir(prev_dir) def binarize(ed_db_params, output, ed_component_path, cities_db_params): logger = logging.getLogger(__name__) logger.info('creating data.nav') ed2nav = 'ed2nav' if ed_component_path: ed2nav = os.path.join(ed_component_path, ed2nav) launch_exec( ed2nav, [ "-o", output, "--connection-string", ed_db_params.old_school_cnx_string(), "--cities-connection-string", cities_db_params.old_school_cnx_string(), ], logger, ) logger.info("data.nav is created successfully: {}".format(output)) def import_data(data_dir, db_params, ed_component_path): """ call the right component to import the data in the directory we loop through all files until we recognize one on them """ log = logging.getLogger(__name__) files = glob.glob(data_dir + "/*") data_type, file_to_load = utils.type_of_data(files) if not data_type: log.info('unknown data type for dir {}, skipping'.format(data_dir)) return # Note, we consider that we only have to load one kind of data per directory import_component = data_type + '2ed' if ed_component_path: import_component = os.path.join(ed_component_path, import_component) if file_to_load.endswith('.zip') or file_to_load.endswith('.geopal'): # TODO: handle geopal as non zip # if it's a zip, we unzip it zip_file = zipfile.ZipFile(file_to_load) zip_file.extractall(path=data_dir) file_to_load = data_dir if launch_exec( import_component, ["-i", file_to_load, "--connection-string", db_params.old_school_cnx_string()], log ): raise Exception('Error: problem with running {}, stoping'.format(import_component)) def load_cities(cities_file, cities_db_params, cities_exec_path): logger = logging.getLogger(__name__) cities_exec = os.path.join(cities_exec_path, 'cities') if launch_exec( cities_exec, ["-i", cities_file, "--connection-string", cities_db_params.old_school_cnx_string()], logger ): raise Exception('Error: problem with running {}, stoping'.format(cities_exec)) def load_data(data_dirs, ed_db_params, ed_component_path): logging.getLogger(__name__).info('loading {}'.format(data_dirs)) for d in data_dirs: import_data(d, ed_db_params, ed_component_path) def
(db_params, alembic_path): """ enable postgis on the db and update it's scheme """ cnx_string = db_params.cnx_string() # we need to enable postgis on the db cnx = psycopg2.connect( database=db_params.dbname, user=db_params.user, password=db_params.password, host=db_params.host ) c = cnx.cursor() c.execute("create extension postgis;") c.close() cnx.commit() logging.getLogger(__name__).info('message = {}'.format(c.statusmessage)) with cd(alembic_path): res = os.system('PYTHONPATH=. alembic -x dbname="{cnx}" upgrade head'.format(cnx=cnx_string)) if res: raise Exception('problem with db update') def generate_nav( data_dir, docker_ed, docker_cities, output_file, ed_component_path, cities_exec_path, import_cities ): """ load all data either directly in data_dir if there is no sub dir, or all data in the subdir """ cities_db_params = docker_cities.get_db_params() update_db(cities_db_params, ALEMBIC_PATH_CITIES) ed_db_params = docker_ed.get_db_params() update_db(ed_db_params, ALEMBIC_PATH_ED) if import_cities: if not os.path.exists(import_cities): raise Exception('Error: impossible to find {}, exiting'.format(import_cities)) load_cities(import_cities, cities_db_params, cities_exec_path) if not os.path.exists(data_dir): raise Exception('Error: impossible to find {}, exiting'.format(data_dir)) data_dirs = [ os.path.join(data_dir, sub_dir_name) for sub_dir_name in os.listdir(data_dir) if os.path.isdir(os.path.join(data_dir, sub_dir_name)) ] or [ data_dir ] # if there is no sub dir, we import only the files in the dir load_data(data_dirs, ed_db_params, ed_component_path) binarize(ed_db_params, output_file, ed_component_path, cities_db_params)
update_db
identifier_name
ed_handler.py
# Copyright (c) 2001-2015, Canal TP and/or its affiliates. All rights reserved. # # This file is part of Navitia, # the software to build cool stuff with public transport. # # Hope you'll enjoy and contribute to this project, # powered by Canal TP (www.canaltp.fr). # Help us simplify mobility and open public transport: # a non ending quest to the responsive locomotion way of traveling! # # LICENCE: This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # # Stay tuned using # twitter @navitia # IRC #navitia on freenode # https://groups.google.com/d/forum/navitia # www.navitia.io from contextlib import contextmanager import glob import os from navitiacommon import utils, launch_exec from navitiacommon.launch_exec import launch_exec import psycopg2 import zipfile import logging ALEMBIC_PATH_ED = os.environ.get('ALEMBIC_PATH', '../sql') ALEMBIC_PATH_CITIES = os.environ.get('ALEMBIC_PATH_CITIES', '../cities') @contextmanager def cd(new_dir): """ small helper to change the current dir """ prev_dir = os.getcwd() os.chdir(os.path.expanduser(new_dir)) try: yield finally: os.chdir(prev_dir) def binarize(ed_db_params, output, ed_component_path, cities_db_params): logger = logging.getLogger(__name__) logger.info('creating data.nav') ed2nav = 'ed2nav' if ed_component_path: ed2nav = os.path.join(ed_component_path, ed2nav) launch_exec( ed2nav, [ "-o", output, "--connection-string", ed_db_params.old_school_cnx_string(), "--cities-connection-string", cities_db_params.old_school_cnx_string(), ], logger, ) logger.info("data.nav is created successfully: {}".format(output)) def import_data(data_dir, db_params, ed_component_path): """ call the right component to import the data in the directory we loop through all files until we recognize one on them """ log = logging.getLogger(__name__) files = glob.glob(data_dir + "/*") data_type, file_to_load = utils.type_of_data(files) if not data_type: log.info('unknown data type for dir {}, skipping'.format(data_dir)) return # Note, we consider that we only have to load one kind of data per directory import_component = data_type + '2ed' if ed_component_path: import_component = os.path.join(ed_component_path, import_component) if file_to_load.endswith('.zip') or file_to_load.endswith('.geopal'): # TODO: handle geopal as non zip # if it's a zip, we unzip it
if launch_exec( import_component, ["-i", file_to_load, "--connection-string", db_params.old_school_cnx_string()], log ): raise Exception('Error: problem with running {}, stoping'.format(import_component)) def load_cities(cities_file, cities_db_params, cities_exec_path): logger = logging.getLogger(__name__) cities_exec = os.path.join(cities_exec_path, 'cities') if launch_exec( cities_exec, ["-i", cities_file, "--connection-string", cities_db_params.old_school_cnx_string()], logger ): raise Exception('Error: problem with running {}, stoping'.format(cities_exec)) def load_data(data_dirs, ed_db_params, ed_component_path): logging.getLogger(__name__).info('loading {}'.format(data_dirs)) for d in data_dirs: import_data(d, ed_db_params, ed_component_path) def update_db(db_params, alembic_path): """ enable postgis on the db and update it's scheme """ cnx_string = db_params.cnx_string() # we need to enable postgis on the db cnx = psycopg2.connect( database=db_params.dbname, user=db_params.user, password=db_params.password, host=db_params.host ) c = cnx.cursor() c.execute("create extension postgis;") c.close() cnx.commit() logging.getLogger(__name__).info('message = {}'.format(c.statusmessage)) with cd(alembic_path): res = os.system('PYTHONPATH=. alembic -x dbname="{cnx}" upgrade head'.format(cnx=cnx_string)) if res: raise Exception('problem with db update') def generate_nav( data_dir, docker_ed, docker_cities, output_file, ed_component_path, cities_exec_path, import_cities ): """ load all data either directly in data_dir if there is no sub dir, or all data in the subdir """ cities_db_params = docker_cities.get_db_params() update_db(cities_db_params, ALEMBIC_PATH_CITIES) ed_db_params = docker_ed.get_db_params() update_db(ed_db_params, ALEMBIC_PATH_ED) if import_cities: if not os.path.exists(import_cities): raise Exception('Error: impossible to find {}, exiting'.format(import_cities)) load_cities(import_cities, cities_db_params, cities_exec_path) if not os.path.exists(data_dir): raise Exception('Error: impossible to find {}, exiting'.format(data_dir)) data_dirs = [ os.path.join(data_dir, sub_dir_name) for sub_dir_name in os.listdir(data_dir) if os.path.isdir(os.path.join(data_dir, sub_dir_name)) ] or [ data_dir ] # if there is no sub dir, we import only the files in the dir load_data(data_dirs, ed_db_params, ed_component_path) binarize(ed_db_params, output_file, ed_component_path, cities_db_params)
zip_file = zipfile.ZipFile(file_to_load) zip_file.extractall(path=data_dir) file_to_load = data_dir
conditional_block
ed_handler.py
# Copyright (c) 2001-2015, Canal TP and/or its affiliates. All rights reserved. # # This file is part of Navitia, # the software to build cool stuff with public transport. # # Hope you'll enjoy and contribute to this project, # powered by Canal TP (www.canaltp.fr). # Help us simplify mobility and open public transport: # a non ending quest to the responsive locomotion way of traveling! # # LICENCE: This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # # Stay tuned using # twitter @navitia # IRC #navitia on freenode # https://groups.google.com/d/forum/navitia # www.navitia.io from contextlib import contextmanager import glob import os from navitiacommon import utils, launch_exec from navitiacommon.launch_exec import launch_exec import psycopg2 import zipfile import logging ALEMBIC_PATH_ED = os.environ.get('ALEMBIC_PATH', '../sql') ALEMBIC_PATH_CITIES = os.environ.get('ALEMBIC_PATH_CITIES', '../cities') @contextmanager def cd(new_dir): """ small helper to change the current dir """ prev_dir = os.getcwd() os.chdir(os.path.expanduser(new_dir)) try: yield finally: os.chdir(prev_dir) def binarize(ed_db_params, output, ed_component_path, cities_db_params): logger = logging.getLogger(__name__) logger.info('creating data.nav') ed2nav = 'ed2nav' if ed_component_path: ed2nav = os.path.join(ed_component_path, ed2nav) launch_exec( ed2nav, [ "-o", output, "--connection-string", ed_db_params.old_school_cnx_string(), "--cities-connection-string", cities_db_params.old_school_cnx_string(), ], logger, ) logger.info("data.nav is created successfully: {}".format(output)) def import_data(data_dir, db_params, ed_component_path): """ call the right component to import the data in the directory we loop through all files until we recognize one on them """ log = logging.getLogger(__name__) files = glob.glob(data_dir + "/*") data_type, file_to_load = utils.type_of_data(files) if not data_type: log.info('unknown data type for dir {}, skipping'.format(data_dir)) return # Note, we consider that we only have to load one kind of data per directory import_component = data_type + '2ed' if ed_component_path: import_component = os.path.join(ed_component_path, import_component) if file_to_load.endswith('.zip') or file_to_load.endswith('.geopal'): # TODO: handle geopal as non zip # if it's a zip, we unzip it zip_file = zipfile.ZipFile(file_to_load) zip_file.extractall(path=data_dir) file_to_load = data_dir if launch_exec( import_component, ["-i", file_to_load, "--connection-string", db_params.old_school_cnx_string()], log ): raise Exception('Error: problem with running {}, stoping'.format(import_component)) def load_cities(cities_file, cities_db_params, cities_exec_path):
def load_data(data_dirs, ed_db_params, ed_component_path): logging.getLogger(__name__).info('loading {}'.format(data_dirs)) for d in data_dirs: import_data(d, ed_db_params, ed_component_path) def update_db(db_params, alembic_path): """ enable postgis on the db and update it's scheme """ cnx_string = db_params.cnx_string() # we need to enable postgis on the db cnx = psycopg2.connect( database=db_params.dbname, user=db_params.user, password=db_params.password, host=db_params.host ) c = cnx.cursor() c.execute("create extension postgis;") c.close() cnx.commit() logging.getLogger(__name__).info('message = {}'.format(c.statusmessage)) with cd(alembic_path): res = os.system('PYTHONPATH=. alembic -x dbname="{cnx}" upgrade head'.format(cnx=cnx_string)) if res: raise Exception('problem with db update') def generate_nav( data_dir, docker_ed, docker_cities, output_file, ed_component_path, cities_exec_path, import_cities ): """ load all data either directly in data_dir if there is no sub dir, or all data in the subdir """ cities_db_params = docker_cities.get_db_params() update_db(cities_db_params, ALEMBIC_PATH_CITIES) ed_db_params = docker_ed.get_db_params() update_db(ed_db_params, ALEMBIC_PATH_ED) if import_cities: if not os.path.exists(import_cities): raise Exception('Error: impossible to find {}, exiting'.format(import_cities)) load_cities(import_cities, cities_db_params, cities_exec_path) if not os.path.exists(data_dir): raise Exception('Error: impossible to find {}, exiting'.format(data_dir)) data_dirs = [ os.path.join(data_dir, sub_dir_name) for sub_dir_name in os.listdir(data_dir) if os.path.isdir(os.path.join(data_dir, sub_dir_name)) ] or [ data_dir ] # if there is no sub dir, we import only the files in the dir load_data(data_dirs, ed_db_params, ed_component_path) binarize(ed_db_params, output_file, ed_component_path, cities_db_params)
logger = logging.getLogger(__name__) cities_exec = os.path.join(cities_exec_path, 'cities') if launch_exec( cities_exec, ["-i", cities_file, "--connection-string", cities_db_params.old_school_cnx_string()], logger ): raise Exception('Error: problem with running {}, stoping'.format(cities_exec))
identifier_body
MasterRegistry.ts
import { Reducer, ReducersMapObject, ActionCreatorsMapObject } from "redux"; import { store } from "../store/store"; import combineReducersWithRoot from "./combineReducersWithRoot"; import SeqPartRegistry from "./SeqPartRegistry"; import SeqPart from "../seqpart/SeqPart"; import PluginRegistry from "./PluginRegistry"; import { AudioEndpoint } from "../interfaces/interfaces"; import { IPlugin, IPluginConstructor } from "../interfaces/IRegistryItems";
// this file has a method also called "addPlugin" // so we'll rename it to avoid confusion. const addPluginAction = addPlugin; const removePluginAction = removePlugin; /** * Calls the appropriate sub-registries * and adds new items to the state and reducers map * * This is not derived from AbstractRegistry, * it's more like an orchestrator class. */ export default class MasterRegistry { private plugins: PluginRegistry; private seqParts: SeqPartRegistry; public constructor(private ac: AudioContext) { this.plugins = new PluginRegistry(ac); this.seqParts = new SeqPartRegistry(); } public addPlugin(pluginClass: IPluginConstructor): string { const newPlugin: IPlugin = this.plugins.add(pluginClass); // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPluginAction(newPlugin.uid)); // make the new item observe the store newPlugin.unsubscribe = this.plugins.observeStore(store, newPlugin); return newPlugin.uid; } public removePlugin(itemId: string): void { this.plugins.remove(itemId); this.replaceReducer(); store.dispatch(removePluginAction(itemId)); } public addSeqPart(lengthInStepsPerBar?: number): string { let newPart: SeqPart; // add new item to the seqPart Registry if (lengthInStepsPerBar) { newPart = this.seqParts.add(lengthInStepsPerBar); } else { newPart = this.seqParts.add(); } // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPart(newPart.uid)); // make the new item observe the store newPart.unsubscribe = this.seqParts.observeStore(store, newPart); return newPart.uid; } public removeSeqPart(itemId: string): void { this.seqParts.remove(itemId); this.replaceReducer(); store.dispatch(removePart(itemId)); } public getActionCreators(itemId: string, bound?: string): ActionCreatorsMapObject { const pluginKeys = this.plugins.getUidList(); const seqPartKeys = this.seqParts.getUidList(); const actionCreatorsType = bound === "unbound" ? "unboundActionCreators" : "actionCreators"; let actionCreators: ActionCreatorsMapObject = {}; if (pluginKeys.includes(itemId)) { const item = this.plugins.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } else if (seqPartKeys.includes(itemId)) { const item = this.seqParts.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } return actionCreators; } /** * Connects two audio endpoints and dispatches the new state. * If the id of the input plugin is not valid, it connects to the soundcard input. * If the id of the output plugin is not valid, it cancels the operation. * @param connection Audio endpoints to be connected */ public connectAudioNodes(connection: [AudioEndpoint, AudioEndpoint]): void { const output = connection[0]; const input = connection[1]; const pluginOut = this.plugins.itemList.get(output[0]); const pluginIn = this.plugins.itemList.get(input[0]); if (typeof pluginOut === "undefined") { return; } const audioNodeOut = pluginOut.outputs[output[1]]; const audioNodeIn = pluginIn ? pluginIn.inputs[input[1]] : this.ac.destination; if (audioNodeIn.numberOfOutputs === 0) { input[0] = "destination"; // enshure that no wrong id will be dispatched } audioNodeOut.disconnect(); audioNodeOut.connect(audioNodeIn); store.dispatch(connectAudioNodes(connection)); } /** * Combines all sub reducers with the root reducer * and replaces the current reducer */ private replaceReducer(): void { const pluginReducers: ReducersMapObject = this.plugins.getAllSubReducers(); const seqPartReducers: ReducersMapObject = this.seqParts.getAllSubReducers(); const subReducers: ReducersMapObject = this.getSubReducer(pluginReducers, seqPartReducers); const reducerTree: Reducer = this.getCompleteReducer(rootReducer, subReducers); store.replaceReducer(reducerTree); } private getSubReducer(...subReducers: ReducersMapObject[]): ReducersMapObject { return Object.assign({}, ...subReducers); } private getCompleteReducer(rootReducer: Reducer, subReducers: ReducersMapObject): Reducer { return combineReducersWithRoot(subReducers, rootReducer); } }
import rootReducer from "../store/rootReducer"; import { addPlugin, addPart, removePlugin, removePart, connectAudioNodes } from "../store/rootActions";
random_line_split
MasterRegistry.ts
