text stringlengths 160 608k | id stringlengths 47 47 | dump stringclasses 2 values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1 value | language_score float64 0.65 1 | token_count int64 48 145k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
All the crops have specific requirements, and they require suitable climatic conditions to grow and yield a good harvest. Based on the different climatic conditions, the crops are classified into the Kharif and Rabi crops.
Rabi and Kharif are the two distinct cropping patterns prevalent in many countries. They are dependent upon the Monsoon, thus localized in the Indian sub-continent. Rabi cropping season starts with sowing when the Monsoon ends.
Farmers harvest the Rabi crops before the advent of the summer season. On the contrary, Kharif crops are grown in summer, i.e., sown when the Monsoon ends and harvested when the end of the rainy season.
Here, we explore more about the Rabi crops and how they are grown and harvested.
What are Rabi Crops?
Rabi crops or Rabi harvest are crops that are sown in winter. Farmers harvest the Rabi crops in the spring in South Asia. Rabi has been derived from the Arabic word for “spring.” It is also called the “winter crop .” These crops are harvested during the springtime. Usually, sowing starts between October-November or when the monsoon rains stop entirely.
Cold and dry environment is best for Rabi crops. Rainfall plays a vital role in yielding both Rabi and Kharif crops. Rain is considered suitable for Kharif crops, while on the other hand, it may spoil the yield of these crops. Few people know the two agriculture patterns and their differences.
However, knowing the difference between the Rabi and Kharif crops may help explain why some crops are available during specific times of the year. It becomes essential as the prices of fruits, vegetables, and food grains highly depend on the yield of these two cropping patterns.
When is the Rabi Cropping Season?
The cropping season for Rabi starts with the onset of the Monsoon in the Indian subcontinent. Rabi cropping season starts with sowing with end of monsoon. Rabi crop is harvested before the advent of the summer season. The harvesting season for these crops begins in April – May and ends before the beginning of the summer. Rabi crops are grown either with rainwater percolated into the ground or irrigation. Rains in winter spoil the these crops.
Rabi crops are alternatively known as winter crops. They are grown in October or November and then harvested in spring. They require frequent irrigation because they are grown in dry areas. Wheat, peas, pulses, mustard, gram, barley, and rapeseed are some of the significant Rabi crops. The crops are grown with rainwater that has percolated into the ground or by using irrigation methods. In winter, a good amount of rain spoils the Rabi crops but is suitable for Kharif season crops.
Barley, gram, mustard, oats, cabbage, capsicum, and tomato are a few Rabi crops.
Important Rabi Crops
Some of the critical Rabi Crops include
- Cereals – Barley, Gram, Rapeseed, Mustard, Oat, Bajra
- Fruits – Banana, Okra or Lady Fingers, Tomato, Grapefruit. Mangoes and Lemons
- Vegetables – Cabbage, Capsicum, Onion, Potato, Tomato, and Spinach
Wheat is one of most common and important Rabi crop. It requires cool temperatures of about 14°C to 18°C during its growing season. Rainfall of about 50 to 90 cm is most ideal. During harvesting season in the spring, wheat requires slightly warmer weather and bright sunshine.
Wheat grown in India is largely a medium-hard or soft, medium protein, white bread wheat, somewhat similar to U.S. hard white wheat. On the other hand, Wheat grown in central and western parts of India is hard, with high protein and high gluten content. Wheat is grown in a variety of soil. Soils with a clay loam soil or loam texture, good structure, and moderate water holding capacity are considered ideal for wheat cultivation.
You must take care to avoid excessively drained and very porous soil. The soil must be neutral and should not react. Heavy soil with poor drainage and poor structure are not appropriate as wheat is very sensitive to waterlogging. You can grow wheat successfully on lighter soils if their water and nutrient holding capacity are improved.
Mustard is a Rabi crop and is cultivated in a subtropical climate. Cultivation of mustard seed is done in dry and cool weather. The mustard seed tree requires temperatures in the range of 10°C to 25°C. The mustard crop requires 625 -1000 mm annual rainfall. Mustard farm does not tolerate a freeze. Thus it requires a clear sky with frost-free conditions.
he spacing of mustard plants should be about 45 cm x 20 cm. Farmers can do mustard farming in various soils ranging from light to heavy loamy soils. However, medium to deep soils with good drainage are best suitable for cultivating the mustard crop. Soil’s ideal pH range for mustard variety is 6.0 to 7.5. Sandy and loamy sand soils are most suitable for mustard farming.
Differences Between Rabi and Kharif Crops
Some of the main differences between Kharif and Rabi crops are;
- Kharif crops are monsoon or autumn crops. On the other hand, Rabi crops are spring or winter crops.
- Farmers plant the these crops around the end of the monsoon or the beginning of the winter season. This is roughly around the months of September and October.
- Rainfall affects Kharif crops, as they require lots of water to grow. On the contrary, Rabi crops do not have any effects on Monsoon.
- June and July are the favorable sowing season for the Kharif crops. March and April are sowing seasons for Rabi crops.
- Farmers harvest Kharif crops in September and October and Rabi in March and April.
- Kharif crops depend on rainfall patterns, whereas rainfall does not affect Rabi.
- Rabi crops require a warm climate for seed germination and a cold environment for their development. Kharif crops require hot weather and a large amount of water for growth.
- Wet warm weather and shorter day lengths are favorable for flowering in the case of Kharif crops, whereas, in the case of Rabi, dry and cold weather and more extended day length are beneficial for flowering.
- Major Kharif crops are Cotton, maize, Rice, Jowar, and bajra, whereas major Rabi Crops are Wheat, gram, peas, and barley.
- In Kharif, crops flowering requires a shorter day length. While these crops flowering requires more extended day length.
Why are Rabi Crops Long-day plants?
The fundamentals behind the Kharif and Rabi crops is elementary. It is not just rain; Rabi and Kharif crops even depend on the sunlight/darkness during the season. The term called Photoperiodism means plants respond to darkness and light differently. The amount of darkness determines when the plants bloom and how many blooms are produced.
Rabi crops require less darkness(more extended days). Rabi crops are called long-day plants. The flowers bloom in March- April when the days are longer. Sunrise is early, and Sunset is late, making the night smaller. So less darkness allows Rabi crops flowers to bloom.
Soil Requirements for Rabi Crops
Rabi crops grow best on well-drained fertile, clay loam to medium black soils. However, farmers can also raise a good harvest in sandy loam and black soils. Heavy soils with poor drainage are unsuitable because Wheat is sensitive to water logging.
The durum types express significant yellow berry problems when grown in light soils, resulting in poor quality grains. The ground should be neutral in reaction to Climatic requirements. The wheat crop has wide adaptability. You can grow wheat in the tropical ,subtropical zone and temperate zone.
The most suitable for the these crops is the dry and cool weather. The optimum temperature required for ideal germination of the Rabi crop like Wheat ranges from 20 to 25ºC. Rains received immediately after sowing hampers germination and encourages seedling blight, while high humidity and low temperature are ideal for rust attack.
The high temperatures at the season’s starting and ending determine the duration available for wheat cultivation, ranging from 100 days down south to more than 145 days on northwestern plains and 180 days in the hills. The scorching temperature during the grain ripening period results in grain shriveling.
Cultural Practices for Rabi Crops
(i) Land Preparation: The Rabi crops require a well-pulverized and compact seed bed for good uniform germination. Farmers should prepare the field under conditions by carrying one deep plowing with soil turning plow. They should then follow it up with two harrowing. Additionally, planking is desirable.
Recently sowing practices like zero-tillage and minimum tillage using a specially designed zero-till seeding-cum-fertilizer drill. Dry wheat requires a friable seedbed for better germination and good crop growth. Farmers dry the accumulated rainwater from the fields completely. In the next step, farmers prepare the land by giving two to three harrowing. This operation helps in removing weeds and conserving more moisture in the soil.
(ii) Time of sowing and varieties: Time of sowing is an essential aspect of obtaining a good wheat yield. Usually, farmers sow wheat when the average daily temperatures fall to around 22-23°C. This happens only in November in most wheat growing areas.
Rabi and Kharif crops indicate the right time to sow, raise and harvest a particular crop. Apart from these two, one more type is the Zaid crop. Farmers cultivate Zaid crop in the summer season from March to June. It includes watermelon, muskmelon, bitter gourd, cucumber, etc.
Read related topics on contour ploughing, and more. | <urn:uuid:f509f014-3f87-41dc-9eb4-7fe117e97544> | CC-MAIN-2022-33 | https://www.aaaksc.com/rabi-crops/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.931531 | 2,134 | 3.6875 | 4 |
A real socialist alternative requires a “profound democracy from below rather than decisions by a state that stands over and above society”, where all workers are able to develop their human capacities.
Michael Lebowitz. The Socialist Alternative: Real Human Development. Monthly Review Press, 2010.
The onset of the global economic crisis in mid 2008, symbolised by the collapse of some of Wall Street’s most iconic companies, led to soaring sales of Karl Marx’s seminal work Das Kapital, as many sought explanations to the tumultuous events unfolding.
Although written more than 100 years ago, this devastating and insightful dissection of how capital functions is still a powerful tool for people looking to understand and change the world.
Marx’s aim was to provide a handbook for working-class activists that unravelled the logic of capital and its inherently exploitative nature. Marx said this was necessary because as long as workers did not understand that capital was the result of their exploitation, they would not be able to defeat their enemy.
Michael Lebowitz’s latest book, The Socialist Alternative: Real Human Development says it is essential also to investigate the important insights Marx made regarding the alternative. This easily accessible book is written to provide young and working-class socialist militants a weapon in their struggle for a better world.
It is hard to agree more with Bill Fletcher Jr., when he says this book “should be the focus of discussion groups of activists as they attempt to unite their radical practice with theorising a radical, democratic and Marxist alternative for the future.”
Lebowitz rejects the old saying that “if we don’t know where we want to go, any path will take us there.” Rather, if you don’t know where you are going, no path will lead you there. Lebowitz says: “The purpose of this book is to point to an alternative path” focused on the “full development of human potential.”
Pulling together the different threads in Marx’s various sketches on socialism, and drawing on his own personal experiences and studies on “real existing socialism,” social democracy, and most importantly, Venezuela’s struggle for a new socialism for the 21st century, The Socialist Alternative aims to “develop a general vision of socialism and concrete directions for struggle.”
Lebowitz’s idea of socialism breaks from the dominant vision that prioritises “the development of productive forces” that, supposedly, will one day provide abundance and “allow everyone to consume and consume in accordance with their needs.”
Instead, he places humans at the centre of its focus.
The book does not set out to be about the Bolivarian process in Venezuela — Lebowitz has lived in Venezuela since 2004 — but many of the ideas in it will be familiar to those acquainted with the ideas being debated today within a mass movement where the idea of socialism has gripped the mind of the masses and converted itself into a material force for change.
The idea that self-emancipation and struggle are the keys to changing the world and people is essential to Lebowitz’s argument. Citing Friedrich Engels, Lebowitz maintains that the aim of communists is “to organise society in such a way that every member of it can develop and use all his capacities and powers in complete freedom and without thereby infringing the basic condition of this society.”
The only way to do so is through “revolutionary practice” because human development is not a gift given from on high. Marx explained that revolutionary struggle produces a simultaneous “changing of circumstances and of human activity or self-change.”
Put another way, “without the protagonism that transforms people, you cannot produce the people who belong in the good society … and understand that the development of the human capacities on the one side [cannot be] based on the restriction of development on the other.”
Capitalism offers no alternative in this regard. Rather, it is a system based on a “vicious cycle.” People have real needs but do not possess the means to satisfy them. They are therefore forced to work for those that do (capitalists) and compete against others in repetitive labour, so as to be able to buy at least some of the products they need.
“Add to this the fact that workers’ needs to consume grow as a result of the combination of the alienation (the impoverishment, the “complete emptying-out) characteristic of capitalist production and the constant generation of new needs by capital in its attempt to sell commodities, and it is easy to see why workers are compelled to continually present themselves in the labour market.”
This vicious cycle never stops under capitalism. Capital requires workers to see the cycle as a “normal” part of life. “The advance of capitalist production develops a working class which by education, tradition and habit looks upon the requirement of that mode of production as self-evident natural laws,” wrote Marx in Capital.
Today however, capital is haunted by the spectre of “socialism for the 21st century.” Drawing on Venezuelan President Hugo Chavez and what he calls “the elementary triangle of socialism” — social ownership of the means of production, social production organised by workers, and production for communal needs — Lebowitz outlines what is at the heart of this radical alternative for the 21st century.
Private ownership of the means of production must be replaced with social ownership of the products of social heritage and social labour as the “only way to ensure that these are used in the interests of society and not for private gain”.
But social and state ownership are not the same. A real socialist alternative requires a “profound democracy from below rather than decisions by a state that stands over and above society”, where all workers are able to develop their human capacities.
Critical to this is the second side of the triangle: social production.
In opposition to the command-and-obey workplace, a socialist alternative must be based on the replacement of the division of labour between those that think (intellectual labour) and those that do (manual labour). This artificial division can best be overcome with collective democratic decision-making in the workplace.
To complete the triangle of social ownership and worker management, Lebowitz says productive activity must be geared towards the needs of others. That is, the creation of a society based on solidarity, where there is an exchange “not of exchange values but ‘of activities, determined by communal needs and communal purposes’”.
The second half of the book deals with how we get there: “Knowing where you want to go is only the first part; it’s not at all the same as knowing how to get there.” Here again, Lebowitz puts stress on revolutionary practice. He says the impulse for the development of socialism must be the drive of workers for their own human development. Workers need not only “seize possession of production” to introduce worker management and communal production. They also need to “seize possession of the state” and conquer political power.
As the Communist Manifesto says: “The first step in the revolution by the working class is to raise the proletariat to the position of ruling class.” From this position of power, “the proletariat will use its political supremacy to wrest, by degrees, all capital from the bourgeoisie, to centralise all instruments of production in the hands of the state”.
The experience of the Paris Commune convinced Marx and Engels workers could not use the ready existing state for its own purposes; rather it had to be smashed and replaced by a new state of “self-working and self-governing communes.” So the struggle for a socialist transformation must unfold on two fronts: within the state that owns the means of production, and in the workplaces.
But the struggle also unfolds within the context of an emerging new society that is, said Marx, “economically, morally and intellectually, still stamped with the birthmarks of the old [capitalist] society from whose womb it emerges.” For the struggle to succeed, it is vital to fight consciously against the “defects” inherited from the old society and subordinate — rather than try to use — these defects to one’s ends.
Lebowitz is opposed to a vision of socialism that suggests it must pass through distinct stages, where priority is first given to developing the productive forces to create a world of abundance, and says this was not Marx’s view.
Chapter six, “Making a path to socialism,” offers a kind of transitional program for socialism in the 21st century. Lebowitz’s starting point is that the transition towards socialism must move forward simultaneously on all three fronts of the socialist triangle. He says every concrete measure must serve to change circumstances while helping to produce revolutionary subjects and raise their capacities.
“Only in a revolution”, wrote Marx and Engels, can the working class “succeed in ridding itself of all the muck of ages and become fitted to found society anew”.
Threats to this revolutionary process are always present from counter-revolutionary capitalist elements, the tendency of bureaucrats to “seize production” for themselves and the tendency to rely on the market to resolve problems. To combat this, a “socialist mode of regulation” is essential to allow socialism to subordinate all elements of society to itself, and create the organs it still lacks.
This encompasses an ideological struggle against capitalism and for socialism (“The Battle of Ideas”); the creation of worker and community councils where people can organise to change their circumstances and themselves at the same time; and “a state that supports this struggle ideologically, economically, and militarily and thus serves as the midwife for the birth of the new society”.
At this point, Lebowitz asks a central question: “What do we mean by the state?
“We have to talk about two states here — one, the state that workers captured at the outset and that initiates despotic inroads upon capital, that is, the old state; and, second, the emerging new state based upon workers councils and neighborhood councils as its cells.
“The two must coexist and interact throughout this process of becoming.
“The inherent tension between these two states — between the top-down orientation from within the old state and the bottom-up emphasis of the workers and community councils — is obvious.”
“Yet”, Lebowitz argues adamantly, “that tension is not the principle contradiction”.
Given the presence of revolutionaries in the old state, it would be an error to act as if it was the same as the capitalist state. Similarly, it would be a mistake to ignore the vices of the old society present in the embryonic forms of the new state. The struggle against bureaucrats seeking to defend their privileges or ideological inertia will unfold within both states.
At the same time, Lebowitz says, “interaction between the two states is essential.” The old state has the advantage of being able to see the picture as a whole and concentrate forces, but it also has a tendency to act from above and prioritise expediency over revolutionary practice. The new organs can identify “the needs and capacities of people and can mobilise people to link those needs and capacities directly.”
But there is also a tendency towards localism and the new emerging state “is not capable at the outset of making essential decisions that require concentration and coordination of forces.”
Critical to all this is a political instrument — or political party — that can provide leadership. This is needed because a society marked by the vices of the old cannot produce a process where all workers become socialists at the same time.
But a new kind of leadership that :
“fosters revolutionary practice only by continuously learning from below. There is, in short, a process of interaction, a dialectic between the political instrument and popular movements.
“By itself, the former becomes a process of command from above; by itself, the latter cannot develop a concept of the whole — that is, it cannot transcend localism.”
The Socialist Alternative is an inspiring and insightful contribution to the discussion of rebuilding the socialist project in light of past failures and the current challenges facing anti-capitalist activists everywhere.
No doubt here in Australia, in the context of the resources boom and the growing environmental crisis, the ideas raised in the book regarding social ownership and the need to struggle for transparency – “open the books” – will provide much food for thought for ecosocialists in the battles that lie ahead of us. | <urn:uuid:42b2f3f8-61db-421e-a93c-9d3c6196509a> | CC-MAIN-2022-33 | https://climateandcapitalism.com/2010/12/05/putting-humans-back-into-socialism/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.955161 | 2,677 | 2.15625 | 2 |
Are you considering a career in web design services? Chances are you have a little experience in either online marketing, graphic design, or art in general. If you are just starting out in web design and development, however, you may not realize that the role of web designer is actually more diverse and complex than it seems on the surface. Here are some of the important skills and strategies you will need to break into the professional web design world.
A Broad Skillset
The best website designers are multi-talented. They know everything from art theory to basic coding. If you want to be the complete package, these are some of the skills you will need to master:
- Marketing online ? As a website designer, you will play a critical role in your client?s online marketing strategy. In order to create a site that is optimized for customer satisfaction and maximum traffic, you will need to be able to incorporate branding strategies into your art.
- Coding ? You may know how to use Photoshop to create an awesome logo, but do you know how to get that logo onto the web page? Clients and employers want a designer who is well-versed in HTML and CSS so that they can handle every aspect of the website?s development.
- Business skills ? In order to become a competitor in the industry, you will need to know how to turn your web design services into a business. These skills include communication, organization, time-management, self-discipline, and collaboration.
Strategies For Success
It?s not just about your skills and talent. You need to come up with a plan. Here are several strategies to help you start out:
- Diversify your portfolio ? Show off your entire skillset. Demonstrate that you are capable of different kinds of designs and styles and can work with a variety of tools and programs. This will increase your chances of finding work, especially if you are a freelancer.
- Talk to other designers ? Reach out to any and all contacts you have in the web design industry. Talk to as many designers as you can and ask for general advice as well as feedback on your work. Networking is key in the art world.
- Keep learning ? Consider everything a learning experience. Continually educate yourself by reading design books and following web design blogs. Because your art is technology-based, it is changing fast. Make sure you keep up with trends, tools, and techniques. | <urn:uuid:04ab0996-4323-491b-a88d-a569709c7d28> | CC-MAIN-2022-33 | https://whartdesign.com/skills-and-strategies-you-need-to-start-a-career-in-web-design/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.947422 | 500 | 2.25 | 2 |
Successful Grants (Toolkit for Grant Success)
Items in this Collection
SSHRC IDG awarded 2020: The proposed research project focuses on constructions of disability in the Old NorseIcelandic Sagas of Bishops (byskupa sögur). Research for this project will take place over a twoyear period. The first year(202021) will be dedicated to data collection, consultation,...
SSHRC Awarded IDG 2016: The heart of this project is careful textual analysis of "The Directory of Conscience" and "The Pilgrimage of Perfection" written by William Bonde, who joined the Birgittine community of monks and nuns at Syon Abbey early in the sixteenth century. The Birgittines played a...
SSHRC Awarded IG 2018: This Aboriginal and community-based, participatory research project aims to co-create knowledge about the holistic (emotional, mental, physical, and spiritual) benefits to Indigenous youth of participating in northern games, and to identify factors that might be modified to...
"The Difference", a Novel: In 1908, a Canadian woman on a clipper ship in the south Pacific buys a small boy for four pounds of tobaccoDownload
SSHRC Awarded IG 2013: Over the next three years, I will research and write the first draft of a new novel. The Difference will examine the actions of a Canadian woman in 1908, wife of a clipper ship captain, who buys a small Tongan boy for four pounds of tobacco. The research required for The...
SSHRC IDG awarded 2021: The study of language attitudes and their development is an interdisciplinary field of research, at the intersection of psychology, sociolinguistics, and speech-language pathology. To examine attitudes towards French dialects, we formed an interdisciplinary team with...
SSHRC IDG awarded 2020: The compulsory tattooed number on Holocaust survivors’ from Auschwitz acts as an embodied public record of the attempted extermination of Eastern European Jews during the Second World War. As Holocaust survivors are aging and dying these material archives are disappearing,...
SSHRC PG awarded 2019: In response to the well-documented threats to Indigenous cultures and languages, this Partnership project will support the revitalization and sustained daily use of multiple Indigenous languages by developing modern technological tools and resources for these languages in...
SSHRC IDG awarded 2022: This project seeks to challenge the stereotype of the forever foreigner by highlighting the liveliness and diversity of the Chinese diaspora community in Western Canada. The project draws upon the Strathcona basketball program in Vancouver, BC as a case study, examining...
A Comparative Investigation of Pedagogical possibilities of Digital Tools for Family and School Early Literacy EducationDownload
SSHRC Awarded Insight Grant 2013: The proposed research aims to investigate shifts in digital literacy practices in school and home in sites in Canada and Australia and to examine factors that might impede and/or facilitate digital literacy development.
SSHRC Awarded IG 2017: The importance of the body in fashion and the radical adoption of street styles by the elite go back to eighteenth-century Europe. This study examines the effects of the French Revolution on European and American style. It asks how 1790s fashion drastically changed to... | <urn:uuid:5ac48148-5386-4f3f-a4a2-5364e6322794> | CC-MAIN-2022-33 | https://era.library.ualberta.ca/communities/8f446adf-bae4-49f5-84b7-6195718ca844/collections/18826f1d-a1f7-4466-9f0e-8ae88350b984 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.909326 | 752 | 2.171875 | 2 |
A true gamer knows one of the best parts of a competitive multiplayer video game, whether via device or PC, is the energy that comes from live communication with your teammates. There’s just something about being able to strategize, coordinate, and attack your common enemies together that you won’t find in any chat function.
More games than ever are beginning to include voice chat communication options, including classics like Overwatch, Fortnite, and even the newly popular PC version of Among Us. Voice chat can take your gaming to the next level, but Bluetooth headsets offer a number of other benefits for your gaming set-up beyond just allowing more communication. From noise cancellation to streamlined game reactions, a Bluetooth headset will take your gaming experience to the next level.
Bluetooth headsets provide a range of benefits to gamers, including a cord-free connection between device and headset, improved voice chat during games, superior game sound quality, and noise reduction. Whether you’re a serious gamer, constant traveler, or late night Xbox addict who just so happens to have roommates, a Bluetooth headset works to deliver the best possible gaming experience without requiring clunky equipment or a hefty investment.
What Exactly Does a Bluetooth Headset Do for Gamers?
Bluetooth headsets provide a lot of useful perks for players, including:
- Voice Chat Functionality (Away from the computer)
My favorite feature of using a Bluetooth headset for gaming is the ability to communicate to my friends away from my computer. Whenever downtime occurs I can roam around the appartment while still talking to my team players.
- Easy to connect to mobile phones
Bluetooth headphones are the new standard for mobile phones. More and more producers are removing the 3.5mm standard jack input, so Bluetooth is now an essential part.
Standard wired gaming headsets are using USB for connectivity, and it is a hassle to get it connected to your mobile phone.
With Bluetooth headset, connecting to mobile is a breeze and you can start enjoying your favorite games on your phone without delay.
- Noise Cancellation
Video games are enthralling experiences that often require total attention and concentration from players in order to succeed. When you’re sneaking through a graveyard or trying to navigate a booby-trapped field, the last thing you want is your family’s loud conversation downstairs interrupting your focus and disturbing your game.
Many Bluetooth headsets come with noise cancellation features, whether through tiny microphones embedded in your earphones that detect and counter loud external noise or through tight sealing headphones that block out extraneous distractions. By putting on a headset, you can cancel out distractions and focus on your game with ease.
- Convenient Use
Cordless, hands-free headphones are incredibly easy to use and multitask with. The lack of a connecting cord means you won’t get tangled up in your headphones or controller cords trying to play your game, and it also means you can sit further away from your device without being literally tied down by your headset.
Bluetooth headsets can also be useful if you need to step away from your game for a second but don’t want to fully disengage. You can run to the bathroom, make yourself a snack, or run outside for a moment without needing to unplug or disconnect.
They can also be valuable tools to use outside gaming, such as over a digital meeting, long phone call, or another type of video call or conference. In an increasingly digital world, having a convenient wireless headset available is a big advantage.
- Superior Sound Quality
With a good gaming headset, you can play on virtually any device and experience the same high quality of sound design. No matter if your computer speakers are tinny or if your television is broken, your headset provides clear, clean surround sound that plays without disturbance or distortion.
Your headset can also provide ideal microphone feedback for those using voice chats. A Bluetooth headset with a built-in microphone will have clear feedback and sound transmission that will make your quality and diction impeccable, making it even easier to communicate with fellow teammates.
What are the Drawbacks of a Bluetooth gaming headset?
Though gaming headsets are largely beneficial for all kinds of gamers, there are a few distinct disadvantages to using one, including:
- Pricy Initial Investment
Though many gaming headsets last a long time, their initial price can be pretty steep. Average quality headsets will typically cost between $50-100 USD per pair, with more fully equipped versions running into the $200s. Wired headsets, the major alternative to Bluetooth versions, are drastically cheaper.
Despite all the advantages a Bluetooth headset can provide, its initial price point is hefty. If you want to invest in a good quality gaming headset that will last you a while, you should look at Bluetooth options, but be prepared for the possibility of coughing up some substantial cash at first.
- Lagging and Latency (With Cheaper Models)
Certain brands of headsets are notorious for latency and lag issues that ruin the gaming experience. Because of the wireless connection, if your headset doesn’t come with a strong transmitter you’re bound to experience slower response times and network transmissions as a result.
Lagging and latency can best be reduced by avoiding cheaper or slower headset brands and investing in higher quality headsets with higher-power transmitters. Keeping your latency low will reduce wait and lag time, making your communication instantaneous and improving your gaming experience.
- Charging Needs
Another drawback to the wireless model is that they require charging or battery replacements in order to function properly. With a wired model, you can simply plug in your headset and go, whereas wireless headsets will need power from a source at some point, so you’ll have to be strategic about how you use your headset.
The higher-quality your headset model is, the less time your model will likely need to charge, so you can certainly find a headset to accommodate your charging timeline.
- Limited Compatibility
Bluetooth headsets are compatible with many devices, including almost all PCs, but there are certain devices they just don’t play nice with. Xbox Ones are notorious for having issues with connecting to certain headset models, so depending on the console or PC you’re using you may need to keep connectivity in mind.
In general, Bluetooth headsets are compatible with Playstations, Xbox 360s, and Nintendo Switches. If you have questions about the specific connectivity of your chosen model you should ask the manufacturers for clarity.
Which Headset Should I Choose?
If you’re ready to make the investment into a Bluetooth headset, there are many good options available for you. A lot will depend on user preference, including budget, size preference, and connectivity, and console compatibility, but I’ve linked my two favorite headset options below to help guide you on your gaming headset journey.
Best of the Best – Logitech G935
These top-notch headphones offer a high-quality gaming experience at a fair price for their wide range of functionality. They’re comfortable, long-lasting (up to twelve hours of continuous use before needing a charge), and provide superior audio quality for gaming, music or video watching, and communicating.
They also offer built-in noise cancellation modes, so you can choose whether you’d like to reduce your external environment or allow that sound in. You can program custom audio settings and the included mic is high quality and high performing.
Check out this video for a more intensive review and comparison to other top gaming headsets!
- Budget Buy – JLab Play
For an affordable but high-performing headset, look no further than the JLab Play gaming headset. This wireless gaming headset offers up to 22 hours of playtime before needing to plug in to your console. The retractable boom mic makes communicating a piece of cake with teammates, and the low latency means you’ll experience minimal lag.
This headset’s audio quality is pretty great for the price. The comfortably fitting earphones offer good, though not perfect sound reduction as well, meaning you’ll be able to play relatively undisturbed throughout your game.
Gaming headsets offer an elevated experience that provides greater detail and improved communication with players and console/PCs alike. Eliminate sound delay and environmental distractions through quality noise cancellation, and improve your team’s performance through live communication and strategy using voice chat. Free up your hands and movement space through a cordless headset, making gaming even more flexible and enjoyable.
Whether you’re ready for the ultimate investment or starting slow, adding a wireless Bluetooth gaming headset into your video game set up will transform your gaming experience one day at a time. No matter what brand or model of headset you choose, you’re sure to begin experiencing the benefits of a wireless headset on your game right away. | <urn:uuid:799d66df-ceda-48f6-a4d8-517c410c6bfd> | CC-MAIN-2022-33 | https://earrockers.com/bluetooth-headsets-good-for-gaming/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.920463 | 1,810 | 1.695313 | 2 |
OTTAWA — There is enough evidence to say the Oxford-AstraZeneca vaccine may cause very rare blood clots but the shot is still extremely safe, very effective and will remain on the Canadian market, Health Canada said Wednesday.
The department’s regulatory team is updating the vaccine’s label with information about the possibility of clots but only a patient who developed the new vaccine-induced blood clotting syndrome is advised not to get another dose of it.
“Health Canada still considers the benefits of the AstraZeneca vaccine to outweigh the risks of getting COVID-19,” said Dr. Supriya Sharma, the chief medical adviser at Health Canada who manages the regulation of the COVID-19 vaccines.
“We are not limiting the use of the vaccine to any specific age group or sex.”
The National Advisory Committee on Immunization, which recommended March 29 that AstraZeneca not be used on patients under 55, will now meet to decide if that advice should be updated.
NACI issued a statement Wednesday afternoon saying it will update the guidance “soon” but for now the age recommendation stands.
All provinces agreed to follow that advice, which was based on the fact early reports showed women under 55 were getting clots more often, and the risk of COVID-19 is higher as you age.
The U.K. regulator recently said, like Health Canada, that the vaccine remained safe for everyone, but the British version of NACI recommended it not be given to people under 30, who have the lowest risk for severe illness from COVID.
Denmark on Wednesday became the first country to decide to stop using AstraZeneca entirely as a result of the clots.
The clotting syndrome has been labelled VIPIT, short for vaccine-induced immune thrombotic thrombocytopenia. It occurs when the body’s immune system begins to attack blood platelets, leading to clots, and is treatable.
Canada has had one VIPIT case reported — a Quebec woman older than 55.
The number of doses given was 480,000 as of April 3. The figure is likely much higher now, as Canada has received more than 2.3 million doses of the vaccine produced in the United States, India and South Korea. But Sharma said Health Canada’s analysis looked only at the 480,000 shots.
International reports show anywhere from one clot reported for every 40,000 doses given in Denmark, to one in 100,000 in Germany, and one in 250,000 in the U.K. Sharma said the general belief is that the incident rate will end up between one in 100,000 and one in 250,000.
“These are extremely, extremely rare,” she said.
“The risk of … regular clots with COVID is much, much, much higher.”
Blood clots are also much riskier when taking certain medications, including birth control. About one in 1,600 patients on the pill will develop a clot.
COVID-19-caused clots are not the same as those caused by VIPIT, but one in five patients hospitalized with COVID-19 will develop a clot, and for patients who end up in critical care, the risk is one in three.
There are also other risks from COVID-19, including death, and Sharma said the balance between risks of a vaccine weighed against the risks of COVID-19 heavily falls towards the virus being a much bigger risk.
She also noted that VIPIT is very similar to clots caused in a very small number of people given the blood-thinning drug Heparin.
“We still have Heparin on the market,” Sharma said. “We still use it for prevention. We use it in syringes, for example, to prevent clots, even though there might be alternatives to it.”
The issue of blood clots extended to the Johnson & Johnson vaccine this week, which uses the same technology as AstraZeneca but has a different formula.
The United States on Tuesday temporarily stopped using J&J because six patients developed clots, after 6.8 million doses were given. The pause was largely intended to provide time to get information to medical providers about what to look for and ensure treatments are known.
Sharma said Canada is continuing to look at the J&J evidence as well.
J&J is not moving to roll out the vaccine in Europe pending more information from the United States but a spokesman said Wednesday there are no plans to stop it in Canada at the moment.
Canada isn’t due to get its first deliveries of J&J for another two weeks. Europe was supposed to get its first deliveries this week.
Sharma said Health Canada is updating the warning label on the AstraZeneca vaccine to include the potential for clots, the symptoms to look for and the treatments to provide.
Sharma said Canadians should look to the case in Quebec, which was picked up and treated, to gain confidence that the monitoring system is working as it should.
“Our best advice to Canadians is always the same but possibly more urgent now than ever, with cases of COVID-19 increasing across Canada,” Sharma said. “Get whichever vaccine is available to you. It’s that simple. The longer you wait to get vaccinated, the longer you’re not protected.”
This report by The Canadian Press was first published April 14, 2021.
Mia Rabson, The Canadian Press | <urn:uuid:fcca9e32-4fb0-4b7c-86b8-614e7d37e917> | CC-MAIN-2022-33 | https://www.farwestherald.com/main/astrazeneca-very-safe-effective-with-extremely-rare-risk-of-clots-health-canada/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.969407 | 1,162 | 2.1875 | 2 |
Paycheck to paycheck, hand to mouth, month to month. All of these phrases evoke an uncertain living, but “month to month” elicits a special kind of anxiety for renters. Living month to month suggests you have no lease, no official document to protect you from the threat of eviction or a rent hike you can’t afford. Which gets at the heart of Jen Dalton and Bill Powhida’s latest project, MONTH2MONTH, a series of events that combine real estate, art and activism in eight New York City apartments.
“The name was chosen because the project events take place over the course of a month,” explained Dalton, “and also we were hoping to evoke the tenuous nature of most people’s economic situations.”
Beginning May 7 with a “housewarming party,” MONTH2MONTH will continue the ongoing dialogue of inequality and wealth disparity in New York City by inviting the public to discuss the city’s housing crisis—whether they’re affected by it or feel distanced from the issue—in luxury and affordable housing units that will be temporarily open to total strangers. The eight apartments hosting MONTH2MONTH range from a townhouse in Chelsea to an architect’s loft with an indoor pond to a tiny East Village apartment.
“It was not easy by any stretch of the imagination,” said Powhida, who has made his own affordable home one of the project sites. “It’s been a really delicate negotiation to get anyone to open up their home and share their space with the public.”
But with the help of project sponsor More Art, a nonprofit dedicated to funding public art projects with an eye toward social justice, Powhida and Dalton were able to secure the sites needed for MONTH2MONTH and hope to generate interest and involvement on two fronts: Through opening the available apartments to members of the public and through a month-long series of events and talks.
For the former, Powhida and Dalton recruited a small group of people through a housing lottery held last winter with the promise that those chosen would get a chance to spend four fully paid nights in any one of the apartments. Throughout their stay, these temporary residents will enjoy the high life, including free meals and a “curated lifestyle experience,” as well as participation in the many events centered around the project. All interested parties had to do was apply.
“It was patterned after the actual applications for affordable housing units in New York,” said Dalton.
About 60 people applied to be residents and eight were chosen in the lotteries,four4 residents for stays in “affordable” apartments andfour4 for stays in “luxury” apartments. Applicants who claimed to make more than $150,000 per year were directed to a second, optional page prompting them to upload private financial documents, an invasive process that the hundreds of thousands of people who apply for affordable housing each year are more than familiar with.
“It got really in the weeds,” said Dalton of the second application page. “In really small type at the bottom it says that you didn’t actually have to do this, but we hoped that it would spark a feeling.”
While the residents explore their new lives, non-residents are invited to take part in free events and talks that will be hosted in each of the residences throughout May.
The list of activities, held at 6pm every Saturday through Tuesday, is diverse and varied and includes such events as “A Dinner with Doormen,” “A Dinner with Housing Policy Experts and A Dinner with Developers & Real Estate Professionals,” where attendees are invited to wine and dine with the people closest to the city’s luxury housing stock. Or there’s “Gentrifiers Anonymous,” a live confessional where participants will discuss the ways in which they’ve contributed to the city’s gentrification epidemic, and “The Rent is Too Damn High So We Took Away Its Weed,” an experimental improv comedy show focused on questions of fictional housing (like Monica and Rachel’s apartment on Friends). Overall, there will 16 events to attend, all free with RSVP.
“I hope we’re able to bring together people who may not ever have a chance to meet in a social space where they can talk,” says Powhida. “And to keep it all in a social space that’s relaxed and honest and off-kilter and disarming, so it’s not just business as usual.”
And there’s no discounting the element of voyeurism involved in this project. After all, it is quintessentially New York to dwell on how the other half is living, whether it be in a luxury high-rise on Park Avenue or a covetable affordable housing unit.
“When you walk by the big windows and the townhouses in Chelsea or the brownstone blocks, we are all peering into them,” says Dalton. “We have this very prurient relationship and curiosity with how other people live.”
But more than giving curious onlookers a glimpse into homes they may never be able to afford, Dalton and Powhida want to explore how the art world, which is populated by struggling creatives dependent on well-to-do patrons, may have ultimately contributed to the current housing crisis. After all, it’s artists who are thought of as the harbingers of gentrification in formerly low-income neighborhoods like Bushwick and East Williamsburg.
“In general, artists are implicated in every gentrification story in this kind of awful colonial language,” Powhida continues. “And I hate to say it, but the goal is to continue to raise awareness about the issue and maybe to use art to push back against the way art is too often used: To sell real estate.”
MONTH2MONTH will kick off with a “housewarming party” on Sunday, May 7 at 6pm with more events scheduled throughout the month. For those unable to attend (the RSVPs for each event are limited to about 15-20 people), the events will be livestreamed on Youtube and on the project website. To learn more, visit month2month.nyc. | <urn:uuid:77b7104c-5f9d-4030-9040-ef0cfbcddbf6> | CC-MAIN-2022-33 | https://brooklynbased.com/2016/04/29/bringing-tales-gentrification-homes-new-yorkers/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.96094 | 1,345 | 1.5625 | 2 |
Tumor immunity is a science that uses immunologic theories and methods to study the antigenicity of tumors, the relationship between the immune function of the body and the occurrence/development of tumors, the immune response of the body to tumors and its anti-tumor immune mechanism, the immune diagnosis and immune prevention of tumors. It is closely related to the metabolic characteristics of tumors and the reconstruction of microenvironment. It is of great significance to the study of the pathogenesis, prevention, diagnosis and treatment of tumors.
Energy metabolism is one of the most basic characteristics of life. The reprogramming of metabolism is closely related to cancer, immunity, neurodegenerative diseases, obesity, diabetes and so on. Therefore, it has become a hot research field to explore the mysteries of life phenomena and find new therapies for major diseases from the perspective of cell energy metabolism.
The article takes you to interpret the highlights of the reports of the recent 2 meetings and reveal the hidden details!
June 15 – tumor immunity and metabolism(click the agenda to register for the meeting)
1. for major diseases such as tumors and autoimmune diseases, carry out systematic immunological research around dendritic cell vesicle transport related molecules and T cell specific antigen receptor library
2. aiming at the individual differences of tumors and the spatial heterogeneity of tumors, we developed the metabolome molecular typing – visualization of heterogeneous distribution space of metabolites – precise particle therapy strategy to minimize side effects and achieve better tumor inhibition effect
3. focused on tumor immunobiotherapy and related metabolic mechanisms, and made a series of original discoveries in the field of micro vesicle research.
4. Agilent’s heavy new products are rewarded online, and energy metabolism analysis technology is strongly applied
June 24 – tumor immunology in translational medicine(click the agenda to register for the meeting)
1. focus on the new progress in the research on the molecular mechanism of functional plasticity and stability of foxp3+ regulatory T cells, as well as the new progress of tissue-specific Treg, especially autoimmune diseases, obesity and aging related diabetes, and foxp3+treg function and immunotherapy in the tumor microenvironment
2. by studying the interaction between immune system and tumor, identify tumor specific immune cells, especially T cells that recognize tumor antigens, and the escape mechanism of tumor cells against immune attack, find new therapeutic targets, and establish efficient new methods of tumor immunotherapy
3. progress and challenges of TIL therapy for tumor infiltrating lymphocytes
4. Cytiva chromatography technology helps tumor immunology research
♥ More highlights in the online lecture hall:https://www.instrument.com.cn/webinar/ | <urn:uuid:67aa6a8f-d641-47fe-a1c0-97999dbd486e> | CC-MAIN-2022-33 | https://www.instrumentandapparatus.com/2022/pay-attention-to-tumor-immunity-and-metabolism-these-two-free-live-broadcasts-should-not-be-missed/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.898836 | 555 | 2.453125 | 2 |
This was taken from
[ Back to Home Page ]
Been told and Hearsay . . .
Lougheed -- Loughead
Probably meaning the head of a lake. Is a name quite prevalent in Scotland, so say the immigrants from that land.
Our ancestors come from *Sligo County Ireland by boat, landing in Montreal, Canada.
Although it is reported that the family consisted of 11 girls and three boys -- only four girls and one boy accompanied them to America. (Possibly some of the older children had already come to this Country, as there are many Lougheed families, towns, Lakes and Mountains by that name in Canada.)
On the boat trip, two of the Lougheed girls married lads by the name of O'Mealy. They eventually settled in N.W. Ohio and became farmers. Their line apparently ran out.
The Mother and Father of the immigrant Lougheed family died in Montreal within two years after arrival.
The married sisters apparently assisted the 7 to 9 year old Robert (My Grandfather) to survive (1822-1900)
One of the sister's married a French Canadian, by the name of Campion, [sic]. They and Robert came to Michigan, settled on farmland in the vicinity of Pittsfield, Mich. (Somewhere between Adrian and Hillsdale Mich. - date unknown).
Now, Electa Goodrich (1832-1916) enters. A 15 year old girl from Canandiago County, N.Y. She met and married Robert Lougheed, who was about 25 years old and a foreman of a gang of Scotch-Irish; grading a line for a R.R. from Detroit to Chicago.
Electa (My Grandmother) took on the job of cooking for this gang which moved their camp as they progressed.
In due time, this union of Robert and Electa had a daughter named Alice, then another named Estella and the third, a boy named Robert A.
On his 40th birthday, Robert (My grandfather) enlisted (1862) in the Ohio Volunteers and was in the Army until it was over.
In due time, a second group of children came upon the scene of which Linden (My Father) was the eldest. Two years later, Louis was born. Two years later came Lena, Two years later came Lola.*
When I was small, maybe 4 or 5 years of age, Grandmother Lougheed told about Grandfather being above the clouds. While in the Army, I wanted to believe her. But when I looked up at the clouds, her story seemed a little suspicious. Later (50 years) when I drove up to the top of Lookout Mt., I understood it better. [Insert Text]
Robert A. Married Zenobia Klime. They had nine children. Three died in infancy - 6 boys grew to manhood. John, Bert, Fay, Chalmer, Clifford and Randle.
Linden married Ida M. Decker. To this union were born Vern, Cecil, (Mary - died at 8 months), Olin (ME), Golda and Veda.
Louis married Mertie Cohen. They had five children, Belva, Burton, Leo, Lyle and Joseph.
Lena married Frank Malcolm and had two sons - Zandes ? and Harold.
Lola married Harry Gore. They were childless.
My Maternal Grandfather, Ellis James Decker (1845-1917) started life in Delaware County, Ohio. One of a family of 11 children. When his Mother died, his father married a widow with 8 children, who gave birth to 5 more.
Since it was customary to put children (out) to work for their board and clothes, all 24 brothers, sisters, half-brothers & sisters and step brothers and sisters were not all at home at the same time.
They boys were put out at 9 years and the girls at 11 years of age.
The people that Grandfather lived with and worked for moved to N.E. Indiana, where Grandfather grew up and met and married Jane Elizabeth Jenkins.
To this union was born a daughter, Ida May and 12 years later another daughter Pearl who married Lloyd Underwood. They had one son Paul.
Grandfather Decker had a sister Elizabeth Jane Decker who was born crippled (having two club feet). She was put out to work at 11 and did not get much schooling. She lived with Grandfather after he established a home - a 1/2 mile west of Cooney, O. on 40 a. which they acquired ownership.
The children [Grandfather Decker's kids???] grew up in a log-house, in about 1901. Grandfather built a frame house - consisting of 5 bedrooms, a parlor, living-dining and kitchen plus cellar.
About 1910, my grandparents sold the farm and moved to Edon, O. where they bought two houses and three lots.
Grandmother [wife of Ellis James Decker died shortly after at age 55.]
Later Grandfather sold his property and lived part time with another sister at Ashley, Ind. And with Pearl at Montpeiler.
At Ashley he met and married a 43 year old gal who had charge of a dress factory about two year later he died of a heart attack and was buried at Edon. O. beside Grandmother. Their graves are facing highway 49.
You should have known my brother Cecil (who died in 1955) to appreciate the following story. The forepart of this event must have started about 2945 - The location about 45 mi. So. Of Toledo Ohio where Cecil lived and because of the high yield of grain on the farms, the pheasants and quail reproduced abundantly. Cecil's brother-in-law farmed a large farm with corn rows almost 1/2 mi. long and he knew they were full of birds.
On the opening day of the season, he took his 410 single shot gun and went to his brother-in-law's farm. When he arrived he was surprised to see a car load of hunters already there complete with dogs, fancy automatic shot guns and dressed in expensive hunting clothes. There was introductions all around. Then someone said the word, "lets get going."
Cecil went to his car and pulled out his single shot 410 . Someone snickered and said, "What do you expect to do with that popgun?"
Cecil said, "I hope to kill a pheasant." Everyone laughed.
The hunters released the dogs, they started in the cornfield. Pheasants begin to fly, but away from the hunters toward the lower end of the field. Everyone rushed to follow the dogs and birds in the tall corn.
Except Cecil. He saw what was going on and placed this gun back in his car, drover around the road to the opposite end of the field and as the birds came flying over - he shot them.
Cecil told me this shortly after the bird season ended that year.
In the meantime, I moved to Florida and entered the real estate business.
One day a gentle man walked in. After the usual introductions, I asked, "Where are you from?" He answered, Ohio. What part? Answer Youngstown. I said I'm from Ohio too, but from the extreme N.W. part.
He said, "that's where the good pheasant hunting used to be."
He then proceeded to tell about driving from Youngstown to south of Toledo on opening day to a farm where they had been invited to hunt. Upon arrival at the farm, there was a native who was some relation to the owner of the farm, who waited until the hunting party started to rout the birds out of the standing corn. This fellow drove his car to the opposite end of the field just as the pheasants flew over. He shot them with his little pop gun. "It was very frustrating", he said.
Ethel and I decided to make a trip to the West Coast in the Fall of '46 . We had been told by a friend that if we went, we should take our bed with us, as they had driven over 400 mi. trying to find a motel or room that was not already occupied. So I said, I'll buy a trailer. There was no Trailer Sales Lots as the Army had rationed all from the manufacturers. I checked two ads of trailers for sale. One was sold and the other would not stand hauling from the thicket where it had been for a long time.
So I'll build one, I said. I found a small welding shop in the country, which had enough steel for the frame, and he said he knew how to get a single axle. I told him to go ahead. After two weeks he had completed an acceptable frame, axle and wheels. I furnished the tires and purchased some lumber for the floor and walls.
At that time, I discovered that all flat material for outside and inside was not only rationed, but that the trailer manufacturers were paying extra (or under the counter) for each piece as fast as the lumber companies got it; and were sending their trucks on regular trips to pick it up. (200 mi. trips.)
Through my son-in-law, John, I found that I could get some window and door cutouts from the National Homes of Lafayette, Ind. I picked them up at Fort Wayne, Ind. They were quite irregular.
I made a T square of 8' long - and squared them so that we could cover the inside of the wood frame.
I went to a Trailer-stove Mfg. Co. and ordered a stoves for cooking and heat. After placing the orders, I asked when I could pick it up. After some consultation, they gave me a date of 7 mo. later; and so on with sinks, refrigerator, etc.
Ethel had wired the trailer for 6 Volt and 110 Volt as I was working full time in my shop.
After hunting for 90 da. for exterior plywood and masonite, I heard of a lumber company that had a new owner. I was able to get enough 1/8" masonite to cover the outside.
After fastening the masonite with no-rust nails, we painted it with a sealer and in the evening while painting it with gray paint - I tipped over a gallon of paint on top of Ethel's head. She did not have a hat or scarf. We had quite a time cleaning the paint from her hair.
Our axle and steel frame was ready in late Sept. and our paint operation took place late in Dec. We had acquired a small electric space heater, a gas-plate and a tank of gas, plus a small stainless steel sink, a folding bed and a rod to hang clothes.
So on Jan. 4, 1947, after visiting our children & grandchildren, we left Ft. Wayne on 2" of ice covering the highways in Northern Indiana and Illinois. Instead of going west as we might have, we decided to go South and East through Decatur and Portland to Route 40 then west to Indianapolis to Terre Haute then South on dry roads to Little Rock. After that I canvassed for plywood in many, many towns and fount it in Carlsbad, N.M. There I built an ice-box and sink combination, plus table, clothes hampers and closet. While in a nice trailer park, later in El Paso, I built a screen door and put in light fixtures, and in San Diego, I found aluminum molding to cover the outside seams and corners.
John's Mother, Pauline, and sister Charlene lived in San Diego where went for two weeks.
When Pauline found that we were going North up the West Coast, she insisted that we visit John's Aunt Ruth who had married a Dr. Samuels in Tacoma, Washington. We promised.
Count fifteen pages ahead for the rest of the story. [sic]
Continued from #4 of trailer trip . . .
Our trip from San Diego North was quite uneventful. In the state of Washington, we passed through Olympia and Tacoma and finally found a Trailer Park on the East of Puget Sound.
After resting a day, we started to go to Seattle for some shopping. Some acquaintances next door suggested that the shopping in Tacoma was much better, so we went back to Tacoma which is built on a side hill, each street or flock approximately 25' or 30' higher than the other - so that you are either going up or down of on the level sideways.
We found a parking lot up on the top and walked down to a large Dept. Store. Made some purchases, had a bite to eat. Then started to climb the incline to the parking lot. Being playful I got behind Ethel and started to push her up the hill.
When we reached the parking lot and was waiting for our car, I noticed a lady who was carrying a large open - work shopping bag which reminded me of Pauline.
The attendant came up - driving a Volkswagen - gave change - and said, "Thank you Mrs. Samuels. The lady got into the car and pulled up to the exit and stopped for the traffic.
I ran up and hammered onto the winder, which she finally opened and said, "What do you want?" I said, "Is this Mrs. Samuels?" Answer: Yes. Question: Mrs. Dr. Samuels? Answer: Yes. I said, "I'm Olin Lougheed. John Grandy's father-in-law.
Mrs. Samuels or Aunt Ruthie thought for an instant and said, "You've go to come to our house for dinner." My answer was, "Oh no, some other time." But she insisted that we must follow her home and meet Dr. Samuels after he had closed his office and came to dinner.
We had a delicious dinner - and - a delightful evening even though we were dressed in our second best.
Aunt Ruth had seen me playfully pushing Ethel up the hill and she said to herself - there is a couple enjoying one another.
You might call this meeting a coincidence or an accident, but Aunt Ruth said it was meant to be. It was planned by a higher authority. Anyway, we thought it was very unusual.------
The Empty Pocket Book
Fill it with ideas and observations, with data, sketches, poetry. Fill it with anything but money!
Written by M.T. Head Lougheed
December 25, 1976
A lovely Christmas day, Mary & I attacked a 12 lb. Tukey. We are only a little off each leg. Just enough to cripple it. The stuffing and gravey filled out our forms until we were content.
New Years Day
Mary & I ate hog, fowl and black-eyed peas for lunch.
Good luck is guaranteed throughout the year. So they say.
There was once a man my grandfather knew
Who had some things he was going to do
But whenever the time came
For him to begin
He couldn't because of the state he was in!
Olene said, "She's a republican and she likes my Dad"
Cook called her "Magnolia Blossum."
Scott said "I can't call you Grannie, I'd prefer toots."
Jeanne said "She's a fantastic gal."
Scott wrote that "She is a grand lady and a nice person."
Veda said "She's good for Olin."
And I knew it all the time. O.L.
Elected officials are not exempt from doing dumb things.
He who whispers down a well, about the goods he has to sell.
Will never reap the bright green dollars,
like he who climbs a tree and hollers.
A Bit of Philosophy
A lil ol' man
Came riding by
Sez I, "Ol' man, your horse will die"
Sez he; "if he dies, I'll tan his skin,"
If he lives, I'll ride him again and again."
When I was walking
Up the Stair
I met a man
Who wasn't there
He wasn't there
Gee, I wish
He' go away.
It matters not what tools you use
But that you use them well
For some must write and some must paint
While others buy and sell
Some must preach and some must pray
And some must plot and plan
But this rule holds for ??ours?? and all
Just do the best you can.
There is no better advice from parents to children
Eat it up
Wear it out
Make it do
Or do without
Children are the interest on the bonds of Matrimony
An inventor could win world renown if he could devise a grocery cart with four wheels that would go in the same direction.
We tend to be down on everything we are not up on.
A famous British School Master was once asked:
"Where in your curriculum do you teach religion?"
We Teach It All Day Long
We teach it
In Arithmetic by accuracy,
In Language by saying what we mean,
In History by humanity,
In Geography by breadth of mind,
In Handicraft by thoroughness,
Astronomy by reverence,
In Playground by fair play,
We teach it by kindness to animals,
By courtesy to servants,
By good manners to one another,
And truthfulness in all things.
He who sings
Away his ills.
Being broke is no disgrace. But then it's not very much fun either.
A man shows what he is
By doing what he does
With what he has.
The first day of Spring
Is one thing
And the first Spring day | <urn:uuid:9074e3b7-d444-4c1c-b0b0-7223fe610a2a> | CC-MAIN-2022-33 | http://lougheed.net/Lougheed/Olin_Decker_Lougheed/Olin_Decker_Lougheed_Notes.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.983021 | 3,775 | 2.28125 | 2 |
Sources: General Services Administration; CP staff
The agency overseeing much federal building development and construction has formally issued “Request for Information Regarding Concrete: Environmental Product Declarations and Low Embodied Carbon Products,” inviting EPD data and responses to a nine-point questionnaire at adedicated portal. Over a two-week survey concluding March 1, the General Services Administration aims to gather information on concrete producers’ ability to provide mix-specific, cradle-to-gate Type III EPDs and insights on concrete exhibiting low embodied carbon characteristics. Candidate mixes for agency review are those whose embodied carbon threshold have a reduced global warming potential, expressed on EPD as kilograms of carbon dioxide equivalent per cubic meter, when measured against industry averages.
Along with the Request for Information, GSA has engaged trade associations, architectural firms specializing in sustainable construction, U.S. Department of Transportation, U.S. Environmental Protection Agency, plus state and local governments on the topic. Low embodied carbon concrete mixes for buildings and pavement may be readily available and cost-competitive, with regional variation, the agency finds. GSA seeks to learn more regarding any barriers to the production of sustainable concrete and any opportunities to more consistently use such products in the future. The agency’s survey of low carbon concrete mixes aligns with White House Executive Order 14057, Catalyzing Clean Energy Industries and Jobs Through Federal Sustainability. It compels appropriate agencies to “promote use of construction materials with lower embodied emissions.” | <urn:uuid:bfb19191-272e-4818-a50f-0880f03a22d1> | CC-MAIN-2022-33 | https://www.teambjj.com/index.php/2022/02/15/general-services-administration-invites-input-on-low-carbon-concrete/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.922287 | 306 | 1.859375 | 2 |
Unemployment is known to be associated with poor mental health, but it is not clear how strongly unemployment leads to onset of diagnosed clinical depression (causation), or if depression raises the risks of becoming unemployed (health selection), or indeed if both pathways operate. We therefore investigate the direction of associations between clinical depression and unemployment in a cross-cultural prospective cohort study. 10,059 consecutive general practice attendees (18-75 years) were recruited from six European countries and Chile between 2003 and 2004 and followed up at six, 12 and (in a subset) 24 months. The analysis sample was restricted to 3969 men and women who were employed or unemployed and seeking employment and had data on depression measures. The outcomes were depressive episodes, assessed using the Depression Section of the Composite International Diagnostic Interview (CIDI) and self-reported employment status. Among 3969 men and women with complete data on depression and unemployment, 10% (n = 393) had depression symptoms and a further 6% (n = 221) had major depression at 12 months. 11% (n = 423) of the sample were unemployed by 6 months. Participants who became unemployed between baseline and 6 months compared to those employed at both times had an adjusted relative risk ratio for 12-month depression of 1.58 (95% Confidence Interval 0.76, 3.27). Participants with depression at baseline and 6 months compared to neither time had an odds ratio for 6-month unemployment of 1.58 (95% Confidence Interval 0.97, 2.58). We found evidence that causation and (to a lesser extent) health selection raise the prevalence of depression in the unemployed. Unemployed adults are at particular risk for onset of major clinical depression and should be offered extra services or screened. Given the trend for adults with depression to perhaps be at greater risk of subsequent unemployment, employees with depressive symptoms should also be supported at work as a precautionary principle.
Copyright © 2011 Elsevier Ltd. All rights reserved. | <urn:uuid:9632544c-0b49-47d5-b42b-118ff3a0b79f> | CC-MAIN-2022-33 | https://pubmed.ncbi.nlm.nih.gov/22019370/?dopt=Abstract | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.961545 | 404 | 1.507813 | 2 |
MAKE A MARK IN YOUR LIFETIME!
For if you remain completely silent at this time, relief and deliverance will arise for the Jews from another place, but you and your father’s house will perish. Yet who knows whether you have come to the kingdom for such a time as this? (Esther 4:14).
