text stringlengths 160 608k | id stringlengths 47 47 | dump stringclasses 2 values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1 value | language_score float64 0.65 1 | token_count int64 48 145k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
From the Desk of Ann Kummer
One of the most controversial subjects in the field of speech-language pathology is the use of non-speech oral motor exercises (NSOMEs) to improve speech disorders and even feeding and swallowing. NSOMEs do not involve direct work on speech sound placement or on feeding or swallowing. Instead, these exercises include unrelated oral motor activities, such as blowing bubbles and horns; tongue pushes, wags, and curling; lip-puckering and stretching; and other movements of the structures of the mouth. The assumption behind these exercises is that weak oral muscles or inadequate flexibility is the cause of these disorders. NSOMEs are promoted by many of our colleagues and especially by vendors who offer a wide variety of tools, gadgets, and techniques for purchase.
Although the use of these exercises is popular with many, the evidence for their efficacy and even the theoretical basis for their use is consistently lacking. In this era of “fake news,” fringe theories, and pseudoscience, it is more important than ever to consider the evidence before employing techniques that may be ineffective, costing our clients time and money with no real benefit. Therefore, I am particularly excited to introduce Alice Lee, PhD to you. With this 20Q article, Dr. Lee will answer many of your questions about NSOMEs and the current evidence regarding the efficacy of these exercises for treatment.
Dr. Alice Lee is a speech-language therapist and Lecturer in Speech and Hearing Sciences at University College in Cork, Ireland. Her research interests and expertise include perceptual and instrumental investigations of speech disorders using electropalatography, acoustic analysis, and ultrasound. She researches problems with resonance, articulation, and prosody in individuals with structural anomalies, such as cleft palate, and neurological impairment causing motor speech disorders. She is an author of the following systematic review on non-speech oral motor treatments: Lee, A. S. Y., Gibbon, F. E. (2015) Non-speech oral motor treatment for children with developmental speech sound disorders (Review), Cochrane Database of Systematic Reviews 2015, Issue 3. Dr. Lee has served as the Editor of Journal of Clinical Speech and Language Studies, the official journal of the Irish Association of Speech and Language Therapists (2010-2019) and she currently serves as the Section Editor for Speech Pathology for The Cleft Palate-Craniofacial Journal.
I think this is a particularly important topic for all of us and this article is certainly thought-provoking!
Now…read on, learn, and enjoy!
Ann W. Kummer, PhD, CCC-SLP, FASHA, 2017 ASHA Honors
Browse the complete collection of 20Q with Ann Kummer CEU articles at www.speechpathology.com/20Q
20Q: Non-Speech Oral Motor Treatments: Any evidence?
After this course, readers will be able to:
- Define non-speech oral motor treatments or exercises (NSOMTs or NSOMEs).
- Discuss the arguments for and against using NSOMTs.
- Describe the current evidence regarding NSOMTs for treating individuals with speech disorders and swallowing problems.
- There have been controversies about using non-speech oral motor treatments in speech therapy. So, first of all, what are non-speech oral motor treatments?
The most cited definition of non-speech oral motor treatments is probably the one stated in the systematic review by McCauley and colleagues published in 2009. This paper reports an evidence-based systematic review supported by the National Center for Evidence-Based Practice in Communication Disorders (N-CEP) of the American Speech-Language-Hearing Association (ASHA). The authors defined oral motor exercises as “nonspeech activities that involve sensory stimulation to or actions of the lips, jaw, tongue, soft palate, larynx, and respiratory muscles that are intended to influence the physiological underpinnings of the oropharyngeal mechanism to improve its functions. They may include activities described as active muscle exercise, muscle stretching, passive exercise, or sensory stimulation” (McCauley et al., 2009, p. 334).
2. Are there any other definitions that have been mentioned in the literature?
Yes, other definitions have been provided and some also included a few typical examples of the tasks used in this treatment approach. For example, Hodge (2002, p. 22) stated that “the term oral motor treatment refers to a range of nonspeech and speech-like activities used to achieve a variety of goals that involve actions of the lips, jaw, and tongue”. Lof (2008, p. 253) explained that “NSOMEs [nonspeech oral motor exercises] can be defined as any therapy technique that does not require the child to produce a speech sound but is used to influence the development of speaking abilities”. And Lass and Pannbacker (2008, p. 408) described that “nonspeech oral motor treatments (NSOMTs) focus on nonspeech movements of the speech mechanism such as exercise, blowing, positioning, icing, swallowing, and other nonspeech activities”.
3. Are there any more recent discussions of the definition?
Yes, there is a fairly recent paper by Kent (2015), where he used the term “nonspeech oral movements” (NSOMs) and defined it as the “motor acts performed by various parts of the speech musculature to accomplish specified movement or postural goals that are not sufficient in themselves to have phonetic identity” (p. 765).
4. There seem to be some differences between these definitions, is that right?
Yes, and this was pointed out in Kent’s paper, that the definition used in the systematic review by McCauley and colleagues “does not explicitly exclude speech behaviors of any kind” (Kent, 2015, p. 766). And if the non-speech tasks refer to those that do not involve the production of speech sounds (e.g. the definition used in Lof, 2008), then “a host of research and clinical procedures such as imagined, covert, or mouthed speech” would be considered as non-speech oral motor tasks (Kent, 2015, p. 766). Hence, he offered definitions and taxonomies for speech and non-speech movements and discussed the distinctions between non-speech oral motor movements, speechlike, quasispeech or paraspeech, nonword repetition, speech. These are important when evaluating the application of NSOMs in assessment and intervention (Kent, 2015).
5. So far, I heard you mentioned a few variations of the name of this treatment approach. So, what kind of terms have been used in the literature?
The key constituent is “oral motor”, so previously it has been known as “oral motor exercises”, “oral motor therapy”, or “oral motor intervention”. The terms, “myofunctional therapy” or “orofacial myofunctional therapy”, have been used as well. The term with “non-speech” (or “nonspeech”) added to it has been used in the past couple of decades or so; perhaps, to differentiate this approach from the others that employ speech production tasks in speech intervention. Kent (2015) used the term, “nonspeech oral movements”, and this term does not limit to those that are used in intervention.
6. Which clinical areas have NSOMTs been applied to?
As reviewed by Kent (2015), it has been applied to “developmental speech and language disorders, motor speech disorders, drooling, feeding and swallowing difficulties, orofacial myofunctional disorders, obstructive sleep apnea, trismus, and tardive stereotypies” (p. 763). Lass and Pannbacker (2008) also mentioned “cleft palate, … autism, voice disorders, … and hearing loss” (p. 412). Similar information was reported in other papers as well.
7. What are the arguments for using NSOMTs in general?
There are a few assumptions for NSOMTs (see Bunton, 2008; Clark, 2010; Lee & Gibbon, 2015; Ruscello, 2008). The first main assumption is that there is a common set of motor control principles and neural anatomical representation in the human nervous system for speech and non-speech activities that involve the same structures. Hence, for example, movement characteristics and task demands for the production of bilabial speech sounds and those for blowing bubbles or horns are presumably similar, and the training effect caused by practicing blowing bubbles or horns could be transferred to the production of bilabial sounds. Another assumption is based that learning could be facilitated by breaking down complex movements into subcomponents because this allows “the motor system to plan simpler movement patterns and gradually develop skilled control of more complex movement patterns” (Clark, 2010, p. 586). Hence, for example, to treat a child with a speech error for the sound /s/, exercises for establishing jaw stability, tongue stability, elevation of the lateral sides of the tongue, elevation of the tip of the tongue and so on are used (Marshalla, 2000).
8. And what are the arguments against using NSOMTs?
Lof and Watson (2010) summarized the arguments about why NSOMTs do not work. First, isolated training of individual speech movements will not generalise to the whole articulatory gesture. Second, NSOMTs are not useful for improving muscle strength because it has been shown that high muscular strength is not required for producing speech. Moreover, reduced speech intelligibility and speech sound errors are not caused by reduced muscular strength of the articulators. Third, previous studies have demonstrated that neural organization for speech and non-speech tasks can be different, even though the same oral structures are involved in those speech and nonspeech tasks. Fourth, NSOMTs for the purpose of warming up muscles or increasing children’s awareness of their articulators are not useful or necessary because speaking does not tax the muscular system.
9. Do we have any statistics about the usage of NSOMTs by speech-language pathologists (SLPs) or speech and language therapists (SLTs)?
There are a number of published studies that reported the information and it is summarised very generally in the table below. As shown by the results of these surveys, the percentage of SLPs or SLTs who reported having used NSOMTs, whether it is frequently or infrequently, seems to vary between countries and depending on the client group or the type of speech difficulties of the clients. For example, it seems that adults with acquired dysarthrias is the group with which more clinicians have used NSOMTs. A very recent study that used focus group discussion with 62 SLT professionals in the UK also reported the use of NSOMTs as one of the intervention approaches with preschool children with repaired cleft palate (Williams, Harding, & Wren, 2020); however, the information on how many of those SLT professionals have used this intervention approach was not available. For the two surveys carried out in the US, there seems to be a trend of decreased percentage of clinicians who reported having used NSOMTs; however, further investigation is needed in order to make a more definite conclusion.
Percentage of respondents
McLeod & Baker (2014)
Children with speech sound disorders
37.6% of 186 respondents
Rumbach, Rose, & Cheah (2019)
Children with speech sound difficulties
11.3-37.7% of 53 respondents
Adults with speech sound difficulties
5.6-68.5% of 89 respondents
Gracia, Rumbach, & Finch (2020)
Clients with non-progressive dysarthria
60.61% of 80 respondents
Hodge, Salonka, & Kollias (2005)
Children with speech disorders
85% of 149 respondents
Thomas & Kaipa (2015)
Did not specify
91% of 127 respondents
Lee & Moore (2014)
Children with speech sound disorders
56% of 39 respondents
Conway & Walshe (2015)
Adults with non-progressive dysarthria
88.8% of 45 respondents
Joffe & Pring (2008)
Children with phonological problems
71.5% of 98 respondents
Mackenzie, Muir, & Allen (2010)
Adults with acquired dysarthria
81% of 191 respondents
Lof & Watson (2008)
Children with speech sound problems
85% of 537 respondents
Brumbaugh & Smit (2013)
Pre-school children with speech sound disorders
67% of 366 respondents
10. For those who have used NSOMTs, what kind of tasks have been used?
Four of the surveys stated above reported that information and in general the findings are quite similar, with tasks that involve the lips, such as “lip rounding”, “pucker-smile alternations”, and “blowing”, being used by the majority of clinicians, following by tasks that involve the tongue, such as “tongue lateralization” and “tongue push-ups” (Lee & Moore, 2014; Lof & Watson, 2008; Rumbach et al., 2019; Thomas & Kaipa, 2015).
11. Why did they use NSOMTs?
For most of the respondents, they used NSOMTs (1) for improving the clients’ awareness of articulators and/or the strength and range or movement of the articulators (Rumbach et al., 2019; Thomas & Kaipa, 2015); (2) as “warm-up” (Lee & Moore, 2014; Lof & Watson, 2008); or (3) because of the positive results from the clinical experience of their own or their colleagues, and high level of exposure to related products (Hodge et al., 2005; Mackenzie et al., 2010).
12. How did they use NSOMTs – did they use it as the only intervention approach, or as an adjunctive treatment?
NSOMTs were usually used in combination with other speech intervention approaches or used as home practice or optional therapies (Joffe & Pring, 2008; Lee & Moore, 2014; Lof & Watson, 2008; Rumbach et al., 2019).
13. What is the evidence of NSOMTs for treating feeding and swallowing?
There is a systematic review on this topic carried out by Arvedson and colleagues (2010), which was also supported by the N-CEP of ASHA, for preterm infants. This review included 12 treatment studies of different research designs, published in English in peer-reviewed journals between 1960 and 2007. The review authors concluded that, although some of the oral motor interventions showed positive results in improving some of the feeding and swallowing variables, a clear conclusion on the efficacy of the intervention approach could not be made due to the methodological limitations in the included studies. There is no systematic review for children of other age groups and adults, but Kent (2015) gave a literature review. Similarly, there is limited evidence that shows the efficacy of NSOMTs for improving swallowing function for adults (Kent, 2015).
14. What about the evidence of NSOMTs for treating dysarthrias?
A review of the relevant literature is available in the papers by Hodge (2002) and Kent (2015). Hodge (2002) identified one case study, 12 studies of cases reviewed in a book and a book chapter, one case reported in an anecdotal report and two in a newsletter – all published between 1960 and 2002. These cases were adults with acquired dysarthrias. Kent (2015) reviewed the inclusion of NSOMEs as a component in intervention approaches that target respiratory/phonatory function, and orofacial muscles. Altogether, although positive effects on speech were reported in some of these studies, the current evidence is insufficient to support the efficacy of NSOMTs for treating dysarthrias.
15. How about NSOMTs for treating children with a history of cleft palate?
For this group of clients, there is a very recent review of literature carried out by Ruscello and Vallino (2020). They reviewed the literature on the neurophysiological relationship between speech and nonspeech tasks, treatment studies that used NSOMTs, and relevant systematic reviews. The authors concluded that “there is no empirical support for the use of NSOME as a direct or adjunct treatment for velopharyngeal dysfunction or compensatory speech errors” (p. 1811).
16. How about NSOMTs for treating speech sound disorders in children?
There are four systematic reviews that addressed this topic (Lass & Pannbacker, 2008; Lee & Gibbon, 2015; McCauley et al., 2008; Ruscello, 2010). Although there were some differences in the search strategies between these systematic reviews, the findings were consistent in that there is no sufficient evidence to support the efficacy of NSOMTs for treating children with speech sound disorders due to the methodological limitations (e.g. small sample size, insufficient description of protocols) evident in the included studies.
17. In terms of speech evaluation, many non-speech oral motor tasks are used as part of an assessment protocol, such as those used in an oral peripheral exam. So, what is the latest view regarding the value of these tasks in speech assessment?
It is true that there is quite a long history of including non-speech tasks as part of an assessment protocol, especially in those for motor speech disorders. The latest view is that, when used with assessment tasks that evaluate speech production, these tasks of NSOMs are useful for investigating the nature and the severity level of neurological abnormalities of the clients (Kent, 2015).
18. There is an increasing application of motor learning theory in motor-based articulation therapy. How does that link to the topic that we are discussing here?
The rationale of applying motor learning theory in speech intervention is that speech production is a motor skill, so perhaps some of the principles that enhance the learning of motor skills in other domains, such as non-speech motor skills, can provide insights to the learning of speech motor skills (Maas et al., 2008). This is different from using a non-speech task for treating the production of a certain speech sound. What it means is, for example, if a large number of practice trials is useful for learning a non-speech motor skill, similar principle might work for learning a speech motor skill. In the paper by Maas and colleagues, they reviewed the variables related to the structure of practice and augmented feedback that can enhance the learning of non-speech and speech motor skills. For the structure of practice, they include the amount, distribution, variability, and schedule of practice, attentional focus, and movement complexity. For the structure of feedback, they include the type, frequency, and timing of feedback (Maas et al., 2008).
19. If we would like to do some further readings on this topic, are there any references that you could recommend?
Yes, I would suggest starting with the series of papers published as a clinical forum on NSOMTs in the journal, Language, Speech, and Hearing Services in Schools in 2008 (volume 39, issue 3) and the special issue, “Controversies surrounding nonspeech oral motor exercises for childhood speech disorders”, published in the same year in the journal, Seminars in Speech and Language (volume 29, issue 4). I would also suggest reading the systematic reviews mentioned above (Arvedson et al., 2010; Lee & Gibbon, 2015; McCauley et al., 2009) and the recent narrative review by Kent (2015); as well as other articles or book chapters (e.g. Bowen, 2005; Clark, 2010; Lof, 2009; Lof & Watson, 2010).
20. What is the final message for our audience regarding the current topic?
As discussed, there is still insufficient evidence that supports the efficacy of NSOMTs for treating speech and swallowing function. So, the use of this treatment approach should be avoided until concrete evidence is available. As pointed out by Ruscello and Vallino (2020), using treatment for which the efficacy is unclear can be costly to both patients and clinicians in terms of money, time and resources. Finally, as discussed by Kent in his paper (2015), a variety of tasks that involve speech production, speech-like activities, and non-speech movements have been used in research and treatment; and the similarities (or differences) between them in terms of neural control and muscles deployed varies to different extent. Future research that investigates the efficacy of NSOMTs, or the link between speech and non-speech movements should go beyond 'description of oral structures and movements involved only’. Further account of those tasks by applying, for example, the definitions and taxonomies detailed in Kent (2015) would us better in evaluating the value of these tasks in speech assessment and intervention.
Arvedson, J., Clark, H., Lazarus, C., Schooling, T., & Frymark, T. (2010). Evidence-based systematic review: Effects of oral motor interventions on feeding and swallowing in preterm infants. American Journal of Speech-Language Pathology, 19(4), 321-340. doi:10.1044/1058-0360(2010/09-0067)
Bowen, C. (2005). What is the evidence for oral motor therapy? Acquiring Knowledge in Speech, Language and Hearing, 7(3), 144–147.
Bunton, K. (2008). Speech versus nonspeech: Different tasks, different neural organization. Seminars in Speech & Language, 29(4), 267-275. doi:10.1055/s-0028-1103390
Brumbaugh, K. M., & Smit, A. B. (2013). Treating children ages 3-6 who have speech sound disorder: A survey. Language, Speech, and Hearing Services in Schools, 44(3), 306-319. doi:10.1044/0161-1461(2013/12-0029)
Clark, H. M. (2010). Nonspeech oral motor intervention. In A. L. Williams, S. McLeod, & R. J. McCauley (Eds.), Interventions for speech sound disorders in children (pp. 579-599). Baltimore, MD: Paul H. Brookes Publishing.
Conway, A., & Walshe, M. (2015). Management of non-progressive dysarthria: Practice patterns of speech and language therapists in the Republic of Ireland. International Journal of Language & Communication Disorders, 50(3), 374-388. doi:10.1111/1460-6984.12143
Gracia, N., Rumbach, A. F., & Finch, E. (2020). A survey of speech-language pathology treatment for non-progressive dysarthria in Australia. Brain Impairment, 21(2), 173-190. doi:10.1017/BrImp.2020.3
Hodge, M. M. (2002). Nonspeech oral motor treatment approaches for dysarthria: Perspectives on a controversial clinical practice. Perspectives on Neurophysiology and Neurogenic Speech and Language Disorders, 12(4), 22-28. doi:10.1044/nnsld12.4.22
Hodge, M. M., Salonka, R., & Kollias, S. (2005, November). Use of nonspeech oral-motor exercises in children’s speech therapy. Paper presented at the Annual meeting of the American Speech-Language-Hearing Association, San Diego, CA.
Joffe, V., & Pring, T. (2008). Children with phonological problems: A survey of clinical practice. International Journal of Language & Communication Disorders, 43, 154-164. doi: 10.1080/13682820701660259
Kent, R. D. (2015). Nonspeech oral movements and oral motor disorders: A narrative review. American Journal of Speech-Language Pathology, 24(4), 763-789. doi:10.1044/2015_AJSLP-14-0179
Lass, N. J., & Pannbacker, M. (2008). The application of evidence-based practice to nonspeech oral motor treatments. Language, Speech, and Hearing Services in Schools, 39(3), 408-421. doi:10.1044/0161-1461(2008/038)
Lee, A., & Gibbon, F. E. (2015). Non-speech oral motor treatment for developmental speech sound disorders in children. Cochrane Database of Systematic Reviews 2015(Issue 3), Art. No.: CD009383. doi:10.1002/14651858.CD009383.pub2
Lee, A., & Moore, N. (2014). A survey of the usage of nonspeech oral motor exercises by speech and language therapists in the Republic of Ireland. Journal of Clinical Speech and Language Studies, 21, 1-40.
Lof, G. L. (2008). Controversies surrounding nonspeech oral motor exercises for childhood speech disorders. Seminars in Speech and Language, 29(4), 253-256. doi:10.1055/s-0028-1103388
Lof, G. L. (2009). The nonspeech-oral motor exercise phenomenon in speech pathology practice. In C. Bowen (Ed.). Children’s speech sound disorders (pp. 180-184). West Sussex: Wiley-Blackwell.
Lof, G. L., & Watson, M. M. (2008). A nationwide survey of nonspeech oral motor exercise use: Implications for evidence-based practice. Language, Speech, and Hearing Services in Schools, 39(3), 392-407. doi:10.1044/0161-1461(2008/037)
Lof, G. L., & Watson, M. M. (2010). Five reasons why Nonspeech Oral Motor Exercises (NSOME) do not work. Perspectives on School-Based Issues, 11, 109-117. doi: 10.1044/sbi11.4.109
Mackenzie, C., Muir, M., & Allen, C. (2010). Non-speech oro-motor exercise use in acquired dysarthria management: Regimes and rationales. International Journal of Language & Communication Disorders, 45(6), 617-629. doi:10.3109/13682820903470577
Marshalla, P. (2000). Oral-motor techniques in articulation and phonological therapy. Kirkland, WA: Marshall Speech and Language.
Maas, E., Robin, D. A., Austermann Hula, S. N., Freedman, S. E., Wulf, G., Ballard, K. J., & Schmidt, R. A. (2008). Principles of motor learning in treatment of motor speech disorders. American Journal of Speech-Language Pathology, 17, 277-298. doi:10.1044/1058-0360(2008/025)
McCauley, R. J., Strand, E., Lof, G. L., Schooling, T., & Frymark, T. (2009). Evidence-based systematic review: Effects of nonspeech oral motor exercises on speech. American Journal of Speech-Language Pathology, 18(4), 343-360. doi:10.1044/1058-0360(2009/09-0006)
McLeod, S., & Baker, E. (2014). Speech-language pathologists’ practices regarding assessment, analysis, target selection, intervention, and service delivery for children with speech sound disorders. Clinical Linguistics & Phonetics, 28(7-8), 508-531. doi:10.3109/02699206.2014.926994
Rumbach, A. F., Rose, T. A., & Cheah, M. (2019). Exploring Australian speech-language pathologists’ use and perceptions of non-speech oral motor exercises. Disability & Rehabilitation, 41(12), 1463-1474. doi:10.1080/09638288.2018.1431694
Ruscello, D. M. (2008). Nonspeech oral motor treatment issues related to children with developmental speech sound disorders. Language, Speech, and Hearing Services in Schools, 39(3), 380-391. doi:10.1044/0161-1461(2008/036)
Ruscello, D. M. (2010). Collective findings neither support nor refute the use of oral motor exercises as a treatment for speech sound disorders. Evidence-Based Communication Assessment and Intervention, 4(2), 65-72. doi:doi.org/10.1080/17489539.2010.501168
Ruscello, D. M., & Vallino, L. D. (2020). The use of nonspeech oral motor exercises in the treatment of children with cleft palate: A re-examination of available evidence. American Journal of Speech-Language Pathology, 29(4), 1811–1820. doi:10.1044/2020_AJSLP-20-00087
Thomas, R. M., & Kaipa, R. (2015). The use of non-speech oral-motor exercises among Indian speech-language pathologists to treat speech disorders: An online survey. South African Journal of Communication Disorders, 62(1), 82. doi:10.4102/sajcd.v62i1.82
Williams, C., Harding, S., & Wren, Y. (2020). An exploratory study of speech and language therapy intervention for children born with cleft palate ± lip. Cleft Palate-Craniofacial Journal. Advance online publication.
Lee, A. (2021). 20Q: Non-Speech Oral Motor Treatments: Any evidence? SpeechPathology.com, Article 20430. Available from www.speechpathology.com | <urn:uuid:d376c5fc-5d2a-48a8-a6ef-f560be9ef9c6> | CC-MAIN-2022-33 | https://www.speechpathology.com/articles/20q-non-speech-oral-motor-20430 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.897456 | 6,418 | 2.390625 | 2 |
At the Table with Nina Simonds
Nina explains that everyone took food from the communal bowls and ate it with the rice. When your rice bowl was empty, she says, you filled it with what was left of the soup to drink as an aid to digestion. The author of 10 books on Chinese cuisine and culture, including the best-selling Asian Noodles and A Spoonful of Ginger, Nina still travels to Asia at least once a year and dreams of spending a year or two living in Shanghai.
Today, she wanders far from the cultural and urban centers in search of authentic food and customs that have not been influenced by the West. "It's sad to see how Asians have adopted some of our Western customs," she says. "On the other hand, I also see them coming full circle and readopting their own traditions for a more healthful life—things like less meat and more grains and vegetables at a meal."
But regardless of what she finds in Asian cities or small hamlets, she is always drawn to the value of the family she finds everywhere. "The richness of sharing these customs is what it's all about," she concludes.
Nina Simond's Recipes
- Warm Roasted Vegetable Salad
- Sautéed Chicken with Cherry Tomatoes
- Grilled Shrimp with Mango Salsa
- Spicy Shrimp with Basil
- Roasted Beets with Ginger
- Pumpkin Applesauce Muffins | <urn:uuid:6a7cc2fc-60e7-4da2-aebc-78e2d05203ba> | CC-MAIN-2022-33 | https://www.oprah.com/food/at-the-table-with-nina-simonds/2 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.971118 | 300 | 1.726563 | 2 |
You’ve probably heard about the stock market (the big guys also known as stock exchanges). There are lots around the world. In the U.S., amongst the biggest and most well known are the New York Stock Exchange (NYSE) and the NASDAQ.
These stock markets have minimum requirements to allow companies to have their stock traded there. When a stock can be traded on one of these exchanges, it’s called “listed” on that exchange. For instance, Ford Motor Company is listed on the NYSE.
Most companies that take advantage of Reg. A / Title IV / Tier 2 will not initially meet the large exchanges’ minimum requirements. They will trade over the counter (OTC).
There are advantages to companies and investors to trading stocks listed on the NYSE and NASDAQ, but it is very expensive.
iConsumer stock is quoted on the OTCQB (their mid level market) under the ticker symbol RWRDP. Active quotation is expected to begin in February, 2018. | <urn:uuid:95b09ba5-6797-41ec-af67-df25e342e10e> | CC-MAIN-2022-33 | https://shareholderacademy.iconsumer.com/blog/learning_center/stock-markets-trading-startup-stock | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.972088 | 211 | 1.648438 | 2 |
One of the grandest of the “old world charm” is the splendid Victorian styled red brick building of the Cargill’s Department store building which has not changed too much from the days the British ruled and when the hill country tea plantation superintendents and colonial administrators would travel by foot or carriage into the capital city of Colombo every six months or so to collect their supplies and luxuries. One of the best photos within the Fort that you could take is capturing the Cargills department store with the twin towers of the Sri Lankan World Trade Centre in the background. It portrays a mixture of the old world charm against the backdrop of the rising modern skyscrapers.
The hype of the once busy department store has diminished and it is now more of a shell, which is a shame. There is a small shopping museum. You will find it on the corner of York Street. In its heyday it was on par with London’s grand Fortnum and Mason department store, out fitters of the Empire. Sadly commerce has moved on. Cargill’s is now a modern supermarket company with stores all over Sri Lanka trading under the name of Food City.
Notice how the original Cargill’s building has archways over the pavement. They serve two purposes. They kept their customers dry in the monsoon and out of the glare of the hot sun by offering shade when needed. | <urn:uuid:8d248c84-f460-4bc9-b4bf-e3f812d88253> | CC-MAIN-2022-33 | https://touringsrilanka.com/st_activity/cargills-department-store/?currency=USD | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.950092 | 301 | 2.125 | 2 |
Nature provides an endless variety of appealing subjects to inspire the artist. And with the versatile mediums of oil and acrylic, you can both layer transparent glazes and apply thick, luscious strokes of color for a wide range of interesting effects. In Painting: Land & Sea, artist Vernon Kerr shows you his step-by-step process for painting seascapes and landscapes in oil and acrylic, from simple sketches to the most elaborate renderings. In addition, he demonstrates how to capture the beauty of nature in all its seasons and at different times of the day, as well as the importance of making small color studies and learning the various cloud formations. You’ll also discover tips for using color effectively, with additional helpful information on composition, perspective, texture, and contrast. And along the way, you’ll learn special techniques for creating dramatic skies, luminous waves, and lush landscapes.
From rendering light and shadow to creating realism through depth and texture, aspiring artists will discover the basics of oil and acrylic painting through engaging, inspirational lessons and useful artist tips. Artists will find helpful information about selecting the right paintbrushes, supports, and paints to get started in acrylic painting. Additionally, artists will discover useful tips for using basic and special acrylic painting techniques to render textures, suggest dimension, and create effects.
The How to Draw & Paint series offers an easy-to-follow guide that introduces artists to basic tools and materials and includes simple step-by-step lessons for a variety of projects suitable for the aspiring artist. With comprehensive instruction, plenty of artist tips and tricks, and beautiful artwork to inspire, Painting: Land & Sea is the perfect resource for any aspiring acrylic painter.
Vernon Kerr was born in Bellevue, Pennsylvania, in 1938. Recognizing his young son's talent, his father secured an apprenticeship for him with Leon Franks. Vernon studied with Franks for four years and was an accomplished artist by age 23. His first taste of fame occurred when he was the youngest artist to be published by the International Art Publishing Company. He worked as a naval illustrator while stationed in Japan during his time in the U.S. Navy and had also won numerous awards for his portraits, marines, and still lifes before his move to Laguna Beach, California, in 1959. Vernon was a professional artist for 26 years and was internationally known for his seascapes and landscapes. He taught at his own school in Laguna Beach and Coeur d'Alene, Idaho, for 15 years. He once said, "Painting is not fun unless I am learning something new, and nature is my greatest teacher." Vernon passed away in 1982 at the age of 44. | <urn:uuid:ee6d5a4d-416e-421a-a101-5513d1b209dd> | CC-MAIN-2022-33 | https://walterfoster.com/walter-foster-book/painting-land-sea/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.966625 | 550 | 2.25 | 2 |
The General Court of the European Union, the bloc's second highest tribunal, said the European Commission had “erred in its assessment of the facts” when it ruled that the tax arrangements amounted to illegal state aid to the clubs.
Tuesday's ruling means the clubs do not have to repay millions of euros to the Spanish authorities, as they had been ordered to do in the 2016 decision.
After a two-and-a-half year probe, the commission, which acts as the EU's anti-trust enforcer, ruled that tax arrangements Spain gave four clubs — Real, Barca, Athletic Bilbao and Osasuna — breached the bloc's rules on state aid.
But after a challenge by Barcelona, the Luxembourg-based General Court said that the commission had “not shown to the requisite legal standard that the measure at issue conferred an advantage on its beneficiaries” and threw out the 2016 decision.
Under European Union anti-trust rules, governments are not allowed to provide state aid to commercial enterprises if it distorts market competition.
The commission ruling said the four clubs were treated as non-profit organisations, which pay a lower tax rate than other professional clubs registered as limited liability companies. | <urn:uuid:3dfd8a93-2cd9-4801-8688-4d14f01ce31f> | CC-MAIN-2022-33 | https://www.thelocal.es/20190226/eu-court-cancels-state-aid-ruling-against-four-spanish-football-clubs/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.9745 | 246 | 1.640625 | 2 |
Lunotriquetral joint instability is often misdiagnosed and if left untreated can result in lunotriquetral dissociation. Although patients may lack symptoms in low grade lunotriquetral injury, when symptomatic there is a typical pattern of pain and simple tests can be performed and obtained to more specifically identify injury. This activity outlines the identification and management of lunotriquetral joint instability for the clinician as well as the interprofessional team dealing with this pathology.
Identify the classical presentation of lunotriquetral joint instability.
Review the imaging modalities and imaging findings of lunotriquetral joint instability.
Outline the treatment and management options for lunotriquetral joint instability.
Explain the importance of improving care coordination amongst the interprofessional team to improve outcomes for patients with lunotriquetral joint instability type injuries.
Lunotriquetral (LT) joint instability is an often missed diagnosis and can result in LT dissociation. The reasons for undiagnosed LT joint instability are in part due to multiple confounding injuries (usually associated with high energy/impact sports) and isolated injury to the LT ligament results in relatively normal-appearing radiographs. LT ligamentous injury is less common than other proximal, carpal row, ligamentous injury and thus, more poorly understood and diagnosed.
The earliest reported LT injury was in 1903, which was then followed by a description of carpal dissociation of the lunate and triquetrum without significant change in position in 1913. Later in the 1900s, volar intercalated segmental instability (VISI) began to be defined. In the mid to late 1900s, it was found that a cause of VISI was LT ligament dissociation.
The wrist is comprised of numerous extrinsic and intrinsic ligaments that work together to provide stability. The complex, harmonious relationship between these ligaments indicates that compromise in the integrity of one of these parts will affect the overall position and strength of the wrist. The extrinsic ligaments that are most often involved in LT instability include the dorsal radiocarpal (providing dorsal support) and the radiolunate ligament (providing volar support). The interosseous LT ligament is the main intrinsic ligamentous supporter of the LT joint. It is described as “C” shaped and is divided into 3 parts. The volar portion is the strongest and thickest portion and provides the most stability and mainly prevents volar translation. The dorsal portion limits rotational movement, and the combination of all parts of the LT intrinsic ligament prevent dorsal translation. Both of these attach to bone, while the third, weaker portion, or membranous portion, connects to the articular cartilage. The dorsal radiocarpal ligament is an extrinsic ligament that when injured will cause further instability of the LT joint by allowing the lunate to flex more easily. The radiolunate ligament is extrinsic and can be involved in advanced cases of injury.
The lunate and triquetrum have been shown to have the same movements in flexion/extension motion as well as radial/ulnar deviation. This is likely why the lunotriquetral coalition is usually an asymptomatic variant.
LT joint instability is caused primarily by the disruption of the intrinsic LT ligament secondary to trauma to the wrist. Dorsal radiolunate and radiotriquetral ligament rupture are usually involved on presentation because isolated LT ligament injury seldom causes symptoms.
Young athletes who participate in high-energy sports are the group most commonly associated with LT instability. Injury to the ligaments that support the LT joint is the second most common cause of carpal instability which is reportedly one-sixth as common as scapholunate ligamentous injury.
The mechanism of action for LT joint injury occurs with hyperextension of the wrist which can be caused by falling on an outstretched hand or a combination of radial deviation and extension motion. Lifting heavy objects with forced pronation has also been described as a mechanism of injury. A blow to the dorsum of the hand can provide this level of hyperextension, which is typical with sports injuries. Ulnar positive variance has also been associated with LT instability.
Isolated injury to the intrinsic LT ligament is usually asymptomatic initially. The extensive network of extrinsic ligaments within the wrist mostly maintain the LT joint, and only micromotion instability will occur, over time causing arthritis or synovitis. If a larger injury to the wrist occurs, which involves more than just the intrinsic LT ligament, VISI can occur.
In rare cases, VISI can be non-pathological due to ligamentous laxity. VISI can be seen with LT joint instability because the lunate tends to flex when there is no support from the triquetrum. As mentioned earlier, isolated injury to the LT ligament is often associated with other ligamentous injuries including dorsal radiotriquetral and volar radiolunate ligaments and the combination of these will cause a VISI deformity. VISI diagnosis will be discussed in the imaging section.
History and Physical
LT joint injury can present asymptomatically or with gross deformity. An asymptomatic injury usually involves only an isolated assault to the LT ligament, which is often missed. The most common presentation is ulnar-sided pain in the proximal wrist with provocation during pronation and ulnar deviation. Patients may also present with decreased grip strength and a clicking noise with movement. A clue in history gathering can be participation in impact sports (football, hockey, rugby) or high energy injury. Often the history of the injury can occur more than a few weeks before presentation. The pain described is often constant with increased pain on provocation.
Upon examination, it is important to investigate the hand and forearm to identify other potential causes of the pain or co-injuries. In general, a physical exam that shows increased mobility of triquetrum in comparison to the lunate will likely be positive for LT joint instability. Almost always there will be point tenderness over the lunotriquetral joint. There are numerous described specific tests to evaluate this mobility more carefully. An important step in all of these tests is testing the contralateral wrist for comparison.
The LT shuck test or ballottement test is one of the most commonly used for diagnosis. It is performed by grasping the lunate and triquetrum between both thumbs and index fingers and applying alternating palmar and dorsal loads repeatedly. A positive exam will elicit pain, potentially a clicking noise, increased laxity, or crepitus.
Kleinman’s shear test is similar to the LT shuck test where the grasping locations are the same, but the test is performed by loading the triquetrum dorsally.
The LT compression test is performed by grasping the triquetrum and deviating it radially and ulnarly.
The click provocation test is performed by pronating the wrist after which ulnar deviation is added, and an axial compression load is applied.
The ulnar snuffbox test is a more specific localization method by palpation for tenderness which involves pressure between the extensor carpi ulnaris and flexor carpi ulnaris tendons.
Intra-articular steroid injection to the location has also been described as a test helpful for diagnosis if the injection relieved the pain patients are experiencing.
Once the clinician performs the physical exam and obtains a thorough history and highly suspects lunotriquetral instability, he or she should order appropriate imaging which is greatly beneficial.
Plain radiography can be helpful if abnormal, but LT injury cannot be excluded if it is normal. A lateral and AP wrist radiograph of the injured wrist is the initial imaging to be obtained. On the lateral radiograph, a volar tilt of the lunate can be seen which causes the scapholunate angle to be less than 30 degrees, where a normal angle would be approximately 47 degrees. A scapholunate angle less than 30 degrees is consistent with VISI deformity. A capitolunate angle can also be seen where a normal capitolunate interaction is co-linear. On the AP radiograph, one can see a break in the proximal carpal arc and overlap of the lunate and triquetrum with proximal translation.
Historically, arthrography was beneficial in diagnosis as it demonstrated contrast interdigitating the lunotriquetral ligament; however, this finding was not specific as micro membrane perforations from a degenerative disease could be another cause. Magnetic resonance arthrography has since replaced arthrography.
If an audible clicking sound is associated with the pain, video fluoroscopy can be beneficial in localizing the joint in question.
MR imaging could potentially be very useful and specific in the diagnosis of LT instability, particularly when combined with arthrography. With MR arthrography, spillage of contrast from the radiocarpal to the intercarpal joints through the lunotriquetral interspace indicates disruption or injury to these intrinsic carpal ligaments. Occasionally this can be positive with age-related degenerative changes, similar to regular arthrography.
The most agreed upon and definitive way to diagnose LT joint instability is through direct visualization with arthroscopy.
Treatment / Management
A nonoperative approach can initially be attempted with wrist immobilization and close observation. This allows for optimal healing and reduction of inflammation and will often be curative. If the pain is persistent, steroid injections can be considered. If these more conservative options for relatively stable LT injuries are unsuccessful, more aggressive surgical options are warranted if symptoms persist.
Surgeons may implement many operative paths, and each has slightly different indications. Arthroscopic intervention is considered the first line treatment, particularly in athletes with isolated LT ligament tears. The best view of the LT ligament in arthroscopy is the 4-5, 6R, and midcarpal portals. Closed reduction and percutaneous pinning with Kirschner wire fixation are indicated when there is acute instability. Direct, open primary repair of the LT ligament is indicated if there is gross instability of the ligament upon inspection during arthroscopy and occasionally capsulodesis can be considered. Another option is LT fusion which is indicated for chronic instability, but has fallen out of favor and nonunion is often a complication.
Post-operative management includes a short arm cast for up to 12 weeks with subsequent removal of K-wires when fully healed.
The differential diagnosis list is extensive, and each option has distinct presenting symptoms on physical exam or imaging. Some osseous-related pain that can mimic LT instability includes fractures of the ulnar styloid, pisiform or hamate. Injury to the triangular fibrocartilage complex, extensor carpi ulnaris, and flexor carpi ulnaris are soft tissue injuries that can also mimic LT instability. Some vascular diseases that can mimic LT instability include Kienbock syndrome or hypothenar hammer syndrome. Neurological diseases that should be considered include ulnar nerve entrapment and ulnar dorsal sensory branch neuritis.
A classification of LT ligament injury has been described by Viegas and colleagues which includes 3 levels of disease.
Grade 1 is a partial or incomplete tear of the LT ligament without VISI deformity.
Grade 2 is a complete tear of the LT ligament including a lesion within the palmar ligaments with a dynamic VISI deformity.
Grade 3 is a complete tear of the LT ligament including a lesion within both the palmar and dorsal ligament with a static VISI deformity.
The Mayfield classification is commonly used as a grading system for arthroscopic assessment of carpal ligaments. Severity is described using a grading system of I through IV with an increasing number indicating worse injury. Grade I is attenuation/hemorrhage of ligament without malalignment. Grade II is attenuation/hemorrhage of the ligament with a small step-off of the carpal bones. Grade III is a step-off of the carpal bones with the ability to pass a probe through the gap between carpal bones. Grade IV is a step-off of the carpal bones with the ability to pass a probe through the gap between carpal bones and gross instability.
Enhancing Healthcare Team Outcomes
Lunotriquetral instability frequently poses a diagnostic dilemma as many injuries could be a mimic of this pathology. Patients will present with general wrist pain to an urgent care facility or emergency department. There is usually no apparent deformity, and the pain is generalized over the ulnar region of the wrist. With non-specific signs such as these, an accurate and precise physical exam is vital in correctly identifying the abnormality. Often this will require a team of specialists which include an emergency physician, orthopedic surgeon, and radiologist for accurate diagnosis.
Imaging of the wrist will almost always be involved with generalized ulnar-sided wrist pain. A well-trained x-ray technician will aid by obtaining quality imaging for more accurate diagnoses by the radiologist. If no findings on the initial radiographs are present, MR imaging of the wrist can be obtained, and a well trained MRI technician is also utilized for a radiologist to make a diagnosis of LT ligamentous injury.
If intervention is indicated once the diagnosis of LT instability is made, an orthopedic surgeon and their staff including nurses, surgery technicians, and accompanying anesthesiologists will be involved for proper surgical fixation.
Almost always, even if surgery is not indicated, physical therapists will help with recovery of mobility, functioning and with pain relief. Physical therapists can also guide orthopedic surgeons in determining improvement or lack thereof for decisions on intervention with more invasive stabilization procedures.
(Click Image to Enlarge)
Volar Intercalated Segmental Instability; Lateral Wrist Radiograph
Contributed by Kevin Carter, DO
Ritt MJ,Linscheid RL,Cooney WP 3rd,Berger RA,An KN, The lunotriquetral joint: kinematic effects of sequential ligament sectioning, ligament repair, and arthrodesis. The Journal of hand surgery. 1998 May [PubMed PMID: 9620184]
Geissler WB,Freeland AE,Savoie FH,McIntyre LW,Whipple TL, Intracarpal soft-tissue lesions associated with an intra-articular fracture of the distal end of the radius. The Journal of bone and joint surgery. American volume. 1996 Mar [PubMed PMID: 8613442]
Use the mouse wheel to zoom in and out, click and drag to pan the image | <urn:uuid:6926a5d0-16d9-43f3-9835-4b769c6cc9d3> | CC-MAIN-2022-33 | https://www.statpearls.com/ArticleLibrary/viewarticle/24524 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.933163 | 3,148 | 2.921875 | 3 |
(RxWiki News) Athletes reach peak performance when hard training is combined with a balanced diet.
While the recommended diet for athletes does not differ much from that of a healthy person, the type of sport and amount of training determine how much an athlete should eat. Read on for more information.
Carbohydrates are mainly stored in the muscles and liver and provide energy during exercise. Carbohydrates can be complex or simple. Complex carbohydrates provide energy and other nutrients, such as minerals, vitamins and fiber. They are in found in low-fat foods like vegetables, beans, whole grains and potatoes. In comparison, simple carbohydrates, such as those found in candy and soft drinks, only provide energy through calories.
About half of your calories should come from carbohydrates. While exercising less than two hours usually does not require athletes to eat beforehand, events requiring heavy work for two hours or more may require you to fill your body's energy storage by eating a high-carbohydrate diet. This is especially true for endurance athletes, who should generally get 70 percent of their calories from carbohydrates.
In an endurance sport event lasting more than six hours, fat becomes the main source of energy. Generally, fat is used more as the duration increases and intensity decreases. It's the opposite for carbohydrates. As a general rule, fat should be at least 20 percent of caloric intake. Remember that dietary fat is necessary to absorb fat-soluble vitamins like A, D, E and K.
