text stringlengths 160 608k | id stringlengths 47 47 | dump stringclasses 2
values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1
value | language_score float64 0.65 1 | token_count int64 48 145k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
Underground card shops endure because they are the epitome of a centralized criminal economy. At their highest levels, card shops are stood up by an established infrastructure, a team accountable for the product, and reputations that translate to revenue.
Despite many gains by the law enforcement and private-sector research communities, card shops figure to remain a primary method by which cybercriminals seek stolen payment card data, whether it’s in the form of dumps or cards, analysts at Flashpoint said.
Dumps consist of payment card data stolen from the magnetic stripe of a payment card through the use of skimmers; these are used for cloning physical cards and for in-store fraud. Cards, meanwhile, are packages of card numbers and other information necessary for card-not-present fraud. Some sellers will also offer what are known as fullz, or a full package of personally identifiable data (PII). Fullz may include a victim’s Social Security number, date of birth and other information that is reportedly enough to steal and profit from someone’s identity.
Analysts believe that criminals continue to patronize card shops in order to avoid the risks associated with stealing the data themselves. DIY theft would require, among other approaches, the installation of a skimmer on a physical card reader or the use of point-of-sale malware, for example, in order to steal and collect payment card data. Such an approach can require extensive up-front costs and additional risk to the criminal.
Instead, card shops have become a quick and clean one-stop for payment card procurement. Many operate with a slick interface where a purchaser can load funds from a cryptocurrency wallet and verify the validity of a dump through an online checker provided by the shop; some higher tier shops offer a refund within an allotted time period, say 30 minutes following the purchase, for example if a number is not valid. Prices of dumps and cards vary according to the region from where the numbers originate, and their freshness.
These services and behaviors vary depending on the tier and reputation of a shop.
Tiers definitely matter to buyers, especially when dealing with shops of lesser reputations, known as junk and mid-tier shops where a lot of payment card data may be drawn from the same sources that other similar lower-tier shops draw from. The data is likely to be old and potentially unusable, and there may be less opportunity for a refund. Analysts said that when it comes to top-tier card shops, the expectation is that the cards and dumps are fresh because many of these shops have private sources of stolen cards. Top-tier shops also shy away from reselling cards that have been sold already, whereas those at the junk tier may not resell on the same shop, but may instead try to sell cards or dumps which have already been used by fraudsters or have already been sold at another shop. Typical buys, meanwhile, depend on the individual; gangs in carding operations may buy in bulk whereas individuals cloning cards on their own may buy lesser amounts.
Deep & Dark Web (DDW) forums also have their place in this ecosystem, whether it be where shops are advertised or new breaches are marketed. Operators can interact with buyers and can in some cases share invitation codes to closed shops providing private access to a new customer.
Shop operators also use forums to discuss infrastructure changes — most importantly, when a shop opens a new domain of operation. Scammers frequently attempt to set up fake shops with similar URLs in order to phish other threat actors, tricking them into entering their login credentials in order to take over their accounts on the official website.
Card shops remain a viable part of the underground economy, in spite of the emergence of other potential revenue streams introduced through the availability of hundreds of millions of stolen credentials, or the spread of cryptocurrency miners, and ransomware, just to name a few. Enhanced security measures to combat fraud have cut into the viability of a stolen card, meaning those that survive likely have an enhanced value to buyers and sellers. All of this is continuing to breathe life into card shops as a primary means of this type of business on the underground.
Block has been deleted or is unavailable. | <urn:uuid:0d2f82f9-5ce0-4f9e-ac21-09356f33e5af> | CC-MAIN-2022-33 | https://www.flashpoint.io/blog/card-shops-endure-as-a-primary-method-of-fraud/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.956299 | 852 | 1.898438 | 2 |
2020 is just around the corner. That’s when experts predict that 5G wireless will be broadly available.
Increasing data speeds and responsiveness times by nearly 1,000 percent, a fully functioning 5G network could be a game-changer in the way universities use, manage and set up everything from IoT devices to data-heavy applications like augmented and virtual reality.
“Human brain signals take 14 milliseconds to travel,” says Jason Leigh, senior research analyst for mobility at IDC. “The most recent tests have recorded 5G latency times — how fast a signal goes to and from a device — at under 10 milliseconds. Network responsiveness could be even faster than your brain.”
How Does 5G Differ from 4G?
5G uses the millimeter wave portion of the spectrum, between 30 GHz and 300 GHz. The signal covers smaller areas than 4G, and has trouble moving through solid objects, like buildings and trees. However, it covers distances with much greater speed and capacity. So, instead of a central 4G cell tower, with 5G, wireless carriers will have to install a much greater density of smaller, portable towers to carry signals.
The advantages are clear.
“Today’s average 4G tower can support about 2,000 connections at one time,” says Leigh. “With 5G, you could support more than a million connections per square kilometer.”
Education Researchers Test the Power of 5G
Ted Rappaport, professor and NYU Wireless founding director, led a team of researchers to prove that 5G signals would work in an urban school environment.
“We measured around the streets of Manhattan and deployed test equipment that emulated commercial installations on portable towers at lamp post height to prove that mmWaves could work even better than today’s wireless networks,” he says.
In addition to urban schools, Rappaport says that rural areas could also benefit from 5G capabilities.
“5G equipment could allow immediate replacement of aging copper wires with ‘wireless’ fiber,” says Rappaport. “Tests done in Virginia found the distances reached by the mmWave signal were much greater than people thought — up to 10 kilometers.”
How Can K–12 Schools Prepare for 5G?
Although nationwide 5G coverage is still a few years away, K–12 IT leaders should start preparing now.
“Educational institutions should evaluate the opportunity to ditch legacy hardwired networks supporting classrooms, and the related complexity and cost,” says David Hemingson, partner and leader of the higher education and academic medical center divisions at advisory firm ISG.
It’s also time to rethink business agreements with telecommunications carriers.
“[5G] presents a new opportunity for schools to host small cells, but also new challenges, as they will have to deal with carrier requests and a new business model,” says Phil Wilson, managing director of telecommunications strategy and operations at Deloitte. Overall, education leaders and researchers are sharing excitement for the future that 5G technology could bring, including augmented reality and virtual reality.
“We have hints of what we’ll see,” says Rappaport. “Virtual meetings, 3D imaging, AR, VR. It could give us the ability to interact in a tactile way with remote objects with virtually no latency, even across great distances. 5G teaching and learning technologies are probably being developed in startups as we speak.” | <urn:uuid:88e8fba4-1127-45ad-89a3-020df656dfd0> | CC-MAIN-2022-33 | https://edtechmagazine.com/k12/k12/higher/k12/k12/higher/k12/k12/higher/k12/k12/higher/k12/k12/higher/k12/k12/higher/k12/k12/higher/k12/k12/higher/article/2018/10/k-12-education-ready-5g | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.957746 | 730 | 2.921875 | 3 |
- How can you boost your chances of being happy in the office?
- The career site Comparably recently analyzed its data to find out what large US companies have the happiest workers.
- Most of the companies were California-based tech outfits.
Want to be happy at work?
It based the results on anonymous employee reviews of companies with over 500 employees posted on its site between September 2017 and September 2018. At least 50 employees had to leave reviews for a company to be considered.
Of the top 25 companies, 12 were based in California. Red Bull GmbH is technically headquartered in Austria, but its North American branch is based in Santa Monica, California.
The Golden State's splendid showing shouldn't come as much of a surprise. The vast majority of the happiest companies belong to the tech sector, which is, of course, largely situated in California.
Red Bull, International Flavors & Fragrances, Golden Hippo Media, Starbucks, and Delta Airlines were the only companies in the rankings that weren't strictly tech-oriented, but even these firms boast a significant tech aspect to their businesses. Eight of the companies that made the rankings create and sell software products. Five — Netflix, Google, LinkedIn, Facebook, and eBay — are well-known consumer-facing tech giants.
So if the domination of tech companies explains why California fared so well, then what explains the fact that tech workers are so happy? The answer is pretty simple, at least in part: tech jobs pay well.
In Glassdoor's roundup of the 25 highest-paid occupations of 2018, 13 of the top jobs could be considered straight-up tech roles. According to the Bureau of Labor Statistics, the average systems software developer earns $127,230 a year in California. And the average wage for a systems software developer in the San Jose-Sunnyvale-Santa Clara area was even higher, coming in at $141,890 a year.
For perspective, the median annual wage for all US workers in 2017 was $44,564.
What's more, research indicates that it's not all about the money. Forbes reported on a 2016 survey in which 71% of tech workers said they felt they had a good work-life balance, while 72% of respondents working in tech said they felt appreciated on the job.
So if you've got the blues at work, consider brushing up on your tech skills and looking west. | <urn:uuid:43b6bb1f-4fe9-4354-9b51-6aa6dd51d5bb> | CC-MAIN-2022-33 | https://www.businessinsider.com/happiest-companies-california-tech-2018-10 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.967855 | 495 | 1.617188 | 2 |
Transportation and Infrastructure Committee Ranking Member Sam Graves (R- MO) and Committee Republicans led a roundtable on the Energy Crisis this week, during which energy stakeholders highlighted challenges in safely and efficiently moving sufficient levels of American energy.
Following the roundtable, Ranking Member Sam Graves said, "We've seen plenty of finger-pointing from this Administration about why Americans across the country are paying such high energy prices. But we haven't heard a word from the President about how his policies -- long before Russia invaded Ukraine -- have put a chokehold on the development and the safe, efficient transportation of North American energy resources."
Graves continued, "The stakeholders who participated today talked about solutions, but they're based on the federal government allowing the responsible production of domestic energy and putting us back on the path to the energy independence. Since revoking the permit for the Keystone XL pipeline on his first day in office, the President and his administration have been enacting policies that continue to block, discourage, and impede energy production, capacity, and transportation. This continues to drive up costs for Americans to heat their homes and buy gas and diesel, and it limits our ability to help our allies meet their energy needs in the wake of Russia's aggression. Today's roundtable demonstrates that we can and must do better, but only if the Administration recognizes that its policies are at the root of our energy crisis and does something about it."
Issues discussed at the roundtable included:
Challenges to developing pipeline projects that could safely and efficiently move more oil, natural gas, etc. to markets across the country where energy costs remain high
Panelists' support of the 2020 liquefied natural gas (LNG) by rail rule that the Biden Administration halted and common misconceptions about the safety of LNG transportation
How the lack of sufficient energy resources or infrastructure at home and abroad increases reliance on Russian energy
Environmental permitting difficulties and delays, including under National Environmental Policy Act (NEPA), during the Biden Administration
You can watch Ranking Member Graves' remarks below: | <urn:uuid:f3a3e0c7-b976-46f1-bd16-46d88b14f3f1> | CC-MAIN-2022-33 | https://justfacts.votesmart.org/public-statement/1603395/graves-hosts-ti-republican-roundtable-on-energy-crisis | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.950981 | 412 | 1.734375 | 2 |
The word “anniversary” takes on a whole new meaning for widow/ers, or for any griever. An anniversary date is any meaningful date to you and your loved one. The hardest anniversary date usually is the one that commemorates the day of the death.
There have been many psychological-based articles written on the importance of the one year marker. Do not be fooled that at one year all your grief will magically dissipate, and you will be ready to move on with your life. Please do not misunderstand me. The one year anniversary is a very important date. It is a marker of all that you have accomplished by yourself. You have managed to cope with all the seasons of the year and the hard days they have brought; you have made independent decisions; you have supported your family financially and emotionally; and you have grown more than you can imagine.
And if you have not yet reached this point, please know that all these things and more can be accomplished with some hard work and introspection on your part. The cliché “time heals all wounds” is a little misleading. Does it mean that in one year, or two or five, you will not miss your loved one or feel the pain of his/her absence? I think not. Grief is never fully dissolved. Do not expect to wake up one morning and feel like you did before your loss. That is not possible. You are
What time does is give you more perspective. It also does dissolve the actual physical pain that you feel inside. It allows you to decide when you will fully feel your grief and when you can compartmentalize it — that is, put it away for a while and deal with the present. It is what you do to help yourself during the passage of time that will be the greatest aid in your recovery.
Do not be afraid of change. Change forces you to grow and hopefully become a better, more fully developed person. It is you who will decide how your grief will affect your life. On one hand, you can sink deep into your grief and never see that there is still life going on around you — life in which you can participate. On the other hand, you can be proactive in adjusting to your new circumstances and see all the positive things around you.
In dealing with anniversary dates and holiday times, including Father’s Day and Mother’s Day, there are going to be changes in how you celebrate. Probably the best advice is to have open and honest communication with your family and friends about what these changes are and how you are going to go about implementing them. You need to decide how, and if, you wish to include your deceased partner in future events.
Making a scrapbook filled with pictures and mementos of happy times, watching home videos, reminiscing about past events, and telling childhood stories about a deceased parent are various ways to keep memories alive. Some widow/ers with younger children find it helpful to send a balloon off to the heavens with a message for the deceased parent. Others find it helpful to picnic at the cemetery.
The important fact to remember is that there is no right or wrong way. Do what feels good to you and your family. If you feel sad — feel sad. You don’t have to be strong for others. By ignoring your true emotions, they become bottled up inside just waiting to explode one day. Live each emotion fully, and then let it pass through your system. Don’t feel guilty if over the passage of time your sadness lessens. Try not to become attached to your grief. Don’t let it define who you are.
You are the master of your emotions, and it is you alone who will determine how this devastating loss will affect the rest of your life.Tags: grief, hope | <urn:uuid:c01c047e-46d1-41f8-b727-172d5fe5fc34> | CC-MAIN-2022-33 | https://www.opentohope.com/grief-and-the-holidays-you-can-be-master-of-your-emotions/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.957633 | 782 | 1.921875 | 2 |
La esperanza es lo último que se pierde
(You Have the Right to Be Hopeful – Spanish)
Hope is essential for a cancer survivor to achieve personal satisfaction with his or her quality of life. “La Esperanza Es Lo Último Que Se Pierde” is the Spanish translation of our “You Have the Right to Be Hopeful” booklet. This publication seeks to define the many ways that hope can be present in a survivor’s life and offers a place for survivors to chronicle and reflect on their cancer journey.
Written by Elizabeth J. Clark, PhD, © 2005 – 20 pages
For other NCCS resources in Spanish, click here. | <urn:uuid:b107db66-3329-4278-b286-3ccf8180ab34> | CC-MAIN-2022-33 | https://canceradvocacy.org/product/la-esperanza-es-lo-ultimo-que-se-pierde-hopeful-spanish/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.870817 | 150 | 1.515625 | 2 |
Friday, July 5, 1912. Troy’s New York State League baseball team is trying to make their latest stay in first place last longer than the others. They’re doing all they can, but the Utica Indians are still on their trail. Troy and Utica have traded the lead back and forth for the past month. The Collarmakers reclaimed the top spot last Saturday only to fall back into second behind Utica the following day. They pulled ahead of Utica once more on Wednesday and widened their lead to 1.5 games with a double-header sweep of Albany yesterday, while the Utes split their holiday twin-bill. The Trojans host the seventh-place Binghamton Bingoes for a four-game series at Laureate Park starting this afternoon. Former Troy shortstop Gus Zeimer, Binghamton’s player-manager, sends former Major Leaguer Elmer Stricklett to the mound. The 35 year old Stricklett has recently been reinstated into organized baseball after playing for a wildcat California league several years ago. Despite a losing record for the Brooklyn Superbas over three seasons, Stricklett is considered one of the first pitchers, if not the very first, to master the spitball during the time when it was legal. Stricklett doesn’t make it past the third inning, but his attitude rather than his pitching is the problem. “Stricklett is not by any means a spring chicken,” The Record reports, “and should have known better than to incur the wrath of the umpire. The former spitball king of the National league entered several verbal protests against the decisions on balls and strikes rendered by the indicator holder. In the third inning, with two men on base, Mr. Daley called a ball on [Troy second baseman Billy] Cranston. Stricklett tossed his glove into the air and attempted to go through a little sketch that resembled the grave digger’s scene in Hamlet. “Umpire Davey could discover no sense of humor in the heavy setting and ordered Mr. Stricklett from the game. Manager Zeimer came in to inquire ‘what for?’ and he was told to take it on the run.” Stricklett and Zeimer leave the game with Binghamton leading, 3-1, but with Troy threatening. The Collarmakers tie the game later in the third inning and take a 6-3 lead with three runs in the fifth. They blow the game wide open with four runs in the seventh. Binghamton makes its last stand with a four-run outburst off Troy starter Bill Harkins in the eighth, but the home team holds on for a 10-7 victory. Utica keeps pace with Troy by beating the two-time defending champion Wilkes Barre Barons, 9-5. | <urn:uuid:457a27e7-c946-42e6-9e52-29aca0f6f7dc> | CC-MAIN-2022-33 | https://www.saratogian.com/2012/07/05/this-day-in-1912-in-the-record-july-5-1912/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.968548 | 588 | 1.6875 | 2 |
8 th World Congress on Conservation Agriculture (8WCCA)Table of Contents
- Why do we process your data?
- Which data do we collect and process?
- How long do we keep your data?
- Who has access to your data and to whom is it disclosed?
- What are your rights and how can you exercise them?
- Contact information
1. IntroductionThis privacy statement explains the reason for the processing, the way we collect, handle and ensure protection of all personal data provided, how that information is used and what rights you may exercise in relation to your data (the right to access, rectify, block etc.).
2. Why do we process your data?The purposes of the processing of personal data include in particular management of lists and mailingslists for contacts, invitations, participants, reports, minutes, istribution of reports/minutes, feedback on reports, 8WCCA follow-up, follow-up actions, photographs/pictures, presentations, live web streaming and/or audio and video recording of speakers and participants, news and publications.
Processing operations linked to pictures, photos, video/voice recordings take place based on the explicit consent of the data subject. The data subjects give their onsent via a clear affirmative act by clicking the relevant box in the registration form.
The processing operations on personal data for the organization and management of the Congress are necessary and lawful under the following article of the Regulation (EU) 2018/1725:
- Article 5 (a): processing is necessary for the performance of a task carried out in the public interest on the basis of the Treaties establishing the European ommunities or other legal instruments adopted on the basis thereof;
- Article 5 (b): processing is necessary for compliance with a legal obligation to which the controller is subject;
- Article 5 (d): the data subject has given consent to the processing of his/her personal data.
No restrictions under Article 25 of Regulation (EU) 2018/1725 apply.
3. Which data do we collect and process?
We only keep data necessary for the organization and management of the 8WCCA.
Identification DataThe personal data collected and further processed will be:
- Data necessary for the organization and management of the 8WCCA, such as Gender (needed for the right title)/name/surname/profession/postal & E-mail ddresses/phone number/fax number/etc.
- Identity/passport number, date of birth for travel arrangements if relevant
- Photographs/pictures, presentations, live web-streaming and/or video recording of speakers and participants;
- Information about transport & accommodation used, and banking information (account number, IBAN, name and address of the bank, etc. for purpose of reimbursement of travel expenses and/or allowances – see DPO-372) if relevant
Live web streaming, video + voice recordings and images of the speakers and the participants, as well as photographs of groups of participants and organizers could be taken and published in the context of the Congress. By attending the event, you give your consent to your pictures/videos being taken.
4. How long do we keep your data?8th World Congress on Conservation Agriculture only keeps the data for as long as follow-up actions to the Congress are necessary, considering the purpose(s) of the processing of personal data. Reports containing personal data will be archived according to the legal framework. Nevertheless, where needed, after this delay, personal data will be part of a list of contact details for contacting data subjects in the future in the context of professional activities. If data subjects do not agree with this, they may contact the Controller by using the contact information as mentioned in this privacy statement and by explicitly specifying their request.
5. Who has access to your data and to whom is it disclosed?Participants and a wider public if it is provided that personal data are published on Internet, without prejudice to a possible transmission to the bodies in charge of a monitoring or inspection task in accordance with the current legislation.
In order to keep the network of the participants operational a contact list of participants is shared between attendees. Only the Names of the participants and names of the organizations are circulated. If you do not want to be part of the network, please inform the data Controller by leaving the relevant box unticked in the registration form.
Your name and the name of the organization you are working for may be published on the website of the event. If you do not agree with this publication, please inform the data Controller by leaving the relevant box unticked in the registration form.