import { Reducer, ReducersMapObject, ActionCreatorsMapObject } from "redux"; import { store } from "../store/store"; import combineReducersWithRoot from "./combineReducersWithRoot"; import SeqPartRegistry from "./SeqPartRegistry"; import SeqPart from "../seqpart/SeqPart"; import PluginRegistry from "./PluginRegistry"; import { AudioEndpoint } from "../interfaces/interfaces"; import { IPlugin, IPluginConstructor } from "../interfaces/IRegistryItems"; import rootReducer from "../store/rootReducer"; import { addPlugin, addPart, removePlugin, removePart, connectAudioNodes } from "../store/rootActions"; // this file has a method also called "addPlugin" // so we'll rename it to avoid confusion. const addPluginAction = addPlugin; const removePluginAction = removePlugin; /** * Calls the appropriate sub-registries * and adds new items to the state and reducers map * * This is not derived from AbstractRegistry, * it's more like an orchestrator class. */ export default class MasterRegistry { private plugins: PluginRegistry; private seqParts: SeqPartRegistry; public constructor(private ac: AudioContext) { this.plugins = new PluginRegistry(ac); this.seqParts = new SeqPartRegistry(); } public addPlugin(pluginClass: IPluginConstructor): string { const newPlugin: IPlugin = this.plugins.add(pluginClass); // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPluginAction(newPlugin.uid)); // make the new item observe the store newPlugin.unsubscribe = this.plugins.observeStore(store, newPlugin); return newPlugin.uid; } public removePlugin(itemId: string): void { this.plugins.remove(itemId); this.replaceReducer(); store.dispatch(removePluginAction(itemId)); } public addSeqPart(lengthInStepsPerBar?: number): string { let newPart: SeqPart; // add new item to the seqPart Registry if (lengthInStepsPerBar) { newPart = this.seqParts.add(lengthInStepsPerBar); } else { newPart = this.seqParts.add(); } // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPart(newPart.uid)); // make the new item observe the store newPart.unsubscribe = this.seqParts.observeStore(store, newPart); return newPart.uid; } public removeSeqPart(itemId: string): void { this.seqParts.remove(itemId); this.replaceReducer(); store.dispatch(removePart(itemId)); } public getActionCreators(itemId: string, bound?: string): ActionCreatorsMapObject { const pluginKeys = this.plugins.getUidList(); const seqPartKeys = this.seqParts.getUidList(); const actionCreatorsType = bound === "unbound" ? "unboundActionCreators" : "actionCreators"; let actionCreators: ActionCreatorsMapObject = {}; if (pluginKeys.includes(itemId)) { const item = this.plugins.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } else if (seqPartKeys.includes(itemId)) { const item = this.seqParts.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } return actionCreators; } /** * Connects two audio endpoints and dispatches the new state. * If the id of the input plugin is not valid, it connects to the soundcard input. * If the id of the output plugin is not valid, it cancels the operation. * @param connection Audio endpoints to be connected */ public connectAudioNodes(connection: [AudioEndpoint, AudioEndpoint]): void { const output = connection[0]; const input = connection[1]; const pluginOut = this.plugins.itemList.get(output[0]); const pluginIn = this.plugins.itemList.get(input[0]); if (typeof pluginOut === "undefined") { return; } const audioNodeOut = pluginOut.outputs[output[1]]; const audioNodeIn = pluginIn ? pluginIn.inputs[input[1]] : this.ac.destination; if (audioNodeIn.numberOfOutputs === 0) { input[0] = "destination"; // enshure that no wrong id will be dispatched } audioNodeOut.disconnect(); audioNodeOut.connect(audioNodeIn); store.dispatch(connectAudioNodes(connection)); } /** * Combines all sub reducers with the root reducer * and replaces the current reducer */ private
(): void { const pluginReducers: ReducersMapObject = this.plugins.getAllSubReducers(); const seqPartReducers: ReducersMapObject = this.seqParts.getAllSubReducers(); const subReducers: ReducersMapObject = this.getSubReducer(pluginReducers, seqPartReducers); const reducerTree: Reducer = this.getCompleteReducer(rootReducer, subReducers); store.replaceReducer(reducerTree); } private getSubReducer(...subReducers: ReducersMapObject[]): ReducersMapObject { return Object.assign({}, ...subReducers); } private getCompleteReducer(rootReducer: Reducer, subReducers: ReducersMapObject): Reducer { return combineReducersWithRoot(subReducers, rootReducer); } }
replaceReducer
identifier_name
MasterRegistry.ts
import { Reducer, ReducersMapObject, ActionCreatorsMapObject } from "redux"; import { store } from "../store/store"; import combineReducersWithRoot from "./combineReducersWithRoot"; import SeqPartRegistry from "./SeqPartRegistry"; import SeqPart from "../seqpart/SeqPart"; import PluginRegistry from "./PluginRegistry"; import { AudioEndpoint } from "../interfaces/interfaces"; import { IPlugin, IPluginConstructor } from "../interfaces/IRegistryItems"; import rootReducer from "../store/rootReducer"; import { addPlugin, addPart, removePlugin, removePart, connectAudioNodes } from "../store/rootActions"; // this file has a method also called "addPlugin" // so we'll rename it to avoid confusion. const addPluginAction = addPlugin; const removePluginAction = removePlugin; /** * Calls the appropriate sub-registries * and adds new items to the state and reducers map * * This is not derived from AbstractRegistry, * it's more like an orchestrator class. */ export default class MasterRegistry { private plugins: PluginRegistry; private seqParts: SeqPartRegistry; public constructor(private ac: AudioContext) { this.plugins = new PluginRegistry(ac); this.seqParts = new SeqPartRegistry(); } public addPlugin(pluginClass: IPluginConstructor): string { const newPlugin: IPlugin = this.plugins.add(pluginClass); // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPluginAction(newPlugin.uid)); // make the new item observe the store newPlugin.unsubscribe = this.plugins.observeStore(store, newPlugin); return newPlugin.uid; } public removePlugin(itemId: string): void { this.plugins.remove(itemId); this.replaceReducer(); store.dispatch(removePluginAction(itemId)); } public addSeqPart(lengthInStepsPerBar?: number): string { let newPart: SeqPart; // add new item to the seqPart Registry if (lengthInStepsPerBar) { newPart = this.seqParts.add(lengthInStepsPerBar); } else { newPart = this.seqParts.add(); } // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPart(newPart.uid)); // make the new item observe the store newPart.unsubscribe = this.seqParts.observeStore(store, newPart); return newPart.uid; } public removeSeqPart(itemId: string): void { this.seqParts.remove(itemId); this.replaceReducer(); store.dispatch(removePart(itemId)); } public getActionCreators(itemId: string, bound?: string): ActionCreatorsMapObject { const pluginKeys = this.plugins.getUidList(); const seqPartKeys = this.seqParts.getUidList(); const actionCreatorsType = bound === "unbound" ? "unboundActionCreators" : "actionCreators"; let actionCreators: ActionCreatorsMapObject = {}; if (pluginKeys.includes(itemId)) { const item = this.plugins.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } else if (seqPartKeys.includes(itemId)) { const item = this.seqParts.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } return actionCreators; } /** * Connects two audio endpoints and dispatches the new state. * If the id of the input plugin is not valid, it connects to the soundcard input. * If the id of the output plugin is not valid, it cancels the operation. * @param connection Audio endpoints to be connected */ public connectAudioNodes(connection: [AudioEndpoint, AudioEndpoint]): void { const output = connection[0]; const input = connection[1]; const pluginOut = this.plugins.itemList.get(output[0]); const pluginIn = this.plugins.itemList.get(input[0]); if (typeof pluginOut === "undefined") { return; } const audioNodeOut = pluginOut.outputs[output[1]]; const audioNodeIn = pluginIn ? pluginIn.inputs[input[1]] : this.ac.destination; if (audioNodeIn.numberOfOutputs === 0) { input[0] = "destination"; // enshure that no wrong id will be dispatched } audioNodeOut.disconnect(); audioNodeOut.connect(audioNodeIn); store.dispatch(connectAudioNodes(connection)); } /** * Combines all sub reducers with the root reducer * and replaces the current reducer */ private replaceReducer(): void { const pluginReducers: ReducersMapObject = this.plugins.getAllSubReducers(); const seqPartReducers: ReducersMapObject = this.seqParts.getAllSubReducers(); const subReducers: ReducersMapObject = this.getSubReducer(pluginReducers, seqPartReducers); const reducerTree: Reducer = this.getCompleteReducer(rootReducer, subReducers); store.replaceReducer(reducerTree); } private getSubReducer(...subReducers: ReducersMapObject[]): ReducersMapObject { return Object.assign({}, ...subReducers); } private getCompleteReducer(rootReducer: Reducer, subReducers: ReducersMapObject): Reducer
}
{ return combineReducersWithRoot(subReducers, rootReducer); }
identifier_body
MasterRegistry.ts
import { Reducer, ReducersMapObject, ActionCreatorsMapObject } from "redux"; import { store } from "../store/store"; import combineReducersWithRoot from "./combineReducersWithRoot"; import SeqPartRegistry from "./SeqPartRegistry"; import SeqPart from "../seqpart/SeqPart"; import PluginRegistry from "./PluginRegistry"; import { AudioEndpoint } from "../interfaces/interfaces"; import { IPlugin, IPluginConstructor } from "../interfaces/IRegistryItems"; import rootReducer from "../store/rootReducer"; import { addPlugin, addPart, removePlugin, removePart, connectAudioNodes } from "../store/rootActions"; // this file has a method also called "addPlugin" // so we'll rename it to avoid confusion. const addPluginAction = addPlugin; const removePluginAction = removePlugin; /** * Calls the appropriate sub-registries * and adds new items to the state and reducers map * * This is not derived from AbstractRegistry, * it's more like an orchestrator class. */ export default class MasterRegistry { private plugins: PluginRegistry; private seqParts: SeqPartRegistry; public constructor(private ac: AudioContext) { this.plugins = new PluginRegistry(ac); this.seqParts = new SeqPartRegistry(); } public addPlugin(pluginClass: IPluginConstructor): string { const newPlugin: IPlugin = this.plugins.add(pluginClass); // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPluginAction(newPlugin.uid)); // make the new item observe the store newPlugin.unsubscribe = this.plugins.observeStore(store, newPlugin); return newPlugin.uid; } public removePlugin(itemId: string): void { this.plugins.remove(itemId); this.replaceReducer(); store.dispatch(removePluginAction(itemId)); } public addSeqPart(lengthInStepsPerBar?: number): string { let newPart: SeqPart; // add new item to the seqPart Registry if (lengthInStepsPerBar)
else { newPart = this.seqParts.add(); } // build a new root reducer and replace the current one this.replaceReducer(); store.dispatch(addPart(newPart.uid)); // make the new item observe the store newPart.unsubscribe = this.seqParts.observeStore(store, newPart); return newPart.uid; } public removeSeqPart(itemId: string): void { this.seqParts.remove(itemId); this.replaceReducer(); store.dispatch(removePart(itemId)); } public getActionCreators(itemId: string, bound?: string): ActionCreatorsMapObject { const pluginKeys = this.plugins.getUidList(); const seqPartKeys = this.seqParts.getUidList(); const actionCreatorsType = bound === "unbound" ? "unboundActionCreators" : "actionCreators"; let actionCreators: ActionCreatorsMapObject = {}; if (pluginKeys.includes(itemId)) { const item = this.plugins.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } else if (seqPartKeys.includes(itemId)) { const item = this.seqParts.itemList.get(itemId); if (item) { actionCreators = Object.assign({}, item[actionCreatorsType]); } } return actionCreators; } /** * Connects two audio endpoints and dispatches the new state. * If the id of the input plugin is not valid, it connects to the soundcard input. * If the id of the output plugin is not valid, it cancels the operation. * @param connection Audio endpoints to be connected */ public connectAudioNodes(connection: [AudioEndpoint, AudioEndpoint]): void { const output = connection[0]; const input = connection[1]; const pluginOut = this.plugins.itemList.get(output[0]); const pluginIn = this.plugins.itemList.get(input[0]); if (typeof pluginOut === "undefined") { return; } const audioNodeOut = pluginOut.outputs[output[1]]; const audioNodeIn = pluginIn ? pluginIn.inputs[input[1]] : this.ac.destination; if (audioNodeIn.numberOfOutputs === 0) { input[0] = "destination"; // enshure that no wrong id will be dispatched } audioNodeOut.disconnect(); audioNodeOut.connect(audioNodeIn); store.dispatch(connectAudioNodes(connection)); } /** * Combines all sub reducers with the root reducer * and replaces the current reducer */ private replaceReducer(): void { const pluginReducers: ReducersMapObject = this.plugins.getAllSubReducers(); const seqPartReducers: ReducersMapObject = this.seqParts.getAllSubReducers(); const subReducers: ReducersMapObject = this.getSubReducer(pluginReducers, seqPartReducers); const reducerTree: Reducer = this.getCompleteReducer(rootReducer, subReducers); store.replaceReducer(reducerTree); } private getSubReducer(...subReducers: ReducersMapObject[]): ReducersMapObject { return Object.assign({}, ...subReducers); } private getCompleteReducer(rootReducer: Reducer, subReducers: ReducersMapObject): Reducer { return combineReducersWithRoot(subReducers, rootReducer); } }
{ newPart = this.seqParts.add(lengthInStepsPerBar); }
conditional_block
code_input.ts
// Copyright 2021 The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. import 'chrome://resources/cr_elements/cr_input/cr_input.m.js'; import {CrInputElement} from 'chrome://resources/cr_elements/cr_input/cr_input.m.js'; import {html, PolymerElement} from 'chrome://resources/polymer/v3_0/polymer/polymer_bundled.min.js'; export interface CodeInputElement { $: { accessCodeInput: CrInputElement; } } export class CodeInputElement extends PolymerElement { static get is() { return 'c2c-code-input'; } static get template() { return html`{__html_template__}`; } static get properties() { return { length: Number, value: { type: String, value: '', } }; } get crInput() { return this.$.accessCodeInput; } value: string; ready()
clearInput() { this.$.accessCodeInput.value = ''; } focusInput() { this.$.accessCodeInput.focusInput(); } private handleInput() { this.$.accessCodeInput.value = this.$.accessCodeInput.value.toUpperCase(); this.dispatchEvent(new CustomEvent('access-code-input', { detail: {value: this.$.accessCodeInput.value} })); } } customElements.define(CodeInputElement.is, CodeInputElement);
{ super.ready(); this.$.accessCodeInput.addEventListener('input', () => { this.handleInput(); }); }
identifier_body
code_input.ts
// Copyright 2021 The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. import 'chrome://resources/cr_elements/cr_input/cr_input.m.js'; import {CrInputElement} from 'chrome://resources/cr_elements/cr_input/cr_input.m.js'; import {html, PolymerElement} from 'chrome://resources/polymer/v3_0/polymer/polymer_bundled.min.js'; export interface CodeInputElement { $: { accessCodeInput: CrInputElement; } } export class CodeInputElement extends PolymerElement { static get
() { return 'c2c-code-input'; } static get template() { return html`{__html_template__}`; } static get properties() { return { length: Number, value: { type: String, value: '', } }; } get crInput() { return this.$.accessCodeInput; } value: string; ready() { super.ready(); this.$.accessCodeInput.addEventListener('input', () => { this.handleInput(); }); } clearInput() { this.$.accessCodeInput.value = ''; } focusInput() { this.$.accessCodeInput.focusInput(); } private handleInput() { this.$.accessCodeInput.value = this.$.accessCodeInput.value.toUpperCase(); this.dispatchEvent(new CustomEvent('access-code-input', { detail: {value: this.$.accessCodeInput.value} })); } } customElements.define(CodeInputElement.is, CodeInputElement);
is
identifier_name
code_input.ts
// Copyright 2021 The Chromium Authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. import 'chrome://resources/cr_elements/cr_input/cr_input.m.js'; import {CrInputElement} from 'chrome://resources/cr_elements/cr_input/cr_input.m.js'; import {html, PolymerElement} from 'chrome://resources/polymer/v3_0/polymer/polymer_bundled.min.js'; export interface CodeInputElement { $: { accessCodeInput: CrInputElement; } } export class CodeInputElement extends PolymerElement { static get is() { return 'c2c-code-input'; } static get template() { return html`{__html_template__}`; } static get properties() { return { length: Number, value: { type: String, value: '', } }; } get crInput() { return this.$.accessCodeInput; } value: string; ready() { super.ready(); this.$.accessCodeInput.addEventListener('input', () => { this.handleInput(); }); } clearInput() { this.$.accessCodeInput.value = ''; }
private handleInput() { this.$.accessCodeInput.value = this.$.accessCodeInput.value.toUpperCase(); this.dispatchEvent(new CustomEvent('access-code-input', { detail: {value: this.$.accessCodeInput.value} })); } } customElements.define(CodeInputElement.is, CodeInputElement);
focusInput() { this.$.accessCodeInput.focusInput(); }
random_line_split
gc_engine.py
# -*- encoding: UTF-8 -*- import re import sys import os import traceback from ..ibdawg import IBDAWG from ..echo import echo from . import gc_options __all__ = [ "lang", "locales", "pkg", "name", "version", "author", \ "load", "parse", "getDictionary", \ "setOptions", "getOptions", "getOptionsLabels", "resetOptions", \ "ignoreRule", "resetIgnoreRules" ] __version__ = u"${version}" lang = u"${lang}" locales = ${loc} pkg = u"${implname}" name = u"${name}" version = u"${version}" author = u"${author}" # commons regexes _zEndOfSentence = re.compile(u'([.?!:;…][ .?!… »”")]*|.