Proteins are essential building blocks for the muscles. While lots of athletes fixate on protein intake for muscle buildup and repair, the American diet is usually more than enough to provide the recommended protein intake for most athletes. The recommended protein intake is 0.8 grams per kilogram for adults, 1.2 to 1.4 grams per kilogram for endurance athletes and 1.2 to 1.7 grams per kilogram for strength-training athletes. Instead of protein supplements, whole foods are recommended to meet the needs of the body.
Water, Vitamins and Minerals
Water loss can be easily tracked by measuring weight changes before and after a workout. It is important to know how much water you lose so you can replace it. Most athletes should drink 5 to 7 milliliters per kilogram of body weight about four hours before an event.
Vitamins play an important role in producing energy from food, protecting the body and improving athletic performance. Minerals are necessary for bone health, muscle function and overall body function. While vitamins obtained through food are usually enough, minerals like sodium and potassium may have to be replenished during exercise.
Three to four hours before a sports event, health experts recommend a small meal of 500 to 1,000 calories that is high in complex carbohydrates and low in fat. After the event, a small, balanced meal should be eaten within 30 minutes to maximize muscle repair and energy replenishment.
What type of athlete are you? If you need professional advice, talk to a dietitian. And always speak with your doctor before starting any new exercise program or diet. | <urn:uuid:f8a7c8a0-d85b-4edd-8a17-a16de5d60656> | CC-MAIN-2022-33 | https://rxwiki.com/news-article/what-athletes-can-eat-peak-performance | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00065.warc.gz | en | 0.940497 | 636 | 3.828125 | 4 |
Personally, I am not a fan of the gimmicky sounds that have accompanied Windows throughout the years. Admittedly, they don’t sound like you made them on a Gameboy anymore; however, the last thing I want is for the sound to play if I turn on my laptop during class etc. In this guide, you’ll learn how to disable the Windows startup sound in Vista.
Disable the Startup Sound
1. Click on the Start button and type Sound. Select Sound and hit Enter.
2. Click on the Sounds tab and remove the check from Play Windows Startup sound
3. Press OK
Now you wont have to worry about class members turning around when you turn your laptop on during the lecture. | <urn:uuid:896f387f-1cd4-41c1-b7c2-8dd9dbace810> | CC-MAIN-2022-33 | https://www.mintywhite.com/vista/vcustomization/disable-the-startup-sound-in-windows-vista-how-to/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.914184 | 148 | 1.632813 | 2 |
Darwinian Snails GIRP
This will be the first of two Group Independent Research Projects for the quarter.
Working groups of three or four, your challenge is to use the More Snails environment within Darwinian Snails to conduct a collaborative independent research project. Your group will: (i) ask a question that was not part of the formal Darwinian Snails tutorial , (ii) design and run an experiment to answer it, and (iii) produce a concise coauthored research report.
Please watch this 4-minute explainer video. It provides an example of the kind of project I have in mind. I made it for my students in another class a couple of years ago. They were using a somewhat different version of the Darwinian snails interface, but you should have no trouble figuring out how you would conduct the same experiment in the version of the lab you are using.
If your group can spot the flaw in the experiment I describe in his video and you can design a better experiment that overcomes this flaw, then you can, if you want to, address the question: Does the strength of selection influence the rate at which a population evolves?
Other questions your group can choose to address—see this PDF file for more details:
How heritable is shell thickness in Darwinian snails (that is, how much of the variation among individuals is due to difference in genes)?
Does the number of founders influence the diversity within a newly-established snail population?
Does migration among populations impede local adaptation?
How does the amount of genetic variation in a population influence the rate of evolution?
It will be helpful to consider ground rules for smoothly functioning groups. As soon as possible, please have a meeting of your group in which you: (1) Discuss your ground rules and upload a completed agreement to the Canvas assignment (only one per group is needed), and (2) Pick the question your group will address.
Replicating your experiments
Among the advantages of working with collaborators is that you can run the same experiment many times. That is, you can perform many replicates. Note that something different happens every time you run a SimUText simulation. That means that replicating your experiments is necessary to get a clear idea of whether your predictions are correct.
To present your data, you should devise graphs that aggregate the results of your replicates in a useful and informative way. There is an example in the explainer video linked above. I can help you and your collaborators think about ways to aggregate the results for your experiment.
Extracting Data from the Bar Graphs in More Snails
For many of your experimental designs, you will need to record summary data from the bar graphs in More Snails. Here’s how to do so:
If you use the pointer tool to click and hold on a bar, a label will appear showing you the height of that bar (proportion of snails in the population it represents):
Record this number for all seven bars on the graph (including the bars with heights of zero).
Assume all the snails represented by each bar have a shell thickness equal to the midpoint of the bar—that is, 1, 3, 5, 7, 9, 11, or 13.
Please read the following documents under the Info tab in the main menu:
Dr. Herron’s List of Common Prose Errors, Plus some Pet Peeves
Research Report Format
Your grade will be based on the clarity of your question, the acuity of your scientific reasoning, the design and conduct of your study, and the lucidity of your report. Your grade will not be be based on whether your hypothesis turned out to be right or wrong.
Before uploading your finished report, please be sure to check it against the rubric on the Canvas assignment page. | <urn:uuid:c911b8b9-c50f-4898-b4e7-582a9b3fee2b> | CC-MAIN-2022-33 | http://evound.com/posts/simbio-workshop/darwinian-snails-assign/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.930504 | 803 | 3.21875 | 3 |
ESCALON – To Understand, Predict and Diagnose Hepatobiliary Tumours
Earlier this year, it was announced that researchers from Manchester were part of ESCALON – a collaborative network between Europe and Latin America which aims to improve both the detection and treatment of hepatobiliary cancers. We interviewed Dr Angela Lamarca, a consultant in Medical Oncology at The Christie NHS Foundation Trust, to find out more about the network and her important role.
What is ESCALON?
ESCALON is a global network between Europe and Latin America aiming to learn more about biliary tract tumours in order to improve patient outcomes. The network arranges for hospitals around the world to contribute biomarkers from patients with hepatobiliary cancers to Latin America, with the hope that new biological discoveries can be made. The project involves multiple research centres from across the world, including centres in Spain, the Netherlands, Chile, Argentina, Ecuador, Canada, Germany, and of course, Manchester.
Why does ESCALON focus on hepatobiliary cancers in Latin America?
Hepatobiliary cancers are extremely difficult to detect and treat. This difficulty constitutes a major problem for many countries across the world, especially in Latin America, where the incidence is high. ESCALON is aiming to alleviate this through the identification of new blood markers that could be used for early detection of liver and biliary tract cancers. At the moment, screening strategies are only in place for a specific subtype of liver cancer (hepatocellular carcinoma), mainly because the population at risk of developing this cancer is easier to define. Screening consists of abdominal ultrasonography every six months to detect the cancer at an early stage. Many places across the world simply do not have the resources to do such screening, or if resources are in place, the distances may be too long for the patient to travel for these investigations. Unfortunately, no screening has shown benefit for biliary tract cancer, since patients at risk are difficult to define. As a result, hepatobiliary cancers are leading killers globally, including in the UK.
This problem is highly visible in Latin America because many people, particularly those in rural areas, do not have easy access to healthcare. By uniting leading cancer centres across the world, ESCALON is aiming to identify blood markers thereby creating a cheaper and more accessible way of detecting hepatobiliary cancers, accessible to all countries across the world and all patients, regardless of where they live.
How is Manchester contributing?
The University of Manchester is one of 9 institutions contributing to ESCALON. The University of Manchester and The Christie have been world-leading in the clinical management and clinical trials for patients diagnosed with cholangiocarcinoma and gallbladder cancer and our main aim is to provide clinical expertise to make sure that the data generated is also of use for our future patients. In addition, we are also contributing by providing access to some of the samples stored at the MCRC Biobank. Work on Manchester’s involvement in the project is led by Professor Juan Valle and I am the local sub-investigator.
However, Manchester’s involvement in ESCALON is multi-faceted and is not limited only to professional input. There is a wealth of ‘indirect’ involvement taking place every day at The Christie, from its patients giving medical samples to the clinicians taking them. Patients from The Christie can be proud in saying that they are part of a global network rallying to improve medical outcomes in countries with fewer resources. With Manchester being the only UK city involved in ESCALON, we can be proud of our part in such a worthwhile and ambitious project.
What progress has ESCALON made so far?
Our team and clinicians around the world have started gathering samples ready for identification in what is called the sample collection phase. This identification is taking place in Manchester, and also in Spain, Latin America and the Netherlands, where links between particular indicators and types of cancers are established. Once this identification process has taken place, its findings can be implemented into creating more efficient ways of detecting hepatobiliary cancers in Latin America and beyond.
How is ESCALON funded and what is the future for the project?
The consortium is funded by a Horizon 2020 Grant which is due to last 4 years, however we expect our collaborations and networks to continue into the future. Also involved is ENS-CCA, the European Network for the Study of Cholangiocarcinoma, the ‘umbrella’ which oversees ESCALON, ensuring that the project has suitable and resourceful supporters. ENS-CCA is supported by AMMF, the only UK-based cholangiocarcinoma charity, and CCF, the US-based Cholangiocarcinoma Foundation, whose support is then channelled to relevant projects by ENS-CCA. By mapping the consortium’s sponsors, we can distinguish the international nature of ESCALON and be proud that Manchester is involved in two continents coming together under one mutual aim; to improve hepatobiliary cancer survival rates.
You can learn more about ESCALON on its website here.
This study was supported by the European-Latin Amedican ESCALON consortium, funded by the EU Horizon2020 program, project number 825510 | <urn:uuid:dc14a096-c38a-46bf-a49f-e5190aa76c69> | CC-MAIN-2022-33 | https://www.mcrc.manchester.ac.uk/escalon-to-understand-predict-and-diagnose-hepatobiliary-tumours/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.939826 | 1,098 | 2.65625 | 3 |
Will international law and diplomacy limit cyberwar? Those who believe in international “norms” for cyberwar usually argue that cyberattacks on financial institutions are beyond the pale.
For example, Harold Koh has declared the State Department’s view that cyberwarriors “must distinguish military objectives … from civilian objects, which under international law are generally protected from attack.” And Richard Clarke, a former White House adviser, claimed in 2010 that “most countries would agree to sign a treaty not to attack each other’s international financial and banking system networks. They don’t want to cross that Rubicon, or the entire international banking system could go down.”
Have you noticed that, since these speeches were given, DDOS attacks on Western banks have been attributed to Iran and North Korea has been blamed for cyberattacks on banks in South Korea. If you’re looking for norms in actual conflicts, as opposed to speeches, cyberattacks on the financial sector are starting to look, well, normal. | <urn:uuid:85a45b95-2366-4d3e-b0ad-6dcc7a193b9a> | CC-MAIN-2022-33 | https://www.steptoecyberblog.com/2013/03/22/the-question-of-international-law-of-cyberwar/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.956261 | 214 | 2.046875 | 2 |
I recently needed to have a copy off bootgen I could build to run on my Zynq platform. I found an open-source version called zynq-mkbootgen here:
It needs two libraries: pcre and elf, which I found at:
I downloaded and unpacked the libraries onto my Linux box with the Petalinux 2016.2 tools installed. In each directory, I ran:
Be aware that the host parameter for your system will vary depending on which version of Petalinux you have installed. For example, an earlier version might have been arm-xilinx-linux-gnueabi.
For libelf, despite using the configure command, you will need to manually edit:
In each of these, change the CC = gcc to read CC = arm-xilinx-linux-gnueab-gcc. In addition, in lib/Makefile, change AR = ar to AR = arm-xilinx-linux-gnueabi-ar. Note the gcc and ar prefix should match the one used in your ./configure command. Do a make in each of the library directories.
Now unpack your mkbootimage tarball and edit the Makefile there. Again, change CC=gcc to read CC=arm-xilinx-linux-gnueab-gcc. In addition, append to the CFLAGS after the –std=c11 pointers to the include directories and library directories:
-I../libelf-0.3.13/lib -L../libelf-0.3.13/lib -L../pcre-8.41/.libs
Do a make. and you should now have a functioning mkbootimage executable you can put on your Zynq platform. You can then do a:
mkbootimage boot.bif BOOT.BIN
to generate an appropriate BOOT.BIN.
All the files needed to build mkbootimage may be found at https://www.dropbox.com/s/9r66x2f4b319leo/mkbootimage.tar.gz?dl=0 which includes a working executable for Petalinux 2016.2. | <urn:uuid:3c949709-5103-4a25-9cb5-3c940ea07fc9> | CC-MAIN-2022-33 | https://zynqing.wordpress.com/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.817592 | 494 | 1.617188 | 2 |
Will A Weighted Blanket Lesson Anxiety – Best Blanket For You?
Weighted coverings are fairly a huge investment, so lots of individuals wish to know, do heavy coverings truly work? Will A Weighted Blanket Lesson Anxiety
So, we thought we ‘d compose a post specifically regarding this, exactly how these coverings are intended to function, as well as why you ought to obtain one (possibly).
One point we ‘d like to state prior to we go any additional is the major difference between normal heavy blankets as well as cooling down weighted coverings.
A heavy air conditioning covering, such as the chiliBLANKET, is generally made of a lighter, much more breathable textile that does not absorb wetness and also make you hot or perspiring. We will certainly discover exactly how each of these coverings functions below.
Exactly how is a Weighted Blanket Intended to Work?
Generally, a weighted blanket is filled with material, most often glass or plastic pellets.
These pellets are typically hypo-allergenic as well as non-toxic and also are stitched right into the material of the covering itself, to preserve even distribution.
Various other types of weighted blankets can consist of numerous layers of textile or a water-powered heater.
The factor heavy coverings operate in controling your sleep (both in regards to temperature level and also stress and anxiety) is that the included stress of the weighted blanket is comforting to the body. This is referred to as deep stress treatment.
The weight of the covering is therapeutic since it makes us really feel safeguarded and promotes the body’s production of serotonin as well as endorphins, which in turn make us really feel a lot more kicked back and happy.
The pressure of the weighted blanket additionally forces your heart rate to slow down.
As we know, our hearts tend to defeat also quickly when we’re angry or worried. This brings about general anxiety and anxiety as well as can prevent us from getting the rest we need.
But by applying stress and essentially ‘holding us down’, a weighted blanket negates that and regulates our heart beat.
By using heavy fill, weighted blankets gain added heft that separates them from traditional alternatives. As a straight outcome of the additional weight, many weighted coverings are normally warmer as well as cozier. Nonetheless, some air conditioning versions are created for breathability, making them ideal for year-round usage.
The theory behind the included weight is that it helps to reduce anxiousness and encourage rest by promoting melatonin (a sleep hormone). Some specialists also claim that heavy coverings may stimulate other natural hormones, such as dopamine and also serotonin, which are directly connected to happiness. The decrease of cortisol, a natural steroid connected to tension, is an additional purported effect of heavy coverings.
While numerous customers speak highly of their heavy coverings, it ought to be kept in mind that their prospective wellness advantages have yet to be scientifically validated.
Whether you’re looking for extra warmth or other possible benefits, a weighted blanket’s efficiency counts greatly on the weight differential in between it and the individual. The basic standard is that a weighted blanket needs to be around 10% of the user’s weight. If a weighted blanket isn’t hefty enough, then it might really feel irrelevant to the sleeper. A covering that’s too heavy might restrict movement as well as really feel uneasy.
Some Bottom line are:
– It has less layers than a normal weighted blanket.
Certainly, even more layers suggest even more warm, so the fewer a blanket has, the a lot more chilled you’ll be
– Its’ external layer is made of an air conditioning material, such as cotton (known for its’ breathability) or bamboo
– It can use the cooling power of water to give your body with the warmth it needs during rest, without being excessively hot.
Generally, we would certainly advise getting a weighted air conditioning covering, rather than a regular weighted blanket. Even if you are not a warm sleeper or don’t generally deal with evening sweats, a cooling covering is just a lot more flexible. It can supply an exceptional cooling option in those cozy summer months.
What Should You Search for In A Weighted Blanket?
Not all weighted blankets are produced equal, and because of this, not all weighted coverings are necessarily advertised as ‘cooling down’.
Some could not have a specifically made modern technology to maintain you cool, but might supply that effect, anyway.
The reality is, how cooling a blanket is depends above all on manufacturing elements. As with a lot of items, a high quality covering will not be too suppressing, however to guarantee that, you have to try to find the complying with things:
Fabric is the most crucial facet, and also the one that will genuinely identify whether your weighted blanket feels as well warm or otherwise. Unfortunately, lots of producers opt for economical items to lessen their costs.
You’ll discover many blankets that are made of low-cost cotton and also polyester. These will certainly draw away the moisture from your body and create it to accumulate in the textile of the covering itself. This develops a clammy, perspiring sensation that stops you from getting proper rest.
What you should seek:.
Bamboo is absorbant, yet likewise renewing, which implies the dampness from your body does not build up on the covering and make it adhere to your skin. Bamboo is likewise excellent due to the fact that it’s a breathable material, and it does not make you feel stifled as you rest. Last but not least, bamboo is cozy as well as resistant, making it an excellent product for the exterior cover of a weighted blanket.
An additional preferred alternative, microfiber, is notoriously simple to wash and soft. So there’s no chance of not resting as a result of a ‘scratchy blanket’. Though relatively slim, microfiber likewise gives superb warmth as well as is hypo-allergenic. For these reasons, microfiber can be one more superb material for a cooling weighted blanket.
100% Pure Cotton.
Bear in mind, not inexpensive cotton, yet correct cotton, since that is widely known for its’ breathability and gentleness. It’s likewise trendy and also pleasurable against the skin, making it one more big fave for blanket material.
Stay away from synthetics, such as polyester, because that draws away all the wetness, without supplying any one of the benefits of microfiber. That will certainly make the covering feel as well hot as well as make you sweat.
Undoubtedly, the more insulation (wadding) a covering has, the hotter it will keep. And while some insulation is necessary for that weighted sensation, excessive can be detrimental because it will certainly stifle you.
A great deal of weighted blanket manufacturers utilize heavy insulation to make the blanket appear heavy.
This is a trick to make you seem like you’re obtaining your cash’s well worth (as a result of program, you ‘d desire a hefty covering, right?), but it will, actually, make your nights hot and also sticky.
To guarantee that weighted feeling, blankets typically have layers. Way too many layers, to be exact, and also this can make you too hot.
An excellent weighted blanket must contend the majority of 7 layers. Keep in mind, each layer catches warm and sweat, as well as considering a great deal of these blankets are comprised of 9 layers, no wonder the sleeper can get as well warm!
All heavy blankets ought to have an outside cover that is simple to separate and also machine-washable. This cover ought to be constructed from cotton, bamboo, or microfiber to make sure breathability.
Some heavy coverings come with different covers– one for the chillier months and also a lighter one for warmer months.
All these aspects are vital in developing that cooling result and also ensuring you don’t get also hot in the night.
Even if a covering promises a cooling innovation, such as a hydro-powered one, don’t be misleaded. Make sure you do the correct research study and that the blanket satisfies the above factors.
Exactly how Heavy Should My Weighted Blanket Be?
It’s suggested to get a weighted blanket that is 10 percent of your body weight or 10 percent of the individual’s weight who you are buying it for. This makes sure that the weighted blanket is the best weight for your body as well as will give you with the very best benefits.
Weighted coverings for grownups ought to be 10 percent of their body weight. Normally, the typical range of weight for grownups is 12 to 20 pounds. We’ve offered some examples listed below:.
– 130 pounds = 13lb blanket
– 150 extra pounds = 15lb blanket
– 170 extra pounds = 17lb covering
– 190 pounds = 19lb covering
You get the idea. If you drop in between two suggestions, round up by including one to two pounds or seek advice from the blanket manufacturer.
Weighted Blanket Weight for Couples
Selecting a weighted blanket weight for pairs is a little bit more difficult. Rather than 10 percent, seek a weighted blanket that is 7.5 percent of their mixed body weight. Below are some instances:.
– 120 – 150 pounds = 10lb covering
– 150 – 200 pounds = 15lb covering
– 200 – 250 extra pounds = 20lb blanket
If you remain in between dimensions, assemble or get in touch with the covering manufacturer. Will A Weighted Blanket Lesson Anxiety
Weighted Blanket Weight for Children
When buying a weighted blanket for a kid, the basic guideline is 10 percent of their body weight, plus one to 2 pounds. Below are a couple of instances:.
– 40 extra pounds = 5 – 6lb covering
– 60 pounds = 7 – 8lb covering
– 80 pounds = 9 – 10lb blanket
Usually, weighted coverings that are 12– 25 pounds are also heavy. Constantly talk to a pediatrician ahead of time if you are not sure. Will A Weighted Blanket Lesson Anxiety
What Dimension Weighted Blanket Should You Get?
Once you recognize the weight of the weighted blanket you’re looking for, it’s time to choose the right size. You desire the weighted blanket to cover the body completely, yet it should not be so huge that it drapes off the side of the bed..
Usually, you must choose a weighted blanket that resembles the dimension of the mattress you or the person you are buying it for to sleep on. For example, if you sleep on a double or complete size mattress, you need to acquire a weighted blanket that has comparable measurements. The same point goes with a full or queen cushion..
When it pertains to elevation, you should acquire a weighted blanket that coincides dimension or somewhat larger than the person you’re buying it for. Think about a weighted blanket as a throw covering — it should be big enough to cover you totally, yet not also huge that it hangs over the side of the bed.
Which Filling Should You Obtain?
The fillers inside of a weighted blanket are mainly what adds to its weight. The blankets are made with several various kinds of fillers. However, one of the most prominent options are plastic poly pellets, mini glass beads, and steel shot grains.
Plastic poly pellets:
This material is made from 100% polypropylene and is taken into consideration to be completely risk-free, non-toxic, and also safe to clean. Plastic poly pellets are thought about among the “more affordable” weighted blanket fillers.
Micro glass grains
Micro glass grains are an environmentally friendly choice to poly pellets. They are hypoallergenic and equipment washable. Will A Weighted Blanket Lesson Anxiety
Steel fired grains:
These grains are bigger and heavier than glass beads as well as they are incredibly sturdy. Due to their size, it takes fewer beads to accomplish the preferred weight – making them an affordable option.
Picking which loading you such as will certainly boil down to personal preference. The Luxome weighted blanket is filled with micro glass grains and polyester batting. We recommend seeking quality heavy coverings like the Luxome weighted blanket– that are made with quilted networks that keep the filling in position so weight is evenly dispersed.
So, Do Heavy Air Conditioning Blankets In Fact Work?
Yes, these coverings can offer you with the best equilibrium between cold and hot and regulate your body temperature level for ideal sleep. Yet you need to take the time to discover the right blanket.
We understand it’s a fair bit of study, however ultimately, an excellent cooling weighted blanket will be totally worth it!
Just how to Pick the very best Weighted Blanket for You
Heavy blankets are like being hugged all night long. They make a terrific present for any individual with sleep problems or stress and anxiety.
The most vital point to remember when buying a weighted blanket is weight. If you’re an adult, see to it you select a blanket that is 10 percent of your body weight. If you’re shopping for a kid, it’s advised to locate a weighted blanket that is 10 percent of their body weight, plus one to two pounds. Always contact your covering manufacturer or doctor if you are unclear if a weight blanket is right for you.
Once you have actually picked the correct weight as well as size, remember of any kind of added functions the blanket possesses.
The Luxome weighted blanket is made with quilted channels that equally disperse weight, breathable cotton that flows air, and also three various weight alternatives so you can locate the covering that is perfect for you. Will A Weighted Blanket Lesson Anxiety
Do weighted cooling blankets really work?
A weighted blanket made from breathable materials can help in temperature level policy and protect against overheating. Fabrics such as cotton and wool are recognized for their breathability. Open-knit patterns that allow even more room for airflow can additionally avoid warm from becoming entraped throughout the evening.
Do weighted blankets keep you warm or cool?
The short answer is yes, weighted blankets can certainly assist keep you warm in the winter season. Nonetheless, truth heat of your weighted blanket mostly boils down to three points: filler product, textile and also building and construction.
How can a weighted blanket be cooling?
Fabric: Search for a breathable textile such as cotton, bamboo, or linen, every one of which are naturally cooling down. Filling: If your weighted blanket is filled with beads, make certain they’re made from glass, which will not keep warm the means plastic ones will.
Are weighted blankets good for hot weather?
In other words, yes they are! Anyone can utilize a weighted blanket. The best type of weighted blanket for hot sleepers are those that are breathable and not constructed out of artificial products, as mentioned above. You could also wish to choose a covering that is a bit lighter for usage during the summer season.
What is the difference between a cooling weighted blanket and a weighted blanket?
The vital distinction between cooling and regular heavy coverings is that the air conditioning variations are created for breathability as well as for your body heat to move away from you. This prevents warmth from getting entraped between you as well as the blanket.
Do weighted blankets cause night sweats?
Evening sweats can be defined as sweating in excess of that required by the body to regulate body temperature. Night sweats can take place throughout rest and without physical exertion. They aren’t triggered by a hefty blanket or cozy bedroom.
Do you use a top sheet with a weighted blanket?
Photo result If you pick to make use of both, the weighted blanket can be put either ahead or below your bed linen. It’s everything about your preference!
Can you wash weighted blankets?
Most weighted blankets come with one of the following instructions: Machine Wash and Dry: When machine washing, choose a bleach-free, gentle detergent, and wash your blanket in cold or warm water on a gentle cycle. Avoid fabric softeners.
Do weighted blankets affect blood pressure?
Another study released in the journal Occupational Therapy in Mental Health revealed that individuals who utilized heavy coverings had reduced blood pressure, pulse prices and pulse oximetry– all indicators of reduced stress and anxiety degrees. Will A Weighted Blanket Lesson Anxiety
You can read more about Weighted Blankets Here | <urn:uuid:4482cad2-3d3d-4f63-bb95-28617103eef3> | CC-MAIN-2022-33 | https://www.swaddlingblankets.org/will-a-weighted-blanket-lesson-anxiety-which-weighted-blanket-2022/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.947137 | 3,476 | 1.664063 | 2 |
Stocking a Japanese Pantry
When making Japanese cuisine at home, simple doesn't always mean quick and easy. With all the washing, cleaning, chopping, cooking, arranging and garnishing, the preparation of many Japanese dishes can be very labor intensive. And the amount of work that goes into a traditional Japanese meal is the same, whether you make it with cheap, inferior ingredients or costly top-quality ones. Therefore, it is always important to buy the freshest and very best products you can afford to ensure that your labor of love doesn't end up a big disappointment because you tried to cut corners. So don't skimp. Buy the best!
Where to Look
If you live in a large metropolitan area, you should have no problem locating an Asian grocery, if not several of them, one or more of which may specialize exclusively in Japanese foods. If you live in the suburbs or in a rural area, your quest may be a little more difficult. You might have to drive into the city to find the things you need, although many upscale grocery stores and gourmet food shops in smaller towns often carry a limited inventory of Japanese ingredients. If there is a sushi bar in your town, you might consider asking the proprietor to give you the names of his suppliers, or even to sell you small quantities of his bulk ingredients. Of course, buying local is always your best bet, since you can examine the quality of the ingredients and compare products. But in a pinch, it's also possible to order the basics online at one of the following websites:
Seagull-NY - This site offers quite a wide selection of hard-to-find Japanese ingredients at reasonable prices
Ethnic Grocer - Offers a reasonably good selection of Japanese ingredients at fair market prices, but with several conspicuous omissions.
What to Keep on Hand
If you plan to cook traditional Japanese cuisine on a regular basis, there are several items with a very long shelf life that you may want to keep on hand. Those ingredients include:
A mild soy sauce such as Takara, or Kikkoman. Beware of cheap soy sauces, as they may tend to be thick, heavy and overly salty. Soy sauce keeps indefinitely at room temperature in a tightly sealed container.
Pickled Ginger, available in jars, bottles and occasionally in plastic containers in the produce section. Keeps indefinitely in a tightly sealed container in the refrigerator. Just be sure that the ginger is fully immersed in the rice wine vinegar.
Wasabi, available in prepared form in small, squeezable tubes, or in powdered form to mix with water into a soft paste. Keeps indefinitely in an airtight, bug proof container. (Believe it or not, grain moths love the stuff.)
Sesame seeds, available in the spice and baking ingredients section of your grocery store. Japanese markets also carry a black, toasted variety. Will keep indefinitely in a sealed container in the refrigerator. Untoasted sesame seeds tend to go rancid at room temperature and are also a tasty target for grain moths.
Sesame oil also goes rancid if left unrefrigerated, but will keep indefinitely at cooler temperatures in a tightly sealed container, although it does tend to become viscous and may need to warm up a bit before use.
Dried seaweed of all types keeps indefinitely in sealed bags or containers, but is probably best kept in the fridge to prevent unwelcome pests. Some cats love nori.
Katsuo, flakes of dried bonito will keep indefinitely in sealed bags or containers and should also be kept in the fridge just to be sure. Of course, they're so tasty and versatile, chances are they won't last long enough to spoil.
Rice wine vinegar, like all vinegars, will keep indefinitely at room temperature, but would best be kept in the fridge with the rest of your Japanese ingredients.
Mirin, sweet cooking sake, also has an indefinite shelf life in the refrigerator.
Miso, savory soybean paste available in both red and white, does have a somewhat limited shelf life, but will keep for several months in a sealed container in the refrigerator. White miso is creamy and mild, while red miso is heavier, richer and more savory. They're virtually interchangeable in recipes, so choose according to your own taste. Beware however, that miso often contains MSG, so read the ingredient label if you're sensitive or allergic.
Noodles are also a good buy-ahead staple. So if you find a not-so-nearby source of high quality ramen or dry soba noodles, feel free to buy several packages. Udon, however, often comes in sealed packages, pre-cooked and ready to heat and serve. You should find an expiration date somewhere on the package.
Rice can also be purchased in large quantities and stored for long periods of time. Be aware however, that you will get the best results if you buy Japanese rice, and for making sushi in particular, if you purchase rice specifically intended for that purpose. Of course much of the outcome depends on the cooking process, however, sushi rice tends to be a little more sticky than the other varieties and therefore holds together better for nigiri and makizushi.
Sembei crackers are a tasty little starter for any Japanese meal. They come in dozens of varieties, from bite-sized bits and nori-wrapped nibbles, to large, crunchy rounds. They're wonderful to munch while you're cooking, or to keep your guests from getting too restless if dinner is a little delayed. They come in airtight bags and will keep indefinitely at room temperature.
What to Buy Absolutely Fresh
For the best outcome of your culinary efforts, try to shop for your fresh ingredients on the day before you plan to cook, or even on the same day if time allows, especially for the fish if you plan to serve it raw. It's even a good idea to check with the proprietor of your local fish market or your supermarket butcher a few days ahead to request that he set aside his best cuts for you. Always avoid frozen ingredients, and use them only if you can't find fresh, and only if you plan to cook them.
Leafy vegetables can become limp and dehydrated in the refrigerator overnight if not stored properly, and although tofu keeps for weeks in its original sealed package, it goes bad very quickly once it's been opened.
Remember, buy only the freshest and the best, and serve it as soon as possible.
* * * | <urn:uuid:ae220fc8-3630-479f-b72e-dcd8a25da171> | CC-MAIN-2022-33 | http://thingsasian.com/story/stocking-japanese-pantry | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.952172 | 1,342 | 1.539063 | 2 |
- This event has passed.
Virtual Author’s Talk – Underwriters of the United States: How Insurance Shaped the American Founding
January 13, 2022 @ 6:30 pm - 7:30 pm
Unassuming but formidable, American maritime insurers used their position at the pinnacle of global trade to shape the new nation. As Hannah Farber demonstrates in her new book Underwriters of the United States: How Insurance Shaped the American Founding, the international information insurers gathered and the capital they generated enabled them to play central roles in state building and economic development. During the American Revolution, they helped the new nation negotiate foreign loans, sell state debts and establish a single national bank. Afterward, they increased their influence by lending money to the federal government and to its citizens. Even as federal and state governments began to encroach on their domain, maritime insurers adapted, preserving their autonomy and authority through extensive involvement in the formation of commercial law. Leveraging their claims to unmatched expertise, they operated free from government interference while simultaneously embedding themselves into the nation’s institutional fabric. By the early nineteenth century, insurers were no longer just risk assessors. They were nation builders and market makers.
The talk will last approximately one hour on Zoom. Registration is required to access the virtual author’s talk.
About the Speaker
Hannah Farber is an assistant professor of history at Columbia University. Her research focuses on politics and economy in colonial North America, the early American republic and the Atlantic world. Her first book, Underwriters of the United States: How Insurance Shaped the American Founding, was published in November 2021 by the Omohundro Institute of Early American History and Culture and University of North Carolina Press. Professor Farber holds a Ph.D. in history from the University of California, Berkeley. She is a series editor of “American Beginnings, 1500-1900” at the University of Chicago Press, and she held a National Endowment for the Humanities fellowship at the New-York Historical Society during 2020-2021. | <urn:uuid:4f01ef1c-0406-496d-9a17-ae633ba5e0d9> | CC-MAIN-2022-33 | https://www.americanrevolutioninstitute.org/event/virtual-authors-talk-underwriters-of-the-united-states/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.948941 | 417 | 1.734375 | 2 |
The DICT Development Group
3 definitions found
From The Collaborative International Dictionary of English v.0.48 :
Impracticable \Im*prac"ti*ca*ble\, a.
1. Not practicable; incapable of being performed, or
accomplished by the means employed, or at command;
impossible; as, an impracticable undertaking.
2. Not to be overcome, persuaded, or controlled by any
reasonable method; unmanageable; intractable; not capable
of being easily dealt with; -- used in a general sense, as
applied to a person or thing that is difficult to control
or get along with.
This though, impracticable heart
Is governed by a dainty-fingered girl. --Rowe.
Patriotic but loyal men went away disgusted afresh
with the impracticable arrogance of a sovereign.
3. Incapable of being used or availed of; as, an
impracticable road; an impracticable method.
Syn: Impossible; infeasible. -- Impracticable,
Impossible. A thing is impracticable when it can not
be accomplished by any human means at present possessed;
a thing is impossible when the laws of nature forbid it.
The navigation of a river may now be impracticable, but
not impossible, because the existing obstructions may
yet be removed. "The barons exercised the most despotic
authority over their vassals, and every scheme of public
utility was rendered impracticable by their continued
petty wars with each other." --Mickle. "With men this is
impossible, but with God all things are possible."
--Matt. xix. 26.
From WordNet (r) 3.0 (2006) :
adj 1: not capable of being carried out or put into practice;
"refloating the sunken ship proved impracticable because
of its fragility"; "a suggested reform that was
unfeasible in the prevailing circumstances" [syn:
impracticable, infeasible, unfeasible,
From Moby Thesaurus II by Grady Ward, 1.0 :
22 Moby Thesaurus words for "impracticable":
awkward, disadvantageous, impossible, impractical, inapplicable,
inconvenient, infeasible, nonfunctional, troublesome, unacceptable,
unachievable, unattainable, undesirable, unfeasible, unfit,
unrealizable, unsatisfactory, unserviceable, unsuitable, unusable,
firstname.lastname@example.org Specification=RFC 2229 | <urn:uuid:2e7d1ff1-96c9-429e-bb4b-ef5a42784c66> | CC-MAIN-2022-33 | http://dict.org/bin/Dict?Form=Dict2&Database=*&Query=Impracticable | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.809421 | 623 | 2.890625 | 3 |
Recommender systems have become extremely common in recent years, and are applied in a variety of applications. The most popular ones are probably movies, music, news, books, research articles, search queries, social tags, and products in general. However, there are
Collective intelligence is shared or group intelligence that emerges from the collaboration, collective efforts, and competition of many individuals and appears in consensus decision making. The term appears in sociobiology, political science and in context of mass peer review and
An Information filtering system is a system that removes redundant or unwanted information from an information stream using (semi)automated or computerized methods prior to presentation to a human user. Its main goal is the management of the information overload and
A filter bubble is a result state in which a website algorithm selectively guesses what information a user would like to see based on information about the user (such as location, past click behaviour and search history) and, as a
Cold start is a potential problem in computer-based information systems which involve a degree of automated data modelling. Specifically, it concerns the issue that the system cannot draw any inferences for users or items about which it has not yet
Multi-Criteria Recommender Systems (MCRS) can be defined as Recommender Systems that incorporate preference information upon multiple criteria. Instead of developing recommendation techniques based on a single criterion values, the overall preference of user u for the item i, these systems
Diversity – Users tend to be more satisfied with recommendations when there is a higher intra-list diversity, i.e. items from e.g. different artists. Recommender Persistence – In some situations it is more effective to re-show recommendations, or let users re-rate
Netflix is a good example of hybrid systems. They make recommendations by comparing the watching and searching habits of similar users (i.e. collaborative filtering) as well as by offering movies that share characteristics with films that a user has rated
When building a model from a user’s profile, a distinction is often made between explicit and implicit forms of data collection. Examples of explicit data collection include the following: Asking a user to rate an item on a sliding scale.
To abstract the features of the items in the system, item presentation algorithm is applied. A widely used algorithm is the tf–idf representation (also called vector space representation). | <urn:uuid:3a99208d-972b-40ef-b29d-a49105f7ad21> | CC-MAIN-2022-33 | http://demo.sosere.com/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.93658 | 484 | 3.25 | 3 |
Screenworks has outlined a Reconciliation Action Plan (RAP) to coincide with NAIDOC Week, joining a network of more than 1,100 corporate, government, and not-for-profit organisations that have made a formal commitment to reconciliation.
Prepared across 18 months in consultation with local Elders and First Nations community representatives, in addition to Indigenous film and TV industry representatives, the Reflect RAP has received the endorsement of Reconciliation Australia, which has operated the program since 2006. Reflect is one of four types of RAP, with the others being Innovate, Stretch and Elevate.
Screenworks CEO Ken Crouch is leading the rollout of the plan, working towards objectives that include better understanding the needs of the community and building stronger relationships with First Nations peoples locally and across regional Australia; demonstrating an ongoing commitment to close the gap across the industry through a strong First Nations membership, narrative, and awareness; and ensuring Screenworks staff, board members, and stakeholders have an appropriate and ongoing cultural understanding and use appropriate language to create a safe space/working environment for First Nations people.
As part of the RAP, Screenworks will work through the steps of cultural training, establishing a local knowledge circle (RAP Knowledge Circle) and an Industry Reference Group, and identifying the key priorities.
In introducing the plan Reconciliation Australia CEO Karen Mundine said she looked forward to following Screenworks’ reconciliation journey for “many years to come”.
“This Reflect RAP enables Screenworks to deepen its understanding of its sphere of influence and the unique contribution it can make to lead progress across the five dimensions,” she said.
“Getting these first steps right will ensure the sustainability of future RAPs and reconciliation initiatives, and provide meaningful impact toward Australia’s reconciliation journey.”
The Reflect RAP incorporates the work of local artist Cherie Leon, whose painting Nyangbul people in Bundjalung nation was chosen for the front cover due to its story of people and country where Screenworks is based in Ballina.
“Nyangbul [Ballina] people are very connected to country in the dreamlike stories told by our ancestors and still spiritually connected also Nyangbul belongs to the people and the people belong to the land,” Leon said.
Click here to view the Screenworks Reflect RAP. | <urn:uuid:3a0af116-f80f-4f99-9c3f-206755422de7> | CC-MAIN-2022-33 | https://if.com.au/screenworks-launches-reflect-reconciliation-action-plan/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.933013 | 485 | 1.773438 | 2 |
Remarks to the Colored Citizens of Memphis, Tennessee
Mr. Chairman, General Wright, and you, my fellow citizens:
I am indeed glad to have been here to witness and to share in your greeting to General Wright. I can well understand how inevitable it was that he should succeed in the post of high responsibility he has occupied outside of our country, when he has had the character that has entitled him to the profound respect and regard of all his fellow citizens.
General Wright has succeeded in the Philippines by displaying just those qualities which each one of us must in a lesser degree display, if we are to be good citizens here at home. There is nothing peculiar in government. Good government consists in applying the old humdrum everyday, commonplace virtues which all of us learn, but which all of us do not practice. If a man is fearless, is honest, has consideration for others and is gifted with the crowning grace of common sense, he is going to do fairly well.
We, all of us, tend to rise or fall together. If any set of us goes down the whole nation sags a little. If any of us raise ourselves a little, then by just so much the nation, as a whole, is raised. Every man who does markedly good work in one sphere of government by just so much helps all of us and elevates all of us. It is a great thing when we can point to any American who has rendered signal service in any position. It makes all of us a little better Americans, makes us feel spurred on to do a little better work as citizens, each in his own sphere of activity.
General Wright stands for duty well done in the Philippines. He stands for the qualities of firmness, of strength, of fair dealing with all, fair play for each, according to his capacity and character, which we must apply at home just as much. All of us should remember that the qualities which we are anxious to have the other fellow apply we must apply ourselves.
For that reason we owe to General Wright a double debt of gratitude as Americans, as men and women interested in the honor of our common country. We owe him a debt of gratitude for the way in which he has administered the greatest of the country's dependencies, which came to it as a result of the Spanish war. And, furthermore, as American citizens, we owe him a debt of gratitude for having practiced in a high position those qualities of good citizenship which each of us must practice in our several degrees, if we are to make and to keep this nation what it shall be made among the nations of the earth.
Theodore Roosevelt, Remarks to the Colored Citizens of Memphis, Tennessee Online by Gerhard Peters and John T. Woolley, The American Presidency Project https://www.presidency.ucsb.edu/node/343539 | <urn:uuid:d16707c6-9ace-44e5-ace2-a6313bda8e75> | CC-MAIN-2022-33 | https://www.presidency.ucsb.edu/documents/remarks-the-colored-citizens-memphis-tennessee | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.974493 | 582 | 2.109375 | 2 |
One of the major aspects of running a clothing brand is the pricing of your products. You’ll have to consider what price you can afford to sell at (while making a profit) and what price potential customers are willing to buy at.
You might be tempted to sell your t-shirts at the cheapest price possible, convinced that people will buy for that reason. However, keep in mind that price won’t be the determining factor for someone who’s making an emotional purchase. After all, a cool looking t-shirt isn’t exactly a basic human need.
As Entrepreneur magazine puts it:
“Before setting a price for your product, you have to know the costs of running your business. If the price for your product or service doesn’t cover costs, your cash flow will be cumulatively negative, you’ll exhaust your financial resources, and your business will ultimately fail”.
People will be willing to purchase your shirts based on the pricing of brands in a niche similar to yours. The perceived value of your brand (celebrity endorsed, fabric quality, exclusivity, etc.) also plays a role in the what price you can sell at.
So how do you set the right price for your t-shirts?
Let’s take a look at some of the common price ranges for t-shirts. The prices below refer to short sleeve t-shirts with a graphic on the front.
Price Range: $5 – $15
This approach works if you’re selling mass marketed designs and can afford to place huge bulk orders upfront (1000+ units per unique design / color). By ordering large quantities per unique product, you’re cost per unit will drop significantly.
Alternatively, if you’re printing the shirts yourself (assuming you know what you’re doing), you can still be profitable while selling cheap shirts.
Price Range: $16 – $27
The unofficial average price range for the majority of t-shirt brands. Most brands you come across will have their tees at this price range whether they’re new or have been around for a while.
Great profit margin if you can afford huge orders, good enough margin if you place small wholesale orders.
Price Range: $28 – $40
These tees usually come off as higher quality than the average tees and often involve designs that feature various print locations, multiple print techniques and all over prints. Many streetwear labels, rookies and vets alike, go with this range.
Price Range: $41 – $80+
These tees are often associated with luxury, affluence and sophistication and also have more complex production processes…or the brand is so popular the name sells itself.
The labels are also often endorsed by and marketed towards celebs, which allows the retail price to be so high.
When choosing a price range for your brand, keep in mind these key factors to each range. See which range your brand could best be defined as or which you’d like for your brand to be sold for.
Be realistic too. Some newbies make the mistake of trying to create expensive upscale labels without offering high quality t-shirts or having any celebrity backing.