The information we collect will not be given to any third party, except to the extent and for the purpose we may be required to do so by law. | <urn:uuid:40c8f9cf-63e7-43b9-aef1-379d0ad41387> | CC-MAIN-2022-33 | https://8wcca.org/protection-of-your-personal-data/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.893962 | 991 | 1.71875 | 2 |
This paper focuses on the assessment of color strength and chroma values that occur in dyed polyester fabrics after different cycles of abrasion for different fabric construction parameters. We used 12 polyester fabrics with various construction parameters in two experimental sets. The fabrics differed from each other by their cover factors. The warp yarn type and count, warp density, warp yarn twist and the fabric weave were the same for all of the fabrics in each experimental set. The dyeing of the fabric samples was performed by using a commercial disperse dye (CI Disperse Red 74:1). Four different abrasion cycles (2500, 5000, 7500, 10,000) were used. The main differences in color strength and chroma values were observed between 0 and 2500 cycles of abrasion. Increasing abrasion cycles after 2500 changed the appearance of the fabrics woven from staple weft yarns considerably. It is concluded that the rubbing motion of the Martindale instrument is related to the cover factor of the fabrics and dyeing concentration applied. The main effect of abrasion on color strength and chroma values was obtained up to 2500 cycles. | <urn:uuid:68aa36f6-acb0-4b60-9d6a-30dd2fb93023> | CC-MAIN-2022-33 | https://avesis.uludag.edu.tr/yayin/416ea730-2a11-42fb-bdd1-574ad519e3a0/assessment-of-color-strength-and-chroma-values-of-polyester-fabrics-having-different-cover-factors-after-abrasion | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.942165 | 227 | 2.40625 | 2 |
Delivering the message in a way that people can hear. In a way that motivates them to take flight.
In our house we read a book called The Whispering Rabbit…a lot.
In summary, a sleepy rabbit yawns without covering his mouth and a bee flies into his throat and falls asleep so the rabbit can only whisper. A “community advisor,” he’s a groundhog, tells the rabbit that he must make a little noise to wake up the bee, “because a little bee does not bother with big noises.” The sleepy rabbit tries lots of little noises (my favorites: an egg, a bird’s wing cutting the air, a fireman thinking) until finally he makes the “small click of a bee sipping nectar from an apple blossom in an apple tree in full bloom.” With that the bee wakes up and flies away. And the little rabbit finally gets to curl up and go to sleep.
It’s a great book! My son loves it because we whisper part of the words and he laughs at the thought of a little rabbit covering his mouth with his tiny paw to yawn. I like those parts also. And I like the underlying message about saying things in a way that people can hear them. In a way that motivates them to take flight.
I think of that little rabbit often when I’m developing curriculum, working with community stakeholders, and doing training. I remind myself to be thoughtful about my message, how I deliver it, and the way I frame it in order for it to make sense. To make it matter.
Your message should above all be informed. By what and from whom depends on the audience/community. Gather your data through research on the topic and be prepared to cite your resources (hopefully you have more than one). Depending on the topic or community issue you’re addressing, resources can include statistics from reliable studies, experts in the field, community members affected in positive and negative ways by the topic/issue, historical and current political and social dynamics, and future policy and/or trend analysis. If you are drawing a conclusion be prepared to explain a logical connection between the data and your conclusion.
Frame Your Message Properly
Proper framing requires comprehensive research but understanding what it means to the people it touches is vital. Spend time thinking about the different groups or individuals you will present to and how they might connect to your message, how they might benefit, and how they might be negatively impacted. If you can, talk about your work with people from diverse backgrounds. Does it make sense? Does it inspire them, anger them, or surprise them? What questions do they have and how can you answer them? If you can’t answer them, what other data or people do you need to get input from? Go back and make adjustments.
Think About the Messenger
Consider who should deliver the message. Could, or should, it be done by or in partnership with a community leader, representative from the target audience, and/or other key stakeholder? Your delivery should be in partnership with your audience or group with whom you’re working. Allow for questions and answer them thoughtfully if you know the answer. If you don’t, commit to further research and follow up. Don’t pretend you know everything or know better than everyone else because 1) you don’t and 2) pretty much everyone hates that.
Putting it All Together
Proper framing is the sum of an informed message and thoughtful delivery. Framing an issue is important. Especially when it’s the issue no one wants to talk about. This is the place where you have to find solidarity and I’ll be honest, not everyone is going to get there. Give the group time to process together as a community so that they can make their own connections to the components that matter the most to them. Education is a tool and everyone uses tools just a little bit differently. People need time to practice in order to integrate information, tools, and practices so leave space in your training or meeting for the group to work with, puzzle over, and practice new ideas.
“Nothing about us without us” may seem obvious but it is so often overlooked in developing programs, curricula, and policy. If you skip out on gathering data from actual people and really, fully, openly listening to them, you run the risk of not having an informed message and/or delivering it in an ineffective or even destructive way, neither of which will have positive results.
The sleepy rabbit figured out the noise that made the bee think he was missing something and have to go toward it. So think of the rabbit, listen to community advisors, do your research, and find your tiny noise that will motivate your sleeping bee.
by Jessie Towne-Cardenas | <urn:uuid:eb92417a-8b1f-40aa-a8ab-29259de704f4> | CC-MAIN-2022-33 | http://arboretagroup.com/rabbit/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.950174 | 1,009 | 2.25 | 2 |
First Caffeine, Then Analysis!
As a school-based BCBA, my days begin similarly to a clinic-based Analyst; I wake up, brush my teeth, workout (occasionally), get dressed, load up on caffeine, and head to work. In my office, you’ll find my work computer locked in my desk with my scholar’s files. Inside the scholar, files are documents like their Individualized Education Plans (IEPs) and the referral information that I have received in order for me to begin services. In a school setting, there are a few steps that take place prior to obtaining a scholar on your caseload.
My experience thus far has been completing a few observations of the scholar prior to what is called a Student Focus Team (SFT) meeting. SFT meetings take place with the scholar’s IEP team. In this meeting, the team discusses the need for a Functional Behavior Assessment and me as the Analyst gives the go-ahead to conduct the assessment. After agreeing to conduct a Functional Behavior Assessment (FBA) in the SFT meeting, I have a set amount of time (a total of 45 days in my state) to complete the assessment and report its findings.
I complete each of my FBAs by observing the scholars across various times, settings, and teachers, all within the school setting. Some of my observation locations include the classroom, recess, lunchtime, and in other staff rooms during sessions like speech therapy. I, or my RBT, observes and takes narrative and structured Antecedent Behavior Consequence (ABC) data consistently for at least 5 days. I conduct a FAST interview with the teacher(s) and the parent(s). I then analyze the data by graphing the frequency of each antecedent, consequence, and targeted behavior.
After analyzing the data and studying the graphs, I write my report which includes my graphed data of each antecedent and consequence, a description of the hypothesized function(s) of the behaviors, some examples of environmental changes that I suggest, and a detailed description of my analysis of each of the targeted behaviors. I wrap up my report by recommending suggestions for the family and teacher(s) of the scholar. If the data provides evidence that the scholar could benefit from having a one on one RBT without impeding their learning, I suggest that. I also provide behavioral goal suggestions in my FBA. After the parents and teachers accept the recommendations in my FBA, I write the scholar a Behavior Intervention Plan (BIP).
Another meeting then will be scheduled where I present my BIP. Until the BIP is agreed upon by the IEP team, it is a working document, meaning that the IEP team in the meeting has the ability to ask me about changing and tweaking the BIP until it is agreed upon by the entire team. Once the BIP is agreed upon, I begin writing the scholar’s program goals.
How Can I Be an RBT in a School Setting?
In supervising my RBTs, I stress to them the art of using least to most prompting with assisting the scholar with attending to the teacher and educational assistant and their instructions. This is one of the main differences that I have found from the clinical setting. In theory, my goal for the RBT during group instruction would be for the RBT to silently prompt the scholar, and provide the teacher with the reinforcer to give to the scholar immediately upon appropriately responding, all a while pairing with the scholar, and gaining instructional control during one on one time periods. Oftentimes I have found that teachers simply do not have the luxury of waiting out behaviors as we may in a clinical setting. They have more students to tend to and a school schedule to adhere to, so I also supervise the RBT on how to follow the BIP and intervene for behavior management when necessary.
Behavior Goes Where the Reinforcement Flows
As a school-based BCBA, I consult with each of my teachers for a set amount of time per week as outlined in the scholar’s IEP. I love teacher consultations because this helps me to pair with the teacher, provide the teacher some insight on ABA and the specific methods that I am using with each scholar, and it gives me the ability to understand the teacher’s methods as well. Staff buy-in is everything in a school setting, and PAIRING IS KEY! It is very important to not come across as a know-it-all, arrogant, or as though you are telling the school staff what they are doing wrong. In order to have the most success with suggestions and intervention implementation, the school staff must feel supported by you.
One of my favorite things about being a school-based BCBA is having the ability to collaborate on a daily basis with the teachers and other school staff. We all may come from different disciplines, but with the primary focus being on the scholar, we all come together, kumbaya, and work to crush each goal one day at a time! The way I like to think of it is like this, the teacher states what the academic goal is, and as the Behavior Analyst, I can program for “how” the goal can be taught. Although the school setting is less controlled than the clinical setting, implementing the principles of ABA in this environment has given me the opportunity to apply my skill set to both my scholars and my professional peers, and that is the part that I wouldn’t change for the world. Come on over to the school side y’all!
Like a behavioral cusp, it opens us up to a whole new world!
Cammie Morgan, MSC, BCBA, LBA (Hawaii), IBA | <urn:uuid:32298bfd-4491-41ab-8ef6-c9832b5b18c5> | CC-MAIN-2022-33 | https://readysetaba.com/a-day-in-the-life-of-a-school-based-bcba/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.962383 | 1,195 | 1.898438 | 2 |
Australians have been warned to prepare for a wilder climate with a dangerous combination of events that could occur for the first time in nearly 50 years.
A dangerous combination of weather events not seen together in nearly 50 years could see more Australian communities sinking under rising floodwaters during the remainder of 2022.
Sky News chief meteorologist Tom Saunders says signs have emerged showing that the current La Niña rain system impacting Australia could be joined by another system leading to increased rainfall: a negative dipole of the Indian Ocean (IOD).
“The last time a wet phase in India occurred at the same time as a repeat La Niña was 1974 and that was Australia’s wettest year in 122 years of data,” he said.
“In the history of Australia there have only been three years in which La Niña coincided with a negative dipole of the Indian Ocean during the winter and spring. All three of these years were among the top 10 ever recorded betting tests in Australia since 1900 “.
Saunders said an analysis of sea surface temperature anomalies from the Pacific showed that La Niña lasted longer than normal and that changes in ocean temperatures were altering global weather patterns.
“The Bureau of Meteorology expects this event to end towards the beginning of winter, however data analyzed by Sky News forecasters suggests a high risk of a third La Niña coming back again by the end of the year,” he said.
“This would be the first time we see a La Niña triple in 22 years. If it occurs it would be only the fourth triple since 1900.
“It’s been just over 18 months since the first La Niña was declared.”
Saunders says that while ocean temperatures were cooler than normal in the Pacific, in the Indian Ocean on the other side of Australia, the waters warmed near Indonesia.
“All forecasting models predict that this will continue, causing a negative IOD event to develop during the winter,” he said.
“A-IOD is basically the Indian Ocean version of La Niña, so the rain will come from all directions.
“Therefore expectations are for wetter-than-usual weather across much of Australia for the next six months, and BOMs forecasts for winter already show an 80% greater risk of above-average rain for around. half of the country “.
Originally published as Australian weather expert warns of increased risk of flooding in 2022 | <urn:uuid:f8ff9895-bc79-49aa-91ce-f1407d561edf> | CC-MAIN-2022-33 | https://newsmaker2009.com.ar/tech/australian-weather-expert-warns-of-increased-risk-of-flooding-in-2022/13989/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.960586 | 508 | 2.703125 | 3 |
CaSE sets out our vision and calls on Government to use its levers to cultivate an environment in which science & engineering will thrive.
As the UK prepares to leave the EU, more than ever we must play to our strengths.
The fruits of science & engineering enrich all our lives. In an increasingly competitive global economy, they will also be the drivers of future innovation, productivity gains, and high-value job creation.
Our six priority areas for government:
1. Equip providers to deliver high-quality STEM education and training that is open to all
2. Create a migration system that supports mobility for excellence, skills, education and collaboration
3. Grow the UK's leadership and collaboration in research & innovation internationally
4. Invest at a level and in such a way as to enhance the UK's research & innovation environment
5. Deliver a stable regulatory environment that facilitates trade, access to markets and innovation
6. Champion the use of evidence and science advice in all government decisions, documents and messaging | <urn:uuid:b5e9ef52-48ec-43df-8958-8c3de37942b5> | CC-MAIN-2022-33 | https://www.sciencecampaign.org.uk/resource/vision-and-priorities-for-the-new-government-2017.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.922546 | 203 | 1.9375 | 2 |
« PrécédentContinuer »
of physical; “types” of the law of liberty which, operate in what matter it will, is still a law of uniformity. It is the Pauline sense of the word, as when he tells the Romans that Adam was a “ type” of Him that was to come; or, philosophising history to the Corinthians, teaches them that all that happened to Israel in the wilderness were “types” written for our admonition: or bids the Philippians walk as they had him for a "type"; or exhorts Timothy to be a "type” to the believers; or praises the integrity of the faith of the Thessalonians, that they were "types" to all that believed in Macedonia and Achaia. A type that is sought, not in a single isolated act, but in the whole career of a living human being, making him a pattern to after generations of the power of divine grace and the possibilities of human nature, must be a type governed by human, that is, moral or spiritual laws, and cannot consist in mere symbolism-mere literal, physical conformity.
There is a phrase of St. Paul which appears to me to imply these ideas. It was God the Father's purpose, says the Apostle, in the dispensation of the fulness of time “to gather together in one all things in Christ, both things in heaven and things on earth,” that so, as he teaches the Colossians, He might be not only the “image of the invisible God," but the “first born of every creature."
The force of the Greek word ανακεφαλαιώσασθαι is very inadequately rendered by the expression “ to gather together in one.” That is a vague phrase, and the Greek word is a most precise one, meaning “to bring
to a head,” “ to collect as in a focus," " to sum up in an organic whole” what has before been dispersed, disjointed, disrnembered, spread over a wide surface; “to recapitulate," as the Latins call it; to reproduce to the eye, or ear, or understanding, in a compact, complete, living way, that which before had been fragmentary, partial, disconnected, apparently incongruous, or separated in its parts by long intervals of place or time. Thus the Gospel was the ανακεφαλαίωσις of all previous revelations—“ the dispensation of the fulness of time;" and Christ was the avakepalaíwois of all previous manifestations of the power of grace in the soul of man.
In Him they were reproduced, summed up, harmonised, developed, culminated. He was “the first-born of every creature.” “Things,” says Aristotle, “which are philosophically, and in the order of ideas, first; naturally, and in the order of time, are last.” Jesus Christ, in the perfection of His human nature, and not Adam, was the archetypical idea of man. conformed to Him, not He to Adam. He was the type, the mould, the pattern-form. They that were saints and heroes did but take off the impression of His saintliness and heroism, as clearly as the coarser clay of which they were fashioned allowed its outlines to be seen. And so they were as shadows in the morning, projected before the body which generated them, whose outline they represent, and whose approach they herald, but which contract themselves more and more, and are finally absorbed, when the sun reaches his noonday height, and pours down in a direct ray his glory upon the earth.
Thus the principle of typology, even when applied to the whole life of a human being, is relieved from all just exceptions, and the simplest justification of it is also the truest. For it stands upon the relationship which may be claimed to exist between Christ the Head of the Church, and those who have belonged to His mystical body in every age. This relationship, issuing as it does from the verity of His human nature, rests upon the great philosophical dogma of the immutability of the laws—that is, of the will and purposes-of God.
These laws, which are simply the expression of His will, determined by the essential attributes of His character, are as unchanged and unchangeable in the moral and spiritual, as in the physical, world. The phenomenon which complicates the question here, and renders it philosophically inexplicable under our present conditions of thought, is that, in the moral world you have free agents, exercising their freedom, and by that exercise fashioning their character and their destiny, under a system of necessary and immutable laws.
So, when we speak of typical men, we mean those whom the conscience, the divine instinct within, recognises as the ideals of humanity, illustrating the capacities of the race, showing in what infinite variety both of ways and of degree the natural man may become spiritual, and the heirs of a fallen nature may once again become partakers of the divine.
“ The types of the Book of Genesis,” says an ingenious and pious writer, “exhibit God's great dispensational purposes and the course appointed for man's development.” By the phrase "dispensational purposes,” he means “the mode in which God, at various periods since the Fall, has dealt with man, in different degrees of intimacy, and in a certain sense, also on different principles.” “Throughout all He has had one purpose in view-to reveal what He is, and to show what man is; but this one end has been brought about in different ways and under various repeated trials.”
I demur, however, to the statement that in the course of this development the Creator has dealt with the creature even “in a certain sense,” on different principles. The outward manifestation of the principle may have been different, but the inward power and energy of it have been the same. The God of the Old Testament is the God also of the New. The proclamation of the name of the Lord to Moses on Mount Sinai—“the Lord, the Lord God, merciful and gracious, long-suffering and abundant in goodness and truth, keeping mercy for thousands, forgiving iniquity, transgression, and sin; yet that will by no means clear the guilty, visiting the iniquity of the fathers
the children and upon the children's children unto the third and fourth generation”-is as true now as it was then.
The God of the Jews, says St. Paul, is also the God of the Gentiles. Faith is the condition of justification to 'the circumcision' and 'the uncircumcision.' "The righteousness of God manifested without the law;' rather perhaps should it have been translated, “manifested without an accompanying code of rules,” embodied in a Divine Person, was yet "witnessed by the law and the prophets” (Romans iii. 21).
God,” says the text,“ preached the Gospel to Abraham.” The very oath sworn to him by his Maker was, according to the Epistle to the Hebrews, designed to show to the heirs of promise, down the whole stream of time, the immutability of God's counsels. God forbid, cries St. Paul, that any one should think that the lawthe schoolmaster who was to bring us to Christ—was against the promises of God. Though the sanctions of the two covenants might be different—a circumstance which does not in the least affect the moral obligation —the terms on which they dealt with man were the same. This development may be more complete, more uniform, more equable, more progressive, under the Gospel than under the law, but the direction of that development was ever, if not consciously towards Christ, at least towards Christianity. “Your father Abraham rejoiced to see My day,” said Christ, “and he saw it and was glad."
And so these men, living under what we sometimes call “another dispensation,” and certainly surrounded by very different circumstances, may yet be regarded as typical. They have their message for us "on whom the ends of the world are come.' "They sought a country," a brighter, better land than any which their feet had ever trod, or on which their eye had ever rested. “They died in faith," “confessing themselves strangers and pilgrims," " persuaded of the promises and embracing them, though they never actually received them-indeed, they seemed ever to retreat from their yearning gaze. Even now they are waiting with us for their perfection. Even now their impatience, | <urn:uuid:cea7d6f1-6789-4615-b1b0-264b0b58f079> | CC-MAIN-2022-33 | https://books.google.fr/books?id=H9YTAAAAYAAJ&pg=PA5&focus=viewport&vq=%22and+if+in+anything+ye+be+otherwise+minded,+God+shall+reveal+even+this+unto+you%22&dq=editions:ISBN0461053934&lr=&hl=fr&output=html_text | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.978089 | 1,860 | 2.46875 | 2 |
This sleep calculator estimates the time you need to go to bed or wake up to get the desired amount of sleep (in terms of number of full cycles of sleep or a specified length of time in hours and minutes). The calculator assumes an average sleep cycle length of 90 minutes, so 5 sleep cycles is equivalent to 450 minutes, or 7.5 hours. Also, take into account the amount of time it takes you to fall asleep, since this is different for different people, and will affect the calculation. To use the calculator, please provide the time you want to wake up or go to bed, select the amount of sleep you want to get, then click the "Calculate" button.
What are sleep cycles?
A sleep cycle is the cycle between non-rapid-eye-movement (NREM) sleep and rapid-eye-movement (REM) sleep. Typically, a person goes through 4-6 sleep cycles per night, which last approximately 90 minutes per cycle, but can range from 70-110 minutes long. Furthermore, an individual's sleep cycle also varies in length throughout the night. For example, an earlier sleep cycle may last 70-100 minutes, while a sleep cycle later in the night may last 90-120 minutes.
A sleep cycle is comprised of 4 sleep stages: N1, N2, N3, and REM. The first three stages are the NREM sleep stages and the fourth stage is the REM sleep stage. Normally, a sleep cycle progresses as follows:
- N1 sleep
- N2 sleep
- N3 sleep
- N2 sleep
- N2 sleep
From the last stage of N2 sleep, the cycle then repeats.
Stage 1 / N1 sleep:
The first stage of sleep, N1, is often referred to as the dozing off stage. This stage can be very short in length, and may last only 1-5 minutes.
In this stage of sleep, the body is not yet fully relaxed, and there are only light changes in brain activity as compared to being awake. Overall, the functions of the body and the brain begin to slow. In this stage, it is fairly easy to wake a person up, thereby interrupting the sleep cycle.
Stage 2 / N2 sleep:
The second sleep stage, N2, is sometimes referred to as the light-sleep stage. This stage typically lasts around 10-25 minutes, and can increase as the night continues. A person typically spends approximately half of their time asleep in N2 sleep over the course of a night.