In a football competition, there are different categories of people. We have the spectators, officials and the footballers. But among the footballers, there are some that are very unique; these ones make marks by creating history. God has given us the power to make a mark in our lifetime that will create history in the future. The Bible tells us that you shall receive power when the Holy Spirit has come upon you (Acts 1:8). Of course, every Christian should endeavor to take note of the fact that God wants him to make a mark in his lifetime and generation forever.
History is full of stories of great men and women who made a mark in their lifetime. Queen Esther happened to be one of them. In fact, if not for the prompt action of Queen Esther, the entire Jews would have been totally annihilated by the enemy of the Jews, Hamah. But thank God for the prompt intervention of Queen Esther that saved the entire race of the Jews. Therefore, it is the duty of a Christian to always arise in making a mark in his lifetime through the grace and power of the Holy Spirit. God expects you to make a mark in your lifetime and generation forever.
Moses is another great man of God who made a mark in his lifetime and generation. History of life cannot forget the man called Moses. A child that was destined to die but later became a prince in a foreign land. A murderer who went into asylum in the wilderness to become a shepherd. A shepherd who met God at the burning bush and became a deliverer to the children of Israel. He successfully delivered the children of Israel from Egypt. In fact, God created a Christian in His own image and likeness, and destined him for a life of greatness forever.
Daily Tip: You are not a spectator for life; you have been destined to make a mark in your lifetime and generation forever. Shalom!
Golden Text: I will make you a great nation; I will bless you and make your name great; and you shall be a blessing (Genesis 12:2).
PRAYER: TAKE A WORSHIP SONG AS LED
- Thank God for today and about the Word of God you heard.
- Humbly acknowledge your weakness and limitation before God.
- My Father! My Father! Give me the grace and wisdom to make a mark in my lifetime and generation forever in Jesus Christ Name! Amen.
- Holy Spirit! I come against the spirit of self-limitation and barrier in my life forever in Jesus Christ Name! Amen.
- Pray generally as led by the Holy Spirit concerning your life, situations and challenges.
For Further Study: Hebrews 11. RBT: NAHUM 1-3
God has led me to write and publish His Word of life freely to the blessing of mankind all over the world. If indeed you have been blessed by this message daily, kindly partner to support financially this young and teething ministry as led by the Holy Spirit: UBA, OKHOMHEN TIMOTHY OSEMUDIAMEN, 2031305611 OR ACCESS BANK, OKHOMHEN OSEMUDIAMEN TIMOTHY, 0054808436. You can as well send your assistance through Western Union Transfer by calling these numbers: +234-8051430395; +234-8035196707. Thanks and God bless you richly as you do so in Jesus Christ Name! Amen. My e-mail contact is: email@example.com. Facebook: www.facebook.com/therhemadevotionals. Shalom! | <urn:uuid:dfeaf52b-dfad-4c3a-8712-4249955d1d57> | CC-MAIN-2022-33 | https://therhemadevotionals.org/day-6-sunday-october-2019/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.941174 | 820 | 1.585938 | 2 |
As a car owner, you need to note the fact that you are bound to ensure that you have availed an insurance cover for your car as per the laws and over and above this is the fact that where you have the right cover, you will stay well protected against any financial loss should your car happen to get damaged for a reason under your cover.
On top of this, life insurance as well serves to protect the other road users such as pedestrians, passengers, other drivers and their property against losses and injuries that may be caused them by you as a car owner. One thing that is such a reality that as a motorist you need to note is the fact of the reality of the happening of a road accident and as such you need to have the comfort and it is so reassuring knowing that you have some sure financial backing should it happen to be that you suffer an accident.
The laws clearly stipulate in the various state’s traffic acts that all motorists must be insured. One other risk that will be covered by a number of the car insurance products is that of theft and as such where you have such a cover, you will be sure of having some good financial support in the event that your car gets stolen. One other risk that will be covered by a number of the car insurance policies are such as vandalism and destruction by fire as such you notice the fact that car insurance offers you such backing for you against losing your investment in your car.
But anyway, there are some instances where you will not have to insure your car anyway. These are such as the instances where you happen to have declared your car off the road.
If you happen to be driving your car without insurance, you need to know that there will be some risks that will be highly likely to you.
Business owners as well need to appreciate the need for workers compensation insurance as well. This is actually the kind of insurance that will provide for the medical and lost time benefits to the employees for the injuries and diseases that they may happen to be exposed to while going about their duties. State and federal laws have made it mandatory for all business to ensure that they have this insurance, workers compensation insurance as well known as workman’s comp insurance so as to be compliant.
Bear in mind as well the fact that your business is as well quite exposed to a host of risks and as such you need to have in place measures that will ensure that you are not going to run out of business in case such happen to pass. | <urn:uuid:af47fdb2-8803-412a-b546-c9ad8022e2b0> | CC-MAIN-2022-33 | http://van141.com/2019/01/14/the-5-laws-of-professionals-and-how-learn-more/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.988481 | 506 | 1.601563 | 2 |
Domestika – Introduction to Unreal Engine 4 for Scene Design by Guillermo Moreno Free Download
If you want to create fantastic narrative surroundings that can support a videogame’s story, you need imagination, as well as knowing how to use Unreal Engine 4, the most used platform in videogame development. In this 5 course Domestika Basics, take the first steps toward creating your own virtual worlds, with the help of Guillermo Moreno, videogame developer specialized in scene composing and illumination, who teaches you how to create a diorama, using Unreal Engine, from scratch.
Domestika Introduction to Unreal Engine 4 for Scene Design by Guillermo Moreno Content Details are found below by pressing the Preview Button. Epzilla.com is a Free Content Providing Website and we Help Beginner Graphics Designers and Free-Lancers who need some stuff Like Major Categories Tutorials, Magazines, Design Books, Manuals, Videohive, Motion Array, Templates, Software Tools From Envato Elements, Graphicriver, Udemy, Lynda, School Of Motion, Motion Design School, Domestika, Skillshare, By Providing more than 50 Categorized Necessary Materials Like 2D/3D Cad Software, Stock Footages, PSD Mockup, PSD Template, LightRoom Preset, Flyers, Vector, Web Banner, UI Examples, After Effects Template, After Effects Script, Premiere Pro Template etc. All Software Tools, High Quality Graphics Design Tutorials including Photography To 2D/3D Animation, Videography are available here.
Those who are Beginner Graphics Designers Want to practice By Reverse Engineering The pre-made stuff from Envato Elements can do this by taking Our available Stuff. Here We Categorized All the Courses in several Section a bit like 2D/3D Design, Architect, Motion Graphics Object, Gaming Graphics Elements, Product Design Under different Software Programs Like Cinema 4D, AcceliCAD, Adobe Animate , After Effects , ArchiCAD , CAD Modelling, 3ds Max, AutoCAD, AutoDesk, Blender, Catia, ColorWay, MARI, Maya, MODO, MotionBuilder, Mudbox, NUKE , Revit, Sketchbook, Sketchup, Softimage, Solid Works, V-Ray, ZBrush, Camtasia, Character Animator, Digital Painting, movie Pro, Unity, Rhino, Terragen more . Download Introduction to Unreal Engine 4 for Scene Design by Guillermo Moreno Free From Epzilla.com.
Note:We Don’t Own and Resell this Domestika Introduction to Unreal Engine 4 for Scene Design by Guillermo Moreno content. This sample file is merely for promotional purposes to draw in and motivate Graphics Designers and to understand them about the truth of graphics World. This content isn’t such a lot cost. If you actually a die-hard fan of this Creator Please Visit Their official Website.
Here you get the thought of the way to prepare respective to the present Material and you’ll even be alerted to new podcasts and live webinar events, Free Content and far More. you’ll get Originally a readable version or A digital Version of magazine Through Which you’ll Get Clarity representation Of All Details Content Of this Course. Believe us, This Domestika – Introduction to Unreal Engine 4 for Scene Design is that the Best Content For Content Creators. So We Bring It For You.
Join Our Telegram Channel For New Updates | <urn:uuid:1e82cadb-c3ac-4b22-b1c1-3f676240b79e> | CC-MAIN-2022-33 | https://epzilla.com/domestika-introduction-to-unreal-engine-4-for-scene-design/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.793395 | 724 | 2.25 | 2 |
Work has begun on a $791m South Runway Expansion project at Fort Lauderdale-Hollywood International Airport in Broward County, Florida, US, in order to reduce flight delays and meet rising traffic demands.
The new project will extend, shift and lengthen runway 9R/27L from 5,276ft to 8,000ft, which will provide two parallel runways to accommodate larger aircraft. The runway will open in September 2014 and will handle 450,000 takeoffs and landings a year.
US Department of Transportation secretary Ray LaHood commented that the project is one of the largest and most important airport construction projects in the country.
"Modernising our airport infrastructure will keep our economy moving forward, and put thousands of Americans back to work," said LaHood.
The parallel runways will increase the airport’s capacity and help the airport handle 107 flights an hour from 84 flights an hour.
Broward County Aviation Department spokesman Greg Meyer said that the design meets all FAA standards for safe and efficient airplane arrivals and departures.
"If the airport does not increase its runway capacity, its average annual delay is projected to surge from the current rate of six minutes to 26 minutes by 2020," Meyer said.
The US Government will provide $250m for the project, Florida will contribute $129m and the remainder will come from passenger ticket charges.
Fort Lauderdale-Hollywood International Airport handles 22 million passengers every year, with over 600 flights to 60 US cities and international destinations.
Image: Fort Lauderdale-Hollywood International Airport’s South Runway Expansion project will reduce flight delays and meet air traffic demands. Photo: Broward. | <urn:uuid:a12de8d2-96b7-466e-be28-14b8385b9b57> | CC-MAIN-2022-33 | https://www.airport-technology.com/news/newsft-lauderdale-hollywood-international-airport-begins-runway-expansion-project/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.913983 | 340 | 1.640625 | 2 |
Long before credit cards existed, people still borrowed money. It just worked differently.
In the United States, during the 1920s, individual firms, such as hotel chains and oil companies, began issuing credit cards to customers for purchases made at company outlets.
Nowadays, the average American has over $6,000 in credit card debt. Taking cash from credit cards is one benefit that every credit card user should understand.
Do you want to make sure you understand the effects of taking cash from credit cards?
Keep reading to learn 10 essentials about credit card cash advance.
1. It’s Different Than Withdrawing from Your Bank Account
Taking cash from credit cards is what people do when they need money. It’s not the same, however, as withdrawing cash using your debit card or simply making a purchase on your credit card.
When you withdraw funds from your debit card, all you’re doing is taking cash from the money that you’ve already earned, which is sitting in the bank in your personal bank account.
When you withdraw a cash loan from your credit card, you’re taking money from your future self, because you’re borrowing against what you’ll be earning in the future.
Credit card cash advances are essentially loans, and loans always come with a price.
2. A Cash Advance Is Much More Expensive
Regardless of how easy it is to take out a cash advance against your credit card’s credit limit, don’t do it unless it’s an emergency.
Cash advance interest rates are almost always significantly higher than your card’s interest rate for spending on your credit card. It won’t be as expensive as a payday loan no credit check, but you’ll definitely be paying more than a small personal loan.
If you do decide the emergency is worth it, pay that borrowed amount back as soon as you can.
The Interest Is Higher
As we mentioned earlier, it’s rare for cash advance interest not to be higher than purchase and balance transfer interest charges.
Say, for example, you spent $250 on concert tickets using your credit card, and then you took out a cash advance for $250 to pay for dinner later that evening. Even if you paid both types of payments on time, at the same time, you’d still pay more interest on the cash advance amount.
Plus, the longer you take to pay off a cash advance withdrawal, the more interest you’ll accrue in the process, and the more you’ll owe and have to pay back.
3. There May Be More Than One Extra Charge
A credit card cash advance is one of the most expensive forms of credit card transactions, especially because there is more than one charge.
There’s a Cash Advance Fee
First of all, there’s always a cash advance fee that’s charged each time you take out a cash advance. Sometimes this fee is a minimum flat rate, and sometimes it’s a percentage of the amount of which you’ve withdrawn.
For example, a particular credit card’s terms might state that the cash advance fee is either $5 or 4%, whichever number is greater. That means that the fee for a $200 withdrawal would be $8.
Typically, these fees range from 2 to 5% of the amount you withdrawal, but most charge around the higher end of that range.
There Are ATM Fees
On top of the cash advance fee we mentioned, you’ll also have to pay an ATM fee, usually somewhere between $2 and $5. The fee amount depends on which bank’s ATM you use.
Remember that you might even be charged 2 different ATM fees if the ATM’s bank AND your credit card issuer both charge an ATM withdrawal fee.
4. Pay Attention to Payment Allocation Rules
Did you know that by federal law, credit card issuers have to apply minimum payment amounts to account balances with the HIGHEST interest? However, any amount IN ADDITION to the minimum payment can be applied wherever the credit card issuers want.
Say you owe $8,000 on a particular credit card, of which $3,000 was racked up by taking out cash advances. Your minimum payment is around $250, but you make a $500 payment every month.
It might be the case that your credit card issuer only applies the minimum amount of $250 to the higher interest cash advance debt, but they apply the remaining $250 to the lower interest debt.
It’s an easy way for them to make more money. The longer you have debt with a higher interest rate, the longer it’ll take you to pay, and the more you’ll end up forking over in the long run.
5. There’s Rarely a Grace Period
Unfortunately, most credit card issuers don’t offer a grace period on credit card cash advances. What that means is that you aren’t allotted a full billing cycle to pay off the amount due in its entirety.
With normal credit card use, borrowers can use that grace period to pay back what they’ve spent, without accruing any interest or incurring a charge. But with a cash withdrawal on a credit card, the interest begins to accrue the moment the transaction clears.
The tip is that if it’s the only balance on your credit card, pay it off as soon as you can. Don’t wait until your bill arrives if you want to minimize earned interest on that money that you borrow.
6. You Might Need Financial Help
If you want to make good use of your credit cards, especially as it pertains to maintaining good credit, don’t ever use more than 30% of your available credit. Another good rule to live by is to make sure you don’t spend anything you can’t pay back at the end of the month.
If you’re in the position of needing a cash advance to pay a bill or get through the week, the chances are high that you need financial help.
One option to consider is consolidating your finances. Even if you have bad credit, you can still apply for a bad credit payday loan.
7. There Are Alternatives
There comes a moment in almost anyone’s life when they find themselves in a cash crisis. When you need that cash to keep your lights on or support a family, it doesn’t matter how high an interest rate is because, at the end of the day, you’d rather have the money than not.
But there are a few alternatives to consider if you do find yourself in that situation.
Borrow Money from Someone You Know
If you have a friend or family member you can ask for cash, do it. While it may be awkward, the savings will be worth it, and you might be able to work out a multi-payment payback situation.
Just make sure you make a plan with that person concerning how you’ll pay them back, and when. Both you and your lender will probably feel more comfortable knowing there’s a plan for repayment going forward.
Take out a Personal Loan
A personal loan isn’t always ideal, and if your credit isn’t great, it’ll probably be a little more expensive. That being said, it’ll still probably be LESS expensive than borrowing money from your credit card.
Overdrawing Your Checking Account
If it’s a small amount of cash that you need, think about overdrawing your checking account using your debit card. Even though you’ll face a fee, you won’t have to worry about paying interest, and many banks will waive a certain number of fees per year.
8. Make Sure You Create a PIN
When you get a debit card, you must set up a PIN before you begin using your card as debit or at an ATM. When you get a credit card, you won’t automatically receive a PIN, but you usually need one to get a cash advance.
If you do plan to use your card for cash, make sure you set up your PIN beforehand. And if you want to avoid cash advances altogether, don’t ever set up the PIN!
9. You Can Set a Limit for Yourself
Another way to avoid taking advantage of a cash advance is by setting a limit on your card. All you have to do is speak with your issuer and set your amount, to prevent yourself from taking any cash in the future.
10. It’s Not the Only Way to Get Cash Fast
Many people opt to withdraw cash from their credit cards, because they don’t think there’s any other way to get cash fast. But there are other ways. In addition to borrowing from a friend or overdrawing your account, you can also get a same day loan.
With a same day loan, you can apply for it and get cash on the same day. If the interest rate is lower for a same day loan, go for that rather than adding debt to your high-interest credit card.
Think Before You Take Cash from Credit Cards
Before you withdraw cash from credit cards, think about everything we’ve gone over in this guide. And at that moment, ask yourself if it’s worth it.
Can you manage for the remaining days until payday? Can you borrow from a friend or a family member?
If the answer is no, take what time you can afford to do some research. A personal loan might be the better, and less expensive option. | <urn:uuid:30c2138a-25ef-44e1-a2c5-105364dc267f> | CC-MAIN-2022-33 | https://bonsaifinance.com/credit-cards-tips/cash-from-credit-cards-10-things-you-should-know-about-a-credit-card-cash-advance-lc/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.956807 | 2,013 | 2.203125 | 2 |
One of the major functions of county government is to build and maintain a network of roads and bridges in the unincorporated areas of the county. In Tarrant County, the four County Commissioners have responsibility for the construction and maintenance of approximately 430 miles of county roads. The Transportation Services Department supports these efforts by providing engineering, planning, environmental and right-of-way acquisition services to each County Commissioner's Precinct and other County Departments. We also have a Striping Crew that maintains pavement markings on all County roads and parking areas. A Sign Shop designs and fabricates a variety of signs and decals. The Survey Crew handles surveying projects in the unincorporated county and for internal County projects, while the Central Garage manages and services a County fleet consisting of more than 500 cars, vans and light duty trucks.
Randy Skinner, Director
County Telephone Operator 817-884-1111
Tarrant County provides the information contained in this web site as a public service. Every effort is made to ensure that information provided is correct. However, in any case where legal reliance on information contained in these pages is required, the official records of Tarrant County should be consulted. Tarrant County is not responsible for the content of, nor endorses any site which has a link from the Tarrant County web site.
This site is best experienced with supported browsers: Internet Explorer 9 and above, Google Chrome, Mozilla Firefox, or Apple Safari. If you use an older or unsupported browser, you might notice that some features do not function properly. Click the browser name above to learn more about the recommended browsers. | <urn:uuid:f0d042d5-b2cc-4a47-945d-3c2b6e57bc9a> | CC-MAIN-2022-33 | https://www.tarrantcounty.com/content/main/en/transportation.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.91772 | 350 | 1.554688 | 2 |
SERC has established Pedagogic Service partnerships with digital libraries, campus based teaching and learning centers, and other education projects. SERC's current partners are listed below.
These partnerships are actively engaged in developing new pedagogic service portals. You can view "in-progress" sites, which reveal some of Pedagogic Service Project structures by clicking on the links below. These projects are in various states of development.
- Learning and Teaching Center (LTC) and Quantitative Inquiry, Reasoning, and Knowledge (Quirk) Initiative. Carleton is engaged in developing a set of modules and examples that support faculty development workshops on campus and foster discussion of teaching across the campus.
- The LTC coordinates programs for new and experienced faculty, circulates new information about teaching theories and strategies, and helps to identify problems and suggest solutions for classroom practice. Its Teaching Resources section showcases resources and expertise on campus.
- QuIRK is an innovative project intended to help Carleton and other institutions of higher education better prepare students to evaluate and use quantitative evidence in their future roles as citizens, consumers, professionals, business people, and government leaders. QUIRK has sponsored development of a module on Quantitative Writing. The National Numeracy Network has adopted this module and expanded its example collection.
- CAUSE (The Consortium for Undergraduate Statistics Education) has launched a pedagogic service portal to serve statistics educators. This portal includes two modules sponsored by CAUSE Testing Conjectures and Teaching with Data Simulations as well as growing set of examples.
- The Center for Teaching and Learning-Stanford University supports effective communication of knowledge and the love of learning by faculty in the classroom, by graduate students in their roles as apprentice scholar/teachers, and by undergraduates as they take their place in the community of scholars. They hosted an initiative to redesign introductory geoscience courses that produced course and activity pages now available through the library, the Cutting Edge collections and the Starting Point collections. This initiative used a novel design engaging faculty and graduate students together in redesigning the course.
- The Chemical Education Digital Library (ChemEd DL) is a collaborative, community-driven effort to provide chemistry faculty with exemplary digital resources, tools, and online services for teaching and learning chemistry. ChemEd DL has developed a pedagogic service portal where workshop participants have posted teaching activities making use of ChemEd DL resources for teaching chemistry.
- comPADRE Digital Resources for Physics and Astronomy Education is a growing network of educational resource collections supporting teachers and students in Physics and Astronomy. comPADRE has launched a pedagogic service portal. This collection includes activities developed through face-to-face and virtual workshop processes.
- Enduring Resources for Earth Sciences Education (ERESE) is a collaboration between middle and high school teachers and Earth scientists that promotes the development and use of teaching materials incorporating state-of-the-art geoscience research results. ERESE has developed a pedagogic portal to share teaching activities that use ERESE resources and to link them to pedagogic methods.
- MERLOT (Multimedia Educational Resources for Learning and Online Teaching) seeks to improve the effectiveness of teaching and learning by increasing the quantity and quality of peer reviewed online learning materials that can be easily incorporated into courses. MERLOT has developed three pedagogic service portals to serve MERLOT's Biology, Mathematics, and Physics communities and initiated work on portals for Modern Languages and Geoscience.
- Minnesota Science Teachers Education Project MnSTEP provides convenient, relevant, standards-based summer science institutes to teachers throughout Minnesota. MnSTEP uses the pedagogic service to share the activities they design as part of this program with one another and the broader community. They have completed more than 500 activities across the sciences.
- Microbial Life Educational Resources promotes visibility of on-line resources for use in the teaching of microbiology. Their pedagogic portal includes modules and activities on Socratic questioning, teaching with data and teaching with games.
- NAGT On the Cutting Edge helps geoscience faculty stay up-to-date with both geoscience research and teaching methods. The workshop series and website combine to provide professional development opportunities, resources, and opportunities for faculty to interact on-line and in person with colleagues around the world who are focused on improving their teaching. This iniative makes use of the pedagogic service to support workshop participants in using a vareity of teaching methods. Their teaching methods portal includes five new modules on ConcepTests, Lecture Tutorials, Structured Academic Controversy, Teaching with Google Earth and Teaching Urban Students. In addition, links to activities and modules are included throughout their site. The Cutting Edge sites on Introductory Geoscience and Assessment make particularly heavy use of the Pedagogic Service.
- National Numeracy Network envisions a society in which all citizens possess the power and habit of mind to search out quantitative information, critique it, reflect upon it, and apply it in their public, personal and professional lives. The Network promotes education that integrates quantitative skills across all disciplines and at all levels. The NNN website makes use of the Pedagogic Service to bring information on teaching methods, including Quantitative Writing and Spreadsheets Across the Curriculum to its user community. The NNN has used its annual meetings to generate new examples for the library.
- Project Kaleidoscope (PKAL) is an informal alliance of educators and institutions focused on understanding and sharing what works in undergraduate education. The SERC Pedagogic Library is drawing on resources from PKAL, while PKAL is using the Pedagogic Service to empower faculty to use Pedagogies of Engagement. The PKAL pedagogic portal provides access to modules created or reviewed by its Pedagogic Pioneers as well as example collections created by participating patners
- Starting Point Project led by SERC built and piloted the initial Pedagogic Resource Library with 27 modules and over 500 activities. The Starting Point website now includes modules and activities developed by Spreadsheets across the Curriculum and Cutting Edge as part of its collections.
- Spreadsheets Across The Curriculum project and the Washington Center for Improving the Quality of Undergraduate Education have utilized the pedagogic service to build a module describing this pedagogy based in creative use of PowerPoint and Excel resources. These resources promote quantitative literacy by facilitating mathematical problem solving beyond the mathematics classroom. In addition to the general collection, a special collections address teaching of Physical Volcanology. The Spreadsheets Across the Curriculum module is now in use by Starting Point and the National Numeracy Network.
- Visionlearning is an innovative educational resource designed for students, teachers, parents or anyone interested in learning. Visionlearning has developed a module on Teaching the Process of Science that includes a collection of example courses and activities contributed by participants in a 2009 workshop.
- Whitaker Center is a collaboration of faculty, staff, and students from FGCU's College of Arts & Sciences, College of Education, and the School of Engineering committed to improving the delivery and content of science and mathematics across all levels. In January 2009 the Whitaker Center hosted a faculty seminar to explore Publishing On Line that provided an opportunity to learn about the Pedagogic Service, review activities and experiment with submitting activities. The Whitaker Center has moved forward with a more extensive collaboration with the Pedagogic Service to develop a repository of their STEM faculties' teaching activities and of activities developed by local teachers during their Summer Science Institute.
- Starting Point:Teaching and Learning Economics, an NSF funded project to create pedaogic resources for Economics faculty is revising and authoring modules with economics activities. Their portal will launch in fall 2009. | <urn:uuid:70ba0276-ea26-4e9f-9be5-25cf4c78a962> | CC-MAIN-2022-33 | https://serc.carleton.edu/sp/service/partners.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.932371 | 1,588 | 2.359375 | 2 |
Bird books seem to my biggest new indulgence this year. No fewer than seven of them have followed me home (so far) in the last 12 months. [I’ve reviewed several here; search my blog for “birds” to retrieve them.] As a group, these books have been a delight. Birders and the little flitting critters they follow make for enjoyable reading.
My latest find, however, is a feast for the eyes. Paul Bannick, a fellow Washingtonian, has assembled a marvelous collection of photographs in The Owl and the Woodpecker [LibraryThing / WorldCat]. Both birds mentioned in the title are “indicator” species, suggesting the health of the local environment. The woodpecker, with its industrious cavity-drilling behavior, is a “keystone” species, as well. They inadvertently build homes for other animals with each hole they excavate.
Setting out to find and photograph all 19 owls and 22 woodpeckers native to North America, Bannick wandered into the field with a couple of high-powered digital cameras, a personal bird blind, and infinite patience. Within the book’s text, he discusses the habitat and behavior of each bird he sought. Close study enabled him to read the environment and ultimately find every species. After finding a bird, Bannick deployed his patience. With the eye of a photographer, he considered light, angles, and probable roosting and nesting sites. Then he planned (and waited) for the pictures that appear in the book.
What pictures they are! You might marvel at the colorful clarity of two Yellow-shafted Northern Flickers peering from a nest on page 139, take in the color of a Gila Woodpecker sipping from a saguaro on page 104, or admire the confident flight of a Short-eared Owl on page 97. Most of Bannick’s woodpecker photos reveal activity: working over a tree, feeding their young, or storing acorns. His owls show either show their impressive wings in flight or their captivating eyes, perpetually watching. Page after page, those attentive eyes seem to reinforce the most memorable line of text in the book for me: “I use stealth to approach … but every time I have found a Northern Spotted Owl, it was already looking at me.” Through Bannick’s camera, it looks directly at you, too.
Bannick’s writing is tedious at times, but each new page offers a fresh new image. In the back of the book, there’s a nine page guide to all the species, along with a “calls and drumming” CD to help identify the birds by sound.
Addendum: I met Bannick in Seattle the day after I finished reading the book. His images and descriptions were still so fresh in my mind that his slide presentation made me feel like I was thumbing through the book a second time. I didn’t mind at all. | <urn:uuid:932a862f-4f8f-423f-9936-fe1df56d35bf> | CC-MAIN-2022-33 | http://www.stevecampion.com/MostlyNF/?p=173 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.948507 | 634 | 2 | 2 |
510/ eGo adapter - An adapter that you can use to change the threading from 510 to the eGo thread.
510 Thread - The threading at the peak of the mod or battery which the tank fastens into
510 Drip Tip - A mouthpiece that works within any 510 sized tank
810 Drip Tip - A mouthpiece that works with any 810 sized tank
18350 Battery – A small battery that is used in 18350 mods. They usually come with 800mAh
18490/18500 Battery - A medium sized battery normally with up to 1300mAh for use with mods that require an 18500 battery
18650 Battery: The most commonly used vaping battery in the vaping market
20700 Battery: A slightly bigger sized battery than the 18650. Can hold up to twice the amount of mAh and for use in mods that use 20700 batteries
26650 Battery: A bigger battery for use in mods that can use 26650 batteries
Airflow Control (AFC) - The ability to change the amount of airflow to the coil situated in a tank, usually by turning a band around the outside of the tank
Atomizer - The heating element of an e-cigarette, also known as the coil. This will have a piece of wicking material threaded through it, usually natural Japanese cotton. Over time, these will ‘burn out’ and we recommend that they are changed every few weeks.
Atomizer Head - The metal outer shell that holds the coil and wick inside.
All Day Vape (ADV) – This is an e-liquid which you can comfortably vape all day, every day.
Amperage (Amps) - Unit of electrical current
Automatic - An electronic cigarette that has no button to start the heating process of the atomiser coil/heating element
Battery - The source of power the current comes from in order to power your vape.
Bottom coil clearomizer (BCC) - A clearomizer with a single coil located in the base.
Bottom Vertical Coil clearomizer (BVC) - A clearomizer where the coils are located vertically rather than horizontal
Box Mod - A device which is shaped like a box, they usually take up to 4 batteries depending on the design and capabilities. Box mods can either be mechanical (for use with an RDA) or variable wattage giving you the ability to control the power of the device to your tank or rebuildable atomizer.
Building - Making coils and wicking them in a rebuildable tank or dripping atomizer.
Build Deck - The deck where you build your coils. Found underneath the cap in a rebuildable tank or RDA.
Bottom Dual Coil Clearomizer (BDC) - A bottom coil clearomizer with two coils. Produces more vapour and a stronger throat hit, but battery life is poorer than a single coil clearomizer.
Bottom Feeder - Refers to clearomizers where the atomiser is at the bottom of the coil, instead of the top.
Clearomiser – This is a pen style tank which usually has a capacity of between 0.5ml - 1.8ml of liquid. Normally made from polycarbonate plastic.
Clone - A copy of the original, authentic product made with poor materials which haven’t undergone the standard tests for safety & performance as premium, regulated brands.
Cloud Chaser – This is someone who is looking to produce massive amounts of vapour.
Clouds - The vapour that is produced when a person uses a vape.
Coil - The heating element inside a tank, clearomiser or rebuildable atomiser.
Competition Cap - A cover made for an RDA to increase performance by getting more airflow to the coils.
Connection Pin - A safety feature included on a vast variety of mods that automatically cuts the power after 10 seconds of constant fire.
Chain Vaping – This is when a person constantly vapes.
CASAA (Consumer Advocacy for Smoke-Free Alternatives Association) - A non-profit organisation that campaigns on behalf of electronic cigarette users.
Cigalike - An electronic cigarette that resembles a cigarette.
Direct Lung Inhale - This kind of inhale is where the vapour is taken directly into the lungs, rather than pausing in the mouth first like a MTL inhale.
Dripper - Another word for an RDA.
Drip Tip - The mouthpiece of your vape. These come in various shapes, sizes, materials and colours.
Dry Burn - Heating your coil to take away extra e-liquid from the cotton. This method can burn your cotton within the coil so please be careful.
Dry Hit - When the cotton is burnt and needs to be changed if you vape with a coil that has burnt cotton you’ll get a really disgusting, burnt taste in your mouth, when this happens change your coil.
Disposable E-Cigarette - Designed to be thrown away after you finish all the e-juice within.
Dripping - Can refer to dripping a drop of e-juice onto an atomiser prior to vaping.
E-Cig – This is the shorthand for an electronic cigarette.
E-Juice - The liquid that goes into a vape: contains vegetable gylcerin (VG), propylene glycol (PG), flavourings and nicotine if required.
eGo Battery - A small pen style battery which is usually 4.2V in power.
Electronic Cigarette - An electronic cigarette is another name for a vape. The electronic cigarettes can come in all different shapes, sizes, colours and some have the option of fixed or variable wattage.
External Battery - A battery that can be taken out of the device for recharging or to be replaced.
External Charging - Charging a battery outside of your vape using an external charger.
ECITA (Electronic Cigarette Industry Trade Association) - Represent the UK electronic cigarette industry. Members are charged a monthly fee, have to follow strict standards and undergo rigorous twice-yearly audits. They also campaign for fair regulations on behalf of its members.
Electronic Cigar - Similar to an electronic cigarette but with a cigar look and taste.
Electronic Cigarette Starter Kits - Complete kits which usually contain batteries, atomisers, chargers, a manual and cartridges, these kits are aimed at people who are looking to start vaping.
E-Smoking - Smoking an electronic cigarette.
Flavour Chasing - A vaper who is looking for the best flavour, they prefer a stronger flavour than bigger clouds.
Flooding - This happens when there is too much liquid in the atomiser coil this can lead to a gurgling sound and/or leaking.
Filler Material - A material located within e-cigarette cartridges which soaks up and holds e-liquid.
Grub Screws - Small screws that are used in the posts of a rebuildable atomiser to hold the coils in place.
Gurgling - This gurgling sound happens when the coil is flooded with too much e-liquid.
Hot Spot - If the coil is not adjusted correctly when rebuilding, it can heat up incorrectly causing one of the wraps to heat up quicker than the others. This can cause the cotton to burn or sometimes even the coil can snap/melt.
Inhale - When you take in the vapour when you vape.
Internal Battery – This is when a device has an inbuilt battery which cannot be removed and requires charging through a Micro USB port or more commonly now a USB-C port.
Juice - Another name for e-liquid.
Kanthal - A material used to make wire for rebuilding coils.
Leaking – This is when e-liquid leaks from the tank.
Liquid - The juice or e-liquid used with a vape.
Low Resistance – Is usually any resistance under 0.20 ohms. Low resistance can result in an error warning on a vape and as a result will stop your vape from working.
LED - The light at the tip of an e-cigarette is usually an LED. Depending on the model, the LED may light up when the user inhales. More commonly, the LED may give information to the user about the battery, for example the battery life is low or running out.
mAh (Milliamps per hour) - This is the charge that a battery will hold and how long a device will run before the battery needs recharging.
Menthol - Alternative name for mint, found in e-liquids. Menthol liquids are commonly used by vapers for a cool refreshing vape.
Mg (Milligrams) - This is the unit that nicotine is measured in.
Micro USB - The most common charging port on the majority of vapes. If your mod uses an alternative charging method such as USB-C then the cable that comes packaged will reflect that.
Mint - Alternative word for menthol which often refers to an e-liquid flavour profile. Some companies also call it "Ice". These flavours normally leave a cold after taste when vaped.
Mod - The mod is the main body of your vape, it holds the batteries and depending on the model it’s where you control things like temperature, wattage etc.
Modders – These are people who make their own mods and are usually advanced users.
Mouthpiece - Alternative word for drip tip.
MTL - Mouth to lung style of inhale, similar to the inhale of someone smoking a cigarette.
Ni80 Coil - A heating element which is made using a nickel wire
Ni200 Wire - A type of coil made from nickel used for temperature sensing coils
Nic Shot - Shortened name for Nicotine Booster. These are usually added to short fill bottles to add Nicotine to the e-liquid.
Nicotine Booster - A 10ml bottle of nicotine that is used to add nicotine to e-liquids; usually those in short fill bottles. These can vary in strength and VG/PG mix however the most commonly used is a 100% VG based 18mg Nicotine Booster.
Nicotine - Also called "Nic” this is the substance found in cigarettes and some e-liquids. E-liquids have varying amounts of nicotine ranging from 0.2% to 2.0%. Nicotine is very addictive.
O-Ring - Rubber seals usually found inside tanks to keep them leak proof
Ohm - The measurement of the electrical resistance in your coil
Organic Cotton - This is used within most coils as a wicking material due to its ability to soak up liquid
Parallel Box Mod - A device with more than one battery. Devices like this only increase battery life and not power.
Pass Through - A vape which can be used whilst being charged
Pen Style - These devices tend to be longer and slimmer than other mods, resembling the size and shape of a pen.
PG (Propylene Glycol) - A mixing agent used in e-liquids. PG is linked with more flavour and throat hits.
Positive and negative posts - These are found in a rebuildable atomizer and are where the legs of the coil are inserted.
Priming – The Process of ensuring the cotton is fully soaked with e-liquid before the device is used for the first time.
Protected battery – This is a battery with a tiny chip. These batteries tend to have a raised top. They don’t work in variable wattage devices.
Pull - When a person inhales vapour through a vape.
Primer Puff - When you take a short drag on your e-cigarette to activate the atomiser. Not usually necessary unless your vape has been standing for a while and the atomiser is dry.
RBA - Rebuildable atomiser base for tanks with standard coils
RDA - Rebuildable Dripping Atomiser
RDTA - Rebuildable Dripping Tank Atomiser
Rebuildable tank - A tank that uses handmade coils within the tank before use
RTA - Rebuildable Tank Atomiser
Resistance - Refers to the resistance of the coil in the atomiser (measured in Ohms). The lower the resistance the more heat and vapour is produced.
Series Box Mod - A mod which holds more than one battery. This does the opposite of a parallel box mod (see above for definition) a series box mod will increase power but not the battery life.
Squonking - Using a device with a bottom fed RDA: The mod has a tube which allows liquid to travel up to it when the bottle is pressed (or squonked). These mods tend to be easier to use and save you time of having to drip liquid when you want to vape.
Stacking batteries - A dangerous technique of using more than 1 battery to increase power, we do not advise this and if used should only be done by advanced vapers.
Starter kit - A kit that is designed for a person who is starting out vaping
Stealth vaping - Small devices which can be concealed in the hand to keep things stealthy these devices don’t produce much vapour at all
Steel mesh - An alternative wicking material used in specific RDAs
Steeping - The process of allowing ingredients to blend together. Usually refers to e-liquid and the ageing of e-liquid into its flavours, the term is also used in tea making.
SS316L - Stainless steel wire used when making coils
Sub-Ohm - A coil with a resistance of 0.99 or smaller
Sweet Spot - The perfect resistance and power for any given vaper. This is completely down to the user’s preference although companies will recommend a range of wattage for coils.
Smoke-juice - Another term for e-liquid, however it is not commonly used
Tank - The object on top of a mod that holds the e-liquid
Temp Control (TC) - A mod that has temperature control can be used with different coils such as nickel, titanium, NiChrome or stainless steel
Throat Hit - The kick in the back of your throat normally felt when smoking a traditional cigarette. High PG e-liquids replicate this. This is also one of the reasons people will add Nic. shots to their e-liquid
Ti Coil - A coil where the wire is made out of titanium
Tricks - Using a vape to perform tricks such as rings or Bane’s mask
Unicorn Bottle - A bottle with a needle cap that is used to store and transport e-liquids easily and safely
Unprotected Battery - The majority of batteries are now unprotected and have a flat top. This is due to the fact that most vapes now have power protection internally and so it is not as important as it once was.
Unregulated Mod - A mod which has no wattage control and uses the max power possible from the batteries. Used with a rebuildable tank or dripping atomiser
Vape Band - A tiny rubber ring which goes around the glass tube on your tank to protect it from cracking when dropped
Vape Juice - Alternative name for e-liquid
Vaper - Someone who vapes, most likely you reading this glossary
Vaper’s Tongue - When a person can’t taste a flavour anymore after vaping it for weeks, if this happens to use simply change your e-liquid and use that for a week or so before switching back to your favourite
Vaping - This is the act of inhaling and exhaling the vapour from an e-liquid through the use of a vape
Vapour - The water vapour which is released when an e-cigarette is used
Vent Holes - These are found on most mods and in the event of a battery venting it lets the gasses leave the mod through these holes
Venting Battery - When the battery is used incorrectly it can cause damage to your mod and possibly to yourself.
VG (Vegetable glycerine) - A mixing agent used in e-liquids. Linked with a smooth hit and more vapour (clouds)
Voltage Drop - The loss of power due to variables such as loose post screws or materials and the accuracy of the chip situated inside the device
Volts - The measurement of power emitted by the battery situated inside the mod
VW - Variable Wattage
Wire - Used for making coils to create the heating element
Wicking - Material used to soak up e-liquid and deliver it to the coil for vaporising, usually cotton
Wrap - The protective layer around a battery or mod
Zero Nic - An e-liquid that contains no nicotine | <urn:uuid:48639df6-9506-4984-bee0-b30df9844d0c> | CC-MAIN-2022-33 | https://www.vapeshoppers.co.uk/vape-shoppers-glossary-of-vaping-terms-10 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.90891 | 3,508 | 1.515625 | 2 |
Questioner: O Shaikh! One more question, and it’s the last: there is someone who is vicious in speaking about the scholars, not concerned whether they are major or not, I’ll give you an example, whoever has been described as being Ash’ari or about whom it has been said that his aqidah is Ash’ari, then you will find that this person speaks about him in the most despicable manner, so we want you to advise him, especially since a lot of people have been deceived by him and they say that, ‘He has the characteristics of the righteous.’
So we want you to advise him, O Shaikh!
Al-Albaani: Yes. May Allaah reward you with good.
I believe that justice is that every Muslim is mentioned with the goodness and correctness that he has, and that he is mentioned with the mistakes that he has–and I [say ‘mistakes’ and] not, ‘evil’ because evil is more specific than a mistake.
I believe that this person mentioned in the question is not a faqeeh, it may be that he is righteous, but righteousness is something and understanding in the religion [fiqh] is something else.
And maybe it is pertinent [here] for me to remind you that the result of righteousness which is not coupled with knowledge is that such a righteous person will end up giving himself the death penalty.
As he عليه الصلاة والسلام narrated to us in an authentic hadith, agreed upon by Bukhari and Muslim, on the authority of Abu Hurairah, may Allaah the Most High be pleased with him, who said, “Allaah’s Prophet صلى الله عليه وآله وسلم said, ‘Amongst those before you was a man who killed ninety-nine people and he wanted to repent so he asked about the most knowledgeable people on the face of the earth? And so he was directed to a raahib …” i.e., a righteous slave who had secluded himself from the people to worship Allaah according to their way of monasticism in those times, “… so he came to him and said, ‘I have killed ninety-nine people, is there a chance for me to repent?’ He said, ‘You have killed ninety-nine people and now you’re asking if you can repent?’ There is no chance for you to repent,’–and so he killed him and completed a hundred …”
And it seems from the many versions of the story and its context that the man [i.e., the murderer] really was sincere in wanting to repent, but he wanted a scholar who could show him the path that he should undertake, “… so he carried on asking until he was directed to a scholar and so went to him and said, ‘I have killed one hundred people unlawfully, is there a chance for me to repent?’ So he replied, ‘And who can come between you and repentance? But you are in an evil land …’ this is the answer of a scholar, ‘… so leave it and go to such and such a place whose inhabitants are righteous.’”
So he left, walking, and on his way there his appointed time came and so the angels started to contend over him, the Angels of Mercy and the Angels of Punishment, each one claiming that the man was rightfully theirs to take. So Allaah sent an angel to them to judge between them, and so he said, ‘Measure the distance between him and both towns, the one he left and the one he was going to, and cause him to join the people of whichever of the two he is closest.’
So they measured and found him to be closer to the town he was going to and so the Angels of Mercy took his soul. [Transl. note: so the Shaikh was trying to show that even though the first person the murderer asked may have been righteous, he was not a scholar and gave the wrong answer, telling the murderer that there was no way for him to repent, and thus the result of his incorrect ruling was that he was also killed. Whereas the second person was a true scholar, someone who is righteous and has knowledge too, and based upon his knowledge did give the correct answer.]
The point is that this man [you mentioned in the question], if he is righteous, as we hope he is, then [we still say that] he is not a faqeeh.
He does not picture, and he is not alone in this–and I think this is a very important point–many people differentiate between mistakes in the subsidiary issues [furoo’] and those in the fundamentals [usool], saying, ‘Mistakes in the subsidiary issues are forgiven if they emanate from ijtihaad, but as for those which occur in the fundamentals then they are not forgiven,’–this is incorrect.
The first reason [for this being incorrect] is that there is no proof for this categorization, i.e., splitting the Sharee’ah into fundamentals and subsidiary issues and then basing judgements on this categorization has no basis.
The second is that the proofs, or some of them at the very least, confirm that even if a person makes a mistake in things connected to aqidah he is also excused.
The greatest proofs for that are the two hadiths which I will quote now. The first is the one of that man who gathered his children when he was about to die and said to them, ‘What kind of a father have I been to you?’ They said, ‘The best father.’ He said, ‘Verily, I have sinned against my Lord. After my death, burn me and then crush me, and scatter half the powder in the air and half in the sea, for by Allah, if Allah has control over me, He will give me such a punishment as He has never given to anyone else.’
So when he died they carried out his request, a request whose injustice and distance from the legislation may not have an equivalent, So Allaah the Mighty and Majestic said to his particles, ‘Be so and so.’ And then Allaah the Mighty and Majestic asked him, ‘My servant! What made you do that?’ He said, ‘My Lord! I was afraid of You.’ So He said, ‘Go, for I have forgiven you.’
So he disbelieved, there is no doubt that he disbelieved, because he made that unjust will thinking that he would be able to get away from his Lord, which reminds us of the Most High’s Saying, “And he presents for Us an example and forgets his [own] creation. He says, “Who will give life to bones while they are disintegrated?” [Yaa Seen 36:78]
So this man, [what] his will [contains] says that Allaah the Mighty and Majestic is unable to resurrect him to be the fully formed man that he was, but Allaah did, saying, ‘Be so and so,’ and then addressed him.
But Allaah the Mighty and Majestic who is the One who knows what man’s breast conceals, knew that this person in doing that action was not denying the Resurrection and that it was only the fear of the impending punishment [which made him do what he did], and he admitted that it would happen and that he would deserve it, [so it was these things] that blinded his insight and thus he left that unjust will.
The second hadith is his saying عليه السلام–and this is also very important and has a connection to the issue of the Ahlul-Fitrah, and many sittings concerning this topic have preceded–he عليه السلام said, “There is no man from this Ummah, whether Jew or Christian, who hears about me yet does not believe in me except that he will enter the Fire.”
So, these people who did not hear of the Prophet عليه السلام and died as disbelievers, as polytheists, will not be punished because of their shirk and misguidance–in fact I will go even further and, taking the understanding from his saying عليه السلام, “…who hears about me …” say that it means, ‘… [who hears about] me truly/my true reality …’ because if we picture some of these Europeans, like the British or the Germans and their like, those who have been affected by the call of the Qadiyanis and who have believed that there are other Prophets after the Messenger of Allaah صلى الله عليه وسلم and that one of them was sent to Qadian [in India], the one who was initially well-known as Mirza Ghulam Ahmad al-Qadiyani, and who then changed his name to Ahmad for a reason well-known … so the point is that these Germans and British people who were led astray in the name of the call to Islaam, [being led to believe that] Islaam acknowledges the coming of messengers after the Messenger صلى الله عليه وسلم and that one of them was called Mirza Ghulam Ahmad al-Qadiyani and that Islam denies the existence of a creation called the Jinn–which have well-known characteristics in the Book and the Sunnah–there is no doubt that these people have gone astray: but did they really hear about him عليه السلام truly? The answer is no.
Thus, this hadith teaches us that:
Firstly, those whom the message does not reach at all will not be punished. They will be dealt with in that well-known manner on the Day of Resurrection.
Secondly, if Islaam’s message reaches them in a distorted manner, altered, changed, and they believe in it, then they will also not be held to account over that.
So, differentiating between fundamentals [usool] and subsidiary issues [furoo] is a deviance from the Book and the Sunnah, for this reason I say that it is obligatory on this brother [you asked about in the question and] who is righteous inshaa Allaah, to rectify his knowledge, at the very least to rectify it in his unjust fatwa.
So the fact that a noble scholar erred in an Aqidah issue like [Allaah’s] Names and Attributes and other such things which some of the Ash’aris and Maaturidis fell into … then it is possible that that could have been based upon their ijtihaad and not because of any evil intent on their behalf–so it is not allowed to make such a statement [as the one mentioned in the question] unrestrictedly except with a restriction [like the following]: whoever comes to know the truth and then deviates from it then he is such and such.
[And following on from this] there is no difference between someone who deviates from what is right in the issue of [Allaah’s] Names and Attributes or anything [else] connected to aqidah and someone who deviates in a legislative ruling.
For example, someone who knows that the truth is that bleeding does not break one’s ablution but who still goes astray and insists [on the opposite] arrogantly [going against] the proofs [then the case is clear], and you can judge the rest based upon this [example].
And how many subsidiary issues there are which the scholars have differed in and whose effect on the community can be much worse than some issues which are only connected to aqidah.
I wonder, do you think those who deny the punishment of the grave like some of the groups found in the Islamic world today, would you say that the harm of denying the punishment of the grave is greater than that fiqh opinion which says that it is permissible for a Muslim girl who reaches the age of discernment to get married herself without her guardians consent, in opposition to the hadith?
Which of the two opinions has a greater effect in corrupting the community? Is it the first which denies the punishment of the grave or this one which denies the condition of the guardian’s consent?
There is no doubt that this [i.e., denying the guardian’s consent] causes more corruption, but this issue is a subsidiary one [furoo] and that other one [i.e., denying the punishment in the grave] is a fundamental [usool], “They are not but [mere] names you have named–you and your forefathers for which Allaah has sent down no authority.” [An-Najm 53:23]
Questioner: May Allaah reward you with good.
Al-Hudaa wan-Noor, 635. | <urn:uuid:1201552b-0ccb-40c0-82d2-18decd6d71f9> | CC-MAIN-2022-33 | https://thealbaani.site/tag/qadiani/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.98418 | 2,796 | 1.59375 | 2 |
The DigiFind consortium is glad to inform about another interesting European iniatiative aimed at contributing to the innovation capacity and competitiveness of EU wood and furniture industry: the EQ-WOOD project.
EQ-WOOD tackles innovation capacity and competitiveness of EU wood and furniture industry by designing and delivering the curriculum of Innovation Advisor in the Wood and Furniture Industry.
It helps managing innovation by merging green, digital and marketing skills.
The Innovation Advisor curriculum is offered both as a Full Qualification, mainly addressed to young people, and as a set of independent learning modules mainly addressed to Continuing Professional Development of adult workers, through a combination of classroom-base and e-learning in an international community of practice. The proposed qualification is coherent with EU instruments (EQF, EQAVET, ECVET)”
EQ-WOOD is coordinated by FederlegnoArredo (Italy), with the collaboration of 9 partners representing 6 countries (Italy, Spain, Belgium, Bulgaria, Hungary, France).
More information here: www.eqwood.org | <urn:uuid:db6e66d6-4413-4629-8553-59b30d1b5f29> | CC-MAIN-2022-33 | http://digifind.unwe.bg/index.php/2019/10/24/eq-wood-project/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.933753 | 214 | 1.546875 | 2 |
Visit for the latest Coronavirus Illness (COVID-19) updates. Cooking your own meals at residence, and choosing whole meals or minimally-processed meals will even help to restrict how lots salt and added sugar we devour. Avocados are fully different than most fruits because of they are loaded with healthy fats as a substitute of carbs. Seek for train instruments, reminiscent of exercise gloves and lifting belts, to keep up your self protected. Among them, choosing a balanced weight-discount plan or healthy consuming plan. The Australian Dietary Pointers suggest that you just simply eat one to 3 serves of meals from this group every day, relying in your age.
On this view, in each particular selective state of affairs a distinct specification of the schematic propensity definition of fitness figures in the antecedent of a distinct and extremely restricted principle of natural alternative that’s applicable solely in that situation. Why It is Nice: Comprised of pressed avocados , this oil is wealthy in coronary heart-healthy monounsaturated fat that may help enhance cholesterol … Read the rest | <urn:uuid:3531fbfb-9ec8-4a93-9955-f4ff9e60b193> | CC-MAIN-2022-33 | http://agnnews.com/tag/cheap | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.935545 | 223 | 1.859375 | 2 |
Gluten-free products have become so popular now that you probably don’t even notice them anymore. Currently, you can opt for gluten-free pastas, breads, cookies, and bottled water (yup, water). It doesn’t end there: A growing number of companies are releasing gluten-free beauty products, lotions, and body washes.
Gluten-free products have become such a big market that it’s now a $15 billion industry, according to the Wall Street Journal.
Whether you’re on a gluten-free diet out of medical necessity or are just doing it for your health, how many of these products do you actually need?
Experts say it really depends on how your body reacts to gluten. People with celiac disease—a serious autoimmune disorder in which people can’t tolerate gluten—need to be the most wary of products containing gluten, certified dietitian-nutritionist Lisa Moskovitz, R.D., CEO of NY Nutrition Group, tells SELF. (According to the Celiac Disease Foundation, this applies to one in 100 people worldwide.)
“Only those who suffer from celiac disease, a severe, life-threatening intolerance to gluten need gluten-free products for their safety,” she says.
People with celiac disease are at risk of serious nutrient deficiencies that can snowball into health issues such as anemia, osteoporosis, neurological complications, migraines, and infertility, as well as unpleasant symptoms such as gas and bloating, diarrhea, vomiting, constipation, weight loss, and extreme fatigue, registered dietitian-nutritionist Karen Ansel, coauthor of The Calendar Diet: A Month by Month Guide to Losing Weight While Living Your Life, tells SELF. “That said, only about 1 percent of people have celiac disease, so it's fairly rare,” she says.
However, Alissa Rumsey, M.S., R.D., a spokesperson for the Academy of Nutrition and Dietetics, tells SELF, there’s also a condition called non-celiac gluten sensitivity which, while not dangerous, can cause severe digestion issues such as diarrhea, cramping, and malabsorption of nutrients after a person has gluten.
“Those with self-diagnosed intolerances or allergies that have not been confirmed by their doctor usually do not require gluten-free products,” Moskovitz says. “However, they may still feel better avoiding gluten in their diet.”
But how extreme do you need to go? While things like gluten-free toothpaste sound silly, it’s actually important that people with celiac disease use it because they could swallow it, says Moskovitz. “One should also check their toothpaste, chewing gum, or anything that they put in their mouth and could end up passing through their digestive system,” she says.
However, if you have a gluten intolerance, but not something as extreme as celiac disease, experts say it really depends on how you feel after using those products.
As for gluten-free beauty products, Ansel calls them “pure hype.” “Gluten molecules are too big to be absorbed through the skin, so with the exception of things like lipstick that you might end up swallowing, there's absolutely no reason to use a gluten-free beauty product,” she says.
And gluten-free water?! “Water, as with any product that doesn't contain wheat, rye, or barley, doesn't have any gluten in it to begin with,” Rumsey points out. So, unless something is added to it, you're fine with drinking plain old H2O.
So, for sufferers of celiac disease, it’s important to be wary of gluten content in any products that can wind up in your mouth. For everyone else who has a mild gluten sensitivity or intolerance, do your best to avoid foods that contain gluten. Otherwise, save your money.
Photo Credit: Daniel Acker/Bloomberg via Getty Images | <urn:uuid:2381ca84-18ec-45a1-bc5a-a3a3d55fc8e0> | CC-MAIN-2022-33 | https://www.self.com/story/heres-when-you-actually-need-gluten-free-products-that-arent-food | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.955785 | 847 | 1.757813 | 2 |
4 Side Effects of Drinking Celery Juice
1. filled with beneficial nutrients
One of the major benefits of drinking celery juice regularly is the boost of micronutrients it gives your body in one easy, green cup.
Celery juice contains calcium, potassium, magnesium, vitamins A, C, and K. Our body needs these nutrients for numerous tasks.
One cup of celery juice also contains calcium, magnesium, and potassium (14 percent DV).
2. reduce inflammation and risk of disease
Calcium, potassium, and magnesium can all help to lower blood pressure and have been found to reduce the risk of heart disease and stroke.
Celery juice plus frequent chiropractic therapy helped a hypertensive patient's blood pressure. Many experts agree that celery juice can enhance heart health.
3. improve eye and skin health
One cup of celery juice contains 7% of your DV of vitamin A, which is needed for "vision, development, cell division, reproduction, and immunity"
This green juice's vitamin C (16% DV) can also aid with collagen formation, which supports joints and gives skin suppleness.
4. It lacks fiber
One cup of entire celery stalks contains 1.6 grammes of fibre, vitamins, and minerals.
Fiber feeds good gut bacteria, which maintains a healthy gut microbiota and produces short-chain fatty acids.
Straining celery juice removes most of the fibre. Without fibre and protein, your blood sugar might increase and fall fast, leaving you hungry after a meal.
Blood Pressure Reducing Tricks Actually Work | <urn:uuid:6be2b593-55d0-434f-bbaf-4781f442e6ec> | CC-MAIN-2022-33 | https://www.eastwestcafeburlington.com/web-stories/4-side-effects-of-drinking-celery-juice/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.8801 | 334 | 2.0625 | 2 |
As an archaeologist, my expertise in the cognate field of geology includes fluvial processes, so I know something about floods. And I’ve experienced plenty of floods working in the Hudson and Mohawk river valleys … now that I think of it, I’ve got quite a few good flood stories. But the most significant experience I’ve had with flooding happened in about a foot of water.
It was in the Congo, at Senga, a location I’ve written about before. Our camp was on one side of a wash right where it entered the Semliki River, and the excavation was on the other side of the wash, but since the digging all occurred during the dry(ish) season, that was never an issue. But when the excavation was over, and almost everyone went home, those of us left behind to do our own non-excavation research projects experienced a number of good rains.
One day I had parked the Zodiac on the other side of the dry wash, where it was tied up to a sturdy tree AND pulled fully out of the water. It rained, and I went down to look at the wash to see if it was running, and it was. I realized that the river was rising, so water was lapping at the boat, and the water running into the river from the wash was between me and the vessel. So, I considered crossing the wash to drag the boat farther inland.
Not being a total moron, I first tested the was with a stick to see how deep the water is. If the water was flowing over the surface as I had seen it only that morning, the water could be no more than 12 inches deep. When I stuck the stick into the rushing torrent, I discovered two things: 1) Yes, the water was only about a foot deep and 2) the strength of the water was sufficient to pull the stick out of my hands and drag it at a very high velocity into the river, where it would flow down stream over the rapids, then down the water fall, then into the crocodile infested lake.
I walked the long way around. It took an hour and a half to make it to the boat, and I had to cross through the territories of a pride of lions and a bunch of hyenas, but that was a LOT safer than crossing the one foot deep flood.
And I’m reminded of all of this by this post, which you should visit and read: “I Can Feel The Boulders Rolling”
Do you have a flood story? | <urn:uuid:397262b2-1ceb-41af-b018-4e1a1cd66afb> | CC-MAIN-2022-33 | https://gregladen.com/blog/2011/10/22/floods-dont-go-in-them/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570868.47/warc/CC-MAIN-20220808152744-20220808182744-00072.warc.gz | en | 0.983929 | 536 | 2.140625 | 2 |
A decision tree is a great way to determine a course of action and possible outcomes associated with an officer’s decision. Today everyone has a camera and decisions are reviewed, questioned, and judged by those who have no idea what happened. In Ch. 5 you learned about tactical decision-making and scenario-based training for new officers. Discretion is a major part of a police officer’s role and the decision he or she makes in a split second can create many different outcomes and consequences. Watch the Decision Tree video located in the University Library. (See attached file) Read the Sidebar 11-1, “Police Discretion in an Unfolding Disturbance Call” in the “New Perspectives on Police Discretion” section of Ch. 11, “Police Discretion,” of The Police in America. (See attached file) Consider the different stages the officer is faced with in the scenario. Select stage four, five, or six and review the officer response provided. Create a 10- to 12-slide PowerPoint® presentation in which you: – Describe possible decision points that the officer may have faced. – Explain how one decision the officer could have made modeled abuse of discretion or modeled positive use of discretion. – Describe factors that may limit the officer’s discretion. – Explain at least three internal and external mechanisms police departments use for accountability. – Include detailed speaker notes, the notes should be equivalent to you presenting to a group. – Include pictures relevant to the topic.