Wholesale T-Shirt Pricing
Now let’s take a look at wholesale pricing. Typically, retail stores will take your product and sell it for 2x as much as they bought it for. If your retail price is $20 your wholesale price should be $10.
This is what the price ranges above would look like as wholesale prices:
- Retail: $5 – $15
- Wholesale: $2.50 – $7.50
At this price range, you’re better off selling your products exclusively online.
- Retail: $16 – $27
- Wholesale: $8 – $13.50
- Retail: $28 – $40
- Wholesale: $14 – $20
- Retail: $41 – $80+
- Wholesale: $20.50 – $40+
Are you ready to offer your t-shirts for these wholesale prices? Will you still be able to profit?
Here’s a rule you should try to go by:
Production cost x 2 = Wholesale price
Wholesale price x 2 = Retail price
Keep these things in mind when deciding on your t-shirt prices. As with many business journeys you may find that not all this pricing stuff is the same everywhere or that your particular situation requires you to price differently.
Now let’s play some Plinko! | <urn:uuid:8abb7957-ac91-4ab2-ad93-8db0e0039eb4> | CC-MAIN-2022-33 | https://t-shirtmagazineonline.com/t-shirt-pricing/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.924433 | 995 | 1.585938 | 2 |
What is a Scrum Master Certification?
Are you interested in the role of Scrum Master? You’ve probably heard of Scrum Master certifications.
Scrum Master certification allows professionals to perform the Scrum Master role. Scrum Alliance’s Certified Scrum Master (CSM), is the most popular Scrum Master certification.
We will walk you through the requirements and benefits of CSM certification. We will also provide information about other popular Scrum Master certifications.
The Certified Scrum Master (CSM), Certification: Explained
Why do you need certification to become Scrum Master? The Scrum Master role is unique and should only be held by someone who is an Agile expert and has used the Scrum framework.
About Scrum Alliance
Scrum Alliance is one the largest Scrum organizations in the world, with more than 750,000 members from different parts of the globe.
This non-profit organization has helped thousands of professionals become Scrum Masters. It also grants other entry level Scrum and Agile credentials like the Certified Scrum Developer or the Certified Scrum Product Owner.
What is the role of a Scrum Master and how can they help?
Scrum Masters manage small Scrum teams in Agile environments. The responsibilities of a Scrum Master typically include some or all the following:
Scrum Masters ensure that the Scrum framework is followed by the team. A Scrum Master is a servant leader that helps team members accomplish their tasks efficiently by self-organizing and self-managing.
It is important to remember that a Scrum Master doesn’t actually manage the team. Their primary role is to support the team and organize the work flow.
Coaching that is goal-oriented
A Scrum Master helps their team achieve their goals by constantly coming up with new ideas in areas such as predictability, quality and flow.
Get to know the product owner.
A Scrum Master’s main responsibility is to work with the Product Owner, guide the team in the right direction, and manage the backlog.
Both practitioners also ensure that the project’s priorities and goals are met.
Benefits of Scrum Master Certification
There are many perks to becoming a CSM. These can be summarized as follows:
Scrum Master certification opens up new opportunities.
Even if you don’t want to be a Scrum Master you can still learn the Scrum framework and make it easier to work in Scrum groups.
Scrum Master certification is a great way to validate your skills and establish credibility when applying to jobs.
The certification will help you get more interviews and increase your chances to be hired.
Acquiring new skills and knowledge
Scrum Master exams will test your knowledge in all aspects of Scrum. This is why it is important to study hard for it.
You’ll have the opportunity to expand your knowledge and participate in practical workshops with other students during your preparation journey.
This certification prepares you to be a Scrum Master. It teaches you about Scrum and how it can be applied in an Agile environment.
You’ll also be able to access many learning resources at a discounted price once you are certified. Scrum events will be available at discounted prices.
Scrum Master certifications can be used worldwide, so you can apply for a job in any country with your certification. Employers all over the world recognize the value of Scrum Master certifications.
Once you are certified, you will be able to make your own. | <urn:uuid:3c0e3b43-f083-4819-9480-e0d8533bec1a> | CC-MAIN-2022-33 | http://thesignatureleaf.com/what-is-a-scrum-master-certification/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.932578 | 751 | 2 | 2 |
Introduced back in the late 15th century, lace has gone on to become a highly popular fabric in the world. During its inception, threads were used in order to make lace of linen, gold, silver, and silk. Nowadays, lace is commonly made with the help of cotton thread, although silk and linen threads are still available in the market. On the contrary, manufactured lace are made up of synthetic fiber. The patterned fabric is produced with the help of machines or with some intricate handwork by braiding, twisting, and looping a thread. It has a distinctive embroidered pattern and has an open weave with vivid space between the weaves. During the 17th century, lace fabric was turned into a luxury commodity and was driving the European economy in a positive manner. Both men as well as women were seen wearing clothing made up of lace fabric.
The fabric is popularly used for clothing purposes as well as for interiors like drapes, throws, curtains, detailing, and more. Consumers prefer lace drapery fabric as it adds a distinctive sophistication with effortless style to one’s home. It is highly fashionable and gives a contemporary vibe, this is prompting the lace fabric market to grow in huge numbers. Although seen by many as a traditional concept or material, the fabric holds an important place in the modern world. Fashion and designing students of various institutions work with this material to create unique fashion designs. The popularity of lace fabric is slated to soar high due to the increasing contemporary fashion trend. The report published on the global lace fabric market revealed the growth to be at a notable pace. The valuation of the lace fabric market was further stated to surpass its previous valuation.
Request Free Sample Report at: https://www.wiseguyreports.com/sample-request/4434209-global-lace-fabric-market-insights-forecast-to-2025
Regionally, the Lace Fabric market report covers the key regions such as North America, Latin America, Asia Pacific, Europe, and the Middle East & Africa. The present, past, and forecast overview of Lace Fabric market is signified in this report. The regional analysis and strategies of the market provide understanding about the market forces and how those can be exploited to create future opportunities.
Method of Research
The analysis of the market is done according to the parameters mentioned in Porter’s Five Force Model. These reliable market reports have led to integrating top-down and bottom-up approaches into the research model. This allows the analysists to provide the clients with estimations of various crucial market figures which are then used for a SWOT analysis of the Lace Fabric market along with relevant insights into the global market
View Detailed Report at : https://www.wiseguyreports.com/reports/4434209-global-lace-fabric-market-insights-forecast-to-2025
This study categorizes the global Lace Fabric breakdown data by manufacturers, region, type and application, also analyzes the market status, market share, growth rate, future trends, market drivers, opportunities and challenges, risks and entry barriers, sales channels, distributors and Porter’s Five Forces Analysis.
The following manufacturers are covered in this report:
KC Astir & Co. Pvt. Ltd.
Hangzhou Dobest Lace
Sinem Tekstil Brode
Shanghai Yaoyu Textile
Ningbo MH Industry
Sun Hing Industries Holding
Lace Fabric Breakdown Data by Type
Lace Fabric Breakdown Data by Application
Clothes and Lingerie
Lace Fabric Production Breakdown Data by Region
Lace Fabric Consumption Breakdown Data by Region
Central & South America
Middle East & Africa
For more information or any query mail at firstname.lastname@example.org
Wise Guy Reports are a part of the Wise Guy Research Consultants Pvt. Ltd. and offers premium progressive statistical surveying, market research reports, analysis & forecast data for industries and governments around the global.
Ph: +1-646-845-9349 (US)
Ph: +44 208 133 9349 (UK)
Company Name: Wiseguyreports.com
Contact Person: Norah Trent
Email: Send Email
Phone: +1 646 845 9349, +44 208 133 9349 | <urn:uuid:52c75ae5-5b61-4008-b5da-2b43a30d8654> | CC-MAIN-2022-33 | https://www.getnews.info/968243/global-lace-fabric-market-2019-2025-by-type-component-industry-region.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.89708 | 1,115 | 2.359375 | 2 |
Everyone, well at least almost everyone, has had headaches from time to time, and we all know how miserable they can make us feel. In fact, at some point in time, 9 out of 10 Americans suffer from headaches that range between mild and dull to throbbing, intense, and debilitating, sometimes to the point of requiring bed rest in a dark, quiet room.
The common reflex is to reach for that bottle of pills and pray the headache subsides so you don’t have to call in sick and lose another day of productivity when you have so much to do. Unfortunately, between the side effects of many medications designed to help headaches and the pain associated with the headache, this approach is frequently NOT the answer. So what is?
The good news is that many studies have identified spinal manipulation therapy (SMT), the main type of care utilized by chiropractors, as being very effective for popular types of headaches—in particular tension-type headaches that arise in the neck. An important 2001 study reported that SMT provided almost immediate relief for headaches that arose in the neck with SIGNIFICANTLY fewer side effects and longer-lasting results compared with commonly prescribed medications.
Another interesting study that found similar results included tracking the prevalence/frequency of headaches after treatment stopped. The authors of the study reported the patients receiving SMT had continued to experience sustained benefits throughout the following weeks, and even months, in contrast to those in a medication treatment group where headaches came back almost immediately after they discontinued treatment.
The most commonly prescribed medication for tension-type headaches are non-steroidal anti-inflammatory drugs (NSAIDs). Common over-the-counter options include ibuprofen (Advil, Nuprin, etc.) and Aleve (Naproxen). For those who can’t take NSAIDs because of blood thinning and/or stomach-liver-kidney problems, doctors commonly prescribe acetaminophen (Tylenol), but it can be hard on the liver and kidneys, especially when taken over time.
So, what can you expect from a visit to a chiropractor for your headaches? The typical approach begins with a thorough history and examination with an emphasis of evaluating the neck and its associated function. Your doctor of chiropractic may also perform tests designed to reduce pain and some that provoke a pain response to identify the “pain generator” or cause!
Because each patient is unique, the type of care provided will be individually determined based on the findings, the patient’s age, comfort, and preference of both the provider and patient.
So, the next time you find yourself reaching for pills because of headaches, remember that there are better options! Give chiropractic a try. You’ll be GLAD you did!!!
Our highly trained, dedicated and caring team is committed to relieving your headaches & migraines and improving your life. And our SAME DAY GUARANTEE* is our way of showing you just how committed we are. Call us in the morning…see us in the afternoon!
Achieve Total Wellness. Call today! | <urn:uuid:1b60082f-f314-4748-8ea5-3ac43f12d806> | CC-MAIN-2022-33 | https://oaklandspinenj.com/can-chiropractic-help-my-headaches-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.94204 | 645 | 1.960938 | 2 |
In this article we are writing about rail passenger rights for delayed trains.
Trains are often delayed in Hungary, but it’s important to know the length of the delay. As in all major sectors, there is also an EU Regulation about rail passenger rights.
Under the Regulation, in the case of a cancellation or a delay of more than 60 minutes, passengers have the right to the reimbursement of the full cost of the ticket for the part of the journey not made, or continuation or re-routing under comparable transport conditions at the earliest opportunity or at a later date at the passengers’ convenience.
If passengers do not opt for reimbursement, they may claim a compensation for the delay. The Regulation sets the minimum compensation but railway undertakings can pay more compensation based on the transport contract. The rail passenger can claim minimum 25% of the ticket price for a delay of 60 to 119 minutes, and minimum 50% of the ticket price for a delay of 120 minutes or more. The passenger having a travel pass or season ticket can be entitled to compensation in accordance with the railway undertaking’s compensation arrangements. The compensation must be paid in money within one month after the submission of the request. Under the Regulation the compensation of the ticket price cannot be reduced by financial transactions costs such as fees, telephone costs or stamps. However, railway undertakings may introduce a minimum threshold under which payments for compensation will not be paid. This threshold shall not exceed EUR 4.
It is also important that the passenger is not entitled to compensation if he or she is informed of a delay before he buys a ticket, or if a delay due to continuation on a different service or re-routing remains below 60 minutes.
You can read the detailed rules on railway undertakings’ websites in accordance with these provisions.
Content supported by DAS!
Author: dr. Zsuzsanna Burján | <urn:uuid:2a3ca300-c2c7-45be-ae40-800b90aa8fb9> | CC-MAIN-2022-33 | https://flightrefund.com/rail-passenger-rights-in-case-of-delay/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.941758 | 385 | 1.804688 | 2 |
I have text file i separated columns based on comma ,
I got in this way
I want this in this way
reviewer Id name text helpful
12323 hgdge this is not working 3
i.e each row contains column names i have to make table in such a way where column names must be as column header and no row contain column name in its cell
and some errors are show how to overcome them
Please can someone help me with
could you import an example csv (few line input file) and give a clear result that you want to achieve?
try.txt (49.6 KB)
this is my file
i want to achieve a table with column headers (reviewerID , asin , reviewerName …)
and respective values in each row
You can use the JSON nodes for parsing. Just process each row as separate JSON object. Then use JSON Path node to extract the required properties.
You can use “file reader”+“string to json”+“json path”.
File reader with:
- column delimiter = none
- advance/quote support/currently set quotes = disabled/empty
txt_to_json.knwf (28.0 KB)
This working well but my file has 25 rows and table is showing all 25 rows with Huge garbage data in table how to remove that garbage data
Please help me
I toyed around with the example a little bit and came up with the following solution. Which is:
- Import the Text file as one large column width: 500
- convert the column into JSON
- manually define JSON paths for each column (or see if the default setting does the trick)
- remove the “column*” columns
- export the resulting data with headers
I now have a few empty lines but maybe that was the case if not they could be removed.
If data is missing it could be feasible to expand the width.
Then if you have garbage in your data it could be because of UTF-8 encoding. I had a similar problem and had to change a setting in the knime.ini (until KNIME would have fixed a problem). If you still experience this problem I could try to look up the solution I got.
txt_to_json.knwf (250.4 KB)
This topic was automatically closed 7 days after the last reply. New replies are no longer allowed. | <urn:uuid:50584bf5-afbb-4089-af1d-b20dbf8264d6> | CC-MAIN-2022-33 | https://forum.knime.com/t/how-to-arrange-this/10980 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.914023 | 534 | 1.523438 | 2 |
After my post on the above topic came out, I have had encountered numerous queries in this area. The questions were varied, but after aggregating I could group them generally into three categories. There were some which were unique to the individuals’ situations, so I would leave them out.
Category #1: Is it OK to attend courses?
This was the most common line of questioning I got, which I believe it stems from my post’s biasness and impression on self-learning via available offline and online resources.
I do recognize the differences in every individual’s learning styles and methods; some prefer to go through on their own, while some prefer someone to guide them along, and others may want to have a hybrid of the former two.
As emphasized in the earlier post, not all courses are suitable for everyone, as the course structure may have a few assumptions in place, like the participant having some underpinning knowledge of certain topics to be taught. Imagine a newbie who had never invested before learning about fundamental analysis; if he/she has a business/finance/accounting background, that is fine. If not, however, he/she would be confused even by the words “debit” and “credit”.
For my case, I did attend a course to further my knowledge on investing and the things related to it (see here on my experience in attending Nanyang Poly’s Specialist Diploma). In my opinion, the course option would be suitable after you had completed Stage Two, where you had at least mastered the required info needed for investing and be ready on what the trainers/lecturers will be talking about. You can take courses in advancing and obtaining Stage Three knowledge, and/or Stage One/Two to reinforce on what you had learnt and/or fill in the gaps that you may have missed.
Category #2: Different materials telling me different things on investing. Which should I follow?
In our primary and secondary academic education journey, most of us were used to having absolute answers to questions, e.g., 1 + 1 = 2 and hydrogen + oxygen = water. The trouble about investing is that there is more than one way in going about it, and the range of results obtained is infinite.
To start off, my Bedokian Portfolio make-up already differs from other known portfolios like the 60/40, Bogleheads’, etc. Or for fundamental analysis, there are many ways in valuing a company. Especially if you are learning from the ground up, you will find that many authors, writers and bloggers have different methods, styles and means, and their results are vastly different.
Frankly, there is no one ultimate answer in the world of investing, and the reason why is that the factors in play that govern the answer is in a constant flux. Add in different perspectives from various players, it is as random as you can get.
My answer to this category is, after going through Stages One and Two, find one methodology and style that you are comfortable with, and stick to it. It could be from a single source (e.g., 60/40 equity/bond) or a mix like the Bedokian Portfolio (which itself is cobbled from a few portfolio make-ups and investing styles). Tweaks and adjustments are OK as you go along, but try not to deviate drastically from the original, e.g., from 60/40 equity/bond into 50/50 crypto/cash.
Category #3: Do I need to know “everything” related to investing?
The word “everything” here is a cumulation of styles, methodologies, financial instruments, strategies, etc. A couple of examples would be like “do I need to know fundamental analysis if I opt for passive investing” and “do I need to know about options and futures”. Basically, it is a question of whether we need to have every ounce of investing knowledge stuffed in our brains.
While the theories behind learning, knowledge and application warrants a separate reading, I can put it simply in the following “knowledge tiers”, namely:
- Tier 0: No knowledge of the topic
- Tier 1: Heard of the topic
- Tier 2: Understand the topic
- Tier 3: Able to apply on the topic
Ideally, we should go for Tier 3 in all aspects related to investing, though it is not necessary. Depending on individual preferences, one can get started in investing with just some Tier 3 and others Tier 0. I have met a seasoned investor who knows nothing about option strategies, and I have also seen a passive fund investor with zilch accounting knowledge. Both are currently doing well in their respective investments.
Using the Stages in the previous post, for active investing, my preference would be at least Tier 2 for Stages One and Two to start, and at least Tier 1 for Stage Three going forward. For passive investing, you can afford to go Tier 1 for topics like accounting, economics and fundamental analysis, and Tier 2 for portfolio management and asset classes.
While I had recommended the basic level of investment knowledge, do not just stop there. Learning, like investing, is a journey, and I hope you could pair these two together going forward. | <urn:uuid:53aa0ffc-2fae-4473-b342-dbc8aecfd27e> | CC-MAIN-2022-33 | http://bedokianportfolio.blogspot.com/2021/05/a-structured-and-holistic-way-to-learn.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.966695 | 1,097 | 1.523438 | 2 |
In recent years many books have been published in the area of Christology (who is Jesus in himself?) and soteriology (what did he do as Saviour?). A number of notable, ecumenical documents on Christian ministry have also appeared. But in all this literature there is surprisingly little reflection on the priesthood of Christ, from which derives all ministry, whether the priesthood of all the faithful or ministerial priesthood. This present work aims to fill that gap
by examining, in the light of the Scriptures and the Christian tradition, what it means to call Christ our priest.
Beginning with a study of the biblical material, the book then moves to the witness to Christ's priesthood coming from the fathers of the Church, Thomas Aquinas, Luther and Calvin, the Council of Trent, the seventeenth-century 'French School', John Henry Newman, Tom Torrance and the Second Vatican Council. The two concluding chapters describe and define in twelve theses the key characteristics of Christ's priesthood and what sharing in that priesthood, through baptism and ordination,
This is yet another very fine book by two well-known and highly regarded theologians...What makes the book a joy to read is the methodical, step by step, and masterly guidance through a wealth of material...we can be grateful to these two authors for this most informative and stimulating publication. Brendan Leahy. The Furrow The discussion is lucid... interesting insights are in good supply... The authors lay hold of the central threads and follow them down through the centuries with keen theological acumen... Carefully derived, the theological conclusions of Jesus Our Priest cannot be set lightly aside. Nicholas Perrin, Theology This is a well-researched book on an important subject... a thoroughly commendable volume, a sustained, accessible and near-comprehensive treatment of a theologically, liturgically and devotionally rich and multi-textured theme. Jonathan Baker, New Directions Magazine. | <urn:uuid:c3174dbc-772c-49b5-a67e-820b3ec7792b> | CC-MAIN-2022-33 | https://chbookshop.hymnsam.co.uk/books/9780199576456/jesus-our-priest | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.928064 | 398 | 1.890625 | 2 |
The following is a reaction from the parents of Zachary and Sarah: “Zachary and Sarah’s B’nei Mitzvah was a magical afternoon . The theme was clearly to raise consciousness and funds to help needy children in Israel for Meir Panim. It began right from the invitation where it stated that, “In fulfillment of the obligation to do good deeds and to help make a difference in the world, we are making a donation to Meir Panim to help feed the hungry in Israel.” The feedback we received from our guests was astounding- they were so excited to donate funds. The actual day of the simcha, Zachary and Sarah prepared songs to sing for their guests. They sing in beautiful harmony and when they got to their finale the crowd was truly touched.
The movie screens were set up around the room, the lights were dimmed and Zachary and Sarah started singing, “We Are The World”- the song about world hunger. On the screens were pictures flashing of children who were recipients of Meir Panim benefits. Their performance was very impacting and quite touching-it truly made a statement and the crowd of four hundred fifty people spoke about this simcha for weeks after. We hope that Meir Panim continues to benefit from other children’s efforts in the future as well- what a great lesson that Zachary and Sarah learned- children helping other children. Thank you Meir Panim!!”
The money raised at the B’nei Mitzvah was allocated to sponsor a Bar and Bat Mitzvah in Israel, with the remaining money allowing Meir Panim to feed thousands of hungry Israeli children!
Zachary and Sarah Blumner had also participated in the children’s choir at the Meir Panim Carlebach concert in 2006 at the Avery Fisher Hall in New York City. Their contribution and efforts to raise awareness and funds for Meir Panim has been a real awe-inspiring experience for everyone at Meir Panim. | <urn:uuid:4baa9c48-b6f8-490f-8eb3-ba08029afa53> | CC-MAIN-2022-33 | https://meirpanim.org/a-bnei-mitzvah-for-the-ages/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570741.21/warc/CC-MAIN-20220808001418-20220808031418-00065.warc.gz | en | 0.978354 | 422 | 1.515625 | 2 |
Source: Harvard Educational Review, Volume 83, No. 3 (Fall 2013): 463-488.
(Reviewed by the Portal Team)
In this article, the author examines the challenges faced by American schooling and the reasons for persistent failure of American school reforms to achieve successful educational outcomes at scale.
He concludes that, many of the problems faced by American schools are derived from trying to solve a problem that requires professional skill and expertise by using bureaucratic levers of requirements and regulations.
The author advances a sectoral perspective on education reform, exploring how this shift in thinking could help education stakeholders produce quality practice across the US.
From the sectoral perspective, the key to improvement is not individual initiatives but, rather, the features that organize the work of the sector as a whole.
These features include:
(1) who is drawn to work in the sector, how they are selected, and how they are trained;
(2) whether there is an accumulating knowledge base that guides the work;
(3) whether there are processes in place to ensure that knowledge is consistently used at the delivery site; and
(4) whether the aforementioned steps are aligned around an overarching system of accountability.
He claims that in the American educational system, we do not recruit teachers from the top tier of academic achievement; we provide them with only limited training, equip them with little usable knowledge, and send them to work in schools that, by international standards, have high levels of child poverty and weak welfare state supports.
In turn, policy makers look at these failing schools and seek to intervene, most directly by holding schools and teachers accountable for results.
This creates a climate of distrust between policy makers and practitioners, with policy makers seeking to monitor and direct practitioners they feel are failing to provide students a decent education and practitioners resenting policy makers for what they see as misplaced blame and ill-informed demands from afar.
In particular, it has contributed to an unhealthy relationship between educational practice inside schools and the outside forces that seek to shape that practice.
The result has been antagonism and mistrust between policy makers and practitioners, with little of the hoped-for improvement in practice at scale.
From the point of view of teachers, policy makers and district administrators are generally out of touch with the realities in the classroom; they lurch from one priority to another for largely political reasons and unfairly wield power despite their limited useful knowledge.
Initial levels of professional skill and expertise in schools create a more fertile ground on which to try out new ideas.
Those ideas are then offered less in the spirit of compliance and more in the spirit of offering new knowledge that might be well suited to solving a problem of practice.
By creating a professional rather than a bureaucratic orientation, we could escape the downward spiral that we have been in and move toward the kind of upward spiral that is characteristic of higher-performing nations.
There are four interrelated aspects to the needed changes that correspond to the four core functions in any field.
We need to make changes to the human capital pipeline, changes to the knowledge base, changes to the organizational processes that ensure that the knowledge is used, and changes to the role of districts and the state, from compliance monitors to partners in the social improvement processes.
These things are all necessary if the goal is sector wide improvement.
Building an Expert Workforce
With respect to human capital, we need to take seriously the entire pipeline: attracting, selecting, training, and retaining our next generation of teachers.
The author claims that successful programs all tend to select people with content training in what they are going to teach, give them careful and extended practice and feedback on their work in schools, and teach them to use data and to reflect carefully on their practice.
Policy should continue to embrace pluralism of different types of training institutions; but as standards become clearer, some will survive and others will not on the basis of whether their graduates are consistently able to pass the bar and become teachers.
Currently, teacher training institutions are responsible for teacher preparation during student teaching or the first year of teaching, and districts are responsible for induction after that.
It would make more sense to unite these functions under single institutions that would oversee teachers' development during their first three years of teaching.
New teachers would be given increased levels of responsibility over time, beginning with team teaching with master teachers.
Then they would teach a partial load (one class for teachers in middle and high schools and part of the day for teachers in elementary schools) and use the rest of the time for feedback, reflection, and integration of what they are learning about teaching with their experiences in the classroom.
Finally, expert teachers not only possess these kinds of knowledge, but also know how to integrate them in real situations; like experts in other domains, they are able to quickly diagnose situations and draw on a wide repertoire of techniques in response.
Hence good teaching also has an affective dimension, as the ability to develop a warm but demanding rapport with students is critical for success. | <urn:uuid:6e514708-0b71-4fb2-80ea-337adfabb245> | CC-MAIN-2022-33 | http://education.eng.macam.ac.il/article/3809 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.960766 | 1,018 | 2.40625 | 2 |
AGC’s Sonja Mueller will be running this year’s Tough Mudder Yorkshire, one of the most challenging running events in the world. The 10 – 12 mile mud and obstacle course combines activities such as running, climbing, jumping, diving, swimming as well as crawling in mud. She is completing the event for the Bone Cancer Research Trust, which is dedicated to saving lives and improving outcomes for people affected by primary bone cancer. They are in fact the leading funders of research into this disease. This year, as part of ‘The Biggest Fight Against Bone Cancer – Ever!’ the charity aims to raise £1.1million to fuel more research, more information, more awareness, more support and ultimately save more lives! Sonja’s personal aim is to raise £600, of which a third has been donated by AGC Chemicals Europe. For contributions visit her JustGiving account or for further information about the Bone Cancer Research Trust go to www.bcrt.org.uk/. | <urn:uuid:b5807a14-ed22-4d8a-84f4-6225d51e4dad> | CC-MAIN-2022-33 | https://www.agcce.com/bone-cancer-research-trust/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.962611 | 209 | 1.59375 | 2 |
27 Sep Itchy? It could be Intrahepatic Cholestasis of Pregnancy
What is intrahepatic cholestasis of pregnancy (ICP)?
Intrahepatic cholestasis of pregnancy (ICP) is the most common liver disorder of pregnancy that affects around 5000 women each year in the UK alone; at present this figure is unknown in South Africa.
What are the symptoms?
Itching (also called pruritus):
- Itching usually presents in the third trimester, however it’s important to note that some women may develop ICP as early as the first trimester or second trimester of pregnancy.
- It can be mild or severe, constant or intermittent, localized or general. Many women report that it typically affects their hands and feet.
- It is generally reported as being worse at night, and often interrupts sleep. Researchers are unsure whether this is because women are more active during the day and notice it less or if there is biological reason for the nocturnal increase in severity.
- There is no rash associated with ICP, although scratch marks on the skin are common. Some women scratch until their skin bleeds.
- The severity of the itch does not necessarily correlate with the severity of the condition, and it is possible to itch for some time before blood work becomes elevated
Other less-common symptoms:
- Dark urine
- Steatorrhoea (pale stools)
- Jaundice (yellowing of the skin and whites of the eyes thought to affect less than 20% of ICP women)
- Anecdotally many women report upper right quadrant pain (pain under or close to the right ribs where the liver is situated) but this has not been researched.
- Anxiety and depression
- Loss of appetite
What are the risks?
ICP is associated with spontaneous preterm labour, fetal distress, meconium staining and in severe cases stillbirth. There is also an association of PPH (post partum haemorrhage) but this is thought to affect less than 20% of women with the condition. Recent research has suggested that with active management the risk of stillbirth in an ICP pregnancy is believed to be the same as that of a normal pregnancy (1%).
What are the causes?
The causes of ICP are not yet fully understood, but it is likely to be due to a number of different factors, including:
- ICP only occurs in pregnancy suggesting a hormonal link such as estrogen or progesterone. Recent research has shown that sulfated progesterone metabolites (breakdown products of the hormone progesterone) are always higher in women with ICP and that these also seem to correlate with the bile acid levels. Further research is being undertaken to explore this link.
- Women expecting two or more babies seem to be predisposed towards developing the condition, as are women who have had IVF.
- ICP is more common in certain populations, including Scandinavians and South Americans
- ICP can run in families, including grandmother, mother and daughter (and may also pass down from the male side). Sisters and daughters of women with ICP have around a 14% increased chance of developing ICP in their own pregnancies. The presence of liver conditions and/or gallbladder issues in the mother’s family may be indicative of a genetic link.
- Lots of research has been done to try to establish exactly what the link is, and some genetic variation in women with the disease has been found. However, it should be emphasized that researchers are a long way from explaining all cases of ICP by means of genetic analysis.
- More women are diagnosed with ICP during the winter months.
- Although the reason for this is not clear, it suggests that there may be an environmental trigger for the condition, such as reduced exposure to sunlight or a change in diet.
How is ICP diagnosed?
To make a diagnosis of ICP, other liver disorders need to be ruled out first with either blood tests and/or liver ultra sound scanning. These other conditions may include viral hepatitis, autoimmune hepatitis and gallstones. The presence of gallstones does not necessarily exclude a diagnosis of ICP – it is possible to have both ICP and gallstones. Research shows that women with ICP have a higher chance of either already having had gallstones or developing them in later life.
- Bile acid test: Bile acids are chemicals produced in the liver to help with digestion. In ICP the flow of bile acid in the liver is reduced and they build up in the blood. A bile acid test is believed to be the most specific test for ICP. Bile acids are thought to be harmful because they may be responsible for some of the complications that could affect the baby. It is largely accepted in the literature that a diagnostic cut-off for the diagnosis of ICP ranges from 10 to 14µmol/L (fasting sample). Anything over 40 mmol/L is considered to be “severe”, and is associated with increased risk. In South Africa, bile acid may be sent to Onderstepoort (the Faculty of Veterinary Science at the University of Pretoria) for testing.
- Liver function test: This blood test looks at how well the liver is working by measuring the level of different enzymes. ALT (or AST) is the specific one that is used to help make the diagnosis. It is important to note that not all women with ICP will have raised liver functions.
The most effective treatment is still to be established, but it is believed that with active management the risk of fetal complication drops to that of a normal pregnancy. Current practice includes prescribing the medication UDCA (ursodeoxycholic acid), monitoring bile acid levels and delivering the baby at around 36–38 weeks.
- UDCA (ursodeoxycholic acid): This is believed to be a “friendly” bile acid that displaces the more harmful bile acids from the blood. Many doctors believe that UDCA helps to protect the baby from the damaging effects of bile acid as well as helping to relieve symptoms. A recent pilot trial that looked at UDCA versus placebo showed that the incidence of meconium staining was reduced in those women who received UDCA and that the ALT/AST levels improved. However, it did not show that bile acid levels were improved for a significant number of women. A further larger-powered trial is planned. UDCA is typically administered starting at 500mg per day, and rising in 500mg increments to a maximum dose of 2000mg per day. Some clinicians still adhere to the recommended prescribing policy of basing the dosage on weight i.e. 12-15mg per kg of bodyweight but in the UK where the condition is the subject of extensive research most clinicians begin with 500mg twice a day. UDCA is still unlicensed for use during pregnancy but is prescribed to women with “informed consent”.
- Rifampicin: This is a powerful antibiotic that is traditionally used to treat tuberculosis (TB). Recently it has been found to be helpful in treating ICP if UDCA is not effective. It must be given in addition to UDCA but there has been little research to evaluate its efficacy in treating ICP.
- Piriton (Chlorpheniramine): This is an antihistamine. This type of drug is used to treat itching in other conditions (e.g. allergies). There is no evidence to prove that it helps in ICP, and indeed many women would agree with this. However, another effect of piriton is that it causes people to feel drowsy, and this may help if the itch is interrupting sleep.
- Body cream with menthol: Some women report a temporary relief from itching due to the cooling effect of menthol. It is relatively simple for a pharmacist to make up some aqueous cream with menthol added (1-2% of menthol).
- Oral vitamin K: This practice evolved in the UK because clinicians hoped that it would help to reduce any risk of PPH. However there is no research to support its use although researchers in the UK will prescribe it if the woman reports steatorrhea (pale stools). There is no evidence to suggest that taking oral vitamin K is harmful to mother or baby.
Monitoring the blood:
- Both bile acid and liver function tests should be performed regularly. While liver function tests are indicative of how well the maternal liver is working, researchers believe that bile acid levels are most important in gauging the risk to the baby.
- Bile acid levels can be unpredictable and may go up and down during an ICP pregnancy. Given their association with fetal risk it is reasonable to implement a practice of weekly bile acid levels, perhaps twice weekly from 34 weeks.
Monitoring the baby and early delivery:
- Weekly monitoring from diagnosis is followed by many doctors in the UK but can vary in what it involves. However, it generally includes weekly blood tests (bile acids and liver function), with some hospitals adding biophysical profiles and Doppler flow studies.
- Non-stress tests that evaluate the fetal heart rate may be offered twice weekly, but they are only offered as a way of reassurance. The reason for this is because there have been reported cases of stillbirths 12-hours after a non-stress test was passed so there is no evidence to suggest that conducting this procedure will identify an “at risk” baby.
- Because research has shown that stillbirths tend to occur from 36 weeks the practice of early delivery has evolved. As the risk of sudden IUD (intra-uterine death) is also associated with bile acid levels (and recent research has shown a 200% increase in risk if the bile acids double for a mother who is in the “severe” category) it may be necessary to consider an earlier delivery than 36 weeks. This is a challenging decision for clinicians who have to weigh up the risk of early delivery and increased risk of the baby being admitted to the neonatal unit versus exposure to high bile acid levels and possible stillbirth. Research is currently investigating the exact mechanism for fetal death and has suggested that it is linked to the affect of bile acids on the fetal heart but further research is required before there are any definitive answers.
- Some women choose to keep a kick-chart to help monitor the baby’s movements, although there is much debate on the value of these.
Other things that may help:
- There is no research to suggest that reducing saturated fats in the diet will help but as all women are advised to follow a healthy diet in pregnancy and saturated fats are not of any nutritional benefit it makes sense to let women know this.
- There is no research that suggests that rest and relaxation can help with the condition but it may help women to be able to cope with the psychological impact of having ICP.
- Some women report that cool clothing helps with the itch, as does applying an icepack to the affected area (but these need to be applied carefully to prevent any ice-burns).
- ICP can be a distressing condition, and many women feel depressed and anxious, which is exacerbated by lack of sleep due to itching. Just being able to talk to someone about this may help her feel supported. Referring women to specialist organizations such as ICP Support that has the benefit of having some trained counselors in the team may help. ICP Support is a science-based charity that also offers support via the phone, Facebook groups and an online forum. They can also be contacted via email.
What happens after the baby is born?
- Usually the condition resolves within 48 hours of delivery, but it can take several weeks for the itching to disappear completely.
- Around 6-12 weeks postpartum (although it can take longer for everything to settle), the mother’s liver function and bile acid level should be checked to confirm that it has returned to normal. This is important, as there may be an underlying liver condition that has caused the itching and abnormal liver readings during pregnancy. If this is the case and the mother’s bloods have not improved after several months she should be referred to a hepatologist (liver specialist) or gastroenterologist who has a special interest in the liver for further investigation.
- It is worth noting that some women report a return of ICP symptoms post-partum when using hormonal contraceptives, in which case alternative contraceptive methods may be discussed. It may be a case of trial and error, as what works for some women may not work for others.
- Some women experience “cyclic itching” during ovulation or at the start of menstruation. It generally only lasts for a few days and is not as intense as the itching experienced during an ICP pregnancy. There has been no research to explain why this happens, but current thinking suggests that it happens because the liver has been left ‘sensitive’ to hormone fluctuations.
- Some women have reported that they experience itching again in times of extreme tiredness and stress, but the reasons for this are not yet known.
Will ICP reoccur?
Reported recurrence rates vary, with some researchers stating 60% and others up to 90%. What is known is that women who have ICP in one pregnancy are very likely to develop it again in a subsequent one.
More information and support
All information in this article was sourced from ICP Support, a UK-based charity who are involved with research into the condition, and who are linked to ICP specialists. Other information and current research papers can be downloaded directly from their website. For more information, please visit:
Facebook group: www.facebook.com/groups/icpsupportsa | <urn:uuid:1666b3ad-b793-4966-b995-60aa4c755d44> | CC-MAIN-2022-33 | https://www.expectantmothersguide.co.za/itchy-it-could-be-intrahepatic-cholestasis-of-pregnancy/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.963911 | 2,915 | 2.515625 | 3 |
Looks like Russia has outwitted the EU yet again.
Gazprom’s bid to tap into a pipeline meant to wean Europe off Russian gas threatens to undermine a pillar of European energy policy and slow plans to develop rival deposits in the east Mediterranean.
This article outlines how Russia plans to make use of the new Trans Adriatic Pipeline (TAP) – which was intended as a means to reduce Europe’s reliance on Russian gas.
Unfortunately, EU ‘experts’ failed to spot a flaw in the plan to allow any company to bid to fill capacity in the expanded pipeline. Gazprom’s Alexander Medvedev said recently that the company was considering pumping gas through TAP;
“That would be very bad,” one EU official said. “It would be totally contrary to everything we have agreed with partners.”
Having prevented Russia from expanding gas exports via the South Stream project it’s not surprising that they see TAP as an alternative route into Europe’s lucrative gas market. But as usual with the EU, they haven’t grasped the full impact of their meddling;
EU sources said Russian gas flows via TAP may jar with the terms set by its financial backers, such as the European Investment Bank. The bank said it is carrying out due diligence.
At most, officials say they could extend an exemption from EU anti-trust rules to TAP in order to keep Gazprom out, but Brussels would require the firms and governments concerned to initiate the move.
And as usual, the EU’s solution is more regulation and red tape to cover up their failures. | <urn:uuid:cce5ab3c-cdfe-4e09-87b5-692032d23682> | CC-MAIN-2022-33 | http://crosslaneengineering.co.uk/tag/tap | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.962894 | 341 | 2.328125 | 2 |
Lets stop nangs in our community!
We the undersigned community members are concerned about the increasing use of Nitrous Oxide bulbs or “Nangs” by the youth in our community. While Nitrous Oxide has a legitimate purpose, either as an Anaesthetic for mostly dental services or for cake decorating, our children and young people are using them to get high.
The use of Nitrous Oxide is associated with a range of potential harmful effects, including:
- Reduced blood pressure;
- Fainting, heart attack and hypoxia;
- Memory loss, significant reduction in vitamin B12 stores;
- Damage to the spine, anaemia, incontinence;
- Numbness to extremities, limb spasms and weakened immune systems; and
- Birth defects (when used during pregnancy).
At present many would be surprised to know that there is very little regulation on the supply of Nitrous Oxide. It can be ordered by any person, even juveniles and can be delivered to a person’s home at any time, day or night. This needs to stop.
Nangs also have a negative impact on our environment with users discarding the empty bulbs anywhere they see fit. This has an adverse effect on our waterways, local parks and playgrounds. Not to mention young children in our community finding great piles of discarded bulbs.
We believe more needs to be done to address the sale and use of the Nitrous Oxide bulbs or ‘Nangs” that is disproportionally affecting the youth in our community. | <urn:uuid:b7fc9937-f19d-460c-b686-659ada988fec> | CC-MAIN-2022-33 | https://jessicastojkovski.com.au/community/petition-lets-stop-nangs-in-our-community/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.954966 | 323 | 2.640625 | 3 |
iFixit just finished a teardown of Apple’s new 13-inch retina MacBook Pro, and the findings are a mixed bag of good and bad news for folks who like to fix their own gear. Compared to the 15-inch retina MacBook Pro, the smaller model should be marginally easier to tinker with. But it’s still pretty much impossible to repair.
Remember how the battery in the last 15-inch retina MacBook Pro was glued into place? Well, this time around, Apple’s placed some of the cells into a metal tray held into place with screws — iFixit managed to remove all six battery cells without destroying the anything. There’s hope there, at least, for a replacement.
But that’s where the good news ends. The iFixit teardown reveals that the new Pro is locked up by the same proprietary petalobe screws that’ll keep you from opening it up, the RAM is soldered to the logic board so you can’t upgrade the memory ever, and the display assembly is basically impossible to deconstruct, which means that you can’t fix a cracked screen yourself. So much for self-sufficiency. if you were wondering if you should get Apple Care for your shiny new MacBook, the answer’s almost definitely yes. [iFixit] | <urn:uuid:5b809433-136c-4142-abcf-9aca320fb9dc> | CC-MAIN-2022-33 | https://www.gizmodo.com.au/2012/10/13-inch-retina-macbook-pro-teardown-at-least-the-battery-comes-out/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.938281 | 280 | 1.664063 | 2 |
Traveling in an RV can be a lot of fun; you'll always have a place to stay no matter how crowded the hotels may be wherever you go. But traveling in one of these vehicles can also mean having some questionable power supplies if you have to boondock, or stay outside an RV park that provides power. RVs can be rigged to be nearly self-powering; you'd still need gas to drive it, but solar panels can provide a lot of the electricity you'd need to run the appliances inside.
If you enjoy camping but miss some of the creature comforts you have access to at home, there are a few accessories you can invest in that will turn your next camping trip into the ultimate glamping experience. Here are a few important items to consider adding to your camping gear setup:
A Portable Solar Generator
One of the most important accessories you'll need to ensure that your glamping experience is successful is a portable solar generator.
Two important steps to prevent the waste of energy in your home are to increase insulation and stop air leaks. New homes are constructed with superior insulation so they are usually very energy efficient. If you live in an older home that hasn't been renovated, it probably wastes a lot of energy, and that means your power bills are higher than they need to be. Consider these suggestions for making your older home more energy efficient:
All propane tanks are not the same. Failure to understand this could result in you having a tank that is not equipped to meet your needs. To avoid this and ensure you're paired with a tank that meets your needs, learn what you should look for when searching for a new propane tank.
Begin your search efforts with a focus on size. The size of the tank will have a lot to do with its function.
When you're ready to make the transition to solar power, it's a great investment. However, you need to be sure of what you're getting and how many solar panels you'll actually need. Before you make the investment and find yourself with insufficient panels for the energy you need, take some time to do some calculation. Here's a look at what you need to think about.
How Much Power Do You Use? | <urn:uuid:597dac26-5aa4-46e7-97d7-f61444d13871> | CC-MAIN-2022-33 | http://www.pak-economist.com/year/2017/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.969226 | 453 | 2.03125 | 2 |
According to the Centers for Disease Control and Prevention, approximately one in 50 school aged children in the United States have some form of Autism. As these statistics continue to rise, researchers have been hard at work trying to find a cause for the disorder.
For the most part, researchers have been battling a nature vs. nurture argument for some time. Some believe that autism springs from environmental causes, while a larger camp believes that the disorder is rooted in genetics.
But researchers at the Cold Spring Harbor Laboratory (CSHL) have uncovered compelling evidence that is strongly in favor of genetics being the cause of autism spectrum disorders (ASD).
For the study, the researchers at CSHL studied mutations of genes that develop in the beginning of a child’s life — these are called “de novo likely gene-disruptive mutations,” or LGDs. The researchers studied how these LGDS occurred, and furthermore, how these genes become vulnerable and contribute to the development of ASD.
So far, LGDs have been a leading contributing factor in the development of ASD in the eyes of many autism researchers.
In addition to their vulnerabilities, researchers also investigated how these gene-disruptions were passed on from generation to generation.
Interestingly enough, researchers found that the mutated genes that usually lead to the development of these autism spectrum disorders are actually less mutated than the majority of other human genes. This is surprising, considering the widely accepted notion is that the more mutated a gene is, the more it affects a person’s health.