During this stage of sleep, body temperature starts to decrease, muscles become more relaxed than in the N1 stage, breathing and heart rate slow, and eye movement stops. Brain activity also continues to slow in this stage, but this stage is also characteristic of short bursts of brain activity, referred to as sleep spindles, that have the effect of reducing the chance of a person being woken up. This stage, as well as the following stage, N3, are the stages of sleep during which it is most difficult to wake a person up.
Stage 3 / N3 sleep:
The third stage of sleep, N3, is also referred to as the deep-sleep, slow-wave sleep, or delta sleep stage. Each N3 stage lasts around 20-40 minutes, and people spend more time in this stage of sleep in the earlier parts of the night, but the amount of time spent in N3 decreases as the night goes on, with a shift toward increased periods of REM sleep.
During this stage, muscle tone further decreases along with heart rate and breathing rate, and blood pressure drops. Brain activity also decreases even more than in previous stages of sleep. Also, in this stage of sleep, there is a measurable pattern of slow brain waves (delta waves), hence the names slow-wave and delta-wave sleep.
It is believed that this stage of sleep has many restorative functions that affect a person's growth, immune system, and many other bodily processes. Also, even though brain activity is reduced during this stage of sleep, studies have shown that it affects things such as memory consolidation, creativity, and insightful thinking.
The fourth stage of sleep is referred to as rapid-eye-movement (REM) sleep. It is the state of sleep during which brain activity most closely resembles activity while awake. It derives its name from the fact that the eyes move rapidly during this stage of sleep. REM sleep can typically only occur after a person has been asleep for around 90 minutes. It can last around 10-60 minutes and the duration of REM sleep tends to increase as the night goes on. On average, it makes up about 25% of sleep, and may only last a few minutes during a person's first sleep cycle of the night.
During this stage of sleep, brain activity increases to levels similar to that of being awake, vivid dreams occur, breathing rate increases and becomes more irregular, rapid eye movement occurs, and temporary paralysis of the muscles occurs (atonia) in part to prevent a person from acting out their dreams. Furthermore, this stage is believed to be an important stage for learning, memory, and creativity, as it is the stage during which information is cemented into a person's memory.
Sleep and health
Sleep has a significant impact on a person's health. Not getting enough sleep can affect both physical and mental health. Lack of sleep impacts higher level reasoning, problem solving, attention to detail, mood, and more. It can also result in an increase in blood pressure leading to adverse events such as heart attack and stroke, obesity, type 2 diabetes, dementia, increased stress, decreased academic performance, and poor mental health.
In addition to getting an adequate number of hours of sleep, it is also important to have a consistent sleep schedule that includes uninterrupted, refreshing sleep. Even if a person gets an adequate number of hours of sleep, if the quality of the sleep is not good, it can still lead to the variety of issues described above. The following table shows the number of hours of quality sleep recommended by the National Sleep Foundation based on age:
|Age||Recommended hours of sleep|
|0-3 months (newborns)||14-17|
|4-11 months (infants)||12-15|
|1-2 years (toddlers)||11-14|
|3-5 years (preschoolers)||10-13|
|6-13 years (school-aged children)||9-11|
|14-17 years (teenagers)||8-10|
|18-25 years (young adults)||7-9|
|26-64 years (adults)||7-9|
|≥ 64 years (older adults)||7-8|
Factors that affect sleep stages:
There are a number of factors that can affect the sleep stages described in the section above. Some of these include a person's recent sleep patterns, alcohol consumption, and sleep disorders such as sleep apnea, restless leg syndrome, and more.
A person's recent sleep patterns can affect their sleep cycle, particularly if they get insufficient or irregular amounts of sleep over a period of days or more. Examples include those who work night shifts. It can be very difficult to adjust to these types of schedules because they run counter to the body's natural circadian rhythms, which can result in inadequate duration or quality of sleep.
Alcohol consumption also affects sleep in that it decreases the duration of early REM sleep. In later stages of the sleep cycle though, once the alcohol has worn off, the duration of REM sleep may increase to above typical levels to compensate for the decreased duration in early sleep. Often however, this compensation is insufficient.
Sleep disorders such as sleep apnea, restless leg syndrome, and more, can cause interruptions to a person's sleep cycle. This results in a person not completing a proper sleep cycle, or having their sleep cycles frequently interrupted. In such cases, even if a person gets an adequate number of hours of sleep, they may still wake up without feeling refreshed, and may suffer the consequences of sleep deprivation.
Ways to improve sleep:
There are a number of ways for a person to try to improve their sleep. Sleep is complicated and techniques that are helpful for some people may not be helpful for others. In cases where a person practices good sleep hygiene but still wakes up feeling tired or not refreshed, it may be worth checking in with their healthcare provider to examine whether or not the person has any sleep disorders. Below are some tips for increasing the chances of getting good quality sleep.
- Maintain a consistent sleep schedule
- Get sufficient natural daylight exposure, at least 30 mins a day
- Avoid alcohol and large meals before bedtime
- Eliminate noise and light disruptions during sleeping hours, and keep the temperature cool
- Exercise daily, but not close to bedtime
- Avoid nicotine and caffeine
- Don't take naps after mid-afternoon
- Limit use of electronics, especially looking at your devices before bed
- Don't lie in bed awake. If you cannot fall asleep after approximately 20 minutes, get up to do something relaxing | <urn:uuid:89b6d454-fdb6-454e-b3f0-57b2e793ce94> | CC-MAIN-2022-33 | https://www.calculatorweb.com/sleep-calculator | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.950283 | 1,912 | 2.953125 | 3 |
Wind turbines with a 6-8MW capacity and a rotor diameter of 150-180m are what the world's largest offshore wind developer, Dong Energy, is looking for as it plans its future turbine purchase agreements.
"We think this is what will be needed to be competitive," Uffe Jørgensen, Dong senior director for concepts and technology, told Windpower Offshore.
Dong signalled its commitment to increase turbine size at its future offshore projects last summer, when it announced a 300-unit framework agreement with Siemens for the latter's new 6MW 154m machine to be deployed in UK waters.
The relationship with Siemens is not exclusive. "Dong scouts all relevant turbine suppliers," said Jørgensen. "Yes, we have spoken with Chinese manufacturers, but so far their turbines are at a relatively early stage of development."
Talks with Chinese and other Asian suppliers of array cable technology are more advanced. Dong has recently received tenders for the supply of 66kV inter array cables from Asian suppliers, confirmed Jørgensen. Increasing the voltage and reducing the cost of inter-array cabling is a high priority for Dong, he added. | <urn:uuid:471e04e3-f8f6-4156-b2a4-4537bfe032a1> | CC-MAIN-2022-33 | https://www.windpowermonthly.com/article/1190809/dong-turbine-strategy-based-6-8mw-machines?utm_source=website&utm_medium=social | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.953414 | 241 | 1.78125 | 2 |
Nuvotronics has developed and optimized the PolyStrataTM
process for the fabrication of intricate microwave and millimeter-wave devices. These devices have primarily been rectangular coaxial transmission lines, although rectangular waveguide and other structures have also been demonstrated. Intricate devices have been demonstrated with insertion loss 5 to 10 times lower than traditional planar circuits; isolation better than 60dB for lines that share separating walls; multiple levels of densely-packed coaxial circuits; and low-parasitic attachment to active devices and traditional circuit boards. In this Phase I project, Nuvotronics is proposing to develop high density low-loss millimeter backplane circuits to package and interconnect components of future NASA millimeter wave (MMW) radars. The significance of the innovation primarily lies in three areas: reduction of system size, weight and loss in MMW radars. The PolyStrata technology is a batch manufacturing process, providing economies of scale and cost reduction for higher volumes, in addition to flexibility in design for various frequencies of interest. Nuvotronics will design and test select Polystrata interconnects at MMW frequencies of interest, with particular attention to performance over temperature and survivability to launch conditions. The result of the Phase I research will prove the feasibilty of utlizing the Polystrata MMW backplane technology in future NASA missions, and provide the foundation for full scale development, testing, and prototype delivery during the Phase II project. | <urn:uuid:e5991503-4181-4ab8-adad-0460f1e35510> | CC-MAIN-2022-33 | https://techport.nasa.gov/view/8608 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.899553 | 301 | 2.375 | 2 |
Enthusiasm for STEM Sparks Early Amongst Girls in Asia Pacific: Mastercard ResearchFebruary 9, 2018 | Auckland
Ahead of the International Day of Women and Girls in Science, Mastercard research has found an encouraging number of girls and young women have a passion for STEM.
The third edition of the Mastercard STEM research surveyed more than 2,000 girls between the ages of 12-25 in the Asia Pacific region, exploring the influences that encourage or dissuade girls and young women from pursing education and career paths in Science, Technology, Engineering and Mathematics (STEM), and found over two thirds of 12 to 14-year-old girls find STEM subjects interesting (68%).
When 12 to 14-year-old girls were asked what job they wanted in the future, 22% said doctors, 20% said teachers and 18% said engineers.
Ruth Riviere, Mastercard Country Manager for New Zealand and the Pacific Islands says, ‘“The results of this latest study are encouraging but reinforce the need to inspire the next generation of female scientists, technologists and designers who clearly have a passion for these traditionally male dominated areas. Mastercard has a range of education outreach initiatives aimed at sparking and sustaining an interest in STEM amongst young girls – like Girls4Tech – to help change the gender biases and societal perceptions towards women in STEM.”
The study found 15 is the critical age when girls decided to pursue STEM or not. Although half of 15-19 year olds considered STEM related subjects when they were young, half changed their minds, and by 17-19 only 12% continued studying STEM subjects.
“The research shows 15 is a critical age for girls to determine whether they follow a STEM path, especially as they select their subjects for NCEA. This can have a significant impact on their future career, so we need to make sure we do everything to minimise barriers and ensure girls have every opportunity to pursue STEM subjects,” says Riviere.
The key reasons girls were discouraged from pursuing STEM education and career pathways was due to their learned perceptions of gender bias, and subject difficulty, despite their interest and ability in the area.
When the girls were asked what would encourage them to pursue a career in STEM, parental encouragement was considered the most important influence (49%). Support from schools and institutions (29%), having female STEM role models (36%) and scholarships (38%) are also key motivators.
“From this study it is clear that work still needs to be done. It’s important that we continue to challenge gender biases in STEM, so that more Kiwi girls and women can achieve their STEM potential, and the broader economy can benefit from a wider talent base and greater diversity in the workplace,” says Riviere.
Mastercard (NYSE: MA), www.mastercard.com, is a technology company in the global payments industry. Our global payments processing network connects consumers, financial institutions, merchants, governments and businesses in more than 210 countries and territories. Mastercard products and solutions make everyday commerce activities – such as shopping, traveling, running a business and managing finances – easier, more secure and more efficient for everyone. Follow us on Twitter @MastercardAP, join the discussion on the Beyond the Transaction Blog and subscribe for the latest news on the Engagement Bureau.
Mastercard Communications Contact
Acumen Republic, for Mastercard
+64 9 354 0583
+64 21 024 95013
National Certificate of Educational Achievement (NCEA) | <urn:uuid:ae222f9a-2fe4-4eca-909e-0df27a6206f6> | CC-MAIN-2022-33 | https://www.mastercard.com/news/ap/en/newsroom/press-releases/en/2018/february/enthusiasm-for-stem-sparks-early-amongst-girls-in-asia-pacific-mastercard-research-1/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.942556 | 732 | 2.40625 | 2 |
There are ways to identify Mild acne
Even though there are not consistent ways to categorize acne, most people (including dermatologist Classify acne as mild, moderate or severe, it’s good to have a fundamental idea of where your acne falls on this dermatologist scale, because it will help you know where you should start treatment.
What is Mild Acne?
A mild acne is a minor form of acne. You have some bumps and blackheads. Sometimes a papule or a pustule will develop. However, they are not typically widespread and inflamed. Mild acne can also be identified by what you do not have on your skin. You would not have deep-seated blemishes, or cyst or nodules.
Not all individuals with mild acne get the traditional or conventional pimples either. Some people are shocked to discover that the non-inflamed, skin-colored bumpiness they will have their face or back is a mildew form of acne called acne that is comdeonal.
Mild acne can occur across all ages, in all skin types and ethnics. Nearly every teen has acne; younger tweens too.
And many adults are shocked to lean that the acne they believed they outgrew… it’s returned. Yes, mild acne is common in adults as well. Even newborn infants can have cases of mild acne which is also known as baby acnes.
This type of acne is not just limited to the face. You can get mild acne breakouts on the back, neck, chest, and shoulders too. And don’t worry too much if you find blackheads within your ears or even on the earlobe. Mild acne breakouts can occur there as well.
How can You Tell if Your Acne is Mild?
Since there is no quantitative test that perfectly dictates what level of acne you would have for certain. Review the following statements and see if they describe your skin. If they do you likely have acne and probably mild.
- Most of my breakouts are non-inflamed whitehead and blackheads.
- Sometimes I get red pimples, but not a lot of them and they are not very big.
- The blemishes I do get are on the surface of the skin. They don’t feel ”deep”.
- I do not get nodular breakouts or (painful, extremely inflamed, hard) or cysts
- My breakouts do not cause scars.
If this not sounds like your acne, then it is likely its moderate or severe. IN that case, take a look at these additional resources and see if it sounds more like your skin.
What is Moderate Acne and What is Severe Acne?
Moderate and severe types of acne should be treated differently from mild and would require a doctor’s assistance to get under control.
There are some skin diseases that cause minor bumps and breakouts on the skin as well, and some look very like acne. If you are at all unsure, it wouldn’t be a bad idea to have your doctor look at your skin.
How to treat Mild Acne
For some individuals, acne will always stay relatively mild. But For others, those insignificant bumps and blemishes can progress to smoothing more serious in a hurry.
It’s always best to treat acne at this 1st stage because it is early and easier to stop from further development. Often people will wait too long, seeing how acne will form or hoping it will go away on its own.
Unfortunately, acne normally does not go away, on it own. Very often it we deteriorate and progress to more severe cases of acne.
This tends to be the case with teen acne. There are many kinds that start getting superficial sin breakouts early in the process. A young as eight or nine years old.
At this point, they can be very easy to overlook.
But as time continues, those little bumps become larger, inflamed pimples. Once acne starts, it becomes harder to treat. There is the additional risk of scaring that comes from serious forms of acne.
No matter your age, you will want to start treating acne immediately, when it is still mild, you get better results, much faster.
In order to treat mild acne you can start with over- the- counter medications. These are recommended to for consistency use between 10 and 12 weeks. If you are not getting the results you are looking for; the next step is to see a dermatologist.
Mild acne is so common.
Even these mild breakouts can be irritating and, in some cases, very upsetting, ( this tends to be true for teen)
Don’t worry because mild acne is the easiest type of acne to control. Would you, like a step by step breakdown to treating your breakouts.
Treatment options for Mild Acne.
- Over the counter, Acne Medications
You can gain control; over acne by using a certain type of products, that are available at your local drug store, Hover acne treatment is a very large market, just walking into the skin care aisles and you know will see the seemingly endless options available. It can be easy to become overwhelmed and inundated, by the sheer number of products available.
If you know which ingredients to look for you, it is much easier to choose and acne treatment product for your skin
- Salicylic Acid Salicylic acid is a beta hydroxy acid that serves to cleanse debris from the pores. It’s not the most potent or efficacious treatment, but if you have slight difficulties with blocked pores, blackheads, and very mild breakouts, salicylic acid might work for you.
Salicylic acid can further increase the effectiveness of other acne medications, though, so you might want to leverage it along with another acne treatment ingredient.
- Benzoyl peroxide
This is the most relevant OTC acne ingredient that’s out on the market. Over-the-counter acne medications can contain up to 10% benzoyl peroxide, but this is an instance of when more doesn’t necessarily mean better. Larger percentages cause more side effects, like dryness and peeling.
Mic with a lower rate of benzoyl peroxide can have similar but aren’t as harsh.
Begin with a lower-percentage cream first; you can always move up to a higher percentage if needed.
Sulfur has been employed as an acne treatment for decades. Today, you’ll typically find sulfur treatment products such as masks, cleansers and spot treatments.
Sulfur products perform by drying out the skin (and consequently drying out pimples). It’s not the most reliable treatment that is over-the-counter on its own, but it can be useful when involved with another acne treatment substance. You might use sulfur products as well as other OTC acne treatments, so long as you are getting too dry.
- Alpha acids which are hydroxy
They are maybe not the standard zits treatment options, and so they probably will not thoroughly clean acne themselves, but leader Alpha acids might help hold skin pores from getting blocked within the destination that is actually 1st. They could also increase the potency of other zits treatment ingredients so that they’re; usual improvements to OTC acne treatment services and products.
Of the many AHAs, glycolic acid is probably the absolute most common (and probably the most helpful). AHAs exfoliate the skin, though they truly are ordinarily a more way that is gentle exfoliate than scrubs.
- Prescription Medication Options
If over-the-counter products simply are not cutting it, there are plenty of medications that can help clean up zits that is mild quickly.
Do not think your acne “isn’t bad enough” to warrant a call to the dermatologist. You are going to conserve cash in the long run from some frustration, too) because you won’t be buying OTC items that just aren’t working for you (and undoubtedly you’ll save yourself the trouble).
- Topical retinoids
Some of the treatment options are most popular medications are topical retinoids. They’re useful in improving both breakouts that are inflamed non-inflamed blackheads and bumps.
Topical retinoids exfoliate the epidermis, help unclog pores and make pores look smaller. They’re additionally used as anti-agers (bonus)!
- Combination Medications
Lots of pimples medications work even better when used in combination with another medicine.
That is the fundamental idea behind these prescription combo treatments: with one application, you get the benefit of two. So, you’re going to be getting peroxide that is benzoyl adapalene, or tretinoin and clindamycin, in one single medication.
Professional remedies are another option for you. These methods are done at a spa or medi-spa day.
Treat these processes as being an addition to your acne therapy that is routine. You will get ideal outcomes if you are using therapy that is pimples between your professional procedures.
As always, if you’re seeing a dermatologist, obtain approval before having certainly one of these treatments done. And always tell the esthetician doing your therapy about all treatment that is acne you are currently using (even the OTC ones).
Acne treatment facials
Facials are on the list of most popular of all the spa remedies. And, if frequently done by a talented esthetician, they can help improve acne that is moderate. The esthetician will cleanse and exfoliate your skin during a face.
But the value that is genuine the face is always to have your skin pores fully cleaned. Blackheads and other non-inflamed blemishes may be coaxed through the skin pores, which can help stop small blemishes from becoming outbreaks which can be big.
Light chemical peels
Contrary to your title, these remedies don’t actually “peel” the skin; instead, they are another way to exfoliate it. An exfoliating agent is placed on the skin for a period that is certain then removed. A short while later, the skin is softer and ultra-exfoliated. Peels are usually done in a series of remedies and can help jump-start improvement of mild pimples.
Another beauty salon treatment that is popular, microdermabrasion procedure, which help exfoliate skin. A device is used to apply crystals to the epidermis while simultaneously vacuuming them away (there are additionally crystal-less Microderm treatments that use a wand that is diamond-tipped). Microdermabrasion is frequently included into a treatment that is facial usually as a series of remedies.
You’ve got a complete large amount of therapy options, which means you don’t possess to deal with mild acne. Let blackheads and outbreaks be described as a plain thing of yesteryear | <urn:uuid:4db692c8-80eb-4baa-8efe-abce7e50d9ce> | CC-MAIN-2022-33 | https://healthlifemedia.com/healthy/what-is-mild-acne/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.943906 | 2,340 | 2.5625 | 3 |
Using a panel of 101 low- and middle-income countries with data covering the period 1980-2012, this paper applies various econometric approaches that deal with endogeneity issues to assess the impact of food price shocks on socio-political instability once fiscal policy and remittances have been accounted for. It focuses on import prices to reflect the vulnerability of importer countries / net-buyer households to food price shocks. The paper finds that import food price shocks strongly increase the likelihood of socio-political instability. This effect is greater in countries with lower levels of private credit and income per capita. On the other hand, while remittances seem to dampen the adverse effect of import food price shocks on socio-political instability in almost all countries, the mitigating role of fiscal policy is significant only in countries with low-levels of private credit.
Growth remained strong in the region in 2012, with regional GDP rates increasing in most countries (excluding Nigeria and South Africa). Projections point to a moderate, broad-based acceleration in growth to around 5½ percent in 2013¬14, reflecting a gradually strengthening global economy and robust domestic demand. Investment in export-oriented sectors remains an important economic driver, and an agriculture rebound in drought-affected areas will also help growth. Uncertainties in the global economy are the main risk to the region’s outlook, but plausible adverse shocks would likely not have a large effect on the region’s overall performance.