Why Choose Us
Top Quality and Well-Researched Papers
We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.
Professional and Experienced Academic Writers
We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.
Free Unlimited Revisions
If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.
Prompt Delivery and 100% Money-Back-Guarantee
All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.
Original & Confidential
We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.
Customer Support 24/7
Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.
Try it now!
How it works?
Follow these simple steps to get your paper done
Place your order
Fill in the order form and provide all details of your assignment.
Proceed with the payment
Choose the payment system that suits you most.
Receive the final file
Once your paper is ready, we will email it to you.
No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.
No matter what kind of academic paper you need and how urgent you need it, you are welcome to choose your academic level and the type of your paper at an affordable price. We take care of all your paper needs and give a 24/7 customer care support system.
Admission and Business Papers
An admission essay is an essay or other written statement by a candidate, often a potential student enrolling in a college, university, or graduate school. You can be rest assurred that through our service we will write the best admission essay for you.
Editing and Proofreading
Our academic writers and editors make the necessary changes to your paper so that it is polished. We also format your document by correctly quoting the sources and creating reference lists in the formats APA, Harvard, MLA, Chicago / Turabian.
If you think your paper could be improved, you can request a review. In this case, your paper will be checked by the writer or assigned to an editor. You can use this option as many times as you see fit. This is free because we want you to be completely satisfied with the service offered. | <urn:uuid:7b4f7b73-a950-4087-b563-039953da21b8> | CC-MAIN-2022-33 | https://myhomeworkwritings.com/2021/12/09/ethnic-minority-group-relations-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.947534 | 960 | 2.9375 | 3 |
Search this website for information about collecting stocks and bonds.
No single grading standard has yet evolved for the collecting of stocks and bonds. In general, certificate grading standards mirror those used by paper money collectors. Here are the terms I use for grading paper.
Be warned that dealers' definitions can and will differ. Many dealers will grade stocks and bonds one level higher than me.
Using my definitions, the grades of most stocks and bonds will cluster around the Fine and Very Fine categories. Unless a seller specifically argues to the contrary, you can generally assume certificates are in average condition. Fortunately, certificates in average condition are perfectly acceptable for most collectors.
Also be warned of the phrase, "average condition for the issue." The average condition of some issues, particularly early Cuban certificates, can be downright awful. Because of storage conditions, average certificates of some issues will include discoloration and water staining. The average condition of some issue may actually mean heavy cancellation. If ever in doubt about condition, ask your seller to explain and send you a copy.
Here are my grading standards. Other dealers and collectors may use different standards. Before spending a lot of money, be sure you understand the seller's system.
Mint = ???
I NEVER use this term for paper. With deference to experts in other hobbies, I argue that paper is printed. Paper is not minted!
UNC = uncirculated
I seldom use this term for stocks and bonds. Virtually all stocks and bonds, upon close examination, show handling marks. Truly uncirculated documents are still in printing plants.
XF = extra fine
Documents are much better than average. There are no tears or water stains. This is generally the highest grade I use for any stock certificate. Paper is bright with original body. Proofs in this category may show a few pencils or crayon marks, but the paper will be better than average.
VF = very fine
Documents are better than average, but not perfect. There may two or three light folds. This is generally the highest grade I use for bonds, because most bonds were folded in quarters. There may be minimal cancellations that affects signatures, but not the paper. Paper is generally bright, but may show minimal aging. Older certificates may show halos around ink signatures, but the paper will be intact.
F = fine
Average documents with average problems. Documents are intact, but may have average creases, handling marks, tiny edge tears. Cancellations will be typical for the issue and may include punches, punch-out cancels, cut cancels, and cut-out cancels. There may be one or two staple holes. The document may be fastened to a stub with staple, glue, or paste. Average certificates may also have been removed from stubs, and may show staining from the old glue. The paper, however, should show only minor wrinkling from removal. DO NOT BUY anything in this condition if you are unwilling to accept average problems.
VG = very good
Documents have more problems than normal. They show definite wear. Originally-folded documents may show minor separations along original folds. There may be water stains. Pulp paper may show yellowing or brittleness. Cancellations will be heavier than average for the issue.
G = good
Documents are intact, but beat up. There may be significant acidic paper deterioration in paper with high pulp content. Do not collect documents in this condition except as space fillers.
FR = fair
Documents are heavily worn. There may be large tears or bad acidic paper deterioration. There may be pieces missing. Collect items in this condition only if they have significant historical or collectible interest.
PR = poor
Documents have serious problems. They are barely above rag status. Buy with extreme caution. Items in this condition are space fillers only. They are likely to have minimal resale value.
I strongly recommend buying the Cox Catalog 3rd Edition from your favorite
If they do not carry, or are out of stock, you may buy directly from me. Simply click the buy button below.
Help support this free site! Please visit my eBay store called Papermental by Terry Cox. My inventory includes railroad passes, railroad ephemera, newspapers, magazines, engravings, and all sorts of paper collectibles.
I suggest using WeTransfer or similar file transfer sites when sending large files or large numbers of files.
PLEASE contact the many fine dealers listed on my dealers page to buy certificates.
© Copyright 2021 by Terry Cox | <urn:uuid:b5f80a5e-4019-40b1-b368-6eb39ae79af3> | CC-MAIN-2022-33 | https://www.coxrail.com/grading-standards.asp | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.933991 | 956 | 1.632813 | 2 |
We are an organization dedicated to promoting classical Christian education (CCE) by encouraging parents, educating seekers, and uniting the existing national community. As affiliates of the Association of Classical Christian Schools (ACCS), we promote classical Christian education through our magazine publication in addition to our online community.
How do we develop leaders such as these? It’s no secret. We work to revive the medieval model of education, one with a robust core of liberal arts, centered on Christ. We believe Christ is sovereign over everything, and as such should be integrated into every part of the educational curriculum and community. Why study history? Because we can see how Christ prepared the world for his works. Why study math? Because we can witness the meticulous order with which God designed the world. We have found that when Christ is first in every subject, students become lifelong learners, enchanted by the wonder of the world and passionate about justice and truth. We think the world needs more people like these, which is why we, here at The Classical Difference, are dedicated to expanding the presence and vision of classical Christian education.
Check our blog often for news and blog posts about parenting, media, and culture, and other updates.
If you have any questions, thoughts you would like to share, or requests for content, please do not hesitate to email us at firstname.lastname@example.org. We value our community members and will respond as soon as we can. | <urn:uuid:bf5745f4-531c-4706-ad3e-25656604b680> | CC-MAIN-2022-33 | https://www.classicaldifference.com/about-us/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.959233 | 294 | 1.625 | 2 |
Thermal management is becoming a common limiting factor in newer technologies.
Ed.: This is the fifth of an occasional series by the authors of the 2017 iNEMI Roadmap. This information is excerpted from the Roadmap, which is available from iNEMI (http://community.inemi.org/content.asp?contentid=51).
Aerospace/Defense products’ high- and low-temperature requirements force improvements in components and materials. Components must operate at both high- and low-temperature extremes without substantial derating or decrease in functional performance, and ideally without additional cost. This can at times require “up-screening” of commercial parts. Electrical interconnections (solder joints and PTVs) must be able to tolerate constant cycling between these temperature extremes for years without failure. Materials such as dielectric laminates, solder masks, adhesives, underfill, coatings, and solder need to perform at high- and low-temperature extremes and over a range of environmental conditions (i.e., moisture and chemical exposure) without degradation. Additionally, reworkable underfill materials are desirable.
Components. Active leaded components range from 0.015" to 0.050" pitch in a variety of package technologies. Active leadless components range from high-ball-count, fine-pitch area array ball grid array (BGA) to low-ball-count, odd-form BGAs, QFNs, and land grid array (LGAs). BGAs range from 1.27mm to 0.65mm pitch. The higher I/O BGAs are typically 1.0mm, and the 0.65mm pitch BGAs are typically low I/O. This trend of increasing solder ball count and decreasing solder ball pitch is expected to continue as pitches go to 0.5mm, 0.25mm and smaller. The LGA is popular due to its package size, but its reliability, specifically with SnPb solder, is still questioned. BGAs come in a variety of configurations, wire-bonded with an epoxy over-mold, flip chip, with a metal heat sink, etc. Several heat spreader designs are used to dissipate heat generated by BGAs. In some cases, these heat spreaders are open to cleaning solvents and conformal coating. Adhesives used to bond the heat spreader to the package are in many cases incompatible with the cleaning solvents used for flux removal or cleaning prior to application of conformal coating, causing the heat spreaders to fall off the component during cleaning. Additionally, cleaning solvents may attack the thermal interface material (TIM) inside the component, affecting its thermal performance. The assembler must ensure the heat sink attach adhesive, TIMs, and cleaning chemistries are compatible. In some instances, there are capacitors or other discrete components internal to the component. These discrete components may have Pb-free surface finishes that must be considered from a tin whisker perspective. In most cases, an exhaustive parts review for the newer components usually pays for itself in scrap reduction and schedule delay avoidance.
All surface-mount components require a low-cycle thermal fatigue analysis for military products, and the thermal expansion characterization of new parts is something our industry frequently investigates beyond what the supply base offers.
Thermal management. Thermal management is typically accomplished with passive conduction cooling. Increasing power densities and demands on thermal management have resulted in various new approaches and a transition from passive to active cooling. COTS products are typically designed for convection cooling, whereas the traditional military box has been designed for passive conduction cooling. Heat sink frames are typically made from aluminum or copper, although the popularity of various composite materials and active (air and liquid flow through) heat sinks is increasing.
Composite materials, although typically expensive, are being used in some cases to improve thermal management but can be used to reduce thermal expansion of the PWB, creating a better match of the thermal coefficient of expansion (CTE) between the PWB and specific components. There is significant interest in the use of nanotechnology materials such as carbon nanotubes to reduce thermal resistance at the various interfaces. Heavy demands have been placed on thermal management techniques with combined use of heat spreaders and heat sinks, resulting in the evolution of several unique assembly requirements and challenges. Based on the power dissipation of many of these new components, thermal management is becoming a common limiting factor in newer technologies.
Most products use rigid PWBs, although an increasing number of applications take advantage of rigid-flex PWB designs. The most common PWB material continues to be high-temperature FR-4 laminate, with polyimide glass used in high-temperature applications. There is niche use of aramid fiber-based laminates when constraint of “x-y thermal expansion” is critical, and Teflon-based materials such as duroid are used for some RF products. There is a growing requirement for specialty laminate materials for HDI PWBs using multiple layers of microvias and requiring multiple lamination cycles. There is limited use of ceramic hybrid substrates, primarily in RF products.
TIMs. There is increasing interest in new and advanced materials for thermal interface materials and heat conduction in all areas of the electronics market, including aerospace and military. While there are obvious similarities, different applications have different key requirements of the TIMs. In all cases, the TIM needs to minimize stress, prevent electromigration of its fillers and maximize adhesion.
Phase change materials (PCM) transition from a solid to a semi-solid phase with heat from the power devices and can completely fill the interfacial air gaps and surface voids, usually under light clamping pressure. The performance is similar to the best of thermal greases and is gaining acceptance in defense and aerospace applications.
While less “runny” than grease, some PCM-based TIMs contain wax and may flow out of tight areas once melt-on temperature is reached. Recently introduced phase change type materials are hot wax-based and will not drip. Since these materials are firm and easy to handle at room temperature, operators have more control when applying the solid pads to a heat sink surface. Compressible phase change pads eliminate trapped air along the interface and are also compressible, conforming to the slight, or large, curvature of the electronic devices.
Polymer solder hybrids provide superior long-term reliability and exhibit the lowest thermal impedance of phase change materials. For optimum performance, the material must be exposed to temperatures above the melting point of contained solder(s) during operation (or by a burn-in cycle) to achieve lowest thermal impedance and highest thermal performance. Upon reaching the required burn-in temperature, the material will fully change phase and attain minimum bond-line thickness of less than 0.001" (0.0254mm) as well as maximum surface wetting. These polymer solder hybrids are typically used in microprocessors, graphics processors, chipsets, memory modules, power modules, and power semiconductors. At higher temperatures, the material may flow when oriented vertically; this does not affect thermal performance, but should be considered if appearance is important.
and co-chair the Aerospace/Defense Product Emulator Group (PEG) of the iNEMI Roadmap. | <urn:uuid:d4ca5ac6-8f91-40cb-998b-65525c158a2b> | CC-MAIN-2022-33 | https://circuitsassembly.com/ca/editorial/menu-features/29476-inemi-roadmap-1806.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00072.warc.gz | en | 0.914014 | 1,520 | 2.34375 | 2 |
Saturday, April 25, 2009
The Ethics of Torture
I guess I agree with what Shepard Smith is saying in this remarkable exchange(start at 1:40): We are America and we don't allow torture: this is not a right and left thing, it's a right and wrong thing. If there has been torture, those who ordered it should be prosecuted, even if it was the president.
If I sound a little reluctant, it's because I see di a problem here. However, I think we already have a solution to this problem.
I think of it as "the Fail Safe problem." At the end of the book and film of that name, the President of the United States (Henry Fonda in the movie) faces the possibility of the destruction of civilization as we know it. Due to a series of human and comuter errors, the US has dropped a hydrogen bomb on Moscow, destroying it. The Soviets are poised to retaliate with an all-out nuclear attack on the US. After exhausting all available alternatives, the president convinces the Soviets that the bombing was an accident by ordering another bomb to be dropped on Manhattan. The pilot who drops the bomb knows that his own wife and children are below him as he drops it. He then commits suicide. End of story.
My point is that you cannot prejudge for all time what you would or should do to prevent unthinkable horrors. Here the cliche example is very much to the point: Wouldn't we torture a terrorist who knows where a ticking H-bomb is? Sure. I would pull a few fingernails myself.
There is no need to legalize torture -- law or no law, we know it will be used in such unthinkably extreme circumstances, and so do our enemies.
But, you may say, if we don't change the law and allow torture, aren't we ensuring that people who are doing things that, though horrible and perhaps even unjust, are nonetheless necessary, will be punished for trying to protect us?
No, we aren't. If I commit torture and am exposed and prosecuted, I could argue that though I broke the law, nonetheless, due to horrific circumstances, I had a justification or excuse for doing so. I would be arguing that though I broke the letter of the law, I am not guilty of doing so. Even if I were still found culpable, these same arguments can figure as "extenuating circumstances" in sentencing (perhaps resulting in a suspended sentence).
Indeed, if my torture is successful and is known to have prevented the ticking-bomb disaster from ocurring, the public prosecutor would surely not prosecute at all and the government will try to keep my crime a secret.
People who want to legalize torture want the legal system to be flexible and adapt to changing times and circumstances. There is no need to abandon some of the most fundamental values of our system in order to be rationally flexible. Time-honored legal concepts like "justification," "excuse," and "extenuating circumstances" already give the system the flexibility it needs. As they say, "hard cases make bad law." | <urn:uuid:2471a228-5d8c-4be3-a1bc-114c08e4001c> | CC-MAIN-2022-33 | https://lesterhhunt.blogspot.com/2009/04/ethics-of-torture.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.97317 | 639 | 1.648438 | 2 |
Attaining Human Dignity by the Conscientious Use
JONATHAN VAN TONGEREN
Political Youth Network]
Christianity understands freedom not as the
freedom to do whatever one chooses, but rather as
the freedom to do what is morally right. Freedom is
to take responsibility for ones actions, hence the
goal of human freedom is to live righteously and
thus attain the fullness of his dignity.
Keywords: politeia, human dignity,
conscience, freedom, objective morality, natural law
A recovery of the concept of regime or politeia as elaborated in the political philosophy of Plato and Aristotle1 would help clarify the deep impact that the culture can have on the minds and hearts of all citizens, including Christians. The regime is the whole political and social order. It refers to the moral tastes, style of life, form of government and the spirit of the laws. So understood the regime is a crucial influence in the lives of most individuals. Only few could escape these influences, such as informed, committed Christians. With the emergence of Christianity, the regime is no longer necessarily as decisive in the lives of individuals. God’s Word and grace mediated through the Church can be wholeheartedly embraced even in the midst of bad regimes. Yet experience shows that many Christians are unduly influenced by the regime, what we usually call the culture or the social conditions.
The impact of the liberal regime
Liberalism and liberal democracy inclined citizens to think about morality to a great degree in terms of rights or subjective values. This in turn leads to a fixation on choice and autonomy as ends in themselves and about the goods of the body, safety, health, pleasure and prosperity. The liberal temper is anything but neutral in the moral tone it sets for its citizens. It supposedly encourages openness to all human possibilities, but today’s version of openness encourages not the pursuit of truth, but rather subservience to public opinion, a preoccupation with having things and a reshaping of religion to suit the temper of the times. Liberal regimes dispose citizens to have an incomplete understanding of human dignity. Persons are said to have dignity because they are autonomous and are capable of making choices. According to the most common opinion in contemporary society, the dignity of the human person is especially secured by ensuring the protection of rights. The initial and primary emphasis on rights is of course a logical step, since the autonomous exercise of choice requires the possession of rights. Another consequence of understanding dignity as constituted by human autonomy is linking the assessment of human dignity to a persons quality of life, especially the capacity to make autonomous choices. It is now commonly thought that a persons dignity diminishes with his or her declining quality of life. Physical and mental deterioration as well as suffering supposedly diminish human dignity. In Quill v. Vacco (1997), the second circuit court of appeal even went so far as to make an ominous statement about legal obligations toward the terminally ill. Quote: „The state’s interest lessens as the potential for life diminishes.”2 The presence of this statement in a decision of an American appeals court, surely indicates a trend toward regarding those persons with diminished physical capacity as less than fully human.
Liberal and Christian understandings of human dignity
Now the liberal understanding of dignity is a challenge to the Church, both in the areas of ordinary Christian teaching and in Christian social thought. Careful education is necessary for Christians to understand that the dignity of the human person is not essentially constituted by the ability to make choices. According to Christian teaching, people have dignity because they are created in the image and likeness of God, redeemed by Jesus Christ and destined for eternal life in communion with God. As Vatican Council II put it: „The principal cause of human dignity lies in the call of human beings to communion with God.” Being created in the image of God and redeemed by Jesus Christ makes it possible for everyone to respond to God’s invitation to communion with Him. This threefold foundation for human dignity is both unshakable and instructive. No act of the human person can remove this foundation. Even when people commit the worst sins and crimes or suffer diminished physical and spiritual capacities, they retain human dignity.
While this Christian teaching about the permanent character of human dignity is often mentioned and acknowledged by informed Christians, rarely do Christians hear that human dignity is also a goal or an achievement. Given the foundation of human dignity and the reality of sin, it logically follows that all will have to strive and strain to reach their ultimate goal, communion with God. Christians continuously achieve their dignity by seeking the truth, resisting sin, practising virtue and repenting when they succumb to temptation. In other words, dignity is not only a permanent possession. There is a sense in which dignity is appropriated over a lifetime of living according to the fullness of truth. Saint Leo the Great’s famous Christmas sermon states this point in a memorable way. Quote: „Christian, recognize your dignity and now that you share in God’s own nature do not return by sin to your former base condition.”3 It is significant that this quotation stands as the first sentence in the section on morality in the Catechism of the Catholic Church. It immediately directs attention to the necessity of achieving human dignity by living without sin. Vatican II’s pastoral constitution on the Church in the modern world says that: „…man achieves [the dignity to which he is called] when emancipating himself from all captivity to passion, he pursues his goal in a spontaneous choice of what is good, and procures for himself through effective and skilful action, apt means to that end. Since man’s freedom has been damaged by sin, only by the help of God’s grace can he bring such a relationship with God to full flower.”4
Human dignity as the goal of freedom
Now we have come to understand that human dignity is not only a permanent asset, but also a goal or an achievement, we also understand that dignity is related to morality. Only in making moral choices and acting accordingly can man achieve his full dignity. Freedom of conscience is required for every individual to achieve his dignity. But it does not follow that conscience is something individually subjective, this would be a reversion of the order of things. Objective morality cannot be subject to individual conscience, but individual conscience rather is subject to objective morality. If morality is subjectified, freedom of conscience becomes problematic, since someone may well deem something right according to subjective individual moral standards, that is objectively a moral wrong. The only way to prevent this problem is to define individual conscience in relation to objective morality or natural law, and the Church has traditionally done exactly that. This is echoed in Gaudium et Spes: „In the depths of his conscience, man detects a law which he does not impose upon himself, but which holds him to obedience. Always summoning him to love good and avoid evil, the voice of conscience when necessary speaks to his heart: do this, shun that. For man has in his heart a law written by God; to obey it is the very dignity of man; according to it he will be judged. [Cf. Rom. 2:15-16.] Conscience is the most secret core and sanctuary of a man. There he is alone with God, Whose voice echoes in his depths. [Cf. Pius XII, March 23, 1952: AAS (1952), p. 271] In a wonderful manner conscience reveals that law which is fulfilled by love of God and neighbor.”5 The Church thus identifies the contents or rather the substance of conscience as natural law, and the dignity of man as living in accordance to this law. The Christian definition of freedom per se is also closely related to conscience, as opposed to the liberal, humanist understanding of freedom. Liberalism holds that the freedom of one ends where the freedom of the other begins. This is a negative definition of freedom, which limits its moral aspect to the principle of not harming the other’s freedom, whereas Christianity holds to a positive definition of freedom. The Christian concept of freedom can be very concisely defined, in the words of the philosopher prof. em. Robert Spaemann: „What we call freedom is the ability to take responsibility.”6 In the liberal definition freedom is the freedom to do whatever one chooses, in the Christian definition freedom is the freedom to do good, to do what is right from a moral point of view. thus understands the freedom of man as the freedom to work conscientiously to attain the fullness of his dignity, a dignity that lies in living in accordance with objective morality or natural law.
BARKER, Sir Ernest, The Political Thought of Plato and Aristotle, Methuen, (London, 1906).
LEO I, „Sermo 1”, Nativitate Domini, (Holy See, 1957) 1-3; PL 54, 190-193.
PAUL VI, Gaudium et Spes, (Holy See, 1965).
MARITAIN, Jacques, Natural Law. Reflections on Theory and Practice, edited by William Sweet, (South Bend, Indiana, St. Augustine’s Press, 2001).
BRAGUE, Rémi et al. ed., „Naturrecht heute”, Internationale Katholische Zeitschrift Communio, 39. Jahrgang, März-April 2010 (Ostfildern, Schwabenverlag, 2010).
RATZINGER, Joseph Cardinal, Catechism of the Catholic Church, (Vatican, 1994) 1730-1802.
Cfr. Sir Ernest Barker, The Political Thought of Plato and Aristotle
, Methuen, (London, 1906).
Pope Leo I, „Sermo 1„, Nativitate Domini
, (Holy See, 2010) 1-3; PL 54, 190-193.
Pope Paul VI, Gaudium et Spes
, (Holy See, 1965).
Robert Spaemann, ‘Menschenwürde und menschliche Natur’, Internationale Katholische Zeitschrift Communio
, 39 (2010), 134-139.
JONATHAN VAN TONGEREN
– Studied International Relations and Russian Language and Culture at Groningen University (the Netherlands). Jonathan was International Secretary and member of the national board of PerspectieF (the youth organisation of the ChristianUnion party of the Netherlands) from November of 2006 until January of 2009. From July 2006 until July 2010 he was Secretary General of ECPYN, where he has remained active as a political advisor. Currently he is editor of the Christians in Politics Portal and he writes editorials and articles for different websites and magazines. | <urn:uuid:c4f2d836-9c1f-4b57-90d0-4231193d4002> | CC-MAIN-2022-33 | https://revistasferapoliticii.ro/sfera/161/art06-Tongeren.php | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.938431 | 2,262 | 2.546875 | 3 |
Rainbows are (literally) in the eye of the beholder
Magical phenomena are even cooler when you understand the science behind them.
Rainbows are perhaps the closest things we have to real magic. They appear like beautiful, ghostly apparitions in the sky just as the rain clears and the sun peeks out and gosh they make you feel happy, don’t they?
Like all seemingly magical things, rainbows get even better when you understand the science behind them. Let’s start with the basics:
What the heck is a rainbow, again?
Sunlight looks white (at least to human eyes). In reality, it’s composed of many different colors of light including all of the “rainbow” shades— red, orange, yellow, green, blue, indigo, and violet. This is the visible spectrum of light for humans.
Certain materials, like water, refract that light and allow it to separate into distinct wavelengths. The wavelength of light determines its color. Short waves wiggle back and forth really fast, whereas long waves meander. In the visible light spectrum, reds are longer while violets are shorter. All these different wavelengths combine to appear white to us, but if you can spread them out you can see the individual colors.
The water vapor in the air reflects, refracts, and disperses light all the time, but it’s usually doing so in so many different directions that you don’t see one distinct rainbow. That only occurs when you have a direct beam of light coming from a single direction, as opposed to the diffuse sunlight you get during daylight hours.
After a rainstorm there are more water droplets suspended in the air, and the ensuing sunlight often comes in rays from one direction. Picture an afternoon with a few rays of light breaking through clouds—that’s the perfect condition for a rainbow. You can also get them in the mist from a waterfall, though, or the spray of the ocean.
The arc forms because the rays of incoming light bounce around inside each individual bead of water in the air and refracts out. You can see it pretty clearly in this chart:
Because the light exits the water droplet at an angle of 42 degrees, you always see a rainbow whenever you’re standing 42 degrees below where the sunlight is coming from. Or, put another way, if you drew a line from your head to the rainbow, then back to the sun, that angle will always be 42 degrees. The sun always has to be behind you, though, because the light gets refracted back in the general direction it came from. You’ll never see a rainbow when you’re facing the sun.
From wherever you’re standing, it looks like the rainbow actually exists in some physical form. Maybe it’s perched on a hilltop or stretching across the ocean horizon. Either way, it’s not actually wherever you think it is. If you saw a person facing away from you, seemingly standing beneath a rainbow, that person isn’t seeing the rainbow above them—they’re seeing it almost exactly the way you are, just farther off into the distance. Everyone is seeing it at that same 42-degree angle.
There are more colors in the rainbow than the “rainbow colors”
What we call the “visible spectrum” of light would more accurately be called the “visible to humans spectrum.” Our eyes can pick up wavelengths between 390 and 700 nanometers because we have specialized cells called cones on the backs of our eyeballs that can interpret those wavelengths as particular colors (reminder: red is at the longer end, while violet is the shortest).
But it’s not just the visible portion of sunlight that gets refracted. Ultraviolet light (shorter than violet) and infrared (longer than red) are both also refracted to some degree, we just can’t see them because our eyes don’t pick them up. Some snakes can see infrared light, though, so the rainbow would have an extra band past the red edge to them. Butterflies and spiders, along with other insects and many birds, can see ultraviolet light, so they’d also get a bonus band beyond the violet bit of the rainbow.
Dogs and cats, together with most other mammals apart from primates, all just see less of the rainbow. They don’t have trichromatic color vision the way humans do, so they only see bits of the visible spectrum. Primates almost all have three types of cone cells, each specializing in a certain region of the visible light, and together they allow us to see all colors to some degree. Most other mammals only have two types of cones, and so see fewer colors. Many humans who are color blind have a similar problem—one or more of their cone types doesn’t work properly, so they don’t see certain portions of the spectrum very well. (There are other types of color blindness, but missing cones is the most common.)
You might not even see the same rainbow as another human
A few lucky humans are born with an extra cone cell that seems to allow them to see more colors within the visible spectrum. It’s hard to talk about these colors because we literally don’t have names for them, but we think some other animals like mantis shrimps can also see more colors within the rainbow.
There’s also a somewhat controversial idea that some cultures can actually discern more shades of color. The Himba of northern Namibia, for example, have many more words for green that English speakers do, and the Himba can differentiate between greens that look to outsiders like exactly the same color. One theory posits that it’s because the Himba have words for those shades that they can learn to tell the difference. Critics say the Himba can just naturally see the difference, and therefore have names for the shades.1
Similarly, Russian speakers can better tell shades of blue apart than English speakers can, and Russian has two categories for blue—one light, one dark—instead of one. English obviously has many words for blue shades, but we still classify them under a single umbrella. Russian separates them.
All this means that, depending on the language you speak, you might see a rainbow differently from a person standing right next to you. Our eyes may physically perceive the same wavelengths of light, but if your brain isn’t processing those rays the same, you’ll “see” different colors. Color is mostly in your brain—not your eyes.
In 2015 Business Insider published an article, which itself is based on a Radiolab episode, that seems to have popularized a story originally told in a BBC documentary about the Himba, claiming that because the tribe doesn’t have words that distinguish green and blue that they literally could not tell a blue square from a green one. The documentary misrepresented the research. The Himba can, of course, see blue—they’re just slower to identify the blue square than English speakers. The point still holds that color perception and language are related, but it’s not like some people just can’t see blue at all because they don’t have a word for it. You can read more about that here). ↩︎ | <urn:uuid:517fe0e4-344b-421a-9f7b-334cd4fe7a46> | CC-MAIN-2022-33 | https://www.popsci.com/why-rainbows-look-like/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.939706 | 1,535 | 3.1875 | 3 |
Discover what a change of paradigm can do for your understanding.
It brings clarity, removes confusion, strengthens faith, gives confidence in Scripture and the God who gave it. Questions like can we trust the Scriptures? What do we do with the passages we cannot understand and what do we do with apparent contradictions? This book answers many of these questions.
Book Details : Missing Lenses
Language : English
Paperback : 485 pages
ISBN-13 : 978-1729326206
Dimensions : 15.24 x 2.79 x 22.86 cm
Dr. Florence Morgan Gillman,
University of San Diego, CA USA
“Missing Lenses offers non-specialist biblical readers a concisely written, yet amazingly informative text from an evangelical, Reformed perspective concerning a major issue in New Testament Studies: the recovery of the corporate, Hebraic backdrop undergirding earliest Christian thought. Serious Bible study participants from many traditions will enjoy engaging with this volume.”
Jerry from Chattanooga
Posted on Goodreads Amazing Grace
“Missing Lenses deserves a very wide reading—no, a very wide studying!—for its wealth of thorough information. Couldn’t put it down! Chiefly, I appreciate the completeness of Missing Lenses. It becomes more and more evident as one reads through the book that this has been a major goal of the work. The writing is from a humble stance, sometimes almost begging the reader to understand that there is no superiority of authorship when a major doctrine is presented from a “new” perspective. The “new” perspective is shown to be an old perspective that has been missed somewhere in the history of biblical interpretation, usually in missing the Hebrew background (context) of the doctrine or concept.
The book is divided into three parts. Part one recovers the Hebraic backdrop to Paul’s thought. It is here that Holland wants to correct four errors that have led the academy and the church astray. The first error is that the early church abandoned its Jewish heritage due to Gentile influx. The second error—often an overreaction to the first—is that first-century Jewish literature is the key to understanding the NT. Rather, the OT is the key to understanding the NT. The third error is that understanding Greek culture is the key to understanding the NT. No, while Greek language was used, the ideas are thoroughly Jewish. The fourth error is to miss the importance of context for understanding a word’s meaning. So what context is appropriate for understanding the NT? In contrast, Holland finds the answer in the storyline of the OT, particularly its expectation of a New Exodus through a new David.
Part two takes a deep dive into the concept of corporate solidarity. This section largely revolves around re-thinking Romans 5-8. The ideas in this section are many and complex, so adequate summary is impossible. However, the essence of Holland’s argument is that, building upon the New Exodus paradigm, “these passages should be read consistently from a corporate perspective first before making individual application” (p89). For example, as Israel was enslaved to Egypt, so all humanity is enslaved to Sin (Satan). As all Israel was baptized into Moses in the Exodus, the whole church was baptized into Jesus in his death and resurrection. Paul’s emphasis is less on individuals being mapped to Jesus’ experience of death and resurrection; rather, Jesus led the entire church—present and future—through the waters of death and new life, and individuals who believe join that community. This is what Paul means in Romans 6. The passage is not about the individual and their baptism in water, but the rebirth of church in the New Exodus from slavery to Sin. Humans have been in a covenant with death, and only death itself will free them from it. This shift from individual to community results in a radical re-reading of Romans and numerous striking insights along the way.
While the New Exodus changes how we think about community and the individual, part three develops how it affects how we think of salvation. The New Exodus paradigm affects how we think about righteousness, justification, atonement and more. For Holland, Christ’s death should be primarily read through the Passover lens. That is, Christ’s work is fundamentally not an atonement for sin but a redemption from slavery. Justification, then, is less a law-court or accounting image; it is about deliverance and acceptance. Theories of the atonement and debates about justification have gone astray when they neglect the New Exodus background of the NT.
A PROFOUND RE-THINKING OF MAJOR BIBLICAL CONCEPTS
As to the ideas within Missing Lenses, I must admit that I am still processing. With some books, it is easy to make critiques. Perhaps the author is inconsistent or works from a radically different starting point. However, I agree so much with Holland’s foundations that critique is difficult, despite how radically different his exegesis is. Since his exegetical insights are so numerous and profound, it will take significant time to sift through them all.
Most Christians have likely encountered the idea that we moderns are far more individualistic than our biblical forefathers. Many, too, have been told of the importance of the New Exodus theme in the OT. However, no one more than Holland has allowed these insights to radically reshape the interpretation of scripture with such fruitful results. | <urn:uuid:a2219104-522b-4253-b148-f3571724f28c> | CC-MAIN-2022-33 | https://www.apiarypublishing.com/product/missing-lenses/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.940106 | 1,305 | 1.992188 | 2 |
Please study the first page of vocabulary of chapter 1, the second page of vocabulary of chapter 1 and the new words we introduced in class. Please also learn the numbers from 1 - 69 which you can also find on the second page of chapter 1. You can also listen to the vocabulary and the numbers on the "Français Interactif" website by clicking here.
Please study the vocabulary of chapter 0 and the numbers from 1 - 20 in chapter 1 page 19.
To help you memorize the new words and expressions you can use this flashcard set on Quizlet by clicking here and/or the Français Interactif site where you can listen to and repeat the words by clicking here and here (scroll down until you see the numbers).
|Bellingham Language School| | <urn:uuid:27043a29-e0f7-4a81-805b-98a98be883ef> | CC-MAIN-2022-33 | http://bellinghamlanguageschool.weebly.com/french-for-beginners-1/archives/04-2017 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.867753 | 179 | 3.46875 | 3 |
The presidents of the United States and Cuba, Barack Obama and Raúl Castro, met on Saturday at the Summit of the Americas, the first public ice-breaking between the two countries’ governments. For the first time in five and a half decades, enmity between Washington and Havana gave way to fresh hope for better ties. That in itself is important considering the severe crises between U.S. administrations (especially those of Kennedy and Nixon in the 1960s and ’70s) and the former government of Fidel Castro (the president’s brother). At the height of the Cold War, the close relations between the Soviet Union and Cuba made the latter both an outpost not far from the shores of Florida and the Soviet representative in the developing world – for example, in Angola. This tense situation almost led to World War III with the Cuban Missile Crisis of October 1962.
- Cubans Welcome Historic Castro-Obama Meeting, Hope for Swift Results
- Obama, Castro Meet for Historic Sit-down
- Beginning of the American Spring
The current thaw in relations reflects an understanding in Washington of the need to break with convention, one that had become fixed as the decades passed and circumstances changed. The Cold War ended a quarter of a century ago. The elderly Fidel Castro retired and is not stopping Raúl from moving closer to Obama. The traditional concern in Washington over its “backyard” – Latin America – which began nearly 200 years ago with the Monroe Doctrine, has not been canceled. But it has been updated, in keeping with the new situation on the continent and worldwide. This is also a political fact: Many Cuban refugees and immigrants live in the United States and impact its policies and elections – especially in Florida, which could decide the future of the presidency.
It is clear that the Nobel Peace Prize, which Obama was surprisingly awarded before he had even finished his first year in office, hangs around his neck like a millstone, waiting to become a legacy. Obama has been unable to move humanity closer to nuclear disarmament – as had been his hope – but he has sought to reduce U.S. military involvement overseas, and to avoid entanglements that are not widely supported by the U.S. public. Despite the haughty remarks of his Republican opponents, that’s one of the main reasons for his diplomatic move regarding Iran.
In fact, two of the idols of the American right, President Ronald Reagan and British Prime Minister Margaret Thatcher, found a partner for practical understandings in Soviet leader Mikhail Gorbachev. Obama found such a partner in Raúl Castro, and it looks like he hopes Iranian President Hassan Rohani is cut from the same cloth (with the consent of his own Fidel – Ayatollah Ali Khamenei). The U.S. president deserves our support and good wishes. | <urn:uuid:2e45a6bb-4800-44a8-aa4c-bcbfc433ef6f> | CC-MAIN-2022-33 | https://www.haaretz.com/opinion/2015-04-13/ty-article/between-cuba-and-iran/0000017f-e129-d7b2-a77f-e32f43320000 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.969493 | 576 | 2.8125 | 3 |
Items used in this project
Software apps and online services
Almost all Hobbyist and Makers dream about owning a Oscilloscope but due to huge prices we could not afford it. So why not make your own?
I have created a Hand Held Oscilloscope which can be used as a wearable to measure voltages with probes attached to your fingers.
1 / 2
Demo Demo Video How It Works
It uses nRF5340's inbuilt ADC to read Voltage. ADC means Analog to Digital Converter. It measures the analog voltage signal and converts it into Digital Bits in range of 0 to 1023.
It then uses LVGL Display Library from Zephyr OS to plot that data on the Adafruit Display using Charts.
Adafruit TFT Dislpay
Adafruit TFT DislpayHow I Made It:
- First I had setup the nRF5340 with Zephyr OS and all its dependencies like west.
- Then Installed the nRF Toolchain.
- Then tested out sample code for blinky and ncs-display.
- Then worked on reading values from Potentiometer and PWM Signals generated from Arduino
The Main Parts were the Body Case and Wiring the Cables
- The Body was 3D Printed and Sketched by me using Fusion360, Here is the STL Files
1 / 2 • 3D Printed
- Then the Jumper Cables were Attached to nRF5340 by soldering Headers to Remaining Analog and Ground Pins as All header pins were occupied by Display Shield.
- To use it as a Wearable, I have added place for adding Flaps on both sides of 3D Printed Case
- And to use with Fingers I have Printed Finger Holders
There are many improvements I am adding to it
- Adding Voltage StepDown Circuit to support greater voltages
- Adding Current Sensing by using Shunt Resistor Method
- Creating a GUI with touch for switching between features and voltages. | <urn:uuid:f0767eb2-2691-45c4-8f5d-3eec06c98fd0> | CC-MAIN-2022-33 | https://www.electromaker.io/project/view/nrf5340-oscilloscope-band | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.915274 | 446 | 2.484375 | 2 |
Healthy Advice: Counting those college calories
Summer is coming, and with it comes swimsuit season, shorts, T-shirts and more skin to show off. The advent of this skin-baring season puts a lot of pressure on students to slim down, but losing weight — in fact, simply eating healthy — isn’t easy, particularly when so much temptation exists on campus.
College life introduces an element of freedom to individuals who had previously relied solely on the food provided at home or in school. Here, students have dining options everywhere they turn, whether it’s more formal restaurants like Eric’s in the Conrad N. Hilton College of Hotel and Restaurant Management, dollar burritos at Taco Bell in the University Center Satellite or even gorging on the endless supply of desserts in the dining hall during a particularly stressful week. Eating healthy isn’t always a top priority.
In the past few decades, the issue of eating healthily has gone past gaining the “freshman 15” and crossed into dangerous territory.
Phillip Sparling, professor of applied physiology at the Georgia Institute of Technology, discussed the rise of this new epidemic in his 2007 article, “Preventing Chronic Disease.” He said college campuses have seen a dramatic increase in the occurrence of obesity and obesity-related disorders including type 2 diabetes, hypertension and dyslipidemia. The American College Health Association’s National College Health Assessment found that three in 10 college students are either obese or overweight.
While tackling the issue of weight on a large scale is hindered by several complications, individuals can work to create a better lifestyle.
Biology junior Merlin Jacob says eating healthy isn’t impossible, and college campuses often encourage healthy eating and living.
“There are more opportunities to eat unhealthily on campus, but for me, the presence of the Rec Center makes me feel guilty. At home I’m not thinking about working out, whereas on campus I’m conscious about it,” she said.
UH has taken several steps to bring fresher and healthier food to its students, including the introduction of the Healthy for Life program.
“The Healthy for Life program is being implemented to help create a culture of wellness. It is designed to enable, educate and encourage our diners to make healthy choices,” said Caroline Sullivan, registered dietitian and UH Dining Services nutritionist.
The Healthy for Life program included the unveiling of the new Wellness Wall on Feb. 19 in Cougar Woods Dining Hall. The Wellness Wall includes Just4U nutrition messaging, which displays healthy menu items carefully selected by culinary experts. The wall also includes information on low-fat foods as well as vegetarian and vegan options.
Some other tools provided by the program include the UH Dining website and a mobile app that enables students to access the nutritional information for all dining options on campus, as well as the dietitian’s “Healthy Picks” to help students make educated food choices. In addition, UH also offers the Heart Healthy Lunch option, which includes healthy dessert options such as reduced fat oatmeal cookies and heart-healthy bread pudding.
So whether you’re trying to look good for that vacation to Cabo this summer or simply want to start leading a healthier lifestyle, explore your options and make educated decisions about what you put into your body.
Trisha Thacker is a biology junior and may be reached at [email protected] | <urn:uuid:44852537-77da-40b7-a516-4a74c0c2b44f> | CC-MAIN-2022-33 | https://thedailycougar.com/2013/04/08/healthy-advice-counting-those-college-calories/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.945242 | 723 | 2.28125 | 2 |
Among many other irrefutable truths, 3 Idiots made it clear that gatecrashing into a wedding is part of an engineering student’s life. Rancho, Farhan and Raju got an earful the next day, but, for the NIT Kurukshetra authorities, it seems, singling out one Rancho, one Farhan or one Raju was a mountainous task — because there were so many.
So, they put up a notice issuing a strong warning against such ‘unethical/immoral/unwanted/uncalled for’ activities.
(Use of plenty of adjectives makes things severe — or that’s what we like to believe!).
Or, the NIT may design QR-enabled invitation cards for the organisers — and then get invited. (Photo: Twitter)
Another Kurukshetra war has been narrowly averted. And until Vaisakha (the Hindu New Year), we don’t think there will be any big, fat Hindu weddings taking place in and around Kurukshetra (Haryana).
Bad days for engineering students.
Gatecrashing into weddings, in fact, is pretty cool — and not an Indian idea at all.
Remember how Michaele and her now-former husband Tareq Salahi earned international prominence as they gatecrashed Obama’s dinner in 2009, actually held in honour of then-PM Manmohan Singh? It was not a wedding though.
Yes, anything unruly carried out with absolute spunk is always hailed.
But these engineering students didn’t make the cut, clearly.
They must have gone in hordes, wearing a geeky look, which the hosts might have never seen before.
Or, they must have headed straight towards the food court, without beating around the bush.
Or, maybe the mole is inside their hostels. The mess people might have noticed that they have a surplus of food every day, no matter how little they are cooking.
If you load your plates like this, obviously you will be caught. (Photo: Screengrab/YouTube)
There are various possibilities. But one thing is for sure. Despite organising weddings in such close proximity to the NIT campus, these weddings are far from becoming tech-savvy. They don’t know that they can provide QR codes on invitation cards — scanning which will be the key to the wedding venue.
Another thing is also certain.
Be it an NIT (National Institute of Technology) or a private engineering college in a remote place which offers seats to students whose ranks are longer than their mobile phone numbers, the food quality has to be deplorable. | <urn:uuid:1203596f-f4ce-4d40-96e2-57ba233d8584> | CC-MAIN-2022-33 | https://www.dailyo.in/humour/nit-warns-students-gatecrashing-into-wedding-kurukshetra-haryana-29989 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.956445 | 558 | 1.609375 | 2 |
- Read our producer manual for North Texas irrigators and producer manual for South Texas irrigators that include all aspects of agricultural irrigation including economics, technologies, water quality, and crop-specific guidelines. You can also read the full research report from the Texas Water Resources Institute.
- Looking for current or historical aerial imagery of your property? Visit the Texas Natural Resources Information System (TNRIS).
- Interested in Agricultural Water Conservation Best Management Practices? Have a suggestion for an additional BMP? Please let us know!
- Additional information on Best Management Practices (BMPs), including Municipal, Wholesale, and Commercial/Institutional BMPs, can be found on the Water Conservation Advisory Council website.
- Ever wondered which major or minor aquifer underlies your property? Visit the TWDB Map Catalog page to find out.
- TAWC Solutions is intended to provide a simple web-based management decision tool and an ET (evapotranspiration) tool that can aid in improved irrigation management.
- Check out the Irrigation for Small Farms Manual.
External Resources in Texas
Texas A&M AgriLife includes teaching, research, extension education, laboratory, and forestry facilities throughout Texas. Through collaborations between the TAMU system and public and private entities, AgriLife is focused on protecting our environment, feeding our world, growing our economy, improving our health, and enriching our youth.
Water My Yard shows how a healthy landscape actually requires less water than you may think! The site provides irrigation recommendations for warm season turf grasses such as St. Augustine, Bermuda, Zoysia, and Buffalo. At this time data are only available for these cities: Allen, Bryan, College Station, Farmersville, Forney, Frisco, Garland, Irving, McKinney, Mesquite, Plano, Princeton, Richardson, Rockwall, Royse City, and Wylie.
The Texas Agricultural Irrigation Association (TAIA) brings members from the irrigation industry, research, education, and production agriculture together to work toward water conservation and improved profitability in irrigated agriculture. TAIA also awards an in-state scholarship for a full-time college student pursuing an agriculture major.
The Texas Alliance of Groundwater Districts (TAGD) was formed to further the purpose of groundwater conservation and protection activities. TAGD provides groundwater conservation districts (GCDs) the opportunity to exchange ideas and develop programs for the management, conservation, protection, and development of groundwater in Texas. Find your GCD.
The Texas State Soil and Water Conservation Board (TSSWCB) is the state agency that administers Texas' soil and water conservation law and coordinates conservation and nonpoint source pollution abatement programs throughout the State. Headquartered in Temple, Texas, the TSSWCB offers technical assistance to the state's 216 soil and water conservation districts. Which district serves you?
The Texas Water Resources Institute (TWRI) works to foster and communicate research and educational outreach programs focused on water and natural resources science and management issues in Texas and beyond. Read about how low pressure center pivot systems improve both energy and water use efficiency in "Status and Trends of Irrigated Agriculture in Texas".
Nationwide External Resources
The Irrigation Innovation Consortium (IIC) is a collaborative research effort to accelerate the development and adoption of water and energy efficient irrigation technologies and practices through public-private partnerships. The Consortium has five founding university partners and eight founding industry partners. Initial participants are working to create a platform for other universities, federal agencies and the private sector to work together on the critical water challenges facing agriculture, municipalities and industry.
The Irrigation Association (IA) is the leading membership organization for irrigation equipment and system manufacturers, distributors, designers, consultants, and end users. The IA is committed to promoting efficient irrigation technologies, products, and services to ensure long-term sustainability of water resources for future generations.
The United States Department of Agriculture- Farm Service Agency's (USDA-FSA) mission is to equitably serve all farmers, ranchers, and agricultural partners through the delivery of effective, efficient agricultural programs for all Americans. The ultimate benefit will be improved economic viability for family farmers and ranchers. Visit FSA’s online knowledge base to find answers to commonly asked questions.
The United States Department of Agriculture-Natural Resource Conservation Service (USDA-NRCS) works with landowners through conservation planning and assistance to benefit the soil, water, air, plants, and animals for productive lands and healthy ecosystems. Find your local Texas field office.
The United States Department of Agriculture- Sustainable Agriculture Research & Education (USDA-SARE) program strives to advance innovations that improve profitability, stewardship, and quality of life by investing in groundbreaking research and education. The southern region includes Texas, and producers can find new ideas and proven technologies on this site. | <urn:uuid:e4191b3d-ba90-4728-bccb-200c98de20a7> | CC-MAIN-2022-33 | http://www.twdb.texas.gov/conservation/resources/agricultural-resources.asp | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.895623 | 1,007 | 2.5625 | 3 |
The beautiful Lumsdale valley in Derbyshire provides endless source material and inspiration for my open vessel forms. From the underground geological formations that shape the land to the trees above with their exposed roots and canopy of leaves; all are readily available for study and can be evidenced, often in a subtle way, through the building method, materials chosen and shape of my vessel forms.
These vessels can be used solely for decoration or, if glazed inside, for flowers and foliage. They are built in layers of different clays interspersed with coloured porcelain. The differing width bands of material echo the asymmetry of rocks, earth and trees; the choice of colours and tones suggest seasonal variations to the landscape. | <urn:uuid:ad692df4-2f83-4ef4-8761-7b95f255f683> | CC-MAIN-2022-33 | https://annbates.co.uk/gallery/gallery-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.933817 | 144 | 1.695313 | 2 |
The allure of Mount Everest is almost mythical. The world’s tallest mountain has captivated explorers and thrill seekers for time immemorial with its elusive summit, first reached in 1953 by Edmund Hillary and Tenzing Norgay. Its awe is matched only by its treachery, with over 250 deaths attributed to the beast; most recently, in April of this year, 18 climbers lost their lives in a single expedition after an earthquake sent an avalanche cascading down the mountain. Respect is foremost when climbing Everest; the slightest mistake on the part of the climber, or the slightest change in conditions, can spell your doom. This was the lesson in 1996, when eight experienced climbers lost their lives in a sudden tragic storm. It was, until last year, when an avalanche caused the deaths of 16 climbers, the single deadliest accident in Everest’s long and storied history, and it’s the story explored in Everest.
The story of the 1996 disaster has been well documented, both on page and on screen, in the 19 years since. Most famously, writer Jon Krakauer (played here by Michael Kelly) chronicled the experience in Into Thin Air, which painstakingly examined the events leading up to the loss of life, and which almost took his own. While Everest is by no means an adaptation of Krakauer’s book, the film works, in its own way, as a sort of companion piece, and clearly owes a debt of gratitude to the author’s recounting.
If the story is unknown to you, Rob Hall (Jason Clarke), New Zealand mountaineer and founder of Adventure Consultants, a company that led the obscenely rich on wild adventures, took a group of seasoned mountain climbers to experience the absolute zenith of planet earth. While on the journey back down, the expedition was hit by a massive storm, whose wind, rain, hail, and snow trapped the climbers near the top of the mountain with no hope for rescue or safety.
Everest tells the story mostly from Hall’s perspective and shies away from casting judgment in favor of a point by point recounting of the events leading to the disaster. Here is the biggest difference between this film and Into Thin Air. Krakauer’s book made no qualms in criticizing Hall’s decisions that fateful day, most notably his refusal to force one slow climber to descend before their window closed. While this event is covered in Everest, the film lets the viewer draw their own conclusions and, to a degree, paints Hall as a bit of a softy. His actions in the film are that of an emotional bleeding heart, who refused to deny a man the experience of a lifetime, standing on top of the world. The decision is almost admirable, brave even, if not for the loss of life.
Of course, that’s not the only mistake made on the mountain that day, and the tragic events are detailed with accuracy, despite feeling somewhat rushed. It’s a massive tale to tell within two hours, but director Baltasar Kormakur (2 Guns) does a fine job recounting it. Working from a script by William Nicholson (Unbroken, Gladiator) and Simon Beaufoy (127 Hours, Slumdog Millionaire), the director paints a stunning portrait of Hall and his ill-fated team and of the mountain herself.
The use of IMAX 3D technology puts the viewer right on the face of the mountain with all its dizzying slopes and drop offs made all too real. At times, I found myself overcome with vertigo, not dissimilar from the effects of Gravity several years ago. In fact, Everest is the first movie since Gravity whose use of IMAX 3D felt less like a gimmick and more like the right choice.
The film is further bolstered by its cast, who in addition to Clarke includes Josh Brolin, Sam Worthington, Jake Gyllenhaal, Keira Knightly, and Robin Wright. With so much star power, you’d think there would be some competition among the cast, but all involved give reverence to the story, playing their roles with respect and grace. Knightly, especially, gives a particularly moving performance as Hall’s wife, Jan, despite her short screen time.
Everest is not a movie for everyone; many will surely be tested with the relatively slow moving first and second acts and it’s not difficult to see where some might be bored with the snail pace leading to the finale. And despite the film’s overall enjoyability and beauty, the parts of the story that were omitted in favor of Hall’s perspective could have served the film in terms of tension and emotion. In this way, I wish Everest had borrowed more from Into Thin Air and focused more on the expedition as a whole. Still, as a remembrance of Hall, the film works well enough, and is good despite its faults.
Though far from the best movie of the year, Everest is a welcome take on the disaster genre and a much needed positive cap on a mostly unremarkable last few months of movies. While I doubt it will win any awards (well, maybe cinematography and other technical achievements) Everest is more than a movie to watch simply because it’s there. In the end, it’s a film about passion and the human desire to push limits and experience to the absolute edges.
Everest is in theaters now. | <urn:uuid:35d0796c-1a69-4c07-b325-c21f72c786a5> | CC-MAIN-2022-33 | https://glidemagazine.com/148439/everest-stunning-tribute-ill-fated-expedition-movie-review/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.964302 | 1,133 | 2.0625 | 2 |
There’s reason to be on edge as more news pours in about volatility in the the U.S. real estate market, with some especially sour news on the housing starts front. But a little analysis paints a more reassuring picture.
According to the National Association of Homebuilders, nationwide housing starts fell by 9.3% in June, and building permits slid by 4.3%.
Market observers were taken aback by the report, seeing a big slide in housing starts as incompatible with a housing environment offering relatively low mortgage rates and tight inventories — which both should trigger higher housing start activity.
One reason for the downturn in home starts may have something to do with geography, which might make the news not be as bad as originally thought.
"The decrease was concentrated in the South, where starts fell 29.6%, while starts rose in the other three regions," says Dean Maki, an analyst at Barclays. "It is unclear what led to the sharp decline in housing starts in the South in June, but the rise in single-family permits in June and the increases in the NAHB homebuilders index in June and July suggest that starts will increase in the coming months."
A longer-term view softens the bad news even further, Maki says.
"It is also worth highlighting that housing starts rose an annualized 26.2% in the second quarter of 2014 after plunging in the first quarter due to adverse weather conditions, so residential investment is still likely to make a positive contribution to the second quarter real GDP growth, despite the weakness in June."
NAHB officials agree with the sentiment that the housing market will bounce back, as bad as the June numbers appeared to be.
"A modest 2.6% increase in single-family permits falls in line with the general optimism that we are hearing from our builders," says Kevin Kelly, chairman of the NAHB.
"Take away the South and nationwide housing starts would have been in positive territory this month," adds David Crowe, NAHB’s chief economist. "This sharp regional decline could be due in part to lots and labor shortages, which are particularly acute in that part of the country. However, the general direction of housing production is trending upward, and we expect 2014 to be a positive year."
Another positive benchmark is an apparent bottoming out in foreclosures, which fell by 2% in June, the lowest level since 2006 before the housing bubble burst.
Foreclosures are also down by 16% from last year. From a foreclosure point of view, things really seem to be getting back to normal.
"Nationwide foreclosure activity in June reached an important milestone, dropping to levels not seen since before the housing price bubble burst in August 2006," said Daren Blomquist, vice president at RealtyTrac. "Over the next six to nine months nationwide foreclosure numbers should start to flatline at consistent historically normal levels.
"There continue to be concerning trends in some states and local markets that clearly indicate those markets are not completely out of the woods when it comes to the lingering foreclosure problem left over from the housing bust," Blomquist adds. "While it’s important that any remaining foreclosure infection is addressed promptly to keep it from festering, foreclosures are no longer a widespread contagion threatening to derail the housing market’s return to full health."
This article was republished with permission from TheStreet. | <urn:uuid:e3b4c5f1-96e0-41c5-a25d-4beb5e115691> | CC-MAIN-2022-33 | https://www.nuwireinvestor.com/housing-starts-down-93-in-june/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.970653 | 703 | 1.59375 | 2 |
Everyone ought to experience the wonder of Niagara Falls at least once in their life. But, between crossing the border into one other country and deciding which activities to do, visiting Niagara Falls requires a bit of advanced planning.
Earlier than you head North, read up on everything that you must know about going to Niagara Falls.
What’s Niagara Falls?
Niagara Falls refers to the three totally different waterfalls which reside on the border of Ontario and New York. Many vacationers make the mistake of believing Niagara Falls is a single waterfall.
When visiting Niagara Falls, you’ll have the chance to see Horseshoe Falls, the American Falls, and the Bridal Veil Falls. Horseshoe Falls is the biggest of the three and about 90% of the Niagara River runs over this waterfall.
The history of the falls dates back to the early 1600s, with a number of European eyewitness accounts and documentation. As a result of falls’ immense beauty and hydropower capabilities, it grew to become a prime tourist destination and supply of reliable energy.
When to Visit Niagara Falls
Irrespective of once you resolve to go to Niagara Falls, you’ll get wet due to the sheer power of the falls. With this in mind, many tourists choose to see Niagara Falls in the summer when the temperatures are warmer. That said, this peak season leads to incredible crowding of the falls and activities, as well as higher hotel and rental automotive rates.
Should you don’t mind being somewhat chilly, consider visiting Niagara Falls in the spring or fall. You’ll expertise fewer crowds as school continues to be in session and most visitors would rather stay dry. Or, when you’re a true adventurer, check out Niagara Falls within the winter for jaw-dropping icicles.
American vs. Canadian Side
A common concern with visiting Niagara Falls is figuring out which side of the border to experience. Both sides of the falls boast quite a lot of activities, views, and attractions.
Most would agree the Canadian side offers far better views of the falls, while the American side is house to Niagara Falls State Park.
Fortuitously, you possibly can go to both sides of the border in a single day via Rainbow Bridge. This bridge connects the two nations and guests can cross by foot or by car. When you plan to stroll over the bridge, you’ll pay a $1.00 payment when leaving Canada. Those driving over the bridge pays $3.75 U.S. or $4.75 CAD spherical-trip.
If you are using a rental automotive, be sure to double check the rental company’s policy about crossing the border with their vehicle. Violating such a policy may lead to an surprising fine.