$)') _zBeginOfParagraph = re.compile(u"^\W*") _zEndOfParagraph = re.compile(u"\W*$") _zNextWord = re.compile(u" +(\w[\w-]*)") _zPrevWord = re.compile(u"(\w[\w-]*) +$") # grammar rules and dictionary _rules = None _dOptions = dict(gc_options.dOpt) # duplication necessary, to be able to reset to default _aIgnoredRules = set() _oDict = None _dAnalyses = {} # cache for data from dictionary _GLOBALS = globals() #### Parsing def parse (sText, sCountry="${country_default}", bDebug=False, dOptions=None): "analyses the paragraph sText and returns list of errors" aErrors = None sAlt = sText dDA = {} dOpt = _dOptions if not dOptions else dOptions # parse paragraph try: sNew, aErrors = _proofread(sText, sAlt, 0, True, dDA, sCountry, dOpt, bDebug) if sNew: sText = sNew except: raise # parse sentences for iStart, iEnd in _getSentenceBoundaries(sText): if 4 < (iEnd - iStart) < 2000: dDA.clear() try: _, errs = _proofread(sText[iStart:iEnd], sAlt[iStart:iEnd], iStart, False, dDA, sCountry, dOpt, bDebug) aErrors.extend(errs) except: raise return aErrors def _getSentenceBoundaries (sText): iStart = _zBeginOfParagraph.match(sText).end() for m in _zEndOfSentence.finditer(sText): yield (iStart, m.end()) iStart = m.end() def _proofread (s, sx, nOffset, bParagraph, dDA, sCountry, dOptions, bDebug): aErrs = [] bChange = False if not bParagraph: # after the first pass, we modify automatically some characters if u" " in s: s = s.replace(u" ", u' ') # nbsp bChange = True if u" " in s: s = s.replace(u" ", u' ') # nnbsp bChange = True if u"@" in s: s = s.replace(u"@", u' ') bChange = True if u"'" in s: s = s.replace(u"'", u"’") bChange = True if u"‑" in s: s = s.replace(u"‑", u"-") # nobreakdash bChange = True bIdRule = option('idrule') for sOption, lRuleGroup in _getRules(bParagraph): if not sOption or dOptions.get(sOption, False): for zRegex, bUppercase, sRuleId, lActions in lRuleGroup: if sRuleId not in _aIgnoredRules: for m in zRegex.finditer(s): for sFuncCond, cActionType, sWhat, *eAct in lActions: # action in lActions: [ condition, action type, replacement/suggestion/action[, iGroup[, message, URL]] ] try: if not sFuncCond or _GLOBALS[sFuncCond](s, sx, m, dDA, sCountry): if cActionType == "-": # grammar error # (text, replacement, nOffset, m, iGroup, sId, bUppercase, sURL, bIdRule) aErrs.append(_createError(s, sWhat, nOffset, m, eAct[0], sRuleId, bUppercase, eAct[1], eAct[2], bIdRule, sOption)) elif cActionType == "~": # text processor s = _rewrite(s, sWhat, eAct[0], m, bUppercase) bChange = True if bDebug: echo(u"~ " + s + " -- " + m.group(eAct[0]) + " # " + sRuleId) elif cActionType == "=": # disambiguation _GLOBALS[sWhat](s, m, dDA) if bDebug: echo(u"= " + m.group(0) + " # " + sRuleId + "\nDA: " + str(dDA)) else: echo("# error: unknown action at " + sRuleId) except Exception as e: raise Exception(str(e), sRuleId) if bChange: return (s, aErrs) return (False, aErrs) def _createWriterError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error for Writer (LO/OO)" xErr = SingleProofreadingError() #xErr = uno.createUnoStruct( "com.sun.star.linguistic2.SingleProofreadingError" ) xErr.nErrorStart = nOffset + m.start(iGroup) xErr.nErrorLength = m.end(iGroup) - m.start(iGroup) xErr.nErrorType = PROOFREADING xErr.aRuleIdentifier = sId # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, sugg.split("|"))) else: xErr.aSuggestions = tuple(sugg.split("|")) else: xErr.aSuggestions = () elif sRepl == "_": xErr.aSuggestions = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, m.expand(sRepl).split("|"))) else: xErr.aSuggestions = tuple(m.expand(sRepl).split("|")) # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) xErr.aShortComment = sMessage # sMessage.split("|")[0] # in context menu xErr.aFullComment = sMessage # sMessage.split("|")[-1] # in dialog if bIdRule: xErr.aShortComment += " # " + sId # URL if sURL: p = PropertyValue() p.Name = "FullCommentURL" p.Value = sURL xErr.aProperties = (p,) else: xErr.aProperties = () return xErr def _createDictError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error as a dictionary" dErr = {} dErr["nStart"] = nOffset + m.start(iGroup) dErr["nEnd"] = nOffset + m.end(iGroup) dErr["sRuleId"] = sId dErr["sType"] = sOption if sOption else "notype" # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, sugg.split("|"))) else: dErr["aSuggestions"] = sugg.split("|") else: dErr["aSuggestions"] = () elif sRepl == "_": dErr["aSuggestions"] = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, m.expand(sRepl).split("|"))) else: dErr["aSuggestions"] = m.expand(sRepl).split("|") # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) dErr["sMessage"] = sMessage if bIdRule: dErr["sMessage"] += " # " + sId # URL dErr["URL"] = sURL if sURL else "" return dErr def _rewrite (s, sRepl, iGroup, m, bUppercase): "text processor: write sRepl in s at iGroup position" ln = m.end(iGroup) - m.start(iGroup) if sRepl == "*": sNew = " " * ln elif sRepl == ">" or sRepl == "_" or sRepl == u"~": sNew = sRepl + " " * (ln-1) elif sRepl == "@": sNew = "@" * ln elif sRepl[0:1] == "=": if sRepl[1:2] != "@": sNew = _GLOBALS[sRepl[1:]](s, m) sNew = sNew + " " * (ln-len(sNew)) else: sNew = _GLOBALS[sRepl[2:]](s, m) sNew = sNew + "@" * (ln-len(sNew)) if bUppercase and m.group(iGroup)[0:1].isupper(): sNew = sNew.capitalize() else: sNew = m.expand(sRepl) sNew = sNew + " " * (ln-len(sNew)) return s[0:m.start(iGroup)] + sNew + s[m.end(iGroup):] def ignoreRule (sId): _aIgnoredRules.add(sId) def resetIgnoreRules (): _aIgnoredRules.clear() #### init try: # LibreOffice / OpenOffice from com.sun.star.linguistic2 import SingleProofreadingError from com.sun.star.text.TextMarkupType import PROOFREADING from com.sun.star.beans import PropertyValue #import lightproof_handler_${implname} as opt _createError = _createWriterError except ImportError: _createError = _createDictError def load (): global _oDict try: _oDict = IBDAWG("${binary_dic}") except: traceback.print_exc() def setOptions (dOpt): _dOptions.update(dOpt) def getOptions (): return _dOptions def getOptionsLabels (sLang): return gc_options.getUI(sLang) def resetOptions (): global _dOptions _dOptions = dict(gc_options.dOpt) def getDictionary (): return _oDict def _getRules (bParagraph): try: if not bParagraph: return _rules.lSentenceRules return _rules.lParagraphRules except: _loadRules() if not bParagraph: return _rules.lSentenceRules return _rules.lParagraphRules def _loadRules2 (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rule in chain(_rules.lParagraphRules, _rules.lSentenceRules): try: rule[1] = re.compile(rule[1]) except: echo("Bad regular expression in # " + str(rule[3])) rule[1] = "(?i)<Grammalecte>" def _loadRules (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rulegroup in chain(_rules.lParagraphRules, _rules.lSentenceRules): for rule in rulegroup[1]: try: rule[0] = re.compile(rule[0]) except: echo("Bad regular expression in # " + str(rule[2])) rule[0] = "(?i)<Grammalecte>" def _getPath (): return os.path.join(os.path.dirname(sys.modules[__name__].__file__), __name__ + ".py") #### common functions def option (sOpt): "return True if option sOpt is active" return _dOptions.get(sOpt, False) def displayInfo (dDA, tWord): "for debugging: retrieve info of word" if not tWord: echo("> nothing to find") return True if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): echo("> not in FSA") return True if tWord[0] in dDA: echo("DA: " + str(dDA[tWord[0]])) echo("FSA: " + str(_dAnalyses[tWord[1]])) return True def _storeMorphFromFSA (sWord): "retrieves morphologies list from _oDict -> _dAnalyses" global _dAnalyses _dAnalyses[sWord] = _oDict.getMorph(sWord) return True if _dAnalyses[sWord] else False def morph (dDA, tWord, sPattern, bStrict=True, bNoWord=False): "analyse a tuple (position, word), return True if sPattern in morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] if not lMorph: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in lMorph) return any(p.search(s) for s in lMorph) def morphex (dDA, tWord, sPattern, sNegPattern, bNoWord=False): "analyse a tuple (p
rd, sPattern, bStrict=True): "analyse a word, return True if sPattern in morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False if not _dAnalyses[sWord]: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in _dAnalyses[sWord]) return any(p.search(s) for s in _dAnalyses[sWord]) def analysex (sWord, sPattern, sNegPattern): "analyse a word, returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in _dAnalyses[sWord]): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in _dAnalyses[sWord]) def stem (sWord): "returns a list of sWord's stems" if not sWord: return [] if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return [] return [ s[1:s.find(" ")] for s in _dAnalyses[sWord] ] ## functions to get text outside pattern scope # warning: check compile_rules.py to understand how it works def nextword (s, iStart, n): "get the nth word of the input string or empty string" m = re.match(u"( +[\\w%-]+){" + str(n-1) + u"} +([\\w%-]+)", s[iStart:]) if not m: return None return (iStart+m.start(2), m.group(2)) def prevword (s, iEnd, n): "get the (-)nth word of the input string or empty string" m = re.search(u"([\\w%-]+) +([\\w%-]+ +){" + str(n-1) + u"}$", s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def nextword1 (s, iStart): "get next word (optimization)" m = _zNextWord.match(s[iStart:]) if not m: return None return (iStart+m.start(1), m.group(1)) def prevword1 (s, iEnd): "get previous word (optimization)" m = _zPrevWord.search(s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def look (s, sPattern, sNegPattern=None): "seek sPattern in s (before/after/fulltext), if sNegPattern not in s" if sNegPattern and re.search(sNegPattern, s): return False if re.search(sPattern, s): return True return False def look_chk1 (dDA, s, nOffset, sPattern, sPatternGroup1, sNegPatternGroup1=None): "returns True if s has pattern sPattern and m.group(1) has pattern sPatternGroup1" m = re.search(sPattern, s) if not m: return False try: sWord = m.group(1) nPos = m.start(1) + nOffset except: #print("Missing group 1") return False if sNegPatternGroup1: return morphex(dDA, (nPos, sWord), sPatternGroup1, sNegPatternGroup1) return morph(dDA, (nPos, sWord), sPatternGroup1, False) #### Disambiguator def select (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def exclude (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if not re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def define (dDA, nPos, lMorph): dDA[nPos] = lMorph #echo("= "+str(nPos)+" "+str(dDA[nPos])) return True #### GRAMMAR CHECKER PLUGINS ${plugins} ${generated}
osition, word), returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in lMorph): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in lMorph) def analyse (sWo
identifier_body
gc_engine.py
# -*- encoding: UTF-8 -*- import re import sys import os import traceback from ..ibdawg import IBDAWG from ..echo import echo from . import gc_options __all__ = [ "lang", "locales", "pkg", "name", "version", "author", \ "load", "parse", "getDictionary", \ "setOptions", "getOptions", "getOptionsLabels", "resetOptions", \ "ignoreRule", "resetIgnoreRules" ] __version__ = u"${version}" lang = u"${lang}" locales = ${loc} pkg = u"${implname}" name = u"${name}" version = u"${version}" author = u"${author}" # commons regexes _zEndOfSentence = re.compile(u'([.?!:;…][ .?!… »”")]*|.$)') _zBeginOfParagraph = re.compile(u"^\W*") _zEndOfParagraph = re.compile(u"\W*$") _zNextWord = re.compile(u" +(\w[\w-]*)") _zPrevWord = re.compile(u"(\w[\w-]*) +$") # grammar rules and dictionary _rules = None _dOptions = dict(gc_options.dOpt) # duplication necessary, to be able to reset to default _aIgnoredRules = set() _oDict = None _dAnalyses = {} # cache for data from dictionary _GLOBALS = globals() #### Parsing def parse (sText, sCountry="${country_default}", bDebug=False, dOptions=None): "analyses the paragraph sText and returns list of errors" aErrors = None sAlt = sText dDA = {} dOpt = _dOptions if not dOptions else dOptions # parse paragraph try: sNew, aErrors = _proofread(sText, sAlt, 0, True, dDA, sCountry, dOpt, bDebug) if sNew: sText = sNew except: raise # parse sentences for iStart, iEnd in _getSentenceBoundaries(sText): if 4 < (iEnd - iStart) < 2000: dDA.clear() try: _, errs = _proofread(sText[iStart:iEnd], sAlt[iStart:iEnd], iStart, False, dDA, sCountry, dOpt, bDebug) aErrors.extend(errs) except: raise return aErrors def _getSentenceBoundaries (sText): iStart = _zBeginOfParagraph.match(sText).end() for m in _zEndOfSentence.finditer(sText): yield (iStart, m.end()) iStart = m.end() def _proofread (s, sx, nOffset, bParagraph, dDA, sCountry, dOptions, bDebug): aErrs = [] bChange = False if not bParagraph: # after the first pass, we modify automatically some characters if u" " in s: s = s.replace(u" ", u' ') # nbsp bChange = True if u" " in s: s = s.replace(u" ", u' ') # nnbsp bChange = True if u"@" in s: s = s.replace(u"@", u' ') bChange = True if u"'" in s: s = s.replace(u"'", u"’") bChange = True if u"‑" in s: s = s.replace(u"‑", u"-") # nobreakdash bChange = True bIdRule = option('idrule') for sOption, lRuleGroup in _getRules(bParagraph): if not sOption or dOptions.get(sOption, False): for zRegex, bUppercase, sRuleId, lActions in lRuleGroup: if sRuleId not in _aIgnoredRules: for m in zRegex.finditer(s): for sFuncCond, cActionType, sWhat, *eAct in lActions: # action in lActions: [ condition, action type, replacement/suggestion/action[, iGroup[, message, URL]] ] try: if not sFuncCond or _GLOBALS[sFuncCond](s, sx, m, dDA, sCountry): if cActionType == "-": # grammar error # (text, replacement, nOffset, m, iGroup, sId, bUppercase, sURL, bIdRule) aErrs.append(_createError(s, sWhat, nOffset, m, eAct[0], sRuleId, bUppercase, eAct[1], eAct[2], bIdRule, sOption)) elif cActionType == "~": # text processor s = _rewrite(s, sWhat, eAct[0], m, bUppercase) bChange = True if bDebug: echo(u"~ " + s + " -- " + m.group(eAct[0]) + " # " + sRuleId) elif cActionType == "=": # disambiguation _GLOBALS[sWhat](s, m, dDA) if bDebug: echo(u"= " + m.group(0) + " # " + sRuleId + "\nDA: " + str(dDA)) else: echo("# error: unknown action at " + sRuleId) except Exception as e: raise Exception(str(e), sRuleId) if bChange: return (s, aErrs) return (False, aErrs) def _createWriterError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error for Writer (LO/OO)" xErr = SingleProofreadingError() #xErr = uno.createUnoStruct( "com.sun.star.linguistic2.SingleProofreadingError" ) xErr.nErrorStart = nOffset + m.start(iGroup) xErr.nErrorLength = m.end(iGroup) - m.start(iGroup) xErr.nErrorType = PROOFREADING xErr.aRuleIdentifier = sId # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, sugg.split("|"))) else: xErr.aSuggestions = tuple(sugg.split("|")) else: xErr.aSuggestions = () elif sRepl == "_": xErr.aSuggestions = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, m.expand(sRepl).split("|"))) else: xErr.aSuggestions = tuple(m.expand(sRepl).split("|")) # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) xErr.aShortComment = sMessage # sMessage.split("|")[0] # in context menu xErr.aFullComment = sMessage # sMessage.split("|")[-1] # in dialog if bIdRule: xErr.aShortComment += " # " + sId # URL if sURL: p = PropertyValue() p.Name = "FullCommentURL" p.Value = sURL xErr.aProperties = (p,) else: xErr.aProperties = () return xErr def _createDictError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error as a dictionary" dErr = {} dErr["nStart"] = nOffset + m.start(iGroup) dErr["nEnd"] = nOffset + m.end(iGroup) dErr["sRuleId"] = sId dErr["sType"] = sOption if sOption else "notype" # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, sugg.split("|"))) else: dErr["aSuggestions"] = sugg.split("|") else: dErr["aSuggestions"] = () elif sRepl == "_": dErr["aSuggestions"] = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, m.expand(sRepl).split("|"))) else: dErr["aSuggestions"] = m.expand(sRepl).split("|") # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) dErr["sMessage"] = sMessage if bIdRule: dErr["sMessage"] += " # " + sId # URL dErr["URL"] = sURL if sURL else "" return dErr def _rewrite (s, sRepl, iGroup, m, bUppercase): "text processor: write sRepl in s at iGroup position" ln = m.end(iGroup) - m.start(iGroup) if sRepl == "*": sNew = " " * ln elif sRepl == ">" or sRepl == "_" or sRepl == u"~": sNew = sRepl + " " * (ln-1) elif sRepl == "@": sNew = "@" * ln elif sRepl[0:1] == "=": if sRepl[1:2] != "@": sNew = _GLOBALS[sRepl[1:]](s, m) sNew = sNew + " " * (ln-len(sNew)) else: sNew = _GLOBALS[sRepl[2:]](s, m) sNew = sNew + "@" * (ln-len(sNew)) if bUppercase and m.group(iGroup)[0:1].isupper(): sNew = sNew.capitalize() else: sNew = m.expand(sRepl) sNew = sNew + " " * (ln-len(sNew)) return s[0:m.start(iGroup)] + sNew + s[m.end(iGroup):] def ignoreRule (sId): _aIgnoredRules.add(sId) def resetIgnoreRules (): _aIgnoredRules.clear() #### init try: # LibreOffice / OpenOffice from com.sun.star.linguistic2 import SingleProofreadingError from com.sun.star.text.TextMarkupType import PROOFREADING from com.sun.star.beans import PropertyValue #import lightproof_handler_${implname} as opt _createError = _createWriterError except ImportError: _createError = _createDictError def load (): global _oDict try: _oDict = IBDAWG("${binary_dic}") except: traceback.print_exc() def setOptions (dOpt): _dOptions.update(dOpt) def getOptions (): return _dOptions def getOptionsLabels (sLang): return gc_options.getUI(sLang) def resetOptions (): global _dOptions _dOptions = dict(gc_options.dOpt) def getDictionary (): return _oDict def _getRules (bParagraph): try: if not bParagraph: return _rules.lSentenceRules return _rules.lParagraphRules except: _loadRules() if not bParagraph: return _rules.lSent
lParagraphRules def _loadRules2 (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rule in chain(_rules.lParagraphRules, _rules.lSentenceRules): try: rule[1] = re.compile(rule[1]) except: echo("Bad regular expression in # " + str(rule[3])) rule[1] = "(?i)<Grammalecte>" def _loadRules (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rulegroup in chain(_rules.lParagraphRules, _rules.lSentenceRules): for rule in rulegroup[1]: try: rule[0] = re.compile(rule[0]) except: echo("Bad regular expression in # " + str(rule[2])) rule[0] = "(?i)<Grammalecte>" def _getPath (): return os.path.join(os.path.dirname(sys.modules[__name__].__file__), __name__ + ".py") #### common functions def option (sOpt): "return True if option sOpt is active" return _dOptions.get(sOpt, False) def displayInfo (dDA, tWord): "for debugging: retrieve info of word" if not tWord: echo("> nothing to find") return True if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): echo("> not in FSA") return True if tWord[0] in dDA: echo("DA: " + str(dDA[tWord[0]])) echo("FSA: " + str(_dAnalyses[tWord[1]])) return True def _storeMorphFromFSA (sWord): "retrieves morphologies list from _oDict -> _dAnalyses" global _dAnalyses _dAnalyses[sWord] = _oDict.getMorph(sWord) return True if _dAnalyses[sWord] else False def morph (dDA, tWord, sPattern, bStrict=True, bNoWord=False): "analyse a tuple (position, word), return True if sPattern in morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] if not lMorph: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in lMorph) return any(p.search(s) for s in lMorph) def morphex (dDA, tWord, sPattern, sNegPattern, bNoWord=False): "analyse a tuple (position, word), returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in lMorph): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in lMorph) def analyse (sWord, sPattern, bStrict=True): "analyse a word, return True if sPattern in morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False if not _dAnalyses[sWord]: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in _dAnalyses[sWord]) return any(p.search(s) for s in _dAnalyses[sWord]) def analysex (sWord, sPattern, sNegPattern): "analyse a word, returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in _dAnalyses[sWord]): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in _dAnalyses[sWord]) def stem (sWord): "returns a list of sWord's stems" if not sWord: return [] if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return [] return [ s[1:s.find(" ")] for s in _dAnalyses[sWord] ] ## functions to get text outside pattern scope # warning: check compile_rules.py to understand how it works def nextword (s, iStart, n): "get the nth word of the input string or empty string" m = re.match(u"( +[\\w%-]+){" + str(n-1) + u"} +([\\w%-]+)", s[iStart:]) if not m: return None return (iStart+m.start(2), m.group(2)) def prevword (s, iEnd, n): "get the (-)nth word of the input string or empty string" m = re.search(u"([\\w%-]+) +([\\w%-]+ +){" + str(n-1) + u"}$", s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def nextword1 (s, iStart): "get next word (optimization)" m = _zNextWord.match(s[iStart:]) if not m: return None return (iStart+m.start(1), m.group(1)) def prevword1 (s, iEnd): "get previous word (optimization)" m = _zPrevWord.search(s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def look (s, sPattern, sNegPattern=None): "seek sPattern in s (before/after/fulltext), if sNegPattern not in s" if sNegPattern and re.search(sNegPattern, s): return False if re.search(sPattern, s): return True return False def look_chk1 (dDA, s, nOffset, sPattern, sPatternGroup1, sNegPatternGroup1=None): "returns True if s has pattern sPattern and m.group(1) has pattern sPatternGroup1" m = re.search(sPattern, s) if not m: return False try: sWord = m.group(1) nPos = m.start(1) + nOffset except: #print("Missing group 1") return False if sNegPatternGroup1: return morphex(dDA, (nPos, sWord), sPatternGroup1, sNegPatternGroup1) return morph(dDA, (nPos, sWord), sPatternGroup1, False) #### Disambiguator def select (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def exclude (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if not re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def define (dDA, nPos, lMorph): dDA[nPos] = lMorph #echo("= "+str(nPos)+" "+str(dDA[nPos])) return True #### GRAMMAR CHECKER PLUGINS ${plugins} ${generated}
enceRules return _rules.