Ivan Iossifov, biologist and assistant professor at CSHL, believes he has an answer. Usually, individuals with severe autism don’t tend to reproduce. This stops the gene from mutating any further and from being passed down.
Given this knowledge, the researchers were able to discern which LGD genes can be considered “autism genes” and which are not. They have now narrowed the list down from 500 genes to 200 genes. | <urn:uuid:a2db180a-8217-4457-90aa-5c9390f1111c> | CC-MAIN-2022-33 | https://dailyobjectivist.com/new-research-gives-credence-to-genetics-role-in-autism-development/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.961384 | 407 | 3.515625 | 4 |
Date of Award
Master in Interior Architecture [Adaptive Reuse]
Academics often overlook the importance of a balanced life and even encourage a competitive work environment. However, life balance, health and mental wellness have strong influence on academic performance, social relationships and even life satisfaction. Working environments matter, too: lack of natural light and ventilation, noise and lack of privacy often contribute to elevated levels of stress, anxiety and depression. In the case of students from the Rhode Island School of Design, most devote almost all time to work without satisfying the body’s need for rest. However, studios do not integrate spaces for relaxing, resting and refreshing and do not fulfill students’ physical and mental health needs. To address this problem, it is necessary to have a dedicated space that offers wellness in terms of spatial characteristics as well as program in order to support balance within the RISD campus.
Many universities in the US have developed student wellness centers to provide help through different kinds of programs, including student support service, stress reduction, mindfulness programs and a place for private moments such as meditation room and chapel, in order to enhance total wellness. RISD currently offers physical, mental and intercultural services; however, these do not cover all of the key aspects of wellness affecting RISD students. Moreover, the inconvenient and scattered locations of these services don’t provide adequate natural light, comfort or privacy, reducing the effectiveness of offerings. What qualities of space engender wellness and how can we present wellness in architecture through a new student wellness center within the RISD campus?
Located at the center of campus, the 15 Westminster building is a good place to have a one-stop student wellness center within the RISD campus. Students live, visit and pass around this prominent building everyday, so RISD students who have limited time do not need to struggle to get to the wellness center. The RISD studen t wellness center will offer various spaces including an indoor running track, student lounge, rooftop garden and non-denominational worship space on the penthouse floor. Counseling rooms and group activity space will be placed on the mezzanine floor so that RISD students can ease their exhausted bodies and minds in a variety of ways. Furthermore, these spaces are well connected and will provide essential qualities of space such as plenty of natural light, high ceiling and a lively atmosphere. This thesis proposes a new student wellness center in which essential health and wellness resources are brought together under a single roof, highlighting the uniqueness of the RISD campus through the juxtaposition of an existing building with a floating addition in the sky.
Kang, Kyunghwa, "Wellness within reach : life / work balance within the RISD campus" (2017). Masters Theses. 173.
Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-No Derivative Works 4.0 International License. | <urn:uuid:e64fa94e-0bf5-4e90-84d2-69414da27292> | CC-MAIN-2022-33 | https://digitalcommons.risd.edu/masterstheses/173/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.92367 | 659 | 2.046875 | 2 |
In March 2020, stay-at-home orders were issued for the general population to limit the spread of COVID-19. At the same time, nursing homes restricted visitation to only non-essential personnel. At first, we all had specific expectations that the health crisis would be temporary and our “normal” would shortly return. However, as the crisis continued to move forward and restrictions have relaxed, the elderly population is still under isolation orders due to the higher risk of becoming ill and a higher likelihood of not recovering.
Most of this population finds their social interaction through families, religious services, and circles of friends. For this reason, we must find alternative ways to interact. Social isolation can trigger mental health problems such as depression, loss of motivation, poor appetite, and becoming withdrawn. And in some cases, these declines can often be difficult to reverse.
Isolation Does Not Have to Mean You Are Alone
This is the time to become creative and to let them know that they are loved, important, and needed. Here are some tips to show your support:
Don’t overload on the news. Take time to relax and take up hobbies that both you and your loved ones can enjoy.
Try to limit appeasing your loved ones by saying “It will be ok” or “This will too pass”. This is difficult time for all and even though you cannot see them in person, you can still be with them.
If they don’t already have one, provide them with a video-capable device to set up FaceTime, Zoom or other type of video communication. Use it regularly to stay connected and tell them they are welcome to call you whenever they need.
Set up live stream religious services, entertainment services, or lectures that interest them.
Don’t just talk during the live stream sessions. Sing, play a game, read a book, this is a time to be creative. Help them feel that they are part of an activity.
Try to encourage them to increase outside activity if they are able to.
Most importantly, listen to their concerns. Be cognizant of their feelings and be there when and how you can.
If you would like to speak with us about hospice services: | <urn:uuid:2c23203d-db25-40e1-8c9d-6d134e63a65f> | CC-MAIN-2022-33 | https://granehospice.com/tag/telecommunications/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.971605 | 463 | 2.0625 | 2 |
What are Unlisted Shares?
Unlisted shares are speculations into portions of organizations or resources that are not exchanged on the open market. They are additionally some of the time alluded to as unquoted speculations.
The organizations being referred to are commonly little yet with aggressive designs for quick development and need shares to take their business to the following level. As they are viewed as high-hazard by customary money related organizations, accounts can be difficult for them to get. One arrangement is a private value from singular speculators and assets put straightforwardly in the organizations. Buy unlisted shares and unlisted equity shares from Babli Investments.
The Advantages of Unlisted Shares:
Putting resources into new businesses conveys critical dangers, however quite possibly it could end up being the following Facebook or Google.
There are likewise charge motivating forces to support high total assets people to put resources into unlisted organizations, despite the fact that the passing sums contrast between the two plans referenced beneath.
Undertaking Investment Scheme (EIS):
The Enterprise Investment Scheme shares annual assessment and capital additions charge reliefs to speculators. Singular personal duty help of 30% is offered under the EIS conspire.
High development investment: Often unlisted firms are littler in size and are yet to arrive at a phase where they can open up to the world to benefit assets for their capital necessities. Thus, contributing when the organization is little and being contributed through its development when it records on value markets, frequently yields significant yields inferable from little base impact.
diversification of risk: Unlisted value shares are an alternate resource class without anyone else and therefore offer some enhancement of danger for financial specialists who significantly put resources into recorded value markets.
Seed Enterprise Investment Scheme (SEIS):
Like the EIS plot, the Seed Enterprise Investment Scheme shares annual duty, and capital increases charge reliefs to financial specialists. Singular personal duty help of half is offered under SEIS.
One more advantage of putting resources into Unlisted Shares:
The personal duty (IT) office said that pay from the move of unlisted shares will be sorted as capital increases, regardless of the holding time frame. The explanation is a continuation of the assessment office’s endeavors to diminish cases and different debates and get a uniform way to deal with the characterization of salary.
The current declaration is positive for speculators putting resources into unlisted shares as surveys can guarantee the salary as capital increase rather than business pay. Capital Gain on special unlisted securities that qualify as the present moment is available at 15%. Capital increase at a bargain of unlisted protections pulls in a drawn-out capital addition charge at the pace of 20% with indexation advantage. Business pay, then again, is available on piece rate which can be as high as 30%, that too without indexation.
In February this year, the duty officer had given a comparable explanation with respect to the order of salary emerging from the move of recorded shares wherein it had said that an assessee could characterize pay from an exchange as capital increases following a year.
Be that as it may, the expense division has recorded three special cases wherein this explanation won’t be material. It won’t have any significant bearing in situations where the validity of exchanges in unlisted shares is flawed, where an issue of lifting the corporate shroud emerges and where there is a move of control and the board, the CBDT said in a notice.
The risk of Unlisted Shares Investment:
Loss of capital contributed:
Putting resources into a startup is innately hazardous the same number of fall flat, so speculators should be monetarily ready to assimilate any misfortunes and put resources into unlisted ventures as a component of a broadened portfolio.
Powerlessness to exchange shares on the open market:
As the offers are not exchanged on the open market, unlisted speculations are for the most part profoundly illiquid. Financial specialists may possibly have the option to sell their offers when the organization accomplishes an effective exit by means of a deal or buoyancy – maybe numerous years in the wake of making the underlying speculation.
Probability of weakening:
Financial specialists may find that as the unlisted organization develops, it will require extra funds. Consequently, extra offers will be given subsequently decreasing the level of the organization possessed by existing investors and weakening their property.
Unlisted organizations are not obliged to deliver profits to investors or in the event that they do, they might be inconsistent. Rather, numerous little organizations decide to reinvest benefits in the business to encourage further development.
Elective approaches to make unlisted investments:
Just as immediate interest in an unlisted organization it is likewise conceivable to contribute through an EIS store or SEIS finance. These are overseen speculation vehicles that raise accounts from people and foundations to contribute over an arrangement of EIS or SEIS-qualified organizations. This can be a route for financial specialists to spread danger over a few such organizations. Babli Investment has the best list of Unlisted shares such as CSK shares in India.
These assets are generally overseen by experienced people with the objective of restoring a benefit which is then mutual by each one of those putting resources into it. The equivalent EIS and SEIS charge reliefs apply in the case of contributing by means of a reserve or making immediate speculation.
Funding Trusts (VCTs) additionally offer financial specialists charge reliefs. They work likewise to EIS and SEIS reserves, permitting people to spread their venture over various little higher-hazard exchanging organizations which are not recorded on a perceived stock trade. | <urn:uuid:663e2ee7-08e9-44f3-ae9f-86bc64605d79> | CC-MAIN-2022-33 | https://www.babliinvestment.com/benefits-of-investing-in-unlisted-shares-instead-of-listed-shares/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.951171 | 1,151 | 1.976563 | 2 |
How To Change the Oculus Quest 2’s Batteries
The Oculus Quest 2 has a rechargeable battery in its headset that might begin wearing out over time. You may find that you need to charge it more frequently and can’t use the headset for long. Alternatively, the controllers might stop working altogether, which is usually due to drained batteries, which don’t come with built-in chargers.
Whichever of these problems has happened to you, it’s time to consider replacing the batteries. Here, we’ll address the issue of replacing your Quest 2 headset and controller batteries, getting you back to optimal performance. Let’s get started.
Changing the Batteries
The Quest 2 is powered by a built-in rechargeable lithium-ion battery. This battery pack is charged using a USB-C cable like other modern tech. However, the controllers aren’t equipped with the same integrated battery. They have a single AA battery, which should run for a decent amount of time before needing to be replaced or recharged separately. Here’s what you need to know about replacing these sets of batteries.
Changing the Headset Batteries
Devices with rechargeable batteries are prone to having power issues. For example, the batteries may get weaker over time, which means they’ll have to be recharged more frequently. This can be frustrating when gaming because you won’t be able to use them continuously for a long session. When this happens, you might consider replacing the rechargeable battery pack.
Changing the Oculus Quest 2 headset batteries may not be a straightforward task, especially if you don’t have a lot of knowledge about electronics. Changing these batteries yourself could also void your warranty and put you at risk of injury. You don’t want to put on a VR headset with a faulty power source.
It’s advisable to have the batteries replaced by the manufacturer, especially if the device is still under warranty. Get in touch with Oculus through their support page and submit a ticket requesting a battery change. They will get back to you within two days with information on how to proceed.
Fortunately, the Oculus Quest in-built battery pack is designed for heavy usage. It should last you a long time before there’s a need to replace it.
Changing the Controller Batteries
Unfortunately, the Quest 2 controllers don’t have in-built batteries. Instead, they each have a single AA battery that can’t be charged using the USB cable. These batteries will have to be replaced or charged via battery chargers once they run out of juice.
The Oculus controllers have a battery compartment that many users find challenging to locate. It’s hidden away in the controller grip with a small eject icon giving away its location. Check out how to replace the Oculus Quest 2 controller batteries.
- Hold the controller with the eject icon pointing up.
- Apply a little pressure and slide the battery recess cover upwards.
- With the cover off, remove the battery and replace it with a new one.
- Slide the cover in place and repeat the above steps for the second controller.
If you have rechargeable AA batteries, you can put them in a compatible battery charger and have two sets of interchangeable batteries at all times to minimize downtime. This is an eco-friendlier option since decomposing batteries are extremely toxic to the environment. There is also a push towards recycling options, such as California’s ban on tossing alkaline batteries with other domestic waste.
How to Check Controller Battery Level
Oculus Quest 2 controllers have excellent battery life, but it doesn’t hurt to check the level every once in a while. This will prevent the disappointment of your controllers running out of juice during a gaming session. Let’s look at how to verify the battery level.
- Open the Oculus Quest 2 home screen.
- Navigate to the menu and locate the battery section.
- Check the battery levels of the headset and each controller.
The battery level section might not be accurate for degraded rechargeable batteries. If a recharged battery is reporting a relatively low charge, it might be time for a permanent replacement.
How to Charge the Controllers With Rechargeable Batteries
The Oculus Quest 2 controllers are powered by AA batteries, and there’s no way to change that. That means that you can’t recharge them using a USB cable like you would the headset.
However, you can use a charging dock to get the job done. Keep in mind that the batteries that come with the initial Oculus Quest 2 purchase are disposable. To use the charging dock, you need to invest in higher-grade rechargeable AA batteries compatible with the dock. You should research the dock you’re planning to buy to see which batteries to use.
Anker, an electronics company that specializes in batteries, has designed a charging dock you can use with your controllers. The Anker Quest 2 Charging Dock allows for the wireless charging of the headset and controllers. You won’t even have to remove the battery cover when juicing up the AA batteries.
BeswinVR is another company that offers charging solutions for Oculus Quest 2 controllers. It has a magnetic charging port that you can use to charge the batteries using a USB cable.
Give It Some Juice
The Oculus Quest 2 is a popular VR device that allows users to immerse themselves in an online universe. The headset and controllers come equipped with batteries designed for heavy usage. Nevertheless, they eventually get drained. Running out of battery power halfway through a gaming session can be particularly frustrating. Therefore, it’s essential to check the battery level regularly and learn how to replace them as well. This guide teaches you all you need to know about changing your Oculus Quest 2 batteries.
Have you changed your Oculus Quest 2 batteries? How did you go about it? Let us know in the comments below. | <urn:uuid:5d6ae3ec-8a0b-456b-a570-0fc44c451181> | CC-MAIN-2022-33 | https://www.alphr.com/change-batteries-oculus-quest-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.931181 | 1,227 | 1.609375 | 2 |
Woohoo! Congratulations you are going to be mommy soon. Anxious what your pregnancy diet should be like? So was I! Pregnancy diet plays an important role for the growth and the development of the baby. I still remember my mom, aunts and even my neighbours giving me advice for the best pregnancy diet. All adding to my confusion. And oh God, that morning sickness and nausea! Many times I was not able to eat the entire day. Sounds like you? Then keep on reading further to know more about the Indian pregnancy diet for the first trimester.
Foods that must be Part of Pregnancy Diet
The most crucial nutrients that you require during the first trimester are folic acid, iron and vitamin B6. Your gynaecologist will give you folic acid and vitamin B6 supplements. So please don’t think that these supplements will be enough. You need to eat foods rich in folic acid, iron and B6 as well. For first trimester, your pregnancy diet should include dried fruits such as apricots, figs, prunes and raisins. Citrus fruits, dark leafy greens, beans, peas, lentils, legumes, okra, broccoli, soya. Also, raw coconut slices are abundant in nutrients. Especially the bananas, potatoes are good sources of B6.
Ginger and vitamin B6 may reduce nausea and vomiting for few ladies. Morning sickness is common and you will feel dizzy and really awful. And the worst part is that you will not able to eat anything. Although you want to. When I was in my second month, this is how I felt.
Whatever I put in my mouth, I used to vomit. Finally I came to know the three awesome solution. First, ginger, one of the best home remedy for morning sickness. Second, eating at regular intervals. Third, say no to caffeine(chocolates, tea and coffee). However, if you are addicted to your tea/coffee, please try to limit it to one cup per day. If your condition is like me, just eat what you like. Mind it – it has to be healthy. Always listen to your body. Stop eating if you don’t feel like eating anymore.
Spread out your Pregnancy Diet
I felt a lot more better and active when my diet was spread out through the day. You may have a look at the chart that I followed for my pregnancy diet. After an hour of having lunch it is advised to have an afternoon nap for a healthy mom and a healthy baby.
On looking at the chart, you will find that you have to eat after every two to two and a half hours. You can always add another mid meal as per your requirement. You may add it either before lunch or after lunch, with a gap of minium one hour. For this mid meal’s options, choose anything from that particular time meal. Another important thing to keep in mind is that if a option is given for morning mid meal, you have to eat it in the morning. The same goes for the evening mid meal and not vice versa. The timing of the meals are designed as per the ayurveda, keeping in consideration the body’s digestion. One more thing, please do not overeat. Always listen to your body and stop eating when you are full. It is fine if the food is left on your plate.
This chart will help you to have frequent meals. Thus, relieving the morning sickness and nausea! In the beginning of the article, I have given you few examples of the foods that must be part of the pregnancy diet. You have to include these foods, especially in your first trimester, wherever you see fruits/veggies/dals in the chart. It is completely fine if you don’t feel like eating a particular item. You don’t have to force yourself. Just eat whatever you feel like eating from the given options. Keep in mind – it has to be a healthy meal.
Foods to Avoid and Not to Avoid
Always remember, the pregnancy diet is a strict no to papaya and pineapple. No to ghee, but have homemade butter. Buttermilk forms an awesome nutritious drink. No to pickles, yes to murabbas like that of gooseberry(amla) ka murabba. In addition to this, always lay emphasis on the quality of diet. Along with the beat pregnancy diet, you need to stay active and have a healthy pregnancy. For this you may read How can You Stay Healthy and Active during Pregnancy.
Those of you are non-vegetarians, stick to chicken, avoid its liver. If you are a fish lover, make only low mercury fish as a part of your pregnancy diet. Also, you may eat these fish upto 2 times a week. High mercury fish include mackerel, bluefish, grouper(kalava in Malayali), sea bass(bhekti), tuna(ahi), shark and swordfish. Pregnant women are extremely sensitive to infections. Furthermore, the bacteria and viruses may threaten the well-being of the forthcoming baby. So please avoid any raw or undercooked or processed meat as these contain harmful bacteria. Don’t eat too much of red meats.
As a nutritionist, it is advised not to drink any of the packed juices or have biscuits. I preferred having the whole fruit. And ate homemade cashew coconut cookies made from whole wheat flour. Sometimes, 1:1 wheat:ragi flour. Nowadays my son loves to have them. And yes, most importantly remember always to eat freshly prepared meals.
Have a Healthy and Happy Pregnancy! | <urn:uuid:09ca9a0d-5f65-46ff-a0ab-d23435337060> | CC-MAIN-2022-33 | https://itshealthymoms.com/index.php/2018/04/03/pregnancy-diet-indian-first-trimester/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.955246 | 1,179 | 1.632813 | 2 |
Troia Cathedral (Italian: Concattedrale di Troia; Cattedrale di Santa Maria Assunta) is the cathedral of Troia in Apulia, Italy, dedicated to the Assumption of the Blessed Virgin Mary. Built in the first quarter of the 12th century, it is reckoned a masterpiece of Apulian Romanesque architecture and is particularly noted for the rose window and the bronze doors of the west front. Formerly the seat of the Bishops of Troia, it is now a co-cathedral in the diocese of Lucera-Troia.
Location and dedication
The church is located in the centre of Troia on the Via Regina Margherita. The principal façade, orientated to the north-west, looks onto a small forecourt. The dedication to the Assumption of the Virgin Mary was taken over from the predecessor building, which has been partly incorporated into the present structure.The following Latin inscription is located on a wall of the Chapel of the Patron Saints: Felix antistes dom(i)nus Guillelmus secundus fecit hanc aede(m) D(e)o ac beatae Mariae vobisq(ue) fidelibus felices troiani
A Byzantine church formerly stood on the site, apparently constructed largely from the remains of Roman buildings. Work on a new cathedral began in the last quarter of the 11th century. The year 1073 is often given but the exact date of the start of construction is in fact unconfirmed. Excavations in the 1950s were at one time believed to have established that the present transept was originally the nave of the previous church building, but this is now contested. It is however certain that the cores of the two western pillars of the crossing date from the very first building phase, and possibly served the same purpose in the original church.The church received its present groundplan however in the first quarter of the 12th century through the substantial enlargements of Bishop William II of Troia, who from 1093 had the present nave built. The construction of the present apse may well also date from this period. An inscription on the bronze doors of the main portal indicates that this was finished in 1119, by which time the construction of the nave was clearly more or less completed. In 1107 work began on the lower part of the west front. Further works, particularly on the upper part of the west front, took place in the 13th century. The sacristy and the two arms of the transept received their present form in the 17th and 18th centuries; the eastern arm of the transept still contains older material in its external walls. The present bell tower also stands in part on walls of the 11th century.
West front and rose window
The west front of the cathedral is richly decorated. The lower part was built as part of Bishop William's works that took place between 1107 and 1120; the upper part was redesigned about 100 years later., but was overhauled, while retaining the older work, from 1229.The lower part of the west front is 19 metres wide and divided into seven parts. To left and right of the main portal are three blind arches, supported by pilasters with varying forms of capital. The central blind arches on both sides each contain a round window, while the flanking arches are worked in a lozenge pattern. Like the external parts of the nave, which also follow this basic structure, they are very finely worked in a variety of building stones. The construction of the church exterior is thus held to be unusually ornate for Apulia.The main portal itself is outlined by a simple archivolt. In the architrave is a relief showing Christ in the centre accompanied by Mary to the left and Saint Peter to the right. Beyond them on either side are two of the symbols of the Evangelists, and on the outside the patron saints of the town, Saints Eleutherius and Secundinus. Along the lower edge of the relief is the Latin inscription Istius ecclesiae per portam materialis introitus nobis tribuatur spiritualis ("Through the door of this material church may there be granted to us the entry to the spiritual").The upper part of the west front, up as far as the top of the rose window, dates from the period up to about 1180, while the point of the gable and its outermost surfaces are from the alterations at the beginning of the 13th century.
The rose window is famous as one of the most beautiful in Apulia. It consists of eleven slender columns assembled in a wheel, the spaces between them filled with decorative carved stone grilles (transenne), a very rare form of the rose window. Each transenna is differently worked, and some have an Oriental effect. The surround consists of overlapping arches, with the interstices pierced by trefoils. Also remarkable are the carvings of the inner of the two arches overhanging the window, consisting of a multiplicity of animals and human forms, among them a boy relieving himself. These arches are supported by double columns on the backs of lions.
The famous doors of the main portal were made by one of the most celebrated bronze-casters of the 12th century, Oderisio of Benevento; according to the inscription, they were finished in 1119. They contain 28 panels in niello work. The door knockers in the mouths of lions and the small figures of winged dragons, representing fear and desire are the originals, little masterpieces of medieval sculpture. Many of the panels were replaced during the 16th and 17th centuries, but the four along the top row are still the originals. They depict, from left to right: the artist, Oderisio; Christ in Judgment; Count Berard of Sangro; and Bishop William II. The inscription on the four panels below reads as follows:
(1) An[n]o ab incarnatio[n]e/d[omi]ni n[o]stri Ie[s]v Xr[ist]i mil[e]simo/centisimo nondecimo/indictione dvodecima
(2) Anno pontificat[us] d[omi]ni/Kalisti P[a]p[e] secvndi p[rimo]/ann[o] dvcat[us] W[ilelmi] Rocerii/clo[rio]si dvcis filii nono
(3) Willelmvs secvnd[us]/hui[us] Troiane sedis ep[i]s[copus]/erat svi an[no] XII has/portas fieri fecit
(4) DE PROPRIO ECCLESIAE AERARIO IPSAMQUE FABRICAM A FUNDAMENTIS FERE EXIT(The fourth panel and its text were restored in the 16th century, as a note on the plate indicates.)
This translates as:
(1) - In the 1119th year from the incarnation of Our Lord Jesus Christ and in the twelfth indiction /
(2) - In the first year of the pontificate of the Lord Pope Callixtus II / and the ninth year of the rule of Duke William son of Roger the Glorious /
(3) - William the Second, who was bishop of the See of Troia, in his twelfth year caused these doors to be made /
(4) - From his own wealth for the church and the fabric of the same to be raised almost from the foundations.On the capital of the left-hand column are carved a ram, a goat, a dog and a damned soul. On the capital of the right column are carved the Tree of Life, ripe fruits, and a blessed soul.
These doors served as models for those of the cathedrals of Foggia and of Termoli.
Also by Oderisio of Benevento is the door in the portal on the south side of the cathedral. The inscription begins in the uppermost panel with the opening words: Princeps patronv[m]/Petre Troia[m] suvspice/donv[m], qua[m] leta/bvndvs Gvilelm[us]/dono svndvs, which records the gift by Duke William of the city of Troia to the Apostle Peter. Next to it is a depiction of the bishop next to the town, between Saints Peter and Paul. The next eight panels contain representations of the previous eight bishops, who have been strikingly individualised. The row below contains more door knockers in the mouths of lions, beneath which follow a further eight panels with a long inscription, recording that the people of Troia, in order to recover their freedom after the death of Duke William, destroyed the castle and fortified the town with a wall and a ditch, in the time of Bishop William, who describes himself as the guardian of justice and the liberator of his country.This door is noticeably simpler in style than the doors of the main portal.
Sides and apse
The north and south exterior walls display a continuous series of blind arcades supported on pilasters and containing rectangular windows alternating with round-arched windows and blank spaces. The north side has better-developed capitals on the pilasters, however, and the blind arcades are sometimes decorated with reliefs.
The tympanum over the portal on the north side contains a relief of Christ between two angels, over a richly decorated architrave. The style of the relief points to Byzantine influences.
The exterior of the apse is of particular interest. It is semi-circular and consists of unusually deep blind arcades constructed out of conjoined pillars. The capitals and bases are extremely richly carved with human figures, animal figures and foliage. The apse window is supported by figures of lions. It is supposed that the pillars and capitals were pieces of booty taken by Robert Guiscard from Bari and presented to Troia in 1073.
The church is built on a Latin cross plan and contains a central nave, the height of which is perhaps the most striking feature of the interior, and two side-aisles separated by two round-arched arcades of 6 marble columns each. The forms of the capitals vary, but most are of the Corinthian Order. The first column to the west is a double column, the only one in the building, thus making a total of 13 columns. There is no ceiling, leaving the construction of the roof above the massive corbels open to view. The nave is not precisely symmetrical: at the crossing the central axis deviates a few degrees to the north, as can be seen by the difference in the distances between the north and south columns at the crossing.The pulpit is located between the fifth and sixth columns on the north side. It is supported by small columns with strongly worked capitals of the Corinthian order. It dates from the Norman-Staufer period of Apulia, and is reckoned as one of the masterpieces of the period. It originally stood in the Basilica of San Basilio in Troia and was not moved to the cathedral until 1860. According to the inscription that runs round it, it was built in 1169. At the front, supported on a single small column, is a lectern on the back of a Staufer eagle, which is striking at a hare. On the left side is a relief showing a lion attacking a sheep while itself being attacked by a dog, an ancient Oriental motif. The disparity of the various elements strongly suggests that the pulpit was assembled from already existing parts that were to hand.
The cathedral treasury contains some important medieval artworks, among them three Exultet rolls as well as equipment and robes for the Mass. | <urn:uuid:87a2d501-27e8-47a3-9213-a1d5bc49fda4> | CC-MAIN-2022-33 | https://www.dguideapp.com/guide/details/Troia%20Cathedral.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.953751 | 2,508 | 2.390625 | 2 |
College: Is It Worth the Debt?
There are a lot of things Alan Collinge wishes he had known before he took out a private student loan to attend the University of Southern California. After missing a single payment, Colligne's original $38,000 loan was pelted with fees and charges. Within 14 months, his debt ballooned to $80,000.
Collinge's 3,000-plus member website, StudentLoanJustice.org, acts as a host for stories like his, many from people who have defaulted on their student loans and are struggling to pay them back.
Through his website and book The Student Loan Scam, Collinge hopes to pressure Congress to restore standard consumer protection on student loans. "There is no bankruptcy protection, no statutes of limitations, and there is a very predatory collection system waiting to pounce when you default," he says.
After all he's seen, Collinge's advice is to stay away from student loans altogether. "My first piece of advice is don't borrow. Period," he says. "I think it's a difficult goal to reach, but I think it's a very wise goal to set for oneself."
If student loans are a must—like they were for the 67 percent of students who graduated with debt last year—Collinge says to be shrewd. "Invest a real, significant amount of time to do any sort of cost-benefit analysis they feel is necessary with their parents, counselors or whoever else," he says." The time that they spend now could save them literally a lifetime of financial woe." | <urn:uuid:6f1bc7ae-e00f-43d5-821f-230add1a2054> | CC-MAIN-2022-33 | https://www.oprah.com/money/college-is-it-worth-the-debt/3 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.985811 | 324 | 1.90625 | 2 |
The Somali language has a new word to describe autism thanks to the efforts of a group of Minnesota medical professionals, people with autism, and parents.
One of those parents is Anisa Hagi-Mohamed, an artist and advocate from St. Cloud who has two children with autism. She joined host Tom Crann to talk about how this came about and why it's needed.
Hear the full conversation by using the audio player above or reading the transcript below. It has been lightly edited for clarity and length.
So a word for autism or a phrase didn't really exist in the Somali language. Why is that?
The reason for that is, back home in Somalia, there isn't a diagnosis for autism. There's not an actual term for it. So it was more traits of autism being described. And those traits were linked to other things like having an introverted personality, or being antisocial, or just not being able to — being nonverbal, nonspeaking.
How have Somalis here in the US have talked about autism previous to this process to come up with a term?
I do think that in our community, there's a lot of fear. There's a lot of anxiety for us as people who came from another country, coming from civil war. There's just natural fear that comes with hospitals and authority figures and everything else. So naturally, there are some discussions about autism that lean more towards the fear-based side.
And then there are other discussions happening with medical professionals and parents who are on this journey, and have been, that are more positive, like, what are the strengths of our autistic children? What can we do instead of just sitting in that, 'oh, my child is autistic', and then that's it, you know?
Before you keep reading ...
MPR News is made by Members. Gifts from individuals fuel the programs that you and your neighbors rely on. Donate today to power news, analysis, and community conversations for all.
So tell me about the term you and others have come up with here for us and what is its literal meaning?
The term that we coined — I'm gonna give credit to Dr. Hussein Awjama [who] came up with this term in 2020 — is maangaar.
It breaks up into maan, which is mind, and gaar, which is unique. A unique mind, which I think is a perfect fit.
Tell me were there any other terms considered in this process?
Yes, there was another term: maangooni, which is, maan, mind, gooni, separate. Back in Somalia, someone who's called 'gooni' is someone who is very introverted, not very social. So, if there was someone who was a little bit withdrawn from society, they would be called gooni.
And so we thought, given that background, it kind of is leaning more towards the negative side and that's why we went towards maangaar, which is a more of a celebration.
What does it mean to have this word now?
In our community, anything related to mental health, anything related to any taboo topics, it just carries such a negative stigma.
And as a parent, I feel like my child is autistic, that's not something I'm going to be ashamed about. I think that having this positive term, it will encourage other parents who are facing maybe that fear, that anxiety of going out and having their autistic child integrated into the community. I think it'll be an easier process for them so it means a lot.
It'll be a support system that's being created that hasn't existed before because I think everything starts with language. My background is actually linguistics and so this means so much to me as a parent, as a teacher. I think it means everything.
As a linguist, how do you plan to get this term used more broadly? What's the process to get it accepted by other parents like yourself and the medical community?
We've already received such an incredible response, like all over Facebook. I have actually personally sent it to my child's case manager and to her teachers.
But in terms of future steps, we are working on that —creating a more united effort, maybe doing speaking engagements, maybe meeting with representatives from hospitals and from medical organizations to hopefully make this the mainstream term. | <urn:uuid:760df45a-5e19-4457-9853-b50eba71e2bf> | CC-MAIN-2022-33 | https://www.mprnews.org/story/2022/06/07/it-means-everything-somali-community-creates-word-for-autism | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00065.warc.gz | en | 0.981539 | 902 | 2.78125 | 3 |
The availability of anthropogenic food subsidies has promoted an increase in generalist opportunistic gull species, which currently breed and forage on predictable anthropogenic resources (e.g. landfills). Here we investigated whether marine resources are still important to urban-dwelling gulls. We studied 4 natural and 2 urban yellow-legged gull Larus michahellis colonies and compared (1) diet composition (through pellet analysis) and (2) isotopic niches of adults and chicks, (3) diet delivered to chicks of different ages, and (4) fatty acid (FA) composition of fledglings, in order to assess diet composition, diversity and quality, and the relevance of marine prey for natural and urban gull populations. Adult urban gulls consumed considerably lower proportions of marine prey when compared to gulls from natural colonies; however, they fed their younger chicks (<20 d old) mostly with fish, representing 61-80% of their chick food deliveries. Refuse items were mostly delivered to chicks older than 20 d. Overall, urban isotopic niches were not completely distinct from those of natural colonies, in some cases sharing ca. 50% of their niche space. Fledglings from the most urbanized colony presented overall higher FA concentrations and diversity, but they were lacking some omega-3 FAs relevant to their physiology. Our results highlight the importance of marine resources in the diet of urban gulls, particularly during early chick rearing, the relevance of food sources in the area around the breeding colonies and the fact that urban gulls benefit from year-round reliable anthropogenic food resources
de Faria, J.P., Vaz, P.T., Lopes, C.S., Calado, J.G., Pereira, J.M., Veríssimo, S.N., Paiva, V.H., Gonçalves, A.M. and Ramos, J.A., 2021. The importance of marine resources in the diet of urban gulls. Marine Ecology Progress Series, 660, pp.189-201. | <urn:uuid:64b37360-e074-4fa6-b64c-45227d76018a> | CC-MAIN-2022-33 | https://mardeaves.org/tag/urban-gulls/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.926567 | 424 | 2.984375 | 3 |
Returns the packed size of the struct.
What is th packed size? Normally, struct members are aligned in a way that optimizes access speed. For example, on a 64bit platform, all members are aligned to start on a 64bit boundary https://doc.rust-lang.org/reference/type-layout.html.
Packed means what would be the size if no alignment would be used. In fact, packed size equals the sum of sizes of all members. | <urn:uuid:761c48f1-fca1-4fa3-8c31-72f1705f1183> | CC-MAIN-2022-33 | https://docs.rs/from_bytes/latest/from_bytes/trait.PackedSize.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.885912 | 114 | 2.75 | 3 |
At this moment when climate and environmental justice are being centered and marked for remedy, it is vital that the female founders and vanguards who have long centered their work around environmental justice principles be heard. As the Biden-Harris Administration begins to act on its climate, infrastructure and jobs policies and goals, it is imperative that people of color who have been most impacted by the burden and legacies of climate injustice are the first to receive its benefits, and that environmental justice groups who have already been on the ground doing this work are empowered, affirmed and receive fiscal investment to continue their efforts.
We are two women of color and environmental justice leaders in the Midwest: Huda Alkaff, an ecologist, environmental educator, environmental justice activist, and the founder and director of Wisconsin Green Muslims who for more than two decades has advocated for environmental justice and initiated Muslim and interfaith programs on energy democracy, and water equity, and Donele Wilkins, an environmental justice activist, founder and CEO of the Green Door Initiative in Detroit; she has provided workforce development in the environmental and green collar sectors for people of color for nearly two decades, ensuring that more than 400 people secure good paying employment.
A Black woman and a Muslim woman. The dominant culture and narrative say that we don’t fit the typical profile of who leads climate work, but despite this notion, we have been initiating and leading the charge to provide environmental justice and climate equity solutions for decades, working on behalf of our communities and the grassroots power movement. Despite our proven experience, our voices and efforts have too often been underfunded, overlooked, ignored and isolated. Together we say: Now is the time for bold investment in environmental justice! Based on the 2021 White House Environmental Justice Advisory Council Recommendations, we recommend the following measures be taken before the end of this year:
- Ensure that 100 percent of the investments do no harm to frontline and environmental justice communities
- Make federal funds accessible and distribute them equally, ensuring that small organizations such as ours can access resources and aren’t blocked out by larger organizations who have more resources, hindered by bureaucratic red tape, or excluded based on inequitable assessment criteria
- Invest financially in people of color-led grassroots organizations to acknowledge their efforts and ensure future viability; grant us the resources to offer community-based technical assistance and equitable solutions
- Require women of color and environmental justice advocates to be compensated on par with others who are doing work in this field
We have been working in the shadows and sacrificed a lot…it requires resilience and fortitude to press forward when people don’t acknowledge you as the leaders and innovators that you’ve proven yourself to be. But as women of color, and elders in the environmental justice movement, we’re used to having to break through, to force our light through discriminatory clouds, systemic cracks, and institutional crevices. For too long, environmental justice groups and communities have been underfunded; according to a 2020 Building Equity and Alignment for Environmental Justice research, organizations in the Midwest have received no more than one percent of the $134 million in environmental grant dollars given, and of this, only about $1 million went to environmental justice organizations (and only half of that going to groups in our regions). For too long, women of color have been marginalized, and according to our observations, make up approximately one percent of the solar industry, as supported by a 2019 Solar Foundation report.
The Green Door Initiative solar manufacturing facility will create 200 full-time jobs for marginalized residents including formerly incarcerated. The Detroit Solar Manufacturing plant is anticipated to open by the end of 2022. Through the Wisconsin Faith Communities for Equitable Solar Initiative, Wisconsin Green Muslims is educating more than 6,000 people of 18 different faith traditions, spiritualities, and backgrounds, providing solar training to women of color, and is also seeking to continue a fellowship for young adult BIPOC faith climate activists.
We are grateful to be members of collectives such as the Environmental Justice Leadership Forum and the Midwest Environmental Justice Network - also helmed by women and people of color — that connect us to larger organizations, initiatives and opportunities, but established entities and government officials have a duty to make sure they’re seeking us out, too- we’ve been working for the greater good and on behalf of the underserved and overlooked for years…and doing it on pennies to your dollars.
If the Biden-Harris Administration, and other stakeholders and advocates, want to fulfill the promises of the Justice 40 Initiative and ensure that environmental justice communities receive the benefits of federal climate projects and infrastructure investments, it’s not enough to expect that we should simply find you.
There can be nothing about us without us: There will be no say in any policy that’s going to affect our communities without hearing from us. The sun is a sacred gift and trust for everyone, and we all must have access, for our homes, congregations, and every aspect of our lives. We are motivated to continue leading the charge to ensure that communities of color, and overburdened and disadvantaged communities, receive the benefits of jobs, justice, and climate solutions. In our decades of lived experience, we know that the power of a people is a true personification of the very essence of the sun: a glorious, radiant light that need only be acknowledged and appreciated to sustain our existence and purposefully shine on those who’ve been left behind for too long.
Huda Alkaff is an ecologist, environmental educator, environmental justice activist, and the founder and director of Wisconsin Green Muslims, a grassroots environmental justice group, formed in 2005, connecting faith, environmental justice, sustainability, and healing through education and service. For over two decades, Huda has advocated for environmental justice, initiating Muslim and Interfaith programs on energy and water conservation and democracy.
Donele Wilkins is an environmental justice activist, founder and CEO of the Green Door Initiative in Detroit, MI. She has provided workforce development in the environmental and green collar sectors for people of color for nearly two decades by ensuring that more than 400 people secured good paying employment. | <urn:uuid:65098c13-dcc8-4987-a42e-a546162d7dad> | CC-MAIN-2022-33 | http://m.colorlines.com/articles/pay-now-time-bold-investment-environmental-justice-groups-op-ed | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.952229 | 1,246 | 1.960938 | 2 |
Vision, Mission, and Core Values
To be international leaders in veterinary medicine, biomedical sciences, and public health rooted in service, fueled by a passion to improve health, and focused on innovation and education
The mission of this college is to protect and enhance animal, human, and environmental health and welfare through
- the education of a diverse population of professional, post-graduate, and undergraduate students in preparation for careers in the broad areas of veterinary medicine, biomedical sciences, and public health;
- the creation, dissemination, and application of new medical and public health knowledge via discovery, publication, education, and engagement; and
- the provision of excellent and compassionate clinical service to animals, animal owners, and producers in Virginia, Maryland, and the surrounding region.
- Education is at the core of our mission. We will create and maintain an environment that allows all members to learn and grow to their full potential.
- Human resources are our greatest strength. We promote personal and professional development through a culture that recognizes and rewards contributions and achievements.
- We respect and esteem the human/animal bond and the dignity of all animals and people. We offer preventive, diagnostic, and therapeutic services within a compassionate environment.
- We seek to relieve suffering and promote the well-being of both animals and people through the responsible conduct of clinical, biomedical, and public health research.
- We are an organization that operates with public funds to serve the public good. We will prudently and responsibly steward our human, fiscal, and natural resources.
- We adhere to the principles of trust, respect, and courtesy in all things. | <urn:uuid:e3f99c06-36a4-480d-9275-7048a64c62cc> | CC-MAIN-2022-33 | https://vetmed.vt.edu/about/mission.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.933668 | 337 | 1.585938 | 2 |
Communication is a topic we encounter every day without noticing it. Having a little chat with your parents, texting your friends, and even more, little interactions are led by communications. As children step into their adolescence, communication within the family becomes more and more difficult. A lot of the parents do not know how to communicate efficiently with their children at this very special time. And many teens often reject the idea of chatting with their parents. This would lead to a misunderstanding within the household and creates barriers between children and their parents.
So, how exactly do we communicate with our parents/children? Laureate College host a webinar this week talking about some of the key points to a successful conversation. Let’s review a bit!
First of all, if you want to know how to have a good conversation, you need to know what is good communication in a family. We all know that the family is dynamic and ever-changing, so sharing becomes one of the points leading to a good conversation.
Be willing to open up to your family, share a thing or two that happened in the last few days, and exchange your thoughts on it. This kind of conversation not only generates a genuine conversation but also teaches your children some life lessons. Sometimes, you will be surprised that parents can also learn a lot from their kids! Just a little tip: try to put your phone away during a conversation and give each other enough attention. It is simple, but very hard to follow. In this way, you will build a stronger connection with your family members, and focus less on your friend’s Instagram posts.
A strong collaborative family is formed by confident individuals working as a team. How to build up the confidence you may ask? Well, the answer is communication! Take turns between listening and speaking, give everyone a chance to speak up, express their feelings, and value the opinions of others. Every human being is a noble being that has qualities within them to build a family and community. Acknowledge everyone will have choices to make, and respect their decisions. Value growth and development lead to a wide judgement and prosperity.
Arguments are unavoidable within the household. When it comes to this type of situation, stop the desire to blame others. Adolescents are building an inner architecture that will be their emotional framework. Be patient when adolescents are questioning the parental structures they have been taught. When the argument is escalating, stop and take a time out. It is better not to continue the conversation if you are going to say potentially harmful things. Give each other more space and come back to the issue later.
Have you learned a bit from this webinar’s sum-up? Join us in our next webinar which is on April 26th at 8:30 AM EST! The link to the webinar can be found in the ‘Upcoming Event’ on the homepage! | <urn:uuid:4cf0b357-1aa4-4117-8621-1a71d465bd8a> | CC-MAIN-2022-33 | https://laureatecollege.ca/lc-webinar-series-communication/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.971194 | 588 | 2.578125 | 3 |
The global government of Imam Mahdi (p. b. u. h)
The global government of Imam Mahdi (p.b.u.h)، From the comprehensive virtual encyclopedia of Wiki Mahdism
One of the most important achievements of Imam Mahdi's appearance is to form a global government, which means a transnational, trans-regional and trans-ethnic government. In this approach, the extent of Imam Mahdi's ruling moreover all Islamic tribes and clans, includes all other religions and nations of the world. Hence due to the widely related and authentic traditions narrated from the Prophet and the infallible Imams (p. b. u. t), the global government of Imam Mahdi (p. b. u. h) will encompass the East and West.
In Islamic thought, the achievements of this important issue have been pointed out from different angles and have been defined in two realms of "government" and "development of the government on a global scale".