If you have the time, I like to recommend fitting each sides of the border into your trip. Or, for those who’re spending the weekend, go to a country per day!
Niagara Falls Activities
There’s far more to do than see the falls from a far-off viewpoint. While exploring Niagara Falls, check out these sights and activities.
Over on the Canadian side of the border, you’ll not only have unbelievable views of the falls, but in addition an abundance of things to do throughout your visit.
When visiting Niagara Falls, it’s important to go on a ship tour operated by Hornblower Cruises. On these boat excursions, you’ll stand up close and personal with the Niagara River, American Falls, Bridal Veil Falls, and Horseshoe Falls for unbelievable views. And sure, you’ll get wet! However don’t fear, they provide free ponchos.
Take a ride on Canada’s largest remark wheel, just down the road at Clifton Hill.
Skylon Tower gives indoor and out of doors statement opportunities for these seeking to get a special view of the falls. Inside, you’ll find a multitude of shopping, eating, and leisure options, too.
If you loved this post and you would want to receive more information about Zoom Tours Niagara Falls kindly visit our site. | <urn:uuid:845e4394-9b38-4da4-ab45-6da5682a8f55> | CC-MAIN-2022-33 | https://chooseniagara.com/tag/niagara-falls-tour-from-toronto/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.920474 | 878 | 1.898438 | 2 |
An inquiry opens on Tuesday into whether the UK Government misled parliament on the threat posed by Iraq, as Washington comes under fresh attack for allegedly manipulating evidence.
The threat posed by WMD was the main reason cited for war
In London, parliament's Foreign Affairs Select Committee will focus particular attention on British Government claims that Iraq had the capacity to launch a strike using weapons of mass destruction (WMDs) within 45 minutes.
Since the war was officially declared over, no such weapons have been located - although their alleged existence was a key reason cited by the US President George Bush and UK Prime Minister Tony Blair for going to war.
Watch the Foreign Affairs Committee inquiry live here at 1000 BST
In Washington, Congress is to open inquiries this week into whether the government misread or inflated threats posed by Iraq before going to war.
Such a finding is seen as having the potential to embarrass President Bush.
On Monday, a senior member of the US Senate fuelled the debate with fresh allegations.
Senator Carl Levin said he had evidence that the Central Intelligence Agency (CIA) deliberately withheld crucial information from the UN arms inspectors deployed to Iraq before the war to find evidence of banned weapons.
Mr Levin - the top Democrat on the Senate Armed Services Committee, which is reviewing the information - told reporters that if the public had known that information about alleged top weapons sites was not being shared, there would have been "greater public demand that the inspection process continue".
"Why did the CIA say that they had provided detailed information to the UN inspectors on all of the high and medium suspect sites with the UN, when they had not? Did the CIA act in this way in
order not to undermine administration policy? Was there another explanation for this?" he asked.
While Mr Levin has already made clear that he believes intelligence material may have been misused to make the case for war, the BBC's Justin Webb in Washington says this is the first time he has backed it up with one specific, and serious, allegation.
Mr Bush defended his decision to go to war in a speech on Monday.
"This nation acted to a threat from the dictator of Iraq. Now there are some who would like to rewrite history; revisionist historians is what I like to call them," the president said.
Formal probes rejected
Two former UK cabinet ministers who resigned in connection with the war against Iraq, Robin Cook and Clare Short, are due to give evidence to the committee, whose job is to assess the role played by the Foreign Office in the affair.
Both ministers were privy to confidential briefings given to the government before the war began.
Ms Short has already said she believes the prime minister had "duped" the UK into joining the war, while Mr Cook has highlighted the coalition's failure to locate chemical or biological weapons in Iraq.
This nation acted to a threat from the dictator of Iraq. Now there are some who would like to rewrite history
Both the prime minister and his director of communications, Alastair Campbell, have refused to appear before the committee, which takes evidence in public.
Downing Street has also rejected calls for a full public inquiry into its pre-war claims about Saddam Hussein's weapons capabilities.
Similarly in Washington, the Republican majority in the US Congress has rejected calls for a formal investigation, arguing that any such inquiry could harm the intelligence agencies.
The routine oversight work of the Intelligence and Armed Services committees would be enough to evaluate the Iraqi threat, Republicans say. | <urn:uuid:73ae3762-a01b-40b3-9612-f85225a125ba> | CC-MAIN-2022-33 | http://news.bbc.co.uk/2/hi/americas/2995794.stm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.972739 | 719 | 2 | 2 |
Teaching and learning may be taking place in some inner-city school districts, but how effective is it? Based on the growing number of Black boys who aren’t reaching graduation and success thereafter, it is not as impactful as it could be. This seems to be the case in Atlanta where parents and residents are on opposite sides of how impactful current Superintendent, Meria Carstarphen, has been.
Once again the world is watching. After the cheating scandal, will Atlanta fail Black children again?
The reality for Atlanta, like many urban school districts, is we have children suffering in classrooms. In particular, Black and brown children often experience a lot of changes in staff, leadership, and programs. Even with thriving charter schools and new models such as partner schools, traditional public schools operated by charter organizations, there is still a need for traditional public schools to succeed.
Children Suffer in Public Schools, Period!
The ongoing call for the current superintendent by the business community is developing a false sense of learning that isn’t consistent across the district. Too often, stakeholders get caught up in advocating for school district leaders and turn a blind eye to the real issues children face in public schools.
Black children aren’t suffering alone in public schools. Black teachers are,too. One of the key issues is that Black parents and students feel as if they don’t have teachers who are passionate about teaching. Before the recent runoff election, some communities had less than 100 people to vote. Some attribute the lack of voter turnout to the lack of parent and community engagement in Atlanta schools, especially schools on the westside that are facing major changes.
Many changes, including the collapse of traditional public schools, are forcing many tenured and seasoned teachers out of classrooms. Urban school districts face the following challenges with maintaining teachers:
1. Teacher salary and benefits
2. Teacher support in and out of the classroom
3. School culture
Recently featured on EdLanta was a local Black male educator, Marcus Harden. He spoke truth to the importance of teachers implementing self-care. Once a teacher is overworked, burned out, unappreciated and feels unsupported, teaching and learning is negatively impacted. Students will not reach their highest potential.
Funding Still Isn’t Equitable for Schools Serving Black Children!
Imagine this and facing the possibility of not having a job because schools are closing. Public traditional school systems don’t support charter schools as they say. Although various charter models result in students performing well in the classrooms, the school budgets are often limited and impact teacher salaries. On average, most teachers are working one to two additional jobsto make ends meet.
Additional funding would help strong school leaders to improve urban education. Too often, a large portion of the salary budget is diverted to people who aren’t even in the classroom, That’s the first thing that needs to change! We have to stop providing livable wages and higher salaries only to those in administrative or upper-level positions. This is one major reason why we can’t keep qualified teachers in the classroom and support staff in schools.
If the children can’t get to school because the bus drivers are on strike due to low wages, that’s a problem. If schools don’t have family engagement liaisons, social workers, and counselors, that’s a problem. If teachers are having to work two to three additional jobs just to make ends meet for their families, that’s a problem.
School boards and elected officials have to put forth effort and address the issues Black children are facing. Improving resources for social and human services, remediation and quality academic and administrative staff is a start. When I say invest, I am referencing improving support for teachers and students in schools. This support looks like elementary, middle and high schools having more than one counselor. Having a balance of male counselors in schools, especially for Black boys who are leading the subgroups in behavior and discipline infractions.
We need family engagement liaisons in schools to connect with parents and support effective learning at home. We need support for school remediation programs in the mornings, during lunch, and after school so that teachers can have opportunities to sustain themselves while doing the work needed to give Black children better educational outcomes.
Jason has worked in education for over 15 years as a teacher, blogger and community advocate. He speaks and writes primarily about the need to improve education for Black boys, particularly increasing the number of Black male educators in schools. In addition to blogging here at EdLanta, Jason is also a featured writer at Education Post. | <urn:uuid:a6ce6982-ff42-439d-a05c-29d47b6e292d> | CC-MAIN-2022-33 | https://edlanta.org/2019/12/another-decade-is-passing-and-black-children-are-still-suffering-in-public-schools/?shared=email&msg=fail | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.967699 | 951 | 2.46875 | 2 |
What You Need to Know About the Approach of Community Schools
The schools in the world today are so many and they are different. Most of them have a different approach to education. Most founders of different schools do not have an idea of how they should implement their school mission which should not be the case. There are several factors that you should look at before you set some goals to achieve in certain schools. If there is a lot that you should look at this website, it is the approach of community schools and what they are intending to do.
You should make sure that you know more about a community school and their approach before any other thing. If you make a point of coming up with a school then you must be aware of how it will be capable of changing the society or community. If you would like to create an environment that is safe and supportive then you have to set that as your mission. It is very important that you get to know some of the things that you can learn and take them in actions that can lead to a better society.
Despite that some people are learned and have the knowledge, they do not know how to put it into actions to better what they do. It is a wish for every person to see all that he or she has learned being put into actions so that the knowledge may help you for better. This has been a challenge especially for those who have gone to the big schools they can tell what has been happening for decades. It is crucial to know that you will be in a position to put in action the skills you have been able to learn before.
Some of the projects that you will be able to learn in school is the other factor that you are supposed to consider. You should learn how things are done there and therefore get to know how you will be in a position to carry your own projects. You should not get interested in anything that is not education wise because you will have a loss yourself. The other thing that you should is the guiding principles that should take you to where you are going. In school we tend to learn more about what we will become and not how we are right now and that is what you should embrace. | <urn:uuid:87bfcc63-5ec7-40d7-bfdf-2cb9f24451d0> | CC-MAIN-2022-33 | https://winnerstudy.net/short-course-on-services-covering-the-basics/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.987036 | 439 | 2.46875 | 2 |
How does this medication work? What will it do for me?
Polymyxin B sulfate - bacitracin zinc - gramicidin contains a combination of antibiotics used for the treatment of certain types of infections caused by bacteria. The topical ointment can be used to treat certain skin infections such as infected wounds, burns, skin grafts, boils, and acne. It can also be used to prevent catheter-related infections in people who receive hemodialysis. This medication works by killing the bacteria that cause these infections.
Your doctor may have suggested this medication for conditions other than those listed in these drug information articles. As well, some forms of this medication may not be used for all of the conditions discussed here. If you have not discussed this with your doctor or are not sure why you are taking this medication, speak to your doctor. Do not stop taking this medication without consulting your doctor.
Do not give this medication to anyone else, even if they have the same symptoms as you do. It can be harmful for people to take this medication if their doctor has not prescribed it.
What form(s) does this medication come in?
Each gram of ointment contains polymyxin B (as sulfate) 10,000 IU (international units), bacitracin zinc 500 IU and gramicidin 0.25 mg. Nonmedicinal ingredients: butylated hydroxytoluene, cocoa butter, cotton seed oil, olive oil, petrolatum, sodium pyruvate, and vitamin E (dl-alpha tocopheryl acetate).
How should I use this medication?
Apply the ointment 1 to 3 times a day over the affected area. Cover with a dressing or leave exposed as directed by your doctor. Do not use the ointment in the eyes.
Many things can affect the dose of medication that a person needs, such as body weight, other medical conditions, and other medications. If your doctor has recommended a dose different from the ones listed here, do not change the way that you are using the medication without consulting your doctor.
It is important to use this medication exactly as prescribed by your doctor. If you miss a dose, take it as soon as possible and continue with your regular schedule. If it is almost time for your next dose, skip the missed dose and continue with your regular dosing schedule. Do not take a double dose to make up for a missed one. If you are not sure what to do after missing a dose, contact your doctor or pharmacist for advice.
Store this medication at room temperature, and keep it out of the reach of children.
This medication is available under multiple brand names and/or in several different forms. Any specific brand name of this medication may not be available in all of the forms listed here. The forms available for the specific brand you have searched are listed under, "What form(s) does this medication come in?"
Do not dispose of medications in wastewater (e.g. down the sink or in the toilet) or in household garbage. Ask your pharmacist how to dispose of medications that are no longer needed or have expired.
Who should NOT take this medication?
Polymyxin B - bacitracin - gramicidin should not be used by anyone who is allergic to polymyxin B, bacitracin, gramicidin, or to any of the ingredients of the medication.
What side effects are possible with this medication?
Many medications can cause side effects. A side effect is an unwanted response to a medication when it is taken in normal doses. Side effects can be mild or severe, temporary or permanent. The side effects listed below are not experienced by everyone who takes this medication. If you are concerned about side effects, discuss the risks and benefits of this medication with your doctor.
The following side effects have been reported by at least 1% of people taking this medication. Many of these side effects can be managed, and some may go away on their own over time.
Contact your doctor if you experience these side effects and they are severe or bothersome. Your pharmacist may be able to advise you on managing side effects.
- irritation of the area where the ointment is applied
Stop taking the medication and seek immediate medical attention if any of the following occur:
- signs of a severe allergic reaction such as severe rash or hives; difficulty breathing; or swelling of the mouth, lips, tongue, or throat
Some people may experience side effects other than those listed. Check with your doctor if you notice any symptom that worries you while you are taking this medication.
Are there any other precautions or warnings for this medication?
Before you begin using a medication, be sure to inform your doctor of any medical conditions or allergies you may have, any medications you are taking, whether you are pregnant or breast-feeding, and any other significant facts about your health. These factors may affect how you should use this medication.
Overgrowth of organisms: Prolonged use of this medication may cause an overgrowth of organisms that this medication does not effectively kill. If your symptoms worsen or do not improve, call your doctor as soon as possible.
Pregnancy: It is not clear what effects polymyxin B - bacitracin zinc - gramicidin may have on the unborn baby when used by pregnant women. This medication should not be used during pregnancy unless the benefits outweigh the risks. If you become pregnant while taking this medication, contact your doctor as soon as possible.
Breast-feeding: It is not known if polymyxin B - bacitracin zinc - gramicidin passeHs into breast milk. If you are a breast-feeding mother and are taking this medication, it may affect your baby. Talk to your doctor about whether you should continue breast-feeding.
Seniors: The maximum dose should be reduced for seniors with decreased kidney function.
What other drugs could interact with this medication?
Tell your doctor or prescriber about all prescription, over-the-counter (non-prescription), and herbal medications that you are taking. Also tell them about any supplements you take. Since caffeine, alcohol, the nicotine from cigarettes, or street drugs can affect the action of many medications, you should let your prescriber know if you use them. Depending on your specific circumstances, your doctor may want you to:
- stop taking one of the medications,
- change one of the medications to another,
- change how you are taking one or both of the medications, or
- leave everything as is.
An interaction between two medications does not always mean that you must stop taking one of them. In many cases, interactions are intended or are managed by close monitoring. Speak to your doctor about how any drug interactions are being managed or should be managed.
All material copyright MediResource Inc. 1996 – 2022. Terms and conditions of use. The contents herein are for informational purposes only. Always seek the advice of your physician or other qualified health provider with any questions you may have regarding a medical condition. Source: www.medbroadcast.com/drug/getdrug/Polysporin-Triple-Antibiotic-Ointment | <urn:uuid:7cab6bf9-bd94-4d58-ad69-330de271387f> | CC-MAIN-2022-33 | https://www.medbroadcast.com/drug/getdrug/polysporin-triple-antibiotic-ointment | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.929541 | 1,504 | 1.703125 | 2 |
The surface of spinel LiMn2O4 was modified with Fe2O3 (1.0, 2.0, 3.0, 4.0, and 5.0 wt%) by a simple sol-gel method to improve its electrochemical performance at room temperature. Compared with bare LiMn2O4, surface modification improved cycling stability of the material. Among the surface-modified cathode materials, the 3.0- and 4.0-wt% surface-modified cathodes have lesser capacity loss than the others. While the bare LiMn2O4 showed 25.4 % capacity loss in 70 cycles at room temperature, 3.0 and 4.0 wt% of Fe2O3-modified LiMn2O4 only exhibited the capacity loss of 2.6 and 2.3 % in 70 cycles at room temperature, respectively. The structure and phase were identified with X-ray diffractometer along with the lattice constant calculated by a Win-Metric program. | <urn:uuid:fdd388fd-a6bf-43eb-94b6-b12dea71e66b> | CC-MAIN-2022-33 | https://avesis.kayseri.edu.tr/yayin/575276db-b679-43fe-8b8c-fc4bc4632a86/improvement-of-cycling-stability-of-limn2o4-cathode-by-fe2o3-surface-modification-for-li-ion-battery | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.926152 | 209 | 1.96875 | 2 |
Writing a story takes skill, time, and work ethic. Here are three more strategies to apply to your work in progress.
1. Gather verbs
Verbs are action words and action is story. This one is so simple but it can’t be overlooked. Figure out exactly how your characters do everything they do and use the word, the single most perfect word, that describes just what that is. Render each action succinctly and accurately.
There’s always more than one way to write a sentence. Get a book of clichés so you know what has already been used and scrape all of them out of your story. He’s chomping at the bit was a great sentence with an action verb at its core when first written a million years ago. Gronk’s fans loved it.
Use your thesaurus carefully. Every word listed as a potential synonym is also a potential drop into the language sinkhole. Open the page of any thesaurus and choose a word. How many of its attributed synonyms do you really know? If any poke awkwardly in your mouth, spit them out. Find another. The wrong word can turn a gripping mystery into a joke. If you don’t really know what the alternate word means or precisely how to use it, don’t.
Write the one sentence that provides the most sensory, physical but unique experience possible. The thrill your reader gets will make her turn the page, page after page. Write the next sentence just as well. The craft of writing is in the construction of words into sentences and those into story. Verbs are the most important kinds of words at your disposal. Scuttle, cringe, bustle, gawk, flounder, prickle, notch, chasten, scorch – we react at the sounds of these words. Understand every verb intimately and get lots of outstanding ones into your book.
You know what the director said: Lights, camera, action! Yes, another cliché. Gronk’s fans loved this one too.
2. Try out your acting chops
Nothing helps an author sense the drama and intrigue of her story better than reading it aloud. You shout, whisper, cry, jump, and cringe at the words on your page. You wipe away tears, laugh out loud, and snort in derision. You wish the protagonist had more common sense and the antagonist had some decency. You try accents, speed, volume, and you hear the poetry, the power, the flow. Words repeated repeatedly are exposed so you can delete them. (Got that, didn’t you?) You catch the words are that out place of and the rung words that you meant two right – the stupid things we all do that Spell-Check didn’t catch. (Got that too, didn’t you?)
Most importantly, you will hear how consistent your characters sound, whether or not they speak in their own vernacular or have borrowed another voice. You’ll sense awkward scene shifts and unintended changes in points of view. You’ll spot what’s missing in action and what’s excess verbiage. Reading out loud especially while gesturing points out problems and skill like nothing else. And I have to admit: it’s pretty funny to see my husband’s reactions when I’m so engaged. Even Gronk guffaws to hear me and he doesn’t speak English.
Read your story out loud and you’ll know the drama, humor, and success of your creation.
3. Give it time
Let it ferment for a while. Ever try making beer? Bathtub beer, as my son and daughter-in-law sometimes make, boutique beer as specialty breweries make, commercial beer like the name brand companies make – it all has to ferment or it isn’t beer, it’s dirty dish water. Coffee percolates. Stew simmers. Bread dough rises. Everything takes time while it gathers essence and establishes desirable qualities. (And the fragrances – ah, intoxicating.)
Writing is much the same. Write your story, edit, revise, rewrite, and then let it sit. For a month or so, shift your completed book to an unopened folder while you work on something else. Maybe you’ll try making beer.
Over the month you’ll forget a bit of the details. You’ll forget on exactly what page the lovers first made whoopee, what was the speed of the train wreck, who stashed the knife in the parlor. Then read your story again, beginning to end. It will have a fresh smell and you’ll detect aspects you didn’t observe before. Did you write the story you meant to write? Does the plot progress and excite? Did you end it as intended? Are the loose ends wrapped? Did the hero react according to character and in consideration of all she has learned? Is the story arc consistent and complete? Is there resolution to the original quandary? In this less familiar state, you’ll figure out what needs to be addressed further or deleted altogether. Like adding more hops to beer, salt to stew, sesame seeds to bread dough. Like realizing coffee doesn’t need raisins. Gronk figured this one out.
No point tasting the beer till it’s fully brewed. No point presenting your story till it’s truly done.
Ahhh, now that’s good stuff. | <urn:uuid:1436b37b-58e4-4c8c-b9a7-1a8cd7a81c55> | CC-MAIN-2022-33 | https://todaysauthor.com/2016/05/02/three-more-points-about-story-craft/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.941401 | 1,149 | 3 | 3 |
Government Revenues in Kyrgyzstan averaged 33820373.63 KGS Thousand from 1990 until 2022, reaching an all time high of 209936732.50 KGS Thousand in December of 2021 and a record low of 12432.40 KGS Thousand in December of 1990. This page provides the latest reported value for - Kyrgyzstan Government Revenues - plus previous releases, historical high and low, short-term forecast and long-term prediction, economic calendar, survey consensus and news. Kyrgyzstan Government Revenues - values, historical data and charts - was last updated on August of 2022.
Government Revenues in Kyrgyzstan is expected to be 161000000.00 KGS Thousand by the end of this quarter, according to Trading Economics global macro models and analysts expectations. In the long-term, the Kyrgyzstan Government Revenues is projected to trend around 161000000.00 KGS Thousand in 2023, according to our econometric models. | <urn:uuid:30146095-81da-4fb5-9dff-e8285c575cb4> | CC-MAIN-2022-33 | https://d3fy651gv2fhd3.cloudfront.net/kyrgyzstan/government-revenues | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.886032 | 206 | 1.710938 | 2 |
It looks like something out of a Flash Gordon movie or a feature of a Buck Rogers outer-space adventure. But no, the Citroen U55 Cityrama Currus bus is the stuff of fact and not science-fiction. It is also the stuff of the past: this hyper-futuristic double-decker bus was constructed by French coachbuilder Currus in 1950 for tour operator Groupe Cityrama. Cruising through the scenic boulevards of Paris, it served as a tour bus of the City of Love, where Parisian onlookers would routinely stare at its outrageous figure and fear that they had accidentally stepped through a time portal, or that an alien invasion was imminent.
Reportedly, the vehicle was built atop the chassis of a Citroen U55 truck. It is almost entirely covered in wrap-around glass, including the upper-deck roof, which would be slid away on a fine summer’s day. It has a pointed tip protruding from its forehead, the practical use of which is debatable at best. Its strikingly unorthodox design earned it a place in several movies of the era, though sadly none of them were of the sci-fi genre: it can be seen in Louis Malle’s 1960 comedy satire “Zazie Dans Le Métro,” and then in Gérard Oury’s 1965 comedy “Le Corniaud.”
Check out further images of the bus below, and feel intense jealousy for those who, 60 years ago, got the chance to ride in this space-age automobile. [Read more…] | <urn:uuid:336acfe3-b454-4148-a63c-a48b6f808e19> | CC-MAIN-2022-33 | https://www.thisblogrules.com/tag/capital/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.963491 | 331 | 1.710938 | 2 |
Below is the abstract for this study:
Self-help agencies (SHAs) are consumer-operated service organizations managed as participatory democracies involving members in all management tasks. Hierarchically organized board- and staff-run consumer-operated service programs (BSR-COSPs) are consumer managed, but they afford members less decision-making power. This study considered the relative effectiveness of SHAs and BSR-COSPs working jointly with community mental health agencies (CMHAs) and the role of organizational empowerment in reducing self-stigma.
Clients seeking CMHA services were assigned in separate randomized controlled trials to a trial of combined SHA and CMHA services versus regular CMHA services (N=505) or to a trial of combined BSR-COSP and CMHA services versus regular CMHA services (N=139). Self-stigma, organizational empowerment, and self-efficacy were assessed at baseline and eight months with the Attitudes Toward Persons With Mental Illness Scale, the Organizationally Mediated Empowerment Scale, and the Self-Efficacy Scale. Outcomes were evaluated with fully recursive path analysis models.
SHA-CMHA participants experienced greater positive change in self-stigma than CMHA-only participants, a result attributable to participation in the combined condition (b=1.20, p=.016) and increased organizational empowerment (b=.27, p=.003). BSR-COSP–CMHA participants experienced greater negative change in self-stigma than CMHA-only participants, a result attributable to participation in the combined service (b=−4.73, p=.031). In the SHA-CMHA trial, participants showed positive change in self-efficacy, whereas the change among BSR-COSP–CMHA participants was negative.
Differential organizational empowerment efforts in the SHA and BSR-COSP appeared to account for the differing outcomes. Members experienced reduced self-stigma and increases in self-efficacy when they were engaged in responsible roles.
Click here for the study. | <urn:uuid:4e907ea0-0672-48d9-824b-5d5babffb9a2> | CC-MAIN-2022-33 | https://power2u.org/self-stigma-and-empowerment-in-combined-cmha-and-consumer-run-services-two-controlled-trials/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.943739 | 436 | 1.617188 | 2 |
Last Updated on April 21, 2022 by Jody Halsted
October is Family History Month, and I am thrilled to partner with The Genealogy Center at Allen County Public Library and Visit Fort Wayne, Indiana to bring you tips to help you discover your family's history.
This episode of the podcast is sponsored by ancestry.com. Every family has a story, and ancestry.com has the largest collection of online family history records to help you discover yours. See what records you can find at familyrambling.com/familystory.
My guest is Curt Witcher, Director of Special Collections at the Allen County Public Library.
About The Genealogy Center in Fort Wayne
Located inside the Allen County Public Library in Fort Wayne, Indiana, The Genealogy Center is the second-largest family research collection in North America, behind the Family History Library in Salt Lake City, Utah. But The Genealogy Center is the largest collection in a public library.
“We have about 1.2 million physical items in the collection, but that's not all,” says Witcher. “We actually license every major genealogical database so if you're here, you not only have access to the 1.2 million physical items but you also have free access to all those major databases that you would find in different libraries across the country.”
The third part of the “trifecta,” as Witcher calls it, is the engaged and knowledeable staff. “With all of us, we have a couple of centuries of genealogical research experience, and we will get geeked out about helping people find their stories,” says Witcher. He says the staff are experts in matching people up with the right data to help them find their stories.
What You'll Find in The Genealogy Center
The goal of Fred Reynolds when he began The Genealogy Center was to provide “a place where people could find their stories.” While some items that were collected “BC” (“before computers”) has been digitized, much of the information hasn't made it online yet because it just isn't important enough for aggregators to invest in putting it online.
“I like to say we have the ‘best of both worlds,' ” says Witcher. “We still have hundreds of thousands of items on microfiche or microfilm. We have the legacy medium like print and microfilm, and print will never go away. There are thousands of books every year being published in paper, not online. So we have the best of both worlds.”
Everything at The Genealogy Center is free, except if you want to make a paper copy. You can even scan documents to a flash drive for free.
Databases like ancestry.com, newspapers.com and others that can become expensive to subscribe to are free at the Center. Plus, there are others that you likely haven't even heard of that can be helpful. “We really enjoy making those available because they can really help people out,” says Witcher. “We can bounce from ancestry.com to other databases to our book collection, all through the knowledge of the staff we have here.”
Genealogy Tips for Beginners
TV shows like “Who Do You Think You Are” make genealogy look easy (and very exciting). But, it can be a bit overwhelming, somewhat difficult, and even disappointing.
“I love these TV shows,” says Witcher, “because they get people excited about genealogy. But they pick particular stories that look easy, and you can't fit all of your research into the 47-minute or 16-minute show.”
So how should you begin your genealogical journey?
- Start with a question. Whether you want to know more about a paternal grandfather who was dead before you were born or want to know more about a cool last name in your family, it all starts with a question you want to answer about your family's history.
- Gather as much data as possible. Find all the stories and information that you can. And record the source where you found the information so you can find it again.
- Once you've gathered information, analyze it. Find what's pertinent. And see if you can find your next question.
- If you get stuck researching a distant relative, come back a generation or two. “I like to say ‘look around more,' ” says Witcher. “So maybe you found a census record and a vital record, and now you've identified the parents . And then you kind of roll around a little bit through the databases and you find a couple more vital records and maybe a few more census records and you have the names for the next generation.”
- If you feel like you've hit a “brick wall,” quit focusing on names and dates and focus on the stories. “So instead of doing that sort of laser focus, I'm just going to try to trace my way back to my first ancestor, the information. The ancillary or the supplemental information you can pick up as you're trying to find all the data for each generation will oftentimes be the sledgehammer that will break through that brick wall that you initially had when you were just on this sort of sprint to get back as far as you could,” says Witcher.
- “There's no magic, and it's a process,” says Witcher. “And if we don't do it perfectly, no one's going to die, the world's not going to end. It's okay to go back and retract your steps.”
How to Document and Store Family Research
- If you like using paper and aren't comfortable with technology, use paper. Just make sure it's not your only copy because floods and fires happen. Keep multiple paper copies or paper and digital copies, but don't keep them in the same place. Hand them out to relatives so if something happens, someone has a backup.
- Sometimes you need to pause on the gathering and preserve what you have gathered. Don't skip this step in the process so you don't lose what you've worked so hard finding.
- Genealogical data management programs such as Family Tree Maker (the most popular) have different features. Find one you like or use more than one. “I actually use three because I like to play around with everything,” says Witcher.
Other Services Offered at The Genealogy Center
Schedule a consultation with one of the genealogy librarians. It can be a telephone conversation, “or Zoom consultation where you could share your screen and you show us documents,” says Witcher. Call (260) 421-1225.
The Genealogy Center also began offering virtual programs during the pandemic and plans to continue these programs. Find schedules and resources at https://acpl.lib.in.us/genealogy.
Before a visit, Witcher suggests going to the website and looking around first. Witcher also recommends to “come here with a couple of questions, meaning I really would like to find something on this particular person, or I really like to work on this brick wall.” You can schedule a consultation ahead of time or ask for once when you're there.
Witcher adds, “Be prepared to enjoy yourself because it really is a very clean and comfortable space here in The Genealogy Center. And it's really a neat community. You will feel safe here. If you decide you need a culinary break, there are a lot of neat places in downtown to explore. So be prepared to have a good time.”
The Genealogy Center is open 9 a.m.-9 p.m. Monday-Thursday, 9 a.m.-6 p.m. Friday and Saturday and 12-5 p.m. Sunday. It's located at 900 Library Plaza in Fort Wayne, Indiana.
More Tips for Visiting Fort Wayne, Indiana
Fort Wayne is a terrific getaway and has plenty to keep everyone occupied while you dig into your research!
Here are 5 Ways to Have Fun in Fort Wayne | <urn:uuid:8ae0d786-b99c-457b-8880-c6182926c95e> | CC-MAIN-2022-33 | https://familyrambling.com/the-genealogy-center-fort-wayne-exploring-the-midwest/midwest_podcast/?shared=email&msg=fail | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.961882 | 1,694 | 1.789063 | 2 |
Blue Sky Net’s beginnings.
Incorporated in 2002, Blue Sky Economic Growth Corporation (BSEGC) was initially a sector driven economic development organization. Based on work plans developed by industry leaders in a number of economic pillars such as agriculture, mining, tourism, forestry etc., BSEGC Board members felt that approach was too vast to truly make a difference in economic development. In 2005, the Board of Directors passed a resolution that the mandate of the corporation would shift to technology development, because it became apparent that in order to succeed on a global playing field, all sectors needed the ability to connect their business and vision to the rest of the world through high speed access to the Internet, and also for social, education and health well being initiatives. Thus, Blue Sky Net became the lead initiative for the corporation.
Going back even further, in November 1998 the Mayors of North Bay, Sault Ste. Marie, Sudbury, Thunder Bay and Timmins met with the Ministry of Northern Development and Mines and interested regional telecommunications suppliers to determine how to facilitate the delivery of economical broadband to all communities in Northern Ontario. It was determined that telecommunications suppliers would require capital subsidies to build sustainable business cases for the deployment of Broadband infrastructure in the North. It was also determined that there needed to be regionally based technology development organizations who would gather technology requirements from the hundreds of communities in northern Ontario and act on their behalf to negotiate with technology providers, and the provincial and federal governments, to ensure that sustainable Broadband networks were constructed throughout the North.
Since the fall of 1998 significant progress has been made due to substantial Provincial and Federal government investments, which have assisted various private sector technology providers with Broadband deployment.
In April 2005 FedNor announced the availability of an additional $10 million in capital subsidies for Broadband deployment in Northern Ontario and in September 2005 selected four Regional Technology Development organizations to deliver their program: Knet, based in Sioux Lookout; NeoNet, based in Timmins; Muskoka Community Network, based in Huntsville; and Blue Sky Net, based in North Bay. Today, there are an additional two ICTN’s, with the NW Innovation Centre and The Sault Innovation Centre, both providing service to infill Broadband Connectivity.
Blue Sky Net recent history and moving forward.
Blue Sky Net projects have facilitated deployment of Broadband technologies to over 150 communities in the districts of Nipissing, Parry Sound, Sudbury East and the township of Muskoka Lakes. Phase 2 of BAIMAP is a pan-northern project which was developed on a GIS platform and identifies areas that are un-served or where service is less than the 5 megabits per second download standard as adopted by the CRTC at the time – The recent CRTC standard now being 50 megabits per second download.
As part of Phase 2 we developed a public portal which allows for public access to certain layers of the GIS which help determine services available for new land development, those looking to re-locate to the North and for business developments purposes for ISP’s looking to expand their services to Northern Ontario.
Blue Sky Net (BSN) offers its full suite of ICT services in the Nipissing District, Sudbury East, Manitoulin Island Districts and points in between. With regards to the Almaguin Highlands region in the District of Parry Sound, BSN offers its full suite of ICT services as far south as Burks Falls. For the geographic area between Burks Falls and Novar, Blue Sky Net offers selected services such as support for ICT projects that are more regional in scope such as municipal GIS initiatives and regional broadband deployment projects.
The primary functions of BSN are to facilitate enhancement of broadband access to unserved/underserved areas, develop and implement ICT applications and to offer training, education and awareness of technologies to surrounding communities. | <urn:uuid:72882776-8bb5-4fb1-a6e4-ad4c3a69f2f4> | CC-MAIN-2022-33 | https://blueskynet.ca/about-us/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.95663 | 800 | 1.914063 | 2 |
Exosomes have emerged as important mediators of intercellular communication. Although their modes of action have been elucidated, the molecular mechanisms underlying their secretion, sorting of molecules, uptake into recipient cells, and biological distribution in vivo remain elusive. Here, we present a novel system for quantifying secreted exosomes by introducing ectopic or CRISPR/Cas9-mediated knock-in of luciferase-fusion exosome markers such as CD63. This luciferase-based method makes it possible to measure exosomes secreted into the culture medium with high linearity and wide dynamic range in a high-throughput manner. We demonstrate that data obtained by luminescent quantification are well correlated with data obtained by conventional nanoparticle tracking analysis under multiple conditions. In addition, our system is capable of evaluating the recipient cells or tissues that take up exosomes, as well as visualizing exosomes in vivo. The proposed system represents a powerful tool for understanding the molecular mechanisms underlying exosome production, uptake, and long-term distribution.
Exosomes, 50–150-nm extracellular vesicles secreted by various types of cells, contain cell-derived biological molecules such as nucleic acids (DNA, mRNA, lncRNA, and miRNA), proteins, and lipids. Secreted exosomes are taken up into proximally or distally located cells and modulate biological functions within recipient cells1. Therefore, exosomes have recently attracted attention as an intercellular communication system. Under normal physiological conditions, they play pivotal roles in the regulation of stem cell maintenance2,3, tissue repair4, and immuno-surveillance5,6. In addition, exosomes are involved in cancer progression by preparing the tumor microenvironment and pre-metastatic niche.
Cancer cells secrete aberrantly large amounts of exosomes that contain different cargo molecules than those from normal cells, depending on malignant cancer phenotypes7,8,9,10; that is, cancer cells progress by altering the exosome quality (cargo variety) and quantity (level of production). Based on these differences between normal and cancer cells, liquid biopsies using exosomes for cancer diagnosis have advanced rapidly11,12,13. In addition, therapeutic strategies targeting cancer-derived exosomes would also be useful14. Although methods for removing circulating cancer-derived exosomes by extracorporeal hemofiltration or antibodies are currently under investigation15,16, to date no therapeutic medicines or strategies targeting exosome secretion have been developed17. This is largely because the lack of a high-throughput system for measuring exosomes makes it hard to elucidate the molecular mechanisms underlying their secretion or to test candidate inhibitors. Hence, high-throughput and high-precision exosome quantification systems will be indispensable for the development of clinical and biological exosome studies in the future.
Previously, various physico- or bio-chemical methods, strategies, and devices have been developed and adapted for the assessment of exosome quantity. Among them, ultracentrifugation (UC)-based methods have been commonly used in combination with subsequent quantification by nanoparticle tracking analysis (NTA) or immunoblotting. These conventional methods are useful for analyzing the amount of exosomes, but UC-based methods are time-consuming and their exosome recovery rates are low18. Although NTA enables one to quantitatively analyze not only the concentration but also the size distribution of exosomes, it does not allow measurement of multiple samples simultaneously, and comparisons of values obtained with different instrument settings and conditions must be performed with caution19. Biochemical techniques such as ELISA, AlphaLISA, and flow cytometry (FCM) also have been utilized for exosome quantification8,20,21,22,23. However, while these methods enable one to quantify specific populations of exosomes in both culture medium and body fluids without isolation, they require time-consuming pre-treatment of target samples or optimization of measurement conditions. In addition, although microfluidic devices such as ExoChip or nPLEX capable of quantifying exosomes from small amounts of sample without isolation have been recently developed24,25,26, they remain commercially unavailable or very expensive.
Given this situation, a sensitive, rapid, easy, and low-cost technique for exosome quantification is desired. In this study, we developed a cell-based high-throughput exosome quantification system by genetically labeling exosome markers such as CD63, CD9, and CD81 with high-intensity luciferase NanoLuc (Nluc)27. Using this system, the intensity of luciferase luminescence was well correlated with the number of exosomes in the cell culture medium. Furthermore, Nluc-labeled exosome-secreting cells and/or secreted exosomes could also be used to evaluate recipient cells that take up exosomes and to visualize the distribution of intact exosomes in vivo. Taken together, our results demonstrate that the novel luciferase–exosome system could be an effective tool for analyzing the molecular mechanisms underlying secretion, uptake, and long-term spatial behavior of exosomes.
Quantification of exosomes with Nluc-fused CD63
Tetraspanin CD63 has recently been used as a representative exosomal marker protein. To quantify cell-released exosomes by luminescence, we first attempted to label exosomes with Nluc by ectopically expressing Nluc-fused CD63 in HT29 and HCT116 cells (Fig. 1a). Luciferase activity was easily detectable in the culture medium of CD63Nluc-expressing cells, but not control cells (Fig. 1b). To determine whether the luminescence in the culture medium was derived from exosomes, we compared the luminescence intensities before and after ultracentrifugation and quantified CD63Nluc protein in isolated exosomes. Ultracentrifugation drastically reduced the intensity of luminescence in the culture medium (Fig. 1c), and CD63Nluc was detected only in exosomes derived from CD63Nluc-expressing cells (Fig. 1d and Supplementary Fig. 1). These data indicate that ectopically expressed CD63Nluc can label exosomes with Nluc. To determine whether the luminescence intensity of CD63Nluc-expressing cells provides a quantitative report of exosome number, we next investigated the relationship between reporter signal intensity and cell number or exosome number in the culture medium. When CD63Nluc-expressing cells were seeded at various densities, luminescence in the culture medium correlated closely with both cell and exosome numbers (Fig. 1e,f). Furthermore, we determined the absolute detection limit for exosome quantification using CD63Nluc-expressing cells. At a concentration of 105 particles/mL, the luminescence intensity of Nluc-labeled exosomes was higher than the background level. The regression line depicting the correlation between luminescence and exosome number was linear, in a statistically significant manner, at concentrations above 106 particles/mL (Fig. 1g). Furthermore, we investigated whether ectopic CD63Nluc expression influenced biological characteristics such as cell growth and exosome production. CD63Nluc was found to be localized in multivesicular bodies (MVBs) as endogenous CD63 (Supplementary Fig. 1). Ectopic expression of CD63Nluc did not show significant effects on cell growth and the number and size of exosomes secreted from CD63Nluc-expressing cells were almost equivalent to those from control cells (Supplementary Fig. 1). Taken together, these data suggest that CD63Nluc-expressing cells represent a useful tool for directly quantifying exosomes without purification.
Reliability of CD63Nluc-expressing cells in exosome quantification
For bioluminescent quantification of exosome number, luciferase activity should reflect alterations of exosome production with a high degree of accuracy. To determine the quantitative accuracy of CD63Nluc-expressing cells, we artificially controlled exosome production by genetic and pharmacological techniques. Because ALIX, an ESCRT-associated protein, participates in the formation of intraluminal vesicles (ILVs) at multivesicular bodies (MVBs)28,29, we first investigated whether CD63Nluc-expressing cells are applicable to detect ALIX-mediated exosome production (Fig. 2a). Nanotracking analysis (NTA) revealed that shRNA-mediated suppression of ALIX expression significantly decreased exosome production (Fig. 2b). Consistent with this, the luminescence in the culture medium was significantly lower in ALIX-suppressed cells than in control cells (Fig. 2c).
We next investigated whether CD63Nluc-expressing cells are useful to detect alteration of exosome biogenesis following drug treatment. Several groups have shown that bafilomycin A1, a V-ATPase inhibitor, enhances exosome production30,31,32,33. NTA confirmed that bafilomycin A1 prominently increased exosome production (Fig. 2d). Interestingly, luminescence in the culture medium increased at the same rate as the exosome number (Fig. 2d). In addition to these genetic and pharmacological effects, several environmental factors are also critical for exosome biogenesis and release. Here, we studied the relationship between bioluminescence in the culture medium and secreted exosome number in a hypoxic culture. NTA showed that exosome number decreased under hypoxia, when HIF1α was induced (Fig. 2e,f). Although the hypoxic effect on exosome secretion is dependent on cell types and experimental conditions in previous reports34,35,36,37, it is noteworthy that luminescence in the culture medium also decreased along with exosome number in this study (Fig. 2f). Collectively, these results indicate that CD63Nluc-expressing cells enable exact quantification of exosome production, as well as alteration of production by a variety of factors.
Quantification of exosomes in Nluc-labeled CD9 and CD81
Because exosomes consist of subpopulations that represent distinct biological characteristics and sizes38, it is necessary to select a proper marker protein for labeling exosomes with Nluc according to the target nanoparticle subset. Therefore, we evaluated whether exosome markers other than CD63, such as CD9 and CD81, could be utilized in Nluc-mediated exosome quantification. To achieve this end, we developed Nluc-fused CD9- and CD81-expressing cells (Fig. 3a). As with CD63Nluc-expressing cells, both CD9Nluc and CD81Nluc-expressing cells exhibited very high luciferase intensities (Fig. 3b). On the other hand, ectopic CD9Nluc or CD81Nluc expression did not show significant effects on the production of exosomes in the parental cells (Fig. 3c). As before, we confirmed that the luminescence was derived from exosomes by comparing luminescence intensities before and after ultracentrifugation (Supplementary Fig. 2). Furthermore, to determine whether CD9- and CD81Nluc-expressing cells quantitatively reflected exosome number as luminescence intensity, we investigated the correlation between reporter signal intensity and cell or exosome number in the culture medium. When CD9- or CD81Nluc-expressing cells were seeded at various cell numbers, the luminescence of the culture medium was closely correlated with the cell and exosome number (Fig. 3d,e). These data indicate that CD9 and CD81 can also be utilized as effective markers for quantifying exosomes in the Nluc-based detection system.
Generation of exosome-detectable cells by knocking Nluc into endogenous CD63
Although Nluc-fused CD63 expression was useful for quantifying exosomes with high sensitivity and high accuracy (Fig. 1) and did not show significant effects on cell growth or exosome production in HT29 and HCT116 cells (Supplementary Fig. 1), the tetraspanin CD63 is associated with multiple biological functions in addition to exosome production39,40. Therefore, it would desirable to avoid overexpression of CD63 when monitoring alterations in the rate of intrinsic exosome production. To this end, we next attempted to directly label the CD63 gene with Nluc using the CRISPR/Cas9 genome-editing system. To insert the Nluc gene sequence upstream of the 3′ terminal stop codon, we constructed a targeting vector and knock-in donor vector, and co-transfected both vectors into HCT116 cells (Fig. 4a). We selected some candidate clones by using luciferase activity as an indicator of Nluc knock-in, and obtained CD63Nluc knock-in (KI) cells (clone#17) after confirming the introduction of Nluc by PCR (Supplementary Fig. 3). Finally, we sequenced the CD63 gene in this clone and confirmed homozygotic Nluc insertion at the preterminal position (Supplementary Fig. 3). Expression of Nluc-labeled CD63 was detected in whole cells and isolated exosomes only in CD63Nluc-KI #17 cells (Fig. 4b). Nluc knock-in did not show significant effects on the localization of CD63 and the number and size of exosomes (Supplementary Fig. 3). As described above for CD63Nluc-expressing cells, we studied the relationship between reporter signal intensity and cell number or exosome number in the culture medium. Reporter signals in the culture medium were closely correlated with both cell and exosome numbers (Fig. 4c,d). Moreover, the curve depicting the correlation between luminescence and exosome number was linear in a statistically significant manner at concentrations above 106 particles/mL (Fig. 4e). Furthermore, to verify the reliability of CD63Nluc-KI #17 for exosome quantification, we monitored the alterations of exosome number and luminescence in the culture medium from cells treated with ALIX shRNA, bafilomycin A1, and hypoxia. Under all conditions, changes in the luminescence of the culture medium reflected the alterations in the exosome number (Fig. 4f). Taken together, these results suggest that knock-in of Nluc into CD63 provides a useful tool for quantifying exosomes.
Application of Nluc-labeled exosome–producing cells to cellular uptake analysis
Exosomes work as intercellular mediators only after they are incorporated into recipient cells. Therefore, it is important to quantitatively evaluate the uptake efficiency of exosomes. We speculated that Nluc-labeled exosomes or CD63Nluc-expressing cells would enable quantitative measurement of exosome uptake. First, we added a large amount of exosomes isolated from CD63Nluc-expressing cells to five different types of recipient cells, and measured the luminescence intensities in each cell type (Fig. 5a). Each recipient cell had a different luminescence intensity, with A549 human lung cancer cells exhibiting the most luminescent (Fig. 5b). Uptake assay systems involving the addition of labeled exosomes has been widely used to investigate the cellular uptake of exosomes. However, this system could yield non-physiological results because very high levels of exosome were added. Therefore, we next quantified the uptake efficiency of exosomes by culturing CD63Nluc-expressing cells with recipient cells (Fig. 5c). Although the luminescence intensities in recipient cells were lower overall, the co-culture system yielded a luminescence pattern nearly identical to that of the exosome addition system (Fig. 5d). Taken together, these data suggest that CD63Nluc-expressing cells or Nluc-labeled exosomes are suitable for quantitative analysis of exosome uptake.
Application of Nluc-labeled exosome–producing cells to long-term biodistribution analysis
Luciferase is widely exploited for in vivo imaging of cells, proteins, and molecules such as drugs. Therefore, we investigated whether cells secreting CD63Nluc-labeled exosomes are useful for analyzing the biodistribution of exosomes. Exosomes secreted from cells constantly circulate throughout the whole body via the blood. Therefore, we developed an experimental system that persistently releases exosomes in vivo: specifically, we subcutaneously implanted CD63Nluc-expressing cells encapsulated in a chamber ring with Matrigel into mice (Fig. 6a). Although the encapsulated cells never physically escape from the chamber ring, we labeled the CD63Nluc-expressing cells with mCherry to distinguish between exosome-derived and cell-derived luminescence (Fig. 6b and Supplementary Fig. 4). At 7 weeks after implantation, we tried to detect exosome-derived luminescence in each organ by intravenously or intraperitoneally injecting furimazine (Fig. 6a). After furimazine injection, the chamber ring emitted strong luminescence (Fig. 6c). These data indicate that the implanted chamber ring consistently supplied Nluc-labeled exosomes to the entire body for 7 weeks. In this persistent circulating exosome model, we observed intense luminescence in the stomach and intestine (Fig. 6d). Because the mCherry signal was not detected in these organs (Fig. 6d), we concluded that the luminescence was derived from homing exosomes. These data indicate that CD63Nluc-expressing cells are suitable for analysis of exosome biodistribution.
Luciferase is the most commonly biolumininescence reporter used for quantitative analysis when monitoring multiple biological phenomena such as promoter activity, cell viability, and protein–protein interactions in vitro, as well as tumorigenesis in vivo. Although firefly luciferase (Fluc) has traditionally been used in multiple types of biological analyses, smaller and brighter luciferases are also commonly used. Gaussia luciferase (Gluc), from the marine copepod Gaussia princeps, emits 100-fold higher luminescence in mammalian cells and is much smaller than Fluc (19.9 kDa vs. 61 kDa, making it the better choice for fusion proteins). However, Gluc is naturally secreted and emits a flash-type luminescence, and the signal drops rapidly41. By contrast, NanoLuc (Nluc), an engineered luciferase derived from the deep-sea shrimp Oplophorus, is a non-secreted protein that exhibits sustained signal duration. In addition, Nluc is 150-fold brighter and more stable under a range of temperatures, pH values, and detergent concentrations. Also, as with Gluc, Nluc is significantly smaller (19 kDa) in size than Fluc or Renilla luciferase (36 kDa)27. These properties of Nluc make it the most suitable luciferase for labeling of exosomes. Therefore, we developed a cell-based exosome quantification system using Nluc.
Compared to the UC-NTA method, our Nluc-based exosome measurement system has two main disadvantages: it cannot be used to obtain the size distribution of exosomes or to analyze biological samples such as serum or plasma. However, it is superior to the UC-NTA method from the standpoints of measurement sensitivity, accuracy, operability, operating time, throughput, and run cost. The measurement range of Nluc-labeled exosome-producing cells was 106–1011 particles/mL, whereas the recommended measurement range of NTA is 108–109 particles/mL19 (Figs 1g and 4e). Also, luminescence in the culture medium was linearly correlated with both cell number and exosome number in the range of 106–1011 particles/mL (Figs 1e,f, 3d,e and 4c,d). That is, Nluc-labeled exosome–producing cells give a 100-fold wider measurement range than NTA. It is noteworthy that measurements using Nluc-labeled exosome–producing cells do not require exosome isolation by UC, which leads to lower recovery of exosomes in samples18. We also investigated the recovery rate of exosomes following ultracentrifugation of samples derived from Nluc-labeled exosome–producing cells. Calculations based on luminescence intensities revealed that the rate of exosome collection by ultracentrifugation was approximately 20% (Supplementary Fig. 5). This implies that most of the exosomes in samples are lost during the ultracentrifugation or washing process. Furthermore, due to its simplified handling and the lack of a requirement for expensive reagents and instruments, exosome quantification using Nluc-labeled exosome–producing cells takes less than 15 minutes for acquisition of data. Overall, the Nluc-based quantification method has several technical advantages: (1) high sensitivity, (2) high accuracy, (3) high reproducibility, (4) ease of handling, (5) speed, and (6) low cost relative to conventional methods. In addition to these advantages, Nluc-based quantification permits detection of exosome-derived luminescence in small-culture scales, e.g., 96- or 384-well format. Therefore, this method would be suitable for high-throughput screening for exploring exosome-associated molecules or exosome-regulated compounds. Because cancer cell-derived exosomes are associated with metastasis, inhibition of exosome production represents a promising therapeutic strategy for cancer42,43.
Exosomes are not homogeneous vesicles, but instead consist of a variety of distinct subpopulations depending on size and cargo, including surface proteins, glycosylation, cargo molecules, and lipid composition44. Because each subpopulation has distinct biological functions, it is important to consider the heterogeneity of exosomes. Although CD63 is a useful marker for endosome-derived exosomes, some cells secrete subpopulations of exosomes that are devoid of CD6338,44,45. In addition, given that CD63 is present in microvesicles, it will be necessary to use other exosome markers in some cases. Therefore, we also investigated whether Nluc-labeling of CD9 or CD81 would enable quantification of exosomes. As with CD63, Nluc-labeled CD9- or CD81-expressing cells reported exosome number as luminescence intensity with high sensitive and accuracy (Fig. 3d,e). CD63Nluc expression was suitable for quantifying the exosomes in HT29 and HCT116 human colon cancer cells. However, we can employ additional adequate exosome markers such as CD9 and CD81 for use in other cell lines and target subpopulations.
Additionally, we should consider the unexpected and unwanted biological effects of overexpression of CD63, CD9, or CD81 in this exosomal quantification system. Although ectopic CD63 expression had no influence on exosome production or cell growth under our experimental conditions, tetraspanins are known to be involved in multiple biological functions39,40. Therefore, it would be desirable to conjugate Nluc to an exosome marker without overexpression. Accordingly, we directly inserted the Nluc sequence to the genomic locus of CD63 using CRISPR/Cas9-mediated knock-in. The intrinsic expression level of knock-in Nluc-labeled CD63 was sufficient for exosome quantification based on luminescence, although the sensitivity was insufficient to perform exosome uptake and biodistribution assay. Recently, a screen of a randomly mutated library identified the Nluc mutant ‘teLuc,’ which is about 6-fold brighter than the original Nluc46. If further development or improvement of luciferase or substrate enables detection of the weaker luminescence, the knock-in–mediated luciferase labeling strategy would permit not only quantification of exosome number but also the quantitative elucidation of exosome uptake or long-term biodistribution.
In addition to its function as counting devices, CD63Nluc-labeled exosome–producing cells and CD63Nluc-labeled exosomes could be used to evaluate the uptake efficiency of recipient cells or their biodistribution. Here, we quantitatively scored uptake efficiency by adding isolated Nluc-labeled exosomes to recipient cells or by co-culturing Nluc-labeled exosome–producing cells with recipient cells (Fig. 5). Until now, almost all exosome uptake assays have been performed by counting or measuring internalized labeled exosomes under fluorescence microscopy47, following conjugation of lipophilic dyes to isolated exosomes. However, lipophilic dyes such as PKH26, PKH67, and DiI, which label lipid-containing entities other than exosomes, produce false-positive signals. Additionally, conjugation of lipophilic dyes potentially disrupts the function of exosome surface proteins47,48 that are responsible for binding and subsequent uptake of exosomes. By contrast, cellular uptake assays using CD63Nluc-labeled exosome–producing cells or CD63Nluc-labeled exosomes accurately quantify the uptake efficiency of various recipient cells without requiring exosome isolation and/or labeling. Therefore, the Nluc-based assay would be more appropriate than conventional methods for quantitative assessment of exosome uptake.
We also used CD63Nluc-labeled exosome–producing cells to investigate the biodistribution of exosomes. Although exosomes have emerged as promising new biomarkers for diagnosis and prognosis of cancer, their potential use as drug delivery vehicles have also attracted attention over the years49. To monitor the short-term biodistribution of exosomes as drug carriers, a common method is injection of lipophilic dye-conjugated or genetically fluorescence-labeled exosomes into living animals50. This analytical approach may be reasonable for elucidating the in vivo dynamics of exosomal medicines, but we should not apply the resultant data to the dynamics of exosomes secreted from cells. This is because almost all cells, including cancer cells, persistently release exosomes into the extracellular space, and secreted exosomes constantly circulate through the body via the bloodstream. To improve the exosome supply system, we developed a novel exosome-releasing device by encapsulating CD63Nluc-labeled exosome producer cells in a chamber ring. Implantation of this exosome-releasing device revealed that HT29- and HCT116-derived exosomes preferentially accumulated in the stomach and intestine after a long period of time. Notably in this regard, we previously showed that Src-transformed mouse embryonic fibroblast (MEF)-derived exosomes are exclusively recruited into the lungs (Supplementary Fig. 4). In those experiments, we labeled MEF-derived exosomes expressing Src-Nluc but not CD63-Nluc, so these results are incomparable. However, the Nluc-labeled exosome–releasing chamber is a promising tool for analyzing exosome organotropism in living animals.
In summary, we showed here that Nluc-labeled exosome–producing cells represent a powerful approach for evaluating exosome production, uptake, and long-term tissue disposition. This system is very easy to establish, requiring only basic molecular biological techniques. We hope that this quantification method will be widely adopted, and that it will aid in the advancement of exosome biology.
All animal experiments were performed under protocols approved by the Animal Care and Use Committee of Aichi Cancer Center Research Institute. All analyses were performed in accordance with approved guidelines and regulations.
Cell culture and regents
Human colon cancer cell lines HCT116, HT29 cells and human lung cancer cell lines A431, A549 were obtained from American Type Culture Collection (ATCC). Mouse embryonic fibroblast (MEF) immortalized by large-T antigen was kindly provided from Dr Akira Imamoto51. HCT116, HT29 and generated CD63Nluc-KI/HCT116 cells were cultured at 37 °C with 5% CO2 in McCoy’s 5A medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific). A431, A549 and MEF were cultured at 37 °C with 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM: Sigma-Aldrich, St Louis, MO, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific). Hypoxic culture was performed at 37 °C with 1% O2 and 5% CO2. Bafilomycin A1 was purchased from Sigma-Aldrich.
Generation of Nluc-fused CD63
Plasmid vector pSpCas9(BB)-2A-Puro(PX459) V2.0 (#62988, deposited by Zhang lab) was purchased from Addgene. Construction of plasmids targeting CD63 was performed following to the protocol as per described by Zhang lab, which is available in Addgene website. The guiding oligomers used in the cloning protocol were designed as 5′-TGAGAAGATGTCAGCAATAC-3′. Upstream and downstream 1 kb each from right before the stop codon of CD63 were amplified from HCT116-derived genomic DNA, and NanoLuc gene was amplified from and pNLF1-C vector (Promega, Madison, WI, USA). Each PCR amplicon was cloned into the pUC19 vector with In-Fusion HD enzyme (Takara Bio, Shiga, Japan), and this vector was used as a donor vector. Genome editing in HCT116 was performed as follows: the day before transfection, Cells were seeded on 35-mm dish at the density of 6.25 × 105 cells. The cells were co-transfected with 1 μg of cloned pX459 V2.0 and 1.5 μg of donor vector by using Lipofectamine LTX reagent (Thermo Fisher Scientific), and at 48 hours after transfection cell cloning was initiated by limiting dilution. 28 clones derived from single cells were expanded and prospective three clones were selected based on luminescence in culture medium. Finally, a clone with highest expression of CD63 (clone #17) was selected for assay. Nluc-modification of CD63 gene was confirmed by genomic PCR, sequencing and western blotting. Genomic DNA was extracted from cells by using DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) and genomic PCR was performed by using PrimeSTAR Max DNA polymerase (Takara Bio). Primers were as follows: human CD63, forward (F1) 5′-ctgggcaacagagcaagtct-3′, reverse (R) 5′-gaccatctcttttcggtctga-3′. PCR products were electrophoresed on a 1.0% agarose gel and visualized by staining with Syber Gold (Thermo Fisher Scientific). For sequencing, PCR product was purified by PCR purification kit (Thermo Fisher Scientific) and sequenced by human CD63 primer, forward (F2) 5′- cctgtccccatctttccttc -3′.