La croissance reste vigoureuse dans la région en 2012, la plupart des pays connaissant une hausse de leur PIB (à l'exclusion du Nigéria et de l'Afrique du Sud). Les projections indiquent une accélération modeste mais généralisée de la croissance, qui devrait s'établir à 5,5 % en 2013 2014, en raison d'un renforcement progressif de l'économie mondiale et d'une demande intérieure robuste. L'investissement dans les secteurs axés sur les exportations demeure un moteur important de l'économie, et le rebond de la production agricole dans les régions touchées par la sécheresse contribuera également à la croissance. Les incertitudes qui pèsent sur l'économie mondiale constituent le principal risque pour les perspectives de la région, mais les éventuels chocs négatifs n'auraient probablement qu'un impact mesuré sur les résultats globaux de la région.
International Monetary Fund. Middle East and Central Asia Dept.
This selected issues paper on Sudan was prepared by a staff team of the International Monetary Fund as background documentation for the periodic consultation with the member country. It is based on the information available at the time it was completed on September 7, 2012. The views expressed in this document are those of the staff team and do not necessarily reflect the views of the government of Sudan or the Executive Board of the IMF.
In March 2009, the Fund established a new Framework Administered Account to administer external financial resources for Selected Fund Activities (the “SFA Instrument”). The financing of activities under the terms of the SFA Instrument is implemented through the establishment and operation of a subaccount within the SFA. This paper requests Executive Board approval to establish the Republic of South Sudan Macroeconomic Capacity Building Subaccount (the “Subaccount”) under the terms of the SFA Instrument.
Economic growth is estimated to have moderated further in 2010 to about 5 percent, reflecting slower growth in both the oil and non-oil sectors. The overall commitment fiscal deficit for 2010 is now estimated at 2.7 percent of GDP, about 0.6 percentage point of GDP below the program target. Monetary policy was expansionary in the first half of 2010, but was subsequently tightened. The current account deficit narrowed during the first three quarters of 2010 largely driven by an increase in oil exports. | <urn:uuid:7800a0d4-3102-4323-b982-a96f5b68b222> | CC-MAIN-2022-33 | https://0-www-elibrary-imf-org.library.svsu.edu/subject/SS?pageSize=10&sort=datedescending&t=4cd892a2-f074-5df7-b40b-2f686ac03792&type_0=book&type_1=journalissue | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.723453 | 861 | 1.882813 | 2 |
After that, you’ll be informed that your tax return has been garnished as a result of not paying tax.
The IRS will bite you if you don’t pay your taxes. The scenario mentioned above is not much compared with what could happen when you have to pay the IRS. If you’re in the process of paying real estate taxes, you might be able to get a lien on your home. In the case of a bank levy, or more sales tax could be assessed on your property.
Then, what exactly is a bank levy, and what is taxes on back sales? Bank levies are powerful tool for collection for lenders when their customers have fallen behind in their payment. A bank can place frozen the money on the account of the individual which owes the lender. To pay the debt, banks must transfer money from the account to the creditor. The bank could also consider selling the property in a back tax sale.
Be sure to avoid allowing such dramatic incidents happen. It’s important to make tax payments if you are owed the government. If you’re unable to pay the entire amount in one go You can pay in installment payment. You have options that can help you for avoiding bank levies. Are IRS tax liens official documents? There isn’t a need to ask. 6lbn6nkg59. | <urn:uuid:863df406-bba7-483d-8582-a0aa9a191c12> | CC-MAIN-2022-33 | https://arochester.com/how-to-eliminate-state-tax-liens-free-litigation-advice/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.953447 | 280 | 1.914063 | 2 |
The only place success comes before work is in the dictionary.
More quotes by Vince Lombardi
Mental toughness is spartanism with qualities of sacrifice, self-denial, dedication. It is fearlessness, and it is love.
People who work together will win, whether it be against complex football defenses, or the problems of modern society.
The difference between a successful person and others is not a lack of strength, not a lack of knowledge, but rather a lack of will.
More quotes about Wisdom
While I know myself as a creation of God, I am also obligated to realize and remember that everyone else and everything else are also God’s creation.
We must annex those people. We can afflict them with our wise and beneficent government. We can introduce the novelty of thieves, all the way up from street-car pickpockets to municipal robbers and Government defaulters, and show them how amusing it is to arrest them and try them and then turn them loose – some for cash and some for political influence. We can make them ashamed of their simple and primitive justice. We can make that little bunch of sleepy islands the hottest corner on earth, and array it in the moral splendor of our high and holy civilization. Annexation is what the poor islanders need. Shall we to men benighted, the lamp of life deny?
When people do not respect us we are sharply offended; yet deep down in his private heart no man much respects himself.
Most of us who turn to any subject we love remember some morning or evening hour when we got on a high stool to reach down an untried volume, or sat with parted lips listening to a new talker, or for very lack of books began to listen to the voices within, as the first traceable beginning of our love.
Without ambition one starts nothing. Without work one finishes nothing. The prize will not be sent to you. You have to win it. The man who knows how will always have a job. The man who also knows why will always be his boss.
There is a certain satisfaction in coming down to the lowest ground of politics, for we get rid of cant and hypocrisy.
There is little difference in people, but that little difference makes a big difference. The little difference is attitude. The big difference is whether it is positive or negative.
But who prays for Satan? Who, in eighteen centuries, has had the common humanity to pray for the one sinner that needed it most?
If a man does not keep pace with his companions, perhaps it is because he hears a different drummer. Let him step to the music which he hears, however measured or far away. | <urn:uuid:e4b969e4-2c66-4222-b37b-3836e4d2618d> | CC-MAIN-2022-33 | https://www.myfavequotes.co.uk/quote/vince-lombardi-success-work/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.961698 | 558 | 1.96875 | 2 |
Online meetings present difficult challenges when you can’t interact with your audience as you would in a face-to-face situation. Our course will help you put yourself across with energy whilst understanding the impact of your body language and voice. You will learn how to adapt your approach for the communication preferences of your audience. You will practice different questioning techniques, the language to persuade, influence and motivate, how to signpost changes in the discussion and finally bring different views together with summarising skills. Need inspiration? Read our Case Study 'Virtual Culture Coaching'. | <urn:uuid:2c7ef3cf-48dc-4f6a-aa35-0ac99edcf709> | CC-MAIN-2022-33 | https://www.babelgroup.co.uk/our-services/personal-impact/engaging-virtual-meetings/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.919092 | 112 | 1.773438 | 2 |
Copyright © 2021 Fowler Nurseries, Inc.
~A local heirloom variety~
Alamar was discovered in 1940 in Winters, CA and was the 930th peach ever patented. This yellow fleshed peach has yellow skin and is highly blushed. First class flavor. A great option for storing in the freezer or eating fresh. | <urn:uuid:862297ae-a59b-4942-a988-eba8a9b499cc> | CC-MAIN-2022-33 | https://fowlernurseries.com/product/alamar-peach-2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.954227 | 78 | 1.773438 | 2 |
Rwanda's Genocide Ended 26 Years Ago. Survivors Are Still Finding Mass Graves
From the street, the home looks like any other in this neighborhood on the outskirts of Kigali, Rwanda's capital. A pitched terra cotta roof rises above the sturdy brick wall surrounding the property. The blue metal gate has neat triangles mounted across the top to ward off potential intruders.
But when the front gate swings open, an extraordinary scene emerges.
The yard is pocked with shovel holes, some of them dozens of feet deep. Next to the holes are mounds of dirt, with the tops of leafy banana trees poking through.
It was just late last year that people were searching through 25-year-old mass graves.
The home's owners planted the trees to hide mass graves after the 100-day genocide that raged from April 7 to July 15, 1994. Now, thousands of bodies are being recovered and laid to rest at nearby genocide memorials.
Innocent Gasinzigwa, 70, is a volunteer with Ibuka, an organization of genocide survivors helping to honor the memory of those who were killed ( ibuka means "remember" in the Kinyarwanda language). After receiving a tip that this property contained mass graves, he and his crew took sledgehammers and delivered blows to the ground all across the yard.
"It sounds different when there's a well underneath," he explains through a translator.
He walks over to one such "well" — a hole 20 or 30 feet deep, that was not dug to find water, but to hide hundreds of bodies. At his feet, small rocks and dirt tumble down into the darkness.
Official estimates put the death toll of the genocide between 800,000 and 1 million people. Extremist Hutu militias carried out the mass slaughter primarily of Tutsis, an ethnic minority, as well as members of the Twa ethnic group and moderate Hutus who protected those fleeing the violence or refused to participate in the violence. As many as half a million women were raped.
"These people need to be buried in respect"
Joseph Nkurunziza, the co-founder and director of Never Again, a peace-building organization focused on preventing genocide, calls it a "genocide of proximity," in which neighbors and even relatives turned against one another.
Many of the survivors of the violence still grapple with its scars, both physical and emotional.
Gasinzigwa's wife and seven children were among those killed. He bears a machete scar across the back of his neck and left ear from where a génocidaire tried to decapitate him. Gasinzigwa escaped by the grace of God, he says, and that's why he does this work of recovering victims' remains and giving them a proper burial in a nearby memorial cemetery.
"It's my purpose to do that," he says. "These people need to be buried in respect."
Nkurunziza says that proper burials are an important part of overcoming trauma.
"If you lost your loved one, there's a time you mourn. You pay your last respects. And then you bury," he says. "For purposes of healing the broken hearts, it is essential that the dead can have a decent burial."
Rwandans frequently visit these sites — cemeteries, memorials, even digs like this — to remember the victims and to vow it will never happen again. A quarter of a century later, volunteers like Gasinzigwa are still finding and exhuming mass graves all over the country.
Going back to the past can be difficult, Nkurunziza says. "But it's something that you can't shy away from because it happened."
It took 30 years of colonizers stoking ethnic tensions in Rwanda for the violence to erupt, Nkurunziza points out. Healing is "not something that can be achieved in the middle of the night."
"That history that people observed — it is a bit hard 25 years down the road to just forget it."
The sites serve as a reminder of what happened — and, he says, "a commitment that this shouldn't happen again."
"The only way is forgiveness"
A young man, paid by Rwanda's government to help excavate this site, plunges his bare hands into the earth, turning his palms up and sifting the orange-red dirt until all that remains are bone fragments — maybe 2 or 3 inches long. He sets them aside on a blue tarp. When he encounters a large clump of dirt, he picks up a hammer and delivers a few sharp blows. It could contain a calcified body part.
By last fall, they had found the remains of an estimated 2,500 people in this dig; they expected to find at least double that before they are done. Gasinzigwa carefully sets aside any personal items and every scrap of clothing they recover in the hopes that some survivors are able to identify the remains of their loved ones.
This was the seventh mass gravesite Gasinzigwa had unearthed by September 2019, a year and a half after he began working in this village, Masaka, and the neighboring town, Kabuga. In all, Gasinzigwa and his workers have laid about 70,000 people to rest, and thousands of bodies have also been discovered by volunteers at other sites throughout the country. Gasinzigwa is certain that there are more graves nearby; he just doesn't know where to look yet.
This area was frequently used as a burial site for two reasons: It was on the outskirts of Kigali, where génocidaires would intercept Tutsis fleeing violence in the capital, and it was relatively undeveloped. After the genocide, houses were constructed — knowingly or not — atop the graves.
The man who built this home was a top military leader during the genocide, and his children were members of a local militia. They set up a roadblock at the intersection down the road to intercept Tutsis, and they would bring victims here for dismemberment, decomposition and burial.
The military leader's elderly wife still lives here; she is taking a nap even as workers recover bones in the dirt outside her bedroom.
"The only place that she doesn't want us to go is in the house," Gasinzigwa says. "There's also another 'well' in the house."
When the family built the home, they wanted to cover up that mass grave specifically, the tipster told him. When his crew is done combing through the yard, the police will evict the woman and the workers will tear down the house.
When he discovers graves from the genocide, Gasinzigwa turns the homeowners over to the police, but they're sometimes released with no charges. It's disappointing, he says, but retribution isn't the point.
"What matters is that the bodies of the genocide victims are finally put to rest," he says.
His wife and six of his children have already been laid to rest; one child remains unaccounted for. But he doesn't do this out of a yearning for them. He says he has come to peace with what happened.
"All of what they did, all of the killing — they didn't get anything from it," he says. "For my heart to be cleansed, the only way is forgiveness."
He seems aware this may be difficult for outsiders to comprehend, so he continues to explain. "It's the only way to do it," he says. If he didn't forgive, the hate would only fester and turn toward vengeance, and then he would be no better than they were. "For me, it's the only way — it's the only thing I can do, to forgive."
He pauses and then says simply, "To be able to go past that is to approach God."
A few days after Gasinzigwa showed NPR the gravesite, he was striding down the street again. He had gotten another tip: another mass grave, only a few hundred yards away from the last.
Melody Schreiber is a freelance journalist who reported from Rwanda on a fellowship with the International Women's Media Foundation ( ).
Copyright 2020 NPR. To see more, visit https://www.npr.org. | <urn:uuid:f4add3c6-4c9d-4c37-810e-92e3c520055f> | CC-MAIN-2022-33 | https://www.wksu.org/2020-07-16/rwandas-genocide-ended-26-years-ago-survivors-are-still-finding-mass-graves | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.979659 | 1,721 | 2.765625 | 3 |
Essalam English Schools – Smara and Ausurd
Essalam English Center is a place where Saharawi are able to learn an international language to tell their story to the world. The goal of the school is to prepare adult students to communicate conversationally in English, both informally and professionally. Established at the request of the Saharawi, the school was officially inaugurated. The Smara school was officially inaugurated in March of 2005 as Essalam (the Arabic word for “peace”) English Center.
Essalam English Center brings a high quality English language program to over 150 students in the refugee camps. The program uses a Cambridge curriculum, a technology audio-lab, and most importantly, native English speakers.
Essalam English Center aims to equip the next generation to use their voice to share their story, as well as make a difference in their community and internationally.
This center is more than learning the English language: the aim of the school is to inspire the Saharawi to use their voice more effectively, eloquently, and powerfully.
The Essalam English Center of Ausurd was established in 2016. Hundreds of students gather and learn at the two Essalam English Schools.
Student Spotlight: Khalihena
An excerpt from Forgotten Faces.
My name is Khalihena. I’m 22 years old, and unlike most Saharawis, I am an only child. My father owns a small store, which carries kitchen and household supplies, and sometimes I help run the store in the evenings or on the weekends. In May of 2014, I graduated from Essalam English School. I was very motivated to learn English because it’s the language of the world. It will be very useful in my future. My day job is working as an English teacher in a local middle school. I enjoy working with my students, and I feel satisfied with my work, as I believe I am helping the youth by giving them something that will enhance their futures. It’s not easy. Many students do not show the desire or motivation necessary to learn a second language, but others do.
I really enjoy writing, too; I write about anything, really, but mostly about things that relate to the struggle my people have endured and our hope to be independent one day. It’s difficult to write about our experiences in exile because the realities we face make it somewhat necessary to ignore certain aspects of life, to shut them out, or become hardened by them. We have endured indescribable experiences here in the refugee camps, but in spite of what we have suffered, we have learned a lot—more than what you could ever learn in school. We have learned how we can be patient while being oppressed and displaced from our homeland. We’ve learned how to keep standing in the face of great challenges.
Freedom is the necessary foundation for anything else to be built upon, and so our people, for now, hope only in our right to self-determination and to live freely in our land. The future is always full of hope, but it’s true that it’s hard to talk about my hopes and dreams for the future because there is that need for freedom. My message to the rest of the world is this: we all must continue to educate ourselves and grow in the ability to change our situations for the better. | <urn:uuid:362bb07c-6b61-4b8e-ac5a-c162a217f1a3> | CC-MAIN-2022-33 | https://notforgotteninternational.org/education/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.967185 | 691 | 1.78125 | 2 |
It is more difficult than you might think to integrate electronic signature technology into your business.
The Difference Between Electronic Signatures and Digital Signatures
It is crucial to understand the differences between digital and electronic signatures if your company requires signatures in order to conduct business. Your company's requirements will influence the technology and processes that you use.
What's an Electronic Signature?
Over time, the definition of a signature has remained constant. It has changed in many ways. Nowadays, a signature can only be considered in the context of an email. Signatures in the past have been used to signify different things depending on their context.
However, electronic signatures have been used to sign multiple documents depending on their context. Although adding your electronic signature on paper is quite common, it was not always easy.
Although signatures have seen many changes throughout history, their meaning has remained the same. It is a sign of a person's identity. Signs are often attached to papers or used as a replacement for certificates.
Electronic Signature Benefits:
Legally binding documents between corporations and organizations must be exchanged. The documents must be completed within the time frame specified. It is crucial that all documentation is correct. Signatories who have not signed on the page they were supposed to be signing must send it back and ask for corrections.
It can take a lot of time to sign a document using a handwritten paper-ink process. It is a long process that involves printing, faxing, courier, scanning, and so forth. It takes you a while to send and receive documents that require signatures from several people.
3. Simple to use
It is easy to use and create e-signatures. You can find a lot of software online that will help you create your electronic signature maker. After you have mastered how to use it, your e-signature can be attached to any document. No matter what device you use, it is as easy as possible.
One must constantly be looking for ways to cut costs and increase profits when running a business. E-signatures are a cost-saving option that can be used to save money on paper, pens, and Xeroxing.
5. Secure and Safe
Sometimes it can be stressful to deal with paperwork that is official. Even if you take every precaution, the possibility of losing, stealing, or altering your papers is still possible.
6. More Legal Support
According to the e-signature legislation, any document that is bonded using an electronic signature has the same effect on it as one with a wet ink signature.
To reduce the environmental impact of human activities, many regulations and rules have been put in place. Each company has its own set of policies that make it more environmentally conscious. Since paper is made from trees and water, deforestation must be tackled immediately.
What is Digital Signature?
Digital signatures are mathematical methods that verify the validity and integrity of digital documents, software, and communications. This digital signature is the digital equivalent of a handwritten signature, or a stamped seal but has much more security. A digital signature serves to protect digital communications from tampering or impersonation.
Digital signatures can prove identity, origin, and status in electronic papers, transactions, and digital messages. Digital signatures can be used to confirm signed permission. The digital signature creator is legally binding in many countries, including the United States. They are the same as traditional handwritten signatures.
Digital Signature Benefits:
1. Personal identification numbers, passwords, and codes
This is used to verify and identify the identity of signers, as well as to validate their signatures. Email, username, and password are the most common ways to do this.
2. Asymmetric Cryptography
The public key algorithm is used to encrypt and authenticate private and public keys.
A long string of numbers and letters representing the sum of all the correct digits in digital data can be used to compare and identify errors or modifications. A digital fingerprint can be described as a checksum.
4. Cyclic redundancy checks (CRC)
Digital networks and storage devices use an error-detecting code to detect changes in raw data.
5. Validation Certificate authority (CA).
CAS act as a trusted third party by accepting, authenticating, and issuing digital certificates. They also issue digital signatures. The use of CAs is useful to prevent the creation of fake digital certificates.
6. Trust service provider (TSP) validation
TSPs are legal entities or individuals that validate digital signatures on behalf of corporations and provide signature validation results.
The Difference Between Electronic Signatures and Digital Signatures
An electronic signature can be used to verify a document, while a digital signature can be used to protect it. Digital signatures are regulated by the certifying authority. Several national laws and rules are used to authenticate an electronic signature.
A digital signature can be authorized by the government, or any non-governmental certification provider body. Electronic signatures can be approved by specific suppliers, document producers, and other involved parties. A digital signature serves to protect the document. An electronic signature can be used to verify that the document is authentic.
Digital signatures are more secure than traditional signatures because they have additional security features. An electronic signature is less secure because it has fewer security safeguards.
An electronic signature can be defined as a broad term encompassing a large range of electronic data. A digital signature uses public-key cryptography as a means of protecting it.
A digital signature can be used to get the information because the signature is linked with the information of the signatory. Although an electronic signature doesn't keep track of signatory information, it can be separated from the signature. A timestamp allows for the verification of the integrity of data. It proves that data was present at a particular time and has not changed. The timestamp is a guarantee of the integrity of an electronic signature.
The main difference is that a digital signature refers only to a set of cryptographic procedures. However, an electronic signature is legal because it gives the signature a regulatory framework that gives it legal legitimacy.
Another difference is the context in which they're used. Electronic signatures are used most often to sign electronic documents. However, a digital signature is used by certifying organizations to protect papers.
Digital signatures protect against identity theft and allow identification and verification in many activities, including tax-related, administrative, bureaucratic and tax-related. The electronic signature proves that the signer has agreed to the terms of the contract electronically. It could include signing their name in an email, entering their PIN into an ATM, or signing their name electronically on touch screen gadgets.