The composition of Imam Mahdi's governance:
Formation a divine government
The government of Imam Mahdi (p. b. u. h) bears a divine structure and begins with the formation of an efficient administration. The usage of the verb "Yamliku" in the Islamic narrations indicates that he will govern all over the world, and as quoted from the fifth Imam of Shia, Imam Bāqir (p. b. u. h)), Imam Mahdi's government is among the last governments, and its strength is that no government can behave like it. Paying attention to the content of the Hadiths, it becomes clear that the government of Imam Mahdi (p. b. u. h) is the best government that human beings have experienced, and there is no corruption in it. Also, Imam Mahdi (p. b. u. h) differs from the Imams before him on the matter of governance so that he is compared to Solomon the son of David, the prophet. According to some narrations, Jesus helps the Imam to invite Christians from Rome [Europe] and China [Asia] to Islam.
The benevolent government
In the doctrine of Mahdism, the title of "benevolent government" has been used to describe Imam Mahdi's ruling. This term can be seen in the texts of some supplications related to Imam Mahdi (p. b. u. h). The governance of Imam Mahdi (p. b. u. h) is the actualization of divine promise in religions of the coming of the last savior.
The officials of Imam Mahdi’s government
The agents of Imam Mahdi (p. b. u. h) have a special capability for doing their missions. They are mentioned in some Hadiths as the "owners of the flag" because they are obedient to the command of the Imam and the executors of his divine commands and to help him throughout the world.
The style of Imam Mahdi's governance
According to Islamic narrations, the ruling of Imam Mahdi (p. b. u. h) has some specific features; for instance, he will judge in the manner of Prophet David. In this type of ruling, the witness is not questioned; and this issue may refer to the high rank of the Imam's awareness and consciousness over all affairs, as stated in the narration.
The achievement of Imam Mahdi's government
The most important achievement of Imam Mahdi's government is to establish a pervasive peacefulness on the Earth while supervising all affairs. At that time, people in different parts of the world, declare their deep gratification of the Imam's agents. In accordance with Islamic narrations quoted from the prophet Muhammad (p. b. u. h. and his household) the earth will be full of justice as it has filled with oppression and cruelty. In that era, the sky by a constant rain, irrigates the earth, and the earth grows a lot of plants and brings out its treasures. According to many authentic narrations, the Imam distributes the properties fairly, and he bestows wealth benevolently. At the time of his ruling, Islam becomes venerable.
The time period of Imam Mahdi's governance
Through analyzing some Hadiths on the duration of his ruling, it becomes clear that there are different numbers of duration from five to three hundred and nine years. Also resulting from the narrations received through the Companions of the Prophet (p. b. u. h) the Sunnis believe that the ruling of Imam Mahdi (p. b. u. h) would be inevitable. Abū Saˈīd al-Khudrī has quoted from the Prophet to have said that Imam Mahdi Imam would rule for five, seven or nine years.
Two characteristics of Imam Mahdi's government
The global government:
As a Quranic divine promise, "Global government" is a prominent feature of Imam Mahdi's ruling. This is what God says in the Quran in different occasions; for instance, the Almighty Allah says in chapter al-Tawbah,
﴿هُوَ الَّذي أَرْسَلَ رَسُولَهُ بِالْهُدى وَ دينِ الْحَقِّ لِيُظْهِرَهُ عَلَى الدِّينِ كُلِّهِ وَ لَوْ كَرِهَ الْمُشْرِكُونَ﴾
“He it is Who sent His Messenger with guidance and the religion of truth, that He might cause it to prevail over all religions, though the polytheists may be averse. ”
Interpreting the above verse, it has been narrated from Imam al-Sādiq (the six Imam of Shia) to have said,
«عن أبي بصير قال: قال أبو عبد الله علیه السلام في قول الله عز و جل هُوَ الَّذِي أَرْسَلَ رَسُولَهُ بِالْهُدى وَ دِينِ الْحَقِّ لِيُظْهِرَهُ عَلَى الدِّينِ كُلِّهِ وَ لَوْ كَرِهَ الْمُشْرِكُونَ فَقَالَ وَ اللَّهِ مَا نَزَلَ تَأْوِيلُهَا بَعْدُ وَ لَا يَنْزِلُ تَأْوِيلُهَا حَتَّى يَخْرُجَ الْقَائِمُ علیه السلام.»
“Abū Basīr reports that he asked Imam al-Sādiq (the Shia’s sixth Imam) about the meaning of this verse and the Imam replied, “By Allah, the real meaning of this verse has not yet come to existence, but it will come to existence when al-Qā`im rises… . ’”
With the support of Imam Mahdi's governance, the enemies of Islam will be eliminated, and it will be possible for him to elevate real Islamic through his ruling in the East and West of the world.
The obedience of other religions to Islam:
Another specific feature of the government of Imam Mahdi (p. b. u. h) is the obedience of the followers of other religions to Islam through accepting the universal Islamic government of Imam Mahdi (p. b. u. h).
- Al-Ghaybah, by Sheikh al-Tūsi, p. 474.
- Ibid, p. 372.
- Ibid, p. 474.
- Al-Ghaybah, by Nu’mānī, p. 146.
- The Upriser.
- To govern.
- Our government.
- The benevolent government.
- Al-Kāfī, by Muhammad b. Ya'qūb al-Kulaynī, vol. 3, p. 424.
- Psalms of David, 37-9, 37-27.
- Kamāl al-Dīn, by Shaykh al-Sadūq, vol. 2, p. 673.
- Al-Kāfī, vol. 1, p. 397.
- Kamāl al-Dīn, vol. 2, p. 670.
- Kamāl al-Dīn, vol. 2, p. 673.
- The position of the teaching of Promised Savior from the viewpoint of Sunnis, by Mahdi Farmāniān, p. 185.
- "Research Mahdic" magazine, "A study on the narrations of the time period of Imam Mahdi's governance", by Mustafā Warmazyār, no. 6.
- Musnad, by Ahmad bin Hanbal, vol. 3, p. 27.
- The Quran, 9:33.
- Kamāl al-Dīn wa Tamām al-Ni‘mah, vol. 2, hadith 16.
- Ibid, vol. 1, p. 256.
- Bihār al-Anwār, vol. 51, p. 61.
- The Holy Quran.
- Ibn-e Ḥanbal Al-Shaybanī, Abū ˈAbdullah Ahmad b. Muhammad, Musnad, Beirut, Dar-e Sādir.
- Sadūq, Muhammad b. Ali, Kamāl al-Dīn wa Tamām al-Ni`mah, Tehran, Islamiyyah, 2016.
- Tūsī, Muhammad b. Hassan, Al-Ghaybah, Qom, Dār al-Ma'ārif 1990.
- Farmāniān, Mahdi, The position of the teaching of Promised Savior from the viewpoint of Sunnis, Mashreq-e Mowˈūd Magazine, no. 2, 2007.
- Kulaynī, Muhammad bin Ya'qūb, al-Kāfī, Tehran, Dar al-Kitāb al-Islamiyyah, 1986.
- Nuˈmānī, Muhammad b. Ibrāhīm, Al-Ghaybah, Tehran, Sadūq, 2018.
- Warmazyār, Mustafā, "A study on the narrations of the time period of Imam Mahdi's governance", "Research Mahdic" magazine, No. 6, 2013. | <urn:uuid:5c045a85-189e-4d91-9297-18a63ad37fde> | CC-MAIN-2022-33 | https://wikimahdaviat.ir/en/content/maaref-mahdism/the-global-government-of-imam-mahdi/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.849978 | 2,477 | 1.976563 | 2 |
Get the key to your success by opting for assignment help from us. Getting high scores in assignments is no more a flight of fancy. You are just one click away from your desired grades. Come on, ease up on academic hurdles, and let our top-notch experts deal with them.
The topic of humanism or Sociology is identified with people from different angles. It plays an important role in the life of an individual, a network of people or the general public. The subject assesses its conduct, different forces overseeing a human, culture, chronicle improvement, equity imbalance, sexual orientation studies, and much more.
A sociology assignment help assists the students to survey the social information on an individual; whether he comprehended the essential ideas and related hypotheses where the subject is a human. This subject has numerous sister subjects like research, geology, country, law, and so on as this subject is interdisciplinary. To get quality in an assignment on sociology, one must have a piece of decent information in the subject courses too.
Such tasks are intriguing however take a ton of time to complete. Picking up information on the hypotheses just as their reasonableness and significance require a ton of persuing. Generally, students remain busy with other scholastic and co-curricular exercises, just as close to home commitments. No concern, our humanism task help specialists are consistently prepared to help and offer their insight with you.
Human science comprises of a tremendous topic, and ideal information on writing is pre-essential to compose a social science task.
Benevolently note that the accompanying humanism task tests are for general reference reason as it were. Regardless, they are not to be utilized, appropriated or altered without bringing the equivalent into the notice of Sample Assignment.
Sexual orientation contemplates assignments:
Generally, every student of human science submits one task regarding this matter. This subject isnt new, and the writing is an immense subject as it incorporates nearly everything since the time people figured out how to compose it. It likewise remembers the move for the job of females in the public arena with time, just as different womens activist ideas and hypotheses. Let us talk about a model:
In this inquiry, an article has been doled out by the educator where one needs to examine sex, sex reassignment medical procedure and its impact or effect on naturalized thoughts regarding sex. In this task, a regular observation about standard sex and the changed sexual orientation must be talked about. Appears to be very entangled? Dont sweat it, our sociology assignment experts, know to provide the best sociology assignment help services are experienced to do such tasks.
Another case of sexual orientation related appraisal can be seen beneath:
SOC3GGC research exposition test
Globalization and culture tasks
These two things are independently mind-boggling. Culture is something individuals share yet have one of a kind affiliations and opinions. Then again, globalization is a marvel which is under examination and effects contrastingly on created and creating countries. This subject requires to be upheld with the most recent writing and credible sources.
All things considered, its hard for students to have a general thought regarding everything occurring on the planet. Yet the scholastic specialists at Sample Assignment are knowledgeable with static just as unique nature of these subjects, and they can help you complete a hard copy the most ideal way by including the top-notch topic content by expertly drafting and understanding the task.
While endeavouring such tasks, one needs to comprehend the specific prerequisites, and what the inquiry requests from the sociology assignment writer. This task spins around a way of life and humanism. The idea of culture and globalization should have been talked about while backing them with significant speculations and current instances of different nations.
How does food, style and music are a piece of an individuals life, how it is related to culture, what changed with the approach of globalization? Such tasks dont request ones own opinion(s) and must be bolstered with ongoing information and studies. Its anything but difficult to think about the ebb and flow patterns, yet the difficult part is utilizing them in a task with legitimate exploration, and interface the data related it with social advancement concerning time.
On the off chance that you have been allotted one such task, and need help, simply contact our sociology assignment writers. They wont just get you the evaluations you yearn for, however, will likewise ensure that you find out about the task.
Finding out about Social hypotheses is one of the most loved subjects of the assessors to assess inside and out information on a student. Questions or points on this specific sub-field can be identified with hypothesis investigation, appropriateness in the present or a particular nation, or study of any hypothesis.
Responding to these inquiries require concentrated information on the hypothesis, the related scholar, time (socio-social viewpoints) when it was presented, related exploration and ongoing speculations or paper in favour or against it.
The subjects sound very boisterous however not for our productive Social Science Research Assignment Help who are scholarly sociology assignment experts by calling as well as have 10 years in length experience their field of study.
Let us talk about a model:
Social Speculations Assignments
Here a student simply like you have just picked a subject and like to take a shot at the referenced scholar, Emile Durkheim. One must remember the essential ideas of the hypothesis and why it was given. To compose the hypothesis, one needs to adhere to the focal message of the hypothesis communicated by the scholar. The noteworthy piece of the exposition expects one to manage advancement (again a social connection with individuals), and the featured subjects of self-destruction and division of work.
Here you need to concur that the need of the theme isnt only the hypothesis however increasingly intricate and expansive information supported with great and bona fide writing. Our specialists with their insight and experience, are there to help you any time of time.
Another model identified with these themes could be:
Social change is inescapable. Fundamentally talk about the announcement drawing on social hypothesis and contemporary models.
Drawing on Australian setting, examine and investigate a social hypothesis to enlighten the connection between hypothesis, culture and Australian public activity.
All things considered, these are a portion of the example addresses that human science task composing specialists at Sample Assignment jump every day.
While composing such tasks, one must arrangement and commit explicit opportunity to experience the writing. Human Science is something beyond a mankind subject, yet a useful one. It very well may be identified with numerous nations present situation.
The academic and bona fide source offers better help to your response. In this way, abstain from citing any close to a home article in your answers.
While setting up a sociology assignment, one must guarantee never to have an extraordinary end or backing of a particular hypothesis. Hypotheses are identified with individuals in the setting of viewpoints, besides, it tends to be worthy for a couple however not by others.
This prompts the struggle between the inquiry and your answer. Students effectively arrive at outrageous cutoff points to help their perspectives, and thus the general effect of the task is undermined. There is no mischief in supporting any hypothesis however exhortation of the day by our sociology assignment experts is to not to incorporate individual feelings while composing an expert archive.
Our sociology assignment experts are exceptionally qualified in their separate field and all the related controls. They are knowledgeable in all the measurements like sexual orientation, human studies, conduct, geo-nation, social subjects and so on. These humanities task specialists have an experience of over 10 years in scholastic calling. Besides, they recognize what is asked in tasks, and how to make it a quality bit of review.
Moreover, they are additionally all around read in all the scholarly referencing groups like APA, Harvard, Chicago and different rules, task composing designs and other sectional necessities. We additionally guarantee the quality keep an eye on each level.
Our counterfeiting checking through best in class instruments, and on-time conveyance makes us a standout amongst other sociology assignment solution specialist organizations. So dont think a lot, benefit our administration with only a tick, or contact our nonstop accessible client assistance group for any help.
Are you still searching for someone who can do my science assignment; Sample Assignment is your answer.
A systematic research approach to ensure no research gaps and a clear and comprehensive overview.
Get the industry-specific insights for a subject and add more value to research by adding your perspective to it.
Know how to follow the university requirements and marking rubrics. Share all assignment related issues with experts and get instant solutions.
On-time academic assistance
Best academic tutors
Are you sure, you want to submit? You have not attached any file
Flat 50% Off
on your Assignment Now! | <urn:uuid:0938a45a-e0f6-49d9-9e7e-032d12752a97> | CC-MAIN-2022-33 | https://www.sampleassignment.com/sociology-assignment-help.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.939185 | 1,826 | 2.3125 | 2 |
Studying in abroad is a life changing experience. You embrace new culture, transition, face challenges, and manage between part time work and university for the sake of shinning future and outstanding education from recognized institutes. Australia has everything in store to make your study abroad experience best of it all. Australia offers absolute globalized learning experience to international students; it has multicultural society, unparallel higher education quality, world acclaimed institutions, part time working permission without much complication and opportunity to settle down in Australia if you want to work there. The uncomplicated visa and admission requirements in Australia have made it a top choice among international students. The general study abroad in Australia requirements are detailed below for your overview:
Pakistani Students Admissions in Australian Universities 2020
Australian universities have merit based system of admissions. A student applying for any higher education program at least should have attained 60% marks in each of his subject. The competition is quite high in Australia, each year universities receive hundreds of applications for admissions from countries around the globe. The candidate with best grades is obviously first priority for selectors. Evidently, your chances of getting admission in Australia depend on your grades. The admissions requirements may vary from university to university and program to program. If you meet the admission eligibility of your applied Australian university, you will get an acceptance letter.
Requirements for Admissions in Australian International Universities 2020:
The candidates applying from countries where English is not a native language need to pass English Proficiency Test (IELTS, TOEFL) with satisfactory scores, Bank statement (AUS $20,290 must be in your account for one year duration of your study program), clearance letter from police, recommendation letters, transcripts of your academic certificates and paid admission fee ($100 not refundable).
The international students must keep in mind while choosing a course in Australian University that it must be registered under Commonwealth Register of Institutions of Courses (CRICOS). Only those candidates will be given Australian Student Visa that is enrolled in a study program which has been approved by Commonwealth Register of Institutions of Courses (CRICOS).
Australia Student Visa for Pakistani Students
Once you receive an acceptance letter from the university at which you had applied for admission the application process of Australian Student Visacommences. You get all the details from online website of Australian Department of Home Affairs or you can visit Consulate or Embassy of Australia nearest to your location. The process of attaining Australian Student Visa step to step is written briefly below:
Requirements for Pakistani Citizensof Australian Student Visa:
Clearance Letter From Police Station (Stating the candidate has not been involved in any criminal activity previously or presently)
Paid Tuition fee
Paid Visa Application Form
Health Insurance Coverage
The approval of Australian visa may take duration of 4 to 5 weeks. Within 7 days of entering into Australia the students would be required to register their residence at the university in which they have been enrolled.
Part Time Working Permission in Australia for International Students
The holders of Australian student visa for long term programs are allowed to work 20 hours a week. No additional residence permit or work permit is needed. The Australia student visa serves as work permit and confers them the basic employment rights which include: minimum wage right (any employee in Australia has right to be paid minimum per hour wage of $20), sick leaves, permission to rest and taking breaks during working hours and protection against unlawful and uninformed dismal from job.
Part Time Jobs in Australia
Australia has numerous part time and full time jobs opportunities for international students according to their preferred timings of the day. Due to rules of minimum wage and skilled based income set by Government of Australia, the students are duly paid according to their abilities. You can do part time jobs such as: Retail Jobs, Administrative Jobs, Attendants or Waiters, Tourist Guides, Receptionists, Cashiers, Accountants, Data Entry Officer, Fundraiser and Crew Members in Food Chains, in Event Management Companies etc.
Post-Graduation Visa and Permanent Residency of Australia
Australia is extremely lenient and accommodating towards international students. After attaining a post graduation degree the student can extend his/her visa for 2 to 4 years based on their qualification. During this period, the candidates can do internship or traineeship at an Australian based company or firm to acquire professional experience related to their degree major or specialization. The two types of temporary residency visas programmed by Australian Government are Temporary Graduate Visa and Skilled-Recognised Graduate Visa (Visit Permanent Residency in Australia Article for Details). After having received required training and professional experience the students can apply for permanent residency based on your skills and occupation which will be ascertained on the basis of points and skill assessment. The Permanent Residency Visas are divided into various categories and applied through Skill Select Immigration Program. Each permanent residency visa is being designed to accommodate professionals of different occupations and qualified workers.
Living and Study Expenses
Estimation of living and study expenses is the first step of study abroad checklist. Australia is not an expensive country in terms of living expenses. The only challenge for an international student’s monthly expenses will be paying accommodation rent. On campus accommodation rent will be around AUS$80 to AUS$250. Other options of accommodation include: shared flats, dormitories, home stay, hostels and guest house and private renting apartments. Each type of accommodation rents varies based on location and facilities. As per the estimation given by Australian Government, a student needs AUS $20,290 for each year of his stay in Australia. The average tuition fee per year for a post graduate course can be from $7,800 to $30,000. The tuition fee can be different from one institution to another institution and from one study program to another study program. | <urn:uuid:c6a5b697-de6d-4e14-ab2b-969288752885> | CC-MAIN-2022-33 | https://financelinks.biz/index.php/home/show_country_visa/51 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.942269 | 1,180 | 1.570313 | 2 |
As the title of this tutorial suggests, I am going to show you how to embed pages into WordPress content. But you aren’t limited to pages. You can embed any WordPress content type in a post or page. This includes custom post types that you create yourself, or that are created by a plugin.
Today, I’ll talk about why embedding is a powerful tool, and we’ll go through the steps required to embed pages into WordPress content.
Why Embed a Page in a Page?
If you have content that appears in multiple places on your site, you know that when that content changes, it can be tedious to update every post or page on which it appears. It’s easy to miss a page when you update manually. Then, you run the risk of having conflicting information from one page to another.
But what if you could update the repeating content in one place and automatically update every page where the content appears? That’s the power of embedding.
Just update the page that contains the content and it changes everywhere the text or media appears on your site.
Embedding as a Formatting Tool
Repetitive content isn’t the only good use of embedding. Often, we have elements of a post or page that may require a layout that’s different from the standard WordPress post format. This may be visual presentations such as image galleries or carousels. And sometimes tables might not fit into the standard page markup.
Embedding a custom page type can make your workflow much more efficient.
Embedding is a powerful tool, but it doesn’t have to be complicated. If you’ve ever coded a site manually and used includes for repetitive content, that’s essentially what we’re going to do here. Embedding using WordPress shortcodes or «including» a file in a page will give us the same result.
If you’ve never worked with includes or embedding, don’t worry. By the end of the article, you’ll understand how it works. And if you follow along, you’ll be ready to start embedding right away.
Installing the Insert Pages WordPress Plugin
We’re going to use the «Insert Pages» plugin to do our embedding, so let’s install it.
Log in to your WordPress admin panel.
In the left column navigation mouse over the «Plugins» link and click the «Add New» link.
In the «Search plugins…» box, enter «Insert Pages.»
Once you have located the plugin, click the «Install Now» button.
When the plugin has been installed, click the «Activate» button.
Using the Insert Pages Plugin
The examples here use the WordPress Classic Editor. If you are using Gutenberg, the Insert Pages functions have to be added to posts manually using the Shortcode block. I’ll show you how that works in a minute.
When writing or editing a post, you’ll see an «Insert Page» icon. Click it to insert a page into your post.
In the «Insert Page» pop-up window that opens, select a page from the list of pages. Selecting a page will automatically populate the “Slug or ID” field.
Alternately, you can manually enter the slug name or page ID in the “Slug or ID” field.
Click the “Insert Page” button.
You can see that Insert Pages adds a shortcode to the post.
That code indicates where the inserted page will show up in the post.
By default, only the title of the embedded page is displayed.
Let’s change that so the content of the embedded page is shown.
Open the post that contains the embedded content in the editor. Select the shortcode that we added. Click the «Insert Page» icon.
Now you can choose which part of the embedded page is shown.
We’ll choose «Content,» and then click the «Update» button.
You can see that the shortcode has changed to display=’content’.
After we save the post, you can see that it now displays the page content.
Using the Insert Pages Plugin With the Gutenberg Block Editor
As you may have gathered from the shortcodes in the previous examples, embedding a page in the Gutenberg block editor works the same way it does in the Classic Editor. The only difference is there’s no «Insert Page» icon to bring up the pop-up window.
The shortcode has to be added manually when working with Gutenberg.
To add the contents of our sample page to a post in Gutenberg, we just add the shortcode:
[ht_message mstyle=»info» title=»» show_icon=»» id=»» class=»» style=»» ][ht_message mstyle=»info» title=»» show_icon=»» id=»» class=»» style=»» ][insert page=»sample-page» display=»content»][/ht_message][/ht_message]
Note that Gutenberg will detect shortcode and add it to a shortcode block.
These are the Insert Pages options. You can see that only the «display» value changes.
[ht_message mstyle=»info» title=»» show_icon=»» id=»» class=»» style=»» ][insert page=’sample-page’ display=’title’]
[insert page=’sample-page’ display=’link’]
[insert page=’sample-page’ display=’excerpt’]
[insert page=’sample-page’ display=’excerpt-only’]
[insert page=»sample-page» display=»content»]
[insert page=’sample-page’ display=’post-thumbnail’]
[insert page=’sample-page’ display=’all’][/ht_message]
Embedding Custom Post Types
We talked about the use of custom post types for adding content that requires specific formatting. Custom post types can also be embedded using the «Insert Pages» plugin.
We’ll select the custom post type “FOOTER.”
The «FOOTER» shortcode is inserted.
And the custom post type footer is displayed in the post.
If You Embed It, They Will Come
There are a lot of uses for embedding, and we’ve only scratched the surface here. Using custom post types, you can get into some elaborate and complicated embedding scenarios. But the simple uses are great too. Getting accustomed to the idea of embedding content into a post can open the door to a lot of new ideas.
Have you ever used other manual methods to embed content in a page? Can you think of a custom post type that could be a useful embedding tool? | <urn:uuid:04e9c67e-48f6-4472-bd05-44c9611a77c9> | CC-MAIN-2022-33 | https://es.greengeeks.com/tutorials/embed-pages-wordpress-content/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.720342 | 1,494 | 1.851563 | 2 |
In my lengthy research that went into writing The Age of Reagan, I read a lot of translated Soviet documents, and a ton of the secondary literature, trying to reach a conclusion about Mikhail Gorbachev and his role in the end of the Cold War under the spur of Ronald Reagan’s aggressive policies. I came to the conclusion that Gorbachev was in fact a person of authentic liberal reformist inclinations, but that he was a deeply confused reformer. His basic problem domestically was that he thought the problems of socialism required . . . more socialism. (Fortunately he saw foreign policy more clearly.) For this reason my summary judgment was that he was less Machiavelli than Inspector Clouseau.
Gorbachev, now 80, has given an extraordinary interview to Germany’s Der Spiegel magazine. The whole thing is worth reading, but there are a few extraordinary passages like these:
Gorbachev: . . . That night, I retuned to my dacha shortly before dawn — and went for a walk with Raisa.
SPIEGEL: You never discussed important issues with your wife at home?
Gorbachev: You had to go outside. We also never discussed important things openly at the dacha. When I cleared out our Moscow apartment after stepping down as president, they found all kinds of wiring in the walls. It turned out that they had been spying on me all along. . .
SPIEGEL: . . . You only treated the symptoms of the sick communist system, but you didn’t get to the core of the problem, namely that the planned economy and the party’s monopoly on power remained untouched for too long. Was that not truly the case?
Gorbachev: Let’s take one thing at a time. I would launch perestroika in exactly the same way today. “We can’t go on living this way.” That was our slogan. “I want changes,” Viktor Zoi, the pioneer of Russian rock music, sang.
SPIEGEL: But you lacked a concept for these changes.
Gorbachev: If I had had a plan for it, I would have quickly ended up in Magadan.
SPIEGEL: The capital of the Stalinist gulag, 6,000 kilometers from Moscow.
Gorbachev: Both of you were very familiar with the Soviet Union. Don’t you remember what kind of a country it was? All it took was a tiny political joke to end up in Magadan. And I was supposed to have a plan and a supporting team? . . .
Gorbachev: The Soviet Communist Party was a huge machine. At some point, it began throwing spokes into the wheels. It was the initiator of perestroika, but then it became its biggest obstacle. . . I joined the Communist Party at 19, when I was still in school. My father had been on the front and my grandfather was an old communist — and I was supposed to blow the whole thing up? Today I know that I should have done it. But the man sitting in front of you is not a so-called statesman, but a completely normal person. Someone with a conscience, and that conscience tortured me constantly. . .
SPIEGEL: What would be better today if the Soviet Union still existed?
Gorbachev: Isn’t that clear to you? Everything had grown together over the decades: culture, education, language, the economy, everything. They were building cars in the Baltic republics and airplanes in the Ukraine. We still can’t get by without each other today. And a population of 300 million was also a plus.
SPIEGEL: Are there other things that you did that still torment you today?
Gorbachev: My goal was to avoid bloodshed. But unfortunately there was some bloodshed, after all. It also troubles me that I didn’t resolve the problem with the Communist Party in time. And that I underestimated the fact that the establishment in the other national republics wanted to decide issues relating to their own lives on their own, without anyone from the central government getting involved. Now they have this possibility.
From this and other parts of the interview you can see his strange combination of decency and stubborn cluelessness, and hence my summary judgment stands undisturbed. Centuries from now historians are likely to lump him as a spectacular failure, alongside British Prime Minister Lord North at the time of the American Revolution. | <urn:uuid:e58cf6e2-173d-40b8-8222-2588594a3b3a> | CC-MAIN-2022-33 | https://www.powerlineblog.com/archives/2011/08/the-inspector-clouseau-of-the-cold-war-speaks.php?tsize=small | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.976291 | 935 | 1.804688 | 2 |
We are searching data for your request:
Upon completion, a link will appear to access the found materials.
Fats are one of the essential nutrients during pregnancy for the development of the baby. The pregnant woman's diet must be balanced and contain a variety of foods. Therefore, a slimming diet should not be carried out during pregnancy, much less eliminate fats since they are the body's energy reserves and should account for around 30 percent of daily consumption.
Detecting and knowing the different types of fats in pregnancy will help you choose those that are beneficial because they surround vital organs, transport vitamins, help the formation of hormones or constitute an essential energy source of those that do not bring associated advantages and fundamentally raise cholesterol or triglycerides.
Saturated fat in pregnant women: consumed in excess increase the level of cholesterol so you have to limit its consumption to the maximum, but never eradicate it completely. They are present in butter, heavy cream, bacon, chocolate or the fat of meat. An excess of saturated fat will make you gain weight quickly.
Unsaturated fats: It is important that you consume these fats during pregnancy as they protect the blood vessels. They are of two types: the monounsaturated fats present in olive oil and nuts and the polyunsaturated fats, which are found in oily fish, 100 percent vegetable margarines or cod liver oil. The polyunsaturated fats They include omega3 type, a type of fat that the human body cannot manufacture and it is convenient for you to ingest through food. Omega3 acid is important for your baby's brain and eye development.
It is advisable to eat a healthy diet during pregnancy that contains different types of food. The nutrients present in the food will help the development of the baby and one of these nutrients is fats.
A woman will gain around 40 weeks of pregnancy 500 grams of fatty acids. The greatest demand for these fatty acids will occur in the second and third trimesters due to the enlargement of the breasts to prepare for lactation, the growth of the uterus, the placenta and the development of the fetus.
It is advisable to take at least four times a week blue fish, rich in omega3 fatty acids as well as olive oil and nuts. On the other hand, it is advisable to avoid fats during pregnancy that are present in industrial pastries and snacks.
You can read more articles similar to Fat consumption in pregnancy, in the Diet category - menus on site. | <urn:uuid:a3d83743-3924-4a80-b0ab-897ffc4f4f0a> | CC-MAIN-2022-33 | https://jm.ecuriesduboisvert.com/6763-fat-consumption-in-pregnancy.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.954699 | 500 | 2.859375 | 3 |
More than 15,065 industry engineers and professionals in 151 countries participated in ITT Goulds Pumps’ World of Pumps Quiz, demonstrating both their expert knowledge and enthusiasm for the trade. The global leader in pump technology saw a 39 percent increase in quiz participants over last year’s inaugural game.
Engineers tested their knowledge on a wide range of pump topics, including the most important pump to maintain — the human heart. Questions included:
- In what year was the world’s first pump, the shadoof, invented? (Around 2,000 B.C.)
- What is the most prevalent cause of pump downtime and maintenance? (Seal leakage)
- Where do most cardiac arrests occur? (At home — 80 percent)
“The pump industry’s engineers and experts are some of the brightest people in the world,” said John Manna, vice president, marketing, for ITT Goulds Pumps. “Their excitement and involvement in the quiz week after week shows that not only are they intelligent, they’re engaged and dedicated to the industry.”
Questions were posted over the course of five months on a biweekly basis leading up to Pump Appreciation Day, to take place worldwide April 9. For an additional challenge, 10 optional, expert-level questions were also posed to players during the duration of the quiz.
Pump Appreciation Day also spotlights the world’s most important pump, the human heart. ITT Goulds Pumps has donated $25,000 to the global Emergency Cardiovascular Care (ECC) Program, sponsored by the American Heart Association and its global partners. These funds will support training sessions for hands-only CPR.
All quiz questions and answers are available for viewing now at www.worldofpumpsquiz.com/q-and-a, and the next installment of the quiz is slated for November 2013. Participants across the globe can learn more about both pumps and the human heart on the Pump Appreciation Day website.
About ITT and ITT Goulds Pumps
ITT (NYSE: ITT) is a diversified leading manufacturer of highly engineered critical components and customized technology solutions for growing industrial end-markets in energy infrastructure, electronics, aerospace and transportation. Building on its heritage of innovation, ITT partners with its customers to deliver enduring solutions to the key industries that underpin our modern way of life. Founded in 1920, ITT is headquartered in White Plains, N.Y., with employees in more than 30 countries and sales in a total of approximately 125 countries. The company generated 2012 revenues of $2.2 billion. For more information, visit www.itt.com.
Goulds Pumps, a flagship brand of ITT, is the world’s leading manufacturer of pumps for a wide range of industrial markets — including chemical, mining, oil & gas, power generation, pulp and paper, and general industry. As the only manufacturer to make digital monitoring standard on every process pump, Goulds Pumps continues to lead the industry in both mechanical pump design and the adoption of smart technologies. For more information, visit www.gouldspumps.com. | <urn:uuid:2dc6a21a-a15b-448f-8a23-47c94aca6adb> | CC-MAIN-2022-33 | https://empoweringpumps.com/engineers-show-skills-on-world-of-pumps-quiz/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.934197 | 657 | 2.0625 | 2 |
Poor circulation is a problem that afflicts many, which can have serious consequences if not treated properly and if blood flow to the body is not improved.
Since circulation enables the transfer of oxygen and nutrients to all tissues, thus feeding all the body cells, then it is clear that poor circulation is a major enemy of your body.
Modern lifestyle, stress, delayed sitting, lacking sustenance, smoking, over the top liquor utilization are factors that can prompt poor circulation.
It develops gradually, sometimes not even noticeable at the earliest stage. Cramps, leg and foot fatigue during physical activity are first manifested.
After a short rest, the pain goes away, but at the first opportunity they return. Following are symptoms that already indicate a more advanced stage of the disease such as swelling of the feet, blunt leaf pain, cold feet, discoloration of the skin in bluish or pink, frequent wounds on the skin that do not heal.
You should not ignore these symptoms because very often the disease develops violently in a developed form.
A balanced diet is the best way to achieve optimal circulation.
It is advisable to eat as many whole grains, fruits and vegetables as possible.
You should limit your intake of animal feed that is rich in saturated fatty acids. On the other hand, it is good to consume olive oil and polyunsaturated fatty acids.
- Garlic – lowers cholesterol levels and the risk of atherosclerosis;
- Onions – Increases blood flow;
- Olive oil;
- Black wine;
- Citrus fruits – rich in vitamin C which strengthens blood vessels;
- Tomato and watermelon;
- Nuts – rich in omega 3 fatty acids (especially nuts). | <urn:uuid:a2cc214b-a6b3-4b0d-9491-8eb518bc752a> | CC-MAIN-2022-33 | https://myhealthygram.com/2021/11/28/have-poor-circulation-with-these-foods-you-will-cure-it-easier-than-ever/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.927979 | 356 | 3.0625 | 3 |
Olive Oil is a natural oil extracted from the olive fruit. It is classified as a vegetable oil that contains good fatty acids. And there are various types of vitamins that are beneficial to health , so people are now more popular to consume. So for the comfortable consumption . Let’s get to know each other clearly that has good properties. How should each type be eaten and used?
In the beauty industry, Has been used for nourishing and UFABET beauty care for a long time. for example
- Use to add moisture to the skin. Maintain healthy skin
- Use to make a scrub. by mixing with honey brown sugar Helps skin look radiant
- Soak your hands or feet. to help nourish hands and nails
- Mix olive oil and honey and egg yolks and apply a mask to your face. to make your face look soft and supple
- Apply to the eyebrows and gently massage for 5-10 days every day to help solve the problem of thin eyebrows. Because olive oil contains vitamins that help nourish the eyebrows to be strong and black. More intense color
- Use to marinate hair to add shine and solve frizzy hair problems.
- Use to remove makeup that is stuck on the face.
- Keep your lips soft and moist.
Olive oil is also used in cosmetics, skin care products, medicines and soaps, and as a fuel for traditional oil lamps. | <urn:uuid:95e68d6c-7c7b-46d7-b61c-2f3aada8ff33> | CC-MAIN-2022-33 | https://eilatrest.com/lifestyle/olive-oil-and-its-beauty-benefits/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00065.warc.gz | en | 0.948766 | 294 | 2 | 2 |
Introverts don’t open up to just anyone. If we let you in, it means you’re special. Not everyone gets to see the many layers of our personality. In fact, sometimes, we can seem like two different people in one body.
Around people we don’t know very well, we find it hard to open up. To them, we might come off as aloof, cold, or one-dimensional.
These acquaintances love to point out how “serious”, “quiet”, and “calm” we are. And sure, we might be all those things, but what they don’t realize is that we are also so much more.
Our besties know that we are a treasure trove of awesomeness. Around them, we share all the little nuances of our personality: our pet peeves, our sense of humour, our eccentricities. We also feel comfortable sharing our secret wild side, or our silly side.
It might have taken years to get to this level of comfort with our closest friends. After all, we don’t go flashing the underpants of our personality at just anyone. We need to know that a person is accepting, loyal, and trustworthy.
So many beautiful layers
But once we trust someone, man, are they in for a lifetime of surprises. The introvert personality is like a present that you unwrap again and again. Just when you think you’ve discovered everything there is to know, you find another unexpected layer.
Acquaintances will never understand this because they only see one dimension of our personality. We’re usually okay with this. But sometimes we meet someone new, who we really do want to open up to. It’s painful to desperately want to connect, but feel like we just can’t get past our own walls. Don’t lose hope, dear!
Here are some tips to open up to someone new:
Take a step-by-step approach.
Gradually share more about who you are and what’s important to you. You can start with simple things, like your likes and dislikes. Later, you can share relevant stories and experiences, and eventually you’ll feel comfortable being more vulnerable and sharing your secret fears, and dreams.
Don’t wait for an invitation.
We introverts spend a lot of time wishing that people would ask us just the right questions, so that we can open up. Go ahead and share without invitation.
Drop non-verbal clues.
Talking isn’t the only way to share who you are. This is good news for quiet introverts, who often get tongue-tied. You can drop non-verbal hints about what’s important to you through your clothing, hobbies, art, and overall vibe.
It’s okay to be selective
Remember that it’s okay to be selective with whom you open up. The important thing is that you let someone in. After all, you can’t let your beautiful gift of a personality go unwrapped. Give someone the chance to delight in your many layers.
Over to you
Are you selective about who you open up to? Share your thoughts in the comments below if you please!
The cartoon in today’s post was yet another little gem done by my nephew, Brandon Chung. 😉 | <urn:uuid:d84a7807-23f7-4127-9377-bfb72e99d79d> | CC-MAIN-2022-33 | https://introvertspring.com/introvert-open-means-youre-special/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.944385 | 716 | 1.515625 | 2 |
All About Bones
“Who is Bones?” You might be wondering. Well... he is the Satilla Elementary mascot! You also might be wondering “What is Bones” he is a American Bulldog, and on Friday, February 26, 2021 he walked around almost every classroom to sell toys and gifts for Bulldog Bucks for Dogger General! Bulldog Bucks are green paper dollars with Bulldogs instead of founding fathers or presidents on them. Students are rewarded these Bulldog bucks for good behavior or achievement. Bones does this on every special occasion, including Fun Friday. Fun Friday is at the end of every month of school. So for all of those parents, make sure to bring your kid a snack for Fun Friday. Fun Friday is a reward activity for students.
Written by: Kaelyn Tanner, 4th grade student at Satilla Elementary School | <urn:uuid:d8c945c0-c580-43a8-8b32-3031c561d546> | CC-MAIN-2022-33 | https://sescoffeek12ga.schoolinsites.com/sys/content/newspost/04895ea5dfc24071be60191a1503b4e2 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.950715 | 175 | 2.28125 | 2 |
In Book VII of the Republic Plato’s Socrates presents the Allegory of the Cave. In the Allegory of the Cave, Socrates portrays men mistaking the shadows on the wall for the real deal. The philosopher emerges from the cave to see the forms casting those shadows.
Team Obama inverted the allegory. They called the den of their data analysts the Cave, but the men of the Cave had a handle on the political reality of 2012. The rest of us contended with shadows, in some cases shadows thrown up by the men of the Cave themselves.
Joshua Green has previously reported on the science behind those Obama campaign emails. Using rigorous trial-and-error methodology, the men of the Cave perfected the science of the campaign’s fundraising emails. If there is such a thing as political science, they were practicing it. In this inversion of the Allegory of the Cave, however, the philosophers lead the rest of us astray, or at least enough of us to win the election.
Green now returns to give us another view from inside Obama’s Cave. Green provides a chart based on Cave data showing how the Obama campaign’s swing state model performed against the Gallup poll over the last several months of the 2012 campaign, based on a nightly survey of 10,000 people. Green comments:
Gallup indicates that the selection of Paul Ryan as running mate hurt Mitt Romney, but Obama’s model really doesn’t; Gallup suggests, incredibly, that the “47 Percent” flap hurt Obama and moved the race back in Romney’s direction; and, biggest of all, Gallup shows a huge drop for Obama—really, an outright collapse—after the debacle of the first debate. At the time, Obama’s staffers were claiming to the press that, yes, their internal numbers showed the president’s weak showing had hurt his support, but that the fall was brief and quickly stabilized right about where his level of support had been all along. As a reporter, you never know if you’re just being spun when campaigns tell you this, because even if they really were collapsing the way Gallup suggests, they’d probably lie about it and say everything was fine, so as not to feed the panic. Based on th[e] data, though, the Obama campaign looks to have been telling the truth.
With Green, I think the data are of interest regardless of issues that one might raise and I want to post the chart without further comment. Here it is:
UPDATE: I’m afraid my account of the Allegory of the Cave is not exactly fine tuned. A philosophy professor writes that when corrected, the idea of inversion doesn’t work:
It’s not that the Forms outside the cave cast the shadow on the wall inside the cave. Those shadows are produced by one group of individuals in the cave who hold up artifacts in front of the light of a fire in the cave. The other group of individuals, the prisoners, are facing the wall upon which the shadows are projected, and their heads are shackled so they cannot turn around. The artifacts are meant to be contrasted with the what is real (the forms), and the fire, which the shadows and the artifacts depend on to be seen, is to be contrasted with the sun, which provides the condition for seeing the forms. The philosopher is neither the prisoner who only knows the shadows or the individual projecting these shadows.
I’m afraid I need to return to the text. In the meantime, I regret my confusion on this point. | <urn:uuid:96bb94cd-2358-4ffe-bec8-16fabc7c3cdc> | CC-MAIN-2022-33 | https://www.powerlineblog.com/archives/2013/06/in-obamas-cave-3.php | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.963654 | 735 | 1.679688 | 2 |
Jackson was simply one of the greatest track and field performers from Racine County. She enjoyed an exceptional career at Horlick High School and was a dominating force in both the triple jump and long jump. In fact, as a senior at Horlick in 1988, Jackson won WIAA Division 1 championships in the triple jump and long jump. She had also won the triple jump at state in her sophomore year with the Rebels. Jackson took her exceptional talents to another level after enrolling at Louisiana State University. There, she won multiple conference titles in the triple jump and long jump. She also earned medals at the NCAA Division I Outdoor Championships in 1991 and 1993. In 1991, she was fourth in the triple jump; in 1993, she placed fourth in the long jump and fifth in the triple jump. In 1991 she placed second in the NCAA Division I Indoor Championships. Jackson later competed for the United States in the World Championships in Germany and University Games in Buffalo, N.Y. | <urn:uuid:24eb3043-889a-455f-97db-a683fadde5cb> | CC-MAIN-2022-33 | http://www.rcsportshall.org/athleteBio.php?pID=7 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.981685 | 199 | 1.609375 | 2 |
There’s plenty of fun to be had with our inventive kids recipes and tips for keeping your little eaters happy with kid-sized portions of simple classic sandwiches.
Ingredients and info:
4 minutes Serves 1
- 3 Slices of thinly sliced carrot
- 3 Slices of thinly sliced cooked red pepper
- 3 Slices of thinly sliced cucumber
- 2 Slices of Johnston Mooney & O’Brien Goodness of Both
- Remove the crusts.
- Slice the vegetables and place in layers in the middle of the 1st slice of bread
- Close the sandwich by rolling the bottom to the middle and then to the top.
- Cut into 4 even pieces and repeat for the 2nd slice.
Tip: try different flavours and combinations of fillings. | <urn:uuid:b1591501-8cc9-42fc-99c3-79735ab1bc2f> | CC-MAIN-2022-33 | http://www.jmob.ie/kids-recipes/sushi-adventure/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.891663 | 175 | 1.65625 | 2 |
Malawi has now received the Safe Travels Stamp of approval from the World Travel & Tourism Council in recognition of its new national Health & Safety protocols for tourism. The implementation of these protocols assures the safety and well-being of its international visitors – giving them the confidence to travel to and around the Warm Heart of Africa.