NanoLuc luciferase assay
To remove the cells and cellular debris, collected culture mediums were centrifuged at 2,000 g for 10 min at 4 °C, and transferred 50 μL supernatants into white-walled 96-well plates. 50 μL Nano-Glo substrate diluted 1:50 in provided buffer (Nano-Glo Luciferase Assay System: Promega) was added, and the luciferase intensity in each well was immediately measured using an ARVO X Light luminometer (PerkinElmer, Waltham, MA, USA).
Preparation of exosomes and Nanoparticle tracking analysis (NTA)
HT29/CD63Nluc, HCT116/CD63Nluc, HCT116/CD63Nluc-KI cells were seeded on the 150-mm culture dish at the density of 5 × 106 cells, and culture for 24 hours. After washing with 20 mL phosphate-buffered saline (PBS) two times, the culture medium was replaced with 13 mL 1% exosome-depleted FBS contained medium. After 48 hours culture, to remove cells and cellular debris, the supernatant was centrifuged at 2,000 g for 10 min at 4 °C, and then filtered through a 0.22 μm filter (Merck, Darmstadt, Germany). To prevent aggregation of exosome, trehalose (1 M trehalose in 20 mM HEPES pH7.4) was added at the final concentration of 25 mM52. The supernatants were ultracentrifuged at 110,000 g for 70 min at 4 °C (SW41Ti rotor, Beckman Coulter, Brea, CA, USA), and the pellets were washed with 11 mL trehalose-contained HEPES buffer (20 mM HEPES pH7.4, 25 mM trehalose). The suspensions were re-ultracentrifuged at 110,000 g for 70 min at 4 °C, finally suspended in 200 μL HEPES buffer (20 mM HEPES, pH7.4). The size distribution and concentration of the exosomes were determined by Nanoparticle tracking analysis (NTA). NTA was performed using NanoSight LM10 instrument (Malvern Panalytical, Malvern, UK) with 488 nm laser and NTA3.1 software. Five 30 s measurements were recorded for each sample with automated analysis settings for blur, track length and minimum expected particle size. The camera level was set at 14 and the detection threshold at 10.
Cells and exosomes were lysed in n-octyl-β-D-glucoside (ODG) buffer (20 mM Tris-HCl, pH7.4, 150 mM NaCl, 1 mM EDTA, 1 mM sodium orthovanadate, 20 mM NaF, 1% Nonidet P-40, 5% glycerol, 2% ODG and protease inhibitor cocktail), and immunoblotting was performed as previously described53. The following antibodies were used: anti-Alix (ABC40, Merck), anti-HIF1α (D1S7W, Cell Signaling Technology, Danvers, MA, USA), anti-CD63 (MX-49.129.5, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-mCherry (1G9, MBL, Nagoya, Japan) and anti-GAPDH (6C5, Santa Cruz Biotechnology). Anti-Nluc rabbit polyclonal antibody was kindly provided by Promega.
Long-term biodistribution of exosomes was analyzed using dorsal air sac model mice. In brief, mCherry-labeled HT29 and HCT116/CD63Nluc cells (5 × 106 cells/150 μL) mixed with Matrigel were loaded into a chamber ring (Merck) covered with 0.45 μm pore size filters. The chamber rings were dorsally implanted into 5-week-old Balb/c-nu/nu female mice (Japan SLC Inc., Shizuoka, Japan). After 7 weeks of implantation, 100 μL Nano-Glo reagent diluted 1:20 in sterile PBS was intravenously and intraperitoneally injected into mice. After 3 min of administration, mice was euthanized with cervical dislocation, and organs were harvested within 7 min. Luminescence in the isolated organs were imaged with IVIS Lumina II imaging system (PerkinElmer). All animal experiments were performed under protocols approved by the Animal Care and Use Committee of Aichi Cancer Center Research Institute.
Gene expression and shRNA
All gene transfer experiments were carried out with the pCX4 series of retroviral vectors. After Nluc gene was amplified from pNLF1-C vector (Promega) and subcloned into pCX4bsr (pCX4bsr-Nluc vector), human CD9, CD63 and CD81 were subcloned into pCX4bsr-Nluc. The production and infection of retroviral vectors were performed as described previously54. For gene silencing, Lentiviral vectors, both empty and carrying human Alix (ID: NM_013374.2) were purchased from Sigma.
Soft-agar colony formation assay
Single-cell suspensions of 1 × 104 cells were plated onto six-well culture dishes in 1.5 mL of DMEM containing 10% FBS and 0.36% agar on a layer of 2 mL of the medium containing 0.7% agar. 7 days after plating, colonies were stained with 3-(4,5-dimehylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), and photographs of the stained colonies were taken, and number of stained colonies was counted with photoshop55,56.
Cellular uptake assay
Direct addition system: Host cells were seeded in white-walled 96-well plates at a density of 2.5 × 104 cells/well, and culture for 24 hours. Exosomes isolated from HT29/CD63Nluc and HCT116/CD63Nluc were added into each well, and the cells were incubated for 2 hours. After washing twice with PBS, they were lysed with Nano-Glo substrate diluted in provided buffer, and then luminescence was measured using ARVO X Light luminometer (PerkinElmer).
Co-culture system: Cellular uptake assay in co-culture condition was performed using a 24 multiwell insert system with 1.0 μm-pore PET membrane (Corning, Corning, NY, USA). As recipient cells, MEFs, A431, A549, HT29 and HCT116 cells (1 × 105 cells in 1 mL medium) were seeded into the bottom chamber and engineered-donor HT29/CD63Nluc or HCT116/CD63Nluc cells (2 × 104 cells in 600 μL medium) were seeded in the upper chamber. After 48 hours culture, recipient cells were washed with PBS three times, and then were lysed with Nano-Glo substrate diluted in provided buffer. The lysate was transferred to white-walled 96-well plate, and luminescence was measured using ARVO X Light luminometer (PerkinElmer).
All summary data were reported as means ± S.D. calculated for each group and compared using the Student’s t test using Excel software (Microsoft). Test results were reported as two-tailed p-values, where P < 0.05 was considered statistically significant.
All data generated or analyzed during this study are included in this published article.
Valadi, H. et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 9, 654–659 (2007).
Ratajczak, J. et al. Embryonic stem cell-derived microvesicles reprogram hematopoietic progenitors: evidence for horizontal transfer of mRNA and protein delivery. Leukemia 20, 847–856 (2006).
Katsman, D., Stackpole, E. J., Domin, D. R. & Farber, D. B. Embryonic stem cell-derived microvesicles induce gene expression changes in Muller cells of the retina. PLoS One 7, e50417, https://doi.org/10.1371/journal.pone.0050417 (2012).
Keshtkar, S., Azarpira, N. & Ghahremani, M. H. Mesenchymal stem cell-derived extracellular vesicles: novel frontiers in regenerative medicine. Stem Cell Res. Ther. 9, 63, https://doi.org/10.1186/s13287-018-0791-7 (2018).
Benito-Martin, A., Di Giannatale, A., Ceder, S. & Peinado, H. The new deal: a potential role for secreted vesicles in innate immunity and tumor progression. Front. Immunol. 6, 66, https://doi.org/10.3389/fimmu.2015.00066 (2015).
Robbins, P. D. & Morelli, A. E. Regulation of immune responses by extracellular vesicles. Nat. Rev. Immunol. 14, 195–208 (2014).
Taylor, D. D., Taylor, C. G., Jiang, C. G. & Black, P. H. Characterization of plasma membrane shedding from murine melanoma cells. Int. J. Cancer. 41, 629–635 (1988).
Logozzi, M. et al. High levels of exosomes expressing CD63 and caveolin-1 in plasma of melanoma patients. PLoS One 4, e5219, https://doi.org/10.1371/journal.pone.0005219 (2009).
Taylor, D. D., Lyons, K. S. & Gercel-Taylor, C. Shed membrane fragment-associated markers for endometrial and ovarian cancers. Gynecol. Oncol. 84, 443–448 (2002).
Rabinowits, G., Gercel-Taylor, C., Day, J. M., Taylor, D. D. & Kloecker, G. H. Exosomal microRNA: a diagnostic marker for lung cancer. Clin. Lung Cancer 10, 42–46 (2009).
Melo, S. A. et al. Glypican-1 identifies cancer exosomes and detects early pancreatic cancer. Nature 523, 177–182 (2015).
Ogata-Kawata, H. et al. Circulating exosomal microRNAs as biomarkers of colon cancer. PLoS One 9, e92921, https://doi.org/10.1371/journal.pone.0092921 (2014).
Salehi, M. & Sharifi, M. Exosomal miRNAs as novel cancer biomarkers: Challenges and opportunities. J. Cell Physiol. 233, 6370–6380 (2018).
Wu, K., Xing, F., Wu, S. Y. & Watabe, K. Extracellular vesicles as emerging targets in cancer: Recent development from bench to bedside. Biochim. Biophys. Acta 1868, 538–563 (2017).
Marleau, A. M., Chen, C. S., Joyce, J. A. & Tullis, R. H. Exosome removal as a therapeutic adjuvant in cancer. J. Transl. Med. 10, 134, https://doi.org/10.1186/1479-5876-10-134 (2012).
Nishida-Aoki, N. et al. Disruption of Circulating Extracellular Vesicles as a Novel Therapeutic Strategy against Cancer Metastasis. Mol. Ther. 25, 181–191 (2017).
Tickner, J. A., Urquhart, A. J., Stephenson, S. A., Richard, D. J. & O’Byrne, K. J. Functions and therapeutic roles of exosomes in cancer. Front. Oncol. 4, 127, https://doi.org/10.3389/fonc.2014.00127 (2014).
Momen-Heravi, F. et al. Current methods for the isolation of extracellular vesicles. Biol. Chem. 394, 1253–1262 (2013).
Vestad, B. et al. Size and concentration analyses of extracellular vesicles by nanoparticle tracking analysis: a variation study. J. Extracell Vesicles 6, 1344087 (2017).
Yoshioka, Y. et al. Ultra-sensitive liquid biopsy of circulating extracellular vesicles using ExoScreen. Nat. Commun. 5, 3591, https://doi.org/10.1038/ncomms4591 (2014).
Ueda, K. et al. Antibody-coupled monolithic silica microtips for highthroughput molecular profiling of circulating exosomes. Sci. Rep. 4, 6232, https://doi.org/10.1038/srep06232 (2014).
Yoshida, T., Ishidome, T. & Hanayama, R. High Purity Isolation and Sensitive Quantification of Extracellular Vesicles Using Affinity to TIM4. Curr. Protoc. Cell Biol. 77, 3.45.41–43.45.18 (2017).
Nakai, W. et al. A novel affinity-based method for the isolation of highly purified extracellular vesicles. Sci. Rep. 6, 33935, https://doi.org/10.1038/srep33935 (2016).
Chen, C. et al. Microfluidic isolation and transcriptome analysis of serum microvesicles. Lab. Chip 10, 505–511 (2010).
Kanwar, S. S., Dunlay, C. J., Simeone, D. M. & Nagrath, S. Microfluidic device (ExoChip) for on-chip isolation, quantification and characterization of circulating exosomes. Lab. Chip 14, 1891–1900 (2014).
Im, H. et al. Label-free detection and molecular profiling of exosomes with a nano-plasmonic sensor. Nat. Biotechnol. 32, 490–495 (2014).
Hall, M. P. et al. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem. Biol. 7, 1848–1857 (2012).
Bissig, C. & Gruenberg, J. ALIX and the multivesicular endosome: ALIX in Wonderland. Trends Cell Biol. 24, 19–25 (2014).
Baietti, M. F. et al. Syndecan-syntenin-ALIX regulates the biogenesis of exosomes. Nat. Cell Biol. 14, 677–685 (2012).
Edgar, J. R., Manna, P. T., Nishimura, S., Banting, G. & Robinson, M. S. Tetherin is an exosomal tether. Elife 5, https://doi.org/10.7554/eLife.17180 (2016).
Alvarez-Erviti, L. et al. Lysosomal dysfunction increases exosome-mediated alpha-synuclein release and transmission. Neurobiol Dis 42, 360–367 (2011).
Miao, Y., Li, G., Zhang, X., Xu, H. & Abraham, S. N. A. TRP Channel Senses Lysosome Neutralization by Pathogens to Trigger Their Expulsion. Cell 161, 1306–1319 (2015).
Savina, A., Furlan, M., Vidal, M. & Colombo, M. I. Exosome release is regulated by a calcium-dependent mechanism in K562 cells. J. Biol. Chem. 278, 20083–20090 (2003).
King, H. W., Michael, M. Z. & Gleadle, J. M. Hypoxic enhancement of exosome release by breast cancer cells. BMC Cancer 12, 421, https://doi.org/10.1186/1471-2407-12-421 (2012).
Hsu, Y. L. et al. Hypoxic lung cancer-secreted exosomal miR-23a increased angiogenesis and vascular permeability by targeting prolyl hydroxylase and tight junction protein ZO-1. Oncogene 36, 4929–4942 (2017).
Li, L. et al. Exosomes Derived from Hypoxic Oral Squamous Cell Carcinoma Cells Deliver miR-21 to Normoxic Cells to Elicit a Prometastatic Phenotype. Cancer Res. 76, 1770–1780 (2016).
Berchem, G. et al. Hypoxic tumor-derived microvesicles negatively regulate NK cell function by a mechanism involving TGF-beta and miR23a transfer. Oncoimmunology 5, e1062968, https://doi.org/10.1080/2162402X.2015.1062968 (2016).
Zhang, H. et al. Identification of distinct nanoparticles and subsets of extracellular vesicles by asymmetric flow field-flow fractionation. Nat. Cell Biol. 20, 332–343 (2018).
Andreu, Z. & Yanez-Mo, M. Tetraspanins in extracellular vesicle formation and function. Front. Immunol. 5, 442 (2014).
Pols, M. S. & Klumperman, J. Trafficking and function of the tetraspanin CD63. Exp. Cell Res. 315, 1584–1592 (2009).
Tannous, B. A., Kim, D. E., Fernandez, J. L., Weissleder, R. & Breakefield, X. O. Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Mol. Ther. 11, 435–443 (2005).
Kosaka, N. et al. Neutral sphingomyelinase 2 (nSMase2)-dependent exosomal transfer of angiogenic microRNAs regulate cancer cell metastasis. J. Biol. Chem. 288, 10849–10859 (2013).
Tominaga, N. et al. Brain metastatic cancer cells release microRNA-181c-containing extracellular vesicles capable of destructing blood-brain barrier. Nat. Commun. 6, 6716, https://doi.org/10.1038/ncomms7716 (2015).
Kowal, J. et al. Proteomic comparison defines novel markers to characterize heterogeneous populations of extracellular vesicle subtypes. Proc. Natl. Acad. Sci. USA 113, E968–977 (2016).
Yoshioka, Y. et al. Comparative marker analysis of extracellular vesicles in different human cancer types. J. Extracell. Vesicles 2, https://doi.org/10.3402/jev.v2i0.20424 (2013).
Yeh, H. W. et al. Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging. Nat. Methods 14, 971–974 (2017).
Carpintero-Fernandez, P., Fafian-Labora, J. & O’Loghlen, A. Technical Advances to Study Extracellular Vesicles. Front. Mol. Biosci. 4, 79, https://doi.org/10.3389/fmolb.2017.00079 (2017).
Lai, C. P. et al. Visualization and tracking of tumour extracellular vesicle delivery and RNA translation using multiplexed reporters. Nat. Commun. 6, 7029, https://doi.org/10.1038/ncomms8029 (2015).
Vader, P., Mol, E. A., Pasterkamp, G. & Schiffelers, R. M. Extracellular vesicles for drug delivery. Adv. Drug Deliv. Rev 106, 148–156 (2016).
Gangadaran, P., Hong, C. M. & Ahn, B. C. An Update on in Vivo Imaging of Extracellular Vesicles as Drug Delivery Vehicles. Front. Pharmacol. 9, 169 (2018).
Thomas, S. M., Soriano, P. & Imamoto, A. Specific and redundant roles of Src and Fyn in organizing the cytoskeleton. Nature 376, 267–271 (1995).
Bosch, S. et al. Trehalose prevents aggregation of exosomes and cryodamage. Sci. Rep. 6, 36162, https://doi.org/10.1038/srep36162 (2016).
Oneyama, C. et al. The lipid raft-anchored adaptor protein Cbp controls the oncogenic potential of c-Src. Mol. Cell 30, 426–436 (2008).
Hikita, T., Oneyama, C. & Okada, M. Purvalanol A, a CDK inhibitor, effectively suppresses Src-mediated transformation by inhibiting both CDKs and c-Src. Genes Cells 15, 1051–1062 (2010).
Oneyama, C., Hikita, T., Nada, S. & Okada, M. Functional dissection of transformation by c-Src and v-Src. Genes Cells 13, 1–12 (2008).
Oneyama, C. et al. Fer tyrosine kinase oligomer mediates and amplifies Src-induced tumor progression. Oncogene 35, 501–512 (2016).
This work was supported by JST, PRESTO Grant Number JP1005457, Japan.
The authors declare no competing interests.
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
About this article
Cite this article
Hikita, T., Miyata, M., Watanabe, R. et al. Sensitive and rapid quantification of exosomes by fusing luciferase to exosome marker proteins. Sci Rep 8, 14035 (2018). https://doi.org/10.1038/s41598-018-32535-7
- Exosomal Markers
- Exosome Production
- Exosome Secretion
- Nanoparticle Tracking Analysis (NTA)
- Exosome Numbers
Asteltoxin inhibits extracellular vesicle production through AMPK/mTOR-mediated activation of lysosome function
Scientific Reports (2022)
Synthesis of bioluminescent gold nanoparticle–luciferase hybrid systems for technological applications
Photochemical & Photobiological Sciences (2021)
Spatial and temporal tracking of cardiac exosomes in mouse using a nano-luciferase-CD63 fusion protein
Communications Biology (2020)
Scientific Reports (2020)
Scientific Reports (2019) | <urn:uuid:1f0649af-6b96-44d3-90a8-63e897634f9c> | CC-MAIN-2022-33 | https://www.nature.com/articles/s41598-018-32535-7?error=cookies_not_supported&code=45218f10-b50b-45db-83c8-d004947e989c | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.889836 | 12,042 | 2.015625 | 2 |
Can a single person adopt a child? This is a question that many consider in the adoption community, and the simple answer is yes. Still, there are some things you’ll need to know before you start the process.
This article will debunk the common myth that you must be married to adopt. We’ll also discuss the obstacles and factors to consider with single-parent adoption in Texas.
Can Single People Adopt?
A common misconception in the adoption community is that you must be married or in a committed relationship to adopt a child. Fortunately, this is far from the truth. Plenty of single parents have had the opportunity to love, support, and raise adoptive children throughout the United States. In 2017 alone, nearly 17,000 single parents adopted a child.
Because there is a growing need for more stable and loving homes, single-parent adoption has become quite common in the past several years. Adoption centers across the United States work with single parents to create beautiful, loving families. If you are considering adoption and wondering ‘Can single people adopt?’, here are some things you need to know!
Single Parent Adoption in Texas
It’s no wonder that many individuals think that adoption is restricted to specific relationship requirements. Years ago, there were regulations on who could adopt. A single person could become a guardian to a child if they were a relative. But in the 1960s, we saw a shift in these requirements. Today, it is legal for a single person to adopt a child in all 50 states.
Keep in mind that each state has its own adoption laws that may differ in specific requirements. The same requirements apply to both married and single-parent adoption in Texas. You must be:
- At least 21-years-old
- Financially stable
- Responsible and mature
- Able to complete an application
- Willing to share your background and lifestyle information
- Provide references
- Provide proof of marriage and/or divorce (if applicable)
- Complete a home study
- Submit to a criminal background and child abuse check, including all adults living in your household
While you can undoubtedly adopt as a single parent, there are some things to keep in mind before making a move toward finalizing your adoption. Let’s discuss.
Single-Parent Adoption Challenges and Considerations
Can I adopt as a single parent? If you are asking yourself this question, there are some other things to consider. Talk with your local adoption center to get advice, support, and other resources for adoptive parents. Here are some things to consider:
The home study is a legal requirement for all adoptions. It helps ensure that your home and family are an ideal match for an adoptive child. The home study is a written report that runs from 10–20 pages and provides details about your family and your home environment relevant to a child’s well-being. Every adoption in Texas requires an approved study to adopt.
If you are single, your living habits will be slightly different from that of a married couple. One requirement is that you’ll need to have at least two bedrooms in your home — one for you and one for your adoptive child. Regardless of how your home looks, the home study will check to make sure you can provide a healthy, organized, and safe environment for a child to live in. This is one of the most critical steps in the process.
Before you start the adoption process, think about the social and financial impact of having a child. In the excitement and hope of adoption, many single parents don’t consider how a child will affect finances and relationships. Take a hard look at your finances to ensure you will remain financially stable when adding the responsibilities of caring for another person.
Talk to your close family and friends about your plans. Your support system will be one of the most extensive resources you have. Having a solid support base will resolve many of your challenges getting adjusted to your new lifestyle. With the love and support of those around you, you’ll be on your way to a beautiful life with your child.
Resources and Support
In addition to your personal support system, take advantage of the resources and services available for adoptive parents. Find a local adoption center to help you through the ups and downs of your journey. Selecting an adoption center that you feel comfortable with will help ease the challenges of adopting as a single parent. Most adoption centers offer the following resources and support:
- Counseling and emotional support
- Financial resources
- Legal resources
- Adoptive parent support groups
- Access to educational and training resources
- Expert advice on all aspects of the adoption process | <urn:uuid:880d16aa-c23e-4abb-b499-23d0258e05de> | CC-MAIN-2022-33 | https://www.texasadoptioncenter.org/blog/can-single-people-adopt/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.952009 | 964 | 1.710938 | 2 |
The Colorado Department of Human Services uses a two-generation approach to guide all of our services. The two-gen approach encourages CDHS programs to serve children and their caregivers together, to harness the family's full potential and to put the entire family on a path to permanent economic security.
When programs and policies are designed with the whole family's educational and economic future in mind, and families are assisted to reach the social networks and resources they need to be successful in life, opportunity becomes a family tradition. Fragmented approaches to serving families that separately address the needs of children and their caregivers can leave either the child or the caregiver behind, reducing the likelihood of success for all members of the family. The two-gen approach brings all family members along together, assesses all family members together and provides all family members with opportunities, together, to be successful.
For more information about two-gen efforts at CDHS, contact Family and Community Engagement Director Chelsey Hall at email@example.com or 303.866.5310.
- How Colorado is using the two-generation approach
The two-generation approach is in action across Colorado and serves clients and providers together. Here are several areas where two-gen is having an impact on Coloradans.
Colorado Guide to 2Gen
The Colorado Guide to 2Gen provides a roadmap for the next phase of the state's efforts to ensure that all Colorado families and children are valued, healthy, and thriving. This guide was published in June 2017 with the work of many groups and individuals who have been instrumental in revolutionizing 2Gen approaches in Colorado. The guide is grounded in the excellent work that has been done in the state and strategies that cut across sectors, nonprofits, the business community, state and local governments, and philanthropic partners to lift up Colorado families. The Colorado Guide to 2Gen represents Colorado's commitment to becoming a state in which all families can attain economic security and educational success.
2Generation Opportunities pilot program
2Generation Opportunities, or 2GO, is an effort to help Colorado communities innovate and create their own ways of engaging in a two-generation approach to service delivery. In November 2018, the 2GO pilot awarded 10 grants of $100,000 each to both rural and urban community collaborators who proposed innovative ways to address complex systemic challenges that impede families' ability to reach their full potential. Learn more about the 2GO program.
COACT Colorado builds a system of services and supports for children with serious behavioral health challenges and their families. These individualized, culturally and linguistically relevant services and support are based on an evidence-based process known as high-fidelity wrap around. Learn more about COACT Colorado.
Colorado Community Response
As part of a group of cornerstone prevention programs formed or expanded under Gov. John Hickenlooper's Child Welfare Plan-called Keeping Kids Safe and Families Healthy 2.0 - Colorado Community Response provides comprehensive voluntary services for families with a screened out referral and/or closed referral after initial assessment by local child welfare agencies. CCR is intended to reach families at an earlier stage when they are facing stress, in an effort to reduce future referrals to child welfare, providing a comprehensive, community-based service continuum for families at risk for child maltreatment. Learn more about Colorado Community Response.
Colorado Refugee Services
Refugees come to Colorado from many different countries from around the globe and with an array of talents, skills, backgrounds and life experiences. They share the common aspiration of finding safety, security and opportunities to establish themselves and their families in new communities. Learn more about the Colorado Refugee Services program.
Division of Youth Services
The family is an integral part of the team working with youth involved in CDHS's Division of Youth Services. DYS strives to adequately honor family experience and culture, empower all family members, use family strengths, and inject hope for a safe and successful future. Learn more about DYS.
A DYS two-gen success story:
Being committed to the Division of Youth Services is an intense turning point for any youth and their families. For Deaundrey, a youth at Zeb Pike Youth Services Center, being committed only told part of the story of his challenges going forward.
Shortly after being committed and arriving at Zeb Pike, Deaundrey learned that his newborn child Gloria was diagnosed with cardiomyopathy a condition known as Noonan Syndrome, that required a complete heart transplant in order for his 14-month old baby to survive. In addition, a donor would need to be found within months before the condition would take her life. Thankfully, a match was found and, after several months, little Gloria was able to have the surgery at Children's Hospital in Aurora.
Creating an emotional bond between Deaundrey and Gloria was pivotal at this important time in their lives. That is why Deaundrey's Client Manager, Deaundrey's family and the staff at Zeb Pike worked closely to ensure that their needs would be met during this critical time in their lives. They began to develop trust in each other to help ensure a smooth transition during recovery. All parties involved helped to ensure that Deaundrey had special visits, additional passes and phone calls as needed. Transportation arrangements were made by the facility and Deaundrey's family.
Deaundrey did his part to maintain his pass privileges by displaying safe behaviors in the facility and in the community. As Gloria begins her long road to recovery, Deaundrey, his family and the staff at Zeb Pike all recognize the importance of keeping this strong collaboration intact. According to Deaundrey's Clinician, Maddy Tormoen, the plan going forward is for Deaundrey to leave Zeb Pike in December and be placed at the Dale House. He also recently accepted a job at the Broadmoor Hotel and Resort as a pastry chef, an opportunity that he attributes to his culinary arts training received at Zeb Pike.
Child Support Services
Colorado is proud to be one of the first states in the nation to transform its Child Support Services (CSS) program utilizing the two-gen approach. This approach serves as a complimentary addition to CSS's core services. Counties across the state have already started to incorporate pieces of the approach into their work. Doing so brings focus to the whole family, the child and both parents, custodial and non-custodial, when providing supportive services. Learn more about Child Support Services.
Family Voice Council
At CDHS, we recognize the value of family participation and engaging the voices of those with lived systems experience. The Family Voice Council is made up of community members who have been involved with, or are currently engaging in, at least two CDHS services or programs. Council members come together monthly to learn, give input and ultimately affect positive systems change. The Council's mission is to improve the quality and delivery of services for all Coloradans through giving thoughtful input and achieving personal goals. Members are able to share their honest experiences and provide feedback as a guide for the future. Learn more about the Family Voice Council.
Working Together Project
The Maternal, Infant, and Early Childhood Home Visiting (MIECHV) Working Together Project applies the two-gen framework to support families enrolled in evidence-based home visiting toward increasing their economic security. The project impacts caregiver access to and completion of the GED, short-term college certificate programs, workforce training and financial literacy education. While caregivers are working toward their goals, their young children will simultaneously receive quality care and support services to optimize development. Learn more about the Working Together Project.
- Two-generation approach in the news
- Montrose part of statewide child support pilot program
- Why Punishing Dads Who Owe Child Support Doesn't Work, and What Does Work
- Nonprofit hopes future urban garden will help north Denver residents stay put despite gentrification
- Providing care and custody with dignity and respect within Colorado Division of Youth Services
- Working Together Program Assists Valley Parents in Need
- Empty Stocking Fund: Two Generation Approach Gives Families an Early Start
- Aurora Preschool Offers Custom Scheduling to Help Out Parents with Hectic Schedules
- Breaking the Cycle of Incarceration by Keeping Mothers and Children Together
- Close the Growing Economic Divide by Teaching Two Generations at Once
- In Texas, People With Mental Illness Are Finding Work Helping Peers
- Two-generation partners and resources
Countless individuals and teams help make the two-generation approach a successful reality for Coloradans. Below is a list of partners and resources that aid in the approach.
- CLASP infographic: 2016 Census Data on Poverty
- FrameWorks Institute report: Framing Two-Generation Strategies
Arapahoe County Department of Human Services and Family Tree's Generational Opportunities to Achieve Long-Term Success (GOALS) Program
- Bell Policy Center report: Bound to Succeed: An Environmental Scan of Two-Generation Approaches to Education in Colorado
- Op-ed by Bell Policy Center president: Close the growing economic divide by teaching two generations at once
Community College of Aurora's Strengthening Working Families Initiative (SWFI) | <urn:uuid:d9236b87-c8c2-44f3-bcc0-159d21ba3529> | CC-MAIN-2022-33 | https://cdhs.colorado.gov/about-cdhs/featured-initiatives/two-generation-approach-in-colorado | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.954804 | 1,887 | 1.601563 | 2 |
Disclosure: We may get commissions for purchases made through links in this post.
Snake plants (also known as mother-in-law’s tongue) are among the toughest and easiest houseplants to grow. This makes them an especially popular choice for beginner indoor growers. If you are considering purchasing your first snake plant, you may wonder whether it is considered a succulent plant. Is it also cactus? It seems like a confusing classification, so we have done a bit of research to help explain the category that snake plants fall into.
Snake plants are, in fact, considered succulent plants. This includes all of the varieties of snake plants. They are not considered cactus plants, as they have features that do not align with cacti specifications.
Snake plants and cacti have an interesting relationship that can cause a lot of confusion for new growers. Continue reading to learn what classifies a plant as a succulent plant. We'll also discuss the difference between succulents and cacti and why snake plants fall into the former category.
What Is A Succulent Plant?
The main defining characteristic of a succulent plant is its ability to store water. These plants have leaves, stems, and branches that collect water to save it for the year's dryer months. Succulents typically have hardy leaves, and their internal water storage capability helps them to survive droughts. This is especially important to their survival as many succulent plants are native to warm or tropical climates located in Africa, Eastern Asia, and South America.
Overall, succulents can vary greatly in their color and form, but one commonality will always be their ability to store water. This explains why the leaves of a snake plant can stand tall and firm, as opposed to droopy or leaning---they're typically full of water.
Many succulent plants can easily be propagated by cutting their leaves. Once the leaves are clipped, they can be placed in water or topsoil to create an off-shoot of the mother plant. This can be done for multiple plants, and they can also be grown alongside the mother plant.
If you take a clipping from the rosette of your snake plant, for example, you will find that it will begin to grow its own stems in a period of six to eight weeks. This is another reason why home growers love succulents, as indoor plants--it's easy to grow more of them. This means that you don't have to spend money on new plant seeds.
Leaves and Appearance
Many succulent plants are known for their ability to endure brief temperature freezes without becoming frost damaged. One of the biggest characteristics of a succulent plant is its thick fleshy leaves (or, in some cases, pads), though there are definitely succulent varieties to have thinner leaves. For example, the snake plant's leaves are less than average in terms of thickness for the typical succulent plant.
Another common characteristic of succulent plants is their short stature. Though there are succulent plants that can grow several feet tall (such as the snake plant), many have a wide, bushlike shape, which is likely an adaptive change to survive in their native environment. You'll find these plants available in various colors, including green, yellow, red, and even purple hues.
The Differences Between Succulents and Cactus Plants
It's common for people to use the terms cacti and succulent interchangeably, however, they do not represent the same type of plant categorizations. To understand the relationship between cacti and succulents, it's important to be able to distinguish them from one another. Let's look at the differences between these plants.
As mentioned earlier, succulents are known for their ability to store water in their foliage, roots, and branches. Currently, there are over 50 known plant families that fall into the category of succulents, and cacti are one of these plants. Why? Because cacti can store water. So to say, all cacti are considered succulent plants.
It's common for succulents to be mistaken for cacti, as they can have spines and thorns as well, but there is a difference between the two. It doesn't matter the plant's shape or size, or whether or not they have branches or leaves. The distinguishing factor between succulents and cacti are what are known as areoles.
Areoles are small round cushion mounds of flesh where flowers, hair, and leaves grow from cacti. Areoles are not present on all succulents, however, they are present on all plants classified as cacti. So there you have it, that's the main difference between a succulent plant and a cactus. Though, there are some gray areas of these categorizations.
How Do You Identify Snake Plants?
Currently, there are over 70 known snake plant (or Genus Sansevieria) varieties. So this can make it a bit challenging to distinguish snake plants from other types of plants. However, there are a handful of commonalities that all of the varieties possess. All snake plants are considered succulents, and their varieties have long sword-shaped green leaves that are flat and stand erect.
Most snake plants will be various green hues, though some can contain yellow, red, and purple leaves. When you purchase a snake plant, whether it's online or at a local indoor plant supplier, it should be labeled accordingly. If you are unsure whether or not your new plant is a snake plant, you can visit a local plant nursery or contact a horticulturist online to be sure.
Are Snake Plants Tropical?
Snake plants are tropical and sub-tropical plants. They're native to various continents, including Africa, Europe, and Southeast Asia. Being tropical plants, they can thrive in areas with moderate shade as well as in areas with very bright light. This is one of the many benefits of growing an indoor snake plant-- you can place it almost anywhere in your home, and it will still thrive.
Snake plants are drought-resistant, and depending on their variety, they can go anywhere from four to six weeks without being watered. Snake plants thrive when they're placed in environments that are similar to their native lands. Let's briefly discuss the elements that will help these tropical plants grow best.
Proper watering is probably one of the most important aspects of keeping a snake plant healthy. Snake plants require very little soil to thrive and grow. In fact, it's strongly recommended that you let the soil dry out between each watering session. On average, you won't need to water your snake plant more than once or twice every month.
Even if the plant is damaged or in a state of ill-health, over-watering will rarely be the solution. During the winter months, it's recommended to only water the plant once or whenever the soil is extremely dry.
Temperature and Humidity
Snake plants prefer temperatures similar to that of their native environments, which means 50 degrees Fahrenheit or higher is ideal. The ideal temperature range for snake plants is anywhere between 70 and 90 degrees Fahrenheit. Always keep your plant away from air conditioners or drafty areas of your home, as this can cause the leaves to droop.
Snake plants are known to be extremely forgiving plants. They can be placed under direct sunlight for a few hours a day without their leaves becoming scorched--which is mostly due to their high water content. They can also be placed in areas where there is indirect sunlight and can adapt to bright conditions fairly quickly.
Best when placed in loose well-draining soil. This gives their roots free rein to grow freely and provide the plant with the nutrients that it needs to survive. You can even use an all-purpose cactus soil for your snake plant, as they have similar maintenance and nutritional characteristics. It's best to stay away from plant media that have a small amount of peat, as they may make it difficult for the soil to stay hydrated or drain properly.
Snake plants don't require a lot of fertilizer to thrive and grow. However, you can use a mild fertilizer if your plant needs a growth boost or if it's suffering from a health standpoint. The best fertilizer to use for snake plants is one with an NPK (Nitrogen, Phosphorous, Potassium) ratio of 10-10-10. It's best not to fertilize the snake plant in the winter (it's the slow-growing season), as it can cause a chemical burn.
What Other Plants Can You Arrange With A Snake Plant?
A snake plant can be combined with almost any other succulent for a more interesting looking plant pot--or for convenience. You can also pair snake plants with various annuals to add a bit of color to their consistent greenery. Annuals that are commonly paired with snake plants include fittonia, petunias, and ivy varieties. In particular, Ivories can add a bit of volume to your snake plant's pot, as they will typically spillover if you allowed them to grow fully.
Snake plant with fittonia:
Snake plant with petunias"
Snake plant with ivory:
Can You Combine Snake Plants In A Pot?
Yes, you can combine multiple snake plants in one pot. It's best to combine plants that are near the same stage in life. For example, you may want to avoid pairing a baby snake plant with a plant that is five years old, as they may have vastly different nutrient requirements. It can also become challenging to care for both of the plants; every one of them begins to suffer from health issues.
Wrapping Things Up
Before you go, be sure to check out our other posts: | <urn:uuid:08b7b4fa-6b84-42d8-a9b9-53106b5c2e40> | CC-MAIN-2022-33 | https://gardentabs.com/are-snake-plants-succulents/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.966703 | 2,039 | 2.71875 | 3 |
- 1 What did Gilbert Stuart invent?
- 2 Why did Gilbert Stuart painting George Washington?
- 3 How old is Gilbert Stuart?
- 4 Did Gainsborough paint George Washington?
- 5 What age did Gilbert Stuart die?
- 6 When did Gilbert Stuart paint the National Portrait Gallery?
- 7 Where is the birthplace of Gilbert Stuart located?
What did Gilbert Stuart invent?
Stuart retained the portrait and used it to paint scores of copies that were commissioned by patrons in America and abroad….
|Born||Gilbert Charles StewartDecember 3, 1755 Saunderstown, Rhode Island Colony|
|Died||July 9, 1828 (aged 72) Boston, Massachusetts|
What was unusual about Stuart’s painting technique?
He had a great talent for flesh tones, which he obtained by using a wide variety of colours, but he did not mix the pigments: instead he allowed each colour to shine through the subsequent layer, as in a transparent skin. Unusually, he worked without the aid of sketches, drawing directly upon the canvas.
Why did Gilbert Stuart painting George Washington?
When Gilbert Stuart put brush to canvas during George Washington’s presidency, he painted the image most recognized today. Stuart wanted to paint Washington, for he expected that he could make a “fortune” on images of the Revolutionary War hero and American leader.
What type of art did Gilbert Stuart do?
How old is Gilbert Stuart?
72 years (1755–1828)
Gilbert Stuart/Age at death
It was there that he painted many of his George Washington portraits. In 1805 he moved to Boston where he lived until his death, at the age of 72, on July 9, 1828. He is buried in the Boston Common in an unmarked grave. Gilbert Stuart left a legacy of memorable portraits, over one thousand done in his lifetime.
Where did Gilbert Stuart live?
Gilbert Stuart/Places lived
Gilbert Stuart, in full Gilbert Charles Stuart, (born December 3, 1755, Saunderstown, Rhode Island colony [now in North Kingstown, Rhode Island, U.S.]—died July 9, 1828, Boston, Massachusetts, U.S.), American painter who was one of the great portrait painters of his era and the creator of a distinctively American …
Did Gainsborough paint George Washington?
The Two Georges was a painting made by Thomas Gainsborough in the 1760s, depicting North American colonial leader George Washington being presented to King George III of Britain, and commemorating the accord that averted a revolution by Britain’s North American colonies.
Why is it called the Lansdowne portrait?
The painting, done in 1796, is known as the Lansdowne Portrait because it was a gift to the Marquis of Lansdowne, an English supporter of American independence, from Senator and Mrs. Many of the objects in the painting never really existed, but were chosen by the artist to convey specific ideas to viewers.
What age did Gilbert Stuart die?
In 1793 Gilbert Stuart returned to the United States. He lived and worked in New York for two years then moved to Philadelphia. It was there that he painted many of his George Washington portraits. In 1805 he moved to Boston where he lived until his death, at the age of 72, on July 9, 1828.
What was Gilbert Stuart’s best known work?
Gilbert Stuart is widely considered to be one of America’s foremost portraitists. His best known work, the unfinished portrait of George Washington that is sometimes referred to as The Athenaeum, was begun in 1796 and left incomplete at the time of Stuart’s death in 1828.
When did Gilbert Stuart paint the National Portrait Gallery?
In 1794, he painted statesman John Jay, from whom he received a letter of introduction to Washington. In 1795, Stuart moved to Germantown, Philadelphia where he opened a studio, and Washington posed for him later that year. George Washington ( Lansdowne portrait) 1796. Oil on canvas. National Portrait Gallery, Washington, D.C.
Who was the Scottish artist who tutored Gilbert Stuart?
In 1770, he made the acquaintance of Scottish artist Cosmo Alexander, a visitor to the colonies who made portraits of local patrons and who became a tutor to Stuart. Under the guidance of Alexander, Stuart painted the portrait Dr. Hunter’s Spaniels when he was 14; it hangs today in the Hunter House Mansion in Newport.
Where is the birthplace of Gilbert Stuart located?
Gilbert Stuart’s wonderful collection of portraits can be seen in fine art museums and galleries all over the world. The Gilbert Stuart Birthplace and Museum is situated on 23 acres in the woods of Saunderstown, Rhode Island on a beautiful millpond and stream. | <urn:uuid:2a598d5f-3e77-4de7-a0cb-f51a0ea3b1b1> | CC-MAIN-2022-33 | https://theknowledgeburrow.com/what-did-gilbert-stuart-invent/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.960696 | 1,045 | 3.34375 | 3 |
« AnteriorContinuar »
preme truth of all things real, in respect to the first class; and, in respect to the second, the imaginative truths of the mental products, or mental combinations. Of the nature and mode of operation of the Power to which we refer, we know, and can know, nothing ; it is one of those secrets of our being which He who made us has kept to himself. And we should be content with the assurance, that we have in it a sure and intuitive guide to a reverent knowledge of the beauty and grandeur of his works,
nay, of his own adorable reality. And who shall gainsay it, should we add, that this mysterious Power is essentially immanent in that “ breath of life,” by which man be
a living soul ” ? In the following remarks we shall confine ourself to the first class of Ideas, namely, the Real ; leaving the second to be noticed hereafter.
As to number, ideas are limited only by the number of kinds, without direct relation to degrees; every object, therefore, having in itself a distinctive essential, has also its distinct idea ; while two or more objects of the same kind, however differing in degree, must consequently refer only to one and the same.
For instance, though a hundred animals should differ in size, strength, or color, yet, if none of these peculiarities are essential to the species, they would all refer to the same supreme idea.
The same law applies equally, and with the same limitation, to the essential differences in the intellectual, the moral, and the spiritual. All ideas, however, have but a potential existence until they are called into the consciousness by some real object; the required condition of the object being a predetermined correspondence, or correlation. Every such object we term an assimilant.
With respect to those ideas which relate to the physical world, we remark, that, though the assimilants required are supplied by the senses, the senses have in themselves no productive, coöperating energy, being but the passive instruments, or medium, through which they are conveyed. That the
senses, in this relation, are merely passive, admits of no question, from the obvious difference between the idea and the objects. The senses can do no more than transmit the external in its actual forms, leaving the images in the mind exactly as they found them; whereas the intuitive power rejects, or assimilates, indefinitely, until they are resolved into the proper perfect form. Now the power which prescribes that form must, of necessity, be antecedent to the presentation of the objects which it thus assimilates, as it could not else give consistence and unity to what was before separate or fragmentary. And every one who has ever realized an idea of the class in which alone we compare the assimilants with the ideal form, be he poet, painter, or philosopher, well knows the wide difference between the materials and their result. When an idea is thus realized and made objective, it affirms its own truth, nor can any process of the understanding shake its foundation ; nay, it is to the mind an essential, imperative truth, then emerging, as it were, from the dark potential into the light of reality.
If this be so, the inference is plain, that the relation between the actual and the ideal is one of necessity, and therefore, also, is the predetermined correspondence between the prescribed form of an idea and its assimilant; for how otherwise could the former become recipient of that which was repugnant or indifferent, when the presence of the latter constitutes the very condition by which it is manifested, or can be known to exist ? By actual, here, we do not mean the exclusively physical, but whatever, in the strictest sense, can be called an object, as forming the opposite to a mere subject of the mind.
It would appear, then, that what we call ourself must have a dual reality, that is, in the mind and in the senses, since neither alone could possibly explain the phenomena of the other; consequently, in the existence of either we have clearly implied the reality of both. And hence must follow the still more important truth, that, in the conscious presence of any spiritual fer,
idea, we have the surest proof of a spiritual object; nor is this the less certain, though we perceive not the assimilant. Nay, a spiritual assimilant cannot be perceived, but, to use the words of St. Paul, is “spiritually discerned,” that is, by a sense, so to speak, of our own spirit. But to illustrate by example : we could not, for instance, have the ideas of good and evil without their objective realities, nor of right and wrong, in any intelligible form, without the moral law to which they re
which law we call the Conscience; nor could we have the idea of a moral law without a moral lawgiver, and, if moral, then intelligent, and, if intelligent, then personal; in a word, we could not now have, as we know we have, the idea of conscience, without an objective, personal God. Such ideas may well be called revelations, since, without any perceived assimilant, we find them equally affirmed with those ideas which relate to the purely physical.
But here it may be asked, How are we to distinguish an Idea from a mere notion ? We answer, By its self-affirmation. For an ideal truth, having its own evidence in itself, can neither be proved nor disproved by any thing out of itself; whatever, then, impresses the mind as truth, is truth until it can be shown to be false ; and consequently, in the converse, whatever can be brought into the sphere of the understanding, as a dialectic subject, is not an Idea. It will be observed, however, that we do not say an idea may not be denied ; but
1 to deny is not to disprove. Many things are denied in direct contradiction to fact ; for the mind can comma
mand, and in no measured degree, the power of self-blinding, so that it cannot see what is actually before it. This is a psychological fact, which
may be attested by thousands, who can well remember the time when they had once clearly discerned what has now vanished from their minds. Nor does the actual cessation of these primeval forms, or the after presence of their fragmentary, nay, disfigured relics, disprove their reality, or their original integrity, as we could not else call them up in their proper forms at any future time, to the reacknowledging their
truth : a resuscitation and result, so to speak, which many have experienced.
In conclusion: though it be but one and the same Power that prescribes the form and determines the truth of all Ideas, there is yet an essential difference between the two classes of ideas to which we have referred; for it may well be doubted whether any Primary Idea can ever be fully realized by a finite mind, — at least in the present state. Take, for instance, the idea of beauty. In its highest form, as presented to the consciousness, we still find it referring to something beyond and above itself, as if it were but an approximation to a still higher form. The truth of this, we think, will be particularly felt by the artist, whether poet or painter, whose mind may be supposed, from his natural bias, to be more peculiarly capable of its highest developement; and what true artist was ever satisfied with any idea of beauty of which he is conscious ? From this approximated form, however, he doubtless derives a high degree of pleasure, nay, one of the purest of which his nature is capable ; yet still is the pleasure modified, if we may so express it, by an undefined yearning for what he feels can never be realized. And wherefore this craving, but for the archetype of that which called it forth ?
When we say not satisfied, we do not mean discontented, but simply not in full fruition. And it is better that it should be so, since one of the happiest elements of our nature is that which continually impels it towards the indefinite and unattainable. So far as we know, the like limits may be set to every other primary idea,
as if the Creator had reserved to himself alone the possible contemplation of the archetypes of his universe.
With regard to the other class, that of Secondary Ideas, which we have called the reflex product of the mind, their distinguishing characteristic is, that they not only admit of a perfect realization, but also of outward manifestation, so as to be communicated to others. All works of imagination, so called, present examples of this. Hence they may also be termed imitative or imaginative. For, though they draw their assimilants from the actual world, and are likewise regulated by the unknown Power before mentioned, yet are they but the forms of what, as a whole, have no actual existence ; they are nevertheless true to the mind, and are made so by the same Power which affirms their possibility. This species of Truth we shall hereafter have occasion to distinguish as Poetic Truth. | <urn:uuid:696237de-cfd8-480f-9f58-4002e1c993ef> | CC-MAIN-2022-33 | https://books.google.com.ni/books?id=cb9LAAAAMAAJ&pg=PA5&focus=viewport&vq=%22thou,+which+art+but+air,+a+touch,+a+feeling+Of+their+afflictions%22&dq=editions:NYPL33433076086341&lr=&output=html_text | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.967573 | 1,905 | 2.296875 | 2 |
The Sand Flea Robot created for the US military can jump atop a 30-foot building with a single bound. But no worries. It’s on our side.
In the words of Kyle Reese, “You still don’t get it, do you? He’ll find her! That’s what he does! That’s ALL he does! You can’t stop him! He’ll wade through you, reach down her throat and pull her heart out!”
Oh and it’s made by the same company that makes this.
How long until they mix these two things together. And then all they have to do is add teeth?
Right now, the Sand Flea has such precision, that when properly controlled, it can leap into a window of a second story building, according to MYFoxNY. It does this by stopping, leaning on its back wheels and then propelling itself upward. | <urn:uuid:6f13f691-8ec4-4bc5-921c-3da928b60a56> | CC-MAIN-2022-33 | https://creativeminorityreport.com/blog/2012/03/29/were-doomed-robot-can-jump-30-feet/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.949218 | 204 | 1.53125 | 2 |
A team of researchers from MIT and other institutions claims that their "SPARC" compact fusion reactor will actually work , at least in theory, as they argue in a series of recently published research papers.
In total, well seven articles Written by 47 researchers from 12 institutions, the team says no unexpected hindrances or surprises emerged during the planning stages. In other words, the research "confirms that the SPARC fusion reactor project we are working on is highly likely to work," he said. said to New York Times Martin Greenwald, deputy director of MIT's Plasma Science and Fusion Center and project leader.
The power of fusion remains elusive, but technology promises to someday become a safe and clean way of producing energy by fusing together atomic nuclei like the sun. Basically, creating a star on Earth and harnessing its energy. Despite nearly a century of research, however, no one has yet managed to make it.
Now try SPARC
SPARC, one of the largest projects of its kind in the privately funded sector, would be the first of its kind: a "burning plasma" reactor that fuses isotopes of hydrogen to form helium, without the need for other energy inputs.
Thanks to advances in the field of superconducting magnets, the team hopes to achieve the same performance as much larger reactors, such as the giant ITER (International Thermonuclear Experimental Reactor) reactor, which began assembly in July.
Magnets are used to contain the extremely hot and high pressure reactions going on inside the fusion reactor - this is one of the biggest challenges. According to the team's calculations, SPARC should be able to produce twice the fusion energy of the amount needed to generate the reaction. It would be a huge leap, today even a "balanced budget" cannot be achieved.
Indeed, in the papers, the researchers note that the SPARC fusion reactor could theoretically generate ten times the amount of energy input, but there is a lot of work to be done before they can say for sure.
When will we see the SPARC fusion reactor in action?
What we try to do is put the design on the strongest physical foundation possible. That way we can be confident in how it will work and then provide guidance for the engineering design as it goesMartin Greenwald, deputy director of MIT's Plasma Science and Fusion Center
The MIT team hopes to build its compact reactor in the next three to four years. | <urn:uuid:d74f556f-703c-4a41-bb75-d614585dc613> | CC-MAIN-2022-33 | https://en.futuroprossimo.it/2020/09/per-il-mit-il-loro-reattore-a-fusione-sparc-funzionera/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.951819 | 492 | 3.53125 | 4 |
We are searching data for your request:
Upon completion, a link will appear to access the found materials.
Design convertible attic space, raise the roof or simply modernize the roof… for all these operations, you will have to embark on renovations to your frame. Find more articles on the theme: Structural work quotes
Renovate a wooden frame
Several reasons make renovation work on a wooden frame necessary: - Damage due to bad weather; - A degradation linked to attacks by parasites, such as insects or fungi; - Wood wear. Depending on the extent of the damage, you can take different actions. For example, if the beams have lost all their charm and have no shine, sand them to give them a natural appearance. As for weakened or gnawed wood, you can consider a metal hoop, in order to strengthen the structure. You also have the option of replacing the damaged part, starting with a pickling, followed by a burning of the part, in order to remove the worm-eaten elements.
Renovate an old frame
Before starting the renovation work, it is advisable to inquire in order to know the age of the frame. Indeed, the methods of construction of the frames vary over the generations. It is therefore important to follow certain instructions, in order to preserve the charm and the quality of the frame. Renovating an old frame implies that we keep its original appearance. It is therefore not recommended to apply modern techniques. In addition, it is essential to respect the means of fixing, like mortises, ankles, tenons ... Finally, it will be necessary to determine whether the frame should be renovated partially or entirely.
Renovating a metal frame
Metal frames generally do not require complex maintenance, since steel is a durable material. However, over the years, a few gestures of maintenance will be necessary. It is indeed recommended to brush the metal surface, to clean it with a soft product, to carry out a light sanding if necessary, and to apply a new layer of protective paint. If you notice deformations, do not hesitate to put bracing, in order to reinforce the stability of the structure. You can also consider installing braces to maintain the spacing of the ties.
The frequency of renovation of a frame
In general, the frames must be checked and renovated if necessary, once every 20 or 30 years. You can ask for advice from a craftsman or a carpenter, especially if you have an old frame. However, if it is a minor renovation, you have the option of doing the work yourself. Depending on the condition of the frame, it will be necessary to carry out: - A water-repellent treatment, to remove moisture from the beams; - A fungicide treatment, to eliminate xylophagous insects and termites; - A treatment to eliminate any fungi; - A replacement of any damaged parts. | <urn:uuid:7fe584e4-3a31-4225-b363-279a7d234d18> | CC-MAIN-2022-33 | https://gm.janevsound.com/518-frame-what-you-need-to-know-about-frame-renovation.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.908593 | 587 | 2.09375 | 2 |
FurtherFind additional information and resources available for undocumented students, DACAmented students and students from mixed-status families.
2019 MANA Scholarship: Open to Undocumented Students
Advocacy and Legal Assistance
Missouri Immigrant and Refugee Advocates (MIRA)
MIRA is a coalition of organizations that supports advocacy and education in Missouri. MIRA tracks bills as they pass through the Missouri legislature. They also have a resources directory listing helpful organizations in the area.
Catholic Legal Assistance Ministry (CLAM)–Immigration Law Project
CLAM Immigration Law Project offers legal aid to migrants facing challenges in immigration cases such as: family based petitions, asylum, relative petitions, naturalization, adjustment of status, employment authorization, violence against women, special immigrant juveniles, T and U visas for victims of crime and/or human trafficking, deferred action, temporary protected status and representation for relief while in removal proceedings. Furthermore, CLAM provides outreach and Know Your Rights programs throughout the area to help educate the immigrant communities about current issues.
The Ministry cannot accept walk-ins. To request help, call 314-977-3993 on Tuesdays between 9am and 3pm. Given the volume of calls received, it may take several weeks before you can speak with an attorney. You also can email CLAM.
Migrant and Immigrant Community Action Project
The Migrant and Immigrant Community Action Project (MICA Project) is a community organization committed to working with low-income immigrants to overcome barriers to justice. The MICA Project utilizes legal services, organizing, advocacy, and education to promote the voice and human dignity of immigrant communities.
The MICA Project handles a wide variety of cases, including family immigration, naturalization, removal defense, and asylum and refugee issues. In 2015, The MICA Project worked with over 350 clients. In order to assure that immigrants can get the help they need, the MICA Project provides all services at a discounted rate. Fees are charged on an affordable sliding scale and payment plans are available.
- Immigrants Rising
- Migration Policy Institute
- American Immigration Lawyers Association
- U.S. Citizenship and Immigration Services: Renew Your DACA
- U.S. Citizenship and Immigration Services: DACA Toolkit (PDF)
- My American DREAMs
Films & Videos
- “Beyond Borders” (2016) – Nearly 11 million people live in the US without the benefit of social and political rights, and the majority are Mexicans. As a result, undocumented Mexican immigrants have become the public face of the anti-immigrant backlash now sweeping our country. Much of the debate about their lives, their motivations, and their role in maintaining crucial sectors of the US economy is deeply flawed.
- “DACA, What Next?” (2018) – In this TED talk, Javier describes his personal experience being an undocumented immigrant as a child in the USA. He speaks of his drive to better himself through education, what DACA has meant to him, and his concern for the future (now that the program has been rescinded by the current administration). Javier (Candidate MA Brown University 18′, BA Rhode Island College 17′) is a research fellow at the Latino Policy Institute at Roger Williams University. Because of his efforts to raise awareness about the undocumented student struggle, Javier was awarded the Vital Contribution to the Community award in 2017 at Rhode Island College.
- “Don’t Tell Anyone” (2015) – Angy Rivera has lived in the United States with a secret that threatens to upend her life: She is undocumented. Now 24 and facing an uncertain future, Rivera becomes an activist for undocumented youth with a popular advice blog and steps out of the shadows to share her story of sexual abuse, an experience all too common among undocumented women.
- “Food Chains” (2014) – In this documentary, Sanjay Rawal takes up the plight of migrant farmworkers by focusing on their fight in Immokalee, Florida to push back against supermarket giants who essentially pressure farm owners to pay poverty wages.
- “Forbidden: Undocumented and Queer in Rural America” (2016) – When Moises Serrano was a baby, his parents risked everything to flee Mexico in search of the American Dream. Growing up in the rural South as an undocumented gay man, forbidden to live and love in the country he calls home, Serrano sees only one option — to fight for justice and equality.
- “Hiding in plain sight — my life as an undocumented American” (2014) – An executive communications specialist, Leezia is a first-generation American, of African and Indian descent, who immigrated to Texas from Canada in 1996. Leezia’s interest in writing and foreign affairs led her to Northwestern University, where she earned a bachelor’s degree in journalism and political science. In April 2014, Leezia’s research with Northwestern University’s Medill Innocence Project, a journalism think tank that investigates cases of potentially wrongful convictions, contributed to the release of an inmate who spent nine years incarcerated in an Illinois prison. Her work helped Medill to win the Investigative Reporters & Editors Award and the Peter Lisagor Award for best online feature story.
- “Immigration Battle” (2015) – Born in Chicago to Puerto Rican parents, Luis Gutiérrez has been one of the U.S. House of Representative’s most vocal voices for comprehensive immigration reform. Immigration Battle follows his political maneuvering during the attempted passage of a bi-partisan immigration reform bill that was shot down by politicians feeding off of anti-immigrant sentiment.
- “New American Girls” (2014) – Three teenage girls (of Mexican, Peruvian, and Indian descent) brought to the U.S. describe their experiences as undocumented residents who feel American. Having excelled at school, the girls are subsequently unable to go to college, get jobs, or register in a system that impedes their sense of identity and damages their prospects.
- “Reclaiming Agency: My Journey as an Undocumented American” (2018) – When Jirayut Latthivongskorn told college advisors he wanted to go to medical school, they didn’t know what to say to him. They had never heard of a medical school admitting an undocumented student. Latthivongskorn, who was born in Thailand shares his powerful journey as an undocumented immigrant who became the first undocumented medical student at UCSF.