conditional_block
gc_engine.py
# -*- encoding: UTF-8 -*- import re import sys import os import traceback from ..ibdawg import IBDAWG from ..echo import echo from . import gc_options __all__ = [ "lang", "locales", "pkg", "name", "version", "author", \ "load", "parse", "getDictionary", \ "setOptions", "getOptions", "getOptionsLabels", "resetOptions", \ "ignoreRule", "resetIgnoreRules" ] __version__ = u"${version}" lang = u"${lang}" locales = ${loc} pkg = u"${implname}" name = u"${name}" version = u"${version}" author = u"${author}" # commons regexes _zEndOfSentence = re.compile(u'([.?!:;…][ .?!… »”")]*|.$)') _zBeginOfParagraph = re.compile(u"^\W*") _zEndOfParagraph = re.compile(u"\W*$") _zNextWord = re.compile(u" +(\w[\w-]*)") _zPrevWord = re.compile(u"(\w[\w-]*) +$") # grammar rules and dictionary _rules = None _dOptions = dict(gc_options.dOpt) # duplication necessary, to be able to reset to default _aIgnoredRules = set() _oDict = None _dAnalyses = {} # cache for data from dictionary _GLOBALS = globals() #### Parsing def parse (sText, sCountry="${country_default}", bDebug=False, dOptions=None): "analyses the paragraph sText and returns list of errors" aErrors = None sAlt = sText dDA = {} dOpt = _dOptions if not dOptions else dOptions # parse paragraph try: sNew, aErrors = _proofread(sText, sAlt, 0, True, dDA, sCountry, dOpt, bDebug) if sNew: sText = sNew except: raise # parse sentences for iStart, iEnd in _getSentenceBoundaries(sText): if 4 < (iEnd - iStart) < 2000: dDA.clear() try: _, errs = _proofread(sText[iStart:iEnd], sAlt[iStart:iEnd], iStart, False, dDA, sCountry, dOpt, bDebug) aErrors.extend(errs) except: raise return aErrors def _getSentenceBoundaries (sText): iStart = _zBeginOfParagraph.match(sText).end() for m in _zEndOfSentence.finditer(sText): yield (iStart, m.end()) iStart = m.end() def _proofread (s, sx, nOffset, bParagraph, dDA, sCountry, dOptions, bDebug): aErrs = [] bChange = False if not bParagraph: # after the first pass, we modify automatically some characters if u" " in s: s = s.replace(u" ", u' ') # nbsp bChange = True if u" " in s: s = s.replace(u" ", u' ') # nnbsp bChange = True if u"@" in s: s = s.replace(u"@", u' ') bChange = True if u"'" in s: s = s.replace(u"'", u"’") bChange = True if u"‑" in s: s = s.replace(u"‑", u"-") # nobreakdash bChange = True bIdRule = option('idrule') for sOption, lRuleGroup in _getRules(bParagraph): if not sOption or dOptions.get(sOption, False): for zRegex, bUppercase, sRuleId, lActions in lRuleGroup: if sRuleId not in _aIgnoredRules: for m in zRegex.finditer(s): for sFuncCond, cActionType, sWhat, *eAct in lActions: # action in lActions: [ condition, action type, replacement/suggestion/action[, iGroup[, message, URL]] ] try: if not sFuncCond or _GLOBALS[sFuncCond](s, sx, m, dDA, sCountry): if cActionType == "-": # grammar error # (text, replacement, nOffset, m, iGroup, sId, bUppercase, sURL, bIdRule) aErrs.append(_createError(s, sWhat, nOffset, m, eAct[0], sRuleId, bUppercase, eAct[1], eAct[2], bIdRule, sOption)) elif cActionType == "~": # text processor s = _rewrite(s, sWhat, eAct[0], m, bUppercase) bChange = True if bDebug: echo(u"~ " + s + " -- " + m.group(eAct[0]) + " # " + sRuleId) elif cActionType == "=": # disambiguation
_GLOBALS[sWhat](s, m, dDA) if bDebug: echo(u"= " + m.group(0) + " # " + sRuleId + "\nDA: " + str(dDA)) else: echo("# error: unknown action at " + sRuleId) except Exception as e: raise Exception(str(e), sRuleId) if bChange: return (s, aErrs) return (False, aErrs) def _createWriterError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error for Writer (LO/OO)" xErr = SingleProofreadingError() #xErr = uno.createUnoStruct( "com.sun.star.linguistic2.SingleProofreadingError" ) xErr.nErrorStart = nOffset + m.start(iGroup) xErr.nErrorLength = m.end(iGroup) - m.start(iGroup) xErr.nErrorType = PROOFREADING xErr.aRuleIdentifier = sId # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, sugg.split("|"))) else: xErr.aSuggestions = tuple(sugg.split("|")) else: xErr.aSuggestions = () elif sRepl == "_": xErr.aSuggestions = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, m.expand(sRepl).split("|"))) else: xErr.aSuggestions = tuple(m.expand(sRepl).split("|")) # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) xErr.aShortComment = sMessage # sMessage.split("|")[0] # in context menu xErr.aFullComment = sMessage # sMessage.split("|")[-1] # in dialog if bIdRule: xErr.aShortComment += " # " + sId # URL if sURL: p = PropertyValue() p.Name = "FullCommentURL" p.Value = sURL xErr.aProperties = (p,) else: xErr.aProperties = () return xErr def _createDictError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error as a dictionary" dErr = {} dErr["nStart"] = nOffset + m.start(iGroup) dErr["nEnd"] = nOffset + m.end(iGroup) dErr["sRuleId"] = sId dErr["sType"] = sOption if sOption else "notype" # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, sugg.split("|"))) else: dErr["aSuggestions"] = sugg.split("|") else: dErr["aSuggestions"] = () elif sRepl == "_": dErr["aSuggestions"] = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, m.expand(sRepl).split("|"))) else: dErr["aSuggestions"] = m.expand(sRepl).split("|") # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) dErr["sMessage"] = sMessage if bIdRule: dErr["sMessage"] += " # " + sId # URL dErr["URL"] = sURL if sURL else "" return dErr def _rewrite (s, sRepl, iGroup, m, bUppercase): "text processor: write sRepl in s at iGroup position" ln = m.end(iGroup) - m.start(iGroup) if sRepl == "*": sNew = " " * ln elif sRepl == ">" or sRepl == "_" or sRepl == u"~": sNew = sRepl + " " * (ln-1) elif sRepl == "@": sNew = "@" * ln elif sRepl[0:1] == "=": if sRepl[1:2] != "@": sNew = _GLOBALS[sRepl[1:]](s, m) sNew = sNew + " " * (ln-len(sNew)) else: sNew = _GLOBALS[sRepl[2:]](s, m) sNew = sNew + "@" * (ln-len(sNew)) if bUppercase and m.group(iGroup)[0:1].isupper(): sNew = sNew.capitalize() else: sNew = m.expand(sRepl) sNew = sNew + " " * (ln-len(sNew)) return s[0:m.start(iGroup)] + sNew + s[m.end(iGroup):] def ignoreRule (sId): _aIgnoredRules.add(sId) def resetIgnoreRules (): _aIgnoredRules.clear() #### init try: # LibreOffice / OpenOffice from com.sun.star.linguistic2 import SingleProofreadingError from com.sun.star.text.TextMarkupType import PROOFREADING from com.sun.star.beans import PropertyValue #import lightproof_handler_${implname} as opt _createError = _createWriterError except ImportError: _createError = _createDictError def load (): global _oDict try: _oDict = IBDAWG("${binary_dic}") except: traceback.print_exc() def setOptions (dOpt): _dOptions.update(dOpt) def getOptions (): return _dOptions def getOptionsLabels (sLang): return gc_options.getUI(sLang) def resetOptions (): global _dOptions _dOptions = dict(gc_options.dOpt) def getDictionary (): return _oDict def _getRules (bParagraph): try: if not bParagraph: return _rules.lSentenceRules return _rules.lParagraphRules except: _loadRules() if not bParagraph: return _rules.lSentenceRules return _rules.lParagraphRules def _loadRules2 (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rule in chain(_rules.lParagraphRules, _rules.lSentenceRules): try: rule[1] = re.compile(rule[1]) except: echo("Bad regular expression in # " + str(rule[3])) rule[1] = "(?i)<Grammalecte>" def _loadRules (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rulegroup in chain(_rules.lParagraphRules, _rules.lSentenceRules): for rule in rulegroup[1]: try: rule[0] = re.compile(rule[0]) except: echo("Bad regular expression in # " + str(rule[2])) rule[0] = "(?i)<Grammalecte>" def _getPath (): return os.path.join(os.path.dirname(sys.modules[__name__].__file__), __name__ + ".py") #### common functions def option (sOpt): "return True if option sOpt is active" return _dOptions.get(sOpt, False) def displayInfo (dDA, tWord): "for debugging: retrieve info of word" if not tWord: echo("> nothing to find") return True if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): echo("> not in FSA") return True if tWord[0] in dDA: echo("DA: " + str(dDA[tWord[0]])) echo("FSA: " + str(_dAnalyses[tWord[1]])) return True def _storeMorphFromFSA (sWord): "retrieves morphologies list from _oDict -> _dAnalyses" global _dAnalyses _dAnalyses[sWord] = _oDict.getMorph(sWord) return True if _dAnalyses[sWord] else False def morph (dDA, tWord, sPattern, bStrict=True, bNoWord=False): "analyse a tuple (position, word), return True if sPattern in morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] if not lMorph: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in lMorph) return any(p.search(s) for s in lMorph) def morphex (dDA, tWord, sPattern, sNegPattern, bNoWord=False): "analyse a tuple (position, word), returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in lMorph): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in lMorph) def analyse (sWord, sPattern, bStrict=True): "analyse a word, return True if sPattern in morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False if not _dAnalyses[sWord]: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in _dAnalyses[sWord]) return any(p.search(s) for s in _dAnalyses[sWord]) def analysex (sWord, sPattern, sNegPattern): "analyse a word, returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in _dAnalyses[sWord]): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in _dAnalyses[sWord]) def stem (sWord): "returns a list of sWord's stems" if not sWord: return [] if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return [] return [ s[1:s.find(" ")] for s in _dAnalyses[sWord] ] ## functions to get text outside pattern scope # warning: check compile_rules.py to understand how it works def nextword (s, iStart, n): "get the nth word of the input string or empty string" m = re.match(u"( +[\\w%-]+){" + str(n-1) + u"} +([\\w%-]+)", s[iStart:]) if not m: return None return (iStart+m.start(2), m.group(2)) def prevword (s, iEnd, n): "get the (-)nth word of the input string or empty string" m = re.search(u"([\\w%-]+) +([\\w%-]+ +){" + str(n-1) + u"}$", s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def nextword1 (s, iStart): "get next word (optimization)" m = _zNextWord.match(s[iStart:]) if not m: return None return (iStart+m.start(1), m.group(1)) def prevword1 (s, iEnd): "get previous word (optimization)" m = _zPrevWord.search(s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def look (s, sPattern, sNegPattern=None): "seek sPattern in s (before/after/fulltext), if sNegPattern not in s" if sNegPattern and re.search(sNegPattern, s): return False if re.search(sPattern, s): return True return False def look_chk1 (dDA, s, nOffset, sPattern, sPatternGroup1, sNegPatternGroup1=None): "returns True if s has pattern sPattern and m.group(1) has pattern sPatternGroup1" m = re.search(sPattern, s) if not m: return False try: sWord = m.group(1) nPos = m.start(1) + nOffset except: #print("Missing group 1") return False if sNegPatternGroup1: return morphex(dDA, (nPos, sWord), sPatternGroup1, sNegPatternGroup1) return morph(dDA, (nPos, sWord), sPatternGroup1, False) #### Disambiguator def select (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def exclude (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if not re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def define (dDA, nPos, lMorph): dDA[nPos] = lMorph #echo("= "+str(nPos)+" "+str(dDA[nPos])) return True #### GRAMMAR CHECKER PLUGINS ${plugins} ${generated}
random_line_split
gc_engine.py
# -*- encoding: UTF-8 -*- import re import sys import os import traceback from ..ibdawg import IBDAWG from ..echo import echo from . import gc_options __all__ = [ "lang", "locales", "pkg", "name", "version", "author", \ "load", "parse", "getDictionary", \ "setOptions", "getOptions", "getOptionsLabels", "resetOptions", \ "ignoreRule", "resetIgnoreRules" ] __version__ = u"${version}" lang = u"${lang}" locales = ${loc} pkg = u"${implname}" name = u"${name}" version = u"${version}" author = u"${author}" # commons regexes _zEndOfSentence = re.compile(u'([.?!:;…][ .?!… »”")]*|.$)') _zBeginOfParagraph = re.compile(u"^\W*") _zEndOfParagraph = re.compile(u"\W*$") _zNextWord = re.compile(u" +(\w[\w-]*)") _zPrevWord = re.compile(u"(\w[\w-]*) +$") # grammar rules and dictionary _rules = None _dOptions = dict(gc_options.dOpt) # duplication necessary, to be able to reset to default _aIgnoredRules = set() _oDict = None _dAnalyses = {} # cache for data from dictionary _GLOBALS = globals() #### Parsing def parse (sText, sCountry="${country_default}", bDebug=False, dOptions=None): "analyses the paragraph sText and returns list of errors" aErrors = None sAlt = sText dDA = {} dOpt = _dOptions if not dOptions else dOptions # parse paragraph try: sNew, aErrors = _proofread(sText, sAlt, 0, True, dDA, sCountry, dOpt, bDebug) if sNew: sText = sNew except: raise # parse sentences for iStart, iEnd in _getSentenceBoundaries(sText): if 4 < (iEnd - iStart) < 2000: dDA.clear() try: _, errs = _proofread(sText[iStart:iEnd], sAlt[iStart:iEnd], iStart, False, dDA, sCountry, dOpt, bDebug) aErrors.extend(errs) except: raise return aErrors def _getSentenceBoundaries (sText): iStart = _zBeginOfParagraph.match(sText).end() for m in _zEndOfSentence.finditer(sText): yield (iStart, m.end()) iStart = m.end() def _proofread (s, sx, nOffset, bParagraph, dDA, sCountry, dOptions, bDebug): aErrs = [] bChange = False if not bParagraph: # after the first pass, we modify automatically some characters if u" " in s: s = s.replace(u" ", u' ') # nbsp bChange = True if u" " in s: s = s.replace(u" ", u' ') # nnbsp bChange = True if u"@" in s: s = s.replace(u"@", u' ') bChange = True if u"'" in s: s = s.replace(u"'", u"’") bChange = True if u"‑" in s: s = s.replace(u"‑", u"-") # nobreakdash bChange = True bIdRule = option('idrule') for sOption, lRuleGroup in _getRules(bParagraph): if not sOption or dOptions.get(sOption, False): for zRegex, bUppercase, sRuleId, lActions in lRuleGroup: if sRuleId not in _aIgnoredRules: for m in zRegex.finditer(s): for sFuncCond, cActionType, sWhat, *eAct in lActions: # action in lActions: [ condition, action type, replacement/suggestion/action[, iGroup[, message, URL]] ] try: if not sFuncCond or _GLOBALS[sFuncCond](s, sx, m, dDA, sCountry): if cActionType == "-": # grammar error # (text, replacement, nOffset, m, iGroup, sId, bUppercase, sURL, bIdRule) aErrs.append(_createError(s, sWhat, nOffset, m, eAct[0], sRuleId, bUppercase, eAct[1], eAct[2], bIdRule, sOption)) elif cActionType == "~": # text processor s = _rewrite(s, sWhat, eAct[0], m, bUppercase) bChange = True if bDebug: echo(u"~ " + s + " -- " + m.group(eAct[0]) + " # " + sRuleId) elif cActionType == "=": # disambiguation _GLOBALS[sWhat](s, m, dDA) if bDebug: echo(u"= " + m.group(0) + " # " + sRuleId + "\nDA: " + str(dDA)) else: echo("# error: unknown action at " + sRuleId) except Exception as e: raise Exception(str(e), sRuleId) if bChange: return (s, aErrs) return (False, aErrs) def _createWriterError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error for Writer (LO/OO)" xErr = SingleProofreadingError() #xErr = uno.createUnoStruct( "com.sun.star.linguistic2.SingleProofreadingError" ) xErr.nErrorStart = nOffset + m.start(iGroup) xErr.nErrorLength = m.end(iGroup) - m.start(iGroup) xErr.nErrorType = PROOFREADING xErr.aRuleIdentifier = sId # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, sugg.split("|"))) else: xErr.aSuggestions = tuple(sugg.split("|")) else: xErr.aSuggestions = () elif sRepl == "_": xErr.aSuggestions = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): xErr.aSuggestions = tuple(map(str.capitalize, m.expand(sRepl).split("|"))) else: xErr.aSuggestions = tuple(m.expand(sRepl).split("|")) # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) xErr.aShortComment = sMessage # sMessage.split("|")[0] # in context menu xErr.aFullComment = sMessage # sMessage.split("|")[-1] # in dialog if bIdRule: xErr.aShortComment += " # " + sId # URL if sURL: p = PropertyValue() p.Name = "FullCommentURL" p.Value = sURL xErr.aProperties = (p,) else: xErr.aProperties = () return xErr def _createDictError (s, sRepl, nOffset, m, iGroup, sId, bUppercase, sMsg, sURL, bIdRule, sOption): "error as a dictionary" dErr = {} dErr["nStart"] = nOffset + m.start(iGroup) dErr["nEnd"] = nOffset + m.end(iGroup) dErr["sRuleId"] = sId dErr["sType"] = sOption if sOption else "notype" # suggestions if sRepl[0:1] == "=": sugg = _GLOBALS[sRepl[1:]](s, m) if sugg: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, sugg.split("|"))) else: dErr["aSuggestions"] = sugg.split("|") else: dErr["aSuggestions"] = () elif sRepl == "_": dErr["aSuggestions"] = () else: if bUppercase and m.group(iGroup)[0:1].isupper(): dErr["aSuggestions"] = list(map(str.capitalize, m.expand(sRepl).split("|"))) else: dErr["aSuggestions"] = m.expand(sRepl).split("|") # Message if sMsg[0:1] == "=": sMessage = _GLOBALS[sMsg[1:]](s, m) else: sMessage = m.expand(sMsg) dErr["sMessage"] = sMessage if bIdRule: dErr["sMessage"] += " # " + sId # URL dErr["URL"] = sURL if sURL else "" return dErr def _rewrite (s, sRepl, iGroup, m, bUppercase): "text processor: write sRepl in s at iGroup position" ln = m.end(iGroup) - m.start(iGroup) if sRepl == "*": sNew = " " * ln elif sRepl == ">" or sRepl == "_" or sRepl == u"~": sNew = sRepl + " " * (ln-1) elif sRepl == "@": sNew = "@" * ln elif sRepl[0:1] == "=": if sRepl[1:2] != "@": sNew = _GLOBALS[sRepl[1:]](s, m) sNew = sNew + " " * (ln-len(sNew)) else: sNew = _GLOBALS[sRepl[2:]](s, m) sNew = sNew + "@" * (ln-len(sNew)) if bUppercase and m.group(iGroup)[0:1].isupper(): sNew = sNew.capitalize() else: sNew = m.expand(sRepl) sNew = sNew + " " * (ln-len(sNew)) return s[0:m.start(iGroup)] + sNew + s[m.end(iGroup):] def ignoreRule (sId): _aIgnoredRules.add(sId) def resetIgnoreRules (): _aIgnoredRules.clear() #### init try: # LibreOffice / OpenOffice from com.sun.star.linguistic2 import SingleProofreadingError from com.sun.star.text.TextMarkupType import PROOFREADING from com.sun.star.beans import PropertyValue #import lightproof_handler_${implname} as opt _createError = _createWriterError except ImportError: _createError = _createDictError def load (): global _oDict try: _oDict = IBDAWG("${binary_dic}") except: traceback.print_exc() def setOptions (dOpt): _dOptions.update(dOpt) def getOptions (): return _dOptions def getOptionsLabels (sLang): return gc_options.getUI(sLang) def resetOptions (): global _dOptions _dOptions = dict(gc_options.dOpt) def getDictionary (): return _oDict def _getRules (bParagraph): try: if not bParagraph: return _rules.lSentenceRules return _rules.lParagraphRules except: _loadRules() if not bParagraph: return _rules.lSentenceRules return _rules.lParagraphRules def _loadRules2 (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rule in chain(_rules.lParagraphRules, _rules.lSentenceRules): try: rule[1] = re.compile(rule[1]) except: echo("Bad regular expression in # " + str(rule[3])) rule[1] = "(?i)<Grammalecte>" def _loadRules (): from itertools import chain from . import gc_rules global _rules _rules = gc_rules # compile rules regex for rulegroup in chain(_rules.lParagraphRules, _rules.lSentenceRules): for rule in rulegroup[1]: try: rule[0] = re.compile(rule[0]) except: echo("Bad regular expression in # " + str(rule[2])) rule[0] = "(?i)<Grammalecte>" def _getPath (): return os.path.join(os.path.dirname(sys.modules[__name__].__file__), __name__ + ".py") #### common functions def option (sOpt):
n True if option sOpt is active" return _dOptions.get(sOpt, False) def displayInfo (dDA, tWord): "for debugging: retrieve info of word" if not tWord: echo("> nothing to find") return True if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): echo("> not in FSA") return True if tWord[0] in dDA: echo("DA: " + str(dDA[tWord[0]])) echo("FSA: " + str(_dAnalyses[tWord[1]])) return True def _storeMorphFromFSA (sWord): "retrieves morphologies list from _oDict -> _dAnalyses" global _dAnalyses _dAnalyses[sWord] = _oDict.getMorph(sWord) return True if _dAnalyses[sWord] else False def morph (dDA, tWord, sPattern, bStrict=True, bNoWord=False): "analyse a tuple (position, word), return True if sPattern in morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] if not lMorph: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in lMorph) return any(p.search(s) for s in lMorph) def morphex (dDA, tWord, sPattern, sNegPattern, bNoWord=False): "analyse a tuple (position, word), returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation on)" if not tWord: return bNoWord if tWord[1] not in _dAnalyses and not _storeMorphFromFSA(tWord[1]): return False lMorph = dDA[tWord[0]] if tWord[0] in dDA else _dAnalyses[tWord[1]] # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in lMorph): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in lMorph) def analyse (sWord, sPattern, bStrict=True): "analyse a word, return True if sPattern in morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False if not _dAnalyses[sWord]: return False p = re.compile(sPattern) if bStrict: return all(p.search(s) for s in _dAnalyses[sWord]) return any(p.search(s) for s in _dAnalyses[sWord]) def analysex (sWord, sPattern, sNegPattern): "analyse a word, returns True if not sNegPattern in word morphologies and sPattern in word morphologies (disambiguation off)" if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return False # check negative condition np = re.compile(sNegPattern) if any(np.search(s) for s in _dAnalyses[sWord]): return False # search sPattern p = re.compile(sPattern) return any(p.search(s) for s in _dAnalyses[sWord]) def stem (sWord): "returns a list of sWord's stems" if not sWord: return [] if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return [] return [ s[1:s.find(" ")] for s in _dAnalyses[sWord] ] ## functions to get text outside pattern scope # warning: check compile_rules.py to understand how it works def nextword (s, iStart, n): "get the nth word of the input string or empty string" m = re.match(u"( +[\\w%-]+){" + str(n-1) + u"} +([\\w%-]+)", s[iStart:]) if not m: return None return (iStart+m.start(2), m.group(2)) def prevword (s, iEnd, n): "get the (-)nth word of the input string or empty string" m = re.search(u"([\\w%-]+) +([\\w%-]+ +){" + str(n-1) + u"}$", s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def nextword1 (s, iStart): "get next word (optimization)" m = _zNextWord.match(s[iStart:]) if not m: return None return (iStart+m.start(1), m.group(1)) def prevword1 (s, iEnd): "get previous word (optimization)" m = _zPrevWord.search(s[:iEnd]) if not m: return None return (m.start(1), m.group(1)) def look (s, sPattern, sNegPattern=None): "seek sPattern in s (before/after/fulltext), if sNegPattern not in s" if sNegPattern and re.search(sNegPattern, s): return False if re.search(sPattern, s): return True return False def look_chk1 (dDA, s, nOffset, sPattern, sPatternGroup1, sNegPatternGroup1=None): "returns True if s has pattern sPattern and m.group(1) has pattern sPatternGroup1" m = re.search(sPattern, s) if not m: return False try: sWord = m.group(1) nPos = m.start(1) + nOffset except: #print("Missing group 1") return False if sNegPatternGroup1: return morphex(dDA, (nPos, sWord), sPatternGroup1, sNegPatternGroup1) return morph(dDA, (nPos, sWord), sPatternGroup1, False) #### Disambiguator def select (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def exclude (dDA, nPos, sWord, sPattern, lDefault=None): if not sWord: return True if nPos in dDA: return True if sWord not in _dAnalyses and not _storeMorphFromFSA(sWord): return True if len(_dAnalyses[sWord]) == 1: return True lSelect = [ sMorph for sMorph in _dAnalyses[sWord] if not re.search(sPattern, sMorph) ] if lSelect: if len(lSelect) != len(_dAnalyses[sWord]): dDA[nPos] = lSelect #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) elif lDefault: dDA[nPos] = lDefault #echo("= "+sWord+" "+str(dDA.get(nPos, "null"))) return True def define (dDA, nPos, lMorph): dDA[nPos] = lMorph #echo("= "+str(nPos)+" "+str(dDA[nPos])) return True #### GRAMMAR CHECKER PLUGINS ${plugins} ${generated}