It is important to note that electronic and digital signatures can be used interchangeably, but have significant differences. The type of document you want to sign and the required level or validity will determine the type of signature that can be used. Although both digital and electronic signatures can be legally enforced, the former is preferred because it is more secure. Esignly, This is a quick, easy, and secure way for you to sign documents, as well as many others. | <urn:uuid:3904178f-2ac1-44bf-a375-8042920d911b> | CC-MAIN-2022-33 | https://www.esignly.com/electronic-signature/technology/digital-signature-and-electronic-signature-the-difference.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.939025 | 1,467 | 2.265625 | 2 |
UN Forum Series Blog: Mandatory human rights reporting law will push companies to action
The implementation of the United Nations Guiding Principles on Business and Human Rights (UNGPs) is, most certainly, a journey which will take some time for companies...One of the most significant challenges, which may see a substantial amount of change in the coming year, relates to the promotion of increased transparency on human rights performance and challenges. One way in which transparency may be improved is through the adoption of effective reporting frameworks. What’s more, there is a strong argument that reporting requirements can stimulate action...The [UK's Modern Slavery Act, or,] MSA requirements are a good opportunity for many companies to dip their toe in the human rights reporting water, but they only really start to make sense if they are seen in the broader labour and human rights context, rather than a sole focus on forced labour and trafficking issues – as important as these are. With this in mind, we are anticipating a number of companies starting their human rights journey by producing an ‘MSA+ Report’ for 2016. | <urn:uuid:cc8bf61e-aa97-4fcc-809c-1aadeb828e0c> | CC-MAIN-2022-33 | https://www.business-humanrights.org/en/latest-news/un-forum-series-blog-mandatory-human-rights-reporting-law-will-push-companies-to-action/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.953537 | 222 | 1.59375 | 2 |
Pictured l to r: Kathy Renfrow, Fort Bend County Office of Emergency Management; Cheryl Sewell, The Arc of Fort Bend
FORT BEND COUNTY, TX – Who would have thought that the popular game of Bingo could be used to make Emergency Preparedness more fun? Jeff Braun, Emergency Manager of Fort Bend County, states, “Of all the programs the Office of Emergency Management offers on Emergency Preparedness, this is the most fun!”
Fort Bend County Office of Emergency Management (FBC OEM) unveiled Ready Bingo at the Fort Bend County Coordination Council Meeting on October 23, 2013. Ready Bingo was created to be a fun tool to help educate citizens on Emergency Preparedness. The idea was born as the result of a conversation Kathy Renfrow, Planning Coordinator from the FBC OEM, had with Cheryl Sewell, Director of Youth Programs at The Arc of Fort Bend, a non-profit organization that serves individuals with intellectual and developmental disabilities, about outreach ideas that would assist different populations on how to be prepared in the event of an emergency. Cheryl suggested that OEM create a bingo game for emergency preparedness and she offered her assistance to help with the development. Because of Cheryl’s idea, Ready Bingo is now a reality being produced exclusively by Ready Houston for the region.
The Ready Bingo game is picture-driven, depicting 34 different images of emergency preparedness items such as bottled water, flashlights, batteries, mechanical can openers, prescription medication, etc. Each card held up by the leader of the game has an important message in English and in Spanish of the emergency preparation principle being taught. For example, the game leader holds up a large picture of bottled water for all the game players to see. On the back of the bottled water picture the leader is prompted to read the important message (in English or Spanish) for the audience that states, “your emergency preparedness kit should include at least one gallon of water per person per day for drinking and sanitation”. The audience then searches their unique bingo card of 25 emergency preparedness images to find a bottled water match, covers their match with a bingo marker and the game proceeds to emphasize the next principle.
“It was exciting to help develop an engaging, fun way to stress the importance of the emergency preparedness principles of “Making a Plan, Building a Kit and Staying Informed” to a variety of audiences including seniors, children, English as a second language (ESL) students and individuals with functional and access needs” says Kathy Renfrow, Fort Bend County OEM.
As one avid promoter of the game, Barbara Irving of Project Lift, states, “We are able to really get and keep the audience’s attention in an interactive way. We really wanted to be able to make an impact in terms of disaster preparation and prevention education and Ready Bingo is helping us do just that, make an impact”.
Ready Houston has mass produced the Ready Bingo and it’s now available for use by community partners in the City of Houston, Brazoria, Fort Bend, Harris, Galveston and Montgomery Counties. | <urn:uuid:dc30fc96-95ad-4db3-a457-ceae812581e0> | CC-MAIN-2022-33 | https://fortbendcountynews.info/fort-bend-county-office-of-emergency-management-unveils-ready-bingo/?manage-my-subscriptions | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.945159 | 657 | 2.625 | 3 |
I like to make recipe at home. I like to share recipes with my friends. I am a young Indian writer. I like to write poems and stories.
It is cold all over the country. People are constantly fighting with the cold wind of winter. In this condition, you have to try everything to keep the body warm by yourself.
Wearing multiple warm clothes this winter, drinking hot coffee-tea, sitting in front of a fire or room heater, no matter how hard we try. However, among all these initiatives, we need to take a simple initiative.
And that is to eat food that helps to keep the body warm. Foods that contain fats, proteins, and carbohydrates take time to digest, creating body heat. Try to stay healthy by eating some of these foods regularly in winter.
1. Vegetables that grow under the ground, that is vegetables that have roots, require a lot of energy to digest. This causes a lot of heat in the body. That's why eat potatoes, carrots, radishes, turnips, beets to survive the winter. Onion is also very useful in this case.
Almonds And Dates:
2. Different types of nuts, such as Chinese nuts, cashew nuts and pesto nuts and even dates are very useful food in winter. This is because these nuts and dates speed up the metabolic process and raise body temperature.
3. Apples, oranges and coconuts are very useful fruits in winter. This is because these fruits contain a lot of fibre, which takes time to digest, which increases body heat.
Eggs and chicken:
4. Eggs and chicken contain a lot of protein, calcium and iron which takes time to be digested and in the same way, the body gets heated.
Herbs And Spices:
5. Some known herbs and spices, such as garlic, ginger and chilli, generate heat in the body. So now try to keep any of the above foods on your food list every day to survive the onset of winter.
6. Honey is a unique ingredient to fight against cold, cough, flu etc. Although it is a sweet food, honey does not have the problem of extra calories. Also helps to keep the body warm.
7. In winter, the tendency to mix ghee with rice or bread on rice is quite popular. Ghee warms the body and protects the body from winter ailments. So spreading ghee on food or cooking food with ghee in winter will help to warm the body. | <urn:uuid:a0f99e82-a4b4-4a24-8e68-a326f74b7af0> | CC-MAIN-2022-33 | https://discover.hubpages.com/health/These-Foods-Keep-The-Body-Warm-In-Winter | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.950961 | 534 | 2.46875 | 2 |
Because it is so idyllic, rural, a Vietnamese village culture remains and is living strongly in the heart of the city. It is here that the sidewalk toad shops, or commonly known as sidewalk iced tea, even some cultural researchers in Hanoi also call it “Iced Tea Culture – Culture of Iced Tea”. Pavement”.
Perhaps nowhere on this S-shaped land do people like to sit on the sidewalk drinking iced tea like in Hanoi and perhaps nowhere have as many iced tea shops as here. Sitting and drinking iced tea by the roadside, sidewalk, park… seems to have become a very unique cultural routine of Hanoians. Iced tea shops appear the most, the most popular compared to all other types of shops in Hanoi. Whether it’s on the side of the road, on the sidewalk, or in the caves and alleys, the iced tea shop always attracts a lot of passersby.
Just a few plastic chairs, a small table containing a few gum, peanut candies, a few green mangoes, toads, apple plate, a pot of tea, a pitcher of ice, a thermos of hot water, a tray cups, boxes of pipe tobacco… that’s it
Not picky about the form, the space of the iced tea shop only needs a thermos, a pot of tea, a few chairs, not fussy in the way of preparation, not picky about customers, friendly and idyllic sidewalk iced tea. surprisingly simple.
Sidewalk iced tea appears from early morning until late at night. In the morning, the breakfast is still smoky, a glass of green iced tea for a sober working day. At noon, after a meal, office workers, regardless of boys and girls, young and old, always have to invite each other to sit down with a cup of iced tea and peanut candy. Then after work or at night, in meetings with friends, a rustic iced tea with a plate of tiny seeds makes the relationship more intimate.
With just a few pennies, customers can sit and drink water, chat for hours without being reminded, and even have the enthusiasm and enthusiasm of the ladies and gentlemen of the shop to continue chatting in the sea. That’s why people also call these small iced tea shops with a very catchy name: sidewalk news agency.
Iced tea on the sidewalk where the beginnings of stories without beginning or end, in the sky and under the sea
Therefore, sidewalk iced tea has become a destination without an appointment for any age group. Nothing on sidewalks, street vendors, and iced teas are also present in many eateries, even luxury restaurants. Hanoians are still picky in their way of eating and living, but I don’t understand why iced tea is still so popular? People come to iced tea as a habit, sipping a cup of iced tea in the hot summer but cooling their heart, in the cold winter, sipping a cup of hot tea, enjoying the sweet taste in the mouth. , immersed in the stories “no beginning-no end”…
Each person has a reason to stick with the bar, the interesting thing is that everyone accepts it and looks to it as a hobby to entertain after stressful working days.
Not only Hanoians, tourists from far away when coming to this land of Kinh are interested in this unique popular culture. Saigon people love the simplicity but warmth of sidewalk iced tea. Foreign tourists are surprised and delighted when they see the image of civil servants in suits, full suits, still chatting passionately over cups of iced tea in busy streets.
Not only Hanoians, tourists from afar when coming to Kinh Ky are interested in this unique popular culture.
Like that, sidewalk iced tea is an indispensable part of life here, everyone accepts its presence, and always comes to it as a hobby to entertain after stressful working hours. . A very popular bar, nothing special, but it has become an indispensable part of the lives of the people of the capital. Then when you have to go far away from here, the habit of sidewalk iced tea is nostalgia and curiosity for visitors when coming to this land of thousands of years of civilization.
Thai Nguyen tea village provides delicious broken tea to serve the needs of customers with free shipping | <urn:uuid:43eaebee-b4c3-4abb-a655-d5011f5a86b0> | CC-MAIN-2022-33 | https://linkpiz.com/if-you-are-hanoian-or-have-ever-set-foot-in-or-lived-in-this-land-long-enough-to-understand-hanoi-then-there-is-a-very-familiar-image-present-throughout-the-streets-not-unfamiliar-even-very-famil/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.957706 | 913 | 1.84375 | 2 |
While the world is dealing with COVID-19, and parts of NSW rebound from the summer’s devastating bushfires, Member for the Dubbo electorate Dugald Saunders said it is timely to remember that more than 75% of the state is still in some level of drought.
Mr Saunders said a significant amount of money has been invested to support people in regional NSW, and that support will continue.
“There is no doubt that as a government we have had a lot to deal with over the past few months,” Mr Saunders said.
“But let me be very clear, drought has not been forgotten. Thanks to strong financial management we have been able to support people through bushfires and now coronavirus, but that has not come at the expense of supporting people in drought-ravaged parts of NSW.
“There has now been almost $1 billion invested in regional NSW in the current financial year, to help primary producers and communities through the drought. That funding has been made available in a variety of ways, and although I realise not every single primary producer has been able to qualify for everything available, there has been a huge effort made to help as many as possible in the right way.”
As part of the NSW Government’s drought response more than $186 million has been spent on the drought transport subsidy while the Farm Innovation Fund has seen in excess of $436 million returned to regional communities.
Almost $100 million has been distributed through the Drought Assistance Fund, and in excess of $100 million worth of Local Land Service rates and Fixed Water charges have been waived.
“I am in constant contact with the Minister for Agriculture and Western NSW, Adam Marshall, and we agree on the need to keep supporting our farmers and rural communities,” Mr Saunders said.
“Parts of the region have received good rainfall in recent times, and although I’m mindful the drought certainly isn’t over, there is also the need to be able to help primary producers transition into drought recovery in the best way possible.
More information on the assistance available from the NSW Government can be found by visiting www.droughthub.nsw.gov.au | <urn:uuid:b1d0c046-9e36-4fd8-9e65-e0bd6e9959d9> | CC-MAIN-2022-33 | https://dugaldsaunders.com.au/its-not-time-to-forget-the-drought-saunders/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.978976 | 453 | 1.710938 | 2 |
MongoDB and Hadoop are two of the most popular open-source database systems on the market. However, before you decide which one to choose, it’s important to understand the differences between them. In this article, we’ll compare and contrast these two databases so that you can make an informed decision about which one is best for your needs.
What is Hadoop?
MongoDB, formerly known as MongoDB Atlas, is a NoSQL database management system (DBMS) written in Java. It was created in 2009 by Jeff Lindsay, who started the company that developed it, with the goal of making it fast and easy to use for data storage and analytics. MongoDB is notable for its scalability and performance.
Hadoop is an open-source software platform for distributed data processing. It was developed at Yahoo! Research in the early 2000s by Doug Cutting, MapReduce architect Vijay Govindan, and others. Hadoop Distributed File System (HDFS), its primary component, allows organizations to build powerful distributed applications by storing data across many servers. This makes it well-suited for large-scale data storage and analysis tasks, such as machine learning and natural language processing
Differences Between the Tools
MongoDB is a document-oriented database management system, whereas Hadoop is a distributed processing platform for large data sets. MongoDB has several advantages over Hadoop, including being faster and more scalable.
MongoDB also offers some features that are not available in Hadoop, such as full text search and automatic sharding (distributing the workload across multiple servers). While both tools have their pros and cons, it may be best to choose one or the other depending on the specific needs of your project.
How to Choose Which Tool to Use for Your Project
MongoDB is a great choice for simple projects where you need to store data in a document-oriented way. It’s fast, efficient, and can handle lots of data. Hadoop is a good choice for more complex projects where you need to process data on a large scale. It has parallel processing capabilities and can work with various languages.
In this article, we will be diving into the difference between MongoDB and Hadoop. Both of these databases offer different benefits that can be useful in a variety of applications. Ultimately, the decision comes down to what you are looking for in a database. If you want something that is fast and easy to use, then MongoDB is probably a better option for you.
However, if you are looking for features that Hadoop offers, then MongoDB might not be the best choice for you. | <urn:uuid:78b8f2fd-70cb-4484-b7b8-6d7188e3c4fc> | CC-MAIN-2022-33 | https://learnopedia.co/difference-between-mongodb-vs-hadoop/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.957638 | 557 | 2.859375 | 3 |
Taking Care of Emotional Wounds
When physically wounded most of us don’t ignore the problem but rather take the necessary steps to address the injury. We get the help we need to let the healing process begin. While we’re gentle around the spot of our injury this tender regard comes from an immediate, mindful focus on that injury.
It’s too bad that when it comes to emotional wounds the behavior described above tends to go out the window. Rather than making the emotional wound the center of our attention, rather than making it something of pressing concern to be addressed and worked through as quickly as possible, we feel compelled to keep that emotional wound at arm’s length. We ignore, repress, or project. We recur to our full psychological repertoire to try to protect our fragile psyches. We turn away from instead of towards the pain.
But what happens when a physical wound isn’t treated? It gets worse, it festers, and it ends up causing a lot more damage than it would have if it had been properly dealt with from the get go. Emotional wounds are just the same. They don’t magically go away just because we ignore them. They don’t cease to cause us problems just because we don’t fully address them. Rather they end up causing all sorts of problems in our relationships and our continued growth as human beings.
So when it comes to emotional wounds, we’ve got to resolve to drum up the same type of mindful care, focus, and regimen for healing as we do when our wounds are physical. Rather than turning away from the emotional pain we’ve got to let ourselves inhabit it, learn about its source, treat it, and reach out for help if necessary so that we can let the process of healing begin. | <urn:uuid:ba81db8b-176a-4ea9-90e2-5dec0d8b7f53> | CC-MAIN-2022-33 | https://evolutioncounseling.com/taking-care-of-emotional-wounds/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.949142 | 378 | 1.914063 | 2 |
This project has now ended.
Please visit Multinational Andean Project: Geoscience for Andean Communities for more information.
A joint funded project with Canadian International Development Agency, the Geological Survey of Canada and the National Geoscience Agencies of Argentina, Bolivia, Chile & Peru.
MAP Airborne Geophysical Surveys
Geoscience Canada Article about the Project (pdf - 850K) | <urn:uuid:fa024300-5507-477d-a462-9c0c4a65bf66> | CC-MAIN-2022-33 | https://pma-map.com/gsc/Default.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.759253 | 93 | 1.898438 | 2 |
Trade services are soon emerging as one of the crucial areas for research and policymaking in terms of the global trade scenario. A General Agreement of Trade-in-Service (GATS) was implemented back in 1995. However, it was only recently that there was the realization of close link ups between goods and service exports, and the development of an improved information system, that researchers have given greater significance to trade certain aspects for instance "Comparative Advantage" and "Trade Liberalization".
However, since efficient research on this same lagged, the negotiations and policy analysis have to supplement whatever assessment can be gained on the service sector.An essential cause for the lack of systematized structured facts and data concerning services exports is due to the diverse nature of the industries that constitutes it. The World Trade Organization clearly defines 12 service industries, where every industry segment highlights a distinguished trait, measurement concerns and economic incidence. Furthermore, each service industry section has four trade modes in it and that trade in services comprise of imports and exports as well.Recently, there has been a rise in the trade servicesorganizations providing a shared data platform, over multiple vertical markets to enable the trading members interact with others and operate their regular business.
The features and functions of trade and service companies are built on this aspect. At the same time, constituents in every market need the appropriate business information on which certain time-sensitive and critical decisions depend. Essential information generally source from incongruent sources and hence, organizations need to come up with a procedure to efficiently interpret and manage it. Eminent trade in service enterprises specializes in the following sections:-These services help them in gaining a competitive advantage over the other market players.Recently, numerous service providers in trade services offering in the product and pricing data to the electrical industry have come with up innovative pricing solutions. To elucidate, solutions that offer an internet base user data system thereby providing end consumers and users with an advanced and detailed outlook on every manufacturer price as well as product developments in the future years. The admission to these systems in customized for every single distributor available via a secure username and password. To share few names would be the electrical pricingand copper pricing. | <urn:uuid:3696c322-380f-4c50-b7a2-caebfbb8efcb> | CC-MAIN-2022-33 | https://mayte.us/author/mayte/page/2/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.949462 | 437 | 1.78125 | 2 |
Exproperti.com – If you are one of the many students who chose to learn French, then it is likely that you will soon realize that a small French study room is just as important as having a large French classroom. A small French study room can be a challenge to set up, but it can also be the key to success. A small French study room should have a few advantages, however. These advantages will make your learning experience much easier.
The First Step in Creating a French Study Room
The first thing you need to do is to make your small French study room into an ideal learning environment. For this purpose, your small French study room needs to be devoted exclusively to this activity. It can’t be shared with others and you need to ensure that it is exclusively for you alone. You should not be able to sit next to someone who speaks French, either.
In addition, you will want your small French study room to be the perfect size for your desk, chair, and computer. This is important because you don’t want to feel cramped or crowded when you spend a great deal of time in your small French home. You may even find that sharing a computer with someone who speaks French is difficult at times! Therefore, if you have the luxury of a large table and chair, you may want to consider setting up your desk in your small French home so that you can comfortably work on your assignments.
Quiet French Study Room Design
Once your small French study area has been set up, it will be much easier to focus on your lessons. You will not be distracted by the little noises in the home. This noise will only add to your frustration and make you less effective. Your small French study area should be a private retreat where you can get away from the distractions of life. If you need to work during the day, you will need to ensure that you are able to study without interruptions.
While you are planning your small French home based learning experience, it might be helpful to consider how your family feels about the idea. Some people might feel that a quiet study area is not a good idea because it is too easy to become distracted. However, if you are careful with how you use your study areas, you will be able to use them for what they were designed for: learning.
The Luxury of a French Study Room
If you do not have the luxury of a large quiet study area, you might want to consider a larger model that has more flexibility. A good example is a computer board room. This type of room allows you to collaborate with others in a large classroom without being distractingly close. You can read a book and chat with a few other students, while one person completes an assignment on their laptop.
If you cannot afford a big luxurious board room, you might want to consider purchasing a small French apartment. These apartments can be found in any size and can often be found in apartments that are newly built or recently remodeled. The price of such an apartment is often very affordable and can fit within your budget if you are working on a tight budget. However, you should understand that many of these apartments are often quite small. Therefore, you will need to plan your time accordingly.
If you do not like the idea of sharing a small French study room with someone else, you might want to consider a Scandinavian apartment. A Scandinavian apartment is perfect for someone who wants to study in style. Many of these apartments are found in trendy neighborhoods where there is plenty of natural light and outdoor activities. The price for such a room is often on the higher end but many people cannot afford it fits right into their personal interior design plans. The small interior design look can easily be turned into a large cozy home when the lights and candles are lit and everyone enjoys a good book. | <urn:uuid:6744674f-246e-446a-8ee6-2f673faf8420> | CC-MAIN-2022-33 | https://exproperti.com/2021/09/18/5-interior-design-ideas-for-small-french-study-rooms/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.979342 | 777 | 1.984375 | 2 |
What do you wear when you encounter every season within a 12-hour window?