- “Roadtrip Nation: Beyond the Dream” (2016) – Everyone seems to have a voice in the immigration debate—except immigrants, themselves. Explore the immigrant experience through the eyes of Alexis, Rachel, and Pratishtha: three immigrants who were brought to this country at a young age, and have been temporarily granted partial—but not full—protection against deportation.
- “Sin Pais” (2010) – Sam and Elida Mejia escaped Guatemala during a violent civil war and brought their one-year-old son to California. They worked hard, raised a family, and lived the American dream. Two years ago, immigration agents stormed the Mejias’ house and they have been fighting to stay in the U.S. ever since.
- “The Hand That Feeds” (2014) – Immigrant workers organize themselves to fight a culture of exploitation and mistreatment that gives them zero rights and only slightly more in wages. Due to their undocumented status, they have come up against a brick wall to improve conditions, but their determination builds into a popular movement that draws on the wider community, the courts, and Occupy Wall Street protestors.
- “Which Way Home” (2009) – This Academy Award-nominated documentary follows three children who make a dangerous trek through Mexico en route to the U.S. border, atop the dangerous train known as ‘la bestia,’ in hopes of reuniting with their parents
- “Who is Dayani Cristal?” (2013) – This documentary begins in the Arizona desert where a body of a migrant is found with only one clue as to his identity: a tattoo that reads “Dayani Cristal.” To retrace his path and discover his story, the directors embed themselves among migrant travelers on their own mission to cross the border, providing insight into the stories so often ignored in the immigration debate.
- Cruz, A. (2016). “19 amazing works of art that show who undocumented immigrants really are.”
- Mendoza, E. (2018). “Art as resistance: 7 undocumented artists that you want to follow.” The Body is Not an Apology.
- Juárez Jr., E. “Path to citizenship.” Things I’ll Never Say.
- Pacheco, G. “Yo soy el inmigrante madre.” Things I’ll Never Say. | <urn:uuid:ee030cad-200f-452c-b1b8-70ceef0aa424> | CC-MAIN-2022-33 | https://students.wustl.edu/community-resources-daca/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.951352 | 1,870 | 1.953125 | 2 |
The University of Rochester has the first running 3D processor. The processor attempts to be more efficient at running multiple processes at once by spreading the workload over multiple processors stacked on one another.. The "cube" is currently running at 1.4GHz.
"Unlike past attempts at 3-D chips, the Rochester chip is not simply a number of regular processors stacked on top of one another. It was designed and built specifically to optimize all key processing functions vertically, through multiple layers of processors, the same way ordinary chips optimize functions horizontally. The design means tasks such as synchronicity, power distribution, and long-distance signaling are all fully functioning in three dimensions for the first time."
The University of Rochester (www.rochester.edu) is one of the nation’s leading private universities. Located in Rochester, N.Y., the University gives students exceptional opportunities for interdisciplinary study and close collaboration with faculty through its unique cluster-based curriculum. Its College of Arts, Sciences, and Engineering is complemented by the Eastman School of Music, Simon School of Business, Warner School of Education, Laboratory for Laser Energetics, Schools of Medicine and Nursing, and the Memorial Art Gallery. | <urn:uuid:36bb4a04-c95a-4506-8915-3286663e97d6> | CC-MAIN-2022-33 | https://www.zollotech.com/2008/09/16/new-3d-processor-up-and-running/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.933855 | 249 | 2.0625 | 2 |
Recognition memory function of pre-diabetic HIP rats was intermediate, but not significantly different from either WT rats or diabetic HIP rats (Figure? 3A). hypersecretion of amylin (hyperamylinemia), which is common in humans with obesity or pre-diabetic insulin resistance. Human amylin oligomerizes quickly when oversecreted, which is toxic, induces inflammation in pancreatic islets and contributes to the development of T2D. Here, we tested the hypothesis that accumulation of oligomerized amylin affects brain function. Methods In contrast to amylin from humans, rodent amylin is neither RWJ-51204 amyloidogenic nor cytotoxic. We exploited this fact by comparing rats overexpressing human amylin in the pancreas (HIP rats) with their littermate rats which express only wild-type (WT) non-amyloidogenic rodent amylin. Cage activity, rotarod and novel object recognition tests were performed on animals nine months of age or older. Amylin deposition in the brain was documented by immunohistochemistry, and western blot. We also measured neuroinflammation by immunohistochemistry, quantitative real-time PCR and cytokine proteins levels. Results In comparison to WT rats, HIP rats display em i /em ) decreased Tshr exploratory travel, em ii /em ) impaired reputation memory space and em iii /em ) no capability to improve the efficiency for the rotarod. The introduction of neurological deficits can be connected with amylin build up in the mind. The amount of oligomerized amylin in supernatant fractions and pellets from mind homogenates is nearly dual in HIP rats weighed against WT littermates (P? ?0.05). Huge amylin debris ( 50?m size) were also occasionally observed in HIP rat brains. Build up of oligomerized amylin alters the mind structure in the molecular level. Immunohistochemistry evaluation with an ED1 antibody shows possible triggered microglia/macrophages that are clustering in areas positive for amylin infiltration. Multiple inflammatory markers are indicated in HIP rat brains instead of WT rats, confirming that amylin deposition in the mind induces a neuroinflammatory response. Conclusions Hyperamylinemia promotes build up of oligomerized amylin in RWJ-51204 the mind RWJ-51204 resulting in neurological deficits via an oligomerized amylin-mediated inflammatory response. Extra studies are had a need to determine whether brain amylin accumulation might predispose to diabetic brain injury and cognitive decline. strong course=”kwd-title” Keywords: Diabetes, Alzheimers Disease, Amylin, Pre-diabetes, Insulin Level of resistance, Swelling, Behavior Background Individuals with type-2 diabetes (T2D) are in improved RWJ-51204 risk for developing cerebrovascular damage and cognitive decrease [1-4]. Systems implicated by prior function consist of atherosclerotic disease [1-4] and derangements in mind responsiveness to insulin [1-4], that are also common in nondiabetic patients (discover Guide , for a recently available review). We’ve recently demonstrated that mind tissue from individuals with T2D and cerebrovascular dementia or Alzheimers disease (Advertisement) contains significant build up from the pancreatic hormone amylin (islet amyloid polypeptide). With this paper, we record ramifications of amylin build up on mind function within an pet model. Amylin, a 37 amino acidity peptide with amyloidogenic properties, can be synthesized and co-secreted with insulin by pancreatic -cells and takes on a complex part in modulating peripheral energy stability. A number of the metabolic results exerted by amylin are opposing those of insulin [7-10]. For instance, amylin restrains insulin secretion from pancreatic -cells and decreases glycogen synthesis and blood sugar uptake in isolated muscle tissue strips [8-10]. Furthermore to its part in peripheral metabolic procedures, amylin exerts dual results on the blood circulation pressure by revitalizing renal launch of renin and rest of arteries [12,13]. Amylin also crosses the bloodCbrain hurdle and it is a powerful inhibitor of ingestive behavior . Relative to amylins anorexic results, amylin binding sites had been recognized in feeding-related centers, like the brainstem, hypothalamic nuclei and parabrachial region [7,15-17]. A dense distribution of high-affinity amylin binding sites was determined in nucleus accumbens also. Direct infusion of.
Individual satisfaction was typically low moderately, and an increased affected individual satisfaction was connected with an improved global outcome. Clinical Significance PANDAS and PANS are serious and organic psychiatric disorders. patient scored treatment effects, also to establish if any particular treatment predicts higher affected individual satisfaction. Fifty-three sufferers (m?=?33, f?=?20, median age group?=?14, a long time?=?4C36) with suspected PANS or PANDAS were enrolled and assessed for PANS and PANDAS caseness, remedies given, treatment results, global improvement, and individual satisfaction. Situations with verified and suspected PANS or PANDAS had been likened about the regularity of remedies given and treatment effect. A linear regression model was used to see if treatments given or global improvement predicted patient satisfaction. Twenty-four participants fulfilled criteria for PANS or PANDAS and 29 did not. The most common treatments given were antibiotics (88%), nonsteroidal anti-inflammatory drugs (67%), cognitive behavioral therapy (53%), and selective serotonin reuptake inhibitors (42%). There were no major differences between confirmed and suspected cases regarding what treatments they had Sinomenine hydrochloride received or their effect. Patient satisfaction was predicted by overall clinical improvement at the time of assessment. Antibiotics and intravenous immunoglobulin (IVIG) were rated as the most successful treatments by participants and were associated with higher patient satisfaction. It was more common that Sinomenine hydrochloride patients had received antibiotics than common psychiatric treatments for their psychiatric symptoms. Antibiotics and IVIG were experienced as effective treatments by the patients. Patient satisfaction was on average moderately low, and higher patient satisfaction was associated with global clinical improvement. analysis of data collected within the study PANSA detailed study of the patients, their symptoms, biomarkers, and treatment offered in a Scandinavian cohort, which was registered before enrollment of participants; Clinicaltrials.gov; “type”:”clinical-trial”,”attrs”:”text”:”NCT02190292″,”term_id”:”NCT02190292″NCT02190292. The aim of the recruitment procedure was to be able to compare patients with PANS to psychiatric patients who did not fulfill criteria for PANS. Because one of the aims of the larger study was to evaluate the diagnostic value of a blood test aimed at diagnosing PANS or PANDAS, the recruitment and inclusion followed Standards for Reporting of Diagnostic Accuracy Studies guidelines for studies of diagnostic accuracy (Bossuyt et al. 2015). These guidelines require that this diagnostic test can differentiate between true cases and patients who are likely to be assessed for the disorder in the Sinomenine hydrochloride clinic. The blood test evaluated is called the Cunningham Panel (Moleculera 2016), and the methods and result of this study are described in a previous article (Hesselmark and Bejerot 2017). The Cunningham Panel comprises five analytes measured in serum: calcium/calmodulin dependent kinase II activation, Dopamine receptor D1 and D2 antibodies, -tubulin antibodies, and lysoganglioside antibodies (Moleculera 2016) and was developed by Moleculera Labs, Oklahoma City, OK. At the time of inclusion, the name used for Cunningham Panel in Sweden was PANDAS-panelen or the PANDAS panel. The panel is costly, and it could only be ordered from one specific laboratory (Wieslab). The panel also had to be ordered by a medical doctor (self-referrals were not accepted by Wieslab). Thus, it was concluded that patients who had taken the panel had been suspected of having PANS or PANDAS by the physician who ordered the test. By inviting all patients who had taken the test (regardless of their test results) and then assessing them for PANS and PANDAS criteria (while being blind to their test results), two groups were formed: one group who fulfilled PANS or PANDAS criteria (Interview Confirmed PANS), and one group who was clinically comparable, but who did not fulfill criteria (Suspected PANS). Participants and recruitment All patients (analysis patient-rated CGI-I was added to the regression model of any significant results, to see if the relationship between specific treatments and CSQ was driven mainly by clinical improvement. All data were analyzed using SPSS version 23. The Bonferroni method was used to adjust for multiple comparisons within each analysis. Demographic data are presented as medians or proportions. Ethical considerations All study participants and/or legal guardians granted informed consent. Our protocol was approved by the Regional Ethics Review Board of Stockholm (2014/551-31/2; 2014/1711-32; 2015/964-31; 2016/2121-32). Results Inclusion and demographics A total of 154 patients had taken the Cunningham Panel before study enrollment and were thus invited to participate in the study. Sixty patients responded to the invitation, 53 of whom chose to participate and underwent the diagnostic interview for PANS and PANDAS. See Physique 1 for inclusion flowchart. Median age at disorder onset was 7.9 years (range 1C20), and median age at time of our assessment was 14 years (range 4C36). Participants were markedly ill at the time of assessment with a median CGI-S score of 5 (range 2C7). The median CSQ score was 17 (range?=?8C32), which indicates mild dissatisfaction with the health care services received. For detailed demographic data, see Table Rabbit Polyclonal to GNAT1 1. Table 1. Demographic Information on Included Patients (n(%)20 (38)0Confirmed PANS or.
No horses presented with virus shedding (Table?3) or seroconversion (Table?4) in this study. the dogs and horses were clinically observed. Computer virus titres in nasal swab extracts and serological responses were also evaluated. In addition, all the animals were subjected to a gross pathological examination after euthanasia. Results All three dogs inoculated with CIV exhibited clinical indicators including, pyrexia, cough, nasal discharge, computer virus shedding and seroconversion. Gross pathology revealed lung consolidations in all the dogs, and subsp. was isolated from your lesions. Meanwhile, none of the paired horses showed any clinical indicators, virus shedding or seroconversion. Moreover, gross pathology revealed no lesions in the respiratory tracts including the lungs HLM006474 of the horses. Conclusions These findings may indicate that a single dog infected with CIV is not sufficient to constitute a source of CIV contamination in horses. subsp. was isolated from your lung consolidations of Dogs 1, 2 and 3 (2.4??104, 1.2??104 and 7.4??105 HLM006474 colony forming unit/g, respectively). It has been reported that secondary pneumonia induced by subsp. was observed in diseased dogs during a CIV outbreak in Iowa in the United States in 2005 . Collectively, these findings demonstrate that we reproduced the typical clinical features of field canine influenza experimentally infected with CIV. Open in a separate window Physique 1 Body temperatures of each doggie. The horizontal dotted collection represents 39.5C Table 2 Clinical scores for each animala thead valign=”top” th align=”left” rowspan=”1″ colspan=”1″ Days after inoculation /th th align=”left” rowspan=”1″ colspan=”1″ Doggie 1 /th th align=”left” rowspan=”1″ colspan=”1″ Horse 1 /th th align=”left” rowspan=”1″ colspan=”1″ Doggie 2 /th th align=”left” rowspan=”1″ colspan=”1″ Horse 2 /th th align=”left” rowspan=”1″ colspan=”1″ Doggie 3 /th th align=”left” rowspan=”1″ colspan=”1″ Horse 3 /th /thead ?1 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0 hr / 1 hr / 0 hr / 0 hr / 0 hr / 0 hr / 0.5 hr / 0 hr / 2 hr / 0 hr / 0 hr / 1.5 hr / 0 hr / 2.0 hr / 0 hr / 3 hr / 1.0 hr / 0 hr / 0.5 hr / 0 hr / 0.5 hr / 0 hr / 4 hr / 0.5 hr / 0 hr / 0.5 hr / 0 hr / 0.5 hr / 0 hr / 5 hr / 0.5 hr / 0 hr / 0 hr / 0 hr / 0.5 hr / 0 hr / 6 hr / 1.0 hr / 0 hr / 0.5 hr / 0 hr / 1.0 hr / 0 hr / 7 hr / 0 hr / 0 hr / 0.5 hr / 0 hr / 0.5 hr / 0 hr / 8 hr / 1.0 hr / 0 hr / 0.5 hr / 0 hr / 2.5 hr / 0 hr / 9 hr / 1.0 hr / 0 hr / 0.5 hr / 0 hr / 2.0 hr / 0 hr / 10 hr / 2.0 hr / 0 hr / 1.0 hr / 0 hr / Rabbit Polyclonal to PHACTR4 3.5 hr / 0 hr / 11 hr / 0.5 hr / 0 hr / 0.5 hr / 0 hr / 0.5 hr / 0 hr / 12 hr / 0.5 hr / 0 hr / 0 hr / 0 hr / 2.0 hr / 0 hr / 13 hr / 1.5 hr / 0 hr / 0.5 hr / 0 hr / 1.5 hr / 0 hr / 14b hr / 0 hr / 0 hr / 0 hr / 0 hr / 1.5 hr / 0 hr / 15 hr / Nil hr / 0 hr / Nil hr / 0 hr / Nil hr / 0 hr / 16 hr / Nil hr / 0 hr / Nil hr / 0 hr / Nil hr / 0 hr / 17 hr / Nil hr / 0 hr / Nil hr / 0 hr / Nil hr / 0 hr / 18 hr / Nil hr / 0 hr / Nil hr / 0 hr / Nil hr / 0 hr / 19 hr / Nil hr / 0 hr / Nil hr / 0 hr / Nil hr / 0 hr / 20 hr / Nil hr / 0 hr / Nil hr / 0 hr / Nil hr / 0 hr / 21bNil0Nil0Nil0 Open in a separate window a Animals with the same number were paired. bThe dogs and horses were euthanized on Day 14 and 21, respectively, after sample collection Table 3 Virus detection by egg culture and titre (log10EID50/200?l) of nasal swab specimen collected daily from each animal thead valign=”top” th align=”left” rowspan=”1″ colspan=”1″ Days after inoculation /th th align=”left” rowspan=”1″ colspan=”1″ Doggie 1 /th th align=”left” rowspan=”1″ colspan=”1″ Horse 1 /th th align=”left” rowspan=”1″ colspan=”1″ Doggie 2 /th th align=”left” rowspan=”1″ colspan=”1″ Horse 2 /th th align=”left” rowspan=”1″ colspan=”1″ Doggie 3 /th th align=”left” rowspan=”1″ colspan=”1″ Horse 3 /th /thead ?1 hr / -a hr / – hr / – hr / – hr / – hr / – hr / 0 hr / – hr / – hr / – hr / – hr / – hr / – hr / 1 hr / – hr / – hr / 1.3 hr / – hr / – hr / – hr / 2 hr / 2.0 hr / – hr / 1.5 hr / – hr / – hr / HLM006474 – hr / 3 hr / 1.0 hr / – hr / 2.2 hr / – hr / 1.0 hr / – hr / 4 hr / – hr / – hr / – hr / – hr / 1.0 hr / – hr / 5 hr / – hr / – hr / 2.8 hr / – hr / 1.7 hr / – hr / 6 hr / – hr / – hr / – hr / – hr / – hr / – hr / 7 hr / – hr / – hr / – hr / – hr / – hr / – hr / 8 hr / – hr / – hr / – hr / – hr / – hr / – hr / 9 hr / – hr / – hr / – hr / – hr / – hr / – hr / 10 hr / – hr / – hr / – hr / – hr / – hr / – hr / 11 hr / – hr / – hr / – hr / – hr / – hr / – hr / 12 hr / – hr / – hr / – hr / – hr / – hr / – hr / 13 hr / – hr / – hr / – hr / – hr / – hr / – hr / 14a hr / – hr / – hr / – hr / – hr / – hr / – hr / 15 hr / Nil hr / – hr / Nil hr / – hr / Nil hr / – hr / 16 hr / Nil hr / – hr / Nil hr / – hr / Nil hr / – hr / 17 hr / Nil hr / – hr / Nil hr / – HLM006474 hr / Nil hr / – hr / 18 hr / Nil hr / – hr / Nil hr / – hr / Nil hr / – hr / 19 hr / Nil hr / – hr / Nil hr / – hr / Nil hr / – hr / 20 hr / Nil hr / – hr / Nil hr / – hr / Nil hr / – hr / 21cNil-Nil-Nil- Open in a separate window a 0.7 (No CIV haemagglutination activity was detected from four eggs inoculated with 1:10 dilution of nasal swab specimen). Table 4 HI titres of each animal thead valign=”top” th align=”left” rowspan=”1″ colspan=”1″ Days after inoculation /th th align=”center” rowspan=”1″ colspan=”1″ Doggie 1 /th th align=”center” rowspan=”1″ colspan=”1″ Horse 1 /th th align=”center” rowspan=”1″ colspan=”1″ Doggie 2 /th th align=”center” rowspan=”1″ colspan=”1″ Horse 2 /th th align=”center” rowspan=”1″ colspan=”1″ Doggie 3 /th th align=”center” rowspan=”1″ colspan=”1″ Horse 3 /th /thead ?1 hr / 10 hr / 10 hr / 10 hr / 10 hr / 10 hr / 10 hr / 9 hr / 40 hr / 10 hr / 40 hr / 10 hr / 20 hr / 10 hr / 14 hr / 160 hr / 10 hr / HLM006474 640 hr / 10 hr / 320 hr / 10 hr / 21Nil 10Nil 10Nil 10.
After the initial getting of abnormal IL-6 levels in cartilage tissue, these effects were further validated through cell culture experiments. androgen receptor (AR), and its downstream pathway proteins. Results The serum androgen level in the AIS group was significantly decreased (1.940.09 2.2840.103) Lurbinectedin compared with that in the non-AIS (control) group. The solitary nucleotide polymorphism genotyping results showed the mutation rates of rs6259 between the AIS and control organizations were significantly different (G/G genotype: 48.4% 42.1%, G/A genotype: 40.4% 35.7%, P 0.05). The levels of interleukin (IL)-6 and metalloproteinase (MMP)-13 were improved in the cartilage of AIS individuals, and these individuals also exhibited decreased AR levels. The cell experiment results showed that androgen reduced the degree of irregular cartilage development in female AIS individuals through the AR/IL-6/transmission transducer and activator of transcription 3 (STAT3) signaling pathway. Conclusions Our study provides a fresh perspective within the pathogenesis of AIS and shows that decreased androgen levels in woman AIS individuals play a potential part in the development of AIS via the AR/IL-6/STAT3 signaling pathway. showed that androgen is definitely involved in trabecular bone maintenance and cortical Lurbinectedin bone growth (10). The androgen receptor (AR) is definitely extensively distributed throughout the body, and in bone cells, the AR is mainly distributed in growth sites where proliferation and maturation are advertised during endochondral ossification and in bone redesigning sites, demonstrating that androgen directly functions on cartilage and bone (11). A study carried out by Cicuttini indicated that androgen is definitely positively correlated with the male tibial cartilage volume (12). In addition, a study performed by Steffens showed that androgen regulates experimental bone loss through the AR (13). Although androgen is definitely closely associated with bone development, the part of androgen in the development of AIS and whether androgen induces irregular cartilage or bone development in individuals with AIS have not been reported. Furthermore, serum androgen levels are affected by many factors. Recent studies confirmed that solitary nucleotide Lurbinectedin polymorphism (SNP) loci, including rs12150660, rs727428, rs6259, rs5934505, rs10822184, and rs6258, are associated with serum androgen levels (14-16). Consequently, we enrolled 161 females with AIS and 140 females without AIS and performed genotyping to determine the causes of the reductions in the androgen level observed in individuals with AIS. Our earlier studies showed that interleukin (IL)-6 manifestation is improved in the cartilage of individuals with AIS, suggesting that IL-6 might be associated with the development of AIS. A study carried out by Cho DC showed that androgen blocks IL-6 to promote cortical bone formation in mice (17), indicating that IL-6 manifestation in individuals with AIS might be correlated with androgen abnormalities. In addition, several studies possess indicated that IL-6 is definitely closely associated with cartilage abnormalities in individuals with osteoarthritis (18-20). As a member of the interleukin family, IL-6 can be secreted by many types of cells and may induce the proliferation and differentiation of many cell types. A study carried out by Yamaguchi showed that chondrocytes in individuals with hip synovitis secrete IL-6 and stimulate synovial cell proliferation (21). Earlier studies have confirmed that IL-6 promotes the differentiation of mesenchymal stem cells into chondrocytes and the self-repair of cartilage through the IL-6/STAT3 pathway (22). However, whether IL-6 is definitely associated with the development and progression of AIS has not been reported. Therefore, this study investigated whether androgen and IL-6 abnormalities induce irregular cartilage development in individuals with AIS. Methods Subjects All the specimens were collected from female AIS individuals between 10 and 17 years of age and matched individuals without AIS (2.2840.103) (2.2840.103). *shows a significant difference compared with the control group (P 0.05). SNP genotype rate of recurrence distributions in AIS and non-AIS individuals We genotyped eight SNPs that were previously shown to be related to the serum androgen levels. Specifically, a total of 161 AIS individuals and 140 settings were successfully genotyped and subjected to statistical analysis. The eight genotyped SNPs in the two groups were analyzed using the Chi-square (and FANCC Fishers precise) test. The genotype distribution frequencies are outlined in control)42.1%, G/A genotype: 40.4% 35.7%, and A/A genotype: 11.2% 22.2%; P 0.05). Improved IL-6 manifestation and reduced AR manifestation in the cartilage of AIS individuals To confirm that androgen manifestation is associated with cytokines and proteins in the.
S. that Suggestion60-mediated rules of Np63 raises mobile proliferation by advertising G2/M development through MTS assays and movement cytometry. Taken collectively, our results offer proof that Suggestion60 might donate to SCC development by raising Np63 proteins amounts, promoting cellular proliferation thereby. (stand for 1 S.D. *, 0.05 weighed against control cells in every sections. Inhibition of Suggestion60 decreases Np63 expression Suggestion60 catalytic activity promotes the transcription of multiple genes both straight and indirectly (24). To measure CD247 the ramifications of pharmacological inhibition of endogenous Suggestion60 acetyltransferase activity on Np63 transcript amounts, A431 and FaDu cells had been treated having a Suggestion60-selective inhibitor (100 m NU9056) (25, 26) for 24 h. NU9056 treatment didn’t affect Suggestion60 mRNA amounts but reduced Suggestion60 protein amounts, consistent with earlier studies displaying that Suggestion60 autoacetylation confers proteins balance (27, 28). Inhibiting Suggestion60 activity with NU9056 decreased both Np63 proteins (Fig. 2 0.05). indicate 1 S.D. and and with and with acetylation and and assay using recombinant GST-Np63 and GST-TIP60. Because Suggestion60 goes through autoacetylation, it offered like a positive control (34). PD-1-IN-17 Needlessly to say, we observed improved autoacetylation of Suggestion60 in the current presence of acetyl-CoA (Fig. 4reaction with GST and Suggestion60 and didn’t observe any acetylation of GST (data not really demonstrated). Finally, to verify that Np63 acetylation in cells can be mediated by Suggestion60, H1299 cells had been transfected with Np63 with and without Suggestion60 and in the existence or lack of 100 m NU9056 or 50 m anacardic acidity (an over-all acetyltransferase inhibitor). Immunoprecipitation from whole-cell components using anti-acetyl lysine antibody demonstrated that Suggestion60 improved acetylation of Np63 (Fig. 4and and acetylation assay was completed using recombinant Suggestion60-GST with GST-Np63. Immunoblot evaluation was performed to identify protein using anti-acetyl lysine, anti-TIP60, and anti-p63 antibodies. with and quantitated in Fig. 5and axis represents the -collapse change of every condition in accordance with = 6 h. stand for regular deviation through the suggest. represent 1 S.E. from the mean from three 3rd party tests. *, 0.05). and with axis and and represents the -collapse modification of every condition in accordance with = 6 h. represent regular deviation through the mean. represent the typical deviation through the suggest from three PD-1-IN-17 3rd party tests (*, 0.05). was performed using the indicated antibodies 12 h post-synchronization. Dialogue The proto-oncogene Np63 can be overexpressed in SCC and basal cell carcinoma and promotes tumor cell proliferation by traveling cell cycle development (3, 10). In this scholarly study, we identified Suggestion60 like a book positive regulator of Np63 transcript and proteins amounts (Fig. 1). We display that Suggestion60 prevents the ubiquitination and proteasomal degradation of Np63, which can be associated with immediate acetylation of Np63. Furthermore, TIP60 up-regulation of Np63 led to increased mobile cell and proliferation routine development. We noticed that NU9056 treatment decreased Suggestion60 protein amounts (Fig. 2and and (23) proven that silencing Suggestion60 leads to build up of cells in G2/M by an unfamiliar mechanism. Although Suggestion60 continues to be reported previously to straight stabilize p21Cip1/Waf1 (42), we discovered that silencing Suggestion60, like Np63, decreased G2/M development while simultaneously raising p21Cip1/Waf1 amounts (Fig. 5, and induced using 1 mm isopropyl 1-thio–d-galactopyranoside (Sigma-Aldrich) at 16 C over night. Proteins had been purified by GST affinity chromatography using GSTrap FF columns (GE Health care) based on the manufacturer’s guidelines. In vitro acetylation assay 100 ng of purified GST-TIP60 was incubated with 250 ng of GST-Np63 and 100 m acetyl-CoA (Sigma-Aldrich) in 1 histone acetyltransferase response buffer (50 mm Tris-HCl (pH 8.0), 150 mm NaCl, 10 mm sodium butyrate, and 10% glycerol) in 30 C for 2 h. Acetylated and total proteins levels were verified via immunoblot evaluation. Cell proliferation assays 24 h post-siRNA transfections, cells were reseeded and harvested inside a 96-good flat-bottom tradition dish in 2500/good for PD-1-IN-17 MTS assays. Proliferation was assessed using the Cell Titer 96 AQueous One Option cell proliferation assay (MTS, Promega) in the indicated period points based on the manufacturer’s guidelines. Double thymidine stop A dual thymidine stop was performed utilizing a regular process to arrest cells in G1/S stage as described previous (65). Quickly, cells had been seeded and permitted to reach 40% confluency. The moderate was removed, changed with fresh moderate including 2 mm thymidine, and cells had been incubated for 19 h. Pursuing incubation, cells had been cleaned with PBS 3 x, and the moderate was changed. After 9 h, the moderate was changed with fresh moderate including 2 mm thymidine for 16 h. Cells had been cleaned with PBS as before after that, fresh press was put into each condition, and.
S11bCompact disc). Correspondingly, we further explored the consequences of specific CCR1 inhibition in allergic airway inflammation in vivo. in the crosstalk between HSCs and eosinophils through the advancement of allergic airway irritation, which also reveals a potential healing strategy for FG-2216 concentrating on G protein-coupled receptors (GPCRs) for potential scientific treatment of asthma. and in the asthma sufferers had been greater than those in the handles FANCF (Fig. ?(Fig.1a).1a). Furthermore, the serum hCCL23 concentrations in the asthma group had been greater than those in the healthful control topics (Fig. ?(Fig.1b)1b) and correlated with the amount of eosinophils in peripheral bloodstream (Fig. ?(Fig.1c).1c). After that, we separated individual eosinophils, monocytes, and neutrophils in bloodstream from asthma sufferers and performed immunofluorescence staining (Fig. ?(Fig.1d).1d). Cells were verified through Wright-Giemsa immunofluorescence and staining staining. Notably, hCCL23 and hCCL15 appearance was mainly within eosinophils weighed against various other cell types in white bloodstream cells (Fig. ?(Fig.1e1e and Supplementary Fig. S1a, b). As a result, up-regulation of hCCL23 and hCCL15 in sufferers with asthma suggests a feasible involvement of the cytokine in hypersensitive airway inflammation. Open up in another screen Fig. 1 Elevated expressions of hCCL23 and hCCL15 in asthma sufferers. a member of family mRNA expressions of and altogether white bloodstream cells (WBCs) from asthma sufferers (suggest residues at each aligned placement that are similar towards the hCCL23 and hCCL15 specificity. suggest gaps which were placed to optimize the position. b Schematic timeline and following sample digesting of FG-2216 hypersensitive asthma mouse versions. c-e Expressions of mCCL6 in BALF supernatant (c), lung tissues (d), and serum (e) assessed by ELISA from NS or OVA-challenged mice. Each true point represents a person mouse; data from 4C5 mice per group are plotted as mean??SEM. f Relationship of mCCL6 proteins levels with the amount of eosinophils in murine BALF (knockout (mice (Fig. ?(Fig.3b).3b). Man and feminine mice appeared FG-2216 healthful without basal flaws in complete bloodstream cell matters FG-2216 (Supplementary Desk S2). However, following establishment from the OVA-induced asthma model, we discovered that the mice exhibited a reduced eosinophil count number in BALF considerably, whereas no significant results had been seen in the various other cell types in BALF (Fig. ?(Fig.3c).3c). Pathological lung section evaluation showed which the OVA-challenged WT mice exhibited apparent inflammatory cell infiltration throughout the bronchi, as the mice exhibited a substantial attenuation of inflammatory infiltration (Fig. 3d, e), alleviation of eosinophilia especially, predicated on EPX staining (Fig. 3f, g). Regular acid-Schiff (PAS) staining additional revealed which the mice shown a light response towards the OVA problem with much less mucus secretion (Fig. 3h, i). Additionally, dual immunofluorescence staining of BALF cells with EPX and mCCL6 antibodies verified these leads to OVA-challenged WT and mice (Supplementary Fig. S4a). Open up in another screen Fig. 3 CCL6 insufficiency alleviates OVA-induced eosinophilic airway irritation. a Schematic map of set up and in lung tissue had been dependant on quantitative RT-PCR at 24?h following the last OVA or NS problem. k The focus of IL-33 and IL-4 in lung tissues dependant on ELISA. Data are mean SEM for 4C5 mice per group, 5C7 pictures per mouse. *and secreted airway mucin mRNA appearance seen in the lung tissue from the OVA-challenged WT mice had been considerably attenuated in the mice (Supplementary Fig. S4b). Utilizing a TH2 cell stream cytometry gating technique26 in the lung tissues (Fig. S5a), we present decreased infiltration of TH2 cells from lung tissue in the OVA-challenged and (Fig. ?(Fig.3j)3j) and elevated concentrations of IL-4 and IL-33 proteins (Fig. ?(Fig.3k)3k) in OVA-challenged WT mice were significantly attenuated in OVA-challenged mice. These data suggest that OVA-induced airway irritation is CCL6-reliant.
J Leukoc Biol 82:710C720. College and STAT91 Middle of Community Wellness, Fudan School, Shanghai, China. ABSTRACT The GS-7340 principal target body organ of coronavirus disease 2019 (COVID-19) infections is the respiratory system. Currently, there is bound details on the power of serious acute respiratory symptoms coronavirus 2 (SARS-CoV-2) to infect and regulate innate immunity in individual immune GS-7340 system cells and lung epithelial cells. Right here, we compared the power of four Finnish isolates of SARS-CoV-2 from COVID-19 sufferers to reproduce and induce interferons (IFNs) and various other cytokines in various individual cells. All isolates didn’t replicate in dendritic cells, macrophages, monocytes, and lymphocytes, no induction of cytokine gene appearance was seen. Nevertheless, a lot of the isolates replicated in Calu-3 cells, plus they induced type I and type III IFN gene appearance readily. The hCoV-19/Finland/FIN-25/2020 isolate, from a traveller from Milan in March 2020, demonstrated better capability to replicate and induce IFN and inflammatory replies in Calu-3 cells than various other isolates of SARS-CoV-2. Our data raise the knowledge in the pathogenesis and antiviral systems of SARS-CoV-2 infections GS-7340 in individual cell systems. IMPORTANCE Using the speedy spread from the coronavirus disease 2019 (COVID-19) pandemic, details in the replication of serious acute respiratory symptoms coronavirus 2 (SARS-CoV-2) and legislation of innate immunity in individual immune system cells and lung epithelial cells is necessary. In today’s study, we present that SARS-CoV-2 didn’t productively infect individual immune system cells, but different isolates of SARS-CoV-2 demonstrated differential capability to replicate and regulate innate interferon replies in individual lung epithelial Calu-3 cells. These results will start the way for even more studies in the systems of pathogenesis of SARS-CoV-2 in individual cells. (1). These are enveloped, pleomorphic positive-sense single-stranded RNA infections using a genome size which range from 26 to 32?kb (2). CoVs had been first within infectious bronchitis virus-infected hens in the 1930s (3). CoVs could be sent among different pet types by spillover occasions (2). To time, a huge selection of coronaviruses have already been characterized, with many of them circulating among pets, such as for example mice (4), pigs GS-7340 (5), felines (6), camels (7), ferrets (8), bats (9), and various other animal species. A number of the CoVs are zoonotic, and therefore they might be moved from various other vertebrate types to human beings and trigger disease (10, 11). Presently, a couple of seven types of CoVs that may cause higher and lower respiratory system infections in human beings. HCoV-229E (229E) GS-7340 and HCoV-NL63 (NL63) participate in the genus, while HCoV-OC43 (OC43) and HCoV-HKU1 (HKU1) participate in the genus; these four strains are normal coronaviruses circulating in human beings during wintertime and spring-summer periods and cause generally minor symptoms (12). Nevertheless, the rest of the three betacoronaviruses, SARS-CoV (13, 14), Middle East respiratory syndrome-related coronavirus (MERS-CoV) (13, 14), and SARS-CoV-2 (15) could cause serious symptoms, such as for example pneumonia and severe respiratory distress symptoms (ARDS), which might lead to loss of life. Bats have already been reported to serve as the most likely natural tank for these three CoVs (9, 16); nevertheless, MERS-CoV and SARS-CoV had been sent to human beings via the intermediate hosts civet felines and dromedary camels, respectively (17). The feasible intermediate web host of SARS-CoV-2 hasn’t yet been verified. However, pangolins have already been speculated to have the ability to work as a potential intermediate web host (18, 19). The outbreaks of SARS in China (2002) and MERS in Saudi Arabia (2012) possess resulted in sporadic situations and limited epidemic clusters using a mortality price of 9.6% and 34%, respectively (20). SARS-CoV-2 seems to.
This is also in line with a recent study in which dual CTLA-4/PD-1 blockade promoted rejection of melanoma brain metastases only when an extracranial melanoma tumor was present as well.43 Another recent statement showed that intracerebral delivery of VEGF-C can boost antigen trafficking to deep cervical lymph nodes and travel rejection of GL261 tumors.44 This is a promising new way to modulate antigen trafficking and an exciting candidate for follow-up in the SB28 model in combination with the methods tested here. The dual CTLA-4/PD-1-mediated rejection of SB28 flank tumors was dependent on CD4 T cells and NK cells, while CD8 T cells were less important, suggesting an unconventional effector mechanism of antitumor immunity. properties of the tumor cells versus the specialized immune context of the brain, and if it can be reversed. Methods We used CyTOF mass cytometry to compare the tumor immune microenvironments (TIME) of human being tumors that are generally ICI-refractory (GBM and sarcoma) or ICI-responsive (renal cell carcinoma), as well as mouse models of GBM that are ICI-responsive (GL261) or ICI-refractory (SB28). We further compared SB28 tumors cultivated intracerebrally versus subcutaneously to determine how tumor site affects TIME and responsiveness to dual CTLA-4/PD-1 blockade. Informed by these data, we explored rational immunotherapeutic combinations. Results ICI-sensitivity in human being and mouse tumors was Eprotirome associated with improved T cells and dendritic cells (DCs), and fewer myeloid cells, in particular PD-L1+ tumor-associated macrophages. The SB28 mouse model of GBM responded to ICI when cultivated subcutaneously but not intracerebrally, providing a system to explore mechanisms underlying ICI resistance in GBM. The response to ICI in the subcutaneous SB28 model needed CD4 T cells and NK cells, but not CD8 T cells. Recombinant FLT3L expanded DCs, improved antigen-specific T cell priming, and long term survival of mice with intracerebral SB28 tumors, but at the cost of improved Tregs. Focusing on PD-L1 also long term survival, especially when combined with stereotactic radiation. Conclusions Our data suggest that a major obstacle for effective immunotherapy of GBM is definitely poor antigen demonstration in the brain, rather than intrinsic immunosuppressive properties of GBM tumor cells. Deep immune profiling recognized DCs and PD-L1+ tumor-associated macrophages as encouraging targetable cell populations, which was confirmed using restorative interventions in vivo. and hyperactive ERK signaling through connection between PD-L1 and B7-1 (CD80) on DCs, permitting CD80 to activate T cells via CD28.40 Anti-PD-L1 is also able to act directly on tumor cells, driving cytokine production and in vivo phagocytic activity of glioma TAMs in some contexts.41 Finally, dual CTLA-4/PD-1 blockade can induce apoptosis of tumor-specific T cells in preclinical models with low tumor burden.42 Several lines of evidence suggest that defective antigen demonstration is of central importance in explaining the non-responsiveness of GBM to ICI. Our results in the SB28 model agree with recent reports that mind tumors are poorly infiltrated by DCs.9 10 We observed dramatic differences in antigen presentation and responsiveness to immunotherapy when SB28 tumors were cultivated in the flank as opposed Slc7a7 to the brain. SB28 flank tumors showed a significant influx of cDC2s into the tumors and cDC1s into the tumor-draining lymph nodes, as compared with SB28 intracerebral tumors. This influx was further improved by dual CTLA-4/PD-1 blockade. Further assisting a central part for DCs, the dual CTLA-4/PD-1 blockade-mediated inhibition of SB28 flank tumors was dependent on CD40 signaling, which is definitely important for licensing of DCs. Treatment with huFLT3L improved the rate of recurrence of OVA-presenting cDC1s in cervical lymph nodes and modestly improved survival, therefore highlighting the fundamental problems in antigen demonstration in the brain, and providing a rationale for FLT3L-based strategies to Eprotirome overcome this challenge. This is also in line with a recent study in which dual CTLA-4/PD-1 blockade advertised rejection of melanoma mind metastases only when an extracranial melanoma tumor was present as well.43 Another recent statement showed that intracerebral delivery of VEGF-C can boost antigen trafficking to deep cervical lymph nodes and travel rejection of GL261 tumors.44 This is a promising new way to modulate antigen trafficking and an exciting candidate for follow-up in the SB28 model in combination with the methods tested Eprotirome Eprotirome here. The dual CTLA-4/PD-1-mediated rejection of SB28 flank tumors was dependent on CD4 T cells and NK cells, while CD8 T cells were less important, suggesting an unconventional effector mechanism of antitumor immunity. In our hands, SB28 tumor cells did not express MHC-II, consistent with earlier reports,22 so it is.
Moreover, knockdown of PFKP (Statistics S4A and S4B) considerably induced VSMC autophagy, simply because shown by elevated Beclin1 and Atg5 appearance and transformation of LC3BI to LC3BII (Body?7C) aswell as by increased formation of autolysosomes (Body?7D). and, if therefore, how the discovered miRNA regulates autophagy in angiotensin II (Ang II)-activated VSMCs and mouse AAA versions. In this scholarly study, we survey the id of Sal-miR-58 as an all natural autophagy inducer and VD2-D3 present that Sal-miR-58 induces autophagy and attenuates irritation in VSMCs through cross-species modulation from the Krppel-like aspect 3 (KLF3)/neural precursor cell-expressed developmentally down-regulated 4-like (NEDD4L)/platelet isoform of phosphofructokinase (PFKP) regulatory pathway. Outcomes Sal-miR-58 Specifically Within Might Enter the Mouse Body after Exogenous Administration to Mice We initial utilized a high-throughput sequencing solution to recognize the miRNAs extremely expressed in could possibly be ingested in mice, was implemented to mice intragastrically, and the appearance of Sal-miR-58 VD2-D3 in various tissue of mice was assessed 6?h afterwards. The full total outcomes demonstrated that Sal-miR-58 was discovered in the arteries, liver, spleen, tummy, and little intestine of mice (Body?1C). Because Sal-miR-58 may be the most abundant miRNA in (Body?1A), which is widely distributed after mouth administration in lots of tissue and organs of mice (Body?1C), we centered on the jobs of Sal-miR-58 in every following tests therefore. Open in VD2-D3 another window Body?1 Sal-miR-58 Might Enter the Mouse Body and Induces VSMC Autophagy and Inhibits the Inflammatory Response within a Mouse AAA Model (A) The strategy and result analysis of high-throughput second-generation deep sequencing of and mouse VSMCs. ???p? 0.001 versus VSMCs (n?= 3). (C) qRT-PCR discovered the appearance of was orally implemented to mice for 6 h. ???p? 0.001 versus ppt-miR-414 (n?= 3 in each group). (D) Sal-miR-58 was dependant on qRT-PCR in the serum of mouse AAA versions after exogenous administration of Sal-miR-58 for 28?times. ???p? 0.001 versus (n?= 5 in each group). (E) miRNAs isolated from mouse serum had been treated with/without sodium periodate, and Sal-miR-58 was discovered by qRT-PCR. (F) Aortic ultrasonography was utilized to detect the size of stomach aortas. The mean is represented by The info? SEM. ???p? 0.001 versus mouse stomach aortic dilation after exogenous administration of Sal-miR-58 for 28?times. The info represent the mean? SEM. ???p? 0.001 versus is its anti-inflammation.19 To determine whether Sal-miR-58 exerts a vasoprotective effect by anti-inflammation, apolipoprotein E (ApoE)mice had been infused with Ang II (1,000?ng/kg/min) for 4?weeks to induce AAA development. First, we confirmed that high degrees of Sal-miR-58 could possibly be discovered in the serum of mice irrespective of treatment with Ang II (Body?1D) and showed that Sal-miR-58 was an authentic plant miRNA, seeing that evidenced by the actual fact that Sal-miR-58 isolated from mouse serum was resistant to sodium periodate (oxidizing agent) (Body?1E), which is feature of seed miRNAs.16 Then, we discovered that weighed against saline-infused control mice, infusion of Ang II for 4?weeks led to a significant upsurge in the size of the stomach aortas over the renal artery (size of stomach aortas, 2.383? 4.721?mm versus 1.042? 3.103?mm, ???p? 0.001); nevertheless, the abdominal aorta size of AAA in mice treated with artificial Sal-miR-58 was considerably less than that of the mice infused with Ang II by itself (size of abdominal aortas, 1.832? 5.176?mm versus 2.383? 4.721?mm, ###p? 0.001), seeing that seen by ultrasound aswell as with the nude eyesight (Figure?1F). The mean enlargement price of AAA in mice treated with artificial Sal-miR-58 was VD2-D3 considerably less than that of the mice infused with Ang II by itself (expansion price, 25.620%? 1.789% versus 69.924%? 2.143%, ###p? 0.001) (Body?1G). These VD2-D3 results claim that mice had been greater than those in charge mice considerably, while Sal-miR-58 treatment considerably reduced the appearance of NF-B p65 and p50 (Body?1H). Consistently, weighed against Ang II-infused mice, the serum degrees of inflammatory elements IL-1, IL-6, and TNF- dropped considerably after Sal-miR-58 administration to Ang II-infused mice also, as discovered by ELISA (Body?1I). Because autophagy relates to inflammatory response, and lack of autophagy is certainly a crucial element in triggering inflammatory response,23 we looked PIK3CG into the result of Sal-miR-58 on autophagy. We discovered that.
They estimated a 50% protective neutralization level at an neutralization titer (ID50) between 1:10 and 1:30, which best predicted protection against severe COVID-19.9 However, these quotes derive from the overall population and could not be applicable to immunosuppressed patients. Our data claim that 60 to 80 times after SARS-CoV-2 infections, most convalescent KTRs showed solid neutralization against all tested VoCs. from were or COVID-19 immunized with 2 dosages of BNT162b2. We likened humoral immunity in MLNR 18 KTRs hospitalized for COVID-19 infections with immunity in 25 KTRs with seroconversion after 2-dosage BNT162b2 vaccination. Nucleocapsid antibodies had been measured following the second vaccination in vaccinated sufferers or at hospitalization in COVID-19Ccontaminated sufferers to exclude prior SARS-CoV-2 infections. Baseline features, including immunosuppressive regimens, receive in Supplementary Desk?S1. COVID-19 disease intensity ranged from moderate to important, with 2 COVID-19Crelated fatalities (Supplementary Desk?S2). Immunosuppressive antimetabolite medicine was stopped in every COVID-19 sufferers, and 9 of 18 (50%) sufferers received corticosteroids just (Supplementary Desk?S3). Eight sufferers had infections with the initial SARS-CoV-2 stress, 8 sufferers using the VoC B.1.1.7 (alpha), and 2 sufferers with B.1.351 (beta). Serum was gathered at a median (interquartile range [IQR]) of 72 (67C77) times after hospitalization, or 62 (54C64) times after leading vaccination for COVID-19Ccontaminated or vaccinated KTRs, respectively. We motivated antiCwild-type SARS-CoV-2 spike S1 IgG, neutralizing surrogate antibodies, and performed a bead-based multiplex evaluation of varied SARS-CoV-2 focus on epitopes in 16 convalescent KTRs designed for follow-up and in every 25 vaccinated KTRs. Furthermore, neutralizing antibodies to wild-type, B.1.1.7 (alpha), B.1.351 (beta), and B.1.617.2 (delta) had been measured utilizing a complete pathogen assay (Supplementary Strategies). Our data present that there surely is no factor between vaccinated or convalescent KTRs for commercially obtainable exams, such as for example anti-S1 IgG, neutralizing antibodies dependant on a surrogate pathogen neutralization assay, or antiCreceptor-binding area antibodies (Body?1 aCc). Within a bead-based evaluation CL-82198 of antibodies against different SARS-CoV-2 focus on epitopes, convalescent KTRs demonstrated a broader reactivity against different SARS-CoV-2 focus on epitopes with considerably higher anti-S2 and anti-nucleocapsid antibody amounts weighed against vaccinated KTRs (for both, axis, using the dashed dark range indicating the cutoff for recognition. (d) Titers of neutralizing antibodies against outrageous type, B.1.1.7, B.1.351, and B.1.617.2 variants of concern (VoCs) in SARS-CoV-2 convalescent and BNT162b2 vaccinated kidney transplant recipients, as dependant on serial 2-fold serum dilutions using VeroE6 focus on cells. The Identification50 equals the serum dilution that inhibits 50% from the infectivity. (e) Titers of neutralizing antibodies against outrageous type, B.1.1.7, B.1.351, and B.1.617.2 VoCs in 16 SARS-CoV-2 convalescent kidney transplant recipients 2-3 three months after hospitalization weighed against 12 and 13 2-dosage BNT162b2 vaccinated kidney transplant recipients with and without mycophenolate mofetil (MMF) maintenance therapy, respectively. ?demonstrated that seroconversion in SARS-CoV-2Cvaccinated KTRs is certainly impaired in patients on mycophenolate mofetil (MMF) maintenance therapy.8 As no individual continued to be on MMF therapy during COVID-19 infection, it had been extremely hard to differentiate the result of infection from cessation of immunosuppression in mounting a wide humoral response inside our cohort. Nevertheless, cessation of MMF will not solely explain the bigger neutralization titers in COVID-19Ccontaminated KTRs as seroconverted KTRs without antimetabolite therapy (12 of 25, 48%) still demonstrated lower neutralization titers against B.1.351 and B.1.617.2 weighed against COVID-19 convalescent KTRs (Body?1e). Despite detectable seroconversion in obtainable assays commercially, 8 of 25 (32%), 12 of 25 (48%), and 8 of 25 (32%) 2-dosage vaccinated KTRs didn’t present neutralization against outrageous type, B.1.351, or B.1.617.2, respectively. On the other hand, just 2 of 16 (13%) and 1 of 16 (6%) COVID-19 convalescent KTRs didn’t present detectable neutralizing activity against outrageous type and B.1.617.2, CL-82198 respectively. As yet, it was extremely hard to define humoral or mobile cutoff beliefs that confer defensive immunity. To handle this relevant issue, Khoury modeled SARS-CoV-2 immune system CL-82198 security across different vaccine and convalescent research. They approximated a 50% defensive neutralization level at an neutralization titer (Identification50) between 1:10 and 1:30, which greatest predicted security against serious COVID-19.9 However, these quotes derive from the overall population and could not be applicable to immunosuppressed patients. Our data claim that 60 to 80 times after. | <urn:uuid:e6b1d201-21b8-44f1-b83a-afe3fb11c5cd> | CC-MAIN-2022-33 | https://igf-protein.com/2022/04/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.906279 | 12,500 | 1.875 | 2 |
Is Artificial Turf Safe For Kids & Pets?
As parents to our little ones, our top priority is always their safety. Their well-being is protected at all costs, even more than ours. We want them to grow healthy, well-rounded, and with love for themselves much as we have.
This is why the first thing we ask ourselves when we see artificial grass is… “Is artificial turf safe for my children?”
Is it, really? To understand this, we must first dig into the composition of artificial turf.
What is artificial grass made of?
Most artificial turfs are made of polyethylene. It’s the kind of plastic used to make children’s toys, grocery bags, and even bullet-proof vests. Polypropylene is also in the mix. This is commonly used for plastic utensils and microwavable containers. Nylon is also used for heat resistance.
Are these the materials that make artificial grass dangerous?
No. An article from The Washington Post written by Stuart Shalat, an Environmental Health Professor, discusses this topic. And we’re more than happy to give you his insights for your reference.
Shalat says, “Based on studies I have reviewed and conducted, I believe there is a potential health risk because of the chemicals in tires, which are recycled into crumbs to support the plastic blades of synthetic grass.”
What is artificial turf made up of?
As Shalat talks through, “Artificial turf is made up of three major parts:
- Backing material that will serve to hold the individual blades of artificial grass
- The plastic blades themselves.
- The infill, those tiny black crumbs, that helps support the blades.”.
What makes them harmful?
Shalat points out, “Various pigments are used to provide the green color of the blades. These can include lead or titanium for the white lines and still other metals for school logos on the field.
Those little black crumbs are the problems. Tires can be toxic.”
Is artificial turf safe for kids?
Yes, definitely! Crumb rubber made from the ground up recycled tires are the culprits that make artificial grass unsafe. These are the properties that give artificial grass such a bad reputation. The good news is: putting infill is optional. Also, there are no natural alternatives to it like crushed rocks. Artificial turf with toxic amounts of lead has also been discontinued by turf manufacturers. We’ll discuss these more in-depth in the later paragraphs.
What’s important now is that you know that generally, the artificial grass blades are safe for your kids. You can definitely have artificial turf at home without crumb rubber endangering your lives. However, there is some low-quality turf grass out there. We don’t know what they’re made of, and we can’t vouch for them either. If you want to be sure that your kids are safe, go for manufacturers that pride themselves for being non-toxic and lead- free.
Fortunately, there are brands that go above and beyond the general rule. By offering non-toxic, lead-free, toxin-free artificial grass, King Turf ensures not only your kids’ safety.
But yours as well.
Is Artificial Turf Safe for Pets?
Our furbabies aren’t so different from our tiny humans, are they? They’re all whiney poop machines who are constantly hungry for food and attention. But we love them all the same. If we could give them everything, we would. This is why we’re looking for answers. We wanna know that an investment as big as artificial turf won’t be any harm to them. And hopefully, they’ll benefit from it as much as we will.
The major health concern about synthetic grass of the past is lead exposure. Thankfully, in 2008, the Center for Environmental Health (CEH) and major turf makers agreed to ensure artificial turf safety by freeing it from lead.
Another safety concern with artificial grass is the tripping hazard on uneven surfaces. This is also a problem with natural grass because you won’t be able to see uneven surfaces in a manicured lawn. The best thing about artificial turf is that if it is installed by a professional, you don’t need to worry about stumbling. You can be ~trippin’~ on your lawn instead.
Does artificial turf cause cancer?
Studies show no conclusive evidence linking fake grass to cancer. But why is there even such a discussion? What led people to believe that artificial grass can cause cancer?
Amy Griffin, associate head coach at the University of Washington, has worked with students for 24 years. In her speech, she described her experience with students and artificial turf.
She made a list of athletes who were diagnosed of cancer, and as of February 2019, that list has 260 names. 119 of them are goalkeepers. She says that since the beginning, goalies were always at 59-61% of the victims. It is thought that because goalkeepers are more in contact with the grass (they dive and slam their bodies on the turf) they are more prone to cancer.
Griffin acknowledges that “correlation is different from causation.” But, according to her list, the incidents of cancer rose as more playing fields of natural grass were changed to artificial turf fields (with crumb rubber infill.) This is the same rubber from the ground up recycled tires.
Griffin says that the EPA (Environmental Protection Agency) is in charge of keeping residents of the United States safe from environmental factors. They’re the ones who said that rubber tires are toxic. People can’t throw them out, can’t bury them, can’t burn them either. It’s illegal.
The government taxed the tires so it can afford to safely collect them. They have to get the tires out of the environment to make sure that people won’t do anything stupid with them. But it soon became a problem for the places collecting these tires. They became overflowing with the stuff. They had no place to put the unsafe, toxic, dangerous wheels. They ended up sponsoring the growth of crumb rubber to solve the waste problem. The government subsidized communities using crumb rubber fields.
In 2014, the state of California used $6.1 million to “help” parks and recreational facilities using these crumb rubbers. It allegedly helped both their waste problem and the community. Or so they thought. They ground up recycled tires and broke them into millions of pieces, introduced them into our communities so the kids can play on trash
She continues to discuss the RCRA law (The Resource Conservation and Recovery Act.) It is the law in charge of reducing the amount of waste generated and waste management. This law regulates toxic waste, but not its by-products. In turning tires into crumb rubber, different regulations apply.
Unfortunately, since these crumb rubbers when used as infill, get carried by waters to rivers, lakes, and coasts. They disappear into waterways, thus their disposal is not regulated. Not to mention the fact that these are so small that gushes of wind can definitely take portions of them. They get taken into the air—breathable by any human being in need of oxygen.
Don’t take their disposal into waterways lightly though! These crumb rubbers easily fit into mouths of fishes (that’s right! Fishes that we, human beings, eat!) and can potentially poison their aquatic environments. This poses a threat to all of us because if the water that we use every day is contaminated with toxic substances, we can definitely get sick. It may not always be cancer, but anything we do to plague the environment will definitely haunt us in some way.
What does crumb rubber infill have to do with cancer?
Hypothetically, these tiny pieces of rubber float in the air when the playing field is used by athletes. Much like dust resting on a book when you tap its cover, the dust spews into the air and into your lungs. Imagine a goalie diving to block a shot, rubber infill from underneath goes up in the air and into his face. He ingests them, or they stick to his skin. Since the rubbers are made from toxic materials, they negatively affect students and players on the field. No studies are yet to conclude this hypothesis. It’s only just that.
So why even risk it? You’re going to invest in your family time, picnics, and weekend activities. There’s no reason compelling enough for you to choose a known cesspool of toxic materials like crumbed rubber tires to lie on. Choose better materials, like quartz, sands and broken down stones.
Why is synthetic grass a cancer risk?
It’s not! If anything, the recycled tire rubbers being used for infill are the main suspects. Tires come from a mix of synthetic and natural rubber, carbon black (a petroleum-based material) and 4-10 gallons of petroleum products. Metals like cadmium, lead (neurotoxic! It’s harmful to your brain!) and zinc are also present. Some chemicals like dibenzopyrenes are also known carcinogens.
Even the chemicals the tires are exposed to during its life can also have a hand in its toxicity. 11 out of 92 chemicals found within crumb rubber have been identified as known or suspected carcinogens. Having this in your yard is a sure fire way to poison yourself. The good news is: infill is completely separable from synthetic grass! You can choose sand and broken down rocks instead!
So, is artificial grass toxic?
Generally, no. But of course, there is subpar quality synthetic grass in the market. These are dangerous! Fake grass is something you should get as far away from as you can! These can have amounts of toxins and lead. And since they’re fake, you have no guarantee that they weren’t made out of poisonous substances.
Are there synthetic grass in the market which are perfectly safe for you and your family?
Why yes, of course! You can do away with crumb rubber infill. You can drop unnecessary risks. Go for natural alternatives!
What is the best artificial grass for kids and pets?