"retur
identifier_name
_stream_transform.js
// Copyright Joyent, Inc. and other Node contributors. // // Permission is hereby granted, free of charge, to any person obtaining a // copy of this software and associated documentation files (the // "Software"), to deal in the Software without restriction, including // without limitation the rights to use, copy, modify, merge, publish, // distribute, sublicense, and/or sell copies of the Software, and to permit // persons to whom the Software is furnished to do so, subject to the // following conditions: // // The above copyright notice and this permission notice shall be included // in all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS // OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF // MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN // NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, // DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR // OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE // USE OR OTHER DEALINGS IN THE SOFTWARE. // a transform stream is a readable/writable stream where you do // something with the data. Sometimes it's called a "filter", // but that's not a great name for it, since that implies a thing where // some bits pass through, and others are simply ignored. (That would // be a valid example of a transform, of course.) // // While the output is causally related to the input, it's not a // necessarily symmetric or synchronous transformation. For example, // a zlib stream might take multiple plain-text writes(), and then // emit a single compressed chunk some time in the future. // // Here's how this works: // // The Transform stream has all the aspects of the readable and writable // stream services. When you write(chunk), that calls _write(chunk,cb) // internally, and returns false if there's a lot of pending writes // buffered up. When you call read(), that calls _read(n) until // there's enough pending readable data buffered up. // // In a transform stream, the written data is placed in a buffer. When // _read(n) is called, it transforms the queued up data, calling the // buffered _write cb's as it consumes chunks. If consuming a single // written chunk would result in multiple output chunks, then the first // outputted bit calls the readcb, and subsequent chunks just go into // the read buffer, and will cause it to emit 'readable' if necessary. // // This way, back-pressure is actually determined by the reading side, // since _read has to be called to start processing a new chunk. However, // a pathological inflate type of transform can cause excessive buffering // here. For example, imagine a stream where every byte of input is // interpreted as an integer from 0-255, and then results in that many // bytes of output. Writing the 4 bytes {ff,ff,ff,ff} would result in // 1kb of data being output. In this case, you could write a very small // amount of input, and end up with a very large amount of output. In // such a pathological inflating mechanism, there'd be no way to tell // the system to stop doing the transform. A single 4MB write could // cause the system to run out of memory. // // However, even in such a pathological case, only a single written chunk // would be consumed, and then the rest would wait (un-transformed) until // the results of the previous transformed chunk were consumed. module.exports = Transform; var Duplex = require('./_stream_duplex'); /*<replacement>*/ var util = require('core-util-is'); util.inherits = require('inherits'); /*</replacement>*/ util.inherits(Transform, Duplex); function TransformState(options, stream) { this.afterTransform = function(er, data) { return afterTransform(stream, er, data); }; this.needTransform = false; this.transforming = false; this.writecb = null; this.writechunk = null; } function afterTransform(stream, er, data) { var ts = stream._transformState; ts.transforming = false; var cb = ts.writecb; if (!cb) return stream.emit('error', new Error('no writecb in Transform class')); ts.writechunk = null; ts.writecb = null; if (!util.isNullOrUndefined(data)) stream.push(data); if (cb) cb(er); var rs = stream._readableState; rs.reading = false; if (rs.needReadable || rs.length < rs.highWaterMark) { stream._read(rs.highWaterMark); } } function Transform(options) { if (!(this instanceof Transform)) return new Transform(options); Duplex.call(this, options);
this._transformState = new TransformState(options, this); // when the writable side finishes, then flush out anything remaining. var stream = this; // start out asking for a readable event once data is transformed. this._readableState.needReadable = true; // we have implemented the _read method, and done the other things // that Readable wants before the first _read call, so unset the // sync guard flag. this._readableState.sync = false; this.once('prefinish', function() { if (util.isFunction(this._flush)) this._flush(function(er) { done(stream, er); }); else done(stream); }); } Transform.prototype.push = function(chunk, encoding) { this._transformState.needTransform = false; return Duplex.prototype.push.call(this, chunk, encoding); }; // This is the part where you do stuff! // override this function in implementation services. // 'chunk' is an input chunk. // // Call `push(newChunk)` to pass along transformed output // to the readable side. You may call 'push' zero or more times. // // Call `cb(err)` when you are done with this chunk. If you pass // an error, then that'll put the hurt on the whole operation. If you // never call cb(), then you'll never get another chunk. Transform.prototype._transform = function(chunk, encoding, cb) { throw new Error('not implemented'); }; Transform.prototype._write = function(chunk, encoding, cb) { var ts = this._transformState; ts.writecb = cb; ts.writechunk = chunk; ts.writeencoding = encoding; if (!ts.transforming) { var rs = this._readableState; if (ts.needTransform || rs.needReadable || rs.length < rs.highWaterMark) this._read(rs.highWaterMark); } }; // Doesn't matter what the args are here. // _transform does all the work. // That we got here means that the readable side wants more data. Transform.prototype._read = function(n) { var ts = this._transformState; if (!util.isNull(ts.writechunk) && ts.writecb && !ts.transforming) { ts.transforming = true; this._transform(ts.writechunk, ts.writeencoding, ts.afterTransform); } else { // mark that we need a transform, so that any data that comes in // will get processed, now that we've asked for it. ts.needTransform = true; } }; function done(stream, er) { if (er) return stream.emit('error', er); // if there's nothing in the write buffer, then that means // that nothing more will ever be provided var ws = stream._writableState; var ts = stream._transformState; if (ws.length) throw new Error('calling transform done when ws.length != 0'); if (ts.transforming) throw new Error('calling transform done when still transforming'); return stream.push(null); }
random_line_split
_stream_transform.js
// Copyright Joyent, Inc. and other Node contributors. // // Permission is hereby granted, free of charge, to any person obtaining a // copy of this software and associated documentation files (the // "Software"), to deal in the Software without restriction, including // without limitation the rights to use, copy, modify, merge, publish, // distribute, sublicense, and/or sell copies of the Software, and to permit // persons to whom the Software is furnished to do so, subject to the // following conditions: // // The above copyright notice and this permission notice shall be included // in all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS // OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF // MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN // NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, // DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR // OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE // USE OR OTHER DEALINGS IN THE SOFTWARE. // a transform stream is a readable/writable stream where you do // something with the data. Sometimes it's called a "filter", // but that's not a great name for it, since that implies a thing where // some bits pass through, and others are simply ignored. (That would // be a valid example of a transform, of course.) // // While the output is causally related to the input, it's not a // necessarily symmetric or synchronous transformation. For example, // a zlib stream might take multiple plain-text writes(), and then // emit a single compressed chunk some time in the future. // // Here's how this works: // // The Transform stream has all the aspects of the readable and writable // stream services. When you write(chunk), that calls _write(chunk,cb) // internally, and returns false if there's a lot of pending writes // buffered up. When you call read(), that calls _read(n) until // there's enough pending readable data buffered up. // // In a transform stream, the written data is placed in a buffer. When // _read(n) is called, it transforms the queued up data, calling the // buffered _write cb's as it consumes chunks. If consuming a single // written chunk would result in multiple output chunks, then the first // outputted bit calls the readcb, and subsequent chunks just go into // the read buffer, and will cause it to emit 'readable' if necessary. // // This way, back-pressure is actually determined by the reading side, // since _read has to be called to start processing a new chunk. However, // a pathological inflate type of transform can cause excessive buffering // here. For example, imagine a stream where every byte of input is // interpreted as an integer from 0-255, and then results in that many // bytes of output. Writing the 4 bytes {ff,ff,ff,ff} would result in // 1kb of data being output. In this case, you could write a very small // amount of input, and end up with a very large amount of output. In // such a pathological inflating mechanism, there'd be no way to tell // the system to stop doing the transform. A single 4MB write could // cause the system to run out of memory. // // However, even in such a pathological case, only a single written chunk // would be consumed, and then the rest would wait (un-transformed) until // the results of the previous transformed chunk were consumed. module.exports = Transform; var Duplex = require('./_stream_duplex'); /*<replacement>*/ var util = require('core-util-is'); util.inherits = require('inherits'); /*</replacement>*/ util.inherits(Transform, Duplex); function TransformState(options, stream) { this.afterTransform = function(er, data) { return afterTransform(stream, er, data); }; this.needTransform = false; this.transforming = false; this.writecb = null; this.writechunk = null; } function
(stream, er, data) { var ts = stream._transformState; ts.transforming = false; var cb = ts.writecb; if (!cb) return stream.emit('error', new Error('no writecb in Transform class')); ts.writechunk = null; ts.writecb = null; if (!util.isNullOrUndefined(data)) stream.push(data); if (cb) cb(er); var rs = stream._readableState; rs.reading = false; if (rs.needReadable || rs.length < rs.highWaterMark) { stream._read(rs.highWaterMark); } } function Transform(options) { if (!(this instanceof Transform)) return new Transform(options); Duplex.call(this, options); this._transformState = new TransformState(options, this); // when the writable side finishes, then flush out anything remaining. var stream = this; // start out asking for a readable event once data is transformed. this._readableState.needReadable = true; // we have implemented the _read method, and done the other things // that Readable wants before the first _read call, so unset the // sync guard flag. this._readableState.sync = false; this.once('prefinish', function() { if (util.isFunction(this._flush)) this._flush(function(er) { done(stream, er); }); else done(stream); }); } Transform.prototype.push = function(chunk, encoding) { this._transformState.needTransform = false; return Duplex.prototype.push.call(this, chunk, encoding); }; // This is the part where you do stuff! // override this function in implementation services. // 'chunk' is an input chunk. // // Call `push(newChunk)` to pass along transformed output // to the readable side. You may call 'push' zero or more times. // // Call `cb(err)` when you are done with this chunk. If you pass // an error, then that'll put the hurt on the whole operation. If you // never call cb(), then you'll never get another chunk. Transform.prototype._transform = function(chunk, encoding, cb) { throw new Error('not implemented'); }; Transform.prototype._write = function(chunk, encoding, cb) { var ts = this._transformState; ts.writecb = cb; ts.writechunk = chunk; ts.writeencoding = encoding; if (!ts.transforming) { var rs = this._readableState; if (ts.needTransform || rs.needReadable || rs.length < rs.highWaterMark) this._read(rs.highWaterMark); } }; // Doesn't matter what the args are here. // _transform does all the work. // That we got here means that the readable side wants more data. Transform.prototype._read = function(n) { var ts = this._transformState; if (!util.isNull(ts.writechunk) && ts.writecb && !ts.transforming) { ts.transforming = true; this._transform(ts.writechunk, ts.writeencoding, ts.afterTransform); } else { // mark that we need a transform, so that any data that comes in // will get processed, now that we've asked for it. ts.needTransform = true; } }; function done(stream, er) { if (er) return stream.emit('error', er); // if there's nothing in the write buffer, then that means // that nothing more will ever be provided var ws = stream._writableState; var ts = stream._transformState; if (ws.length) throw new Error('calling transform done when ws.length != 0'); if (ts.transforming) throw new Error('calling transform done when still transforming'); return stream.push(null); }
afterTransform
identifier_name
_stream_transform.js
// Copyright Joyent, Inc. and other Node contributors. // // Permission is hereby granted, free of charge, to any person obtaining a // copy of this software and associated documentation files (the // "Software"), to deal in the Software without restriction, including // without limitation the rights to use, copy, modify, merge, publish, // distribute, sublicense, and/or sell copies of the Software, and to permit // persons to whom the Software is furnished to do so, subject to the // following conditions: // // The above copyright notice and this permission notice shall be included // in all copies or substantial portions of the Software. // // THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS // OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF // MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN // NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, // DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR // OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE // USE OR OTHER DEALINGS IN THE SOFTWARE. // a transform stream is a readable/writable stream where you do // something with the data. Sometimes it's called a "filter", // but that's not a great name for it, since that implies a thing where // some bits pass through, and others are simply ignored. (That would // be a valid example of a transform, of course.) // // While the output is causally related to the input, it's not a // necessarily symmetric or synchronous transformation. For example, // a zlib stream might take multiple plain-text writes(), and then // emit a single compressed chunk some time in the future. // // Here's how this works: // // The Transform stream has all the aspects of the readable and writable // stream services. When you write(chunk), that calls _write(chunk,cb) // internally, and returns false if there's a lot of pending writes // buffered up. When you call read(), that calls _read(n) until // there's enough pending readable data buffered up. // // In a transform stream, the written data is placed in a buffer. When // _read(n) is called, it transforms the queued up data, calling the // buffered _write cb's as it consumes chunks. If consuming a single // written chunk would result in multiple output chunks, then the first // outputted bit calls the readcb, and subsequent chunks just go into // the read buffer, and will cause it to emit 'readable' if necessary. // // This way, back-pressure is actually determined by the reading side, // since _read has to be called to start processing a new chunk. However, // a pathological inflate type of transform can cause excessive buffering // here. For example, imagine a stream where every byte of input is // interpreted as an integer from 0-255, and then results in that many // bytes of output. Writing the 4 bytes {ff,ff,ff,ff} would result in // 1kb of data being output. In this case, you could write a very small // amount of input, and end up with a very large amount of output. In // such a pathological inflating mechanism, there'd be no way to tell // the system to stop doing the transform. A single 4MB write could // cause the system to run out of memory. // // However, even in such a pathological case, only a single written chunk // would be consumed, and then the rest would wait (un-transformed) until // the results of the previous transformed chunk were consumed. module.exports = Transform; var Duplex = require('./_stream_duplex'); /*<replacement>*/ var util = require('core-util-is'); util.inherits = require('inherits'); /*</replacement>*/ util.inherits(Transform, Duplex); function TransformState(options, stream)
function afterTransform(stream, er, data) { var ts = stream._transformState; ts.transforming = false; var cb = ts.writecb; if (!cb) return stream.emit('error', new Error('no writecb in Transform class')); ts.writechunk = null; ts.writecb = null; if (!util.isNullOrUndefined(data)) stream.push(data); if (cb) cb(er); var rs = stream._readableState; rs.reading = false; if (rs.needReadable || rs.length < rs.highWaterMark) { stream._read(rs.highWaterMark); } } function Transform(options) { if (!(this instanceof Transform)) return new Transform(options); Duplex.call(this, options); this._transformState = new TransformState(options, this); // when the writable side finishes, then flush out anything remaining. var stream = this; // start out asking for a readable event once data is transformed. this._readableState.needReadable = true; // we have implemented the _read method, and done the other things // that Readable wants before the first _read call, so unset the // sync guard flag. this._readableState.sync = false; this.once('prefinish', function() { if (util.isFunction(this._flush)) this._flush(function(er) { done(stream, er); }); else done(stream); }); } Transform.prototype.push = function(chunk, encoding) { this._transformState.needTransform = false; return Duplex.prototype.push.call(this, chunk, encoding); }; // This is the part where you do stuff! // override this function in implementation services. // 'chunk' is an input chunk. // // Call `push(newChunk)` to pass along transformed output // to the readable side. You may call 'push' zero or more times. // // Call `cb(err)` when you are done with this chunk. If you pass // an error, then that'll put the hurt on the whole operation. If you // never call cb(), then you'll never get another chunk. Transform.prototype._transform = function(chunk, encoding, cb) { throw new Error('not implemented'); }; Transform.prototype._write = function(chunk, encoding, cb) { var ts = this._transformState; ts.writecb = cb; ts.writechunk = chunk; ts.writeencoding = encoding; if (!ts.transforming) { var rs = this._readableState; if (ts.needTransform || rs.needReadable || rs.length < rs.highWaterMark) this._read(rs.highWaterMark); } }; // Doesn't matter what the args are here. // _transform does all the work. // That we got here means that the readable side wants more data. Transform.prototype._read = function(n) { var ts = this._transformState; if (!util.isNull(ts.writechunk) && ts.writecb && !ts.transforming) { ts.transforming = true; this._transform(ts.writechunk, ts.writeencoding, ts.afterTransform); } else { // mark that we need a transform, so that any data that comes in // will get processed, now that we've asked for it. ts.needTransform = true; } }; function done(stream, er) { if (er) return stream.emit('error', er); // if there's nothing in the write buffer, then that means // that nothing more will ever be provided var ws = stream._writableState; var ts = stream._transformState; if (ws.length) throw new Error('calling transform done when ws.length != 0'); if (ts.transforming) throw new Error('calling transform done when still transforming'); return stream.push(null); }