Malawi is known for its friendly people, beautiful country and its remarkable variety of nature-based tourism experiences: the wildlife, the scenery and Lake Malawi. It has become the latest in a remarkable total of 250 destinations around the world to have been awarded the Safe Travels Stamp since its launch by WTTC in the second half of 2020. Meeting the accepted and established global standard in Health & Safety that allow tourism to re-start, brings Malawi in line with key tourism destination around the world.
This is a wonderful achievement for this small African destination.
The Safe Travels stamp is the world’s first global safety & hygiene stamp for travel & tourism, designed specifically to address COVID-19 and similar outbreaks. It was developed to help restore confidence in travellers and aims to revive the global Travel & Tourism sector which has been devastated by the COVID-19 pandemic. WTTC, which represents the global Travel & Tourism private sector, created the Safe Travels stamp to enable both business and leisure travellers to distinguish destinations around the world which have adopted health and hygiene global standardised protocols – so they can experience ‘Safe Travels’. These worldwide measures provide consistency and guidance to travel providers and travellers about the necessary new approach to health, hygiene, deep cleansing and physical distancing.
The WTTC Safe Travels Protocols have received the backing of the United Nations World Tourism Organisation (UNWTO) and were developed in collaboration with leading industry associations and international organisations, taking into account current guidelines of the World Health Organisation (WHO) and the Center for Disease Control & Prevention (CDC).
Malawi’s own robust guidelines were developed by the Malawi Department of Tourism, through a process of engagement with the Malawi Tourism Council and the Malawi Ministry of Health.
Gloria Guevara, WTTC President & CEO, said: “We are delighted to see our Safe Travels Stamp is still growing at a rapid rate and is being adopted by destinations from all corners of the world. Reaching the incredible milestone of 250 destinations around the world now proudly holding our Safe Travels stamp, is testimony to the hard work which has been put in to make the stamp work for both destinations and holidaymakers. As the global vaccine rollout picks up pace and with the restrictions expected to be relaxed over the coming weeks, we believe the stamp will prove a key component of destination recovery and restoring consumer confidence. The success of the stamp shows the importance of global coordination to help rebuild and revive the international Travel & Tourism sector. Destinations with the stamp will benefit from travellers being able to recognise the destinations which have adopted the global protocols, encouraging the return of ‘Safe Travels’ around the world. We are finally beginning to step into the new normal of a post-COVID world, and we are proud to be leading the way for globally coordinated efforts in recovery.”
Malawi is a genuine ‘hidden gem’ for tourism but one that had been emerging as perhaps one of the most complete destinations in Africa. With a number of attributes making it ideal for post-lockdown travel, it is anticipated that it’s trajectory of growth will now be re-established. Malawi always had stunning landscapes, amazing beaches and the friendliest people in the world. Recent efforts have seen it undergo a remarkable wildlife transformation now also giving it high quality safari experiences. Malawi has no crowds of tourists & spacious accommodation, and most of its attractions are nature-based and enjoyed in the open air (even the cultural interactions are outdoors). As a small country that offers all of Africa’s experiences in one place, there is no need for long journeys cooped up in small vehicles or even any unnecessary border crossings (with their crowds, tests and procedures). Add to that the fact that all of Malawi’s tourism operators support their local communities and conservation efforts and it’s clear to see that Malawi really is the perfect place to visit and spend that ‘tourism dollar’ well, when international tourism re-starts.
Kelly White, representative the Malawi Travel Marketing Consortium, welcomed the award of the Stamp, saying “In obtaining the WTTC Safe Travels Stamp, Malawi is showing the world that it is taking the well-being of its tourists very seriously and doing all that it can to ensure they can visit safely. Despite a rise in early 2021, Malawi’s COVID case numbers remain relatively low and it has now received its first set of vaccines. Its airports are open to international visitors. As vaccines roll out around the world, the Warm Heart of Africa is now very well placed to start welcoming its visitors back as soon as they are able to travel again!”
Following the lifting of its Covid-related travel restrictions, Malawi has seen a six-fold uplift in interest from international volunteers seeking to support wildlife conservation efforts.
Lilongwe Wildlife Trust (LWT), a non-profit conservation organisation that works to protect Malawi’s wildlife and reserves, has released their Impact Report for 2021-2022. This report showcases the facts and figures from a really successful year for the Trust.
This month the Tongole Wilderness Retreat team is delighted to share the news that more wildlife is being translocated to Nkhotakota Wildlife Reserve this July. | <urn:uuid:46f882ce-648d-491b-abdd-dd99d6737816> | CC-MAIN-2022-33 | https://www.malawitourism.com/news-blogs/malawi-awarded-safe-travels-stamp-of-approval-by-wttc/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.950419 | 1,151 | 1.867188 | 2 |
Scripture Reading: Genesis 25:19-21
“And Isaac entreated the Lord for his wife, because she was barren; and the Lord let Himself be entreated of him, and Rebekah his wife conceived.” (Genesis 25: 21)
The Torah honours Ishmael as the firstborn son by giving his genealogy first. Now begins the history of Isaac.
Isaac was forty years old when he took Rebekah, the daughter of Bethuel, the Aramean of Paddan-aram, the sister of Laban, the Aramean, to be his wife. That one verse alone (Genesis 25:20) gives us much information on the genealogy of Rebekah. Paddan-aram was in Mesopotamia.
For the first twenty years of their marriage Rebekah was barren. It seemed as though the spirit of barrenness that was in Sarah’s tent came on Rebekah when she moved into it. Later, her niece, Rachel (her brother, Laban’s daughter) would also suffer the curse of barrenness for many years.
Sometimes the spirits that torment and plague family members stay behind in the dwelling place, looking for someone else whom they can torment when the one they have possessed dies. That is why it is wise to cleanse a house room by room through prayer and exorcism when You move into it; and sometimes you may need to do it even if you only stay there overnight.
After twenty long years of waiting and hoping for a child, Isaac “entreated the Lord for his wife.”
It is the duty and responsibility of every husband to Pray for his wife’s healing when she is sick. He is the priest of the home and the head of the house. This not only brings honour to him, it brings responsibility.
Many men want to be the “boss” of the house. That is all wrong. It is not scriptural! There is a big difference between being the “boss” and being the “head, the father, the husband, the priest of the home.”
A “boss” rules through human authority and intimidation. A priest represents the Lord and leads through entreaties, intercession, God-given direction and wisdom.
If more husbands would fast and pray for their wives when they are sick they would have to pay fewer medical bills. God would get the honour, the devil would be put to flight, and the wife would know that she is cherished, which would help to bring healing.
Isaac prayed, and the Lord let Himself be entreated of him, and Rebekah, his wife conceived.
In the Beginning by Gwen Shaw
Available from our webstore: | <urn:uuid:f0fed62c-ba74-4c7f-9c3c-1dc15a55b4c2> | CC-MAIN-2022-33 | https://globaloutpouring.org/june-4-it-is-the-duty-of-the-husband-to-pray-for-the-wifes-healing/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.982606 | 580 | 2.75 | 3 |
In this monthly Book Club, open to all levels of French, we will read books about French culture and history, or written by Francophone authors. In an effort to be accessible to Francophiles of all levels, the books chosen will be written/translated in English. However, expect the discussion to be both in English and French, as a way for you to learn new vocabulary related to literature and to the French language and culture.
This month we are reading The Seine: The River That Made Paris by Elaine Sciolino.
Over the course of 300 pages, the author of the bestsellers “La Seduction: How the French Play the Game of Life” and “The Only Street in Paris” takes the reader on a journey from the Seine’s seemingly unremarkable source in the Langres plateau to its end in the industrial port city of Le Havre. Along the way we meet a number of characters who live, work and play on the famous river.
This book club is led by Coucou’s intern, Cassidy, and meets on the first Thursday of each month, 5:00-6:30pm (CDT).
Please note that our Book Club will meet online via Zoom for the time being. | <urn:uuid:ad7ed8e2-36f8-4781-9915-01faad3305cb> | CC-MAIN-2022-33 | https://coucoufrenchclasses.com/minneapolis/event/le-book-club-the-seine-the-river-that-made-paris-7-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.919129 | 262 | 1.921875 | 2 |
Mémoire sur le projet de loi C-68 : Les retombées sur la santé publique
Note : Cette page est présentée en anglais seulement
Gun Control as a Public Health Issue
CPHA supports the legitimate use of firearms in law enforcement, the military, hunting for food and sporting activities. However, the misuse of firearms outside these legitimate spheres poses a great social and economic burden on society today.
Protecting the general health of the public has always been a cornerstone of Public Health. An important element in health protection is the development of preventative strategies where the health and safety of the public is at risk. In terms of gun control, these strategies are related to:
- Injuries and Accidental Deaths
- Violent Crime and Domestic Homicide
Education and information on their own are not sufficient for ensuring safe measures and promoting responsible behaviour. It is generally accepted by the public that regulations in addition to education are required to prevent premature death and injuries from such things as automobiles, bicycles, addictive substances, toys and a number of other potentially hazardous products. The rationale for regulation is not that the majority of car owners or toy manufacturers are irresponsible but that the potential for accidents is real and therefore reasonable steps are necessary to prevent injury and death where possible. These same arguments can be made with respect to gun control.
CPHA believes that the majority of gun owners are responsible. However, on average, every year in Canada there are 1,400 firearm related deaths and over 1,000 firearm related injuries. Most firearm related deaths and injuries are not the result of criminal activity but the result of misuse, suicides and domestic homicides with legally owned, easily available rifles and shotguns. In 1991, out of a total of 1,450 firearm related deaths, 1,118 were due to suicide, 250 were the result of assaults, and 57 were unintentional (the remaining were due to unknown causes and legal intervention). CPHA believes that measures are required to prevent these unnecessary human tragedies. | <urn:uuid:37d8b623-ac0f-4c59-8060-4d46114e34a2> | CC-MAIN-2022-33 | https://cpha.ca/fr/memoire-sur-le-projet-de-loi-c-68-les-retombees-sur-la-sante-publique | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.935397 | 416 | 3.015625 | 3 |
Coronaviruses are single-stranded positive-stranded RNA that have the largest virus genome among RNA viruses (1-2). Coronaviruses are widespread in bats around the world but can be found in many other species as well that are phenotypically and genotypically diverse (1,3). The coronavirus disease 2019 (COVID-19) raised considerable concerns as it was associated with severe acute pneumonia and fatal outcomes(4-5) and thus resembled the clinical presentation of severe acute respiratory syndrome (SARS) observed in 2002 and 2003 as well as Middle East respiratory syndrome (MERS) since 2012 (6). The causative agent of COVID-19 was a novel coronavirus known as SARS-CoV-2 and was previously named 2019-nCoV in China (2,5).
Novel quantitative real-time reverse-transcription polymerase chain reaction (rRT-PCR) assays were developed in rapid response to the emergence of COVID-19 originating in Wuhan, and these assays have been widely used in laboratory detection and written into the national technical guidelines used in China (7). We report here in detail on the technical data and comparative analysis of performance of three rRT-PCR assays targeting three distinct regions of the SARS-CoV-2 genome for detection of COVID-19 infection. Three rRT-PCR assays were further evaluation with several species of clinical specimens from patients with COVID-19.
A total of 135 clinical specimens were collected from a cluster of patients with pneumonia in Wuhan and Beijing suspected of being infected with SARS-CoV-2. Specimens included alveolar lavage, sputum, throat swabs, and stool. Inactivation of specimen processing was performed in a biosafety level 3 (BSL3) laboratory.
Nucleic acids were extracted from a 140 μL processed specimen using a QIAamp Viral RNA Mini Kit according to the manufacturer’s instructions. Approximately 60 μL of total nucleic acid eluate was recovered into nuclease-free tubes and either tested immediately or stored at -70 °C.
Multiple primer and probe sets were designed based on bioinformatics analysis of three complete genomes of SARS-CoV-2 (BetaCoV/Wuhan/IVDC-HB-01/2019, Accession ID: EPI_ISL_402119, BetaCoV/Wuhan/IVDC-HB-04/2020, Accession ID: EPI_ISL_402120) obtained in our lab (5,8). ORF1ab, E gene and N gene sequences were selected as targets using Primer Premier software version 5 (Applied Biosystems) with the following default settings: primer melting temperature (TM) set at 60 °C; probe TM set at 10 °C greater than the primers at approximately 70 °C; and no guanidine residues permitted at the 5’ probe termini (Figure 1A, Table 1). Previous reported prime and probe sets for the RNA-dependent RNA polymerase (RdRp) region of pan beta-CoV was designed as a reference experiment (3,9).Figure 1. Development of three rRT-PCR assays for detection of SARS-CoV-2. (A) Description of specific primers and probes for detection of SARS-CoV-2. Relative positions of amplicon targets on the SARS-CoV-2 genome schematic. ORF: open reading frame; RdRp: RNA-dependent RNA polymerase gene; E: envelope protein gene; N: nucleocapsid protein gene. Numbers below amplicons are genome positions according to SARS-CoV-2, accession ID: EPI_ISL_402119, EPI_ISL_402120. (B) Confirmation of rRT-PCR on seven human coronavirus samples using specific probes and primers. (C) Representative amplification plot of developed rRT-PCR assay showing serial dilutions of SARS-CoV-2 RNAs from clinical samples for evaluation of sensitivity of four assays. (D) Determination of detection efficiency and limit of various rRT-PCR assays. Standard calibration curves of Ct and genomic copy number was generated based on rRT-PCR results targeting primer set and SARS-CoV-2 stock with pre-determined genomic copies.
Target Gene Primer Sequence (5’→3’) Genome location* Limit of detection (copies/mL) Forward CCCTGTGGGTTTTACACTTAA Target 1 ORF1ab Reverse ACGATTGTGCATCAGCTGA 13342-13460 203 Probe FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 Forward TTCTTGCTTTCGTGGTATTC Target 2 E Reverse CACGTTAACAATATTGCAGC 26303-26391 664 Probe FAM-GTTACACTAGCCATCCTTACTGCGCTTCGA-BHQ1 Forward GGGGAACTTCTCCTGCTAGAAT Target 3 N Reverse CAGACATTTTGCTCTCAAGCTG 28881-28979 667 Probe FAM-TTGCTGCTGCTTGACAGATT-BHQ1 Forward GGTCATGTGTGGCGGCTC Target 4 RdRp Reverse GCTGTAACAGCTTGACAAATGAAAG 15438-15545 Probe FAM-CTATATGTTAAACCAGGTGGAAC-BHQ1 *The location on the reference genome, accession ID: EPI_ISL_402119, EPI_ISL_402120.
Table 1. Primer and probe sets of rRT-PCR assays for the detection of the 2019 novel coronavirus diseases (COVID-19).
Several one step rRT-PCR assays were developed using the OneStep PrimeScript™ RT-PCR kit (TaKaRa, Japan). Each 25 µL reaction mixture contained 12.5 µL of 2× Master Mix, 0.5 µL of reverse transcriptase/Taq DNA polymerase mixture, 5 μL of RNA extract, 400 nmol/L concentrations of forward primer and reverse primer, and 200 nmol/L of probe. Thermal cycling included 42 °C for 5 minutes, followed by 95 °C for 10 seconds and then 40 cycles of 95 °C for 10 s and 60 °C for 45 s. Each run included one SARS-CoV-2 genomic template control and at least two negative or mock controls (for the extraction and the PCR amplification step) (Table 1).
Assay specificity was determined using high-titer virus stock as well as clinical samples containing known respiratory viruses from collection of our laboratory. Identities and virus RNA concentrations were reconfirmed by specific rRT-PCRs for each virus before the experiment (9-10).
The limit of detection was independently assessed using a SARS-CoV-2 stock with pre-determined genomic copies. The calibration curve for the genomic copy number versus Ct value was obtained from the rRT-PCR machine, which was an ABI 7500 (Applied Biosystems, USA) or a Roche LightCycler 480 (Roche, Switzerland) Real-Time PCR system. Series of four parallel reactions per concentration step were prepared and tested by the respective rRT-PCR.
Clinical samples were considered positive if two or more of the gene targets showed positive results (Ct≤37 cycles; If the Ct value is between 37–40, the experiment needs to be repeated. The judgment of the final result is based on two consistent experimental results) (7).
Nucleic Acid Extraction
Design of Primers and Probes
Real-Time RT-PCR Assay for Screening of SARS-CoV-2 Infection
In the detection of clinical samples using the same gradient dilution, ten-fold serial dilutions of the SARS-CoV-2 RNA were tested to assess the detection limits and dynamic range of our optimized rRT-PCR assays. The detection results of the four rRT-PCR assays were different for clinical samples with gradient dilution. The lower potential limit of detection was approximately 10-4 dilution per reaction for ORF1ab assay, E assay, and N assay, and 10-3 dilution per reaction for RdRp assay (Figure 1C). The genomic copy numbers-based Ct values were calibrated on the standard curve for individual rRT-PCR (Figure 1D). The lowest detection limit of ORF1ab assay was 203 copies/mL. The minimum detection limits of E and N assay were 664 and 667 copies/mL, respectively (Table 1).
The rRT-PCR assays were tested with nucleic acid extracts of 6 human coronaviruses, human NL63 coronaviruses (NL63-CoV), human 229E coronaviruses (229E-CoV), human OC43 coronaviruses (OC43-CoV), human HKU1 coronaviruses (HKU1-CoV), SARS-CoV, and MERS-CoV. In addition, nucleic acid extracts of influenza A were also tested. No positive reactions were observed with any of the primer and probe sets of ORF1ab and N genes, while cross-reactions with SARS-CoV were shown using the primer and probe sets of the E gene as well as RdRp (Figure 1B).
Assay reproducibility was tested by using replicate ten-fold serial dilutions of the SARS-CoV-2 RNA and intra- and inter-assay variability evaluated for each dilution point in quadruplicate three different times. The reproducibility for 3 assays (targeting ORF1ab, E, and N) exceeded 90% at the lower copy detection limit (data not shown).
The rRT-PCR assay was evaluated using different species of clinical specimens collected from a cluster of patients in Wuhan and Beijing, whom were suspected of being infected with SARS-CoV-2. Three rRT-PCR targeting ORF1ab, N and E showed consistent detection rates among various species of specimens (Table 2). The mean Ct value detected in sputum was lower than in other species of clinical specimens (alveolar lavage, throat swab, and tool), which indicated the mean viral loads detected in sputum were higher than other specimens. Similar results were also reported recently using a large amount of clinical specimens.
Target gene Alveolar lavage n(%) Sputum n(%) Throat swab n(%) Stool n(%) Total n=15 n=28 n=53 n=39 ORF1ab Positive rate (%) 14 (93.33%) 12 (42.86%) 25 (47.17%) 16 (41.03%) Mean Ct value 31.11 28.44 32.53 29.93 Range 26.41−36.25 18.44−36.38 24.22−38.58 22.27−37.51 N Positive rate (%) 14 (93.33%) 12 (42.86%) 25 (47.17%) 16 (41.03%) Mean Ct value 31.45 28.91 33.61 31.14 Range 26.58−36.98 18.04−37.76 25.73−38.31 23.46−38.11 E Positive rate (%) 14 (93.33%) 12 (42.86%) 25 (47.17%) 16 (41.03%) Mean Ct value 31.33 28.64 33.27 30.46 Range 26.45−36.55 18.34−36.42 25.03−38.54 22.46−38.30
Table 2. Detection results of clinical specimen by the rRT-PCR based on molecular targets of ORF1ab, N and E gene.
Performance of Different rRT-PCR Methods
Evaluation with Different Species of Clinical Specimens | <urn:uuid:62291543-f32b-4176-8674-9bf5306a7264> | CC-MAIN-2022-33 | https://weekly.chinacdc.cn/en/article/doi/10.46234/ccdcw2020.116 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570741.21/warc/CC-MAIN-20220808001418-20220808031418-00065.warc.gz | en | 0.896203 | 2,593 | 2.515625 | 3 |
Learn How to Trade in 3 minutes
- What are binary options?
- How to trade for beginners
- How to trade successfully and profitable? How to make money in easy steps?
- How to trade with no money?
- How do I setup a demo account?
What are binary options?
When people begin looking for ways to expand their investment portfolio or just want to make some extra side money, they quickly come across binary options. The first question people generally ask themselves is ‘what is a binary option?’. The second question they ask is ‘how to make money with binary options?’. By reading this article, you’ll find answers to both those questions and more.
(Each broker has a different trading platform but all of them have these basic elements)
Binary options are some of the most simple investment opportunities available on the market. Essentially all you have to do is decide ‘yes’ or ‘no’; if you decided the price of an underlying asset be above or below a specified price at a specified time, you say yes. If not, you say no. This is why it is called binary. There are only two choices. This simplicity is the reason these type of investments have broad appeal amongst experienced traders and novice investors to the financial markets.
How to trade for beginners
Here is a practical example of how to trade:
If you believe, based on your market analysis that the price of a specific commodity, for example, will be above $1,000 at 3 PM, you buy a binary option. If not, you sell this option.
The price of any binary option is always between $0 and $100, and just like in the stock market, there is a bid(offer) and ask(sell) price.
The binary option you are interested in might be trading at $42.50 (bid) and $44.50 (ask) at 3 PM.
If you decide to buy the option at $44.50 and at 3 PM the the price of the underlying commodity is above $1,000, your option expires and it becomes worth $100. You make a profit of $100 – $44.50 = $55.50 (less fees). In this scenario your binary option ‘expired in the money’.
How to make money with binary options trading
One the reasons for binary options’ broad appeal is that it is an accessible investment option to really anybody who is interested. If you are the type of person who possess a strong penchant for financial analysis, always up to date with the latest market news, you will have no problem leveraging your knowledge to gain high returns through binary options.
However, novice traders quite often find immediate success as well through measured strategies that allow them to build their understanding of the market while they make sound, solid investments.
Below are tips both types of investors can integrate into their general strategies in order to be well placed to make consistent profit:
- Selection of underlying assets – One key to any strong investment strategy is diversification. This is the same for binary options. When signing up for a site, and as you continue to invest, make sure you have access to a broad selection of assets upon which you can invest in binary.
- Leverage Membership Benefits – A simple, yet underutilized method, to increase your profits as a new investors is to take advantage of the new member signing bonuses almost all binary trading platforms offer.
- Leaving while on top – Many binary trading platforms offer offer you an early exit option on any trades you have made. If you anticipate your trades will expire in the money but you still have a certain amount of time before the trade mature it is your choice whether you want to take the early exit profits, which will never be the full profits you would receive after your option matures..
How to trade with no money
If you are new to binary options, or even an experienced investor, you can improve on your old investment strategy or build an entirely new one without spending any more. That’s right, you can learn how to earn huge profits for free by opening a binary options demo account.
Almost all binary options trading platforms offer their members demo accounts. Demo accounts allow you to review real time market data as well as invest in options, just as if you were using real money. Of course, the money is completely virtual so there is absolutely no risk to you.
How do I set up a Demo Account?
Setting up a demo binary options account as soon as you register for a binary broker platform is one of the easting and smartest things you can do, if you want to get started trading binary options in the right direction. All you need to do is visit any of binary option trading platforms listed at binary-options.trade and click the option to open a demo account. You will be prompted to enter some information. Following a minutes, you will be give your unique username and password.
When you first log into your binary options demo account you will find it comes pre-stocked with demo credits. Demo credits are essentially virtual money, you can use just like real money anywhere in the demo account.
You are encouraged to browse the availability of underlying assets. Once you have found a commodity, index, or currency pair that interests you then simply click on the Put or Call button depending on whether you think the value of that underlying asset or commodity is trending up or down, choose how much you wish to wager and then confirm your trade and wait to see what happens!
After you’ve spent enough time on the demo account to build an effective trading strategy, and you want to start trading for real money, all you need to do is to switch over to the real money version of the binary options trading platform. When you finally make your first real deposit, you will most likely qualify for a new sign up bonus! | <urn:uuid:ad6e0c36-4fc1-4a56-9d49-a87d47a616d2> | CC-MAIN-2022-33 | http://www.binary-options.trade/how-to-trade/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.944054 | 1,215 | 1.945313 | 2 |
Description Two menuki in the shape of dragons are held to the tsuka with a silk cord. The kashira, like the matching fuchi, is decorated with waves. Dragons are associated with water and often depicted in waves or clouds. This is part of a mounted set.
Provenance Henry Walters, Baltimore [date and mode of acquisition unknown]; Walters Art Museum, 1931, by bequest.
Credit Acquired by Henry Walters
Download Image Add to Collection Share on Twitter Share on Facebook Creative Commons License | <urn:uuid:3780050f-d06a-4f27-9db1-b81ea4601ebb> | CC-MAIN-2022-33 | https://art.thewalters.org/detail/79216/tsuka-with-dragon-menuki/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.929307 | 106 | 2.34375 | 2 |
The following is the text of a speech given by CSE Foundation Counselor James C. Miller at the annual meeting of the American Legislative Exchange Council (ALEC), Chicago, Illinois, August 20, 1998.
Thank you for that kind introduction. I’m very pleased to have this opportunity to speak to you today. For a quarter of a century, ALEC has provided a unique perspective on the major issues of state government. I hope to continue in that vein today by offering some personal views on one of the states’ most important — and, I daresay, most misguided — regulatory activities. I refer to the pervasive system of price controls on insurance.
Long after other major industries were subjected to extensive deregulation, insurance remains so heavily regulated that elected officials, bureaucrats, and even industry executives still speak unflinchingly of the insurance “rate-setting process.” That term is nothing more than a euphemism for government price controls. So today, when polls and focus groups reveal voter frustration over high insurance premiums, many state lawmakers instinctively react by promising to lower rates. After all, they have the power to do so, and it’s what they’ve always done in the past.
But ALEC members, who appreciate the virtues of free enterprise and limited government, know intuitively that price controls are economically unsound, and that they ultimately hurt the very people they are intended to help. That was true when the Nixon administration instituted nationwide wage and price controls in the 1970s, and it’s true today in the case of price controls on insurance. Indeed, I think it’s time to say publicly what so many of us know: that government price controls on insurance have been an absolute failure. Here’s a partial list of the havoc price controls have wreaked:
Distortion of the insurance marketplace;
Politicization of insurance pricing;
Limitations on consumer choice, and reductions in competition.
Let me elaborate on each of these points.
First, price controls have distorted the marketplace. The rating laws that authorize government price controls in nearly every state share a common theme. They all say that no insurance rate will be permitted which is “inadequate, excessive, or [is] unfairly discriminatory.” And they all give the insurance regulator the authority to enforce this prohibition. Now, if you survey different states, you’ll notice that the states that are particularly aggressive in exercising their price control authority invariably succeed in driving insurers away, while achieving no long-term reductions in price. That’s true whether we’re talking about price controls on auto insurance, or measures taken by regulators in the aftermath of windstorms and earthquakes to suppress rates for homeowners insurance. Instead of making insurance more affordable and more available, price controls have had the opposite effect. By contrast, our host state of Illinois — which has few, if any, price controls — has perhaps the most competitive, consumer-friendly insurance market in the country.
What accounts for this urge to subject insurance pricing to government control rather than the workings of the free market? Well, it seems that some people are disturbed by what they regard as a moral coldness — a lack of compassion — in the market. In their view, charging higher insurance premiums to people who are considered especially risky through no fault of their own smacks of “blaming the victim.” They believe that the less fortunate should be helped, but instead the insurance market seems to punish the less fortunate. But it’s a mistake to think that the remedy lies in socializing insurance through regulation.
When government sets prices, invariably several unintended negative consequences ensue. There will be fewer competitors vying for customers in the marketplace. Fewer options will be available to higher-risk individuals who are seeking insurance. And because the price people pay for insurance no longer corresponds to the risk associated with their actions or behavior, they will no longer have a financial incentive to practice risk mitigation. In other words, price controls encourage people to engage in risky behavior, which of course increases the likelihood that they will suffer a loss of some kind.
Second, price controls have led to the politicization of insurance pricing. When government has the power to control prices, that power will be exercised for political purposes. This won’t happen all of the time. But it will happen often enough to make clear that, however compelling the economic rationale for a particular price, political considerations will probably be decisive in the end. The temptation to control prices, when you have the power to do so, is simply too great to resist. The politicization of insurance pricing is especially likely to occur in situations where the state insurance commissioner intends at some point to seek higher elected office. The only way to eliminate the temptation to allow political ambition to influence the power to control insurance pricing is to eliminate the power.
Third, price controls artificially limit consumer choice, thereby reducing competition. It’s axiomatic that when government controls prices, product options dry up. This is so obvious a proposition that I am always amazed we don’t do better in debates with those who argue that government price control is the pro-consumer position. Insurance price controls notwithstanding, the trend in the rest of the economy is toward the deregulation of prices. Over the last 25 years, price controls have been eliminated or drastically curtailed in almost every sector of the U.S. economy — from transportation to banking to agriculture. Even the so-called natural monopolies, such as the telephone and electric utilities, are undergoing sharply reduced government price controls and the opening of markets to competition.
Similarly, in the global marketplace, insurance price deregulation is becoming commonplace. There is no government price regulation in the British insurance market. Across the entire European Union, commercial insurers are free to compete for large accounts without government oversight. Even the Japanese government has begun dismantling its system of price controls on insurance.
After all, why should the government control the price of an auto insurance policy, or a homeowners policy, or a workers’ compensation policy, when the government does not control the price of an auto, a home, or a worker’s salary? As long as we accept the notion that government intervention in the relationship between buyers and sellers of insurance is normal and desirable, we can do little more than tinker in the margins of regulatory reform.
My organization, Citizens for a Sound Economy, is waging a campaign to reform our system of insurance regulation. As part of this effort, we have proposed specific changes in insurance regulation in several states over the past year. We have also taken our case to the National Association of Insurance Commissioners, which wields enormous influence over insurance policymaking at the state level. The purpose of CSE’s insurance regulatory reform program is to urge government to allow market forces to determine the price and scope of insurance coverage.
In 1991, a leading insurance scholar, Professor Scott Harrington of the University of South Carolina, concluded his study of insurance price controls with the following observation:
Additional government control over insurance rates is not needed. It would be likely to produce significant inefficiency, including higher claim costs. Instead, rates should be deregulated, and insurance affordability problems should be addressed by measures that reduce claim costs in efficient ways.
Professor Harrington is right to emphasize inflated claim costs as the source of high insurance premiums. State legislatures could help bring claim costs under control by enacting measures such as no-fault automobile insurance laws — and more generally, by embracing tort reform. But those are topics for another day.
Ladies and gentlemen, I’m proud to have played a significant role in the deregulation of the airline, railroad, and trucking industries. In fact, the Brookings book which I coauthored with George Douglas (Economic Regulation of Domestic Air Transport: Theory and Policy, 1974) was held up during the Carter administration as the “bible of deregulation.” Just as in the case of insurance, defenders of the status quo said that without price and entry controls terrible consequences would ensue. Planes would fall from the sky. There would be no service for the poor or for those living in out-of-the-way places. Competition would be “chaotic.” Prices would go through the roof. None of those dire predictions came true, and now deregulation of transportation saves consumers literally tens of billions of dollars every year.
Let’s do the same for consumers of insurance. Thank you very much for your kind attention. | <urn:uuid:983a0dd7-83c7-42e7-8bae-c930f643d0a7> | CC-MAIN-2022-33 | https://www.freedomworks.org/press/issue-analysis-77-the-case-for-eliminating-price-c/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.955985 | 1,733 | 1.765625 | 2 |
Switch off the engine, put on your overalls and get under the hood: it’s motor oil change time! To keep your engine running like clockwork, that’s exactly what it needs – lubricating oil. Multigrade oils defy heat and cold and can be used all year round.
When choosing an engine oil for new car, we recommend using an engine oil that has the specification API SN/SP, ILSAC GF-5/GF-6.
The Best Synthetic Engine Oil 0W-20
What kind of oil you need depends on your car. You can find out which type in your vehicle’s manual. Find out in our test and comparison table which oils are available, how expensive they are and what else you should look out for when buying.
- Engine oil is an important accessory of all cars. Therefore, almost as important as a tire change in the car or motorcycle is the regular change of lubricating oil. Because the oil helps to lubricate the machine of the passenger car and to cool important units. In addition, the oil provides optimal cleaning and effective protection against corrosion.
- Lubricants are divided into monograde oils and multigrade oils. Monograde oils are divided into winter and summer oils. For this reason, they must be changed at the same time as the season changes. Multigrade oils, on the other hand, are not so strongly temperature-dependent. They can be used all year round with confidence. For this reason, they are considered standard today.
- Not every car tolerates every oil. To find out whether the oil you have selected can be used, always consult the manufacturer’s operating instructions before filling.
With engine oil, everything runs like clockwork. At least in the engine of motor vehicles. Because that is where it is mainly used. And it is precisely there that it fulfills its actual purpose and brings great benefits to the vehicle owner and his vehicle.
And this is where our engine oil comparison comes into play. Because many car owners today bring their own oil to the workshop. Because for a 5q canister you pay in the trade usually the same money as for a liter in the workshop. So that you too can start the next oil change prepared, we have looked for the best engine oil for you in our engine oil comparison. In addition, you can learn everything about the engine oil differences, the correct engine oil designation, and also what a potential engine oil test winner must bring along.
What is engine oil?
The oils are namely used to lubricate internal combustion engines. One knows you of course particularly as accessories of cars, but also a lawn mower or a motorcycle needs from time to time an oil change. The oil is used as an accessory because, in an engine, where of course metal meets metal, there is always mechanical friction. Since this is of course not conducive to the machine, one uses engine oil, which often still additives, i.e. additives, were mixed.
What types of engine oil are there?
There are different categories of engine oils. We explain the two most important ones in the engine oil comparison. The engine oil differences result from their respective areas of application.
|Engine oil type||Information|
|Monograde oil||Monograde oil was the standard until the 1970s. Today, it is mostly only used in motor sports or at extreme outside temperatures. This is because monograde oils are divided into winter and summer oils. So when the seasons changed, the engine oil also had to be changed at the same time, as is the case when changing from summer to winter tires (and vice versa).|
|Multigrade oil||Multigrade oil retains its viscosity, i.e. its flow properties, even at higher temperatures. The lubricity therefore remains stable to a certain extent both with warmer or colder oil. Multigrade oil can therefore be used both in winter and in summer. It is important to know here, however, that the larger the covered viscosity range of the oil, the more the oil loses its viscosity when it remains in the machine for a longer period of time.|
Oil change intervals:
In the past, you had to change the oil after approx. 1000 to 5000 ml. Today you have to change engine oil when you have driven about 10000 ml with the car. After approx. 12 months, however, an oil change is still usually mandatory today, regardless of whether you have already driven the required distance or not.
Buying advice: What to look for when you want to buy engine oil?
We are happy to provide you with important criteria in our engine oil comparison to help you find the best engine oil for your car. However, we do not want to neglect one important tip in advance. If your car is still under warranty, it is better to leave it with the engine oil of the vehicle manufacturer. So you are also in case of damage on the safe side what concerns the warranty. If your car is no longer under warranty, then simply use oil that the vehicle manufacturer, e.g. BMW or Chevrolet, has approved for the car in the operating instructions and that also meets all other important standards. Otherwise, we will tell you here about the most important properties of lubricating oils.
The method of production
Lubricants can be produced in different ways. Mineral oils are produced by the distillation of petroleum. This type of lubricating oil for automobiles has been used the longest of all manufacturing methods and is available only in the form of monograde oils. Semi-synthetic oils are a mixture of mineral and synthetic oils. Where we are already with the synthetic oils. These have a very good engine oil quality due to the admixed additives, but therefore also have a higher price. But the advantages are numerous: good cold-start properties, good lubrication even at high temperatures and less engine wear.
The SAE viscosity
As already mentioned, engine oils are divided into summer and winter oils. In the past, engine oil had to be changed every season, similar to tires. Today, multi-grade oils are more commonly used.
If you read the engine oil designation SAE 16 or SAE 20, you can assume that it is a summer oil. The designations range from SAE 20 in increments of ten to SAE 60. The oils at the lower end of the scale tend to be thin-bodied, while SAE 60 tends to be thick-bodied. The viscosity of the oils is specified at 100°C. The individual numerical values, however, do not indicate the viscosity of the oil. However, individual numerical values do not provide any information about the quality of the substances.
Winter oils are indicated by imprints such as 0W or 5W. The scale here extends in increments of five up to 25W. The designations indicate the lowest temperature to which an oil can still be pumped. For 0W, this would be -40°C, for 5W -35°C.
The lowest and highest viscosity can always be read from the designation of the multigrade oils. The names are a combination of the specifications of the winter and summer oils, such as 5W-30. The smaller the number in front of the W, the more fluid the oil is, even at low temperatures.
Tip: A note on the point of SAE class: The class is always based on the vehicle manufacturer. It indicates which class, which car, e.g. a BMW needs. So pay attention to this information. So you ensure that the correct oil pressure in the machine can arise.
Smooth running properties
Many engine oils have properties that make the engine run particularly smoothly. This is said to lead to fuel savings in the long term. This addition is found exclusively in synthetic and semi-synthetic lubricants. However, only use these oils if they have been approved by your vehicle manufacturer. Oils with the designation 0W-20, 0W-30, 0W-40 or 5W-30 have smooth-running properties for saving fuel.
First, long-life oils always have the properties of fuel-efficient oils. You can use this additional property if you have a car with a longlife service. Here, a control unit in the car calculates the next inspection date and oil change. However, this only works with the manufacturer’s oil. If you use a different oil, you have to reprogram your car for a fixed inspection.
Best motor oil brand:
Castrol, Idemitsu, Liqui Moly, Shell, Valvoline, Mobil, Pennzoil.
Questions and answers about engine oil
How to dispose of engine oil?
Disposing of engine oil does not have to be that complicated. However, it often seems to private persons that the disposal is connected with many obstacles. Sellers are obliged by law to take back used oil. But even municipal collection points often take back used oil. Garages and service stations are also often accommodating.
What does the w stand for in engine oil?
The W, which is often part of the number combination of the engine oil designation, indicates that it is a winter oil. In other words, an oil that can be used in winter.
Can engine oil go bad?
A bottle of lubricating oil that has not yet been opened has a very long shelf life. Engine oil shelf life is usually three to five years. Be careful, however. The technical progress in the construction of engines brings with it the compulsion to always use up-to-date oil compositions. Opened oil has a shelf life of about half a year.
When should engine oil be topped up?
It is best to check your oil level after every third refueling stop. Is the oil indicator light flashing? Then it’s usually already too late. It’s good to have a spare canister in the trunk.
How do you get engine oil out of clothing?
Do you want to remove engine oil from jeans fabric? Or from another piece of clothing.
Is it possible to mix engine oil?
In general, it is not recommended to mix engine oils for different types of engines. What does not work at all is mixing engine oils for 4-stroke and 2-stroke engines. Oils for the same type of engine, e.g. a motorcycle, can of course be mixed without any problems.
- Best engine oil for Chevrolet
- Best Engine oil for Chevrolet Equinox
- Best Engine Oil For Ford Expedition
- Best Engine Oil For Ford Explorer
- Best Engine Oil For Ford Fiesta
- Best Engine Oil For Ford Focus
- Best Engine Oil For Ford Fusion
- Best Engine oil for Honda Accord
- Best Engine Oil For Honda CR-V
- Best engine oil for Honda CR-Z
- Best Engine Oil For Honda Pilot
- Best Engine Oil for Jeep
- Best engine oil for Kia: Buying Guide
- Best Engine Oil For Mitsubishi
- Best engine oil for Nissan Altima
- Best Engine Oil for Nissan Sentra
- Best Engine Oil For Subaru Forester
- Best Engine Oil For Subaru Impreza
- Best Engine Oil For Subaru Outback
- Best Engine Oil For Toyota 4runner
- Best engine oil for Toyota Camry
- Best Engine Oil For Toyota Corolla
- Best engine oil for Toyota Highlander
- Best engine oil for Toyota RAV4
- Best Engine oil for Toyota Tacoma
- Best engine oil for Toyota Tundra
- Best Motor Oil for Acura
- Best Motor Oil For Honda Civic
- Best motor oil for Honda Fit (Jazz)
- Best motor oil for Hyundai Elantra
- Best motor oil for Lexus
- Best motor oil for Mercedes Benz
- Best motor oil for Nissan
- Best motor oil for Toyota Prius
- Best Motor Oil For VW
And for those who don’t like to read, this video once again provides all the important information at a glance: | <urn:uuid:04acf554-0c12-46f9-9944-60c3912e8051> | CC-MAIN-2022-33 | https://carnesmechanical.com/how-to-pick-motor-oil/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.952045 | 2,509 | 1.835938 | 2 |
Eyes in the Sky: Hunting Smugglers in All Weather
It was completely dark in the middle of the Caribbean Sea on the evening of October 3, 2018. Dense bands of cloud shrouded the moon, obscuring all light. Storms intermittently rumbled, dampening the darkness with sheets of rain.
Five thousand feet above the sea, a large white airplane sliced through the gloom, its telltale orange stripe and Coast Guard shield obscured by the shadows. Pilots and crew members inside the HC-130 Hercules airplane did not mind the obscurity; in fact, it was a critical part of their mission.
They had been sent into the black, windy night to search for a particular vessel, a panga boat suspected of transporting cocaine northward. Beyond their “search box,” a targeted area in international waters off Costa Rica, the aircrew was armed only with the HC-130’s sensory equipment, years of training and their own intuition.
Petty Officer 1st Class Matt Lotz, a seasoned mission system operator aboard the Hercules, used all three to locate the target. Wrestling with filters and scan methods, he used the plane’s camera to spot and track the panga down below, despite the pitch-black night.
Hovering far overhead, the Hercules crew initiated the “end game,” the final stage in which aircrews help surface assets locate targets. Coast Guard Cutter Donald Horsley, the nearest asset, steamed toward the panga and launched a small boat crew to close the final distance.
Little did the crews know that the end game would be rife with difficulty that night.
“The small boat crew experienced some technical difficulties,” said Lt. Patrick Spencer, aircraft commander of the HC-130. “Matt thought outside the box. He figured out a way to talk directly to the small boat so he could direct them to the target.”
Acting as the boat crew’s aerial navigator, Lotz guided them within 50 feet of the panga. The pursuit was short, but lively, with the panga crew leading the Coast Guard team in wild arcs through the darkness. With the Hercules aircrew serving as their eyes in the sky, Donald Horsley’s crew seized 600 kilograms of cocaine that night, a haul valued at approximately $17 million.
“When we get to see the end game, the actual drug bust, it gives the crew a sense of accomplishment,” said Lt. j.g. Zachary Georgia, an HC-130 pilot at Coast Guard Air Station Elizabeth City who routinely participates in Joint Interagency Task Force South’s counter-narcotics missions.
In 2018, HC-130 crews from Air Station Elizabeth City conducted more than 100 JIATF South aerial patrols, directly contributing to the arrests of 34 suspected drug smugglers and the interdiction of 27,000 kilograms of narcotics worth over $745 million. While working in Central America, the aircrews operate from several different locations, and their patrol coverage varies wildly during their deployments. When the crews receive task direction from JIATF South, they are directed to search an expansive area, to investigate a known target, or to insert themselves into the end game of an ongoing case.
“Flexibility is key,” said Petty Officer 1st Class Trevor Tufts, an aviation maintenance technician in charge of the HC-130’s mechanical functions while airborne. “We don’t actually know where we’re going until we get the pre-mission brief each day. I’ve had the location change 10 minutes before departure.”
Coast Guard aircrews work with a diverse array of entities and agencies while deployed in support of JIATF South, including the U.S. Navy, U.S. Air Force, U.S. Customs and Border Protection, and law enforcement agencies of surrounding nations. But according to the Coast Guard crews, the HC-130 Hercules airplane is what truly distinguishes them from their many teammates.
“We can offer twice the range of some of the other planes working down there,” Lt. Spencer said. “We simply have the best plane for the mission.”
Air Station Elizabeth City is home to five HC-130J Super Hercules airplanes, the more advanced version of older HC-130H airplanes, which Tufts said is an important distinction. The J-model of the HC-130 touts increased air speed, increased flight time, a camera equipped with infrared sensors, and a 360-degree surface search radar, all features that help aircrews efficiently hunt down drug smugglers.