“That’s our largest one-day temperature change in October on record,” said Russell Danielson, a meteorologist at the National Weather Service in Boulder. “We tell people around here to dress in layers, because sometimes you get summer and winter in the same day.”
That chalks up to a 54-degree temperature drop within one day. It also marks a 40-degree plummet in four hours, the mercury diving from 81 degrees to 41 between 4 and 8 p.m. As the winds switched around from the north, gusts up to 55 miles per hour heralded the bone-chilling front’s arrival.
Temperatures were continuing to fall on Thursday, the National Weather Service forecasting a low of 14 degrees into Friday morning. “The record low is 22 degrees, set back in 1946. We should shatter that record.”
How strong can these cold fronts be?
Cold fronts on the High Plains are notorious for their dramatic and capricious shifts. The dry climate makes it easier for enormous fluctuations to occur, while the lack of water bodies or obstacles means that air masses of the opposite extreme can battle it out over relatively short distances. It’s not unusual for the temperature to fall 30 degrees or more behind a fall or winter cold front.
“Our biggest temperature difference in a singled day was 66 degrees on Jan. 25, 1872,” Danielson said. “We had a high of 46 and a low of minus-20.”
On occasion, it’s possible to get both a drop and a leap, sometimes with multiple iterations, in the same day. That’s most common if a stationary front stalls, wobbling back and forth. These stationary fronts can also develop a very sharp gradient.
On Jan. 20, 1943, a stationary front got hung up in the Black Hills of South Dakota. The thermometer registered minus-4 at 7:32 a.m. Two minutes later, it had spiked nearly 50 degrees to a comfortable 45. Temperatures continued rising during until the midmorning, hitting 54 degrees before a drop to minus-4 27 minutes later. The temperature swings were reportedly so dramatic that motorists’ windshields cracked, the temperature fluctuations stressing the glass driving from a warm pocket to a cold one.
Wild temperature swings of the past decade in Denver
- Feb. 24, 2014: In two hours, the temperature jumped from 26 degrees to 57 degrees in the midafternoon. The temperature stayed at 63 degrees until 10:30 p.m. By midnight, it had fallen to 29.
- Jan. 5, 2015: 27.9-degree jump, from 12 degrees to nearly 40 degrees in one hour. The same day featured a 15-degree drop in one hour, thanks to a stalled stationary front. After a morning low of minus-4, the thermometer stood at 55 degrees just before midnight, marking the largest one-day temperature swing of past decade. Wednesday’s cold front just missed the mark.
- Dec. 9, 2016: 11 degrees at 3 p.m., 53 degrees at 8 p.m.
- Dec. 27, 2017: 2 degrees at 2 p.m., 45 degrees by 6 p.m. Two days later, on Dec. 29, the temperature swung from 63 at 8 p.m. to 30 degrees by midnight. The next morning’s low was 9 degrees.
It’s worth noting that Wednesday’s temperature drop of 40 degrees appears to be the largest four-hour drop in temperature in Denver in at least the past decade. A four-hour temperature change of 40 degrees or more occurs on average once every two years.
Where is the cold front now?
The cold front has sailed well past the Colorado Rockies and has a history of producing record-shattering cold to the northwest in Montana. Great Falls tumbled to zero Thursday morning, its lowest October temperature ever recorded.
Denver will drop into the teens by Friday morning; if temperatures were to hit 7 degrees overnight, they would snag their largest two-day temperature swing. The current record of a 76-degree leap from December of 2008 stands.
The cold front showed up on satellite imagery over Oklahoma and the southern Texas Panhandle on Thursday morning, an “undular bore” marking the shock felt in the atmosphere. The encroaching cool, dense air was significant enough to send out a ripple-like wave ahead of it, triggering at its leading edge a roll cloud with a few oscillations behind.
Meanwhile, look at this "undular bore" rippling through southwest #Oklahoma after having just cruised through the Texas panhandle. 😍— Matthew Cappucci (@MatthewCappucci) October 10, 2019
This is associated with the cold front that will knock temperatures back into the 60s this afternoon, w/poss. severe weather to the east. pic.twitter.com/neSuXM8o4o
By Thursday afternoon, the front had plowed through western Oklahoma, plunging some spots into the upper 30s and lower 40s while southeastern Oklahoma enjoyed a summery afternoon in the middle 80s. Kenton, a town in the Oklahoma Panhandle, was 45 degrees cooler Thursday afternoon than Wednesday. Kenton hit 87 yesterday.
The front will continue to march east, losing its steam as it approaches the Mississippi Valley. And if you’re in Denver, good news! Next week will feature highs around 70. | <urn:uuid:fd74b338-70ca-4442-bc14-849a07ea51da> | CC-MAIN-2022-33 | https://www.washingtonpost.com/weather/2019/10/10/denver-hit-degrees-wednesday-afternoon-eight-hours-later-it-was-snowing/?itid=lk_interstitial_manual_4 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.941307 | 1,156 | 2.78125 | 3 |
By ALESHA CADET
Tribune Features Reporter
Fishing is a tradition very much ingrained in the culture and history of the Bahamas. Yet in 2019, it is an activity and industry and that is still dominated by men. For various reasons, only very few Bahamian women learn how to fish.
But the Off Da Rock Ladies Fishing Weekend has been trying to change this. For the past four years, this event has been held to encourage women to learn the fundamentals of fishing in a safe and casual setting.
This Friday, women will once again be encouraged to “get up, get out and get off da rock” for the fourth annual Ladies Fishing Weekend featuring new activities and experiences.
The three-day event, which will take place in North Andros this time around, typically starts off with a meet and greet where participants get to know the instructors and boat captains. There will be hands-on learning activities that include lessons on how to tie knots, rig a line, bait selection and casting. For the women, a fishing day will conclude with putting into practice that which they have learned.
Alexandria Newbold, founder of the Off Da Rock Ladies Fishing Weekend, came up with the concept in 2015 “to encourage women to fish by providing them a safe space to learn to fish without judgement and ridicule.”
“We also discuss with participants the importance of conservation and the economics of fishing, and use this platform to raise funds to support our chosen charitable endeavour, which has been BASRA (Bahamas Air Sea Rescue Association) for the last few years. We were able to donate $500 one year and hope as we continue to grow do more and add others,” Alexandria told Tribune Weekend.
She is extraordinarily pleased that Off Da Rock Bahamas has come this far, with the event growing each year with returning women who are now as addicted to fishing as she is, and with new participants eager and looking forward to the experience.
“We have good instruction and they quickly figure out how to hold the rod and feel for the fish nipping at the bait. Now, when we are trolling for bigger fish and there is a fish on the line and the ladies have to fight to get it in the boat...whoa. It is pure excitement watching them reel the fish in, thinking they are too tired, but eventually landing the fish. So it is very satisfying to see them do something they did not think they were capable of doing,” she said.
Alexandria thinks Bahamian women generally do not fish
“I think this lack of exposure results in missed opportunities for women to become involved in the commercial industry – whether fishing commercially for food or as an entrepreneur in the charter sport-fishing industry. It is also a loss of a leisure activity that could enhance well-being and mental health, as fishing is a relaxing hobby providing respite. Women who have participated in the Weekend leave with a sense of accomplishment that they have gone out and conquered a new activity. They feel empowered to go out on their own or with the men in their lives and are confident in their new skill. I believe that if you ‘teach a woman to fish, she feeds the entire family’, and in our culture that means she is feeding the entire community. And it is not just through having a food source,” she said.
For this year’s instalment of “Off Da Rock”, Alexandria is looking forward to giving participants the island fishing experience where they can throw a line out from the shore and get a catch.
“I think it will give them a new appreciation for the sport, so I am also looking forward to that. Most importantly, I am looking forward to growing the brand. In addition to the fishing, participants will go crabbing and be exposed to the work of some of the local craft persons – straw works and plaiting, and wood carving. I will also be teaching them how to clean and fillet and store their catch,” she said.
Based on the overwhelming response following the announcement of this year’s fishing weekend, Alexandria said she has decided it is time to expand the “Off Da Rock” franchise to more than one event a year. Therefore, this year’s Weekend will act as a model that will be replicated throughout the islands of the Bahamas, targeting domestic and international participants/tourists. The new “Off Da Rock Bahamas Ladies Fishing Adventures” will then officially be launched in November.
“Only a few more participants can be accommodated at this late stage this weekend, but persons can message me on Facebook or Instagram or send an e-mail to firstname.lastname@example.org. Most persons going on the trip this year are new to the event, so I have told them to come to ready to fish; appropriate clothing they can get wet – hats, sunglasses, sun block and lots of mosquito repellant. ‘Off Da Rock’ will provide the gear and guide. Each participant receives a rod and reel setup to keep, an event shirt, and a gift bag,” said Alexandria. | <urn:uuid:480f0e77-c6f4-478d-b0f2-d003610772a0> | CC-MAIN-2022-33 | http://www.tribune242.com/news/2019/jun/04/reel-deal-da-rock-event-encourages-bahamian-women-/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.965563 | 1,077 | 1.703125 | 2 |
Listen to this blog
The test summary report outlines the summation of software testing activities and final testing results. Software testers are required to communicate testing results and findings to project stakeholders on the completion of a testing cycle. The content of the test summary report drives decisions for the release of the software. Revision history, distribution list, document review, project description, testing scope, functionalities and features tested in a cycle, test execution details, test coverage, and results, defect matrix, and outstanding results represent the content in a test summary report.
When to Create a Test Summary Report
The report would be created at the close of software testing cycles. In certain cases, testing engineers working on behalf of a QA company can perform a single round of testing before generating a report. Freelance testers can generate and submit the report to spotlight defects in the ‘open’ statuses. The report serves as a guide to help clients with information on the overall ‘health’ of a software application and enable the planning of corrective measures. For instance, a report may convey certain defects repeatedly occurring through several testing cycles. The recommendation from the tester may include the allocation of a higher number of resources to track and analyze the defects, and also a note for the software development team.
What to Include in the Test Summary Report
Precision and relevance form the basis of an informative test summary report. Testing engineers working on behalf of the top software testing companies must aim to custom design the content to match the nature of the testing project and the work assignment. The following points elucidate the inclusions necessary for a test summary report:
The Objective of the Test This section should outline the purpose and general scope of the testing exercise. This portion must reflect the understanding of the tester on the expectations and requirements of a software testing exercise. Additionally, testers should include notes about whether the results meet the business and user requirements. Conformity with business and system requirement specifications and the confidence in providing a quality product to the end customer are quintessential objectives of a testing exercise.
Testing ApproachThis section provides the mechanisms that power the testing approach in a particular testing cycle. Testing engineers must include details of the measures and the types of testing undertaken to achieve the task. A test approach also defines the implementation of the test strategy of a software testing project through two techniques. The first being proactive, in which the test design process is initiated as early as possible to detect and remediate the defects before the build is created. The second is reactive, in which testing follows the completion of design and coding activities. Further, the approach may outline various approaches – dynamic and heuristic, consultative approaches, and a model-based one that would deploy statistical information on failure rates.
Areas Tested and Untested
All the features and functionalities tested would form this section. Testing engineers working on behalf of a QA company are expected to include high-level information in addition to recommendations (for the development team) on the possible new functionalities. Similarly, untested areas of functionality would also form part of this section. The logic and rationale for excluding certain features from testing should be listed in this section for the benefit of reviewers and clients.
Platform DetailsThis section of the test summary report would cover the various versions of a software application, the use of different browsers, and multiple devices. An application must be tested on each of these platforms and the test results collated for the reviewers and clients. This approach is important in modern times given the varied number of platforms, devices, operating systems, and browsing programs.
Defect ReportTesters must report all defects in the interest of saving time and effort for all those involved in the project. This section would be comprehensive and would mention the significant volumes of information, and facts, and would generate a clear view of the technical opinion of the testers. Testing Metrics can include total defects with an information breakup focused on defect severity and additional metrics regarding test cases.
A test summary report, therefore, is a necessary document and marks the conclusion of a software testing exercise. Test engineers must invest time and effort to complete such reports to maintain clarity and transparency of their efforts and provide clients with a clear summation of the project. This report requires the attention and time of experts and experienced personnel because of the critical nature of the content – connect with us to work with the best in the realm and more. | <urn:uuid:0fb67499-1a01-4738-9354-0c3ae632f993> | CC-MAIN-2022-33 | https://codoid.com/software-testing/what-should-go-into-a-test-summary-report/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.929351 | 899 | 2.171875 | 2 |
Saline May Be as Effective as Heparin in Pediatric Central Venous Catheter Flush
A single-center study evaluated the efficacy of saline flush in pediatric patients with central venous access devices.
Following an intervention which found that saline flush had comparable safety and efficacy with heparin for tunneled catheters used in pediatric patients with cancer, a formal flushing guideline advising lower heparin concentrations and increased saline use was issued in Kapi‘olani Medical Center for Women and Children (KMCWC) institution. Results of the guideline change were published in the Clinical Journal of Oncology Nursing.1
“This limited process improvement project was able to show the effectiveness and safety in the use of normal saline flushing and decreased heparin dose flushes to maintain tunneled [central venous catheter] CVC patency in the population of pediatric patients with cancer,” lead author Dee Ann Omatsu, MS, APRN, PNP-BC, CPON®, a nurse practitioner with Hawaii Pacific Health, and coinvestigators, wrote in the study. “This was evidenced by no statistically significant change in alteplase use recorded postimplementation. The decreased use of heparin resulted in cost savings for patients and families.”
CVCs are a key component in delivering long-term intravenous (IV) therapy to children with cancer. These devices are responsible for a variety of treatments, including parenteral nutrition, chemotherapy, and blood product infusions; however, for fluid infusions and blood draws, adequate CVC patency without catheter occlusions is required. Alteplase administration is the appropriate response when occlusion occurs. In certain cases of occlusion, the CVC may need to be removed.
Numerous studies have documented the efficacy of saline flush use in adults.2-4 Yet there is insufficient literature detailing its efficacy and utility among pediatric patients. Heparin is a more expensive medication compared with saline5 and intermittent flushing with heparin throughout the day can place additional financial burden on the patient’s family because it is a medication that is not frequently covered by insurance.6 Thus, investigators sought to reduce the financial burden on patients if saline represented a viable option.
This study included 62 patients, of whom 42% were women and the mean age was 9.42 years. The 3 most common diagnoses among the study group were acute lymphoblastic leukemia (ALL; n = 15, 24%), osteosarcoma (n = 6, 10%), and T-cell ALL (n = 5, 8%). Eleven percent of patients (n = 7) were receiving were Children’s Oncology Group protocols AALL0932, 8% (n = 5) were receiving AALL1131, and 8% (n = 5) were receiving AOST0331.
Prior to the intervention, the institutional flushing guide included heparin administration for all tunneled lines, at a concentration 100 units/cm3 and various amounts depending on the weight of a patient and the type of device. However, a saline lock for all tunneled lines was added to the flushing guidelines as part of the implementation.
In the inpatient setting, a twice-daily schedule using the new push–pause method was implemented. In the outpatient setting, nurses locked the tunneled lines with saline using the push–pause method if their patient was actively receiving care in the unit. Saline lock was also used if patients needed daily infusion regiments and elected to keep their port needle in place.
The heparin lock changes were implemented at time of discharge of the port or deaccess of the external tunneled catheters. Although the port dosage remained the same with 5 ml (100 units/ mL), the implementation meant that the heparin dose decreased from 3 ml (100 units/mL) to 2 mL (10 units/mL) for tunneled catheters. Study interventions began on September 1, 2020, and data were collected over 5 months, with a cutoff at February 1, 2021.
Overall, the mean alteplase usage rate following implementation of saline flush was not statistically significant than with heparin flush after adjusting for age and sex (P = .89). In the preintervention heparin flush period, the mean alteplase usage rate was 2.17 per 2000-line days. The shift to heparin found a slight increase to 2.42 per 1000-line days. Of note, following the implementation, the cost per single lumen, a 30-count box of heparin (10 units/mL) 5 mL syringe, decreased from $520.20 to $366.24.
Providers may be able to safely decrease heparin use and opt for normal saline flush to maintain CVC patency, effectively reducing costs for patients and families, the authors concluded, noting that it is essential that nurses use the positive pressure lock and push-pause techniques.
- Omatsu D, Thompson K, Maglasang B, Yuasa H, Kimata C. Heparin versus normal saline: flushing effectiveness in managing central venous catheters in pediatric patients with cancer. Clin J Oncol Nurs. 2022;26(3):300-307. doi:10.1188/22.CJON.300-307
- Sharma SK, Mudgal SK, Gaur R, Sharma R, Sharma M, Thakur K. Heparin flush vs. normal saline flush to maintain the patency of central venous catheter among adult patients: A systematic review and meta-analysis. J Family Med Prim Care. 2019;8(9):2779-2792. doi:10.4103/jfmpc.jfmpc_6
- Zhong L, Wang HL, Xu B, et al. Normal saline versus heparin for patency of central venous catheters in adult patients - a systematic review and meta-analysis. Crit Care. 2017;21(1):5. doi:10.1186/s13054-016-1585-x
- López-Briz E, Ruiz Garcia V, Cabello JB, Bort-Martí S, Carbonell Sanchis R, Burls A. Heparin versus 0.9% sodium chloride locking for prevention of occlusion in central venous catheters in adults. Cochrane Database Syst Rev. 2018;7(7):CD008462. doi:10.1002/14651858.CD008462.pub3
- Bradford NK, Edwards RM, Chan RJ. Normal saline (0.9% sodium chloride) versus heparin intermittent flushing for the prevention of occlusion in long-term central venous catheters in infants and children. Cochrane Database Syst Rev. 2020;4(4):CD010996. doi:10.1002/14651858.CD010996.pub3
- UnitedHealthcare Medicare Advantage. UnitedHealthcare Medicare Advantage Coverage Summary: Medication drugs (Outpatient/Part B). United Healthcare Services Inc. Accessed July 13, 2022. | <urn:uuid:d814b6aa-aabe-4ea7-8b34-3641a99a55a6> | CC-MAIN-2022-33 | https://www.oncnursingnews.com/view/saline-may-be-as-effective-as-heparin-in-pediatric-central-venous-catheter-flush | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.906255 | 1,496 | 2.375 | 2 |
Preservation & Historic Trades
Workers skilled in the rehabilitation of older buildings are in short supply across the nation. The labor shortage is especially acute in the specialized trades that are often needed for historic preservation projects, such as window restoration, plaster repair, and finish carpentry. In addition, the average age of workers skilled in the preservation trades is rising. As these specialists approach retirement, it will be critical to find ways to share their expertise and build a new cadre of preservation trades workers. A more robust and accessible system is needed to help people enter the preservation trades, find employers who need their skills, and receive ongoing training to advance their careers and earning potential. Explore this page to find more resources and connect the dots of important work across the nation. | <urn:uuid:6e5a8b47-467e-4a4d-b7a7-2e432694b3ce> | CC-MAIN-2022-33 | https://forum.savingplaces.org/learn/issues/historic-trades | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.960344 | 153 | 2.5 | 2 |
Here’s a snippet of my piece:
The Lacuna doesn’t read like historical fiction, but it is a lush exploration of how momentous events like World War II and the Cold War impacted the lives of everyday individuals. It’s one thing to learn from a textbook that the fear of Communism pushed the U.S. to unfairly persecute foreigners, but when it starts happening to Shepherd, who you as a reader know intimately after several hundred pages, you feel the tragedies of history with a fresh pang.
Like I said, I love serendipitously finding the perfect book. The Lacuna is a luxurious examination of two themes very close to my heart: the impact of words and a writer’s inability to not write, as well as the infinite questions of identity that come with belonging, soul and citizenship, to more than one country.
You can read the rest of my article and explore my attempt at Pan Dulce HERE.
PAPER/PLATES is an awesome blog run by my friend Amina Elahi and features insightful literary reviews, interviews with food bloggers, and (the best part) recipes inspired by books. So make sure to check out the rest of the blog while you’re at it! | <urn:uuid:aa0057cf-25c3-4ccc-be2e-00631eddec00> | CC-MAIN-2022-33 | https://laurajschwartz.com/tag/the-lacuna/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.943672 | 260 | 1.609375 | 2 |
Scripture: Acts 2: 4
All of them were filled with the Holy Spirit and began to speak in other tongues as the Spirit enabled them.
Props: handheld fan, candle and light (if your church doesn’t light candles for service), cotton ball with essential oil, recording of strong wind
Do you know what special day this is? This is Pentecost Sunday. It’s the time when we remember that before Jesus returned to heaven, he promised that God would send a helper — the Holy Spirit — to live inside of those who follow him. He promised that the Holy Spirit would give them the power to do great and mighty things.