{ this.afterTransform = function(er, data) { return afterTransform(stream, er, data); }; this.needTransform = false; this.transforming = false; this.writecb = null; this.writechunk = null; }
identifier_body
hours.ts
import { Component } from '@angular/core'; import { IonicPage, NavController, NavParams } from 'ionic-angular'; @IonicPage() @Component({ selector: 'page-hours', templateUrl: 'hours.html', }) export class HoursPage { started: boolean = false; stopped: boolean = true; constructor(public navCtrl: NavController, public navParams: NavParams) { } ionViewDidLoad() { } startstop() { this.started = !this.started; this.stopped = !this.stopped; var date = new Date(); var month = date.getMonth() + 1; var year = date.getFullYear(); var day = date.getUTCDate(); var hour = date.getHours(); var mins = date.getMinutes(); var time = `${month}/${day}/${year} ${hour}:${mins}`; var msg = `Time ${this.started ? 'in' : 'out'} ${time}`; document.getElementById('startstops').innerHTML = "<div class='time'>" + msg + "</div>" + document.getElementById('startstops').innerHTML;
}
}
random_line_split
hours.ts
import { Component } from '@angular/core'; import { IonicPage, NavController, NavParams } from 'ionic-angular'; @IonicPage() @Component({ selector: 'page-hours', templateUrl: 'hours.html', }) export class HoursPage { started: boolean = false; stopped: boolean = true; constructor(public navCtrl: NavController, public navParams: NavParams) {
ionViewDidLoad() { } startstop() { this.started = !this.started; this.stopped = !this.stopped; var date = new Date(); var month = date.getMonth() + 1; var year = date.getFullYear(); var day = date.getUTCDate(); var hour = date.getHours(); var mins = date.getMinutes(); var time = `${month}/${day}/${year} ${hour}:${mins}`; var msg = `Time ${this.started ? 'in' : 'out'} ${time}`; document.getElementById('startstops').innerHTML = "<div class='time'>" + msg + "</div>" + document.getElementById('startstops').innerHTML; } }
}
identifier_body
hours.ts
import { Component } from '@angular/core'; import { IonicPage, NavController, NavParams } from 'ionic-angular'; @IonicPage() @Component({ selector: 'page-hours', templateUrl: 'hours.html', }) export class Ho
started: boolean = false; stopped: boolean = true; constructor(public navCtrl: NavController, public navParams: NavParams) { } ionViewDidLoad() { } startstop() { this.started = !this.started; this.stopped = !this.stopped; var date = new Date(); var month = date.getMonth() + 1; var year = date.getFullYear(); var day = date.getUTCDate(); var hour = date.getHours(); var mins = date.getMinutes(); var time = `${month}/${day}/${year} ${hour}:${mins}`; var msg = `Time ${this.started ? 'in' : 'out'} ${time}`; document.getElementById('startstops').innerHTML = "<div class='time'>" + msg + "</div>" + document.getElementById('startstops').innerHTML; } }
ursPage {
identifier_name
scheduler.py
from future import standard_library standard_library.install_aliases() from builtins import object import threading from time import time import random import queue from ..common import log class Scheduler(object): """ A simple scheduler which schedules the periodic or once event """ import sortedcontainers as sc max_delay_time = 60 def __init__(self): self._jobs = Scheduler.sc.SortedSet() self._wakeup_q = queue.Queue() self._lock = threading.Lock() self._thr = threading.Thread(target=self._do_jobs) self._thr.deamon = True self._started = False def start(self): """ Start the schduler which will start the internal thread for scheduling jobs. Please do tear_down when doing cleanup """ if self._started: log.logger.info("Scheduler already started.") return self._started = True self._thr.start() def tear_down(self): """ Stop the schduler which will stop the internal thread for scheduling jobs. """ if not self._started: log.logger.info("Scheduler already tear down.") return self._wakeup_q.put(True) def _do_jobs(self): while 1: (sleep_time, jobs) = self.get_ready_jobs() self._do_execution(jobs) try: done = self._wakeup_q.get(timeout=sleep_time) except queue.Empty: pass else: if done: break self._started = False log.logger.info("Scheduler exited.") def get_ready_jobs(self): """ @return: a 2 element tuple. The first element is the next ready duration. The second element is ready jobs list """ now = time() ready_jobs = [] sleep_time = 1 with self._lock: job_set = self._jobs total_jobs = len(job_set) for job in job_set: if job.get_expiration() <= now: ready_jobs.append(job) if ready_jobs: del job_set[:len(ready_jobs)] for job in ready_jobs: if job.get_interval() != 0 and not job.stopped(): # repeated job, calculate next due time and enqueue job.update_expiration() job_set.add(job) if job_set: sleep_time = job_set[0].get_expiration() - now if sleep_time < 0: log.logger.warn("Scheduler satuation, sleep_time=%s", sleep_time) sleep_time = 0.1 if ready_jobs: log.logger.info("Get %d ready jobs, next duration is %f, " "and there are %s jobs scheduling", len(ready_jobs), sleep_time, total_jobs) ready_jobs.sort(key=lambda job: job.get("priority", 0), reverse=True) return (sleep_time, ready_jobs) def add_jobs(self, jobs): with self._lock: now = time() job_set = self._jobs for job in jobs: delay_time = random.randrange(0, self.max_delay_time) job.set_initial_due_time(now + delay_time) job_set.add(job) self._wakeup() def update_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: job_set.discard(njob) job_set.add(njob) self._wakeup() def remove_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: njob.stop() job_set.discard(njob) self._wakeup() def number_of_jobs(self): with self._lock: return len(self._jobs) def disable_randomization(self):
def _wakeup(self): self._wakeup_q.put(None) def _do_execution(self, jobs): for job in jobs: job()
self.max_delay_time = 1
identifier_body
scheduler.py
from future import standard_library standard_library.install_aliases() from builtins import object import threading from time import time import random import queue from ..common import log class Scheduler(object): """ A simple scheduler which schedules the periodic or once event """ import sortedcontainers as sc max_delay_time = 60 def __init__(self): self._jobs = Scheduler.sc.SortedSet() self._wakeup_q = queue.Queue() self._lock = threading.Lock() self._thr = threading.Thread(target=self._do_jobs) self._thr.deamon = True self._started = False def start(self): """ Start the schduler which will start the internal thread for scheduling jobs. Please do tear_down when doing cleanup """ if self._started: log.logger.info("Scheduler already started.") return self._started = True self._thr.start() def tear_down(self): """ Stop the schduler which will stop the internal thread for scheduling jobs. """ if not self._started: log.logger.info("Scheduler already tear down.") return self._wakeup_q.put(True) def _do_jobs(self): while 1: (sleep_time, jobs) = self.get_ready_jobs() self._do_execution(jobs) try: done = self._wakeup_q.get(timeout=sleep_time) except queue.Empty: pass else: if done: break self._started = False log.logger.info("Scheduler exited.") def get_ready_jobs(self): """ @return: a 2 element tuple. The first element is the next ready duration. The second element is ready jobs list """ now = time() ready_jobs = []
sleep_time = 1 with self._lock: job_set = self._jobs total_jobs = len(job_set) for job in job_set: if job.get_expiration() <= now: ready_jobs.append(job) if ready_jobs: del job_set[:len(ready_jobs)] for job in ready_jobs: if job.get_interval() != 0 and not job.stopped(): # repeated job, calculate next due time and enqueue job.update_expiration() job_set.add(job) if job_set: sleep_time = job_set[0].get_expiration() - now if sleep_time < 0: log.logger.warn("Scheduler satuation, sleep_time=%s", sleep_time) sleep_time = 0.1 if ready_jobs: log.logger.info("Get %d ready jobs, next duration is %f, " "and there are %s jobs scheduling", len(ready_jobs), sleep_time, total_jobs) ready_jobs.sort(key=lambda job: job.get("priority", 0), reverse=True) return (sleep_time, ready_jobs) def add_jobs(self, jobs): with self._lock: now = time() job_set = self._jobs for job in jobs: delay_time = random.randrange(0, self.max_delay_time) job.set_initial_due_time(now + delay_time) job_set.add(job) self._wakeup() def update_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: job_set.discard(njob) job_set.add(njob) self._wakeup() def remove_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: njob.stop() job_set.discard(njob) self._wakeup() def number_of_jobs(self): with self._lock: return len(self._jobs) def disable_randomization(self): self.max_delay_time = 1 def _wakeup(self): self._wakeup_q.put(None) def _do_execution(self, jobs): for job in jobs: job()
random_line_split
scheduler.py
from future import standard_library standard_library.install_aliases() from builtins import object import threading from time import time import random import queue from ..common import log class Scheduler(object): """ A simple scheduler which schedules the periodic or once event """ import sortedcontainers as sc max_delay_time = 60 def __init__(self): self._jobs = Scheduler.sc.SortedSet() self._wakeup_q = queue.Queue() self._lock = threading.Lock() self._thr = threading.Thread(target=self._do_jobs) self._thr.deamon = True self._started = False def start(self): """ Start the schduler which will start the internal thread for scheduling jobs. Please do tear_down when doing cleanup """ if self._started: log.logger.info("Scheduler already started.") return self._started = True self._thr.start() def tear_down(self): """ Stop the schduler which will stop the internal thread for scheduling jobs. """ if not self._started: log.logger.info("Scheduler already tear down.") return self._wakeup_q.put(True) def _do_jobs(self): while 1: (sleep_time, jobs) = self.get_ready_jobs() self._do_execution(jobs) try: done = self._wakeup_q.get(timeout=sleep_time) except queue.Empty: pass else: if done: break self._started = False log.logger.info("Scheduler exited.") def get_ready_jobs(self): """ @return: a 2 element tuple. The first element is the next ready duration. The second element is ready jobs list """ now = time() ready_jobs = [] sleep_time = 1 with self._lock: job_set = self._jobs total_jobs = len(job_set) for job in job_set:
if ready_jobs: del job_set[:len(ready_jobs)] for job in ready_jobs: if job.get_interval() != 0 and not job.stopped(): # repeated job, calculate next due time and enqueue job.update_expiration() job_set.add(job) if job_set: sleep_time = job_set[0].get_expiration() - now if sleep_time < 0: log.logger.warn("Scheduler satuation, sleep_time=%s", sleep_time) sleep_time = 0.1 if ready_jobs: log.logger.info("Get %d ready jobs, next duration is %f, " "and there are %s jobs scheduling", len(ready_jobs), sleep_time, total_jobs) ready_jobs.sort(key=lambda job: job.get("priority", 0), reverse=True) return (sleep_time, ready_jobs) def add_jobs(self, jobs): with self._lock: now = time() job_set = self._jobs for job in jobs: delay_time = random.randrange(0, self.max_delay_time) job.set_initial_due_time(now + delay_time) job_set.add(job) self._wakeup() def update_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: job_set.discard(njob) job_set.add(njob) self._wakeup() def remove_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: njob.stop() job_set.discard(njob) self._wakeup() def number_of_jobs(self): with self._lock: return len(self._jobs) def disable_randomization(self): self.max_delay_time = 1 def _wakeup(self): self._wakeup_q.put(None) def _do_execution(self, jobs): for job in jobs: job()
if job.get_expiration() <= now: ready_jobs.append(job)
conditional_block
scheduler.py
from future import standard_library standard_library.install_aliases() from builtins import object import threading from time import time import random import queue from ..common import log class
(object): """ A simple scheduler which schedules the periodic or once event """ import sortedcontainers as sc max_delay_time = 60 def __init__(self): self._jobs = Scheduler.sc.SortedSet() self._wakeup_q = queue.Queue() self._lock = threading.Lock() self._thr = threading.Thread(target=self._do_jobs) self._thr.deamon = True self._started = False def start(self): """ Start the schduler which will start the internal thread for scheduling jobs. Please do tear_down when doing cleanup """ if self._started: log.logger.info("Scheduler already started.") return self._started = True self._thr.start() def tear_down(self): """ Stop the schduler which will stop the internal thread for scheduling jobs. """ if not self._started: log.logger.info("Scheduler already tear down.") return self._wakeup_q.put(True) def _do_jobs(self): while 1: (sleep_time, jobs) = self.get_ready_jobs() self._do_execution(jobs) try: done = self._wakeup_q.get(timeout=sleep_time) except queue.Empty: pass else: if done: break self._started = False log.logger.info("Scheduler exited.") def get_ready_jobs(self): """ @return: a 2 element tuple. The first element is the next ready duration. The second element is ready jobs list """ now = time() ready_jobs = [] sleep_time = 1 with self._lock: job_set = self._jobs total_jobs = len(job_set) for job in job_set: if job.get_expiration() <= now: ready_jobs.append(job) if ready_jobs: del job_set[:len(ready_jobs)] for job in ready_jobs: if job.get_interval() != 0 and not job.stopped(): # repeated job, calculate next due time and enqueue job.update_expiration() job_set.add(job) if job_set: sleep_time = job_set[0].get_expiration() - now if sleep_time < 0: log.logger.warn("Scheduler satuation, sleep_time=%s", sleep_time) sleep_time = 0.1 if ready_jobs: log.logger.info("Get %d ready jobs, next duration is %f, " "and there are %s jobs scheduling", len(ready_jobs), sleep_time, total_jobs) ready_jobs.sort(key=lambda job: job.get("priority", 0), reverse=True) return (sleep_time, ready_jobs) def add_jobs(self, jobs): with self._lock: now = time() job_set = self._jobs for job in jobs: delay_time = random.randrange(0, self.max_delay_time) job.set_initial_due_time(now + delay_time) job_set.add(job) self._wakeup() def update_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: job_set.discard(njob) job_set.add(njob) self._wakeup() def remove_jobs(self, jobs): with self._lock: job_set = self._jobs for njob in jobs: njob.stop() job_set.discard(njob) self._wakeup() def number_of_jobs(self): with self._lock: return len(self._jobs) def disable_randomization(self): self.max_delay_time = 1 def _wakeup(self): self._wakeup_q.put(None) def _do_execution(self, jobs): for job in jobs: job()
Scheduler
identifier_name
cmake.py
# Copyright 2014 Open Source Robotics Foundation, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os import re from catkin_tools.execution.io import IOBufferProtocol from catkin_tools.execution.events import ExecutionEvent from catkin_tools.terminal_color import fmt from catkin_tools.terminal_color import sanitize from catkin_tools.utils import which CMAKE_EXEC = which('cmake') CMAKE_INSTALL_MANIFEST_FILENAME = 'install_manifest.txt' def split_to_last_line_break(data): """This splits a byte buffer into (head, tail) where head contains the beginning of the buffer to the last line break (inclusive) and the tail contains all bytes after that.""" last_break_index = 1 + data.rfind(b'\n') return data[:last_break_index], data[last_break_index:] class CMakeIOBufferProtocol(IOBufferProtocol): """An asyncio protocol that collects stdout and stderr. This class also generates `stdout` and `stderr` events. Since the underlying asyncio API constructs the actual protocols, this class provides a factory method to inject the job and stage information into the created protocol. """ def abspath(self, groups): """Group filter that turns source-relative paths into absolute paths.""" return (groups[0] if groups[0].startswith(os.sep) else os.path.join(self.source_path, groups[0]),) + groups[1:] def __init__(self, label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs): super(CMakeIOBufferProtocol, self).__init__(label, job_id, stage_label, event_queue, log_path, *args, **kwargs) self.source_path = source_path self.suppress_stdout = suppress_stdout # These are buffers for incomplete lines that we want to wait to parse # until we have received them completely self.stdout_tail = b'' self.stderr_tail = b'' # Line formatting filters # Each is a 3-tuple: # - regular expression (with captured groups) # - output formatting line (subs captured groups) # - functor which filters captured groups filters = [ (r'^-- :(.+)', '@{cf}--@| :@{yf}{}@|', None), (r'^-- (.+)', '@{cf}--@| {}', None), (r'CMake Error at (.+):(.+)', '@{rf}@!CMake Error@| at {}:{}', self.abspath), (r'CMake Warning at (.+):(.+)', '@{yf}@!CMake Warning@| at {}:{}', self.abspath), (r'CMake Warning (dev) at (.+):(.+)', '@{yf}@!CMake Warning (dev)@| at {}:{}', self.abspath), (r'(?i)(warning.*)', '@{yf}{}@|', None), (r'(?i)ERROR:(.*)', '@!@{rf}ERROR:@|{}@|', None), (r'Call Stack \(most recent call first\):(.*)', '@{cf}Call Stack (most recent call first):@|{}', None), ] self.filters = [(re.compile(p), r, f) for (p, r, f) in filters] def on_stdout_received(self, data): if not self.suppress_stdout: data_head, self.stdout_tail = split_to_last_line_break(self.stdout_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) def on_stderr_received(self, data): data_head, self.stderr_tail = split_to_last_line_break(self.stderr_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) def close(self): # Make sure tail buffers are flushed self.flush_tails() super(CMakeIOBufferProtocol, self).close() def flush_tails(self): """Write out any unprocessed tail buffers.""" colored = self.color_lines(self.stdout_tail) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) self.stdout_tail = b'' colored = self.color_lines(self.stderr_tail) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) self.stderr_tail = b'' def color_lines(self, data): """Apply colorization rules to each line in data""" decoded_data = self._decode(data) # TODO: This will only work if all lines are received at once. Instead # of directly splitting lines, we should buffer the data lines until # the last character is a line break lines = decoded_data.splitlines(True) # Keep line breaks colored_lines = [self.colorize_cmake(line) for line in lines] colored_data = ''.join(colored_lines) encoded_data = self._encode(colored_data) return encoded_data @classmethod def factory_factory(cls, source_path, suppress_stdout=False): """Factory factory for constructing protocols that know the source path for this CMake package.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs) return init_proxy return factory def colorize_cmake(self, line): """Colorizes output from CMake This also prepends the source path to the locations of warnings and errors. :param line: one, new line terminated, line from `cmake` which needs coloring. :type line: str """ # return line cline = sanitize(line).rstrip() if len(cline.strip()) > 0: for p, r, f in self.filters: match = p.match(cline) if match is not None: cline = fmt(r, reset=False) if f is not None: cline = cline.format(*f(match.groups())) else: cline = cline.format(*match.groups()) break return cline + '\n' class CMakeMakeIOBufferProtocol(IOBufferProtocol): """An IOBufferProtocol which parses CMake's progress prefixes and emits corresponding STAGE_PROGRESS events.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, *args, **kwargs): super(CMakeMakeIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) def on_stdout_received(self, data): super(CMakeMakeIOBufferProtocol, self).on_stdout_received(data) self.send_progress(data) def send_progress(self, data): """Parse CMake Make completion progress""" progress_matches = re.match(r'\[\s*([0-9]+)%\]', self._decode(data)) if progress_matches is not None: self.event_queue.put(ExecutionEvent( 'STAGE_PROGRESS', job_id=self.job_id, stage_label=self.stage_label, percent=str(progress_matches.groups()[0]))) class CMakeMakeRunTestsIOBufferProtocol(CMakeMakeIOBufferProtocol): """An IOBufferProtocol which parses the output of `make run_tests`.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs):
def on_stdout_received(self, data): self.send_progress(data) data = self._decode(data) if data.startswith('-- run_tests.py: execute command'): self.in_test_output = True elif data.startswith('-- run_tests.py: verify result'): self.in_test_output = False if self.verbose or self.in_test_output: colored = self.colorize_run_tests(data) super(CMakeMakeRunTestsIOBufferProtocol, self).on_stdout_received(colored.encode()) def colorize_run_tests(self, line): cline = sanitize(line).rstrip() for p, r in self.filters: if p.match(cline): lines = [fmt(r).format(line) for line in cline.splitlines()] cline = '\n'.join(lines) return cline + '\n' @classmethod def factory_factory(cls, verbose): """Factory factory for constructing protocols that know the verbosity.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs) return init_proxy return factory def get_installed_files(path): """Get a set of files installed by a CMake package as specified by an install_manifest.txt in a given directory.""" install_manifest_path = os.path.join( path, CMAKE_INSTALL_MANIFEST_FILENAME) installed_files = set() if os.path.exists(install_manifest_path): with open(install_manifest_path) as f: installed_files = set([line.strip() for line in f.readlines()]) return installed_files
super(CMakeMakeRunTestsIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) # Line formatting filters # Each is a 2-tuple: # - regular expression # - output formatting line self.filters = [ (re.compile(r'^-- run_tests.py:'), '@!@{kf}{}@|'), ] self.in_test_output = False self.verbose = verbose
identifier_body
cmake.py
# Copyright 2014 Open Source Robotics Foundation, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os import re from catkin_tools.execution.io import IOBufferProtocol from catkin_tools.execution.events import ExecutionEvent from catkin_tools.terminal_color import fmt from catkin_tools.terminal_color import sanitize from catkin_tools.utils import which CMAKE_EXEC = which('cmake') CMAKE_INSTALL_MANIFEST_FILENAME = 'install_manifest.txt' def split_to_last_line_break(data): """This splits a byte buffer into (head, tail) where head contains the beginning of the buffer to the last line break (inclusive) and the tail contains all bytes after that.""" last_break_index = 1 + data.rfind(b'\n') return data[:last_break_index], data[last_break_index:] class CMakeIOBufferProtocol(IOBufferProtocol): """An asyncio protocol that collects stdout and stderr. This class also generates `stdout` and `stderr` events. Since the underlying asyncio API constructs the actual protocols, this class provides a factory method to inject the job and stage information into the created protocol. """ def abspath(self, groups): """Group filter that turns source-relative paths into absolute paths.""" return (groups[0] if groups[0].startswith(os.sep) else os.path.join(self.source_path, groups[0]),) + groups[1:] def __init__(self, label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs): super(CMakeIOBufferProtocol, self).__init__(label, job_id, stage_label, event_queue, log_path, *args, **kwargs) self.source_path = source_path self.suppress_stdout = suppress_stdout # These are buffers for incomplete lines that we want to wait to parse # until we have received them completely self.stdout_tail = b'' self.stderr_tail = b'' # Line formatting filters # Each is a 3-tuple: # - regular expression (with captured groups) # - output formatting line (subs captured groups) # - functor which filters captured groups filters = [ (r'^-- :(.+)', '@{cf}--@| :@{yf}{}@|', None), (r'^-- (.+)', '@{cf}--@| {}', None), (r'CMake Error at (.+):(.+)', '@{rf}@!CMake Error@| at {}:{}', self.abspath), (r'CMake Warning at (.+):(.+)', '@{yf}@!CMake Warning@| at {}:{}', self.abspath), (r'CMake Warning (dev) at (.+):(.+)', '@{yf}@!CMake Warning (dev)@| at {}:{}', self.abspath), (r'(?i)(warning.*)', '@{yf}{}@|', None), (r'(?i)ERROR:(.*)', '@!@{rf}ERROR:@|{}@|', None), (r'Call Stack \(most recent call first\):(.*)', '@{cf}Call Stack (most recent call first):@|{}', None), ] self.filters = [(re.compile(p), r, f) for (p, r, f) in filters] def on_stdout_received(self, data): if not self.suppress_stdout: data_head, self.stdout_tail = split_to_last_line_break(self.stdout_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) def on_stderr_received(self, data): data_head, self.stderr_tail = split_to_last_line_break(self.stderr_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) def close(self): # Make sure tail buffers are flushed self.flush_tails() super(CMakeIOBufferProtocol, self).close() def flush_tails(self): """Write out any unprocessed tail buffers.""" colored = self.color_lines(self.stdout_tail) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) self.stdout_tail = b'' colored = self.color_lines(self.stderr_tail) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) self.stderr_tail = b'' def color_lines(self, data): """Apply colorization rules to each line in data""" decoded_data = self._decode(data) # TODO: This will only work if all lines are received at once. Instead # of directly splitting lines, we should buffer the data lines until # the last character is a line break lines = decoded_data.splitlines(True) # Keep line breaks colored_lines = [self.colorize_cmake(line) for line in lines] colored_data = ''.join(colored_lines) encoded_data = self._encode(colored_data) return encoded_data @classmethod def factory_factory(cls, source_path, suppress_stdout=False): """Factory factory for constructing protocols that know the source path for this CMake package.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs) return init_proxy return factory def colorize_cmake(self, line): """Colorizes output from CMake This also prepends the source path to the locations of warnings and errors. :param line: one, new line terminated, line from `cmake` which needs coloring. :type line: str """ # return line cline = sanitize(line).rstrip() if len(cline.strip()) > 0:
return cline + '\n' class CMakeMakeIOBufferProtocol(IOBufferProtocol): """An IOBufferProtocol which parses CMake's progress prefixes and emits corresponding STAGE_PROGRESS events.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, *args, **kwargs): super(CMakeMakeIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) def on_stdout_received(self, data): super(CMakeMakeIOBufferProtocol, self).on_stdout_received(data) self.send_progress(data) def send_progress(self, data): """Parse CMake Make completion progress""" progress_matches = re.match(r'\[\s*([0-9]+)%\]', self._decode(data)) if progress_matches is not None: self.event_queue.put(ExecutionEvent( 'STAGE_PROGRESS', job_id=self.job_id, stage_label=self.stage_label, percent=str(progress_matches.groups()[0]))) class CMakeMakeRunTestsIOBufferProtocol(CMakeMakeIOBufferProtocol): """An IOBufferProtocol which parses the output of `make run_tests`.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs): super(CMakeMakeRunTestsIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) # Line formatting filters # Each is a 2-tuple: # - regular expression # - output formatting line self.filters = [ (re.compile(r'^-- run_tests.py:'), '@!@{kf}{}@|'), ] self.in_test_output = False self.verbose = verbose def on_stdout_received(self, data): self.send_progress(data) data = self._decode(data) if data.startswith('-- run_tests.py: execute command'): self.in_test_output = True elif data.startswith('-- run_tests.py: verify result'): self.in_test_output = False if self.verbose or self.in_test_output: colored = self.colorize_run_tests(data) super(CMakeMakeRunTestsIOBufferProtocol, self).on_stdout_received(colored.encode()) def colorize_run_tests(self, line): cline = sanitize(line).rstrip() for p, r in self.filters: if p.match(cline): lines = [fmt(r).format(line) for line in cline.splitlines()] cline = '\n'.join(lines) return cline + '\n' @classmethod def factory_factory(cls, verbose): """Factory factory for constructing protocols that know the verbosity.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs) return init_proxy return factory def get_installed_files(path): """Get a set of files installed by a CMake package as specified by an install_manifest.txt in a given directory.""" install_manifest_path = os.path.join( path, CMAKE_INSTALL_MANIFEST_FILENAME) installed_files = set() if os.path.exists(install_manifest_path): with open(install_manifest_path) as f: installed_files = set([line.strip() for line in f.readlines()]) return installed_files
for p, r, f in self.filters: match = p.match(cline) if match is not None: cline = fmt(r, reset=False) if f is not None: cline = cline.format(*f(match.groups())) else: cline = cline.format(*match.groups()) break
conditional_block
cmake.py
# Copyright 2014 Open Source Robotics Foundation, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os import re from catkin_tools.execution.io import IOBufferProtocol from catkin_tools.execution.events import ExecutionEvent from catkin_tools.terminal_color import fmt from catkin_tools.terminal_color import sanitize from catkin_tools.utils import which CMAKE_EXEC = which('cmake') CMAKE_INSTALL_MANIFEST_FILENAME = 'install_manifest.txt' def split_to_last_line_break(data): """This splits a byte buffer into (head, tail) where head contains the beginning of the buffer to the last line break (inclusive) and the tail contains all bytes after that.""" last_break_index = 1 + data.rfind(b'\n') return data[:last_break_index], data[last_break_index:] class
(IOBufferProtocol): """An asyncio protocol that collects stdout and stderr. This class also generates `stdout` and `stderr` events. Since the underlying asyncio API constructs the actual protocols, this class provides a factory method to inject the job and stage information into the created protocol. """ def abspath(self, groups): """Group filter that turns source-relative paths into absolute paths.""" return (groups[0] if groups[0].startswith(os.sep) else os.path.join(self.source_path, groups[0]),) + groups[1:] def __init__(self, label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs): super(CMakeIOBufferProtocol, self).__init__(label, job_id, stage_label, event_queue, log_path, *args, **kwargs) self.source_path = source_path self.suppress_stdout = suppress_stdout # These are buffers for incomplete lines that we want to wait to parse # until we have received them completely self.stdout_tail = b'' self.stderr_tail = b'' # Line formatting filters # Each is a 3-tuple: # - regular expression (with captured groups) # - output formatting line (subs captured groups) # - functor which filters captured groups filters = [ (r'^-- :(.+)', '@{cf}--@| :@{yf}{}@|', None), (r'^-- (.+)', '@{cf}--@| {}', None), (r'CMake Error at (.+):(.+)', '@{rf}@!CMake Error@| at {}:{}', self.abspath), (r'CMake Warning at (.+):(.+)', '@{yf}@!CMake Warning@| at {}:{}', self.abspath), (r'CMake Warning (dev) at (.+):(.+)', '@{yf}@!CMake Warning (dev)@| at {}:{}', self.abspath), (r'(?i)(warning.*)', '@{yf}{}@|', None), (r'(?i)ERROR:(.*)', '@!@{rf}ERROR:@|{}@|', None), (r'Call Stack \(most recent call first\):(.*)', '@{cf}Call Stack (most recent call first):@|{}', None), ] self.filters = [(re.compile(p), r, f) for (p, r, f) in filters] def on_stdout_received(self, data): if not self.suppress_stdout: data_head, self.stdout_tail = split_to_last_line_break(self.stdout_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) def on_stderr_received(self, data): data_head, self.stderr_tail = split_to_last_line_break(self.stderr_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) def close(self): # Make sure tail buffers are flushed self.flush_tails() super(CMakeIOBufferProtocol, self).close() def flush_tails(self): """Write out any unprocessed tail buffers.""" colored = self.color_lines(self.stdout_tail) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) self.stdout_tail = b'' colored = self.color_lines(self.stderr_tail) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) self.stderr_tail = b'' def color_lines(self, data): """Apply colorization rules to each line in data""" decoded_data = self._decode(data) # TODO: This will only work if all lines are received at once. Instead # of directly splitting lines, we should buffer the data lines until # the last character is a line break lines = decoded_data.splitlines(True) # Keep line breaks colored_lines = [self.colorize_cmake(line) for line in lines] colored_data = ''.join(colored_lines) encoded_data = self._encode(colored_data) return encoded_data @classmethod def factory_factory(cls, source_path, suppress_stdout=False): """Factory factory for constructing protocols that know the source path for this CMake package.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs) return init_proxy return factory def colorize_cmake(self, line): """Colorizes output from CMake This also prepends the source path to the locations of warnings and errors. :param line: one, new line terminated, line from `cmake` which needs coloring. :type line: str """ # return line cline = sanitize(line).rstrip() if len(cline.strip()) > 0: for p, r, f in self.filters: match = p.match(cline) if match is not None: cline = fmt(r, reset=False) if f is not None: cline = cline.format(*f(match.groups())) else: cline = cline.format(*match.groups()) break return cline + '\n' class CMakeMakeIOBufferProtocol(IOBufferProtocol): """An IOBufferProtocol which parses CMake's progress prefixes and emits corresponding STAGE_PROGRESS events.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, *args, **kwargs): super(CMakeMakeIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) def on_stdout_received(self, data): super(CMakeMakeIOBufferProtocol, self).on_stdout_received(data) self.send_progress(data) def send_progress(self, data): """Parse CMake Make completion progress""" progress_matches = re.match(r'\[\s*([0-9]+)%\]', self._decode(data)) if progress_matches is not None: self.event_queue.put(ExecutionEvent( 'STAGE_PROGRESS', job_id=self.job_id, stage_label=self.stage_label, percent=str(progress_matches.groups()[0]))) class CMakeMakeRunTestsIOBufferProtocol(CMakeMakeIOBufferProtocol): """An IOBufferProtocol which parses the output of `make run_tests`.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs): super(CMakeMakeRunTestsIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) # Line formatting filters # Each is a 2-tuple: # - regular expression # - output formatting line self.filters = [ (re.compile(r'^-- run_tests.py:'), '@!@{kf}{}@|'), ] self.in_test_output = False self.verbose = verbose def on_stdout_received(self, data): self.send_progress(data) data = self._decode(data) if data.startswith('-- run_tests.py: execute command'): self.in_test_output = True elif data.startswith('-- run_tests.py: verify result'): self.in_test_output = False if self.verbose or self.in_test_output: colored = self.colorize_run_tests(data) super(CMakeMakeRunTestsIOBufferProtocol, self).on_stdout_received(colored.encode()) def colorize_run_tests(self, line): cline = sanitize(line).rstrip() for p, r in self.filters: if p.match(cline): lines = [fmt(r).format(line) for line in cline.splitlines()] cline = '\n'.join(lines) return cline + '\n' @classmethod def factory_factory(cls, verbose): """Factory factory for constructing protocols that know the verbosity.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs) return init_proxy return factory def get_installed_files(path): """Get a set of files installed by a CMake package as specified by an install_manifest.txt in a given directory.""" install_manifest_path = os.path.join( path, CMAKE_INSTALL_MANIFEST_FILENAME) installed_files = set() if os.path.exists(install_manifest_path): with open(install_manifest_path) as f: installed_files = set([line.strip() for line in f.readlines()]) return installed_files
CMakeIOBufferProtocol
identifier_name
cmake.py
# Copyright 2014 Open Source Robotics Foundation, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import os import re from catkin_tools.execution.io import IOBufferProtocol from catkin_tools.execution.events import ExecutionEvent from catkin_tools.terminal_color import fmt from catkin_tools.terminal_color import sanitize from catkin_tools.utils import which CMAKE_EXEC = which('cmake') CMAKE_INSTALL_MANIFEST_FILENAME = 'install_manifest.txt' def split_to_last_line_break(data): """This splits a byte buffer into (head, tail) where head contains the beginning of the buffer to the last line break (inclusive) and the tail contains all bytes after that.""" last_break_index = 1 + data.rfind(b'\n') return data[:last_break_index], data[last_break_index:] class CMakeIOBufferProtocol(IOBufferProtocol):
"""An asyncio protocol that collects stdout and stderr. This class also generates `stdout` and `stderr` events. Since the underlying asyncio API constructs the actual protocols, this class provides a factory method to inject the job and stage information into the created protocol. """ def abspath(self, groups): """Group filter that turns source-relative paths into absolute paths.""" return (groups[0] if groups[0].startswith(os.sep) else os.path.join(self.source_path, groups[0]),) + groups[1:] def __init__(self, label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs): super(CMakeIOBufferProtocol, self).__init__(label, job_id, stage_label, event_queue, log_path, *args, **kwargs) self.source_path = source_path self.suppress_stdout = suppress_stdout # These are buffers for incomplete lines that we want to wait to parse # until we have received them completely self.stdout_tail = b'' self.stderr_tail = b'' # Line formatting filters # Each is a 3-tuple: # - regular expression (with captured groups) # - output formatting line (subs captured groups) # - functor which filters captured groups filters = [ (r'^-- :(.+)', '@{cf}--@| :@{yf}{}@|', None), (r'^-- (.+)', '@{cf}--@| {}', None), (r'CMake Error at (.+):(.+)', '@{rf}@!CMake Error@| at {}:{}', self.abspath), (r'CMake Warning at (.+):(.+)', '@{yf}@!CMake Warning@| at {}:{}', self.abspath), (r'CMake Warning (dev) at (.+):(.+)', '@{yf}@!CMake Warning (dev)@| at {}:{}', self.abspath), (r'(?i)(warning.*)', '@{yf}{}@|', None), (r'(?i)ERROR:(.*)', '@!@{rf}ERROR:@|{}@|', None), (r'Call Stack \(most recent call first\):(.*)', '@{cf}Call Stack (most recent call first):@|{}', None), ] self.filters = [(re.compile(p), r, f) for (p, r, f) in filters] def on_stdout_received(self, data): if not self.suppress_stdout: data_head, self.stdout_tail = split_to_last_line_break(self.stdout_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) def on_stderr_received(self, data): data_head, self.stderr_tail = split_to_last_line_break(self.stderr_tail + data) colored = self.color_lines(data_head) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) def close(self): # Make sure tail buffers are flushed self.flush_tails() super(CMakeIOBufferProtocol, self).close() def flush_tails(self): """Write out any unprocessed tail buffers.""" colored = self.color_lines(self.stdout_tail) super(CMakeIOBufferProtocol, self).on_stdout_received(colored) self.stdout_tail = b'' colored = self.color_lines(self.stderr_tail) super(CMakeIOBufferProtocol, self).on_stderr_received(colored) self.stderr_tail = b'' def color_lines(self, data): """Apply colorization rules to each line in data""" decoded_data = self._decode(data) # TODO: This will only work if all lines are received at once. Instead # of directly splitting lines, we should buffer the data lines until # the last character is a line break lines = decoded_data.splitlines(True) # Keep line breaks colored_lines = [self.colorize_cmake(line) for line in lines] colored_data = ''.join(colored_lines) encoded_data = self._encode(colored_data) return encoded_data @classmethod def factory_factory(cls, source_path, suppress_stdout=False): """Factory factory for constructing protocols that know the source path for this CMake package.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, source_path, suppress_stdout, *args, **kwargs) return init_proxy return factory def colorize_cmake(self, line): """Colorizes output from CMake This also prepends the source path to the locations of warnings and errors. :param line: one, new line terminated, line from `cmake` which needs coloring. :type line: str """ # return line cline = sanitize(line).rstrip() if len(cline.strip()) > 0: for p, r, f in self.filters: match = p.match(cline) if match is not None: cline = fmt(r, reset=False) if f is not None: cline = cline.format(*f(match.groups())) else: cline = cline.format(*match.groups()) break return cline + '\n' class CMakeMakeIOBufferProtocol(IOBufferProtocol): """An IOBufferProtocol which parses CMake's progress prefixes and emits corresponding STAGE_PROGRESS events.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, *args, **kwargs): super(CMakeMakeIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) def on_stdout_received(self, data): super(CMakeMakeIOBufferProtocol, self).on_stdout_received(data) self.send_progress(data) def send_progress(self, data): """Parse CMake Make completion progress""" progress_matches = re.match(r'\[\s*([0-9]+)%\]', self._decode(data)) if progress_matches is not None: self.event_queue.put(ExecutionEvent( 'STAGE_PROGRESS', job_id=self.job_id, stage_label=self.stage_label, percent=str(progress_matches.groups()[0]))) class CMakeMakeRunTestsIOBufferProtocol(CMakeMakeIOBufferProtocol): """An IOBufferProtocol which parses the output of `make run_tests`.""" def __init__(self, label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs): super(CMakeMakeRunTestsIOBufferProtocol, self).__init__( label, job_id, stage_label, event_queue, log_path, *args, **kwargs) # Line formatting filters # Each is a 2-tuple: # - regular expression # - output formatting line self.filters = [ (re.compile(r'^-- run_tests.py:'), '@!@{kf}{}@|'), ] self.in_test_output = False self.verbose = verbose def on_stdout_received(self, data): self.send_progress(data) data = self._decode(data) if data.startswith('-- run_tests.py: execute command'): self.in_test_output = True elif data.startswith('-- run_tests.py: verify result'): self.in_test_output = False if self.verbose or self.in_test_output: colored = self.colorize_run_tests(data) super(CMakeMakeRunTestsIOBufferProtocol, self).on_stdout_received(colored.encode()) def colorize_run_tests(self, line): cline = sanitize(line).rstrip() for p, r in self.filters: if p.match(cline): lines = [fmt(r).format(line) for line in cline.splitlines()] cline = '\n'.join(lines) return cline + '\n' @classmethod def factory_factory(cls, verbose): """Factory factory for constructing protocols that know the verbosity.""" def factory(label, job_id, stage_label, event_queue, log_path): # factory is called by catkin_tools executor def init_proxy(*args, **kwargs): # init_proxy is called by asyncio return cls(label, job_id, stage_label, event_queue, log_path, verbose, *args, **kwargs) return init_proxy return factory def get_installed_files(path): """Get a set of files installed by a CMake package as specified by an install_manifest.txt in a given directory.""" install_manifest_path = os.path.join( path, CMAKE_INSTALL_MANIFEST_FILENAME) installed_files = set() if os.path.exists(install_manifest_path): with open(install_manifest_path) as f: installed_files = set([line.strip() for line in f.readlines()]) return installed_files