Mission system operators like Lotz arguably benefit from the airplane’s equipment the most. As the person simultaneously communicating with JIATF South and other entities, monitoring the radar for possible targets, recording footage of action down below, and directing the movements of surface assets, Lotz said he appreciates the HC-130’s trappings.
“For an MSO, it’s our time to shine,” Lotz said. “I love it. I’d do it forever.”
Story by Petty Officer 2nd Class Corinne Zilnicki / U.S. Coast Guard. This article is available in its original form here.
The opinions expressed herein are the author's and not necessarily those of The Maritime Executive. | <urn:uuid:d5f195a2-cc89-4722-bd5d-52a41391818e> | CC-MAIN-2022-33 | https://www.maritime-executive.com/editorials/eyes-in-the-sky-hunting-drug-smugglers-in-all-weather | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00065.warc.gz | en | 0.941176 | 1,131 | 2.203125 | 2 |
10 Best IELTS Coaching in Karnal 2022
- 1 IELTS coaching in Karnal
- 2 List of top 10 IELTS coaching centres in Karnal
- 3 Why Choose IELTS Coaching in Karnal?
- 4 How do I Choose the Best IELTS Coaching in Karnal?
It is ubiquitously seen how more and more people today are scuffling hard to get to their favourite destinations abroad owing to various reasons and dynamics. Be it for their education, their job perspective, their aspirations, or just for a better standard of living, many people set their goals straight of going to their favoured country. However, it’s easier said than done and requires one to get fully immersed in fulfilling the criteria of getting a visa corresponding to their interest like student visa, work visa, etc.
IELTS is one important criterion of them all, that tests your hold on the English language and demands persistent preparation and planning.
IELTS coaching in Karnal
The IELTS exam is not a regular exam that only tests your grasp over a confined syllabus. Rather it is an assessment of your entire personality that is uniformly planned across its various tasks like Reading, Writing, Speaking, and Listening. However, such exams require apropos guidance and insightful learning that only comes from the experience of an expert mentor.
Talking about the coaching centres in Karnal, the city has seen significant growth in the terms of coaching institutes that judiciously prepare for the IELTS exam, especially in recent times.
List of top 10 IELTS coaching centres in Karnal
As we see a multitude of coaching institutes in Karnal, at times, it becomes difficult to choose the best one amongst all. While choosing an institute, various factors are put into consideration, such as teaching style, assessment mock tests, counseling, batch size, etc., which might seem like a tedious task to do.
Hence, to mitigate the hassle, we have prepared a list of top coaching institutes in Karnal. So, let’s go through.
|SL No.||IELTS Coaching centres in Karnal||Location||Specializes in|
|1||Harpreet’s English Classes||Model Town Karnal, Haryana||IELTS Coaching|
|2||Vani IELTS||Mugal Canal, Karnal||IELTS Coaching|
|3||The English Hub||Sec-13 Karnal||IELTS Coaching|
|4||Maaya Overseas||Model Town, Karnal, Haryana||IELTS Coaching|
|5||Kanan International||Mughal Canal, Karnal, Haryana||IELTS Coaching|
|6||Touchstone Educationals||Marvel Towers, Karnal||IELTS Coaching|
|7||The Empyreal IELTS||Sector 32, Karnal, Haryana||IELTS Coaching|
|8||Skybour institute||Mugal Canal, Karnal, Haryana||IELTS Coaching|
|9||Axis Educos||Ground Floor Mughal Canal, Karnal, Haryana||IELTS Coaching|
|10||Turning Point studies Consultants||Sector 8, Karnal, Haryana||IELTS Coaching|
1) Harpreet’s English Classes
Known for its exceptional teaching methodologies and successful result streak for a long time now, Harpreet’s English classes are one the best institutes in Karnal. It has been a strong player in the field of IELTS coaching for the last 15 years and has trained multiple students and IELTS aspirants so far.
It has quality assessments and rigorous mock tests with personalized attention given to its enrolled students. Moreover, it has rave reviews for its excellent environment conducive to the learner’s mind.
Address: 560L, Part 4, 2nd Floor Behind Guru Teg Bahadur Public School
Model Town Karnal, Haryana 132001 India
2) Vani IELTS
Vani IELTS is a premier coaching institute in Karnal with significant years of experience. It has trained over 700 students successfully so far and has given exceptional results. One of the leading IELTS coaching institutes and immigration assistance centres, it has come a long way. Apart from the IELTS exam, it also trains for the PTE exam and provides VISA assistance.
With best-in-class amenities, phenomenal infrastructure, and classrooms that are comfortable and air-conditioned, it is a choice for many.
Address: SCO-341, Ist Floor, Mugal Canal, Karnal-132001
3) The English Hub
The English Hub is a well-known coaching institute in Karnal for its English-speaking courses and competitive exams like IELTS. Providing a broad range of learning modules with competent testing patterns has delivered amazing results so far.
It has- special batches for professionals, special batches for housewives, special batches for kids, a completely English environment, pioneer staff, well sitting plan, cool & windy classrooms, and 100% job assistance.
In addition to that, it also provides visa assistance to its enrollees.
Address: 1134, New Housing Board Colony, Sec-13 Karnal
4) Maaya Overseas
Maaya Overseas is one of the leading IELTS coaching centres of Karnal and has been helping students for over two decades. With a fine-quality IELTS preparation program and exhaustive classes, it has made a name for itself. It is an authorized representative of various universities across countries in the world including the most sought-after academic destinations for international students like the USA, UK, Australia, Canada, Ireland, New Zealand, Singapore, Europe, etc.
It also prepares for PTE and assists with various visa types, including study visa, work visa, tourist visa, business visa, and Express Entry (PR).
Address: SCO-4, Plot No. 29, Monga Complex, Opp. Lane HDFC Bank, Main Market,
Model Town, Karnal, HARYANA
5) Kanan International
Kanan International is a vintage player in coaching IELTS aspirants for over 23 years. With rich experience in training a huge number of students and having helped over 25,000 students’ immigration, it is a stanchion in the prominent coaching centres of Karnal.
It has a tie up with over 250 government colleges and universities of the USA and Canada to provide a gamut of programs and choices of colleges to its enrolled students. It also helps with student visas.
Address: SCO-90 Mughal Canal, Karnal 132001, Haryana
6) Touchstone Educationals
Awarded by IDP for being the top partner in India for 9 consecutive years, Touchstone Educationals is one of the most sought-after institutions for IELTS training and preparation in Karnal.
It is the first IELTS training institute to be an official partner for the Cambridge University Press.
With 30 campuses across 15 cities in India, this enriched institute is a very popular centre among IELTS aspirants. Enrollees get access to its furnished library and online training materials. A truly accomplished coaching centre, it also prepares for PTE and TOEFL exams.
Address: Marvel Towers, Near Roar Bhawan, Karnal – 132001, INDIA
7) The Empyreal IELTS
A highly personalized coaching institute in Karnal, The Empyreal IELTS is a sound coaching institute in Karnal. With simplified learning and wholesome training for its enrolled students, this institute is an acclaimed one.
With advanced teaching methodology, timely evaluation, and feedback, this institute is worth it. Its updated and comprehensive teaching materials are a feather in its cap. With all praises among its students, this institute has made a mark.
Address: Noor Mahal Chowk, above Nirmaan Timbers, Sector 32, Karnal, Haryana 132001
8) Skybour institute
Skybour Institute is one of the top institutes of Karnal. It has experienced and certified instructors and counselors who help students to sail through one of the most challenging standardized exams- IELTS and PTE. With years of glory in training thousands of students, this institute is known for its “Student-first” approach, qualitative education, one-to-one teacher-student sessions, and whatnot. It also provides scholarships to meritorious students and counsel for visa, career, and job prospects abroad.
Address: S.C.O. 115, Mugal Canal, Karnal, Haryana, India
9) Axis Educos
Since its establishment in 2010, Axis Educos has been paving the way for many IELTS aspirants. With its prodigious pedagogy and astounding learning environment, it is a critically acclaimed institute in Karnal. It has delivered notable results ever since and has recorded praiseworthy band scores by its students.
It provides complete assistance with selection of education provider and study area of interest, complete offer letter and application processing, complete documentation & visa application processing, guidance in booking accommodation, ticket and flight assistance, and also pre-departure briefing.
Address: AXIS EDUCOS, SCO 331, Ground Floor Mughal Canal, Karnal Haryana, India – 132001
10) Turning Point studies Consultants
Founded in 1993 and incorporated in 2001 by the Registrar of Companies Delhi and Haryana, Ministry of Corporate Affairs, Turning Point studies Consultants has played a significant role in mentoring students for overseas education for more than 28 years. It has been training students for English language proficiency since 2009. With comprehensive lectures, all-embracing mocks, and diligent assessments, it has substantially helped students in getting their dreams realized.
It also trains for PTE, CAEL, CELPIP, SAT, GRE.
Address: 1 Atal Park, Ram Mandir Marg, Sector 8, Karnal Haryana 132001
Why Choose IELTS Coaching in Karnal?
Karnal is undoubtedly one of the top-notch cities. Choosing the best IELTS coaching centre in Karnal is one of the most common concerns that is registered. Karnal has had a remarkable track record of housing the premier IELTS centres, and with the best institutes in Karnal, tens of thousands of students have been able to create a mark for themselves over the years.
With some of the best band scores in the past by the IELTS examinees in the city, Karnal is ideal for those who are setting an eye to getting enrolled in any of the top IELTS training centres.
How do I Choose the Best IELTS Coaching in Karnal?
IELTS aspirants may get confused about choosing the finest IELTS coaching institute in Karnal owing to the cut-throat competition among the institutes here. With comparable band scores and enriched experience in training IELTS aspirants, it becomes all the more difficult for one to choose the best one. However, you should take a couple of factors into consideration while choosing the one that is most apt for you. What might work for someone may not necessarily work for you and hence have a couple of options and choose the best IELTS classes in Karnal if an offline institute is something you are looking forward to.
The very need of choosing the right coaching centre at times falters the students’ preparation journey due to uncertainties. However, as it takes movements before a sprint, the same is the case with IELTS preparation.
A sincere and informed approach is all that it takes to crack the first hurdle of preparation for this coveted exam, and that could be efficiently done with a seasoned mentor. Hence, you should choose wisely.
All the best!
Getting no luck with finding the best IELTS online classes in Karnal? We have come up with a list covering top coaching centers. Get to know more here. | <urn:uuid:e173c14d-d6c1-4140-8b3c-b50493fa3584> | CC-MAIN-2022-33 | https://ieltsmaterial.com/ielts-coaching-karnal/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.938789 | 2,535 | 1.554688 | 2 |
One on One: North Carolina’s connection to China’s arms buildup
Published 8:11 am Monday, March 22, 2021
By D.G. Martin
Last week, according to Bloomberg News, China’s top military leaders were using a North Carolina native’s concept to justify their commitment to increasing China’s military budget.
Bloomberg reported that Xu Qiliang, China’s top military officer, said the country needed to brace for a “Thucydides Trap,” which is an inevitable conflict between a rising power and an established one. China is the rising power and the U.S. is the established one.
Xu explained, “Facing the Thucydides Trap and border disturbances, the military must step up its efforts to improve its capabilities.”
He continued, “The most important thing is internal unity and cohesion and improvement of overall capabilities. If you are strong, you will have long-term stability, as well as invincibility.”
What is the ‘Thucydides Trap’ and what is its connection to North Carolina?
Bloomberg explained, “Thucydides Trap refers to ancient Greek historian Thucydides’ explanation of the Peloponnesian War as an inevitable clash between a rising Athens and the established regional power, Sparta. The term was coined by Graham Allison, a professor at Harvard University’s Kennedy School of Government, who argued that China would threaten to displace U.S. influence, possibly resulting in an unhealthy rivalry or armed conflict.”
Allison, the North Carolina connection, grew up in Charlotte, was a star football player at Myers Park High School, and attended Davidson College for two years before transferring to Harvard. Later at Harvard, he became the longtime leader of Harvard’s Kennedy School and more recently has served as director of Harvard’s Belfer Center for Science and International Affairs.
Allison says his interest in Thucydides was sparked by George Labban, his Greek professor at Davidson. Labban promised his students that if they worked hard on his course, they would be able to read Thucydides in the original Greek. Allison worked hard and read Thucydides’s account of the war, including its origins in the competition between the Athens, the established power, and Sparta, the rising power.
In his 2017 book, “Destined for War: Can America and China Escape Thucydides’s Trap?,” Allison argued that the U.S. and China were on a collision course because: (1) China was quickly overtaking us as the world’s dominant economic power, and (2) China’s firm aspirations will put it in direct confrontation with the U.S. Allison pointed out that China expects, over time, to reassert its historic dominance over Taiwan, the South China Sea, and territories claimed by Japan, The Philippines, and other allies to which the U.S. has specific treaty responsibilities for defense.
In his book, Allison carefully explained that war between the U.S. and China was not inevitable. He and his colleagues mapped out 16 other occasions in history when a rising power confronted an established one. In most cases the situation led to war, but in four cases war was averted, including the post-World War II Cold War Soviet challenge to the U.S.
Now that Chinese authorities recognize and cite the Thucydides Trap’s application to the Chinese-U.S. confrontation, does Allison think that war can be avoided?
In a speech last month at Utah Valley University Allison said, “Nature and technology have condemned us to coexist since the only alternative is to co-destruct.”
Allison explained that because the existence of nuclear weapons would bring catastrophic consequences for both countries in the case of war, neither country would logically choose to enter war except in the case of an unintended trigger, or “black swan” event.
Allison also pointed out one compelling reason for the two countries to work together. Both are responsible for significant emission rates of greenhouse gases that could lead to an environment in which neither country could survive. Unless the U.S. and China find ways to work together to constrain emissions. it could be an environmental catastrophe rather than a Thucydides Trap that victimizes them.
D.G. Martin hosts “North Carolina Bookwatch,” Sundays at 3:30 p.m. and Tuesdays at 5 p.m. on PBS North Carolina (formerly UNC-TV). The program also airs on the North Carolina Channel Tuesdays at 8 p.m. and other times. | <urn:uuid:83a57ca7-8103-4a96-ad4d-ea44dbccf9e9> | CC-MAIN-2022-33 | https://www.thecoastlandtimes.com/2021/03/22/one-on-one-north-carolinas-connection-to-chinas-arms-buildup/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.965038 | 980 | 1.976563 | 2 |
|File:Sinnoh Canalave City Map.png|
Location of Canalave Library in Sinnoh.
|Pokémon world locations|
It is the only library in the Sinnoh region and, keeping with one of the most prevalent themes in Diamond, Pearl, and Platinum, its shelves contain books on the myths of Sinnoh. It can be found on the northwest side of Canalave City and it is the place the player, the rival, Lucas/Dawn, and Professor Rowan meet up before the player goes to Lake Valor.
Canalave Library is a small library with three levels. Shelves filled with different books surround several reading tables and chairs. There is a sign that informs people that eating and drinking are prohibited. Not much happens on the first two floors; however, people can be seen here reading books about Pokémon and other topics.
On the top floor of the library, the player can read the books on the bookshelves. These books are philosophical in nature and delve into the history and existence of the Pokémon world as known. These books detail the numerous myths of the Sinnoh region, which serve as a topic of interest and point of study for many, including Cynthia. These books include: "Sinnoh Myth," which may refer to Arceus; "Sinnoh Region's Mythology," which explains why wild Pokémon appear in grass before Trainers; "Sinnoh's Myth," which explains the existence of the lake guardians; "Veilstone's Myth," which tells a story about a young swordsman whose disregard for Pokémon leads to his encounter with Giratina; "The Original Story," which explains the origin of the Pokémon world; "A Horrific Myth," which tells a horrible tale about the consequences of those who threaten the lake guardians; and "Sinnoh Folk Stories," a book containing three folk stories. The first story illustrates that Pokémon can be used for sustenance, the second implies that humans and Pokémon were once one and the same or came to be separate through biological evolution, and the third folk story states that there was a time when Pokémon and humans had no distinguishable differences.
After Byron is defeated in the Canalave Gym, the player's rival summons the player to the Canalave Library to meet with Professor Rowan and his assistant. Professor Rowan assigns each of the three characters to one of the region's lakes for research on the lake guardians, but is interrupted when a huge explosion at Lake Valor shakes Canalave City like an earthquake. Everyone leaves the library before the aftershock occurs.
In Pokémon Platinum, once the player has received the Flame Plate from the Hiker in the Oreburgh Mine during the Arceus-triggered event, they can come to the Canalave Library to find that the ceiling-high bookshelves on the second floor will now contain a book detailing all of the Plate descriptions. Upon initially entering the second floor, the Hiker will also give a brief description of Arceus and its connection to Dialga, Palkia, Giratina, Uxie, Mesprit, and Azelf, as well as admitting to writing and contributing to the book. Either a fateful encounter Arceus or an Arceus caught from the Hall of Origin can trigger the event.
In the anime
The Canalave Library appeared JN089. After Ash's Lucario and Goh's Inteleon had been stolen by Alternate World Team Rocket, with Dawn and Goh having disappeared into the alternate world while chasing them, Ash and Chloe decided to visit the library to find information about Palkia, since it has the power to control space and travel between dimensions. At the library, they met Cynthia, who told them about Palkia, Dialga, and Arceus.
In the manga
The Canalave Library first appeared in A Big Stink Over Stunky when Professor Rowan and Mr. Berlitz arrived there for an academic conference. The library made seveal reappearances during said conference.
In Brash Bronzong I, Platinum learned that Professor Rowan and Mr. Berlitz, her father, had disappeared at Canalave City, prompting her to depart there with Diamond and Pearl. Receiving a ride from Fantina's Drifblim, they were dropped off in front of the library, but it was closed for the night. While they discussed about coming back the following day, Platinum suddenly heard her father's voice coming from another building and followed it.
Pokémon Diamond and Pearl Adventure!
In Hareta's Excellent New Partner...Minun?!, Hareta and Mitsumi met Professor Rowan and Jun at the Canalave Library. Rowan told them that the International Police was pursuing both Team Galactic and Hareta's father Kaisei because of the latter's knowledge regarding Giratina and the fear of him teaming up with the former. Before the conversation could continue, the group was attacked by Saturn, who wanted to get revenge on Hareta for the defeats he had inflicted upon him in the past. With the help of his recently hatched Minun, Hareta was able to once again defeat Saturn, who told him that Kaisei was at the Team Galactic HQ in Veilstone City.
- The first story of the Sinnoh Folk Tales refers to a tradition practiced by the Inuit, which is that after hunting an animal, its bladder should be removed and put in the water (in the bladder dwells the soul) and make a sacred ritual so that the animal returns when the hunter needs it, and that in turn, the animal can rest in the celestial world.
- In Pokémon Sun, Moon, Ultra Sun, and Ultra Moon, the Aether Foundation is revealed to have visited the Canalave Library in order to get information necessary to create Type: Null.
In other languages
|80px||This article is part of Project Locations, a Bulbapedia project that aims to write comprehensive articles on every location in the Pokémon world.| | <urn:uuid:a7084e4f-da32-43bd-b6a0-67ee28197248> | CC-MAIN-2022-33 | https://staging.bulbapedia.bulbagarden.net/wiki/Canalave_Library | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.952348 | 1,325 | 2.1875 | 2 |
I will share my code for it eventually, but I feel like it needs a rewrite first - to make it neater, to make the process faster (the pages took about five hours to generate) and to make the resulting SVG files that are then converted to PDF smaller. At the moment, every box / guideline / kanji on the page is drawn independently, which makes for very big SVG source files. It really should use a proper grid made of lines and SVG’s support for reusing elements.
Rewriting this to leverage <use> and CSS variables for the colouring rules was a huge time-saver - it now only takes three minutes to generate the 2136 jouyou kanji, and the file sizes for each page are now about 3% of the original versions - the final pdf is 29mb now, which is more reasonable.
Quasi-related… I bought some of the Frixion erasable pens, so I could write on some rocketbook cardstock to practice kana, and then microwave it to erase and re-practice without wasting as much paper… not sure if the microwave energy to erase the rocketbook is more or less wasteful than the paper thoufgh…
do you know any books or sites etc where i can learn how to write stroke endings with a pencil? like how yo move my hand etc. have yet to find a resource that teaches me this. i learn japanese in isolation but want to learn to write properly from the start.
I think it’s quite rare to find tutorials involving pencils because most people need to write with a pen or a brush, and pen calligraphy videos (at least, in English and Japanese) are rarer than brush calligraphy videos. As far as books go, I strongly doubt that you’ll find anything in English. I could be wrong though, so try looking around. This book that I recommended on the topic that you started should do the trick:
It’s in Japanese, however, so I know that might mean it’s not immediately helpful or useful. Even so, just reading all the ‘sound effect’ katakana and following the arrows and shapes included in the book should teach you quite a lot.
That aside, I think you should take a look at the images I shared in this post on your previous topic:
In order to adapt the ‘brush tip’ images to pen/pencil writing, imagine the brush tip size changes as pressure changes and possibly pen-to-paper angle changes: less pressure and more vertical pen/pencil hold for thinner lines, and more pressure and (sometimes) a smaller pen-to-paper angle for thicker strokes. In order to create tapering, reduce pressure as you draw lines. For sharp hooks/points at the ends of strokes, flicking your pen is an effective approach. (By the way, when I first attempted to ‘write well’ using a pen, my approach was generally to attempt to replicate brushstroke techniques with the pen nib. It worked pretty well – and I reasoned exactly as I just described, in terms of pressure and angle – so I don’t think you should dismiss brush calligraphy tutorials as useless outright.)
I also seriously recommend that you experiment with following the directional arrows in the diagrams I added to that post. Grab a pen or fairly soft pencil and try moving the writing instrument in accordance with those directional lines while attempting to stay within the confines of a stroke (i.e. don’t leave visible white space inside the loops that appear inside one stroke on the diagram). You should start seeing familiar brushstroke-like contours appearing. These are things you’ll really understand only after trying them yourself or after seeing them being done in front of you. Without practical experience, you won’t understand how the movements described can create the shapes you’re looking for.
Finally, again, please refer to the diagrams I added to that post, particularly the ones filled with examples of ‘basic strokes’. All you really need to master in order to get started is the techniques for making such basic strokes, meaning that those are the movements you need to learn first. From there on, you’ll just have to learn to vary the angles and to have a sense of ‘aesthetically pleasing proportions’ for kanji. The closest thing I can find to a tutorial is examples on Takumi-san’s channel. If you find that you need explanation and that trying to imitate what you see is too hard, then I suggest looking out for videos that contain English subtitles on his channel. There aren’t many of them, but the few that there are are quite instructive. Take a look at these two, for instance:
The second probably won’t be that helpful for you at this point, because it deals with more general issues of proportion and how to nicely arrange characters on a page. The first, however, deals with how to write hiragana. You’ll notice that some of these shapes reappear in kanji (I’m not talking about entire kana, but rather certain angles and types of tapering), meaning that you can reapply what you learn from that video when writing kanji.
The last thing I’d like to recommend is not to overthink this: experiment and try to see, ideally by imitating videos, what seems to reproduce what you see in models that you’d like to match. If all the fancy directional lines and ‘movement within a stroke’ diagrams don’t work for you, then take a look at how someone like Takumi-san writes kanji. First, take note of the correct direction for forming the stroke. That’s the most basic step. Thereafter, ask yourself what seems likely to create such a shape. If you see a slight bend right at the beginning of the stroke (e.g. what you often see at the top of 丿), well… maybe there really is a bend! Try going diagonally downwards from left to right at say, 45º to the vertical, and then draw your writing instrument vertically downwards. Does your stroke look like the model? Yes? Good. Not quite? Then what’s different? Most likely, your initial bent stub is a little too long. What happens if you shorten it? Do you see the model appearing now? It’s really very intuitive. Your pen nib is a sphere, but depending on how you angle the pen, how you drag it around and how much pressure you apply, the shape of the marks you make changes. I sincerely believe it’s possible to figure this out by watching videos and imitating them. Don’t be afraid to experiment. Calligraphy in English is the same: you need to be able to produce appropriate variations in line thickness and angle. The only difference is that the characters are less complex.
Use Takumi-san’s pencil hiragana video (the first one) with the subtitles on as a base for learning the right techniques. (Bonus: something that you can learn by watching but which he doesn’t explain: pay close attention to how he starts strokes. He move the pencil a little and stops briefly before changing direction and continuing. That’s how you get nice little ‘starting stubs’. For a particularly good example, watch how he writes と.) I’m pretty sure things will start falling into place afterwards.
I’m not sure, but there’s a page here https://www.sljfaq.org/afaq/education.html
that says they learn with a brush in their third year of school. I don’t know if they learn kanji before that though. Most likely they do. I don’t know a lot about the Japanese education system though, so it’s probably best if you do a little Googling.
i don’t know about writing kana and kanji but i was watching a lettering video yesterday where the lady had exercises for pencil (to save on brushes cos they’re very expensive to practice with) and she used 2B. 2B is soft enough to get different thicknesses depending on pressure.
2B is my favourite to write with pencil even if i don’t often do so and also for sketching stuff i won’t need to erase. i even have a mechanical pencil with 2B!
2B was the standard when I was in school in Singapore, including for shading answers on for multiple-choice questions marked by machines. You probably won’t have too much trouble with HB, but I think it’s a lot easier to use a 2B pencil, especially if you want to be able to vary line thickness easily.
I’m personally used to using 0.5mm leads, but anything that works for you goes. I personally might find 0.9mm a bit too thick, but for the size of characters Takumi-san was writing, I think it was a good choice.
Oh, and… no, he doesn’t, but judging from the colour of the line, I think that’s a B at the hardest.
Resurrecting this thread to thank you for the recommendation! I bought this book (as well as its pink sibling) and it’s been very helpful as a reference work. It shows you all the important details to pay attention to while writing particular characters and it does a decent job at teaching them in an order that makes sense. Combining this book with Takumi-san’s videos is all one needs for penmanship, I should think.
To go slightly off-topic: does anyone happen to know of a similar style book (that is: aimed at primary school kids, and with lots of pictures for reference) for brush calligraphy? There are loads of youtube videos out there, but there’s nothing like a school textbook to help you figure out a sensible order for learning things in. | <urn:uuid:a1500062-2da7-40c2-9332-eb1dcc0f03e5> | CC-MAIN-2022-33 | https://community.wanikani.com/t/kanakanji-writing-practice-book-recommendation-please/46026/27 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.956644 | 2,110 | 1.71875 | 2 |
June 22, 2008
June 22, 2008
June 25, 2008
Design in Engineering Education
13.399.1 - 13.399.15
Developing Team-work Skills through a Core Design Thread
An approach to evolving teaming skills through a sequence of core design courses starting in Freshman Year is discussed. In the first course in the sequence basic concepts are given for effective teamwork and related individual behaviors. A survey is used at this point to assess students’ prior team and group work experience as well as their attitudes toward team-based work. After participation as a team member in the major design project, students are given a first exposure to a peer feedback questionnaire in which they assess their own attitudes and performance on the team and as well as those of their team-mates. This thread in teaming is continued in the second design course by revisiting the peer-feedback questionnaire at mid- semester and the use of team charters where individuals work together in the team to identify and document personal and team development goals. At the end of the semester a final peer- feedback questionnaire is used to assess team development and also to modulate an individual group project grade to reflect the contributions of the individual team members. Extension of the teaming thread into subsequent design courses is planned. In this paper, the experience and assessments from the freshman year part of the teaming thread are discussed. In particular, we provide analysis of the relationships between prior teaming experiences and actual behavior as measured through peer and self-evaluation and provide inferences on how these can be used as assessment tools and for personal development.
The ability to work effectively in teams, and especially multidisciplinary teams, is a key competency needed of engineers to be successful in the 21st Century workplace. The imperative for addressing this issue is reflected in national reports on the future of engineering education1,2 and also specifically in the ABET Engineering Criteria for accreditation which require all undergraduate engineering programs to include teaming in their educational outcomes and the associated assessment. This need to address teaming has been driven by the advocacy of industry which has long recognized its importance. Not surprisingly, much of the research and skill development approaches related to effective teaming are found in the management literature. It is only relatively recently that we see this area being addressed in the engineering education literature as the profession seeks to understand and implement appropriate means to develop team skills in engineering students. While engineering educators can certainly learn from the body of knowledge associated with teaming in the business world, they also have to respond to the fact that students are not subject to the same contextual issues that teams and team members experience in business. Students are engaged in smaller projects of shorter duration, with significantly less at stake in the success of the team than will typically be the case after graduation. To put it more bluntly, students do not have their livelihood on the line. The maturity and experience of students are also typically limited and these can influence perspective in approaching teamwork and the development of the requisite skills. Thus, addressing effective teaming skills through the undergraduate engineering curriculum represents a significant challenge.
Sheppard, K., & Dominick, P., & Blicharz, E. (2008, June), Developing Team Work Skills Through A Core Design Thread Paper presented at 2008 Annual Conference & Exposition, Pittsburgh, Pennsylvania. 10.18260/1-2--3234
ASEE holds the copyright on this document. It may be read by the public free of charge. Authors may archive their work on personal websites or in institutional repositories with the following citation: © 2008 American Society for Engineering Education. Other scholars may excerpt or quote from these materials with the same citation. When excerpting or quoting from Conference Proceedings, authors should, in addition to noting the ASEE copyright, list all the original authors and their institutions and name the host city of the conference. - Last updated April 1, 2015 | <urn:uuid:018c8141-adc4-410a-af0d-a8cfe4872870> | CC-MAIN-2022-33 | https://peer.asee.org/developing-team-work-skills-through-a-core-design-thread | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570741.21/warc/CC-MAIN-20220808001418-20220808031418-00065.warc.gz | en | 0.953778 | 834 | 2.390625 | 2 |
The “Irelands Ocean Economy” series of reports have been produced the NUI Galway’s Socio-Economic Marine Research Institute and form part on an ongoing process of collection of subsequent analysis of marine socio-economic data. The work was undertaken by the Socio-Economic Marine Research Unit (SEMRU) at NUI Galway and Teagasc. The main research focus of the unit is on the economic importance of coastal and off-shore marine environments. This involves examining the economic utility of the marine environment (e.g. transportation, recreation) and ecological value (e.g. fisheries, aquaculture) derived from the productivity of associated ecosystems.
Questions this practice may help answer
- What methodologies exist for economic marine data collection?
- What are the current economic trends across existing and emerging sectors in Ireland?
- What sources of marine socio-economic data exist?
- How easy is it to compare socio-economic data between different countries?
The aim of the Irish Ocean Economy Series is to establish a common methodology and provide comparative data to facilitate the identification of trends in the marine economy and ascertain the impacts of policy and other interventions on these trends. The Ireland’s Ocean Economy Report Series is funded through the Beaufort Marine Research Award, which is carried out under the Sea Change Strategy and the Strategy for Science Technology and Innovation (2006-2013) which identified the need to build capacity in the field of marine socio-economics.
Marine socio-economic data are not readily available in Ireland. However, they are essential in determining the value of Ireland’s ocean economy, so as to realise its full potential. SEMRU began the extensive task of data collection and analysis of Ireland’s ocean economy in 2009. This work has resulted in the publication of a series of reports every two years with a view to consistently monitoring Ireland’s Ocean Economy and compile a cross sectoral profile.
Aspects / Objectives
The key objective of the Ireland’s Ocean Economy reports is to provide quantification and monitoring of Ireland’s marine data in order to fully quantify data from key sectors which contribute to the ocean economy of Ireland consistently over time and therefore create a comparable sectoral profile. This work will allow policy makers and government to assess whether targets are being met in accordance with those set out in ‘Harnessing Our Ocean Wealth’ (Integrated Marine Plan for Ireland, 2012). The Harnessing Our Ocean Wealth Strategy seeks to expand the Irish Marine Sector to a total of €6.4bn in 2020 representing an increase of €3.2bn on 2010.
The key aims are:
- Provide a profile of Ireland’s ocean economy (in the latest version of the report for 2014-2016 )
- Provide estimates for turnover, Gross Value Added1 (GVA) and employment Assist in monitoring progress of a number of targets set out in the Government’s Integrated Marine Plan for Ireland - Harnessing Our Ocean Wealth (2012)
- Provide an overview of the policy environment and outlook for sectors where appropriate
- Reports will be periodically updated (latest release 2017, 4th version)
For the purpose of the report, the ocean economy has been defined as any economic activity that directly or indirectly uses the sea as an input or produces an output for use in a sea-specific activity. The coastal economy, on the other hand, represents all economic activity that takes place in the coastal region; for example, agriculture, which is not part of the ocean economy.
Definitions of marine-based industries within the ocean economy differ across countries. The general approach taken to produce the latest report was as follows:
- Revise and update the industries from previous reports that are part of the ocean economy
- Identify the marine sectors for which there is publically available data
- Estimate the proportion of economic activity that is marine-based using proxies
- Record levels of turnover, employment and gross value-added for each industry that is in the ocean economy
- Identify sectors where alternative data collection methods must be developed, i.e. surveys
- Certain sectors are clearly identifiable as fully marine, for example shipping and maritime transport or sea fisheries.
Data on other marine activity can often be difficult to obtain; for example, marine engineering data cannot be differentiated from general engineering using the data collected by the Central Statistics Office (CSO). Therefore, these sectors require additional work (surveys/proxies) to ensure that they are represented in the ocean economy. The general approach adopted in this report for assessing Ireland’s ocean economy has been concerned with production activity. The Business Demography (BD) and Structural Business Statistics (SBS) Division in the CSO provides data on turnover, GVA, employment, and where available, exports for each sector within the Irish economy. The data are collected across a number of censuses and surveys. The CSO census and surveys used for the collation of the data on Ireland’s ocean economy include:
- The Census of Industrial Production (CIP)
- The Annual Services Inquiry (ASI)
- Building and Construction Inquiry (BCI)
- Business Register
N.B. The data relating to marine activity from these censuses and surveys is provided at the NACE four-digit level.
A detailed description of the methodology regarding data collection and analysis for each sector is available Appendix of the latest version (2017) of the report.
Main Outputs / Results
The report identified a number of key direct economic impacts which can be summarised as follows:
- The ocean economy had a turnover of €5.7 billion in 2016.
- The indirect economic value in 2016 amounted to €1.57 billion, with a total direct and indirect value of €3.37 billion, which represents 1.7% of GDP.
- The ocean economy provided employment to over 30,000 individuals, full-time equivalents (FTEs) in 2016.
- Established Marine Industries had a turnover of €5.3 billion and provided employment to 28,231 FTEs in 2016, representing 93% of the total turnover and 94% of total employment in Ireland’s ocean economy in 2016. Oil and gas exploration and production, marine aquaculture and tourism and leisure in marine and coastal areas, all experienced a significant increase in activity, with turnover, GVA and employment increasing across the sector in the 2014-2016 period. The shipping and maritime transport sector also exhibited increases, albeit of a smaller scale, across all three variables.
- Emerging Marine Industries had a turnover of €383 million and provided employment to close to 2,000 FTEs representing 7% of the turnover and 6% of employment in Ireland’s ocean economy in 2016. Advanced marine technology products and services and marine renewable energy experienced the largest increases in turnover and gross value add (GVA), while employment rose in all emerging sectors in the 2014-2016 period.
This report is specific to the marine economy of Ireland however the methodology could be used for other economies where comparable data sources exist.
Socio-Economic Marine Research Unit (SEMRU) at NUI Galway and Teagasc
Costs / Funding Source
Carried out with the support of the Marine Institute and it is funded by the Marine Research Sub-Programme PBA/SE/16/01 Valuing and understanding the dynamics of Ireland’s Ocean Economy. Direct costs of this practice elaboration are unknown.
Dr. Stephen Hynes,
Socio-Economic Marine Research Unit,
J.E Cairnes School of Business and Economics,
National University of Ireland, Galwa | <urn:uuid:4126bfb8-2bc4-43ba-8d32-b42e9c8e88f7> | CC-MAIN-2022-33 | https://maritime-spatial-planning.ec.europa.eu/practices/irelands-ocean-economy | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.903258 | 1,617 | 2.0625 | 2 |
Vor 1 Tag · Polish (Polish: język polski, [ˈjɛ̃zɨk ˈpɔlskʲi] ( listen), polszczyzna [pɔlˈʂt͡ʂɨzna] ( listen) or simply polski, [ˈpɔlskʲi] ( listen)) is a West Slavic language of the Lechitic group, written in the Latin script. It is spoken primarily in Poland and serves as the native language of the Poles.
Vor 1 Tag · German is the second most commonly used scientific language as well as the third most widely used language on websites after English and Russian. Deutsche Welle (German pronunciation: [ˈdɔʏtʃə ˈvɛlə]; "German Wave" in German), or DW, is Germany's public international broadcaster. The service is available in 30 languages. DW's satellite ...
Vor 8 Stunden · The sortable table below contains the three sets of ISO 3166-1 country codes for each of its 249 countries, links to the ISO 3166-2 country subdivision codes, and the Internet country code top-level domains (ccTLD) which are based on the ISO 3166-1 alpha-2 standard with the few exceptions noted. See the ISO 3166-3 standard for former country codes.
Vor 1 Tag · Spanish ( español or castellano, Castilian) is a Romance language of the Indo-European language family that evolved from colloquial spoken Latin in the Iberian Peninsula of Europe. Today, it is a global language with nearly 500 million native speakers, mainly in the Americas and Spain. Spanish is the official language of 20 countries. | <urn:uuid:59a1a94a-d08d-42a5-889f-f1010c97611c> | CC-MAIN-2022-33 | https://de.search.yahoo.com/mobile/s?p=Czech+language+wikipedia&nojs=1&ei=UTF-8&_lang=de&_intl=de&age=1d&nocache=1&fr2=time&btf=d&fr=onesearch | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00065.warc.gz | en | 0.860129 | 392 | 2.875 | 3 |
Image 6 of 9
Titan Arum Amorphophallus titanum
The titan arum or Amorphophallus titanum is one of the world's largest flowers. Its bloom can reach over 3 metres and only lasts for 4 days. When fully open, the flower smells like rotting flesh, to attract pollinators, earning it the nicknames carrion flower, corpse flower, or corpse plant. | <urn:uuid:c5453f1a-2e6c-4e75-9adf-9a6c7da4ec17> | CC-MAIN-2022-33 | https://photos.acmphotography.com/gallery-image/Titan-Arum-Amorphophallus-Titanum-Flower-Stock-Photos/G0000AM3En.oihzQ/I0000OxfGLHBczWk/C0000lknDyNfLpIc/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.763369 | 98 | 2.390625 | 2 |
Macbeth once again teamed up with Patrick W. Engel for the recordings of their 5th album, because being a former band member himself, he knows what makes the band tick.
The lyrics deal with topics such as religious fanatism, wartime atrocities, propaganda and the impact all of this has on mankind.
From a musical point of view, Macbeth followed the path that begun with their album "Gotteskrieger": The songs’ pace still varies, but overall "Gedankenwächter" turned out to be a bite faster than previous releases.
3. In seinem Namen
6. Neue Welt | <urn:uuid:f6d41c6d-87ef-457e-abbe-4bd2da9f655b> | CC-MAIN-2022-33 | https://www.music-merchant.shop/en/cd/2108/macbeth-gedankenwaechter-digipak-cd | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.877231 | 201 | 1.734375 | 2 |
ECOFISH Programme milestones, supported by Incatema, to ensure biodiversity preservation in the Western Indian Ocean
8 June, 2022
Upon celebrating World Oceans Day, we point out the main milestones of EU-funded ECOFISH Programme. Incatema provides technical assistance to this programme, one of the topics being biodiversity preservation in the Western Indian Ocean, meaning to raise awareness on sustainable development and its implications for fisheries sustainable management.
According to a study carried out by the World Bank in 2016, Western Indian Ocean region may increase its fisheries benefits by 5,000 million US dollars a year through policies oriented towards biodiversity protection, fisheries resources sustainable management and fight against illegal fishing. Benefits that may impact positively traditional fishers’ livelihoods and small-scale producers in Eastern and Southern Africa.
In the past quarter, annual ECOFISH Programme Steering Committee meeting in Lusaka (Zambia), shared the main results of the past year of program implementation ECOFISH. This meeting gathered the following organizations: Indian Ocean Commission (IOC), Common Market for Eastern and Southern Africa (COMESA), Eastern African Community (EAC), Lake Victoria Fisheries Organization (LVFO), Lake Tanganyika Authority (LTA), Intergovernmental Authority on Development (IGAD) and Southern Africa Development Community (SADC).
In the frame of this programme, this past year has seen several collaboration frameworks being signed, such as a Memorandum of Understanding between the Indian Ocean Commission and Mauritius Open University, that dealt with the lack of specialised technical knowledge for fisheries in the region. This collaboration allowed, among others, to launch a bachelors’ degree course for Law, Blue Economy and Fisheries Sustainable Management, that has 20 students enrolled for its first year.
Introducing technology to improve fisheries sustainability
In addition to the milestones described above, the programme launched the Blue Economy Fisheries Satellite Accounts (BEFSA) to guarantee the development of biodiversity preservation and sustainable fishing policies, and that the follow up is evidence-based with data available at regional and national level. Through BEFSA, decision makers in the region benefit from pertinent data as evidence to steer efficiently and sustainably maritime resources in the Western Indian Ocean.
This way, introduction of innovative technology to professionalise further small-scale artisanal fisheries and improve its sustainability through tools such as smart fish aggregation devices. These devices, equipped with satellite technology, sensors, echosounder to estimate biomass and microprocessors, allow to collect and treat raw data on marine species so fishers can receive, via a mobile app, filtered useful information to improve their catches and, therefore, their revenue.
Fight against illegal fisheries
As for fighting illegal fisheries, ECOFISH Programme has recently completed grant award procedures to island and coastal states in the Western Indian Ocean for an aggregated value of EUR 2 million to finance surveillance operations, reinforcing governance for such initiatives and organising two regional patrols.
Programme partners, present in Lusaka, also stressed the importance to trace the most recent development trends in fisheries sector to satisfy real needs for economic operators, taking into account that overfishing and illegal fishing not only impact the oceans environment, but also increase the risk of natural disasters. | <urn:uuid:0e79c0e2-5e8c-49f3-92b8-2efab3b414d5> | CC-MAIN-2022-33 | https://incatemaconsulting.es/en/noticias/ecofish-programme-milestones-supported-by-incatema-to-ensure-biodiversity-preservation-in-the-western-indian-ocean/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.899643 | 652 | 2.53125 | 3 |
These patients report that they perform intended actions, even though they are paralysed and unable to move (Berti et al., 2005). This anosognosia was interpreted as showing that normal awareness of action is driven partly by both intentional signals, and by monitoring reafferent signals generated during actual movement. Dorsal premotor lesions appeared
to impair the integration of actual reafferent information, leaving the patient with an experience of agency that relied only on their intentions, without any feedback from the affected limb’s lack of movement. One might therefore interpret the dorsal Ivacaftor in vitro premotor cortex as binding the sensory effects of action with the intentional action that caused them. This interpretation is also consistent with our data: stronger activation of this area was associated with stronger binding between action and effect. Moreover, our activation was found in the left hemisphere, in a task where participants responded with their right hand. Intentional
binding may depend on both predictive processes (e.g., motor command signals, Blakemore et al., 2002; Wolpert and Ghahramani, 2000) and on post-hoc reconstruction PD-0332991 mouse (Dennett and Kinsbourne, 1992; Wegner, 2002). The prediction account suggests that compression of perceived time occurs because neural preparation for action already triggers anticipation of the effects of action. In contrast, reconstructive accounts suggest that the mind infers and constructs a narrative
in order to explain bodily movements or their external Chloroambucil consequences after the fact. Recent behavioural studies suggest that intentional binding includes both predictive and reconstructive components (Moore and Haggard, 2008). The current design does not allow us to formally separate the predictive and reconstructive components of sense of agency. We speculate that the computations within BA6 that underlie the sense of agency may recapitulate the medio-lateral gradient for the generation of action. Predictive contributions to sense of agency would rely on intentions and motor plans, and would be housed more medially, while reconstructive contributions to sense of agency would rely on integration of external sensory feedback, and would be housed more laterally. Therefore, the fact that our intentional binding cluster effectively straddles the intermediate zone between medial and lateral subdivisions may reflect the combination of both predictive and reconstructive processes. The two processes cannot be dissociated using interval estimation, but could be distinguished in future studies using estimates of action timing, and varying the probability that an action produces a tone. We found no evidence that the angular gyrus was associated with our implicit temporal measures of sense of agency. | <urn:uuid:02c5429f-c38a-476c-86f8-cfca06a680ea> | CC-MAIN-2022-33 | https://proteasomesignaling.com/index.php/2017/10/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.930458 | 527 | 1.859375 | 2 |
Thank you for your interest in learning more about Hope. The Adult Hope Scale and Children’s Hope Scale below use the Snyder Hope Theory and associated cognitive model of hope. Snyder defines hope as “the perceived capability to derive pathways to desired goals and motivate oneself via agency thinking to use those pathways.” By using Snyder’s Hope Theory, we can identify where you are on your hope journey and predict how hope will impact various outcomes in your life, including academic achievement, work success, athletic performance, health, and resilience.