One day, after the Resurrection at Easter, the disciples were all together and they heard a sound from Heaven: a loud, powerful rushing wind. And a flame appeared – no candle or anything – and touched on each disciple. And the disciples felt a great power and immediately went out to preach – that’s what the power of the Holy Spirit helped them to do – to tell others about God and Jesus.
How do you think you can tell when the Holy Spirit is giving you the power and the urge to tell someone about God and Jesus? Let’s test our senses to see how many ways we can feel that mighty rushing wind of the Holy Spirit:
Can you feel the Holy Spirit? (use a battery-powered hand fan to blow on the children) Can you feel the wind like you’re at the beach or high in the mountains? YES! That’s the Holy Spirit making sure you know it’s there for you.
Can you taste the Holy Spirit? Hmmm, that’s a tough one, isn’t it. Wind doesn’t have a taste, but it we stick out tongues out when the wind blows, we do get another way to feel the wind and know the Holy Spirit is encouraging us.
Can you smell the Holy Spirit? (hold a cotton ball with essential oil in front of the fan to send a scent on the wind) Let’s try it: we already know we can feel the wind when it brushed past us, but the wind – the Holy Spirit – can also use smells to let us know how we can minister to others.
Can you hear the Holy Spirit? (cue Crystal to play the wind storm sound on the Clavinova) Wow, right! That’s a big mighty wind. That’s definitely the Holy Spirit when it really needs to get our attention, right!
Can you see the Holy Spirit? Take a look at the candles on the table. That’s the light of Christ we bring in each Sunday and we take out into the world each week. What makes that light move so that we can see it? YES! The Holy Spirit.
Our basic senses are how we feel and know that the Holy Spirit is with us and ready to help us to do what God asks us to do. This is what we are reminded of each year on the day of Pentecost: that when we know God and follow Jesus, we are filled with the Holy Spirit which gives us the power and the instructions to do wonderful and mighty things for God.
Heavenly Father, thank you for sending us the power of the Holy Spirit. Please fill us up each day with the Holy Spirit that we would have the power to live for Jesus and let His light shine in our lives. In Jesus’s name we pray. Amen.
Delivered on Sunday, June 4, 2017, at Palmetto Presbyterian Church in Mt. Pleasant, SC. | <urn:uuid:cf15951c-e30c-4889-9732-01e7da20d077> | CC-MAIN-2022-33 | https://singingaboutcooking.com/tag/childrens-sermon/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.939068 | 755 | 1.835938 | 2 |
Culture Travel 8 Magnificent Travertine Terraces Around the World By Catie Leary Catie Leary Writer and Photographer Georgia State University Catie Leary writes and curates visual stories about science, animals, the arts, travel, and the natural world. Learn about our editorial process Updated May 20, 2021 Yellowstone National Park's Mammoth Hot Springs consist of travertine terraces formed by an abundance of geothermal vents. Addy Ho / EyeEm / Getty Images Share Twitter Pinterest Email Culture History Travel Sustainable Fashion Art & Media Holidays Community Travertine terraces are some of the most bizarre-looking geological formations on Earth. The rock that makes up these unique formations has been used as a building material since the time of the ancient Romans, and it was even used in the construction of St. Peter's Basilica and Square in Vatican City; however, the most stunning structures this rock produces are perhaps the stepped terraces, one of the most iconic examples of which is located in Pamukkale, Turkey. Apart from this famous Turkish landmark, travertine terraces can be found from Yellowstone National Park in the U.S. to Tuscany, Italy, and almost everywhere in between. What Is a Travertine Terrace? Travertine is a type of limestone commonly deposited by mineral springs through a process of rapid precipitation of carbonate minerals. It often settles in a stepped, terraced formation when the water of a mineral spring cascades down a hill or cliff. Here are eight magnificent and scenic examples of travertine terraces from around the world. 1 of 8 Pamukkale (Turkey) Istvan Kadar Photography / Getty Images Widely thought to be one of the most beautiful places in the world, Pamukkale is named "cotton castle" in Turkish because it's home to a mountain of fluffy-looking white calcium that people travel from all to see. On one section, the travertine displays as a series of platforms, each topped with milky blue water, cascading about 650 feet. Added with the nearby ancient Greek spa city of Hierapolis to the UNESCO World Heritage list in 1988, Pamukkale contains 17 hot springs that have slowly been causing this photogenic phenomenon with their calcium carbonate deposits for centuries. 2 of 8 Huanglong (China) by Chakarin Wattanamongkol / Getty Images Terraced travertines stretch more than two miles through Huanglong Valley in the northwest of China's Sichaun Province. The multicolored pools—glowing golden and blue-green—cut between the permanently snow-capped Minshan mountains and a dense forest where endangered giant pandas and Sichuan golden snub-nosed monkeys live. The Huanglong travertine terraces are described by UNESCO as "unique in all of Asia," rating "among the three most outstanding examples in the world." An ancient Buddhist temple located right next to the pools adds to their charm. 3 of 8 Semuc Champey (Guatemala) Kelly Cheng Travel Photography / Getty Images Tucked away in the lush and mountainous jungle of Alta Verapaz, Guatemala, is a series of six turquoise travertine terraces that stretch over the 122-mile Cahabón River on a 1,000-foot limestone bridge. The words "Semuc Champey" mean "where the river hides under the earth." Somewhat of a giant natural waterpark—and a popular one—Semuc Champey is surrounded by caves and a waterfall visitors can explore by swimming. The idyllic hangout is, however, only accessible by four-wheel drive. Visitors can get a panoramic view of the pools at the El Mirador viewpoint, too, which is at the end of a 45-minute hike. 4 of 8 Mammoth Hot Springs (Wyoming) Vormann / Getty Images The most spectacular and famous example of travertine terraces in the U.S. has to be Mammoth Hot Springs in Yellowstone National Park. A dense complex of travertine "terracettes" blanket a hill over a massive magma chamber. They vary in color from bright white to copper and are covered in stalactites and siliceous sinter formations, giving them the look of an inverted cave. With Yellowstone itself being a 3,500-square-mile hotbed of geothermal activity, it's no surprise the recreation area contains these peculiar limestone formations. They can be explored via a 1.75-mile boardwalk. 5 of 8 Badab-e Surt (Iran) Jean-Philippe Tournut / Getty Images Formed during the Pleistocene and Pliocene epochs as a result of two hot pools bubbling over a cliffside 6,000 feet above sea level, the geological wonder that is Iran's Badab-e Surt is believed to be the second largest example of stepped travertine terraces in the world, behind Pamukkale. Stacked against a background of rugged mountains, these formations glow fiery red-orange and the water they hold at times looks crystal-clear and sky-reflecting, unlike the cloudy blue and turquoise colors displayed by others. 6 of 8 Bagni San Filippo (Italy) Chiara Salvadori / Getty Images Amid the famous olive groves and vineyards of Tuscany, there's Bagni San Filippo, a region known for its white calciferous concretions. These travertine terraces are located on the eastern slope of the extinct Monte Amiata volcano, in the hills of the Val d'Orcia, surrounded by the Monte Amiata woods. Its stunning placement is an idyllic setting for a (free) soak in the grotto. The pools are most blue where the hot spring water meets the cold water of the river. 7 of 8 Egerszalok (Hungary) benedek / Getty Images Part open-air spa, part village, Egerszalok is conveniently situated in the historic wine region of Eger, Hungary. It's not only beautiful—imagine orange- and blue-toned white limestone steps spilling gracefully over a grassy hillside—it's also an integral part of Hungarian heritage and culture, as the locals often soak in its pools, treasured for their rumored healing properties. The water at the top of the "salt hill" has bubbled up from more than 1,000 feet underground and is believed to be 27,000 years old. 8 of 8 Plitvice National Park (Croatia) Michael Cook - Altai World Photography / Getty Images In Croatia's Plitvice National Park, 16 cerulean lakes cascade over travertine platforms, creating a breathtaking chain of falling water in the lush and biologically diverse Dinaric Alps. The limestone formed by a buildup of moss, algae, and bacterias has also created ever-growing natural dams that decelerate the water and keep it flowing at a peaceful pace over the steep, vegetation-covered cliffs. | <urn:uuid:a41fd255-a5d8-4d80-818a-62a3379dc0a2> | CC-MAIN-2022-33 | https://www.treehugger.com/magnificent-views-of-travertine-terraces-around-the-world-4868456 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.917464 | 1,447 | 3.265625 | 3 |
Submission request to W3C
We, W3C Member
hereby submit to the Consortium the following specification, comprising the following document attached hereto:
which collectively are referred to as "the Submission". We request the Submission be known as the Pointer Events Submission.
Today, most web content is used with and/or designed for mouse input. Those that handle input in a custom manner typically code to DOM Level 3 Mouse Events. Newer computing devices today, however, incorporate other forms of input, like touchscreens or pen input. Event types have been proposed for handling each of these forms of input individually. However, that approach requires a step function in opportunity cost to authors when adding support for a new input type. This often creates a compatibility problem when content is written with only one device type in mind. Additionally, for compatibility with existing mouse-based content, most user agents fire Mouse Events for all input types. This makes it ambiguous whether a Mouse Event represents an actual mouse device or is being produced from another input type for compatibility, which makes it hard to code to both device types simultaneously.
To reduce the cost of coding to multiple input types and also to help with the above described ambiguity with Mouse Events, the Pointer Events specifications defines a more abstract form of input, called a pointer. A pointer can be any point of contact on the screen made by a mouse cursor, pen, touch (including multi-touch), or other pointing input device. This model makes it easy to write sites and applications that work well no matter what hardware the user has.
Microsoft Corporation hereby grants to the W3C a perpetual, nonexclusive, royalty-free, world-wide right and license under any Microsoft Corporation copyrights on this contribution, to copy, publish and distribute the contribution under the W3C document licenses.
Additionally, should the Submission be used as a contribution towards a W3C Activity, Microsoft Corporation grants a right and license of the same scope to any derivative works prepared by the W3C and based on, or incorporating all or part of, the contribution. Microsoft Corporation further agrees that any derivative works of this contribution prepared by the W3C shall be solely owned by the W3C.
Should the Submission not be used as a contribution towards a W3C Activity, change control of the Submission shall remain with the Submitters/Authors.
The organization I represent on the W3C Advisory Committee agrees to offer licenses according to the W3C Royalty-Free licensing requirements described in section 5 of the 5 February 2004 W3C Patent Policy for any portion of the Submission that is subsequently incorporated in a W3C Recommendation.
We suggest that the Consortium start a Working Group whose mission is to produce a W3C Recommendation for Pointer Events by refining the Submission, addressing implementation experience and interoperability feedback from the Submission.
To help with this work, we expect to be able to provide assistance as needed to the Consortium.
Inquiries from the public or press about this Submission should be directed to: Robin Ginn (firstname.lastname@example.org)
this 7th day of September, 2012,
Microsoft Corporation, Michael Champion | <urn:uuid:1a2405a0-9a5c-40ea-9e8f-05586d75aee1> | CC-MAIN-2022-33 | https://www.w3.org/Submission/2012/03/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.917709 | 651 | 1.617188 | 2 |
Salman Khan, the ‘Dabangg’ star of Bollywood, has entertained us for more than 25 years and has played various characters with ease. Most of his films are blockbusters and have even broken many records. He has an abundant number of fans that his films considered as hits even before its release date.
Apart from entertainment, the star has given us a lesson or two on being a good human. Salman Khan movies have contributed to bringing some positive changes in the society and even taught us some valuable lessons through movies. These lessons can be grabbed by the audiences via the powerful Salman Khan dialogues as well.
Coupled with Bhaijaan's exceptional dialogue delivery and acting skills, the words in the dialogues touch the heart. While some of them have a romantic feel, others have an inspirational spirit. Here are the best and famous Salman Khan dialogues that provide us with good life lessons.
1. Kyun ki bhagwan ek hi waqt har jagah nahi ho sakte na, is liye unhone maa ko banaya hai. (Garv)
This dialogue depicts the importance of a mother in one’s life. God can’t be everywhere at the same time that’s why he made a mother. A mother who made various sacrifices for us, who knows what we want beforehand.
2. Aam aadmi sota hua sher hai, ungli mat kar, jaag gaya toh cheer phad denga. (Jai Ho)
This Salman Khan dialogue depicts the power that rests within the common man. It shows how strong a common man is, he is like a sleeping lion when he wakes up he destroys everything.
3. Achche waqt ki ek kharabi hai, achcha waqt khatam ho jaata hai . . . lekin bure waqt ki ek achchai hai, ke woh bhi khatam ho jaata hai. (Main Aur Mrs Khanna)
This dialogue represents that we face many challenges in life. It has many ups and downs. Some days are good and some days are bad, but the common thing is that this has come to end whether it is a good day or a bad day.
4. After every sunset, there's a sunrise. Ek naya din, ek nayi umeed, ek nayi shuruvat. (Baabul)
This dialogue depicts that after every sunset there is a sunrise, that same applied in life there is a new day with new hope and opportunities.
5. Do Hindustani picturon ki poster deewar pe tangane se koi Hindustani nahi banta . Hindustani woh hota hai joh apna ghar jalakar doosro ko dabishta hai. (Lucky: No Time For Love)
This dialogue shows the integrity and unity of the Indian people. Just by hanging a poster of Indian movies, you don’t become an Indian. Someone who helps and protect others is true Indians.
6. Joh aurat doosri aurat ki izzat na kare, hamari nazar mein woh aurat hi nahi. (Dabangg 3)
Women are Women’s worst enemies. This dialogue gives us a good life lesson that a woman doesn’t respect other women just because of jealousy and insecurities.
7. Haste huye chehre ka gham padhna kitna mushkil hota hai. (No Entry)
Here’s the another famous Salman Khan dialogue that shows the emotion of people who tried to hide their miseries behind their beautiful smile.
8. Hum Bajrangbali ke bhakt hain, mar jaenge par jhooth nahi bolenge. (Bajrangi Bhaijaan)
Salman Khan dialogues also have a cute element attached to them. This dialogue represents the belief and faith that a person has for God, always chooses the path of honesty.
9. Koi tumhe tab tak nahi hara sakta, jab tak tum khud na haar jao. (Sultan)
This dialogue helps us to gain confidence and courage. No one can defeat you until you lose faith in yourself. Be positive and confident to achieve your dreams.
10. Har family mein problem hain, par vo khushnaseeb hain jinki family hai. (Prem Ratan Dhan Paayo)
The word ‘Family’ brings out various emotions. This dialogue indicates that one should be lucky because you have a family who supports you in difficult times.
11. Is Vardi ki shaan pe jaan dena seekho, imaan bechna nahi. (Auzaar)
This Salman Khan dialogue shows the truth and honesty of a police officer. The police officer gives his life to safeguard others not to sell his dignity.
12. Agar tere paas nafrat ki taqat hai, toh mere paas ab mohabbat ki shakti hai. (Suryavanshi)
Love conquers all. This dialogue shows the importance of love in life. There is no difficulty or disease in the world that love will not conquer or heal.
13. Kamaan se nikla teer, aur zabaan se nikli baat kabhi wapas nahi aati. (Veer)
This dialogue gives us a life lesson of ‘think before you speak’. Just like an arrow leaves the bow never comes back, words cannot be taken back once said.
14. Main maut ko takiya, aur kafan ko chaadar banakar audhta hoon. (Garv)
This dialogue shows the courage and sacrifice made by our soldiers. The one who sacrifices their life for the nation, to protect citizens of the country.
15. There is always a first time, always a next time. (Dabangg)
Salman Khan dialogue like this motivates various peoples. There is always a first time and next time. There is always a first time to start and to do something
16. Aap thank you mat kahiye. Instead teen logon ki madad ki jiye aap, aur un teeno se kehna ki woh teen aur ki madad karen, duniya badal jayegi. (Jai Ho)
Another famous Salman Khan dialogue which reflects a good example of humanity and to bring positive changes in the society.
17. Izzat se baat, izzatdar logon se ki jaati hai . . . bhadwon se nahin. (Garv)
Salman Khan dialogues teach us important lessons. This dialogue directly indicates ‘Give Respect, Take Respect Otherwise Don’t Expect For Respect’.
18. Suar hamesha group mein shikaar karte hai . . . aur sher akele. (Wanted)
This dialogue has a bold angle. This one is for all the dabang people out there. It’s your life, your race, you are all alone in this race.
19. Rishtey ko mazboot hona chahiye . . . majboor nahi. (Kick)
This dialogue tells us about the various relationships of human beings. It depicts that there should be love in every relation, it should be strong and powerful, not weak or hopeless.
20. Utna hi maro . . . jitna ki khud bardasht kar sako. (Dabangg-2)
Another famous Salman Khan dialogue from Dabangg-2 depicts the power of Karma. It indirectly depicts that be careful how you treat people. What you do to others will come back on you.
21. One man can make a difference! (Jai Ho)
This will help to bring positive changes in society. It depicts the power of the one, your opinions or point of view can bring a lot of changes.
22. Aksar log mujhse poochte hai ki mera surname kya hai, jaati kya hai, dharam kya hai . . . aur main unse muskurake kehta hoon . . . ki is desh ke naam pe mere bauji ne mera naam Bharat rakha . . . ab itne badhe naam ke aage jaati, dharam, surname lagake na toh apna aur na hi is desh ka maan kam kar sakta hoon. (Bhaarat)
This powerful dialogue of Salman Khan from the movie Bhaarat shows the pride of the country. It shows the respect of the character towards his country.
23. Yakeen ek tubelight ki tarah hota hai, der se jalta hai, lekin jab jalta hai, toh full light kar deta hai. (Tubelight)
This beautifully written dialogue is from Salman Khan’s Bollywood film Tubelight. Here he tells us that faith is like tube light, it takes time to gain faith.
24. Jiske dil mein Ram base ho, uske liye koi bhi cheez asambhav nahi hai. (Bajrangi Bhaijaan)
Another motivational dialogue from the film Bajrangi Bhaijaan. This is the best dialogue to boost confidence. It reminds us that nothing is impossible, it's your dedication and belief that will bring success.
25. Life mein doosron ke liye itna karna, ki kabhi kam na pade. (Har Dil Joh Pyaar Krenga)
Isn’t it feels good when you do something good for other people? Life is short don’t waste it, make it resourceful. Do good and be good to others.
26. Burre waqt ki ek baat achi hoti hai, ki woh bhi guzar jaata hai. (God Tussi Great Ho)
Some days are good some are bad. Sometimes you feel low and hopeless. Don’t be afraid of it, as it has one quality that these days will also pass away. Isn’t it one of the best Salman Khan dialogues?
27. Is duniya ki shuruvat insaaniyat se hui hai . . . aur aaj is duniya ko sirf ek hi mazhab ki zaroorat hai . . . aur woh hai insaaniyat. (Tiger Zinda Hain)
There is nothing more important than humanity. Today’s world only needs one religion and that is humanity.
28. Ghar bada ho ya chota . . . ghar mein rehne waalo ka dil bada hona chahiye. (Sirf Tum)
This emotional dialogue of Salman Khan from the film Sirf Tum depicts that it doesn’t matter whether the house is big or small, what matters is that the people who live in it must have big hearts.
29. Agar yeh hi hai aapki duniya toh nahi chahiye mujhe aapki duniya, nahi chahiye mujhe woh duniya jis mein ek ladki ke saare haq cheene jaye - beti hone ka, behen hone ka, biwi hone ka - ek zinda insaan ko ek bejaan cheez ki tarah bazar mein rakha jaye . . . uska mol lagaya jaye, usse khareeda jaye, usse becha jaye . . . aur phir kaha jaye ki yahi duniya ka dastoor hai . . . nahi chahiye mujhe aapki duniya. (Baaghi)
This dialogue perfectly reflects the life of women. It depicts how women are treated in our society. How the rights are being snatched from the girls by the people in the name of tradition or culture.
30. Jinke paas pyar ki daulat ho . . . unhe kabhi gareeb nahi samajhna chahiye. (Har Dil Joh Pyaar Krenga)
Love is the greatest wealth in life because it beats our feelings for materialistic things. Your real wealth is not gold or silver, but it is the wealth of love, empathy and kindness are treasured within us.
31. Sapne dekhna achchi baat hai, par kahi baar unke peeche daudte daudte na apne peeche choot jaate hai. (Sultan)
This dialogue reflects on the importance of family and their contribution to turning your dreams into reality. You realise this only after you leave everything behind.
These Salman Khan dialogues are motivating and inspiring. Isn’t Salman Khan is the best now on both the box office and on the encouraging front? We hope these dialogues will be very helpful in bringing out positive changes in society.
Needless to say, these are some of the inspiring dialogues that will be remembered by audiences for a long time.