King Turf offers toxin and lead-free products! Plus, it’s eco-friendly too! We don’t offer crumb rubber as infill; we go with sand and stone, which are all natural and already in the environment! Even if our infill gets blown away by harsh winds. Or driven by running water. You can sleep at night knowing that everything is okay for both your family and the world!
Request A Free Estimate:
The popularity of artificial grass is on the rise, particularly with ongoing drought conditions and the growing understanding of the many benefits of replacing natural grass with manufactured options.
One of the most appealing aspects of installing synthetic turf is that you have the look and feel of natural grass but never have to worry about brown spots, bare spots or having a brown lawn through the summer months. Another appealing aspect is that you get to have a beautiful lawn without the ongoing expenses of maintaining natural grass and without the ongoing mowing, seeding, edging, weeding, fertilizing, watering and aerating it takes to keep natural grass looking good.
There is no irrigation system to maintain, no mud, lower water bills and only occasional maintenance required.
With all of these benefits, it is no surprise that homeowners are choosing this option in growing numbers and that they are using manufactured turf for much more than just their front lawns.
10 Places Homeowners Use Artificial Grass
Here are 10 places homeowners commonly use manufactured grass in residential settings.
Artificial grass is definitely gaining popularity as a go-to choice for dog runs. There is no mud or ruts after rain, no wet blades of grass being tracked in the house, and no warm soil where fleas love to hang out. Additionally, it is easy to clean when used as a restroom area, and you will not have to figure out how to fit your lawn mower through the gate for a weekly mowing.
One of the biggest reasons for choosing fake grass for dog runs is that it provides a soft, grass-like surface where your dogs can play or lounge but does not get unsightly brown spots where your dogs urinate.
One consideration for using artificial turf in a dog run is that it can get hotter than natural grass on hot days or in direct sunlight. You can help counteract this by building your dog run under a shade tree, adding shade sails to provide shade for the grass and your dogs, or covering the dog run with a roof that provides your dogs with protection from sun and rain.
Synthetic grass is a great choice for play areas and offers a level, even surface with fewer tripping hazards. There is no mud or ruts after rain, and little feet will not track grass into the house. If pets share the space with your children, you are sure to appreciate that the Durafill infill used by Install-It-Direct does not allow bacterial spores to grow. When your pets use the area as a restroom, you can simply rinse it off or use a combination of vinegar and water to kill germs.
If you are concerned about the manufactured grass getting too hot under the glare of the South Florida sun, you can install your grass under a tree or use shade sails over the play area to reduce the amount of sunlight coming into the space.
King Turf also has the ability to add Hydro-Chill, which is a high-end infill sand that can help keep the turf cool for a lot longer AND helps eliminate pet odors and other foul odors that can occur.
Backyard Sports Fields
Homeowners choose artificial grass for backyard sports fields, such as soccer fields, for several reasons. For starters, fake grass provides a level playing field with lower risk of tripping when compared to natural grass. It is easier to care for, does not get muddy after rain and is ready for a pick-up game at a moment’s notice. As an added bonus, no mounds or divots in the grass means that your ball will take a truer path, which is nice for practicing your skills.
Front Yard Lawns
This is one of the most common uses for synthetic turf in residential settings, particularly now that the ongoing drought is making many homeowners rethink their natural grass lawns. While front yards are not used for play areas or pet areas as often as backyard lawns, a beautiful front lawn continues to be a status symbol and hugely popular in suburban settings. People want their front yards to look good, and artificial grass is one way to ensure that your lawn will always look green and lush regardless of the weather or mandatory water restrictions.
Of course, it is an added bonus that your lawn will look amazing without ever having to mow, fertilize, edge, seed, aerate or water it.
Homeowners want backyard lawns to enhance the visual appeal of their yards – just like front yard lawns; however, backyard lawns often serve additional purposes. For example, they are often play areas for children and pets, a restroom for dogs and a hangout space for guests. This means that backyard lawns need to look good, but they also need to be durable and a comfortable place to spend time.
Homeowners who opt for fake grass often do so because they know their lawns will always look lush and inviting, will require significantly less maintenance, and can readily withstand traffic from children, pets and guests. They never have to worry about brown spots from dogs or bare spots in high-traffic areas.
Synthetic turf is often used in walkways – either alone or in combination with paving stones. As mentioned above, manufactured grass can handle heavy traffic, which makes it ideal for use in pathways leading to play areas, outdoor living areas, swimming pools or gardens. Therefore, homeowners who love the look of natural grass but need something with better durability and lower maintenance requirements often choose artificial grass to provide an attractive, long-lasting ground cover for walkways.
Backyard Putting Greens
Both residential and commercial putting greens are often seen with artificial grass, which provides an easy-care, level playing surface that is always ready for some practice swings. There is no need to wait days for the soil to dry after it rains and no worrying about tracking mud and grass into the house after practice.
Using synthetic turf for a backyard putting green also gives you more flexibility for where you can fit your practice area. When you do not have to worry about how well your grass will grow in particular conditions, you can place your putting green where you have space, such as in a side yard that gets little sun or under a shade tree.
Outdoor Entertaining Areas
As with other uses for artificial turf, homeowners are choosing it for outdoor entertaining areas for its durability and visual appeal. Without ever having to push a mower or maintain an irrigation system, you can have an inviting, green lawn that will provide both a foundation and a focal point for outdoor entertaining.
An artificial grass lawn can withstand lots of traffic and provides the perfect place for everything from an afternoon tea party to a backyard movie night.
Landscaping around your pool with artificial turf allows you to have the look and feel of a natural grass lawn without worrying about dirt getting in the pool, pool chemicals killing your lawn or wet feet picking up blades of grass to track into your house. These are just a few of the reasons more homeowners are choosing synthetic grass for pool landscaping. Others include its low maintenance requirements and drought-friendly appeal.
No one likes to trudge up and down a hillside trying to pull weeds, prune trees or care for plants. When it comes to hillside landscaping, options that require the least amount of maintenance are the most convenient and time-saving choice, and it does not get much lower maintenance than artificial grass. While manufactured grass does require occasional raking and spraying down to stay clean and looking its best, the maintenance requirements are lower than most living ground cover options.
Artificial turf can also help control erosion, which makes it an even more appealing option for landscaping hillsides.
Request A Free Estimate:
The benefits of fake grass have been well-documented and publicized for years. But when it comes to installing fake grass, you should have all the facts up front. There are a few things homeowners who have made the switch before you wish they had known about the installation process. Those tips will help you avoid any confusion or problems that might pop up during your faux lawn’s installation.
How It Affects Property Values
For many homeowners that are interested in installing artificial turf with King Turf, one of the first questions is how will installing fake grass affect my property value?
This is an easy answer: Due to the ZERO-MAINTENANCE required and the fact that it looks amazing year-round, artificial turf will increase your property value.
This was a HUGE deciding factor among spouses when deciding to move forward with the project.
Prep Work Involved
Before we can install your new fake grass, the old grass has to go. Then the ground must be properly prepared. While this sounds straightforward, removing existing sod is a lot of work and it takes time. Most professional landscaping companies that work with artificial turf can complete the project in two or three days, depending on the amount of grass to be removed, the size of their crew, and how they approach the removal project.
Once the old grass is gone, the soil must be turned and smoothed to eliminate any dips or humps. Then the next phase of the project can begin. Welcome, fake grass!
Installing fake grass isn’t difficult, but it doesn’t happen overnight. For example, it can take 2 to 4 days to install 1,500 square feet of fake grass. The number of people working the project, their level of experience, and the weather all affects how long the installation will take.
Exact measurements must be made, and grass trimmed carefully to fit so there are no ragged edges. Ideally, installation should take place when temperatures are above 50o F. In cooler seasons, this may eliminate early-morning work, which could extend overall installation time. If all goes smoothly, your new lawn can be in place in a couple of days.
The last thing you want is an installation contractor who makes a mess and walks away. You can be sure that won’t happen with King Turf’s experienced and professional installers. We will remove and properly dispose of any leftover turf once your project is completed. And we’ll leave your yard looking at least as inviting as it was before we arrived on the scene.
One thing to keep in mind, though. The messiest part of our job is removing existing sod. If the weather is very dry, this process will inevitably kick up dust. We do everything we can to mitigate that, but if conditions are dry during your installation, you might want to keep your windows closed.
Installing fake grass is an investment. It can seem expensive when you first look at the price tag. But you have to consider the long term, just as you do with any major investment. You’ll have only miniscule maintenance costs, and you can amortize the initial cost of fake grass over the many years you will enjoy having it in place. This transforms your major expenditure into a superior investment that delivers an undeniable financial and functional return.
Your landscaping gets a beautiful upgrade. You get less yard work. Your property gets a boost in value, thanks to that improved curb appeal and lack of future maintenance. Studies have shown that homes with fake grass not only bring higher prices, but they also sell faster than homes with maintenance-intensive natural grass lawns. And why not? What prospective home buyer wouldn’t be excited about a better looking yard that requires less work?
Meanwhile, knowing what it takes to install your new faux lawn will make the process go exactly as expected. Nice grass, by the way!
What About Pests In The Lawn?
Another deciding factor for MANY homeowners was that because artificial turf isn’t a natural environment for any type of pests, this eliminates the desire for any pests to make your lawn their home!
Can you imagine… No ants, no fleas or ticks, absolutely ZERO bugs in your yard
Request A Free Estimate:
Many homeowners like the idea of DIY projects. Check out these top 8 mistakes when attempting to DIY!
Considering artificial turf for your kids or their playground? Read THIS first!
Many homeowners are unaware of the benefits of installing artificial turf. Read our top 5 here. | <urn:uuid:78e4f9cc-e6b0-4181-9c30-dc8a67ddd892> | CC-MAIN-2022-33 | https://kingturf.miami/artificial-turf-blog/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.959027 | 4,783 | 2.546875 | 3 |
- Energy Audits
- Blower Door & Duct Leakage Tests
- Drone Services
- Manual JDS/RESCheck/COMCheck
February 27, 2020
You’ve turned down the AC, turned lights off in rooms you aren’t in and stopped using unnecessary energy yet your energy bill is still high. If you can’t figure out why your business is spending so much money on your monthly energy bill an energy audit may be beneficial. Here is why our team at E3 Power recommends an energy audit if you’re a business in the Denver area.
What Is An Energy Audit?
A commercial energy audit helps you determine the most effective low-cost means of reducing your energy use. It’s very beneficial for businesses who feel they have a high energy bill but can’t pinpoint why it’s so high. The audit will provide a clear breakdown of how, where and when electricity is used in your building. There are three levels of energy audits, those levels are:
Level 1: Walk-through analysis - A walk-through that will give a quick-assessment and quick-hitter changes
Level 2: Energy survey and engineering analysis - This audit provides quantified recommendations for your business to make smarter business decisions
Level 3: Detailed analysis of capital-intensive modifications - This audit provides elaborate cost-saving calculations with a high level of confidence
The outcome of these audits will vary depending on the operating conditions of the business. The level that is best suited for your business will largely depend on what you want out of the audit. If you want quick solutions, level one may be for you.
Save Your Business Some Money
The most obvious reason why a commercial energy audit is beneficial to your business is to save money. Energy audits have the potential to cut your utility bills down by as much as 50%. Audits can also help your business save money in the long run as well.
Audits can often point out when your building needs upgrades to further save money on energy. While these upgrades may put a dent in your wallet initially, they will help you save money in the long run. Audits will help you find the most cost-efficient plans for investing in energy-saving measures.
Make Your Business More Comfortable
Energy efficiency and relaxation are strongly interconnected. Audits can help you figure out measures you can take to make your business more energy-efficient as well as more comfortable. Improved insulation, more efficient heating and cooling systems can go a long way in saving money on energy bills.
They also go a long way in making sure your employees and visitors are comfortable. Improved insulation and more efficient cooling and heating systems make sure that everyone in your place of business in comfortable.
Beyond reducing energy usage and saving money, there are intangible benefits that come along with a commercial energy audit. Going ‘green’ can enhance the public image of your business. This will help grow customer loyalty, brand recognition and productive/happy employees.
Of course, an audit is only the first step in this process, but it’s the most important step of the process. It’s hard to implement changes when you don’t know where changes are needed. It’s up to you to implement the changes recommended to you after receiving an energy audit.
We Offer Energy Audits
If you are a business owner or manager in the Denver area and are looking for an energy audit, our team here at E3 Power is here to help. We offer commercial energy audits as well as home energy audits so you can get a grasp on what you’re spending energy on at home. We want to help you save money while also saving the environment. | <urn:uuid:1be3e877-adc7-4d99-b216-8dcd211d1259> | CC-MAIN-2022-33 | https://e3power.net/blog/why-commercial-energy-audit-beneficial-your-business | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.931058 | 768 | 1.523438 | 2 |
PALANPUR. Nawab Mohammed Khan, circa 1918
H. H. Nawab Mohammed Khan of Palanpur. A cabinet card portrait with no photographer’s credit. The full length portrait shows the ruler of this 13 gun salute state in western Rajasthan wearing cavalry dress uniform. He was born in 1883 and succeeded to the gaddi in late 1918. He was made K.C.I.E. in 1920 and advanced to G.C.I.E. in 1932. He was to be the last ruling Nawab of Palanpur and died in 1957.
1 in stock | <urn:uuid:f147d6f0-3b7f-4e05-82e6-7444049f2e0d> | CC-MAIN-2022-33 | https://www.batesandhindmarch.com/product/palanpur-nawab-mohammed-khan-circa-1918/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.979396 | 133 | 1.835938 | 2 |
In 1951 the US Public Health Service declared obesity, newly reinterpreted as an addictive disorder, to be the nation’s leading health problem. This project will be the first to study the course of this early obesity crisis, analysing the interaction between popular perception, biomedical science and health policy, all in the political and cultural context of postwar America. Research will especially focus on the competing efforts of several biomedical disciplines and their scientific leaders to define the problem and shape responses to it. The goal is to understand the ways science and medicine related to social forces in the episode, and to derive lessons for today’s global obesity crisis.
N. Rasmussen, ARC Discovery Project DP140101629 | <urn:uuid:b0327380-eb92-4f1e-91dd-4a60157e8169> | CC-MAIN-2022-33 | https://research.unsw.edu.au/projects/cold-war-obesity-crisis-fatness-public-health-and-medical-science-united-states-1940-1970 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.925796 | 141 | 2.03125 | 2 |
This building was originally the shooting lodge for the Banchor estate. By 1888 a new lodge had been built (now the Lodge Hotel) and Sam Macdonald, who ran an inn in the building next door (see Craigellachie House) transferred his growing business here.
In 1889 he converted the building into a hotel to meet the needs of the rapidly developing tourist trade in the village: "Mr Macdonald has spared no expense on the work of renovation, and the result is a building admirably adapted for hotel purposes, there being nothing equal to it for size in Badenoch."
Such was the growth in visitor numbers in the village that in 1893 a further five bedrooms, a drawing room and coffee room were added behind the original building. In 1898 a further extension included stables and in 1903 the hotel was enlarged again, "to make adequate provision for the ever-increasing number of tourists who annually include Newtonmore in their holiday tour."
Sam Macdonald was also an enthusiastic patron of the Newtonmore shinty team, as was his son Sam, who took over the Hotel after his parents died. Sam junior was a noted shinty player, but he died in the First World War.
The hotel was originally known simply as "The Hotel, Newtonmore". The name later changed to the "Newtonmore Hotel". It was on the coach route from Kingussie to Tulloch Station on the Fort William road. The last stagecoach in Britain ran on this route until 1914 when a motor charabanc took over. For many years the driver of the stagecoach was James Gillies, whose family ran the shop in Laggan. To fend off any attacks, he carried a pistol which is now in the Macpherson Museum.
By the 1920s the hotel was owned by the Main family, who also owned the Alvie and Lodge hotels. Mains Hotel was always busy in summer and frequently had Rolls Royces parked outside. The hotel closed in 2001 and was converted into a care home.
Ordnance Survey name books
M.G. Lay (1992) Ways of the World: A History of the World's Roads and of the Vehicles that Used Them | <urn:uuid:821fd968-7746-417f-9c90-14260c4c754a> | CC-MAIN-2022-33 | http://www.newtonmore.com/things-to-do/in-newtonmore/heritage-trail/mains-house-care-home.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.984842 | 474 | 2.109375 | 2 |
Thesis statement: The jury has the responsibility to look deeper into a case than what the Crown and defence attorneys give them; there is always room for human error both on the lawyers' side and the jury's side and it is not right to put an innocent man away because the jury did not look deeper into all sides of the case.
"Expect anything from anyone; the devil was once an angel" – Drake Graham. It is easy to look at a defendant in court an automatically assume him guilty; the police picked him out as a suspect, he made it all the way to the trial, and there is evidence that is very compelling to his guilt. However, a jury should not become fixated on how guilty the defendant may seem to them. The jury also bears the responsibility of considering both sides of a trial. The jury has the responsibility to look deeper into a case than what the Crown and defence attorneys give them; there is always room for human error both on the lawyers' side and the jury's side and it is not right to put an innocent man away because the jury did not look deeper into all sides of the case.
In the movie 12 Angry Men the jury had to go over every piece of evidence presented in the trial and deconstruct it – a reasonable expectation of the jury. The jury should look over every piece of evidence presented and, once again, consider it from every angle. In the movie one of the jurors became very fixated on a testimony that later fell through. It is the responsibility of the jury to, as a whole, go over the evidence and present this fixation from happening, easy though it may be. The jury is only human and if something compelling is presented, that may be what their mind gets stuck on, no matter what the other evidence is saying. The jury should be able to assist one another in looking past their original, and surface, thoughts of the evidence and accept the possibility that their original impression is not always the right impression.
In the movie 12 Angry Men the jury made several points about how the defence attorney seemed to be lacking in his job of creating reasonable doubt – something that one of the jurors was able to manage better. It is the responsibility of the jury to recognize that attorneys are only human, plagued with their own bias and life troubles. This does not excuse slopping attorney work but they should not base their opinions singularly on what one side is presenting because that side appears to be more passionate or put together – despite showboating, it is only the solid evidence that the jury should be looking at. The jury should go over the case with reasonable doubt, with questions. If all of their questions about the case have been answered by the end of their deliberations, then they have properly listened to the evidence that has been presented not how the attorneys presented it.
The jury bears the responsibility of a person's life when they ponder over a case. While in 12 Angry Men the man would be facing the death penalty if found guilty and that is not always the case, even going to jail for a short while can severely hinder how a person lives out the rest of their life – facing bias and stigma from society as a whole. The jury has the responsibility to the person on trial to look over the evidence with an unbiased mind and with the assumption that they are innocent until proven guilty. It is not the fair trial the defendant has the right to if this is not done. The jury must bear in mind that how deep they go into a case controls the outcome of a person's life and that is not something to be taken lightly or shallowly.
Juries are human; attorneys are human; defendants are also human. Every human has rights and responsibilities. The responsibility of the jury is to go over every piece of evidence in detail and to not take anything at face value, as the defendant has the right to a fair trial. The jury has a responsibility to consider their own human error, the human error and grandstanding, or lack thereof, of an attorney, and to protect the life of a human being by not simply going with a gut instinct. As is illustrated in 12 Angry Men original instinct is not always correct and the jury must keep that in mind while they deliberate.
©The Last Letter | <urn:uuid:7d9c9db1-bedc-4ff3-b4dc-bdba5e140d09> | CC-MAIN-2022-33 | https://m.fictionpress.com/s/3132536/1/12-Angry-Men | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.977264 | 862 | 2.46875 | 2 |
What you may not know is that crash diets can do more than just leave you feeling frustrated and hungry. These kinds of diets often come with several other health risks.
Promises of fast weight loss with crash diets can often prove hard to resist. If you’re like many people, you’ve probably tried at least one juice fast, grapefruit or similar diet over the years for fast weight loss, and it probably was anything BUT effective in the long run. What you may not know is that crash diets can do more than just leave you feeling frustrated and hungry. These kinds of diets often come with several other health risks, including these outlined by the Obesity Action Coalition:
- Gallstones – Experts believe changes in fat metabolism that happen during rapid weight loss as well as weight cycling can increase the risk of these painful formations.
- Loss of Lean Body Mass – This can negatively impact both metabolism and strength and lead to lower bone density later in life.
- Poor Nutrition – Without enough food, chances are you aren’t getting enough nutrients, leading to a variety of deficiencies.
- The Rebound Effect – Your body is programmed to survive. When it thinks you’re starving due to a crash diet, your body responds by slowing the metabolism to conserve calories, leading to faster weight gain once you return to eating a regular diet.
If you find yourself tempted by the lure of “10 pounds in 3 days” and similar claims, remember that there can be serious risks with fast weight loss. Stick to a quality ingredients like lean proteins, whole grains, fruits and vegetables in recommended amounts, practice moderation and include regular activity as part of your day to lose weight without the side effects. When dining out, look for dietitian-recommended menu choices that include diet-friendly ingredients that can also help you lose weight. | <urn:uuid:e8b6daf5-5e47-4afc-9fbf-63742ddb3519> | CC-MAIN-2022-33 | https://healthydiningfinder.azurewebsites.net/blogs-recipes-more/healthy-weight-loss/4-risks-of-crash-diets/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00072.warc.gz | en | 0.959412 | 376 | 2.390625 | 2 |
I was in the bathroom today going through my usual random thought process when something occurred to me. When I mention this you might think, “Well ya, so what?” Or you may say, “Yeah, we are all hypocrites”.
We are living in a world of such political correctness it’s hard to know whether we’re coming or going. We have to be careful of when and how we say what we say and to who.
I am a plus size woman. That is the term I choose to describe myself physically (It is by no means who I am). Others may choose: fat, obese, cow, voluptuous… the list is really endless.
Now getting back to the bathroom monologue, I was thinking about how so many “things” in our lives are described in terms of size. We are constantly bombarded with sizing. Here are a couple of examples.
- Clothing: S, M, L, XL, XXL, XXXL
- Cars: compact, mid-size, full-size
- Living space: bachelor, single, spacious
- Partnership: single, double
- People: skinny, average, full-figured
- Men: big feet=______
- Serving size: kid’s serving, half serving, hungry man, super-size
- Candles: tapered
- Salary: minimum wage
Now by this point you could be thinking. “How else could we describe these things?” What would we call a Big Mac after all. Well getting to my point and there is one. To me it seems most strange that we spend most of our developmental growth period learning how to describe things as they are. Only to grow up and have to relearn it all so we can be politically correct. I am not saying you should go out and tell your neighbor how fat, short or bald they are. That’s just cruel.
We live in a society that is constantly judging everything around us according to size. Yet it is not acceptable to judge people according to their size. So we make up other analogies for them.
Which all seem to be perfectly acceptable reasons other then saying. “I don’t like her because she 90, 122 1/2, 250 lbs. I think politically correctness is just another excuse for avoiding the truth.
All this in the span of five minutes curling my thin hair with my big curling iron in front of my slimming mirror while I sip on a mega-size glass of water and admire my big ass.
Originally published 1/26/2004 at Large & Lovely, BellaOnline. | <urn:uuid:e4eef45f-9d3b-4503-bcbd-12c68b99af08> | CC-MAIN-2022-33 | https://www.biggirlblue.com/2004/01/26/sizing-up-our-society/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.948304 | 568 | 1.8125 | 2 |
Fitness Tests for Softball
There are several components of fitness that are important for success for all softball players, though there are positional differences in the requirements for fitness. See our discussion about the Fitness Components for Softball. See also the Softball SPARQ fitness testing rating system which uses a different battery of tests.
Aerobic fitness is an important component of fitness for softball, so that players can reduce the effect of fatigue during long periods of play. Fitter players will cope with the heat stress of playing all day in the sun.
The aerobic test performed may depend on the starting fitness level of the players. A submaximal test of aerobic fitness may be suitable, such as a cycle test (Astrand test, Trilevel, PWC170), or the Cooper 12 minute run. For players used to some conditioning exercise, the maximum effort shuttle run (beep) test would be more appropriate. You can find information on many aerobic tests from here.
The flexibility tests should be specific to the actions of softball. Being flexible enables a greater range of movement in the execution of striking or throwing the ball, and may reduce injury in the long term. The sit and reach test can be done for lower back and hamstring flexibility. Other flexibility tests should also be performed that are relevant for the sport or playing position.
Strength & Power
Strength and power tests should also be done to determine initial levels and to monitor changes in conjunction with training programs. Upper body strength is particularly important. Core stability and abdominal function are important for controlling movement and execution of skills.
Maximal strength tests for specific exercises should be conducted. Abdominal muscle function should also be tested, for example using an abdominal strength or endurance test. A handgrip strength testis also suitable. There is also Softball Ball Throw Test for testing throwing power and technique.
Speed & agility
Running speed, acceleration, and agility are very important in softball for moving between the bases and in fielding. Sprint time over 20m, with a split time for the first 10m should be done. You may also want to do a softball specific test, sprinting over the actual distance between bases, and incorporating a turn.
Excess body fat would affect the softballer's ability to move freely around the field, and it would also increase fatigue during training and game play as the excess weight does not benefit the sport. Skinfold measures should be performed to determine body fat levels.
- Softball SPARQ testing
- Softball warm-ups
- softball throw fitness test
- Discussion about the Fitness Components for Softball
- Poll about the fitness components for softball
- All about Fitness Testing | <urn:uuid:28a6d939-3420-4888-b3bf-3552da22de8a> | CC-MAIN-2022-33 | https://www.topendsports.com/sport/softball/testing.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.932656 | 568 | 2.484375 | 2 |
FHA guidelines to buy a house you will need a minimum credit score of 580 to qualify for an FHA loan with a minimum 3.5% down payment.
How does an FHA loan work with a credit score below 620?
If your credit score is below 620 FHA allows two types of loan approval. Your loan will be approved by Fannie Mae with either an Approve/Eligible or Refer/Eligible or what's called a manual underwriting.
The requirements for both are different. When your loan is an Approve/Eligible your maximum debt-to-income will be 31/43. This means that your mortgage payment will be 31% of your monthly income. And 43% of your monthly debts (mortgage payment, car payment, credit card payments, student loans, etc.) of your monthly income.
If your loan receives an Approve/Eligible and your credit score is below 620 there are no reserves required. You will need to have the 3.5% down payment and either enough funds for closing cost or enough credits to close. FHA does allow the seller to pay up to 6% of the purchase price for closing cost.
If your loan receives a Refer/Eligible this means the maximum
debt-to-income ratio should be 31/43 but you will need to have one month's
reserves. Reserves equals one month's proposed mortgage payment in the bank after closing.
If your credit score is below 620 FHA allows ratios above 31/43 with compensating factors. Compensating factors can be one of the following:
FHA below 620 credit score. If your loan receives a Refer/Eligible FHA allows the maximum debt-to-income ratio should be 37/47 with one compensating factor.
What if i do not have a credit score? If you have no credit score FHA guidelines assigns you a credit score of 580. Your loan will be a Refer/Eligible and you will need one months reserve to qualify.
Are you short funds to close? The FHA no closing cost loan allows all of your closing cost to be rolled into your loan including your appraisal fee, hazard insurance premium and even your escrow account.
What if i have collection accounts? FHA does not require collection accounts to be paid off as a condition of mortgage approval. However, FHA does recognize that collection efforts by the creditor for unpaid collections could affect the borrower’s ability to repay the mortgage.
Call us 888.958.5382
We recognize the importance to you of keeping your information secure and confidential. We will not sell or share your personal information.
We look forward to working with you.
FHA below 620 credit score 2017 FHA below 620 credit score 2017
FHA Below 620 Credit Score 2017, Florida FHA Below 620 Credit Score 2017
What's the minimum credit score needed to buy a house or refinance in Florida?
FHA loans require a minimum 500 credit score to buy a house or refinance
VA loans require a minimum 500 credit score to buy a house or refinance
Fannie Mae loans require a minimum 620 credit score to buy a house or refinance
USDA loans require a minimum 580 credit score to buy a houseor refinance
HomePath loans require a minimum 620 credit score to buy a house
HARP loans require no minimum credit score torefinance
Freddie Mac loans require a minimum 620 credit score to buy a house or refinance
Want to know if you qualify for an FHA loan? Get pre-approved for an FHA loan online.
Call Now, Our Staff is Available! | <urn:uuid:2e84dc09-860b-4bc4-ab59-7f5d6e7df827> | CC-MAIN-2022-33 | https://www.fha-world.com/fha-below-620-credit-score-2017.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.930301 | 803 | 1.507813 | 2 |
Welcome to Learning Ally's blog. You've come to the right place if you are an innovative teacher who wants to transform more struggling readers into grade-level achievers.
June 17, 2022 by Learning Ally
Categories: Audiobook Library, Education & Teaching, General, In the news, Press Releases, Reading Strategies for K-12
October 29, 2020 by Learning Ally
Categories: dyslexia, Early Literacy, Educators, General, In the news, Press Releases
November 28, 2018 by Valerie Chernek
Categories: Audiobook Library, Curriculum & Access, Education & Teaching, In the news, The Digital Age | <urn:uuid:24969bd7-b9dd-4ff7-8824-3ebd4e019325> | CC-MAIN-2022-33 | https://learningally.org/Solutions-for-School/Educator-Blog/Tag/support-for-struggling-readers | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.863455 | 135 | 1.820313 | 2 |
I am immediately reminded of a great 2010 documentary called Top Secret Rosies: The Female 'Computers' of WWII.
The word "computer" has had a definition since at least the 17th century. In the traditional sense, this from the Oxford Dictionary of English Etymology (1992), "compute" came from French, meaning "determine by mathematical reckoning." The word computer would refer to a profession wherein one makes their living doing mathematical and arithmetic calculations. The Wiki on human computer should give you loads of insight into this old profession. An nice additional piece of historical perspective is encapsulated in the late 19th century job advertisement, A Computer Wanted.
Historically, when some large computations for some large complicated process needed to be done, and the person wanting them done had the cash to hire the people, human computers would be hired, organized and instructed to take on various parts of long computations in an organized assembly line style. Computer was still a human profession right in to world war II, and the first electronic computers like ENIAC were actually programmed by these human computers. The people who were in this profession typically had math degrees.
ENIAC was not the only electronic computer of the 1940s. An earlier computer, Colossus, was used by British cryptologists during the war, and the Bombe computer was used to help decipher the German Enigma machine.
I also recall Richard Feynman telling stories about his days working on the Manhattan Project. In Feynman - Manhattan Project the author states, "The greater part of his work was administering the computation group of human computers in the theoretical division." Much more first person anecdotal stories of his time here working with his human computers, as I recall, can be found in his book Surely You're Joking, Mr. Feynman! That is a much recommended read, I do not possess a copy; I read it in a library. I vaguely recall him describing his process as one where these students in an orderly fashion, an adder, a multiplier, a divider, and so forth, would, with the use of a punch card system, build up big computations over many hours and days, maybe even weeks. One human misstep would obviously have disastrous results. So I guess he was sort of using a combination of human computers, and machine style punchcard devices.
Essentially, the answer to your question is (mostly I think) the latter; electronic computers arose straight from a desperate demand for more computational power. Being able to automate a huge algorithm formerly done by a team of directed humans in less time with less error became possible, and it was important at the time. They were really pushed along out of necessity in a big way by the demands of the second world war, and the cold war funding immediately thereafter kept this advancement moving forward. I am not saying that WWII gave us the very first examples of computers, but this would be the age when they were dramatically ushered in, and the word computer really began to transfer its meaning from "one (a person) who computes," to these machines that, in a decade, made the job of human computer obsolete, and eventually turned into that thing currently sitting on your desktop. | <urn:uuid:28c390af-d250-47e9-850e-1c8aff4a7d41> | CC-MAIN-2022-33 | https://hsm.stackexchange.com/questions/2443/was-the-computer-invented-through-the-influence-of-the-printing-press-or-through | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.980059 | 654 | 2.96875 | 3 |
So this blog is all about how cases that show HOW dentists could land in hot water when it comes to cords and the obligation to report incidents.
If you’re using a laser (like a biolase) in your office and that machine has electrical power cords running to the wall, guess what – you might have a tripping hazard! In the case of R. v. Grey Bruce Health Services, 2003 CarswellOnt 10494, Mary Wilson, an experienced registered nurse (EMPLOYEE), tripped and fell in CAT scan room at a hospital in Owen Sound (EMPLOYER). The only people in the room when Ms. Wilson fell were the patient and a radiologist. This all happened back in 1999. Basically, Ms. Wilson Wilson had moved a portable blood pressure monitor to the other side of the patient at the request of the radiologist. The monitor was now in high traffic area. At some point, Ms. Wilson tripped (although it’s unclear why; she assumes it was because of the cord) and suffered a 3 part fracture to her arm. Ms. Wilson contacted the hospital’s employee health department, which reported the incident to the Ministry of Labour a week later.
After a few days at trial, the Justice of the Peace overseeing the case wasn’t convinced about the cause of Ms. Wilson’s fall. That said, the Justice found that the hospital was an employer had failed to ensure that a work surface was kept free of obstructions and hazards and was fined $15k for that. The Justice also fined the employer $5k for not immediately reporting the incident. On appeal, these convictions were upheld.
Things to remember:
- Section 51 of the OHSA requires that, where a person is critically injured from any cause at a workplace, the EMPLOYER shall within 48 hours send to an OHSA inspector a written report of the circumstances containing particulars of the occurrence. FYI: “critically injured” means a serious injury that places life in jeopardy, produces unconsciousness, results in substantial loss of blood, involves the fracture/amputation of a legal or arm (not finger or toe), consists of burns to a major part of the body or causes the loss of sign in an eye: see Occupational Health and Safety Act, Critical Injury — Defined, R.R.O. 1990, Reg. 834, s. 1
- Section 51 of the OHSA requires that, if a person is disabled from performing their usual work or needs medical attention because of an accident, incident of workplace violence, but doesn’t die and is not critically injured, then the EMPLOYER shall within 4 days give written notice of the occurrence with particulars to an OHSA inspector. | <urn:uuid:f35278ff-1893-4cec-9d4a-e8b56fc4502c> | CC-MAIN-2022-33 | https://dentistlawyers.ca/infection-control-dentists-part-3-tripping-hazards-and-reporting-requirements/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.958684 | 570 | 1.734375 | 2 |
In Part 1, I briefly explained how to write a presentation outline, to organize the body of your talk, and to introduce it in engaging ways.
I showed you a useful way to lay out your major and minor points. I talked about different ways to sequence your ideas and to guide listeners by using signposts or signals.
Finally, I shared some neat techniques to introduce the presentation, such as using an anecdote or a startling fact.
In this article I’d like to address these three questions.
- How should I conclude a presentation?
- What other helpful signals are there to make a talk flow clearly?
- What is a good title?
Conclude your talk the smart way
So you have a engaging introduction.You have a clearly organized body to your presentation with all the key points spelled out and supported. Now you’re ready to write the conclusion.
The common wisdom among experts is that there are four parts to a conclusion. Keep in mind that you don’t want the conclusion to be too long and you shouldn’t include any new material.
1. Summarize the key points
You want to remind listeners what you showed in the talk and how you did so. Review the main points you covered and state the essential message you would like listeners to retain.
To summarize what I said, . . .
Let me recap the main points . . .
So, as we have seen today . . .
To sum up, . . .[/note]
2. Conclude briefly
Leave a message that logically flows from the ideas you developed in your talk. This could be in the form of a commentary, lessons you’ve learned, some recommendations or possible next steps.
Similarly to what you did in the introduction, you might want to use a quotation – either factual or emotional, a quotation from an authority, an anecdote or question.
In light of what I said today, I suggest that . . .
So, as we have learned . . .
In conclusion, I’d like to quote the famous words of . . .
I want to conclude my talk by quoting . . .
3. Thank the audience for listening
Simply thank the audience for being there.
I want to thank you for your attention.
Thank you for being such a great audience.
It was my pleasure speaking to you today.[/note]
4. Invite feedback from the audience
Finally, depending on the context, you may want to invite comments. Or you could ask for questions, if you feel really well prepared.
Does anyone have any comments?
Please feel free to make any suggestions or comments?
Are there any questions?
I’d be happy to answer any questions.[/note]
Use transitions – more signals to guide your listeners
Both in this article and in Part 1, I presented some useful signposts to guide your talk from point to point. Here are a few more transitional expressions to make it easier for listeners to follow you.
|To draw emphasis||indeed, in fact, of course|
|To give an example||As an illustration of, in other words, in simpler terms|
|To add something||Furthermore, moreover, equally important|
|To compare||In the same way, likewise, similarly|
|To contrast||On the other hand, conversely, be that as it may|
|To show cause and effect||Therefore, as a result, it follows that|
Come up with a catchy title
Can you imagine a newspaper story or a movie without a title? Of course not. An appealing title gives your audience a clue to what you are going to talk about. It’s best to write your title after you have written the body and conclusion of your talk.
It should be provocative as well as short and simple. It should indicate the content and purpose of your talk. Here are some examples:
[note]Question: What is Business English Anyway?
Startling statement: Higher Education is a Scam
Alliteration: Communication and Creativity
Words that rhyme: Fun and Sun[/note]
So now you know some ways to close your talk, some transitional words to make your talk flow well, and a few ideas to give your speech a title. Now you need how to make your talk persuasive and get your audience to take action.
How will you take action next time you present? | <urn:uuid:1f3c81d8-89c5-454b-9461-d4fe95cabde3> | CC-MAIN-2022-33 | https://frankbonkowski.com/structuring-a-presentation-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.934065 | 952 | 2.5625 | 3 |
Nostromo is one of Conrad’s finest works and is also one of the few which is set upon land. It was published in 1904 and concerns primarily the corrupting influence of money or in this case silver. The novel is set in the fictional South American country of Costaguana. We learn of a local legend in the province of Sulaco about the disappearance of two thieving ‘gringos’ who haunt the mountains due to their greed. We meet Charles Gould, who controls a silver mine and is trying to save it from the corrupt government. It is a time of political unrest and the dictator Ribiera flees. In this atmosphere, Gould becomes obsessed with saving the silver from the mine and emplys Decoud and Dr Monygham to aid him. They turn to Nostromo, a popular hero of sorts, who sails with the Decoud to hide the treasure but disaster strikes and they collide with an enemy boat. They arrive on an island and Decoud remains to protect it. However, he goes insane alone on the island and shoots himself before drowning, tied to a great quantity of silver. As the novel progresses we focus on Nostromo’s unwise romance with his friend Viola’s daughters. It contains very perceptive portraits of both heroes and anti-heroes and of the guilt that punishes the selfish, the greedy and the foolish. Many consider it to be Conrad’s most important novel. | <urn:uuid:503630f3-d420-4bb0-ad87-3026b89fcb1b> | CC-MAIN-2022-33 | http://www.bibliomania.com/0/0/15/26 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.961836 | 301 | 2.640625 | 3 |
There are many reasons why online prices are lower than prices in retail stores. It is necessary to keep it low too, as online shop price is dearer, customers would flock to the retail stores. Find below are the reasons why online shop prices are cheaper
A middleman makes a profit for himself in retail trade or wholesale as he serves as a bridge between the manufacturer and the retail shop. This extra cost is not added on to the product by online shopping sites of toys, baby products and many other goods, as they interact directly without any intermediary and this leads to low price online shopping.
Spoilt for Choices:
Online businesses are many and they get the best prices from the manufacturer. Such price is bound to differ marginally, and the customer can surf various shopping sites to get the lowest online shop price. Customers who are aware of this do extensive price comparison to gain low price online shopping.
Online businesses need not spend on infrastructure costs like retailers who have to build in with lime and mortar. Neither are there maintenance costs. This contributes to reduced prices online when you compare retail store prices. In fact, the best price retail store cannot match the best price online shopping sites.
Advertising and marketing by a retailer are bound to cost more than an online shopping site. Online businesses do it digitally and therefore, it is cheap too. The way retailers market themselves is expensive due to which they try to adjust the expenses by including additional costs for the products. Hence one can get the best price online shopping.
Online businesses purchase more than retail shops from the manufacturers. In other words, they sell more too. This allows the online sites to get extra discounts and offers which they pass on to the customers. Retail shops do also get such discounts, but far fewer than the online sites and that’s why retail store prices are higher.
Many online businesses import from the manufacturers directly and thus avoid paying any middlemen commissions which results in low price online shopping.
There are many other costs involved in shopping with the retail stores like petrol, parking fee, air conditioner cost, etc. which are indirect costs which are added to the retail store price practically.
Best Price Online Shopping:
Apart from low prices of products when shopping online, one can use Apps over websites to get the best bargains which is known as best price online shopping. For example, you can choose your budget and use the app to find a variety of products for the same price. It is not a sale but one basket with many products in it at the same price.
The products which are available in this could be clothes for men and women, footwear, computer accessories, mobile chargers, kitchen utilities, watches etc.
The best price online shopping would have three price ranges at least which may be Rs.249, Rs.349, Rs.449 etc. The app is efficient and does not consume much of your computer resources.
Best Price Online Shopping Sites
When one says Best price online shopping sites, there is an additional meaning to it. Any website can advertise a price and sell products at lowest of prices and become the Best price online shopping sites. Reliability and features provided play a vital role –
- Website popularity which practically endorses the reliability factor.
- Strong security should be available as we tend to display out personal information including credit card details and thus be protected from fraudsters.
- Payment Options should be multiple and almost all modes should be acceptable.
- Inventory holding should be large, so that we do not receive a ‘Out of stock’ message frequently.
- Return/ refund policy should include shipping charges and the process should be kept simple and speedy.
Here are the Best price online shopping sites and these are ranked with the cheapest prices:
- Shopclues.com who specialize in kitchen accessories, watches and other jewellery.
- Paytm.com who are specialists in mobile services including bill payment as well as retail selling.
- YepMe.com who are giants in selling fashion products including footwear
- Snapdeal.com where you can find electronic gadgets at the lowest price.
Here is the list of online stores which are popular:
- Amazon which has almost everything you desire and something extra.
- Flipkart which is a number one competitor to Amazon
Price of online Shopping
What is the online price? How does it compare to the retail price?
When you decide to go online and purchase a product that is quoted on it , that price is known as the price of online shopping.
A few retailers do indulge in both retail business and online shopping where their products would be displayed, but the retail store price would be the same price of online shopping.
Some retailers do offer the online price if they know the customer well, in their retail shops.
When retailers are engaged in both online and retail prices, and we are aware of it, you can compare retail store prices with their price of online shopping product to product. This would help you fetch the best price retail store which is best for you.
Reasons why retail prices can never be lower than online prices and other service issues:
Online retailers save money on staff salaries, rent, etc. which helps them lower the price and one cannot compare retail store prices with it.
Sales tax is always not payable, and it depends where you conduct your business from.
Shipping costs may be borne by the customer or the online retailer as the case maybe. In retail shops, a person collects it in person generally.
Mode of Payment:
Online shopping businesses would accept all payment modes but retail shop owners may or may not allow to have all of the payment modes.
The above passage clearly illustrates that online business is here to stay and retail businesses will stay as long as they enjoy the patronage of their faithful customers. But then, price differences should be marginal for staying loyal forever.
Follow – https://financialapple.com for More Updates | <urn:uuid:69d4f26e-a07a-4d92-b5c4-a9ad28e93857> | CC-MAIN-2022-33 | https://financialapple.com/why-online-are-prices-lower-than-prices-in-retail-stores/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.95566 | 1,288 | 2.109375 | 2 |
Recommended Age, Grade, and Reading Levels
- Age: 6 to 10
- Grade: 1 to 5
Reproducible thematic lessons and activities in English and French teach genders, counting to 30, counting by tens, shapes, sizes, emotions, places in the community, opposites and measuring devices. This resource also includes lessons and exercises on avoir, être, connaître and savoir. Lessons are enhanced with an introduction to French landmarks, people, carnivals and more! | <urn:uuid:7ffc4c6c-f6e8-4d5c-8b78-63b987ba5c73> | CC-MAIN-2022-33 | https://49thshelf.com/Books/B/Bilingual-Kids-English-French-vol.-2-Resource-Book | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.908567 | 105 | 3.375 | 3 |
No doubt summers are the prime season for pests and insects but they do not become inactive during winters. In-fact as the temperature drops, your home becomes a comfortable heaven for pests especially mice and rats. Just like human beings, mice and rats search for warm and cozy places to survive in cold winter months. Also if you are not careful enough and leave food and water in open, then most likely these uninvited guests would settle in your home for long. Let us learn about some easy tips for rodent control to get ris of them in winters.
Here are some tips for rodent control in winters:
- Do not leave any food item in open. Store food in tightly closed containers preferably stainless steel and glass containers.
- Always clean the food scarps and crumbs after cooking and eating. Due to small body size, mice can survive on small quantity of food.
- If there are pets in your home, keep the pet food in a secure container. Also cover the half eaten pet food.
- Our garbage is food for rodents. So store garbage in closed bins. Dispose off the trash everyday by placing it outside home shortly before pick up. Do not leave the plastic trash bags out overnight.
- Stop them from entering your home. Inspect for cracks and holes in your walls, door and windows. If there are any, seal them with cement and metal. Also seal all the openings and cracks around plumbing pipes. Do not use cardboard or metal wool as sealing options, as mice are capable of chewing these items.
- Cleanliness is the most effective rodent repellent. Keep your home and surrounding areas clean and uncluttered so that there are no places for rodents to hide.
- Get rid of unused material i.e. junk from your garage and store. Keep these less used areas cleans and clutter free. This way there will be no warm place for rodents to hide.
Above are some preventive measures to keep rodents at door. But if the rodent problem has taken away the peace of your mind, contact pest control professionals for help. For Rodent Control in Delhi NCR, connect with Mr.Right.
Rodents though small in size can cause massive damage to your home and property. By following control measures you can stop them from entering your home.
Stay Rodent free! Stay Happy! | <urn:uuid:18722de2-aa59-438d-8ac4-53b19a263251> | CC-MAIN-2022-33 | https://www.mrright.in/ideas/home-and-garden/pest-control/7-easy-tips-for-rodent-control-in-winters/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.944929 | 479 | 1.921875 | 2 |
Yesterday afternoon certainly became a bit damp and we can expect more of the same today. The Met Office have also issued a severe weather warning for increased wind speeds in our area. The current risk matrix shows that the it is very likely we will see increased wind speeds but the impact from it will be low.
Not a great way to start the day’s weather news so now for a bit of cheer. This morning will also see the odd bright spell – hurrah (although we may get some drizzle too around 10:00 hours).
It is a cool morning (last night’s overnight low of 2.8c at 02:21 hours) with the day taking a few hours to reach our maximum of around 8c. The top temperature, however, will feel more like 3 degrees less than the actual with the wind chill. The overnight low will be mild at around 6c.
The radar tracking charts are showing that more persistent rain, similar to yesterday, will reach our area by around early afternoon and will stay with us, off and on, into the evening. We can expect to receive a further 3-4mm of rain today. The risk of further rain today is 85%.
The wind will be deriving from the SW and because of the low pressure system to the N of the UK creating lots of points of air pressure the wind will be moderately strong. The average wind speed this morning will be around 8mph and during the afternoon this will increase to 12-15mph. Gust speeds could reach around 30mph.
The GFS ensemble charts are showing that next weekend could be a little cooler than we will experience this-weekend but, overall, the period up to the 13 December will see us experiencing very similar temperatures to that we are currently encountering.
Summary: Cool start with the off brighter spell. The cloud will become lower as the morning passes bringing spells of rain to our area during the afternoon and evening.
Observations made 08:09 hours Hammerwich, Staffordshire.
Air pressure : 1010.5mb; Temperature 3.5c (2.8c at 02:21 hours) ; Relative humidity :85%; Wind: 6mph SW; Rain this month : 46.6mm; Rain this year : 457.8mm.
Hammerwich weather, Lichfield weather, Burntwood, weather, Brownhills weather, Bloxwich weather, Pelsall weather, WS7 weather, Walsall weather | <urn:uuid:59cff0c9-618a-41f0-9783-38f811c3bd96> | CC-MAIN-2022-33 | https://kevinjones21.wordpress.com/2015/11/28/good-news-and-not-so-good-news/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.945604 | 506 | 1.882813 | 2 |
‘‘The Leap’’ begins with the narrator telling how her mother, Anna, is the surviving member of a blindfolded trapeze duo known as the Flying Avalons. Although now blind, Anna never stumbles or falls, never knocks over objects in the New Hampshire home she shares with the narrator, who has come back to her childhood home now that her father is dead and her mother cannot live alone.
Anna keeps no mementos of her former life in the circus. Everything the narrator knows about her mother’s past under the big top has been gleaned from newspaper accounts. Acknowledging that ‘‘I owe her my existence three times,’’ the narrator credits her mother’s survival of a circus accident as the first time.
Harry and Anna were members of a traveling circus, and on this given day, weather conditions were just right for a wicked thunderstorm. The Flying Avalons were the fourth act to perform that day. Harry and Anna flirted with one another as they blindfolded each other and took their places on their trapezes, high above the crowd. No one watching knew that Anna was seven months pregnant at the time; her stomach muscles were so tight that she barely showed a bump.
Just as the pair were in mid-flight—Harry upside down, hanging by his knees, arms open wide to grab on to Anna, and Anna just having dived from her bar toward her husband—lightning struck the main tent pole and cruised down the wires. Harry dropped to his death, blindfold still in place. Anna, rather than following her husband to the grave, tore off her blindfold and twisted her body toward one of the wires. Although the metal singed all the skin from her hands, her life was spared.
While trying to pull her from the mess that lay on the ground, a rescuer broke Anna’s arm and caused something to fall and knock her unconscious. She was rushed to the hospital, where she remained for a month and a half before giving birth to a stillborn baby girl.
Although Harry was buried in the circus cemetery, Anna’s daughter was buried just around the corner from her New Hampshire home, the home in which the narrator grew up. The narrator mentions that she never really thought of the girl as anything but a less finalized version of herself, but that she often visited the grave as a child.
Anna met her second husband while recuperating in the hospital. Having spent time in the Air Force during the war—which war, the narrator never says—he became an expert at setting broken arms and legs. He stayed at Anna’s bedside during her recovery, and she regaled him with stories of her life and travels. Always having wanted to travel himself, he considered these stories a gift. In return, he taught the illiterate Anna how to read and write.
Reading quickly became Anna’s favorite pastime, and when her husband, the narrator’s father, dies, the narrator comes home from her life in the West to care for and read to her mother. The house is an old farmhouse that the narrator’s father inherited and is located in the same town in which the circus accident occurred. Although her husband never wanted to stay in such a small town, Anna loved the old house, and he loved her, so they made a life there. And that is the second time Anna was responsible for her daughter’s existence, when she met and married her father.
The house caught fire when the narrator was just seven, although no one knew for sure how it started. Anna and her husband were gone, and the babysitter had fallen asleep. She was awakened by the smoke and used the phone to call for help. By the time the narrator’s parents arrived, volunteers from the town were trying to put out the flames. They were getting ready to try to rescue the narrator, not realizing the only staircase to her bedroom was already destroyed.
The narrator woke up to find the house on fire, but she kept her wits about her and left the door closed, knowing what awaited her just beyond. She put on her robe and sat down on her bed to wait for rescue.
Anna, standing below her daughter’s bedroom window, knew there would be no rescue unless she took it upon herself to make the attempt. When she asked her husband, who was about to rush to the other side of the house, to unzip her dress, he didn’t understand. She explained what she planned to do, but he couldn’t seem to make the zipper work. So Anna stripped right there in front of all the neighbors and the volunteers, climbed up a ladder to the top of a tree, and crawled along a skinny, brittle branch toward her daughter’s window.
She stood, swaying on the fragile bough, and made a death-defying leap in the dark to an even smaller branch, one so skinny it was the size of Anna’s wrist. As she grabbed hold of the branch, it cracked, and the crowd below was temporarily unable to see through the dark to locate where Anna had fallen. As it turned out, she was hanging by her heels from the rooftop gutter. And she was smiling. The narrator was not surprised to see her upside-down, smiling mother, for she knew that Anna lived ‘‘comfortably in extreme elements.’’ Anna tentatively tapped on the window and gestured to her daughter to open and prop it up. Anna then swung down, caught the ledge, and crawled through the window. All the time, she was wearing nothing but her underwear. Her daughter was embarrassed by this, yet relieved at the rescue.
As the narrator held on to Anna, she realized that something her mother had told her years ago was true: there is time to do many things while falling through the air. While mother and daughter quickly fell through the darkness and into the safety of the fireman’s tarp below, the narrator realized she was thinking, noticing the wind, the cold, wondering what might happen if they missed their target. But then she forgot to be afraid and instead felt only the safety of Anna’s hands and body wrapped around her, felt her lips on her head, Anna’s heartbeat in her ears as she pressed her head into the familiar comfort of her mother’s body.
And that is the third time Anna ensured her daughter’s existence.
Sara Constantakis – Short Stories for Students – Presenting Analysis, Context & Criticism on Commonly Studied Short Stories, vol. 30, Louise Erdrich, Published by Gale Group, 2010 | <urn:uuid:e8adf816-ddc3-462e-8ebb-073bf7731fc5> | CC-MAIN-2022-33 | http://jottedlines.com/the-leap-by-louise-erdrich-summary/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.986192 | 1,393 | 2.328125 | 2 |
he policy must include a description of the main roles and responsibilities of information security management. Set out the requirements for staff and contractors, processes and technology in relation to information security, recognising that staff and contractors at all levels have responsibilities in ensuring financial institutions’ information security.
Threats to our information privacy, details and data are growing in intensity and sophistication on a daily basis. With this threat, organisations are beginning to gain awareness of these threats to information security, but provide limited budgets. Organisations must be specific on where they utilise their resources; financial, time and persons. You need to identify, […] | <urn:uuid:a9e11bf3-0ac5-40cb-82e8-17eac6283085> | CC-MAIN-2022-33 | https://andrewsduffy.ie/tag/credit-union/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.91617 | 125 | 1.71875 | 2 |
Civilization and its demons
Civilization and Its Demons
Before 1948, the annus mirabilis of the Homophile Movement, you could publish nothing favorable or even neutral about homosexuality in the good ole USA. In that year came Kinsey, Vidal, and the Bachelors for Wallace, out of which grew Mattachine. It organized the first ever petition, demonstration, parade, case that dismissed charges of lewd behavior, college level courses, and first ever magazine. One, which after a two year struggle won in 1958 from the U.S. Supreme Court the right to be distributed by the U.S. Post Office, and thus blazed the way.
Today, like with homosexuality before 1948, you can't publish anything or even neutral, much less positive, about pederasty -- now conflated with pedophilia, and demonized (as witchcraft was by the Inquisition and communism by Joe McCarthy). At long last, the Roman Catholics, traumatized by the priest sex scandal, which just now even penumbrating His Holiness the Pope himself, are trying to distinguish the two: pederasty being with adolescents and pedophilia, supposedly much more damnable, with prepubescents. Three women have succeeded in publishing studies of intergenerational sex which are not so extremely demonizing: Harmful to Minors by Judith Levine (University of Minnesota Press, 2002), The Trauma Myth by Susan Clancy (Basic Books, 2009), and Understanding and Addressing Adult Sexual Attraction To Children: A Study of Paedophiles In Contemporary Society (Routledge, 2009).
Two major studies of male-to-male intergenerational sex that actually tried to justify it in certain cases still remain unpublished: Rind et al. (1998): "A meta-analytic examination of assumed properties of child sexual abuse (CSA) using college samples," and Richard Yuill’s Ph.D. thesis (2004), Male Age Discrepant Intergenerational Sexualities and Relationships. Male-to-male is the most condemned type of intergenerational sex, a holdover from homophobia, but only one third as frequent as male-female intergenerational sex, and both are less frequent than female-female (which often just amounts to cuddling or petting without penetration or climax, which therefore makes it hard to assess or enumerate) and female-male, which was formally praised as making a man out of the boy until not so long ago!
Since Rind et al.’s - meta-analysis was condemned unanimously by both houses of Congress, the only works even mildly supportive of intergenerational sex have been by three women, Levine, Goode, and most recently by Clancy.
Two other major studies, one by Bruce Rind and the other by Richard Yuill have been suppressed during this time since both claim that intergenerational sex involving young males is much less common than the abuse of females, – often not at all harmful - in the absence of force, incest, or intimidation, and, a positive and beneficial experience for many young people.
O tempora! O mores! When I was young, a woman who made a man of an adolescent was assumed to have benefitted him. Now women are jailed for it, even if it is not one of his teachers, shrinks, or other care-givers. Those women are often convicted, even if the guy loves or marries them. For 30 years now it has been virtually impossible - to publish anything positive or even neutral about “boy-love.” – [I’m not sure this adds anything to the piece].
Unlike the Greco-Romans and the Chinese, both of whom merely pitied those not privileged enough to belong to their “superior” civilizations although within them and failed to live up to their high standards of education, taste, and culture, the followers of the Abrahamic religions (Judaism, Christianity, and Islam) hated and persecuted their “others”. Whether internal or external foes, they claimed that such people were inspired by Satan and doomed to hell. The Israelites, who gave birth to Judaism, demonized Gentiles and the “polluted” Jews among them, especially “males who lie with males as with females” and wished to exterminate them all. When the Christians usurped the role of chosen people from the Jews, they too damned all non-Christians, and among their own non-conformists especially sodomites, associated as they were in the religious mind with heretic more than any other sinners. By the time that I was young, and when religion seemed to be waning among western societies, we deemed communists and “homos”as threats to our security in this world and as cosmic threats to our eternal salvation. Today, with communism defunct and homosexuals tolerated, we now demonize terrorists and pedophiles - always an internal sexual threat paralleling an external one - a hysteria that neither Greeks nor Romans nor Chinese suffered from. For that matter, as far as I can determine, no other cultures, except those inspired by the Abrahamic religions, and their dogmatic successors in the western world - liberals, Marxists, and fascists - feel the apocalyptic inspiration not to resist, restrain, or pity the “others”, but to exterminate them root and branch with a Manichean fervor.
Like necrophilia and bestiality, considered by Krafft-Ebing victimless oddities (though a growing number of animal rights activists now deny that bestiality is a victimless act, and a number have always considered corpses to be sacrosanct), animation is not required here by victimologists [does this mean questions to do with “virtual reality” indecent Internet images? as was the case with the medieval Jews desecrating the host or the Templars urinating on the cross. But even Psychopathia Sexualis didn’t include historically perhaps the most attested sexual deviation, that is congress with extra-terrestrials of whom the devil and his incubi and succubi were the most numerous victimizers in the Abrahamic religions, not to mention the Pagans, with a vast array of Greek and Latin deities and heroes usually bisexual who victimize humans of all ages, or those vast numbers known to have sexual congress with humans in Africa, southeast Asia, and the Americas against which exorcism is still performed and practiced in all its various forms. (I question whether this paragraph rather strays from the subject in hand).