Disclaimer: The scores on these self-assessments do not reflect any particular diagnosis or course of treatment. They are meant as a tool to help assess your level of hope. If you have concerns about your current wellbeing or health, you are encouraged to share your results with a physician or healthcare provider. Innovative Analysis, LLC sponsors, partners, and advertisers disclaim any liability, loss, or risk incurred as a consequence, directly or indirectly, from the use and application of these measures. | <urn:uuid:4fe72896-8a86-4584-a032-1fefe963ea27> | CC-MAIN-2022-33 | https://www.ifred.org/hope-scales/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.932132 | 212 | 2.390625 | 2 |
International and domestic trade in cannabis is nascent yet continues to grow. Internationally, over the last few years, jurisdictions such as Colombia, Poland, and several Africa countries, among others, have made significant progress in developing local cannabis production capabilities. At the same time, truly global cannabis trade remains hampered by prohibitions set out in the international drug treaties which are in turn implemented in highly restrictive domestic laws, regulations and policies. Within this evolving landscape, several developments are noteworthy for international and domestic trade in cannabis for Canada, including the Commission on Narcotic Drugs’ (CND) vote to reject amendments to the international drug treaty framework that would have liberalized trade in cannabis products, the beginning of negotiations on cannabis under the Canada Free Trade Agreement, and the liberalization of cannabis in Mexico, including the imminent legalisation of recreational cannabis. We summarize these developments below, along with an overview of import/export trends.
Canadian import/export trends
The Canadian cannabis market has grown significantly in the past years. Estimates show that the Canadian cannabis market was worth CA $2.6 billion in 2020, compared to CA $1.2 billion in 2019. By the end of 2020, there were 1,369 licensed retailers across Canada, a 100% increase within a one-year period and representing an average monthly growth rate of 6%. Projections show that the number of licensed retailers could be 2,540 by the end of 2021.
Generally, international trade of cannabis is still limited to trade for medical and scientific purposes and even this limited trade is subject to strict regulatory requirements. Nonetheless, there has been significant growth in export of cannabis from Canada, even within the limited medical and scientific purposes. In 2020, producers in Canada exported 15.6 tons of dried cannabis flower and approximately 7.3 kilolitres of cannabis oils and extracts, making Canada one of the largest exporters in the world, with Israel overtaking Germany as the main export destination in 2020. Medical cannabis exports from Canada in 2020 were valued at CA $53 million (US $43 million), representing a 229% increase from 2019. A significant portion of this value (83%) originates from cannabis flower sales, although it is likely that cannabis oil sales may be underreported due to inconsistencies in data submitted by exporters.
Interestingly, less than 8 kilograms of dried cannabis flower were imported to Canada during 2020, according to Health Canada data, compared to the approximately 15.6 tons exported. This disparity has not gone unnoticed. The Jamaican Minister of Industry, Commerce, Agriculture and Fisheries has noted the refusal of the Canadian government to allow importation of commercial quantities of cannabis to Canada. Similarly, other producers from Colombia, and Australia have noted Canada’s restrictive approach to imports, highlighting that this approach has a negative impact on patients who are being denied access to cheaper cannabis. This is indicative of possible non-tariff trade barriers, potentially contrary to Canada’s trade obligations.
On the export side, and to further bolster trade, as of January 2020, the federal government through Canada’s Trade Commissioner Service extended trade commissioner services for Canadian cannabis companies exporting cannabis for medical and scientific purposes. Additional business support would be provided through the Trade Accelerator Program, which provides eligible Canadian companies with strategic advice and resources to activate and scale their exports.
December 2020 Commission on Narcotic Drugs vote
In December 2020, the CND, the drug policy-making body of the United Nations (UN), faced a significant vote on several recommendations by the World Health Organization’s Expert Committee on Drug Dependence. If adopted, the recommendations would have liberalized cannabis trade under the UN Drug Treaties. If all recommendations were passed, further liberalization in domestic laws would likely have followed. Governments often rely on international conventions while crafting their approach to cannabis legislation and while these international conventions do not determine domestic regulatory developments, they can serve as a prompt to encourage liberalisation of cannabis legislation in domestic markets.
However, only one recommendation passed. Cannabis and cannabis resin were removed from Schedule IV of the 1961 Convention. In doing so, the CND recognized their medicinal value. Prior to December 2020, cannabis and cannabis resin were included in Schedules I and IV of the 1961 convention, meaning that they were classified along dangerous and highly addictive opioids like heroin and fentanyl which are not known to have medicinal or therapeutic purposes. Following the CND vote, cannabis and cannabis resin would instead be included in Schedule I of the 1961 Convention, along other medicines like morphine and oxycodone. This rescheduling means that cannabis is no longer classified with deadly and addictive opioids. The CND retained cannabis and cannabis resin in Schedule I of the 1961 Convention. Hence, it remains controlled for the purposes of trade to medicinal and scientific purposes.
The CND refused other recommendations from the WHO. Tetrahydrocannabinol and delta-9-tetrahydrocannabinol (known as THC) remain in Schedules I and II of the 1971 Convention respectively. The CND refused approve the WHO’s recommendation to reclassify these substances into Schedule I of the 1961 Convention, which would have given them similar treatment as cannabis and cannabis resin. The CND also refused to delete extracts and tinctures of cannabis from Schedule I of the 1961 Convention, thereby still restricting their use to medicinal and scientific purposes. Furthermore, the CND rejected the recommendation to remove preparations containing predominantly cannabidiol and not more than 0.2 percent of THC from international control. In this regard, in Canada, they remain heavily regulated and trade is limited to medical and scientific purposes.
Inclusion of cannabis in the Canada Free Trade Agreement
The Canada Free Trade Agreement (CFTA) came into force on July 1, 2017, and is the successor to the Agreement on Internal Trade. During the CFTA negotiations, cannabis was not legalized in Canada, and the CFTA does not apply to measures adopted with respect to cannabis for non-medical purposes. In December 2019, the Committee on Internal Trade (CIT) launched discussions on incorporating non-medical cannabis into the CFTA. These discussions address both federal and provincial/territorial concerns, including wholesale distribution and retail. Negotiations include the elimination of internal barriers to trade, including but not limited to provincial bans and taxes on products such as vaping devices, as well as business registration and licensing requirements, which may hinder the seamless operations of cannabis companies seeking to expand to other Canadian provinces.
Inclusion within the CFTA would make measures relating to non-medical cannabis subject to CFTA’s core obligations on goods and services. This includes provisions on technical barriers to trade, sanitary and phytosantiary measures, market access, and licensing and qualification. It can also produce stronger regulatory coherence, through work under the Regulatory Reconciliation and Cooperation Table which promotes regulatory cooperation throughout Canada. For example, for alcohol there is there is a specific federal-provincial-territorial action plan for trade.
A timeline was proposed for the incorporation of cannabis into the CFTA at a CIT teleconference in December 2019, and in September 2020. However, these discussions have been delayed in light other priorities, particularly the COVID-19 pandemic.
Mexico’s cannabis liberalization – an opening for cannabis trade?
In 2018, the Mexico Supreme Court declared the prohibition of personal use, possession and private cultivation of cannabis unconstitutional, and in June 2021, a court decision decriminalised recreational use of cannabis in Mexico. Alongside these decisions, Mexico is on the cusp of liberalizing cannabis. In March 2021, the lower house approved a bill legalising the recreational use of cannabis. The bill awaits approval from the senate and then presidential approval. Mexico will be only the third country in the world to fully legalize all aspects of cannabis consumption and production countrywide, after Uruguay and Canada.
Imminent liberalization of recreational cannabis in Mexico, raises questions about the potential of increased trade in cannabis between Canada and Mexico. Although international trade in cannabis remains limited to medical and scientific purposes, even within this ambit, import and export of cannabis could take on a different dimension with a bigger market between Canada and Mexico, and also presents opportunities for backward integration of supply chains. Mexico is better positioned — due to its climate — to produce cannabis outdoors throughout the year, but Canada has a more established ecosystem of producers, distributors, retailers and financial backers, along with related service providers who may see opportunities to export their services, expertise and know-how.
Notably, under the Canada-United States-Mexico Agreement (CUSMA), for both the United States and Canada, only tetrahydrocannabinols (THC) (all isomers) attract zero tariffs. Hence, minor amounts of THC in products, such as hemp or cosmetics, that may not require permits for international trade attract zero customs duties. Canada and the US’ tariff schedule, however, do not include cannabis and other derivatives. Hence, those products, at least at this time, would not benefit from the CUSMA’s tariff reduction, and key obligations of national treatment for such products. On the other hand, Mexico’s tariff schedules show that cannabis sativa, cannabis indica, cannabis indicia mixed with other seeds, cannabis derivatives, tetrahydrocannabinols and cannabis indica-based preparations do not attract tariffs. Goods included in these schedules can be imported into the destination country without paying import duties. Other than tariffs, the CUSMA provides significant intellectual property protections for trademarks and patent terms. Further, cannabis companies can benefit from labour mobility provisions should further liberalization occur.
While Canada and Mexico still face significant hurdles to trading cannabis for recreational purposes, potential opportunities exist for international trade in cannabis for medicinal and scientific purposes.
International and domestic trade in cannabis will continue to evolve for years to come. Import and export trends, along with increased focus on how trading instruments can promote trade in cannabis is just beginning. While international trade in cannabis is highly controlled, teasing out how firms can benefit from agreements such as the CUSMA and other trade agreements is the next step to a further globalization of cannabis. Within Canada, we are seeing these first steps being taken with the start of negotiations to include cannabis within the CFTA.
We wish to thank Mariam Momodu for her research and drafting assistance.
The core UN drug control treaties are the Single Convention on Narcotic Drugs of 1961, as amended by the 1972 Protocol (1961 Convention), the 1971 Convention on Psychotropic Substances (1971 Convention), and the 1988 United Nations Convention against Illicit Traffic in Narcotic Drugs and Psychotropic Substances (1988 Convention). These are known as the UN Drug Treaties.
“A Look at Cannabis Store Counts by Province”, (11 January 2021), online: Business of Cannabis <https://businessofcannabis.com/2021/01/11/a-look-at-cannabis-store-counts-by-province/>.
Ibid; World Drug Report 2021. Drug Market Trends: Cannabis, Opioids, by United Nations Office on Drugs and Crime, World Drug Report 3 (Vienna, Austria: United Nations Office on Drugs and Crime, 2021) at 34.
note 2; At the end of July 2021, the number of stores had reached 2,277 “A Look at Cannabis Retail Store Count by Province”, (3 August 2021), online: Business of Cannabis <https://businessofcannabis.com/2021/08/03/a-look-at-cannabis-retail-store-count-by-province/>.
Eric Foster, Paul Lalonde & Sean Stephenson, “Global Cannabis Trade: A Primer on Canadian Import/Export Requirements for Cannabis”, (15 January 2020), online: Dentons Insights <https://www.dentons.com/en/insights/alerts/2020/january/15/global-cannabis-trade-a-primer-on-canadian-import-export-requirements-for-cannabis>.
Conor O’Brien, “Revealed: The Canadian Cannabis Export Market for 2020”, (30 April 2021), online: Prohibition Partners <https://prohibitionpartners.com/2021/04/30/revealed-the-canadian-cannabis-export-market-for-2020/>.
Health Canada, “Data on Cannabis for Medical Purposes”, (15 June 2021), online: <https://www.canada.ca/en/health-canada/services/drugs-medication/cannabis/research-data/medical-purpose.html> Last Modified: 2021-06-15; O’Brien, supra note 6.
Matt Lamers, “Canada Accused of Cannabis ‘Protectionism’ by Blocking Imports – Even as Exports Soar”, (19 August 2020), online: MJBizDaily <https://mjbizdaily.com/canada-accused-of-cannabis-protectionism-by-blocking-imports/>.
“Canadian Medical Cannabis Firms Eligible for Federal Government Funding”, (24 January 2020), online: MJBizDaily <https://mjbizdaily.com/canadian-cannabis-firms-now-eligible-for-trade-commissioner-service-support/>.
“Canada’s Trade Accelerator Program”, online: Greater Vancouver Board of Trade <https://www.boardoftrade.com/wtc/tap>.
Sean Stephenson, “Update: An Opening for Global Trade in Cannabis? What December’s Vote Under the UN Drug Treaties Means for Global Cannabis Trade”, (3 December 2020), online: Canada Regulatory Review <https://www.canadaregulatoryreview.com/update-an-opening-for-global-trade-in-cannabis-what-decembers-vote-under-the-un-drug-treaties-means-for-global-cannabis-trade/>.
Sean Stephenson, “An Opening for Global Trade in Cannabis? What December’s Vote Under the UN Drug Treaties Means for Global Cannabis Trade”, (26 November 2020), online: Canada Regulatory Review <https://www.canadaregulatoryreview.com/an-opening-for-global-trade-in-cannabis-what-decembers-vote-under-the-un-drug-treaties-means-for-global-cannabis-trade/>.
Report on the Reconvened Sixty-Third Session, E/2020/28/Add.1 (United Nations Commission on Narcotic Drugs, 2020).
Matt Lamers, “Talks Underway in Canada to Add Cannabis to Internal Free Trade Deal”, (17 April 2020), online: MJBizDaily <https://mjbizdaily.com/talks-underway-in-canada-to-add-cannabis-to-internal-free-trade-deal/>; “Ministers Meet to Discuss Ongoing Initiatives to Improve Internal Trade”, (17 September 2020), online: Canadian Free Trade Agreement <https://www.cfta-alec.ca/ministers-meet-to-discuss-ongoing-initiatives-to-improve-internal-trade/>.
Lamers, supra note 18.
Sammy Westfall, “Legal Marijuana in Mexico: Top Court Rolls Back Cannabis Prohibition, Opening Door to Legalization”, The Washington Post (29 June 2021), online: <https://www.washingtonpost.com/world/2021/06/29/marijuana-legalization-court-ruling-mexico/>.
“Mexico Marijuana: Lower House Passes Recreational Cannabis Bill”, BBC News (11 March 2021), online: <https://www.bbc.com/news/world-latin-america-56356015>.
“Canada-United States-Mexico Agreement (CUSMA) – Table of Contents”, (26 November 2020), online: Global Affairs Canada <https://www.international.gc.ca/trade-commerce/trade-agreements-accords-commerciaux/agr-acc/cusma-aceum/text-texte/toc-tdm.aspx?lang=eng> Last Modified: 2020-11-26. | <urn:uuid:584a56df-0f4f-4d44-8572-89410c636f88> | CC-MAIN-2022-33 | https://www.canadaregulatoryreview.com/international-trade-in-cannabis-international-and-domestic-regulatory-developments/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.91736 | 3,605 | 1.664063 | 2 |
Safe Haven for Newborns Information Safe Haven, also known as “infant relinquishment,” allows a parent to leave their newborn in a safe place in certain circumstances with certain individuals. What if I change my mind? If you change your mind, please contact the County Human or Social Services Department in the county where you left the baby with a professional under the Safe Haven law. Before the county will consider returning the baby to you, you must first prove you are the baby’s parent. A genetic test can prove you are the parent. If you are the parent, you must take a number of steps before the child may be returned to you, including: Meeting with a County Social Worker; Having the County worker visit your home or where you plan on living with the child; Providing information on why you gave up the baby; Providing information on the health of the baby; Providing information on your ability to care for the baby, including parenting skills; Providing information on anything that may keep you from caring for the baby; and Providing information on your relationship with the baby’s other parent. Based on all of this information, you may be asked to receive services to make sure the child will be safe in your care. The county and the court will make the final decision on the child’s return to your home. How does Safe Haven (Infant Relinquishment) work? Under Wisconsin law, a parent can leave their unharmed newborn child under 72 hours old with a: police officer 911 emergency medical staff person hospital staff member without fear of legal consequences. If you do not indicate that you will be back for your child this is called “Safe Haven” or “Infant Relinquishment.” You do not have to give your name or address to the professional accepting the baby, unless: The baby has been harmed You are being forced by someone to give up the baby The baby is more than 3 days old You may be asked if you are willing to fill out a form. This form is NOT required. It will, however, help providers give the best care to your infant now and in the future. Questions About You and the Infant - English Questions About You and the Infant - Hmong Questions About You and the Infant - Spanish Health Information for Birth Mothers: After women give birth they experience physical and emotional changes. Information about these changes and warning signs that could indicate you have serious health issues are reviewed in this handout. Information Hotlines: Maternal and Child Health Hotline provides information and links to services for pregnant and postpartum women and children. Hotline: 1-800-722-2295 Safe Place for Newborns provides information on Safe Haven laws and crisis support. Crisis Number: 1-877-440-2229 Additional Information Learn about birth parent support at the Wisconsin Adoption Information Center or call 1-800-571-1105. There is also information for parents or soon-to-be parents thinking about adoption for their child(ren). | <urn:uuid:ba5c6aa9-e85b-4477-a1f9-b83a66d72673> | CC-MAIN-2022-33 | https://dcf.wisconsin.gov/cps/safehaven | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.926681 | 622 | 2.0625 | 2 |
Curious about why Irish people love to party on this day?
According to the legend, St. Patrick was a christian missionary who supposedly got rid of all the snakes in Ireland during the 5th century. S. Patrick's Day is celebrated worldwide on March 17 and it is the Irish tradition to celebrate with a lot of beer!!!
We have prepared for you an unbelievable night tour experience in the famous Bairro Alto! Let's celebrate St. Patrick's day together!
Note 1: This Event is exclusive for Erasmus Life Lisboa Cardholders.
Note 2: Make sure you book your place as soon as possible as all events have limited places. | <urn:uuid:75a98955-4712-4d76-a071-9c6e9d850a4f> | CC-MAIN-2022-33 | https://www.erasmuslifelisboa.com/events-trips-21/saint-patricks-pubcrawl-17-03-2022/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.963826 | 144 | 2.34375 | 2 |
RACHEL ATTITUQ QITSUALIK
I love to gaze at nativity scenes at this time of year. There are all varieties, all shapes and sizes, from minuscule ones that you can place on your shelf to life-size replicas all afire with splendour and radiance. Some are clay with painted faces, others white porcelain, trimmed with gold. There are collections that you can set up yourself, with as many sheep or angels as you wish. In many, Mary is depicted as adoring her new baby, while Joseph is off to the side, looking on. Wise men kneel before the rough wooden cradle, and there is a star above the whole scene.
To me, it is a symbol of what has become the drama of the Christmas message: the Christ child recognized as the coming King; God’s love for mankind as he reaches out to us in our own form. And not only to us, but to all creation as well, for a variety of animals are present, surrounding the cradle in the manger as witnesses to this marvellous event. There are choirs of angels in the starry sky. There are rejoicing shepherds.
I try to imagine what it must have been like to have been a lowly manger owner, kind enough to give shelter to travellers, one of whom was heavy with child. Did he also give them supper to eat? Who owned the sheep? Where did the wise men stay? Did they bring tents?
We are given an opportunity to guess at what Mary might have felt, knowing something of what lay before her, perhaps mulling it over in her heart.
How, then – as I observe our Christmas traditions today – did we stray so far from the simplicity of rejoicing in the humble beginnings of this truly grand faith? How did we go from that simple message – Good News for Mankind – to the complexity and insanity that we consistently experience at this time of year? Its transformation over two millennia is as startling as its original message.
I’m not humbugging Christmas, here. I enjoy my holiday celebration, even a bit of the commercialism, as much as everyone else. In some past years, I’ve even enjoyed it a teensy bit too destructively for my own good. I’m sure that many people can say the same. But I still wonder if we, in our fantastic rush to get it further, faster, better, and more fun, missed the major point of it all?
I don’t even object to the mixing of other traditions, so called “pagan” elements, into the holiday season. Everyone has their way, and most of the festive stuff is tribal in origin anyway. I like Santa Claus, Christmas trees, Disney cartoons, and even the endless reruns of “A Christmas Carol”. On the other hand, I can do without the “Nutcracker Suite” either in skating or ballet form. Or carols sung in country ‘n’ western. But I still hang up my socks on Christmas Eve, and some poor soul had better fill them up. (Or I’ll pout on Christmas day).
As I get older though, and have gradually become more inured to the same old societal embarrassments — poverty within one of the world’s wealthiest nations, unchecked violence, the refusal to build much-needed housing, etc. — I rejoice more frequently in the simpler things of life. I guess that’s why, this time of year, it’s particularly significant that the star shines brightly over Bethlehem, and breaks through the darkness of night.
(As it was away in a manger, so long ago.) | <urn:uuid:76dd505f-eef2-41a0-9ab8-b54f0aff5251> | CC-MAIN-2022-33 | https://nunatsiaq.com/stories/article/nativity_scene/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.963706 | 788 | 1.796875 | 2 |
Texas Cotton, Soybeans: “Hit the Target” Website, Other Tools Help with...
Ohio Soybeans: Are Fall Herbicides Required in Xtend Fields?
South Carolina: Pay Attention to Wind Speed to Avoid Herbicide Drift
Indiana: Spring Burndown Applications To Weeds And Cover Crops
Florida Cotton, Soybeans: XtendiMax, Engenia, and Enlist Duo Now Registered for...
Tennessee Weeds: Make Sure to Use Correct Nozzles with New Herbicides
Mississippi: Enlist and Xtend – What Buffers are Mandatory?
Texas Cotton: New Technologies Add to Grower Responsibilities
Mississippi Weeds: Enlist and Xtend – What Mixtures Are Approved?
Mississippi Weeds: Enlist and Xtend – What Boom Specifications Are Required?
Florida: Using Dicamba Technology In 2017 – Frequently Asked Questions
New Addition to Hartzler’s Herbicide Promo Hall of Shame
Arkansas: Mandatory Online Certification Course for Engenia, Enlist Duo Applicators Now...
Dicamba Application: 3 Key Phrases You Need to Know – DTN
Indiana Soybeans: Approved Dicamba Herbicide Guide Available
Dicamba Tank Mixes: Farmers, Applicators Wait for More EPA Approved Products...
South Carolina: 2,4-D and Dicamba Precautions and Guidelines
Texas Cotton: Best Management Practices for Auxin-Tolerant Crop Tech
Tennessee: Xtend Herbicide Applications – Watch the Wind
Tennessee: Xtend Crop Stewardship – Using and Stewarding the Correct Herbicides
Page 3 of 4 | <urn:uuid:15cbc391-326c-40b6-8a4f-910c99877d97> | CC-MAIN-2022-33 | https://agfaxweedsolutions.com/tag/engenia/page/3/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.65914 | 405 | 1.53125 | 2 |
Delays with language skills that children acquire over their first three years.
This may include difficulty with:
Articulation and reading
Children may have difficulties with forming speech sounds. These difficulties may be associated with structural and motor-based difficulties, such as cleft palate, apraxia, cerebral palsy, down's syndrome and other chromosomal disorders.
Adult and Elderly
We have experience working with adults with various disorders and differences.
This may include:
- Post-stroke conditions
- Other disorders and differences | <urn:uuid:9525dae7-08b8-4402-a536-9c618abd4dfa> | CC-MAIN-2022-33 | http://www.abckidstherapy.com/services.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.949316 | 155 | 3.1875 | 3 |
In 2020, Bruton Town Council and One Planet Bruton set up a Safer Walking and Cycling Group led by Cllr James Hood.
Part of the Safer and Walking Cycling Group's vision is that, within ten years, almost all people living in Bruton will be able to walk to the shops, schools and station along safe and direct routes that are easy and safe to walk with a double buggy or in a wheelchair and .
The Group wanted to know how children got to school in Bruton and carried out a 'Walking and Cycling to School' survey in autumn 2020.
The online and hard copy survey could be completed by the parents or carers and students at all schools in Bruton. Bruton Primary School actively promoted it to parents so had a higher response rate than the other schools.
There were 48 responses to the survey for Bruton Primary School. The key findings for Bruton Primary School are that:
- 76 children are driven to school in Bruton from other local towns and villages
- 78% of children who live in Bruton walk to school
- Less than 1% of children in Bruton cycle to school
- Children and their parents want to walk and cycle more
- Safety is perceived as the main obstacle to both walking and cycling
- More and better crossings were the most requested improvement
A presentation of the results of the survey can be found here. | <urn:uuid:64c8032f-769f-43ea-a818-1a5cd43da103> | CC-MAIN-2022-33 | https://bruton2030.ning.com/blog/walking-and-cycling-to-school-in-bruton | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.977265 | 286 | 2.34375 | 2 |
With a globe in economic meltdown and uncertainty built into any step we take, it’s no wonder we hide themselves increasingly more into the web world of HIGH-DEFINITION tv and computers.
Departmental stores in addition to high-streets are all yet deserted yet online product sales are up. A expanding food cravings for High classification visiting is driving demand for a growing number of channels. Net video content is spreading out of control and it also all comes down to be able to space instructions what can we do in regards to the bandwidth dilemma?
You may nicely have noticed that we are in a world wherever impatience will be the norm, perhaps these days. Non regarding us seem to be ready to wait for anything at all, stand in line, or endure any situation that we deem to help be subsequent best.
‘Wait for a full week intended for my new automobile in order to be delivered? Forget it! I’ll take that one around there… ‘ Wait around fifteen minutes to be sitting at your favourite bistro? No thanks, we will feed on elsewhere!
Don’t tremble the head, My spouse and i bet that sounds like you!
Anyway, can you imagine the intense frustration of saving and investing out on the most recent all of singing-all dancing High Definition TV, only to find that generally there are still a small number of stations with the total capacity to be able to broadcast in HD!
(By the way, a new word on the skeptical, if might never observed HD TV SET – no longer! At minimum not but, because won’t seem to be almost any heading back to normal, grainy TV SET after your primary experience without being triumph over with feelings of tremendous aggravation and loss. )
So what’s being done by way of our broadcasters in order to supply more HD stations? Properly, unfortunately, at this second they could do incredibly little. ‘Surely, you must recognize how much bandwidth is taken up by way of the HIGH-DEFINITION channel in comparison to a regular channel, ‘ they be sad. Nonetheless do you? No, possibly definitely not, we just want in order to see! Let’s just point out you may squeeze three typical programs using the very same space used by that one big fat HD station – and this is the problem which has therefore far remaining the tv producers scratching their heads… in least it offers until presently.
We saw typically the release earlier this year involving the IBM CE thousands of server. A hardware qualified directly at the IPTV, online video streaming and transmitting sector. A few nights ago HP announced relationship with the same process in a position to grant HD processing on the 80% saving on living space. Don’t believe me personally still? Properly both these new servers will finally be able to are living up to the states on the box because of a revolutionary, new engineering referred to as CodecSys, from a good minor company called Broadcast International Inc. (BCST. ob).
The item lines will provide development and transcoding solutions regarding around the world broadcast, cable, dish, IPTV, telco, wireless together with going consumers, as very well as apps with regard to business/enterprise communications, training in addition to a digital signage. For example, the telco will be able to deliver HIGH DEFINITION more than DSL cable connections, and, wherever cable/satellite employees now have one HD channel, will have them in a position to deliver six different HD channels at the identical quality – great things!
So how does it work? Well, rather then counting on any single on the latest codecs to convert our viewing pleasure, typically the CodecSys technology uses a new multi-Codec approach, employing the real-time artificial intelligence method to manage libraries associated with common and specialized codecs. That fully patented method effectively changes codecs or maybe codec settings – on the fly instructions upon a scene-by-scene or also frame-by-frame basis. And the idea would appear there are a new multitude of purposes awaiting this holy-grail technology that could finally unlock the blockage in our bandwidth-hungry age. It will allow a good wide variety involving companies in order to make good quality video plus audio transmission at a fraction of the band width that, until now, has been ordinarily required.
As an application its future shows up rich and different, however, the boffins inside Message International have strongly established their sights in the video clip streaming and transmitting sector as the first location to master, teaming develop no less than ‘Big blue’ in addition to HP.
When Japanese IPTV seem fixed to turn the traditional hardware market on their brain, the CodecSys technology can provide the ultimate, top good quality in full-screen, full-motion movie at the least expensive possible bandwidths allowing for typically the broadcasting and video clip loading industry to eventually develop along with consumer requirements. | <urn:uuid:92dd8009-dcbd-4285-addc-d600b948c7bf> | CC-MAIN-2022-33 | https://www.customworksdaytona.com/iptv-and-the-great-band-width-problem-what-can-be-codecsys/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571502.25/warc/CC-MAIN-20220811194507-20220811224507-00065.warc.gz | en | 0.939992 | 1,015 | 1.601563 | 2 |
How To Snap Start Like A Pro Youtube
Press and hold the right hand [alt] [fn] and then hit [space] takes a screenshot within an app (but not the desktop) 2. hardware keys. key combo: win volume down. this is the go to method for. If you guys want to support this channel. consider picking up a yoyo at offsetyoyo thanks for the support guys. you guys asked the question. Go to the app store (for apple ios) or the google play store (for android) and download the app to your device. 2. create a regular snapchat account. before you set up a business account, follow these steps to create a regular account: open the snapchat app and tap sign up. The basic approach here is to simply do the basic snapping motion, only with your thumb shifted down one finger. in other words: press the pad of your thumb against the pad of your ring finger. fold your pinky down against your palm or the base of your thumb. build up pressure between your thumb and ring finger. The traditional snap is the most basic quarterback center exchange. it is the first type taught at a pee wee football level, and it is used at every level of football. the quarterback lines up under the center and readies himself for the snap. the center snaps the ball, bends his wrist, and delivers directly into the hands of his quarterback.
How To Use Snapchat Like A Pro According To A Millennial Business
Snap with a keyboard. select the window you want to snap and press the windows logo key left arrow or the windows logo key right arrow to snap the window to the side of the screen where you want it to be. you can also move it to a corner after snapping it. with the window selected, press the windows logo key up arrow or the windows logo. To turn on the flash, tap the lightning symbol to the left of the camera icon. to snap a photo, tap the circle at the bottom of the screen. tap and hold the circle the take a video. with snapchat. Use windows 11 like a pro. a better way to copy and paste. using snap assist to maximize your available display space. windows 11 comes with new capabilities to make life easier—here’s how to make the most of them.
13 Quick Tips To Snap Pics Like A Pro
How To Snap Start Like A Pro
if you guys want to support this channel. consider picking up a yoyo at offsetyoyo thanks for the support guys. a tutorial on how to snap start a zippo lighter like the characters in the commode scene from the movie reservoir dogs. get the cheapest iphones here: amzn.to 3jtnwar get the cheapest androids here: amzn.to 3r2k1st follow me on how to bring a yoyo back up without winding it every time. learn this and it will save you a ton of time. check out my main channel in this video we are going to tell you how to use snapchat like pro!!! use these fun tricks for your snapscore and to keep streaks. 4 keys to have a more powerful snap shot that you can implement today! i breakdown how to take a snap shot and then show you streaming fortnite! (i'm better than you) m.twitch.tv jackandgab profile turn on my notifications and comment terry white takes you through a tour of the snapchat app and shows you how to quickly get up to speed as a beginner and the here are my best tricks to become a pro snapchatter! 🙂 subscribe for new diy videos every friday! more apple news: cultofmac snapchat — love it or hate it, chances are you're using it to playfully stay in touch with how to increase snapchat score fast! (100% works in 2022) this is how to increase snap score fast without jailbreak buffalo bills' long snapper reid ferguson shows sal capaccio the techniques of long snapping and gives sal a chance to try on | <urn:uuid:83dbfcf8-8efe-4ac7-8624-b20ff56025dd> | CC-MAIN-2022-33 | https://www.instumentalst.com/how-to-snap-start-like-a-pro/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.89203 | 835 | 1.523438 | 2 |
ALSTOM’s Flash Dryer Absorber (FDA) system is a dry FGD technology, which aims for simplicity and compactness. This first installation was in Poland at the 2×120 Mwe Lasiska site, and was commissioned in 1996. Since then there have been a number of important developments of technology, notably combination with an ESP, use of integrated lime hydration and use of ash from CFB as the reagent; supported by an ongoing test program. The technology also looks promising for the retrofit area. The combined full-scale plant for the removal of flyash and SO2 can often be fitted into the space occupied by the existing electrostatic precipitators. There are seventeen commercial installations of FDA in various stages of operation, construction, and design.
- Power Division
Alstom Power’s Flash Dryer Absorber for Flue Gas Desulfurization
- Views Icon Views
- Share Icon Share
- Search Site
Ahman, S, Barranger, CB, & Maurin, PG. "Alstom Power’s Flash Dryer Absorber for Flue Gas Desulfurization." Proceedings of the 2002 International Joint Power Generation Conference. 2002 International Joint Power Generation Conference. Scottsdale, Arizona, USA. June 24–26, 2002. pp. 813-819. ASME. https://doi.org/10.1115/IJPGC2002-26154
Download citation file: | <urn:uuid:e13177d1-94cd-472f-a473-ec7f7ee64c9f> | CC-MAIN-2022-33 | https://asmedigitalcollection.asme.org/IJPGC/proceedings-abstract/IJPGC2002/36177/813/292675 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.879814 | 311 | 2.125 | 2 |
Natural Remedies for Eye Pain is another one of those natural remedies that should be in everyone's toolbox of natural health care. While eye pain can be caused by a variety of factors, many can be treated at home successfully.
As an RN, member of the medical community and a mom, I love having solutions that work to try first, before seeking medical help. Unless, of course, it is important to seek that help first.
So, the question often asked is, when is it necessary to seek medical advice. My answer - If in doubt, seek it!
Let's discuss what can cause eye pain, common remedies and when to seek medical advice.
There is nothing quite like the feeling of eye pain. It can be a persisting irritation, stinging pain or even, a throbbing pain and acute headache.
Your eye may tear, may make you feel like you need to keep it shut or feel an intense pressure.
In this article, we’ll go over some of the things that may cause eye pain and some great natural remedies for eye pain that you can try at home.
Causes of Eye Pain
According to Healthline, these are the main issues that may cause pain on the surface of your eyes:
- Debris: Dirt or debris in the eye is the #1 cause of eye irritation and pain.
- Glaucoma: Glaucoma is an eye disease that can damage your optic nerve.
- External Eyelid Stye: This manifests as a small, read and painful bump on the outside of the eyelid.
- Conjunctivitis: More commonly known as “Pink Eye”, is an infection that causes swelling and redness in the outer-membrane of your eyeball.
- Sinus Infections: These can affect your eyes as well as your nasal passages.
- Nearsightedness: This is when far away items appear blurry and yes, it can cause your eyes to hurt. As can Farsightedness, in which items near to you are harder to see.
- Allergic Conjunctivitis: This is similar to “pink eye” but is usually caused by a common allergy, such as pollen.
- Dry Eye Syndrome: Chronic dry eye is a problem that affects many people and can definitely cause irritation and pain.
- Corneal Abrasions: This is a cut or scratch on the thin layer over your iris and pupil. Depending on severity, this cause could need medical care.
Natural Remedies for Eye Pain
Taking care of your eyes is so important. They are the only ones that you’ve got!
What is good for eye pain?
- Start with an eye wash - Rinse your eye, gently, with some cool sterile water or saline to see if there is any debris that can be loosened or removed.
- Cold Compresses - Take a cold or frozen washcloth or ice pack and place it on your eye for a few minutes at a time. This can be done several times a day and will help with comfort and any swelling.
- Warm Compresses - Using a warm compress several times a day will help with the pain of inflammation especially from a stye or eyelid infection.
- Castor oil - Try using an eye drop solution with Castor oil in it. Place one drop in each eye, at night, and then again in the morning.
- Aloe Vera - Because of aloe vera’s anti-inflammatory and antibacterial properties (1), some recommend using it to alleviate sore eyes. To use: Mix 1 teaspoon of fresh aloe vera gel into 2 tablespoons of cold water, and then soak cotton rounds in the mixture. Place the soaked cotton rounds on your closed eyes for 10 minutes. Do this twice a day.
Natural Remedies for Eye Pain and When to See Your Doctor
Since you are only given one pair of eyes, it is important to take care of them. Do not take any chances with your eyes! If you are unsure, seek medical advice.
When experiencing eye pain, make an appointment with your doctor if you:
- recently had eye surgery
- had an eye injection
- had eye surgery in the past
- wear contact lenses
- have a weakened immune system
- have been taking eye medication for two or three days and the pain hasn’t improved
Some symptoms need immediate medical attention. Seek emergency medical help if:
- the pain was caused by a foreign object hitting or been lodged in your eye
- your pain was caused by a chemical being splashed in your eye
- eye pain is accompanied by fever, headache, or unusual light sensitivity
- you have a sudden vision change
- you start seeing halos around lights
- eye is swelling, or there’s swelling around your eye
- unable to keep your eye open
- you’re having trouble moving your eye
- you have blood or pus coming from your eye(s)
As always, if something seems out of the ordinary or seems to last longer than it should, please seek the help of a licensed medical professional.
Have You Had Eye Pain - Did You Use a Natural Remedy
Leave a comment, I would love to know about it! | <urn:uuid:c6c19db0-2ca8-49e0-82a8-cfa0b96b5d90> | CC-MAIN-2022-33 | https://myculturedpalate.com/natural-remedies-for-eye-pain/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz | en | 0.942894 | 1,103 | 2.125 | 2 |
Recommendations and Opinions to Protect the Rights of the Older Persons from Traffic Accidents
- Over half of the pedestrian accident victims are older persons -
- Need for bold actions to protect the rights to life for senior citizens -
□ The National Human Rights Commission of Korea(Chairperson Doohwan Song, hereinafter the ‘NHRCK’ or the ‘Commission’) commented and recommended the following to the Chairman of the National Assembly, the Minister of Interior and Safety and the Commissioner General of the Korean National Police Agency on 13 May 2022.
- The NHRCK presented an opinion to the Chairman of the National Assembly to promptly review and legislate the ‘Partial Amendment Draft to the Road Traffic Act’, which is pending at the National Assembly.
- The NHRCK recommend conducting an overall assessment on the process of designating and managing ‘senior protection zones’, formulating measures to make more protection zones for the elderly and enhance the protection on older persons in the zones to the Minister of Interior and Safety and the Commissioner General of the Korean National Police Agency.
□ The report ‘Measures for Reducing Traffic Accident Deaths 2021’ says there were 1,039 pedestrian deaths in Korea as of 2020 and 628 of them were older persons (57.5%). The fact that the older persons take up over half of the pedestrian deaths when the group make up only 15.7% of Korean population(8.15 million) shows that older persons are particularly vulnerable to traffic accidents than other age groups.
□ The number of traffic accident deaths of the senior citizens over 65 years old (rate per 100,000 population) in Korea is around 22.8 cases. The number is roughly three times higher than the OECD average of 7.9 cases, and it is also strikingly higher than the second and third highest death rates on the list which are 13.5(Chile) and 13.4(the US) cases.
□ In this regard, the Commission viewed that more measures need to be implemented to improve the process of senior protection zone designation and management in order to protect the rights to health and life of the elderly from fatal traffic accidents. Unlike child protection zones, the current ‘Road Traffic Act’ does not make it compulsory for the authority to install surveillance equipment such as speed cameras and the equipment ensuring safe traffic flow, including traffic lights, in senior protection zones. The Commission also viewed that the current measure of simply identifying and designating an area where there are high chances of traffic accidents and calling it a ‘senior protection zone’ is not enough.
□ The NHRCK, therefore, saw that the speed limit in a senior protection zone has to be set under 30km/h, as it is the case for child protection zones, and that the regulation has to be formulated to make it a requirement for the relevant authority to install safety equipment in senior protection zones for traffic safety, so as to ensure the effective implementation of the Article 12-2 of the ‘Road Traffic Act’(‘Designation and management of Protection Areas for Senior Citizens and Persons with Disabilities’).
□ Incorporating all this, the National Human Rights Commission of Korea presented an opinion to the Chairman of the National Assembly that prompt review and legislation of the bills regarding the traffic safety for the older persons are highly encouraged. The Commission also provided recommendations to the Minister of Interior and Safety and the Commissioner General of the Korean National Police Agency to have an overall assessment on the whole system affecting senior traffic accidents and to formulate measures to enhance the rights for senior citizens to maintain their safety. | <urn:uuid:93944d11-1dea-4809-bf93-5408e2f4ab57> | CC-MAIN-2022-33 | https://www.humanrights.go.kr/site/program/board%20/basicboard/view?&boardtypeid=7003&menuid=002002001&pagesize=10&boardid=7607985 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00665.warc.gz | en | 0.939227 | 753 | 2.234375 | 2 |
Potassium Permanganate is an inorganic compound, it is also known as Condy's Crystals, Potassium Manganate (VII) or Permanganate of Potash. It has the appearance of dark purple crystals.
More Information on Potassium Permanganate
- Has many uses including the following :
- a strong oxidising agent in chemical compositions
- anti-bacterial agent for cleaning fish ponds
- disinfectant for treating mild dermatitis and athletes foot
- survival kits as a fire starter when mixed with glycerine
More Information on the applications of Potassium Permanganate
- High Quality with MSDS and COA.
- Packed in good quality packing.
- Normally Posted/Shipped on the day of purchase.
- All orders over 1kg are shipped using Tracked Shipping.
- You are welcome to collect / Inspect / Test at our premises. | <urn:uuid:f0e4582f-f0ef-4e3a-a02e-d81ae1d9c7c2> | CC-MAIN-2022-33 | http://potassium-permanganate.co.uk/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00065.warc.gz | en | 0.834466 | 226 | 2.0625 | 2 |
CONTRIBUTING TO THE ACCELERATION OF THE TRANSITION TOWARD GREENER TRANSPORT
The transportation industry – which includes airlines, railways, overland vehicles, shipping and more – represents about 25% of the world’s CO2 emissions1.
The marine industry is spearheading the energy transition by developing sustainable fuels, using alternative propulsion systems, and supporting offshore wind farm construction and operations.
Electrification is critical to the energy transition, and the development of electric mobility relies on easily accessible charging solutions.
For nearly 200 years, we have leveraged our expertise in the marine industry to support our clients in developing new energies within the sector. While LNG shipping is gaining more and more traction, we help owners optimize their vessels’ design, ensuring compliance with existing and future air emission regulations.
A mix of technologies, alternative fuels and energy sources is steadily reducing the industry’s environmental footprint. By collaborating with industry players and capitalizing on its expertise in new mobility, BV is helping the industry set the course for a new era of sustainable development.
For Electric Vehicle Charging Stations, BV developed a complete portfolio of services, covering the full lifecycle – from design, construction and commissioning to operations.
- Project management assistance for charging stations under construction
- Inspection services for charging stations in operations
READ THE PRESS RELEASE ABOUT CHARGESCAN BY BV
DISCOVER THE INFOGRAPHIC ON RELIABLE ELECTRIC VEHICLE CHARGING STATIONS
- ALTERNATIVE PROPULSION
- LNG expertise and project support for reducing risk from design to operations
- Engineering services supporting improved performance and sustainability
- Cyber security and safety solutions for the marine & offshore sectors
- Development and implementation of new rules for new fuels | <urn:uuid:f16dd7b0-908b-4e64-90bf-5a48f5c612fe> | CC-MAIN-2022-33 | https://www.bureauveritas.lk/new-mobility | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573118.26/warc/CC-MAIN-20220817213446-20220818003446-00665.warc.gz | en | 0.877807 | 389 | 2.15625 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.