random_line_split
dstr-dflt-obj-ptrn-id-init-fn-name-class.js
// This file was procedurally generated from the following sources: // - src/dstr-binding/obj-ptrn-id-init-fn-name-class.case // - src/dstr-binding/default/async-gen-func-decl-dflt.template /*--- description: SingleNameBinding assigns `name` to "anonymous" classes (async generator function declaration (default parameter)) esid: sec-asyncgenerator-definitions-instantiatefunctionobject features: [async-iteration] flags: [generated, async] info: | AsyncGeneratorDeclaration : async [no LineTerminator here] function * BindingIdentifier ( FormalParameters ) { AsyncGeneratorBody } [...] 3. Let F be ! AsyncGeneratorFunctionCreate(Normal, FormalParameters, AsyncGeneratorBody, scope, strict). [...] 13.3.3.7 Runtime Semantics: KeyedBindingInitialization SingleNameBinding : BindingIdentifier Initializeropt [...] 6. If Initializer is present and v is undefined, then [...] d. If IsAnonymousFunctionDefinition(Initializer) is true, then i. Let hasNameProperty be HasOwnProperty(v, "name"). ii. ReturnIfAbrupt(hasNameProperty). iii. If hasNameProperty is false, perform SetFunctionName(v, bindingId). ---*/ var callCount = 0; async function* f({ cls = class {}, xCls = class X {}, xCls2 = class { static name() {} } } = {}) { assert.sameValue(cls.name, 'cls'); assert.notSameValue(xCls.name, 'xCls'); assert.notSameValue(xCls2.name, 'xCls2'); callCount = callCount + 1; }; f().next().then(() => { assert.sameValue(callCount, 1, 'invoked exactly once');
}).then($DONE, $DONE);
random_line_split
dstr-dflt-obj-ptrn-id-init-fn-name-class.js
// This file was procedurally generated from the following sources: // - src/dstr-binding/obj-ptrn-id-init-fn-name-class.case // - src/dstr-binding/default/async-gen-func-decl-dflt.template /*--- description: SingleNameBinding assigns `name` to "anonymous" classes (async generator function declaration (default parameter)) esid: sec-asyncgenerator-definitions-instantiatefunctionobject features: [async-iteration] flags: [generated, async] info: | AsyncGeneratorDeclaration : async [no LineTerminator here] function * BindingIdentifier ( FormalParameters ) { AsyncGeneratorBody } [...] 3. Let F be ! AsyncGeneratorFunctionCreate(Normal, FormalParameters, AsyncGeneratorBody, scope, strict). [...] 13.3.3.7 Runtime Semantics: KeyedBindingInitialization SingleNameBinding : BindingIdentifier Initializeropt [...] 6. If Initializer is present and v is undefined, then [...] d. If IsAnonymousFunctionDefinition(Initializer) is true, then i. Let hasNameProperty be HasOwnProperty(v, "name"). ii. ReturnIfAbrupt(hasNameProperty). iii. If hasNameProperty is false, perform SetFunctionName(v, bindingId). ---*/ var callCount = 0; async function* f({ cls = class {}, xCls = class X {}, xCls2 = class { static
() {} } } = {}) { assert.sameValue(cls.name, 'cls'); assert.notSameValue(xCls.name, 'xCls'); assert.notSameValue(xCls2.name, 'xCls2'); callCount = callCount + 1; }; f().next().then(() => { assert.sameValue(callCount, 1, 'invoked exactly once'); }).then($DONE, $DONE);
name
identifier_name
dstr-dflt-obj-ptrn-id-init-fn-name-class.js
// This file was procedurally generated from the following sources: // - src/dstr-binding/obj-ptrn-id-init-fn-name-class.case // - src/dstr-binding/default/async-gen-func-decl-dflt.template /*--- description: SingleNameBinding assigns `name` to "anonymous" classes (async generator function declaration (default parameter)) esid: sec-asyncgenerator-definitions-instantiatefunctionobject features: [async-iteration] flags: [generated, async] info: | AsyncGeneratorDeclaration : async [no LineTerminator here] function * BindingIdentifier ( FormalParameters ) { AsyncGeneratorBody } [...] 3. Let F be ! AsyncGeneratorFunctionCreate(Normal, FormalParameters, AsyncGeneratorBody, scope, strict). [...] 13.3.3.7 Runtime Semantics: KeyedBindingInitialization SingleNameBinding : BindingIdentifier Initializeropt [...] 6. If Initializer is present and v is undefined, then [...] d. If IsAnonymousFunctionDefinition(Initializer) is true, then i. Let hasNameProperty be HasOwnProperty(v, "name"). ii. ReturnIfAbrupt(hasNameProperty). iii. If hasNameProperty is false, perform SetFunctionName(v, bindingId). ---*/ var callCount = 0; async function* f({ cls = class {}, xCls = class X {}, xCls2 = class { static name()
} } = {}) { assert.sameValue(cls.name, 'cls'); assert.notSameValue(xCls.name, 'xCls'); assert.notSameValue(xCls2.name, 'xCls2'); callCount = callCount + 1; }; f().next().then(() => { assert.sameValue(callCount, 1, 'invoked exactly once'); }).then($DONE, $DONE);
{}
identifier_body
general-benefits.tsx
import { isBusinessPlan, isCompletePlan, isJetpackPlanSlug, isPersonalPlan, isPremiumPlan, isSecurityDailyPlan, isSecurityRealTimePlan, } from '@automattic/calypso-products'; import { useTranslate } from 'i18n-calypso'; import * as React from 'react'; /* * Show a list of Jetpack benefits that do not depend on site data * These can vary by plan, but we do not need to get any data about the site to show these * This is similar to the disconnection flow where some plan benefits are listed if a user is disconnecting Jetpack */ interface Props { productSlug: string; } const JetpackGeneralBenefits: React.FC< Props > = ( props ) => { const translate = useTranslate(); const { productSlug } = props; const hasSecurityDailyPlan = isSecurityDailyPlan( productSlug ); const hasSecurityRealTimePlan = isSecurityRealTimePlan( productSlug ); const hasCompletePlan = isCompletePlan( productSlug ); const hasPersonalPlan = isPersonalPlan( productSlug ); const hasPremiumPlan = isPremiumPlan( productSlug ); const hasBusinessPlan = isBusinessPlan( productSlug ); const hasJetpackPlanSlug = isJetpackPlanSlug( productSlug ); const benefits = []; // Priority Support if ( hasSecurityDailyPlan || hasSecurityRealTimePlan || hasCompletePlan || hasPersonalPlan || hasPremiumPlan || hasBusinessPlan ) { benefits.push( <React.Fragment> { translate( "{{strong}}Priority support{{/strong}} from Jetpack's WordPress and security experts.", { components: { strong: <strong />, }, } ) } </React.Fragment> ); } // Payment Collection // Ad Program // Google Analytics
hasBusinessPlan ) { benefits.push( <React.Fragment> { translate( 'The ability to {{strong}}collect payments{{/strong}}.', { components: { strong: <strong />, }, } ) } </React.Fragment> ); benefits.push( <React.Fragment> { translate( 'The {{strong}}Ad program{{/strong}} for WordPress.', { components: { strong: <strong />, }, } ) } </React.Fragment> ); benefits.push( <React.Fragment> { translate( 'The {{strong}}Google Analytics{{/strong}} integration.', { components: { strong: <strong />, }, } ) } </React.Fragment> ); } // 13GB of video hosting if ( hasPremiumPlan || hasSecurityDailyPlan ) { benefits.push( <React.Fragment> { translate( 'Up to 13GB of {{strong}}high-speed video hosting{{/strong}}.', { components: { strong: <strong />, }, } ) } </React.Fragment> ); } // Unlimited Video Hosting if ( hasBusinessPlan || hasSecurityRealTimePlan || hasCompletePlan ) { benefits.push( <React.Fragment> { translate( 'Unlimited {{strong}}high-speed video hosting{{/strong}}.', { components: { strong: <strong />, }, } ) } </React.Fragment> ); } // General benefits of all Jetpack Plans (brute force protection, CDN) if ( hasJetpackPlanSlug ) { benefits.push( <React.Fragment> { translate( 'Brute force {{strong}}attack protection{{/strong}} and {{strong}}downtime monitoring{{/strong}}.', { components: { strong: <strong />, }, } ) } </React.Fragment> ); } if ( benefits.length > 0 ) { return ( <ul className="jetpack-benefits__general-benefit-list"> { benefits.map( ( benefit, idx ) => { return <li key={ idx }>{ benefit }</li>; } ) } </ul> ); } return null; }; export default JetpackGeneralBenefits;
if ( hasSecurityDailyPlan || hasSecurityRealTimePlan || hasCompletePlan || hasPremiumPlan ||
random_line_split
iRowModel.d.ts
import { RowNode } from "../entities/rowNode"; export interface RowBounds { rowTop: number; rowHeight: number; rowIndex?: number; } export interface IRowModel { /** Returns the rowNode at the given index. */ getRow(index: number): RowNode | null; /** Returns the rowNode for given id. */ getRowNode(id: string): RowNode | null; /** This is legacy, not used by ag-Grid, but keeping for backward compatibility */ getRowCount(): number; getTopLevelRowCount(): number; getTopLevelRowDisplayedIndex(topLevelIndex: number): number; /** Returns the row index at the given pixel */ getRowIndexAtPixel(pixel: number): number; /** Returns total height of all the rows - used to size the height of the grid div that contains the rows */
/** Returns row top and bottom for a given row */ getRowBounds(index: number): RowBounds | null; /** Returns true if this model has no rows, regardless of model filter. EG if rows present, but filtered * out, this still returns false. If it returns true, then the grid shows the 'no rows' overlay - but we * don't show that overlay if the rows are just filtered out. */ isEmpty(): boolean; /** Returns true if no rows (either no rows at all, or the rows are filtered out). This is what the grid * uses to know if there are rows to render or not. */ isRowsToRender(): boolean; /** Returns all rows in range that should be selected. If there is a gap in range (non ClientSideRowModel) then * then no rows should be returned */ getNodesInRangeForSelection(first: RowNode, last: RowNode): RowNode[]; /** Iterate through each node. What this does depends on the model type. For clientSide, goes through * all nodes. For pagination, goes through current page. For virtualPage, goes through what's loaded in memory. */ forEachNode(callback: (rowNode: RowNode, index: number) => void): void; /** The base class returns the type. We use this instead of 'instanceof' as the client might provide * their own implementation of the models in the future. */ getType(): string; /** * It tells us if this row model knows about the last row that it can produce. This is used by the * PaginationPanel, if last row is not found, then the 'last' button is disabled and the last page is * not shown. This is always true for ClientSideRowModel. It toggles for InfiniteRowModel. */ isLastRowFound(): boolean; /** Used by CSRM only - is makes sure there are now estimated row heights within the range. */ ensureRowHeightsValid(startPixel: number, endPixel: number, startLimitIndex: number, endLimitIndex: number): boolean; /** Gets called after grid is initialised. What happens depends on row model. Client Side will take rowData * from gridOptions, the other row models will start calling their datasources. */ start(): void; }
getCurrentPageHeight(): number; /** Returns true if the provided rowNode is in the list of rows to render */ isRowPresent(rowNode: RowNode): boolean;
random_line_split
feedbackStatusbarItem.ts
/*--------------------------------------------------------------------------------------------- * Copyright (c) Microsoft Corporation. All rights reserved. * Licensed under the MIT License. See License.txt in the project root for license information. *--------------------------------------------------------------------------------------------*/ 'use strict'; import { IDisposable } from 'vs/base/common/lifecycle'; import { IStatusbarItem } from 'vs/workbench/browser/parts/statusbar/statusbar'; import { FeedbackDropdown, IFeedback, IFeedbackService } from './feedback'; import { IContextViewService } from 'vs/platform/contextview/browser/contextView'; import { IInstantiationService } from 'vs/platform/instantiation/common/instantiation'; import product from 'vs/platform/node/product'; import { Themable, STATUS_BAR_FOREGROUND, STATUS_BAR_NO_FOLDER_FOREGROUND } from 'vs/workbench/common/theme'; import { IThemeService } from 'vs/platform/theme/common/themeService'; import { IWorkspaceContextService, WorkbenchState } from 'vs/platform/workspace/common/workspace'; class TwitterFeedbackService implements IFeedbackService { private static TWITTER_URL: string = 'https://twitter.com/intent/tweet'; private static VIA_NAME: string = 'code'; private static HASHTAGS: string[] = ['HappyCoding']; private combineHashTagsAsString(): string { return TwitterFeedbackService.HASHTAGS.join(','); } public submitFeedback(feedback: IFeedback): void { const queryString = `?${feedback.sentiment === 1 ? `hashtags=${this.combineHashTagsAsString()}&` : null}ref_src=twsrc%5Etfw&related=twitterapi%2Ctwitter&text=${feedback.feedback}&tw_p=tweetbutton&via=${TwitterFeedbackService.VIA_NAME}`; const url = TwitterFeedbackService.TWITTER_URL + queryString; window.open(url); } public getCharacterLimit(sentiment: number): number { let length: number = 0; if (sentiment === 1) { TwitterFeedbackService.HASHTAGS.forEach(element => { length += element.length + 2; }); } if (TwitterFeedbackService.VIA_NAME) { length += ` via @${TwitterFeedbackService.VIA_NAME}`.length; } return 140 - length; } } export class FeedbackStatusbarItem extends Themable implements IStatusbarItem { private dropdown: FeedbackDropdown; constructor( @IInstantiationService private instantiationService: IInstantiationService, @IContextViewService private contextViewService: IContextViewService, @IWorkspaceContextService private contextService: IWorkspaceContextService, @IThemeService themeService: IThemeService ) { super(themeService); this.registerListeners(); } private registerListeners(): void { this.toUnbind.push(this.contextService.onDidChangeWorkbenchState(() => this.updateStyles())); } protected updateStyles(): void { super.updateStyles(); if (this.dropdown)
} public render(element: HTMLElement): IDisposable { if (product.sendASmile) { this.dropdown = this.instantiationService.createInstance(FeedbackDropdown, element, { contextViewProvider: this.contextViewService, feedbackService: this.instantiationService.createInstance(TwitterFeedbackService) }); this.updateStyles(); return this.dropdown; } return null; } }
{ this.dropdown.label.style('background-color', this.getColor(this.contextService.getWorkbenchState() !== WorkbenchState.EMPTY ? STATUS_BAR_FOREGROUND : STATUS_BAR_NO_FOLDER_FOREGROUND)); }
conditional_block
feedbackStatusbarItem.ts
/*--------------------------------------------------------------------------------------------- * Copyright (c) Microsoft Corporation. All rights reserved. * Licensed under the MIT License. See License.txt in the project root for license information. *--------------------------------------------------------------------------------------------*/ 'use strict'; import { IDisposable } from 'vs/base/common/lifecycle'; import { IStatusbarItem } from 'vs/workbench/browser/parts/statusbar/statusbar'; import { FeedbackDropdown, IFeedback, IFeedbackService } from './feedback'; import { IContextViewService } from 'vs/platform/contextview/browser/contextView'; import { IInstantiationService } from 'vs/platform/instantiation/common/instantiation'; import product from 'vs/platform/node/product'; import { Themable, STATUS_BAR_FOREGROUND, STATUS_BAR_NO_FOLDER_FOREGROUND } from 'vs/workbench/common/theme'; import { IThemeService } from 'vs/platform/theme/common/themeService'; import { IWorkspaceContextService, WorkbenchState } from 'vs/platform/workspace/common/workspace'; class TwitterFeedbackService implements IFeedbackService { private static TWITTER_URL: string = 'https://twitter.com/intent/tweet'; private static VIA_NAME: string = 'code'; private static HASHTAGS: string[] = ['HappyCoding']; private combineHashTagsAsString(): string { return TwitterFeedbackService.HASHTAGS.join(','); } public submitFeedback(feedback: IFeedback): void
public getCharacterLimit(sentiment: number): number { let length: number = 0; if (sentiment === 1) { TwitterFeedbackService.HASHTAGS.forEach(element => { length += element.length + 2; }); } if (TwitterFeedbackService.VIA_NAME) { length += ` via @${TwitterFeedbackService.VIA_NAME}`.length; } return 140 - length; } } export class FeedbackStatusbarItem extends Themable implements IStatusbarItem { private dropdown: FeedbackDropdown; constructor( @IInstantiationService private instantiationService: IInstantiationService, @IContextViewService private contextViewService: IContextViewService, @IWorkspaceContextService private contextService: IWorkspaceContextService, @IThemeService themeService: IThemeService ) { super(themeService); this.registerListeners(); } private registerListeners(): void { this.toUnbind.push(this.contextService.onDidChangeWorkbenchState(() => this.updateStyles())); } protected updateStyles(): void { super.updateStyles(); if (this.dropdown) { this.dropdown.label.style('background-color', this.getColor(this.contextService.getWorkbenchState() !== WorkbenchState.EMPTY ? STATUS_BAR_FOREGROUND : STATUS_BAR_NO_FOLDER_FOREGROUND)); } } public render(element: HTMLElement): IDisposable { if (product.sendASmile) { this.dropdown = this.instantiationService.createInstance(FeedbackDropdown, element, { contextViewProvider: this.contextViewService, feedbackService: this.instantiationService.createInstance(TwitterFeedbackService) }); this.updateStyles(); return this.dropdown; } return null; } }
{ const queryString = `?${feedback.sentiment === 1 ? `hashtags=${this.combineHashTagsAsString()}&` : null}ref_src=twsrc%5Etfw&related=twitterapi%2Ctwitter&text=${feedback.feedback}&tw_p=tweetbutton&via=${TwitterFeedbackService.VIA_NAME}`; const url = TwitterFeedbackService.TWITTER_URL + queryString; window.open(url); }
identifier_body
feedbackStatusbarItem.ts
/*--------------------------------------------------------------------------------------------- * Copyright (c) Microsoft Corporation. All rights reserved. * Licensed under the MIT License. See License.txt in the project root for license information. *--------------------------------------------------------------------------------------------*/ 'use strict'; import { IDisposable } from 'vs/base/common/lifecycle'; import { IStatusbarItem } from 'vs/workbench/browser/parts/statusbar/statusbar'; import { FeedbackDropdown, IFeedback, IFeedbackService } from './feedback'; import { IContextViewService } from 'vs/platform/contextview/browser/contextView'; import { IInstantiationService } from 'vs/platform/instantiation/common/instantiation'; import product from 'vs/platform/node/product'; import { Themable, STATUS_BAR_FOREGROUND, STATUS_BAR_NO_FOLDER_FOREGROUND } from 'vs/workbench/common/theme'; import { IThemeService } from 'vs/platform/theme/common/themeService'; import { IWorkspaceContextService, WorkbenchState } from 'vs/platform/workspace/common/workspace'; class TwitterFeedbackService implements IFeedbackService { private static TWITTER_URL: string = 'https://twitter.com/intent/tweet'; private static VIA_NAME: string = 'code'; private static HASHTAGS: string[] = ['HappyCoding']; private combineHashTagsAsString(): string { return TwitterFeedbackService.HASHTAGS.join(','); } public submitFeedback(feedback: IFeedback): void { const queryString = `?${feedback.sentiment === 1 ? `hashtags=${this.combineHashTagsAsString()}&` : null}ref_src=twsrc%5Etfw&related=twitterapi%2Ctwitter&text=${feedback.feedback}&tw_p=tweetbutton&via=${TwitterFeedbackService.VIA_NAME}`; const url = TwitterFeedbackService.TWITTER_URL + queryString; window.open(url); } public getCharacterLimit(sentiment: number): number { let length: number = 0; if (sentiment === 1) { TwitterFeedbackService.HASHTAGS.forEach(element => { length += element.length + 2; }); } if (TwitterFeedbackService.VIA_NAME) { length += ` via @${TwitterFeedbackService.VIA_NAME}`.length; } return 140 - length; } } export class FeedbackStatusbarItem extends Themable implements IStatusbarItem { private dropdown: FeedbackDropdown;
( @IInstantiationService private instantiationService: IInstantiationService, @IContextViewService private contextViewService: IContextViewService, @IWorkspaceContextService private contextService: IWorkspaceContextService, @IThemeService themeService: IThemeService ) { super(themeService); this.registerListeners(); } private registerListeners(): void { this.toUnbind.push(this.contextService.onDidChangeWorkbenchState(() => this.updateStyles())); } protected updateStyles(): void { super.updateStyles(); if (this.dropdown) { this.dropdown.label.style('background-color', this.getColor(this.contextService.getWorkbenchState() !== WorkbenchState.EMPTY ? STATUS_BAR_FOREGROUND : STATUS_BAR_NO_FOLDER_FOREGROUND)); } } public render(element: HTMLElement): IDisposable { if (product.sendASmile) { this.dropdown = this.instantiationService.createInstance(FeedbackDropdown, element, { contextViewProvider: this.contextViewService, feedbackService: this.instantiationService.createInstance(TwitterFeedbackService) }); this.updateStyles(); return this.dropdown; } return null; } }
constructor
identifier_name