Having herself been “abused”, the journalist Judith Levine uses her own and other narratives as well as some sociological and psychological data in Harmful to Minors (University of Minnesota Press, 2009) to question the dogma of the sex-abuse industry. Levine’s probing work incorporates information from a variety of sources, including interviews with young people and adults, newspaper articles, internet sites, visits to schools, and more, in concluding that it is okay, normal, and natural for children to have sex. The only real harm in childhood sexuality, as the subtitle suggests, is the peril that results from our modern cultural obsession for “protecting children from sex.” To date, the book has received a considerable amount of attention on Amazon Books, with some 56 reviews, of which nearly 2/3 tw-thirds(36) are favorable, giving the book a full 5 stars (and on Google books where it has received 5 stars from 28/42 readers)---- . The majority praise Levine, for trying to shed light on an important and sensitive issue and for noting the frivolity/paranoia in our modern approach to childhood sexuality in the US. One reader commends Levine for pointing out “the plethora of new laws that, though well intended, are founded on terribly flawed evidence and pushed into enactment by highly neurotic people who understand nothing of what constitutes real harm in the real world,” while another suggests “one can make a compelling case that pedophiles are created by society's prohibition against children satisfying their natural adolescent curiosity during adolescence, the pedophile being a product of arrested sexual curiosity.”
As might be expected, however, Levine’s bold work also occasions shrieking denunciations and scathing reprobation, for example, from supporters of abstinence-only education programs. She is criticized for using pseudo-science, discredited for not being a parent, and scolded for being “unwilling to understand those who don't think the way she does.” One reader advises us to “Read the book--ponder it--but have a few grains of salt handy.” Another objects to Levine’s work on the grounds that the “book is no more than postmodernist claptrap, masquerading as science.” “The positive attention it's garnered,” this same reader tells us, “is due more to the desire of academics and pseudo-intellectuals (too often synonymous) to appear au courant and grab a ride on the PC bandwagon than to any redeeming social value or merit contained within its covers.”Another reader -suggests “Thanks to this book, more teenagers and children are going to have so-called "protected" sex and end up with STDs…This book is another effort to sexualize children at younger and younger ages. The people who make fun of abstinence make ME laugh. I didn't have to have an AIDS test before my wedding.”
However we choose to interpret Levine’s book, or whatever side we might take in the debate about childhood sexuality, one thing is for certain, Harmful to Minors has opened up a “Pandora’s Box” around an already sensitive issue, and we should expect it to be read, debated, and referred to for many more years to come.
Sarah Goode also created a popular uproar with her - long-winded title Understanding and Addressing Adult Sexual Attraction To Children: A Study Of Paedophiles In Contemporary Society (Routledge, 2009). So far she hasn’t received any reviews on Amazon (or Google) but like Levine she has been denounced, although she insisted that pedophilia, which she problematically defines - as sex between someone older than 16 with someone younger, although terrible, was not as dreadful as the sex-abuse industry stated.
By implication, Clancy supports the unpublished dissertation by Richard Yuill, approved by Glasgow University 5 years ago. Considering myself unqualified, and also seeing no reviews for either of these books on either Amazon or Google, I have elicited the following commentary on Sarah Goode’s book by Richard Yuill:
“In a recent ethnographic study on paedophiles in contemporary society, Sarah Goode certainly recognizes the lowly position of self-identified child lovers within contemporary Western society, yet fails to fully theorize the implications of this when it comes to core epistemological issues of knowledge production, scientific veracity, and what cultural stories are able to be disseminated. The central reason for this oversight is her naive adoption of an essentialist perspective on adult-child sexual relations and subsequent failure to engage with constructionist and deconstructionist insights on childhood.
“Furthermore, the attitude Goode displays to her research respondents is far from empathetic or ethical. Indeed, most of her final summation amounts to a rubbishing of the “supposed” positions taken by self-identified paedophiles, and tends to take the form of a self-congratulatory monologue on how convincing she finds the child sexual abuse (CSA) paradigm in her understanding of adult-child sexual relationships. Goode also doesn’t hide her complicity in current legal strictures on paedophiles, by openly declaring her intent to contact the police, and in positioning her work as an important tool in “child protection.”
“Her basically unreconstructed modernist approach to sexual epistemology ultimately fails to provide significant theoretical or practical insights. In contrast, Goode’s reliance on developmental and neurophysiological approaches lead her down a blind alley, one which supposedly presents a liberal notion of progressive toleration, but in fact ultimately binds sexual theory and praxis to a bureaucratic, monolithic regimen, and consigns both paedophiles and children to a sinister and dystopian future.”
The third and most spectacular and debated book on this subject is Sarah Clancy’s The Trauma Myth (Basic Books, 2009). The Trauma Myth has driven a stake through the heart of the dogmatic assertion of the child sexual abuse industry that intergenerational sex - even that of infants under 6 and children under 13 with adults over 18 - is automatically traumatic to the younger person. Clancy says that it only traumatizes those 10% compelled by violence and intimidation. Rind et al. (see their meta-analysis in Psychological Bulletin, July 1998,) claimed that boys on average were less frequently traumatized than girls, partly because they were less abused through incest and force than girls. That work was -censored by both houses of Congress.
While denouncing intergenerational sexual contact as - widespread and highly controversial, Clancy asserts that trauma only occurs years later, when a hostile society condemns it to the victim as an adult. One wonders whether if society were to accept such relationships as inevitable, as it has homosexuality, prostitution, and gambling, there would be no harm at all – a solution that she doesn’t seem to consider. Since legalizing those relationships often seems to have had positive results, she should at least consider having the age of consent lowered to 14, which would mark progress and reduce trauma and other damage. – Not needed I think.
The main reason why Clancy’s Trauma Myth has evoked such shock (26 reviews to date, of which 15 give the book the lowest rating, one star) so soon after its publications is not only its catchy title compared to Sarah Goode’s tedious one - but because it asserts that intergenerational sex involving pre-pubescent children does not immediately create a trauma. She asserts that the trauma comes only later, after the infant or child grows up and learns that what it did is considered horrible, and - internalizes that he/she might have in some way encouraged it - thus Consequently, this work -–potentially opens the way to the claims of the still-suppressed, but more favorable to intergenerational male-male relations, works written by Rind and-Yuill. Rind has argued that in fact there is no harm at all in many cases of such male sexuality if it does not involve force, incest, or intimidation, and that in general, it is less-traumatizing than the far more common adult male with underage female encounter, and that it shouldn’t be called a pathologicaldisorder as it currently is in the DSM-IV - diagnostic manual.
Clancy’s work is not without flaws. I think that she might have made greater distinctions about whether incest and the effect on girls as contrasted to boys might have increased the adverse reactions as some think. Perhaps the most - crucial point is that she restricted her interviews to adults who were under age 12, when they had the sexual encounter --with - an adult. As Rind et al. suggest, younger children tend to have more negative experiences in sexual encounters with adults.Still, the work provocatively explores a controversial topic, and for that its’ value should be rightly acknowledged.
As a historian, all I can say is that throughout much of recorded history and as far as I can ascertain throughout preliterate societies also, the immense majority of sexual unions, often commencing with marriages between males in their late teens (17-19) and females in their early to mid teens (13-16) under 16, were without trauma, so that trauma from such a union surely must be a modern social construct as Susan Clancy has implied.
The answer that she offers is so clear, dramatic, and precise that I shall let Clancy speak for herself! She seems to have anticipated much of the debate that her work has generated:
“Given the assumption that victims themselves report progress, it is understandable that advocates do not want to see, hear, or collect any data that might rock the boat.” (107) “The trauma model is not a good fit for the reality of such violations.” (107) “I realize that many people committed to helping victims of sexual abuse do not really care about the truth surrounding the actual event. The trauma theory’s in accuracy does not matter to them.” (108) “…our lies about sexual abuse are not helping the victims” (108) “Sexual abuse is common and harmful; it is never the child’s fault.” (111) “Characteristics of the sexual abuse experience related to trauma (like how frightening it was, whether penetration or force was involved, and how many times it happened) do not do a good job of forecasting the significance of the victim’s psychological harm in the aftermath.” (112) “Indeed professionals should have paid more attention to what the victims had to say from the beginning. A growing number of scholars in the sexual abuse field are coming to agree that understanding how and why sexual abuse damages victims probably has little to do with actual abuse and a lot to do with what happens in its aftermath.” (113) “…At a later point the victims come to ‘relabel’ the experiences as ‘traumatic.’ I believe I am, however, the first to highlight this ‘relabeling’ as characterizing most cases of sexual abuse… in my study–no different from other research– the exact amount of time it took for the victims to conceptualize what had happened to them varied.” (121) “…once they had re-conceptualized’ these formerly ambiguous events– did the experience become psychologically traumatic and begin to exert its negative events.” (122) “When they discover they have been abused, victims frequently report feelings of betrayal.” (122) “It is the direct result of the conscious malicious intention of another human being.” (123) “…the degree of betrayal the victims felt in the aftermath was an inverse function of how traumatic the abuse was when it happened: the less traumatic it was, the more betrayal the victims reported.” (125) “Yet only 5 percent spontaneously reported feeling angry at their abuser.” (127) “Almost 80 percent felt both [victim and abuser] were at fault.” (129) “Victims almost invariably express guilt about the occurrence of the experience and usually blame themselves.” (131) “…the less traumatic (forceful, frightening, threatening) the abuse was while it occurred, the more guilt and self-blame the victims report later on.” (135) “Today, as a function of the mental health field’s relentless emphasis on trauma, force, and violence and the subsequent embargo on any real-world, practical information about the reality of sexual abuse, most victim’s experiences slip under the radar– their stories are ignored, dismissed, overlooked, or denied by the very people who purport trying to help them.” (140) “The trauma conceptualization results not only in victims’ negative feelings of guilt and isolation not being neutralized but in their being exacerbated; victims feel worse.” (141) “…shame is overwhelming…the trauma theory needs to go.” (142) “ A growing body of data indicates that feelings of betrayal, shame, guilt and self-blame are potent predictors of psychopathological symptoms and disorders like depression, low self-esteem, and PTSD in the aftermath of sexual abuse.” (143) “Today sexual abuse is widely accepted as common and never the victim’s fault. But not much has changed regarding the victim’s decision to speak out about their abuse…Less than 10 percent of actual crimes actually get reported.” (150) “Whether either avoidance or suppression is actually beneficial is unclear.” (155) “Since the vast majority of crimes are never reported, the vast majority of perpetrators go unidentified and unpunished. Instead, according to a consistent body of data, they often commit similar offenses with other children.” (159) “…they must come to believe that they should be should be unafraid, unashamed and as un-stigmatized by others as a mugging victim.” (160) “Further, there is no clear neurobiological evidence that repression (the mind immediately and automatically erasing a memory) is even possible.” (162) “The worst part of the sexual abuse was how other people reacted…It turns out that there is an inverse relationship between psychological damage and social support.” (170) “By highlighting trauma-therefore emphasizing characteristics of a type of abuse that rarely exists– many mental health professionals advocating for victims to be believed, and supported, not blamed or doubted, are fostering the conditions that lead to denial, blame and minimization in the first place.” (176) “It has spawned a billion-dollar industry of media savvy professionals, academics, publishers and politicians who have transformed sexual abuse from a backwater social issue into a major social, health and legal concern.” (177) “Thirty years later, what has changed? Sexual abuse is still the best kept secret in the world.” (178) “The book started with a simple question, why is the experience of sexual abuse, as described by the victims, so different from how professionals portray and communicate it to the larger population?” (179) “…the trauma conceptualization of sexual abuse ‘has shown itself to be utterly resistant to facts revealed over twenty years of research.” (182) “Ten years ago, Bruce Rind, a professor at Temple University, and his colleagues published a paper in the prestigious journal Psychological Bulletin, arguing that sexual abuse does not immediately and directly lead to harm. Professional and societal outrage ensued.” (182) “The American Psychological Association called for a repudiation of the article, and public figures like Dr. Laura and Rush Limbaugh attacked the authors for conducting garbage science and for wanting to ‘sexualize our children and normalize pedophilia…You cannot challenge the trauma conceptualization of sexual abuse because of a deep-seated dogma that has prevailed in mental health and policy circles since the late 1970’s– a rejection of any information that highlights children’s involvement in or compliance with these crimes and a relentless preference for information having to do with the frightening, forceful, violent and threatening nature of sexual abuse.” (183) “Sexual abuse may not be a horror show for most victims when it happens, but certainly can become one later in life.” (184) “Sexual abuse is very wrong, regardless of how it affects victims…It is time to develop a stronger ethical position on the matter, one less dependent on the presumption of harm and more dependent on the premise that the act is inherently vile and unfair to the child.” (186) “Today, most states limit the time in which criminal prosecutions may be brought forward regarding cases of sexual abuse towards children. For example, in many states, once the victim turns eighteen, a five-year statute of limitations exists to bring civil suits forth based on sexual abuse claims.” (190) “…child sexual abuse should have no finite reporting period.” (191) “Highlighting the truth about sexual abuse also has clear implications for the recovered memory debate: the question as to whether people can forget and then, later on in life remember (or recover) their sexual abuse experiences. The answer is, conditionally, yes.” (191) “…cases in which a victim suddenly remembers abuse experiences that were obviously or subjectively traumatic when they happened (they involved pain, terror, violence or force) then it is possible the victim is experiencing a false memory– that the abuse experience never happened.” (192)
O tempora! O mores!
Certain topics today are even more taboo than intergenerational sex, but seem to be far more widespread than the general public believes: necrophilia in nursing homes and hospices (including sex with those near death and thus helpless); sex with the mentally retarded; and what has come to be greatly discussed, in prisons, rape by guards both male and female of underage youth and of other prisoners, as my late friend Steve Donaldson exposed when he founded the “Stop Prison Rape Society” some few decades ago. -
The solution to this much contested debate is more not less published research from all sides and viewpoints so that - knowledge is broadened, as opposed to the unequal access the CSA industry has at present compared to rival accounts. | <urn:uuid:9c9d7033-6639-4d16-8f8e-cd2d91abbe1d> | CC-MAIN-2022-33 | http://www.williamapercy.com/wiki/index.php?title=Civilization_and_its_demons&printable=yes | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.958466 | 5,201 | 1.710938 | 2 |
New energy minister Angus Taylor has confirmed what was largely expected: that he has no interest in emission reductions under the remit handed him by prime minister Scott Morrison, and that his primary focus will be on reducing prices for consumers.
In his first public outing since his appointment on Sunday, after Morrison was elevated following a right-wing putsch against former prime minister Malcolm Turnbull.
Taylor, one of the key players in that putsch, and one of the Coalition’s harshest critics of renewable energy targets and emission reduction schemes, gave selected interviews to Murdoch publications on Thursday, along with some “media drops” to other newspapers ahead of his first speech as minister in Sydney on Thursday.
The interviews and speech confirm much of what is known about Taylor, and his new role – which sees the energy and environment portfolios split, after having been united under Turnbull.
Taylor claims he is not a climate skeptic, but he dislikes emissions reduction schemes. He claims he is not anti-renewables, he just doesn’t like schemes that encourage them like the renewable energy target.
In reality, Taylor’s position on renewables does need some explaining, particularly given his appearance in 2013 along with Craig Kelly and Alan Jones at a “Wind Power Fraud Rally” organised by an anonymous website known for its violent threats, racism and mysogony.
It was interesting to note that when he talked about Australia’s energy resources in his speech on Thursday, there was no mention of wind: “It’s ironic that in a country with an abundance of natural resources – coal, gas, water and solar – we should be in this position,” he said of the country’s high energy prices.
He later mentioned both hydro (his grandfather was chief engineer for Snowy Hydro), and solar (he says his farm has some installed) – but again no mention of wind energy from the energy minister who has campaigned against many wind projects, including one near the family property.
As for his goal as minister, it is about prices, and nothing else.
“As the new Minister for Energy, my first and only priority is to reduce power prices,” he said in his speech. He said prices had already started the downward trend, but he credited this only to lower gas prices, and a focus on retail bills – there was no credit for renewables.
This appears to ignore advice from most energy experts, including the Energy Security Council.
And new analysis released on Thursday suggests that the influx of renewables will cut wholesale prices by around half, with the huge quantities of wind and solar being brought on stream now and in the next two years. This is cutting prices in the spot market and the futures market.
This – while contrary to Taylor’s view of the world – is entirely consistent with the modelling for the original RET, through Tony Abbott’s Warburton Review, the Climate Change Authority research, the Finkel Review and the ESB modelling for the National Energy Guarantee – that renewables will bring down prices, once they are built.
And that is the key. Now that they are being built, the analysis from Green Energy Markets shows, prices are falling as more than 7,200MW of wind and solar committed since 2016 are completed.
“We’ve actually turned the corner on wholesale electricity prices and they’re now headed downward and will continue to decline substantially over the next few years,” GEM director Tristan Edis says.
Taylor, however, remains implacably opposed. He sees a future for “commercially viable” renewables – but mentions only hydro and solar, as well as coal and gas.
He says will focus on recommendations from the Australian Competition and Consumer Commission (whose chairman Rod Sims, like Taylor, is a fellow former director of consultancy group Port Jackson Partners.
These include the imposition of a price cap on retail bills, the potential underwriting of “dispatchable” generation, and attempts to stop price gouging by the big “gen-tailers”.
Perhaps he could start with the government-owned gen-tailer, Snowy Hydro – given the success of the Queensland government in bringing down prices.
He said while the ACCC did not recommend forced divestment of assets in bad cases, the government would consider it.
Taylor said that the flagged program to underwrite “new stable, low-cost generation for commercial and industrial customers” would be done “expeditiously”, but energy insiders, however, say that this is mostly talk.
There is a limit to what the government will be able to do before the next election because of the sheer complexity of what they are seeking, and because they need private contracts to exist before they can double up with their underwriting proposal. That won’t stop them talking about it though.
As for the accusations of being a climate skeptic, Taylor says: “I am not sceptical about climate science. But I am and have been for many years deeply sceptical of the economics of so many of the emissions reduction programs dreamed up by politicians, vested interests and technocrats around the world.”
That puts him firmly in the “do-nothing” camp championed by the likes of Bjorn Lomborg, the controversial Danish polemicist so admired by the Liberals when Tony Abbott was prime minister.
i agree with @AngusTaylorMP when he says he’s not a climate science denier — we’ve discussed it.
he understands the science, knows how we can mitigate climate change but has worked tirelessly to ensure we do nothing.
that’s much worse, and he’s demonstrably effective. #auspol
— simon holmes à court (@simonahac) August 29, 2018
Another interesting aspect of Taylor’s speech was his claim that having a government commitment on emissions would not guarantee certainty – as had been argued by Turnbull, Josh Frydenberg and most every utility and investor.
To some extent Taylor is right, no government can provide absolute certainty. That is not the nature of business. But who is going to invest on the basis that the government won’t, over the long term, do anything about emissions.
And while this supposedly small government, low intervention administration proposes heavy intervention on markets and pricing, it refuses to price the one thing that absolutely must be priced, and that is carbon emissions.
One of the things Taylor could do is fast-track the shift to the 5-minute settlement rule on Australia’s national Electricity Market.
The new rule – designed to encourage battery storage and demand response, and put a stop to some of the most shameless gaming of electricity markets, will not come into effect until 2021 – some 6 years after it was first proposed, and resisted by the main energy utilities.
The regulator, despite some initial resistance, eventually agreed to the change, but said it would take four years to implement, and won’t be seen until 2021.
Many say that delay is ridiculous, a view underpinned by news that in the US, in a market nearly three times bigger than Australia’s, they have achieved the switch just two years after it was first announced.
MISO (Mid-continent independent system operator) says it was essential to stop gaming in the market and encourage investment in new efficient technologies.
Finally, Taylor made it clear that the Coalition government was prepared to fight the next election on fossil fuels vs renewables, emissions targets vs prices.
He criticised former Labor Premier Jay Weatherill’s “failed experiment” in South Australia, where the 50 per cent renewable energy target had resulted in a “flood of tears”.
- He said Labor proposes to “take Weatherill’s failed experiment national” – meaning its 50 per cent renewable energy target.”The difference between us and them could not be more stark,” he said.
- And neither could the difference between the Coalition and reality be more stark. Even AEMO in its Integrated System Plan suggests that renewables will make up 46 per cent of Australia’s electricity by 2030, just on business as usual.
- If that’s so bad, how does he propose to stop it? | <urn:uuid:c7a8b26c-e79e-4897-b85f-4d5c39a17248> | CC-MAIN-2022-33 | https://reneweconomy.com.au/taylor-confirms-no-interest-in-emissions-but-says-hes-no-climate-skeptic-39477/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00072.warc.gz | en | 0.971493 | 1,725 | 1.539063 | 2 |
To feel sacrifice consciously as self-sacrifice argues a failure in love. When a job is undertaken from necessity, or from a grim sense of disagreeable duty, the worker is self-consciously aware of the toils and pains he undergoes, and will say: “I have made such and such sacrifices for this.”
But when the job is a labor of love, the sacrifices will present themselves to the worker — strange as it may seem — in the guise of enjoyment.
Moralists, looking on at this, will always judge that the former kind of sacrifice is more admirable than the latter, because the moralist, whatever he may pretend, has far more respect for pride than for love.
I do not mean that there is no nobility in doing unpleasant things from a sense of duty, but only that there is more nobility in doing them gladly out of sheer love of the job. The Puritan thinks otherwise; he is inclined to say, “Of course, So-and-So works very hard and has given up a good deal for such-and-such a cause, but there’s no merit in that — he enjoys it.” The merit, of course, lies precisely in the enjoyment, and the nobility of So-and-So consists in the very fact that he is the kind of person to whom the doing of that piece of work is delightful.Dorothy Sayers, The Mind of the Maker, pp. 134 – 135
This threefoldness in the reader’s mind corresponds to the threefoldness of the work (Book-as-Thought, Book-as-Written, Book-as-Read), and that again to the original threefoldness in the mind of the writer (Idea, Energy, Power). It is bound to be so, because that is the structure of the creative mind. When, therefore, we consider Trinitarian doctrine about the universal Creator, this is what we are driving at. We are arguing on the analogy of something perfectly familiar to our experience. The implication is that we find three-fold structure in ourselves (who are the Book-as-Read), because that is the actual structure of the universe (which is the Book-as-Written), and that it is in the universe because it is in God’s Idea about the universe (the Book-as-Thought). Further, that this structure is in God’s Idea because it is the structure of God’s mind.
There is nothing mythological about Christian Trinitarian doctrine: it is analogical.Dorothy Sayers, The Mind of the Maker, pp. 122 – 123
So, just as a personal update here, it’s been an odd six weeks since Christmas. First of all, there was … you know … Christmas, with all that implies when you are the mom and in charge of the festivities. Right before Christmas, I injured my shoulder doing a pushup (don’t laugh … I’ve injured myself by sleeping wrong), and that resulted in several weeks of nerve pain. Then around the time the shoulder/arm injury was becoming less intrusive, I got some sort of bug that wiped me out for about two weeks. Added to all this, it’s been really dark and cold, as it tends to be in the dead of winter. Even with our modern conveniences … heated car, warm house, plenty of groceries, etc., that deep chill can really make it seem like life is against you. (Honestly, how did our ancestors ever survive the Dark Ages? Imagine being sick, and having sick kids, in a hut where it’s not warm if you don’t keep building up the fire.)
With all of this, I haven’t exactly been tearing through the reading material. I do have a sizeable TBR of nonfiction … but even some of that, I wasn’t ready to face. I have a couple of nonfiction books about American Indians that promise to be eye-opening but depressing.
So I punted.
My nonfiction this past six weeks has been a reread, a book about the writing process (which is like candy!), and a journalistic book that goes down easy. Here they are.
The Mind of the Maker by Dorothy Sayers
A fantastic book about how the structure of the Trinity is reflected in the creative process. See my review here.
Rigged by Mollie Hemingway
A journalistic book that documents the various things that were done to ensure that T—- was not re-elected in 2020, including things like burying very incriminating evidence of B—–‘s corruption, changing (or ignoring) election laws in Pennsylvania, etc. I actually remember a lot of this stuff happening, because I get my news from the Daily Wire, although of course this book has more details, inside information, sources, etc. If you don’t get your news from the Daily Wire or a similar off-narrative outlet, it’s possible that the contents of this book might shock you. For me, it’s more of an entertaining ride, plus explanations of local election laws that a layperson can understand, plus just seeing that all this stuff is documented for posterity before it gets memory-holed.
I will probably give this book to someone as a gift later, but as per tradition, I must pre-read it first. (I haven’t decided who I will give it to, so if you clamor loudly, there’s chance that person could be you!)
Darwin on Trial by Philip Johnson
Here is the review I posted on Goodreads this week:
This is a reread. The first edition was published in 1991. I’ve read it a number of times over the years. This time, I got it out because my students are getting to the age when we are going to have to start wading in to these debates.
Johnson is a lawyer, so he has a sharp eye for spotting equivocations, ad hominems, and the unexamined philosophical assumptions behind even honestly made arguments. His writing is a pleasure to read. It’s a course in logic as well as a survey of the neo-Darwinian synthesis, or as he calls it, the Blind Watchmaker thesis. Now, on my third or fourth reading, I realize that I missed a lot on previous readings because there is just so much going on in this book. Also, perhaps, because when we are accustomed to hearing a debate framed in one way, it can be difficult to follow, on first reading, when someone frames it differently.
Scientific discoveries have changed a lot since Johnson wrote this book. The changes have not provided more evidence for the Blind Watchmaker thesis; quite the opposite. Soft tissue has been discovered in dinosaur fossils, for example. More and more “hominem” species that were thought to be sub-human have been discovered to have been, in fact, simply human. Stephen Meyer has published his books about the Cambrian explosion and the challenges it poses to the Blind Watchmaker thesis. Genetics gets more, not less, intricate the more closely it is studied. More “living fossils” have been found. However, the amazing thing is that none of this matters much to the thesis of Darwin on Trial. Johnson’s argument is that the Blind Watchmaker thesis is not an empirical claim that its adherents set out to test, but rather a philosophical position: a logical deduction from naturalism, or from strict materialism. To true believers in the Blind Watchmaker thesis, none of the discoveries I have mentioned will look like disconfirming evidence.
… so I’ll just post another quote from Dorothy Sayers.
Our perfect writer is in the act of composing a work –let us call it the perfect poem. At a particular point in this creative act he selects the “right” word for a particular place in the poem. There is only one word that is “dead right” in that place for the perfect expression of the Idea. The very act of choosing that one “right” word, automatically and necessarily makes every other word in the dictionary a “wrong” word. The “wrongness” is not inherent in the words themselves –each of them may be a “right” word in another place. (Footnote: Always excepting, of course, words like “sportsdrome” and “normalcy,” which are so steeped in sin that no place is “right” for them, except Hell, or a Dictionary of Barbarisms.)The Mind of the Maker, p. 103
Does anyone have any other candidates for this category of words?
If we propose to ourselves to “think about nothing,” we find we have engaged in a very difficult exercise. It does not seem to be quite the same as “not thinking about anything.” “Nothing” seems to remain nothing only as long as we refrain from thinking about it; any active thought is apt to turn it into a “sort of something” — it acquires, in fact, precisely that vague and disquieting sort of reality that we are accustomed to associate with the minus signs in algebra.Dorothy Sayers, The Mind of the Maker, p. 98
This is part of a discussion of how evil could come to be, in a good universe created by a good God.
Too much attention should not be paid to those writers who say (holding one the while with a fixed and hypnotic gaze): “I don’t really invent the plot, you know — I just let the characters come into my mind and let them take charge of it.” Writers who work this way do not, as a matter of brutal fact, usually produce very good books. The lay public (most of them confirmed mystagogues) rather like to believe in this inspirational fancy; but as a rule the element of pure craftsmanship is more important than most of us are willing to admit. Nevertheless, the free will of a genuinely created character has a certain reality, which the writer will defy at his peril.The Mind of the Maker, by Dorothy Sayers, p. 67
Dorothy Sayers (1893 – 1957) was the author of the Lord Peter mystery series, numerous plays, and a translation of the Divine Comedy. She was part of the Christian literary flowering in the early 1900s which also encompassed T.S. Eliot, Charles Williams, J.R.R. Tolkien and C.S. Lewis. “She explored by-ways of knowledge, delighted in puzzles and enjoyed many a fight which she conducted with wit and good humour. Her formidable presence, magnificent brain and logical presentation put her in great demand as a lecturer.” (About Dorothy Sayers)
Me and Ms. Sayers
This particular book, The Mind of the Maker, turns out to have a personal history for me. I’ve been vaguely aware of it for years as a book “I really should read some time.” I first remember hearing it recommended by C.S. Lewis in one of his short apologetics books, where in the process of pointing out that any thinking about nonphysical things will necessarily be metaphorical, and that this does not mean that the thinker is taking the metaphor literally, he remarks that “anyone who wishes to think clearly about this topic must read The Mind of the Maker by Dorothy Sayers.”
My dad has a large personal library, and last year, while I was poking around in it looking to borrow some other book(s), I came upon TMoTM, and borrowed that one too. And lo and behold! According to the inscription on the inside cover, this very book was actually given to me by my dad, almost 30 years ago. Even back then he knew I was a creative writer, though at the time I was a very immature and inexperienced creative writer, and was apparently not ready for Sayers. I don’t know how TMoTM made it back into his library. Perhaps I left it there when I went off to university, or when I went to move overseas. Anway, now, after having done some living and some creating, I am ready for this magnificent work of Sayers’, and what a sweet reunion it has been.
I should mention that I have also read many of Sayers’ Lord Peter mysteries, which is helpful because she uses them as illustrations sometimes in The Mind of the Maker. I have not read her translation of The Divine Comedy.
A Must-Read for Artists
The first thing to know about this book is that it’s delightfully readable. Sayers was, after all, a good writer, and she had worked for some years in advertising. This book is full of bon mots, terrific quotes, and so forth, and in fact I plan to post quotes from it for a long time on the Thursday quotation post on Out of Babel. So, although the subject matter might seem kind of abstract, the book is not difficult to read or understand. If you want to read it, don’t be afraid: go ahead and read it. Ms. Sayers will not allow you to get lost or even bored.
The thesis of this book is easy to summarize, but hard to believe until you’ve seen it fleshed out. Ms. Sayers, an Anglican, asserts that we can understand the Mind of the Maker (i.e. God) by looking at the dynamics of the creative process in the minds of lesser makers (people, specifically creative artists). God is, after all, the ultimate creative artist. She talks about “the artist” a lot, but inevitably most of her examples are drawn from the art forms she knew best: novels and plays. Her insights about the creative process were instantly recognizable to this novelist.
Diving a little deeper, she maintains that we can understand the orthodox Christian doctrine of the Trinity (yes, the Trinity) by looking at the dynamics of how an artist produces his or her work. The work itself, she says, is present in what you might call three persons. There is what she calls the Idea, which is the work as a whole, as author first envisions it when she “sees the end from the beginning.” Then there is the physical manifestation of the work (its incarnation, as it were), which is the only means by which any other person can know it. This is the physical book or play; and, in the case of a play, the stage, actors, costumes, etc. … the whole event. The process of converting the Idea into this physical form is hard work, and the artist carries it out by means of what Sayers calls Energy or Activity. Finally, there is the work as an experience that the reader or theater goer has as they read or hear the story. This too is the piece of art itself, and this Sayers calls the Power. Each of these states of the play or novel, Idea, Energy, and Power, can be legitimately said to be the entire play or novel, not just a part of it. Yet they can be distinguished from each other. All three have to be present if the reader is to have an experience of the novel, or the audience an experience of the play. In the Trinity, the Idea corresponds to the Father, the Energy to the Son or the Word, and the Power to the Holy Spirit.
I hope this does not sound blasphemous. As we read through the book, it is striking how well the dynamics of bringing a work of creative art into being parallel the doctrines of the Trinity, and help us to understand them. Sayers would say, of course, that this is no coincidence. It is because people are indeed made in the image of God, and when we engage in creative work, there is something in our structure that parallels His structure as a Maker.
There is, as you might expect, an interesting discussion of the process of the author creating characters that in some sense exist independently of herself, and how this relates to human free will.
Even if you are not interested in the Trinity, I recommend this book to any writer who wants to read the insights of another writer who is intimately familiar with reading and writing literature, including the dynamics of plotting and pantsing, and of being asked if your characters’ tastes and opinions are the same as your own and why you can’t “make X character do Y.” There are also some delightful examples of bad writing that Ms. Sayers quotes as she illustrates different ways in which the creative process can break down. I don’t know how relatable this book may be to artists in different media, such as music or visual arts, but I would encourage them to check it out as well.
Our speculations about Shakespeare are almost as multifarious and foolish as our speculations about the maker of the universe, and, like those, are frequently concerned to establish that his works were not made by him but by another person of the same name.The Mind of the Maker, pp. 56 – 57 | <urn:uuid:46d9bf6b-0027-40a7-b5c7-7cac8786ae00> | CC-MAIN-2022-33 | https://outofbabel.com/tag/dorothy-sayers/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.969598 | 3,578 | 2.515625 | 3 |
WEDNESDAY, Sept. 22, 2021 (HealthDay Information) — Infants could present early indicators of autism, however a analysis normally is not made till age 3. Now, a brand new research means that jumpstarting remedy would possibly stave off that analysis altogether.
Researchers say their preemptive, parent-led intervention might have a big impression on kids’s social improvement and longer-term disabilities.
“What we discovered is that the infants who acquired our remedy had decreased behaviors that we use to diagnose autism. And, actually, the remedy was so efficient in supporting their improvement, that the infants who had acquired the remedy have been much less prone to meet medical standards for autism,” mentioned research creator Andrew Whitehouse. He is a professor of autism analysis at Telethon Youngsters Institute and the College of Western Australia.
The four-year randomized trial, supervised by Telethon Youngsters, included 104 infants in Australia, ages 9 months to 14 months. Most have been adopted to age 3. All had proven behavioral indicators of autism, which may embrace decreased eye contact and fewer gesturing communication.
Half the contributors acquired the standard autism therapies. The opposite half acquired a 10-session intervention utilizing video suggestions, which data the mother and father with the toddler, so mother and father can watch it later and observe how their child communicates. Each teams went by the classes for 5 months.
By the point the kids have been 3, when a analysis could possibly be made, researchers discovered that autism was one-third as seemingly in kids who had acquired the brand new remedy, with 7% assembly the factors for an autism analysis within the intervention group in comparison with 21% within the different group.
These kids nonetheless had developmental difficulties, however the remedy supported their improvement by working with, as an alternative of attempting to counter, their distinctive improvement, in line with the research authors.
Utilizing this method, “we have decreased the extent of incapacity to the purpose that they do not obtain a analysis. What we will completely anticipate or hope is that these reductions in incapacity will translate to real-life, real-world, longer-term outcomes by way of what they will obtain of their training, of their employment and of their on a regular basis lives,” mentioned Whitehouse.
This is not in any means a treatment for autism, neither is that an goal they imagine in, Whitehouse mentioned.
Many therapies attempt to exchange developmental variations with extra “typical” behaviors. This new remedy as an alternative tried to work with every kid’s distinctive variations to create a social surroundings that may work for that little one, the researchers mentioned.
Mother and father developed elevated sensitivity to their child’s distinctive communication. The researchers additionally noticed a rise in parent-reported language improvement.
“The aim of the remedy is to assist the mother and father observe, replicate and alter the best way wherein they work together with their little one,” Whitehouse mentioned.
Autism is a neurodevelopmental dysfunction. Autism spectrum dysfunction (ASD) can embrace impairments in social interplay and communication and repetitive behaviors, in line with the research. In the USA, about 1 in each 54 children has autism, in line with the U.S. Facilities for Illness Management and Prevention.
Kids are sometimes born with small variations in the best way they course of the world, however these small variations can create bigger disabilities later, Whitehouse defined.
“Father or mother-child interactions are by no means a reason behind autism. Completely not,” Whitehouse mentioned. “What we’re saying is that oldsters are probably the most outstanding and necessary folks of their kids’s lives and so they can play such a robust function in serving to help their improvement.”
Researchers plan to comply with these kids as much as age 6 or 7 to get larger affirmation of the findings, revealed Sept. 20 in JAMA Pediatrics.
The research is thrilling for a number of causes, mentioned Dr. Victoria Chen, a developmental behavioral pediatrician at Cohen Kids’s Medical Middle in New York.
“It’s spectacular that this low-intensity intervention confirmed a lower within the variety of kids with medical analysis of ASD at age 3 years previous within the intervention group versus the management group, although the impression on a number of developmental and parental outcomes weren’t as important,” Chen mentioned. “It’s also spectacular that these variations in signs of ASD have been sustained over the two-year research interval.”
Chen, who was not a part of the research, mentioned she discovered it fascinating that households within the management group participated in additional community-based therapeutic applications than the households within the intervention group, but these within the intervention group nonetheless did higher general.
To substantiate the analysis, Chen mentioned she’d prefer to see a bigger research with a extra numerous pattern of contributors.
“It is exhausting to make the proper research in an preliminary research,” Chen mentioned. “I do not need to take away from this research as a result of it is a very, superb research and has a number of strengths.”
The web site Child Navigator has extra on kids’s developmental milestones.
SOURCES: Andrew Whitehouse, PhD, Angela Wright Bennett Professor of Autism Analysis, Telethon Youngsters and College of Western Australia and director, CliniKids, Nedlands, Western Australia; Victoria Chen, MD, developmental behavioral pediatrician, Cohen Kids’s Medical Middle and assistant professor, Zucker College of Medication at Hofstra/Northwell, Uniondale, N.Y.; JAMA Pediatrics, Sept. 20, 2021 | <urn:uuid:5dbb075c-4b78-4dda-94a2-5c99e1073ee4> | CC-MAIN-2022-33 | https://www.everythingplaza.com/intervening-in-infancy-would-possibly-assist-forestall-some-instances-of-autism/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.95363 | 1,193 | 2.5625 | 3 |
by bex Apr 18th, 2016
This is the first of what will be many more fact checks to come – assessing claims made by both sides of the EU referendum. Together, 38 Degrees members chipped in for a team of experts to fact check the issues that matter to all of us this referendum.
Right now, government leaflets telling us why we should stay in the EU are dropping through the letterbox in homes across the UK. Politicians on both sides are using the leaflet to score points off each other. But between the media frenzy and political spin, it’s hard for ordinary people to know which bits of the leaflet are true.
That’s where we come in. Thousands of 38 Degrees members chipped in for independent fact-checkers to cut through the spin about this referendum. A team of experts has investigated the government leaflet line by line, and they’ve separated the facts from the fiction.
Political spin travels fast – but there are millions of us across the UK. If each of us shares the people-powered facts with our friends and family, we can make sure everyone has the information they need to make their decision in this referendum.
Can you help get the truth behind the government’s EU leaflet out?Just click the image below to see the facts for yourself, then share them with your friends and family:
The factsheet’s been put together using research from Full Fact – a group of independent fact-checkers who aren’t on anyone’s side. They use experts, research and investigations to check claims made by politicians and the media, so they’re in a good position to sort the facts from the half-truths.
Staying or leaving the EU is a huge decision for our country. It’s the kind of decision that’s just too important to leave to politicians – or to a shiny government leaflet telling us how to vote.
That’s why hundreds of thousands of 38 Degrees members decided together that we have an important role to play in the EU referendum:to stay neutral, keep out of the party politics, use people power to cut through the spin on both sides – and give voters the chance to get the real facts.
As 38 Degrees member Kate put it: “Everyone seems to have their own agenda, but what people need is the information to make a decision that’s right for them. 38 Degrees members can do this better than the politicians.”
Democracy works best when more of us get involved – and right now, it’s up to all of us to help get the facts out to everyone we know. If enough of us get involved, we can make sure that millions of people across the UK will see the facts that’ll help them to make their mind up about Europe. Can you help get the facts out? Click the image below to read the factsheet, then share it with your friends and family:
PS: This is the first of what will probably be many more leaflets landing on your doormat between now and the EU referendum. Whichever side it comes from, by sharing these people-powered fact checks we can make sure that no one is swindled into voting one way or the other without seeing the real information first. Please forward share this fact check your friends and family to expose the truth behind the government’s leaflets.
More about Full Fact
Full Fact is an independent, fact checking charity. They’re an organisation who use experts, research and investigations to check claims made by politicians and the media. You can find out more about Full Fact and the work they do on their website here. | <urn:uuid:bb252a49-30a1-42c9-a4af-b74420bbcfb5> | CC-MAIN-2022-33 | https://home.38degrees.org.uk/2016/04/18/the-governments-eu-leaflet-fact-checked/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.952275 | 767 | 1.914063 | 2 |
The word “anime” is short for animation and is generally used for popular Japanese animated cartoons featuring hand-drawn or computer animated characters. Anime started gaining popularity through Dragon Ball, Naruto, Death Note, and other series. While this trend of anime initially emerged in Japan as a way of storytelling and narration of historical tales, it has quickly become an entertainment enterprise.
With the increasing popularity of anime series in the global market, anime DVD shops have become extremely popular as well. We can consider these shops as exclusive stores resembling movie shops that offer new DVD releases. While at an anime store, you may only buy anime DVDs, an online DVD store not only offers movies, TV series and world cinema releases, but also the exclusive anime series. The commercialization of anime series including television shows, movies, video games, internet releases, and other visual mediums has made it easier for fans to buy their favorite DVDs from the comfort of their homes.
7 Reasons for the Increasing Popularity of Anime Series:
Anime series usually have a lot of depth in their plots, unlike most cartoons. They deal with themes of good and bad, life, loss, hope, justice etc. Most people like these things, especially young adults can relate to them. These offer important life lessons and are more intriguing and addictive in comparison to regular cartoon series.
Anime features beautifully drawn characters and locations that are very enticing on their own. The characters are colorful, attractive, gorgeous and inhuman. All these things add an air of mystery to anime shows captivating the audience
Perhaps, the most addictive thing about anime series is the way its story unfolds. The developers create the characters to go with the storyline. One show features many different plots at once. Anime movies never become monotonous and the storyline remains dynamic. The continuity of the story over the episodes keeps the viewer hooked to the show.
An Appropriate Ending
Unlike most dramas and series, animes usually do not have a second and third season. They usually end when the time is right. This is what I like best about the anime shows; they do not drag.
No matter how intense or serious an anime series is, it always has a touch of comedy. Whether it is a certain character or certain moments that provide this comic relief, it is always there. These random moments of laughter ensure that you have an enjoyable time watching anime.
Anime movies tend to have well choreographed and synchronized action sequences. The ability to draw gives a lot of flexibility as to how to portray action scenes. Thus, anime videos usually tend to have amazing action moments.
The characters are so well developed and complex that many people can relate to several of them. Some literally fall in love with them. The amazing portrayal of emotions, captivating voice-overs, and charming personalities render the viewers as huge fans of the characters.
Besides the reasons mentioned above, the wide variety of available anime genres has led to a rise in anime viewership. | <urn:uuid:17c11299-4ebd-4672-87d8-1122f6a41106> | CC-MAIN-2022-33 | https://bellenews.com/2019/02/13/entertainment/why-anime-series-has-become-so-popular-around-the-world/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.95271 | 622 | 1.820313 | 2 |
From now until the midterm elections in November, we’ll be featuring essays from powerful cultural voices alongside one simple thing, chosen by the author, that you can do to take action against the paralyzing apoplexy of the daily news. Maybe it’ll be an organization that deserves your donation; maybe it’ll be an issue that deserves greater awareness. Whatever it is, our aim is to remind you, and ourselves, of the big and small things we can do to work toward justice and change.
Native and American
by Sandra Rodriguez Barron
Walking in a nature preserve this spring, I overheard a man loudly complaining to his companion that Connecticut politicians were allowing “Puerto Rican refugees” to resettle here after Hurricane Maria. Roughly 135,000 fled to the U.S. mainland, the highest concentrations winding up in Florida, Massachusetts, and New York. But given that Connecticut already has the largest percentage of Puerto Ricans per capita, I found his comment disturbing. I’m Puerto Rican by birth and couldn’t resist taking him on.
“You can’t be a refugee in your own country,” I interjected. “You mean evacuees. People who lost their homes in the storm went either wherever they have family or where FEMA sent them.”
“Well, they don’t pay taxes in my state,” the man said.
We went back and forth. He knew that Puerto Ricans are U.S. citizens, but his resentment was stubborn, based on the misapprehension that American “nativism” and European patrimony are the same thing.
“More than 60 percent of Puerto Ricans have Native American blood, sir,” I said. “Our ancestors, the Taíno, were here centuries before Columbus.”
“But not here,” he said, pointing at the ground.
“Yes, here! Puerto Rico is a part of the U.S., so it’s here.” I opened my arms and pointed toward the seagrass swaying around us. Exasperated, he shook his head and kept walking.
Bringing up natives always flusters faux nativists. We’re still weak, as a nation, at illuminating our Native American roots, much less understanding the centrality of the Taíno people to the full sweep of American history. Maps of American tribes never include Puerto Rico, which one could argue has everything to do with the island’s marginalization. To be fair, though, the island’s indigenous population was considered extinct by historians. The official story held that its first people, overpowered by Spanish horses, firearms, and diseases, were genetically unrelated to the Puerto Ricans living today. Only in the mid-2000s did the fields of anthropology and genetics converge to prove otherwise. Puerto Ricans woke up to the astonishing news that their native ancestors—the peaceful, seafaring Taíno—had survived the onslaught of their other ancestors, the Spanish.
Does this matter to people like the guy on the boardwalk? Maybe not. But it appears that Americans are teachable. A study published earlier this year found that 78 percent of American adults surveyed are open to learning more about historical and contemporary natives—and that most of them assume what they know is outdated and inaccurate. By extending the chronology of American history curriculum and syllabi—before the English arrived, before the Indian ethnic expulsions of the 1800s—we can reframe how the average American sees Puerto Rico, and in turn indigenous people both inside and outside our borders. The few who already teach Taíno history report that even short attention spans are reliably captured by the legacy of battle and struggle and the mysterious nature of Taíno existence. “Kids learn that the ‘threads of brokenness’ aren’t exclusive to any one race,” says Jessica Galán, a high school teacher in Torrington, Connecticut. “They hear this incredible story and they begin develop empathy for other cultures.”
Experts say Puerto Rico’s recovery process will take years. While our president denies the breadth of the impact and death toll, a thousand evacuees with storm-ravaged homes are still waiting in hotels, and FEMA has either denied or not yet approved housing aid for thousands more. There will be more policy questions regarding Puerto Rico’s status in the future. The waterline of racism and xenophobia is rising. Including the island’s ancient indigenous legacy in our collective history may seem obscure, but it’s a crack in the wall of uninformed nativism. Tapping into the subconscious semantic power of the words native and American is a subtle but powerful act, something we can do in our own educational, creative, and social spaces. History, science, and storytelling have always held the power to illuminate the way out of the caverns of ignorance and fear.
Take action today:
Please join me in amplifying the Taíno story. Begin by visiting the Smithsonian’s Taíno exhibit before it closes in October 2019. Contact your school district to ask that they include the Taíno in their in U.S. history curriculum, and make them aware of this symposium, “Transforming Teaching and Learning about American Indians.” The Yale-New Haven Teachers Institute offers a complete Taíno curriculum unit plan that can be used as a springboard for creative work as well as teaching, and includes book recommendations. Or visit the United Confederation of Taíno People.
Sandra Rodriguez Barron is the author of the novels The Heiress of Water and Stay with Me. | <urn:uuid:2c10849f-9ecd-4949-b249-a12234e36724> | CC-MAIN-2022-33 | https://www.mcsweeneys.net/articles/native-and-american | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.953338 | 1,188 | 2.25 | 2 |
This Sunday, January 22, marks 44 years since the Supreme Court ruling Roe v. Wade made abortion legal throughout the United States. In all that time, no ruling has proved more contentious. And with the election of Donald Trump, who has pledged to undo the law, the marches and protests that mark its every anniversary will only grow more urgent.
There will be much said about people whose efforts, in different ways, brought Roe into being—plaintiff Norma McCorvey, Justice Harry Blackmun, and lawyer Sarah Weddington. It was Weddington who argued before nine robed men that a woman’s right to end a pregnancy was embedded in the Constitution. Seven of them agreed. And as Roe rose to remarkable renown—“undoubtedly the best-known case the United States Supreme Court has ever decided,” as the legal scholar Ronald Dworkin has noted—so did the lawyer who had won it.
But Weddington did not win it alone. She had a partner, a co-counsel named Linda Coffee. It was Coffee, in fact, who found the plaintiff, wrote the initial petitions, and filed the suit. It was Coffee who presented half the oral argument in District Court and appealed the ruling to the Supreme Court. But when Roe reached the highest court in the land, Coffee had been content to sit behind Weddington. And after the 7 to 2 ruling—with the court granting women the right to an abortion “free of interference by the state”—she had further been content to slip away, remaining largely unacknowledged even as her co-counsel absorbed recognition enough for two.
In the first two decades after the decision, Coffee seldom spoke publicly about Roe. Then she stopped mentioning it entirely. Indeed, she went into seclusion. I had found Coffee, three winters ago, in the course of research for a book I am writing about Roe and the plaintiff behind it. (I wrote about McCorvey for Vanity Fair in 2013.) Over the course of a few days, in the small Texas town where she now lives, Coffee told me her story. To the best of her memory, she had not given an interview since speaking with the historian David Garrow more than two decades ago.
Linda Nellene Coffee was born in Houston on Christmas Day, 1942. A sister followed, and the family of four eventually moved to Dallas. Home was on a lawny lane. But the center of Coffee’s life was a Southern Baptist church on Gaston Avenue, where her grandfather was a deacon and where she went to Sunday school, played softball, and sang in a choir. Coffee was shy but plucky; she once killed a scorpion that had scared off other girls at a Baptist camp. And if she was absentminded, she was also cerebral, tutoring algebra at Woodrow Wilson High.
In high school, Coffee and other students were shown a cautionary film about abortion; afterward, it struck her as crucial that women be able to “control their fertility,” she recalled. She wondered why it was acceptable for a man, but not a woman, to have sex before marriage.
Coffee enrolled at Rice University in 1961. She considered, and then rejected, careers in math, medicine, and German. At a loss, she took the LSAT. Three years later, she graduated with high honors from the University of Texas at Austin School of Law, elected to the Order of the Coif, an honor society.
Coffee thought she might go into domestic-relations law; she had interned at a legal aid society in Austin that helped disadvantaged women. But in 1968, it was the rare law firm that offered a woman a job; in Texas, women often needed the backing of a man just to rent an apartment. No firms made Coffee an offer, and she went to work at the Texas Legislative Council, a state agency where, for $600 a month, she helped legislators draft bills.
It was then that her mother heard through a lawyer at the Baptist General Convention that Sarah Hughes, the first female federal judge in Texas, wanted to hire a new clerk. Hughes was famous for swearing in Lyndon Johnson as president aboard Air Force One, after John F. Kennedy was assassinated. But Coffee admired her for working on behalf of women—fighting to secure them equal pay and the right to serve on juries. She applied for the clerkship. And when, recalled Coffee, on the April morning of her interview, The Dallas Morning News happened to print the bar-exam results, Hughes saw that her score of 87 had tied for the second highest in the state.
Coffee waded through a backlog of civil motions for Hughes, and then, after landing a job at a small bankruptcy firm in Dallas, through petitions for bankruptcy. She enjoyed the work. But she wished to do more. Hughes had taught her clerks to take stances. This she did in April of 1969, helping a childhood friend turned lawyer named Henry McCluskey to defend a defrauded man. Soon after, McCluskey—who was gay—decided to challenge the Texas laws against sodomy. He again asked Coffee for help. Coffee was excited. Such a suit would hinge on important questions of privacy.
Coffee got to work. “I wrote some kind of brief and drafted a complaint for him,” she said. McCluskey filed suit in May of 1969 and the court ruled in Buchanan v. Batchelor that the law was unconstitutional—at least with respect to married couples. Coffee, though, kept her involvement private. Like McCluskey, she was gay, though not open about the fact. “I wasn’t about to touch that publicly,” she said. “I would not have enough nerve to even be the counsel of record.”
Coffee was in the Southern Methodist University library when, in early September of 1969, she came upon mention of another suit involving sex and its ramifications: People v. Belous. Only days before, the California Supreme Court had exonerated a doctor who had referred a woman to an illegal abortion provider. Here was a ruling that rendered a state abortion law void on grounds that it was constitutionally vague and that it violated the “due process” clause of the 14th Amendment. Surely the abortion law in Texas was vulnerable too. “I just thought, my goodness!” Coffee recalled. “The same logic would apply.” | <urn:uuid:6bb56e85-c5fc-4ba5-903c-67d267d0530a> | CC-MAIN-2022-33 | https://www.vanityfair.com/news/2017/01/roe-v-wades-secret-heroine-tells-her-story | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00072.warc.gz | en | 0.986133 | 1,342 | 2.234375 | 2 |
upon this rock is a solo exhibition by British artist Rene Matić. It will continue their long-term interrogation of ‘Britishness’, exploring how the nation’s past manifests in its present. The exhibition will also address themes of subculture, faith and family.
A new installation of bronze and wood sculptures focuses on the figure of ‘the crucified skinhead’ – a long-standing symbol used to convey a sense of persecution and alienation. Matić’s work frequently makes reference to the Skinhead movement, which originally emerged in the mid-1960s as a cultural exchange between Caribbean and white working-class communities. The exhibition will place subculture and spirituality in dialogue, positioning subculture as religion – as saviour or guide.
The exhibition will premiere a new film work centring on the figure of Matić’s father, Paul. Also featured are new images from the artist’s ongoing photography series entitled flags for countries that don’t exist but bodies that do (2018 – ongoing). This series is a personal diary documenting Matić’s community and family (chosen and otherwise), as well as being a portrait and deconstruction of contemporary Britain.
ABOUT RENE MATIĆ
Rene Matić (b. 1997, Peterborough) is an artist, writer and poet based in London. Their work brings together themes of post-blackness, glitch feminism and subcultural theory in a meeting place they describe as rude(ness) – to interrupt and exist in/between. Matić takes their departure point from dance and music movements such as Northern soul, Ska and 2-Tone, using them as sites to queer and re-imagine the intimacies between West Indian and white working-class culture in Britain.
Recent solo exhibitions include in spite of, instead of, Quench Gallery, Margate, UK (2022), flags for countries that don’t exist but bodies that do, Arcadia Missa, London, UK (2021), Born British Die British, VITRINE Gallery, London, UK (2021). Recent group exhibitions include Crowd Control, High Art, Arles, FR (2022); Queerdirect, Sadie Coles HQ, London, UK (2022); Arcadia, Bold Tendencies, London, UK (2021); Bloomberg New Contemporaries, South London Gallery, London, UK (2021) and Friends and Friends of Friends, Schlossmuseum, Linz, AT (2020). Matić’s work is in several prominent collections including Tate, London, UK; Fondation Louis Vuitton, Paris, FR; UK Government Art Collection, London, UK; Martin Parr Foundation, Bristol, UK.
The new film work that will premier in this exhibition was originally commissioned by Film and Video Umbrella for BEYOND. | <urn:uuid:5469fa26-b9d2-4703-8d4a-bbc77c770066> | CC-MAIN-2022-33 | https://www.southlondongallery.org/exhibitions/rene-matic-upon-this-rock/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.933262 | 601 | 1.570313 | 2 |
Have you ever wondered what would happen if babies went to school? Children’s author, Barbara Lock, helps encourage critical thinking and inductive reasoning in this adorable and delightful new book titled, If Babies went to School.
Brian and Amanda try to figure out what it would be like if their baby brother, Luke, went to school. What would he and the other babies do at school? How would they get there? Could they share? What kind of games would they play?
As they talk about what the babies would and wouldn’t do, they discover what it would be like if babies went to school, and many ways in which they could help.
This is a great book. It’s funny, it gets kids thinking, and the illustrations are adorable, and many times, hilarious. Lock did a superb job of putting together a story that will educate and entertain. I certainly found myself laughing more than once while reading it. A spelling list of words from the book is including on the last page.
Geared toward readers ages 4 to 8, If Babies went to School, is a book your young reader will pick up often.
Rating: 🙂 🙂 🙂 🙂 🙂 | <urn:uuid:1fc4a3fe-2f2e-4b3b-9f2a-9df5f07d4a95> | CC-MAIN-2022-33 | https://childrensandteensbookconnection.wordpress.com/tag/gus-tarantino/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00072.warc.gz | en | 0.985627 | 246 | 2.71875 | 3 |
Now that we have the idea of a solar-powered, sensor-equipped sunflower that allows students to monitor plants in a rain garden, it’s time to think about where that sunflower will take root. Greenfield Elementary School in Center City has been a model of a “green school”: In 2009, the Philadelphia Water Department worked with the school’s parent group, the Philadelphia School District, the Community Design Collaborative and the EPA to transform an asphalt schoolyard/parking lot into an attractive, green playground (pictured above) that manages stormwater using rain gardens and porous play surfaces. Watch the video below for more detail:
A similar transformation is about to take place at Nebinger Elementary School in South Philadelphia (actually, Bella Vista—you can start a small war in Philly if you’re not careful about getting the neighborhood correct). This summer, construction begins at Nebinger to create a rain garden and porous play surface where asphalt used to be. The rendering below shows what the greened schoolyard might look like. The rendering below also shows what it might look like if a child with one foot were running—you see that guy in the background?
Schools are great locations for green infrastructure. Blacktop schoolyards tend to be large impervious spaces that normally contribute a large volume of stormwater to the sewer system. Schoolyard makeovers can revitalize play areas and introduce nature to the urban landscape. Having the students use technology to monitor their vegetation adds another layer of connectivity and offers even more opportunity for STEM education. | <urn:uuid:b5577510-0366-46c5-9ba6-9a4c0ed3f2a9> | CC-MAIN-2022-33 | http://greenstemnetwork.org/green-schools-greenfield-and-nebinger-elementary/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00072.warc.gz | en | 0.925492 | 325 | 2.9375 | 3 |
Like us on Facebook
Birthday Cake Decorating Set
Categories: Colors and counting.
Use this activity whenever your student has a birthday in your class.
We recommended presenting this activity after presenting “How to send a card” FeltSongs activity.
The children will love the opportunity to decorate their cake, count the candles, name the colors and have everyone sing happy birthday to them.
How to use:
Allow the birthday boy/girl to place the cake on a felt board and decorate it with the cookies and candies.
Ask the birthday boy/girl how old they are and let them pick the right amount of candles to be placed on the board.
Have everyone count the candles together as the birthday student put them on the cake.
Ask the birthday student to name the colors on the candles.
The children will look forward to decorate their cake during their celebration. | <urn:uuid:bed42bbf-2b41-4de4-b7e2-33460b271f34> | CC-MAIN-2022-33 | https://www.feltsongsstories.com/birthday-cake-decorating | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.933029 | 206 | 2.6875 | 3 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.