- 38 Shahrukh Khan Dialogues That Leave You In Positive Feels
- 26 Sanjay Dutt Dialogues Which Will Stay In our Heart For Long
- 25 Iconic Sholay Dialogues That Are Timeless And Refreshing
- 30 Gangs Of Wasseypur Dialogues That Will Remain Iconic
- 27 Irrfan Khan Dialogues That Immortalize His Acting Skills Forever
Explore: Feeding Trends | Events | <urn:uuid:545ef59e-98ea-4f76-95b0-fd72caf45224> | CC-MAIN-2022-33 | https://feedingtrends.com/salman-khan-dialogues-bollywood-movies-motivational-inspirational | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.830521 | 2,970 | 1.5625 | 2 |
MAD Architects, led by Ma Yansong, has released visuals of the Hainan Science and Technology Museum, due for completion and launch in 2024 in Haikou, Hainan.
The Hainan Science and Technology Museum is MAD’s second major public project in Hainan following the Cloudscape of Haikou, which debuted in April this year.
“MAD’s design for the museum draws from the site’s dual urban and natural context, one where a ‘primeval rainforest and technology of the future meet’,” said the studio.
“Set against the backdrop of a rich tropical rainforest, the museum’s main pavilion is shaped like a cloud in dialogue with nature,” MAD added.
Hainan museum set to open in 2024
“From a distance, the futuristic building appears to emerge from the city, while visitors entering in the museum area witness it floating above the jungle.”
The museum is spread across a total area of 46,528 square meters. It will break ground in late August 2021 and is scheduled for completion and opening in 2024.
The attraction will feature 27,782 square meters of above-ground facilities. These include a planetarium, observatory, theatre, flying theatre and permanent exhibition space.
The exhibition experience starts on the fifth floor, where an elevator opens to a 360-degree viewing platform. Also accessible on the fifth floor are technology and space galleries.
MAD’s next public project in Hainan
On the fourth floor, visitors will find ocean and life science galleries. The third floor houses maths and science galleries, and the second floor is home to a multimedia interactive experience area and children’s playground.
As for outside spaces, the museum includes a sunken plaza and reflecting pool surrounded by tropical plants. These are intended as areas for relaxation.
“The diversity of the surrounding tropical plants makes this an ideal setting for learning about nature, offering visitors more than simply an exhibition-viewing experience,” MAD said.
The Shanghai Astronomy Museum, the largest planetarium in the world, recently opened to the public in China after nearly five years of construction. | <urn:uuid:bfdc0fd1-1c73-491d-8c8f-0fdcd2d1c1bb> | CC-MAIN-2022-33 | https://blooloop.com/museum/news/hainan-science-technology-museum-design/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.920385 | 464 | 2.09375 | 2 |
Safeguard Antivirus Threatened by Malware Attacks
According to an information security company, iViz, antivirus software could probably serve as a Trojan. Security experts found that after phishing, vishing and pharming, the antivirus software used to protect PCs from the malware is itself spreading the malware at a rapid pace. Usually, the users remain ignorant of the fact that their safeguard software could also be compromised.
Further, iViz identified various flaws in the normally-used antivirus software that facilitates its hacking. The company also st...
» SPAMfighter News - 11/29/2008
We are happy to see you are reading our IT Security News.
We do believe, that the foundation for a good work environment starts with fast, secure and high performing computers. If you agree, then you should take a look at our Business Solutions to Spam Filter & Antivirus for even the latest version of Exchange Servers - your colleagues will appreciate it! | <urn:uuid:34b835f8-eb64-42ad-9b92-40c43168a3c0> | CC-MAIN-2022-33 | http://www.spamfighter.com/News-11370-Safeguard-Antivirus-Threatened-by-Malware-Attacks.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.917431 | 205 | 2.03125 | 2 |
COHANA Kohan Hino Pincence Banshou Woven
Pincushion is a tool to stab the wait.
The characteristic pedestal of Kono is made of the fragrant cypress of the Kii Mountains.
Fabric features "Banshu", natural texture, rich colors, and wonderful touch, produced in the North Harima area of Hyogo Prefecture.
The pincushion is easy to stab the needle, and the needle comes with a cotton with a rusty rust.
■ Hinoki pincushion Banshu
Hakitori X Saito store
Production area: Hinoki Wakayama Prefecture (Kiii area) / Hyogo Prefecture Hyogo Prefecture
In 1914, Mr. Nakai, which was founded as a button (Botan) manufacturing industry.
Delicate parts are also beautifully finished technology and long-standing know-how, are used in Hinoki.
Working with one manually manually, it takes a lot of concentration.
Saito shop that handles Banshu weaving, famous as a local industry in Hyogo.
Banshou weaving dyeing from yarn is attractive for rich colors and goodness.
Width: about 34mm / height: about 30mm
※ Because of the product, there are some differences depending on the product.
Fabric: 100% cotton
Middle cotton: polyester
made in Japan
Color: It's a good thing Sei Sei Mizuhashigashi Tsukasai Broad
|area||Shipping method||postage||Elder delivery|
|North America, Central America, Oceania||Economy||Currently not available|
|South America, Africa||Economy||¥1,280-||7-21|
※ Currently, due to the influence of COVID-19, some countries can not use economy mode.
※ The shipping cost in USD is just for your reference. This will be varied depending on the exchange rate. | <urn:uuid:7c61b6d4-2f06-41fd-a6e6-7f9c7a233ac8> | CC-MAIN-2022-33 | https://gutegouter-japan.com/en/collections/cohana/products/others-kg-pcs-45 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.847492 | 534 | 1.632813 | 2 |
ANTAGONISTIC CTLA-4 APTAMERS AND APPLICATIONS THEREOF IN ENHANCING IMMUNE ACTIVITY
Aptamers that bind to and inhibit CTLA-4 and uses thereof in enhancing immune activities, and treating cancer and HIV infection are provided.
Latest Academia Sinica Patents:
- METHOD FOR AMPLIFYING AND DETECTING RIBONUCLEIC ACID (RNA) FRAGMENTS
- NANOCOMPOSITE AND USES THEREOF
- A VACCINE COMPRISING A NANOPARTICLE ENCAPSULATING EPITOPES AND ADJUVANT FOR NEUTRALIZING VIRUS INFECTION
- Reloadable hydrogel system for treating brain conditions
- METHODS OF TREATING NEURODEGENERATIVE DISEASES
The present application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 62/031,406, filed Jul. 31, 2014, the entire content of which is incorporated by reference herein.BACKGROUND OF INVENTION
Cancer is the most important disease that causes human death and tremendous financial cost. According to a WHO report in 2004, over 7.4 million lives worldwide were lost to this illness and the victims are still increasing yearly (Abou-Alfa, G. K., et al. (2006), J Clin Oncol 24, 4293-4300. The primary treatments for cancer are surgery, chemotherapy, and radiotherapy. However, these traditional therapies cause serious side effects and kill normal cells as well.
For this reason, targeted therapies were developed and proved to be effective in treating several types of cancer effectively (Van Cutsem, E., et al. (2009), N Engl J Med 360, 1408-1417, Klein, S. and Levitzki A. (2007), Adv Cancer Res 97, 295-319). However, there are few tumor specific markers and only few targeted therapies were successfully applied in the clinic (Jain, R. K., et al. (2009), Nat Rev Clin Oncol 6, 327-3384, Gazdar, A. F. (2009), Oncogene 28 Suppl 1, S24-31). Moreover, many studies have shown that the genomic instability facilitates resistance to targeted therapies (Dassie, J. P., et al. (2009), Nat Biotechnol 27, 839-849, Sica, A., Schioppa, T., Mantovani, A., and Allavena, P. (2006), Eur J Cancer 42, 717-727). More recently, reports have indicated that the surrounding tumor microenvironment is strongly associated with tumor progression, particularly immune evasion (Pollard, J. W. (2004), Nat Rev Cancer 4, 71-78, de Visser, K. E., and Coussens, L. M. (2006), Contrib Microbiol 13, 118-137, Stewart, T. J., and Abrams, S. I. (2008), Oncogene 27, 5894-5903, Joyce, J. A., and Pollard, J. W. (2009), Nat Rev Cancer 9, 239-252).
Several cell types have been suggested to play key roles in the tumor microenvironment and are involved in tumor progression, including tumor-associated macrophages (TAM), regulatory T cells (Treg), natural killer (NK) cells and CD8+ T-cells (Solinas, G., Germano, G., Mantovani, A., and Allavena, P. (2009), J Leukoc Biol 86, 1065-1073, Zou, W. (2006), Nat Rev Immunol 6, 295-307, Whiteside, T. L. (2006), Cancer Treat Res 130, 103-124, Coffelt, S. B., Hughes, R., and Lewis, C. E. (2009), Biochim Biophys Acta 1796, 11-18). NK and CD8+ T-cells are two major effective cell types to eradicate abnormal tumor cells by cell-mediated cytotoxicity. Treg cells represent a small fraction (5-6%) of the overall CD4+ T cells (Wang, R. F., Peng, G., and Wang, H. Y. (2006), Semin Immunol 18, 136-142) and is another major regulatory cell type in tumor microenvironment. Under normal circumstances, Treg cells protect the host from self-reactive T-cells and, therefore, prevent the formation of autoimmune disease (Corthay, A. (2009), Scand J Immunol 70, 326-336). However, in tumor microenvironment, Treg can secrete cytokines, such as IL-10 and TGF-β, to inhibit the function of tumor-targeted innate (NK cells) and adaptive (CD8+ T-cells) immune response (Bingle, L., Brown, N. J., and Lewis, C. E. (2002), J Pathol 196, 254-265) and protect tumor cells from immune clearance (Andrew, G. et al. (2006), J Immunol 177, 896-904).
One protein receptor that can down-regulate the immune system in the tumor microenvironment is Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4), also known as cluster of differentiation 152 (CD152). CTLA-4 is found on the surface of T cells, which lead the cellular immune attack on antigens. While the T cell attack can be turned on by stimulating the CD28 receptor on T cells, it can be turned off by stimulating the CTLA4 receptor.
While antibodies are commonly used to target disease proteins, they have their limitations, including high production costs, low stability, and are restricted in many cases as to the epitopes they can target. Aptamers have several advantages that make it suitable for therapeutic application such as lower molecular weight that allows easier penetration through tissues, low cost in chemical synthesis, established modification methods and high stability. It is therefore of great interest to develop suitable aptamers having high affinity to a target protein.SUMMARY OF INVENTION
The present disclosure is based at least in part, on the unexpected discoveries that a nucleotide aptamer targeting CTLA-4 (CA21) successfully suppressed the growth of lung tumor cells by over 70% in a syngeneic mouse model.
Accordingly, one aspect of the present disclosure features a nucleic acid aptamer binding to CTLA-4. The aptamer comprises a nucleic acid sequence that is at least 85% (e.g., 90%, or 95%) identical to (i) GATGGTGAAAATGGGCCTAGGGTGGACGGT (SEQ ID NO: 1), (ii) GATGACTGGATGCAAAAATGCTGTGGGGTA (SEQ ID NO: 6), (iii) GTCCACACTCAGAAAACAGAATAGGGGGTA (SEQ ID NO: 7), or (iv) CGATCGAAAATGTCCAGGGAGTTGTCTGTA (SEQ ID NO: 8). Such an anti-CTLA-4 aptamer may bind to CTLA-4 with a dissociation constant (Kd) lower than 20 nM. In one example, the anti-CTLA4 aptamer may comprise the nucleic acid sequence of GATGGTGAAAATGGGCCTAGGGTGGACGGT (SEQ ID NO: 1), GATGACTGGATGCAAAAATGCTGTGGGGTA (SEQ ID NO: 6), GTCCACACTCAGAAAACAGAATAGGGGGTA (SEQ ID NO: 7), or CGATCGAAAATGTCCAGGGAGTTGTCTGTA (SEQ ID NO: 8). Such an anti-CTLA4 aptamer may be the nucleic acid of TCCCTACGGCGCTAACGATGGTGAAAA TGGGCCTAGGGTGGACGG TGCCACCGTGCTACAAC (SEQ ID NO: 2), TCCCTACGGCGCTAACGATGACTGGATGCAAAAATGCTGTGGGGTAGCCACCGTGC TACAAC (SEQ ID NO: 3), TCCCTACGGCGCTAACGTCCACACTCAGAAAACAGAATAGGGGGTAGCCACCGTGC TACAAC (SEQ ID NO: 4), or TCCCTACGGCGCTAACCGATCGAAAATGTCCAGGGAGTTGTCTGTAGCCACCGTGCT ACAAC (SEQ ID NO: 5).
Any of the anti-CTLA-4 aptamers described herein may be conjugated with polyethylene glycol (PEG), which may have a molecular weight ranging from 30 kDa to 50 kDa, e.g., 40 kDa. In some examples, the PEG is conjugated to the 3′ end of the aptamer.
In another aspect, the present disclosure provides a pharmaceutical composition comprising any of the anti-CTLA-4 aptamers as described herein and a pharmaceutically acceptable carrier.
In yet another aspect, the present disclosure provides a method for treating cancer (e.g., lung cancer, melanoma, colorectal cancer, or renal-cell cancer), the method comprising administering (e.g., intravenously) to a subject in need thereof an effective amount of any of the pharmaceutical compositions as described herein, which comprises a anti-CTLA-4 aptamer as also described herein.
In some examples, the subject to be treated by the method described herein is a human patient, e.g., a human patient having, suspected of having, or at risk for cancer.
Further, the present disclosure features a method of enhancing immune activity in a subject, the method comprising administering (e.g., intravenously) to a subject in need thereof an effective amount (e.g., an amount sufficient to increase T cell activation) of any of the pharmaceutical compositions described herein, which comprises a anti-CTLA-4 aptamer as also described herein. In some examples, the subject can be a human patient having, suspected of having, or at risk for cancer (e.g., lung cancer, melanoma, colorectal cancer, or renal-cell cancer). In other examples, the subject is a human patient having or suspected of having HIV infection.
Also within the scope of the present disclosure are (a) pharmaceutical compositions for use in treating cancer (e.g., lung cancer, melanoma, colorectal cancer, or renal-cell cancer) or HIV infection, wherein the pharmaceutical composition comprises an anti-CTLA-4 nucleic acid aptamer as described herein, e.g., a nucleic acid comprising a nucleic acid sequence that is at least 85% (e.g., 90%, or 95%) identical to (i) GATGGTGAAAATGGGCCTAGGGTGGACG GT (SEQ ID NO: 1), (ii) GATGACTGGATGCAAAAATGCTGTGGGGTA (SEQ ID NO: 6), (iii) GTCCACACTCAGAAAACAGAATAGGGGGTA (SEQ ID NO: 7), or (iv) CGATCGAA AATGTCCAGGGAGTTGTCTGTA (SEQ ID NO: 8); and a pharmaceutically acceptable carrier; and (b) use of the CTLA-4 aptamer for manufacturing a medicament for treating cancer (e.g., lung cancer, melanoma, colorectal cancer, or renal-cell cancer) or HIV infection.
The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims.
The present disclosure is based on the development of nucleic acid aptamers (e.g., CA21) that specifically bind and inhibit CTLA-4 and the unexpected results that such nucleic acid aptamers successfully suppressed the growth of cancer cells by over 70% in a syngeneic mouse model. The anti-CTLA4 aptamer treatment did not affect mouse body weight, suggesting that the aptamer is not toxic. Thus, anti-CTLA-4 aptamers such as CA21 would be effective in enhancing immune activity and/or reducing cancer growth.
Accordingly, described herein are anti-CTLA-4 aptamers such as CA21, pharmaceutical compositions comprising such, and methods for enhancing immune activity and/or treating diseases such as cancer and HIV infection with the anti-CTLA-4 aptamers disclosed herein.Anti-CTLA-4 Nucleic Acid Aptamers
Described herein are nucleic acid aptamers that bind to CTLA-4 and inhibits it activity (anti-CTLA-4 aptamers), thereby enhancing immune activity such as T cell activity. Accordingly, the anti-CTLA-4 aptamers can be used to enhance immune responses, for example, T cell responses, and thus benefit immunotherapy of cancer.
A nucleic acid aptamer as used herein refers to a nucleic acid molecule (DNA or RNA) having a binding activity for a particular target molecule (e.g., CTLA-4), and thus inhibit its activity. The anti-CTLA-4 aptamer of the present disclosure, in linear or circular form, may be an RNA, a DNA (e.g., a single-stranded DNA), a modified nucleic acid, or a mixture thereof. The anti-CTLA-4 aptamers may be non-naturally molecules (e.g., containing a nucleotide sequence not existing in native genes or containing modified nucleotides not existing in nature). Alternatively or in addition, the anti-CTLA-4 aptamers may not contain a nucleotide sequence that encodes a functional peptide.
CTLA-4, referring to cytotoxic T-lymphocyte-associated protein 4 (also known as CD152), is a receptor expressed on T cells that negatively regulates T cell activity. As an example, the amino acid sequence of a human CTLA-4 is provided under GenBank accession number AAH69566.
In some embodiments, the anti-CTLA-4 nucleic acid aptamer disclosed herein may comprise a nucleotide sequence at least 70% (e.g., 80%, 85%, 90%, 95%, or 98%) identical to 5′-GATGGTGAAAATGGGCCTAGGGTGGACGGT-3′ (SEQ ID NO: 1). In some examples, the anti-CTLA-4 nucleic acid aptamer disclosed herein may comprise a nucleotide sequence at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1. In some examples, the anti-CTLA-4 aptamer comprises the nucleotide sequence of 5′-GATGGTGAAAATGGGCCTAG GGTGGACGGT-3′ (SEQ ID NO: 1). In a particular example, the anti-CTLA-4 aptamer consists of the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:2.
In some embodiments, the anti-CTLA4 nucleic acid aptamer disclosed herein may comprise a nucleotide sequence at least 70% (e.g., 80%, 85%, 90%, 95%, or 98%) identical to the regions in boldface of the following sequences:
In some examples, the anti-CTLA-4 nucleic acid aptamer disclosed herein may comprise a nucleotide sequence at least 85% identical to the nucleic acid sequence of SEQ ID NO: 3, 4, or 5. In some examples, the anti-CTLA-4 aptamer comprises the nucleotide sequence of SEQ ID NO:3, 4, or 5, or the regions in boldface therein. In a particular example, the anti-CTLA-4 aptamer consists of the nucleotide sequence of SEQ ID NO:3, 4, or 5, or the boldfaced region therein.
The “percent identity” of two nucleic acids is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength-12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. Where gaps exist between two sequences, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.
In other embodiments, the anti-CTLA-4 aptamers described herein may contain up to 8 (e.g., up to 7, 6, 5, 4, 3, 2, or 1) nucleotide variations as compared to the nucleotide sequence of 5′-GATGGTGAAAATGGGCCTAGGGTGGACGGT-3′ (SEQ ID NO: 1). Positions where such variations can be introduced can be determined based on, e.g., the secondary structure of CA21, which comprises the reference nucleotide sequence (see
In some examples, the anti-CTLA-4 aptamers may contain a primer site at the 5′ end, the 3′ end, or both. In one example, the anti-CTLA-4 aptamer has the nucleotide sequence of
in which the underlined/italic flanking sequences refer to the 5′ and 3′ primer sites. See also the non-boldfaced regions in SEQ ID NO:3, 4, or 5.
Any of the anti-CTLA-4 aptamers disclosed herein may contain up to 200 nucleotides (nts), e.g., 150 nts, 100 nts, 80 nts, 70 nts, 60 nts. 50 nts, 40 nts, or 30 nts. In some examples, the anti-CTLA-4 aptamer may contain nucleotides ranging from 30-150 nts, 30-100 nts, 30-80 nts, 30-70 nts, 30-60 nts, 30-50 nts, or 30-40 nts.
In some embodiments, the anti-CTLA-4 aptamers described herein may bind to CTLA-4 (e.g., human CTLA-4) with a dissociation constant (Kd) lower than 20 nM (e.g., 15 nM, 10 nM, 5 nm, 1 nm, or less). The anti-CTLA-4 aptamer may specifically bind human CTLA-4. Alternatively, the aptamer may bind to CTLA-4 molecules from different species (e.g., human and mouse). When binding to a CTLA-4 molecule expressed on T cell surface, such an aptamer may inhibit the activity of CTLA-4 (thus increase T cell activity) by at least 20% (e.g., 40%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 100-fold, or 1,000-fold). The inhibitory activity of an anti-CTLA-4 aptamer on CTLA-4 (and thus the activation in enhancing T cell activity) may be determined by, e.g., those described in the Examples below.
In some embodiments, the anti-CTLA-4 aptamers described herein may contain non-naturally-occurring nucleobases, sugars, or covalent internucleoside linkages (backbones). Such a modified oligonucleotide confers desirable properties such as enhanced cellular uptake, improved affinity to the target nucleic acid, and increased in vivo stability.
In one example, the aptamer described herein has a modified backbone, including those that retain a phosphorus atom (see, e.g., U.S. Pat. Nos. 3,687,808; 4,469,863; 5,321,131; 5,399,676; and 5,625,050) and those that do not have a phosphorus atom (see, e.g., U.S. Pat. Nos. 5,034,506; 5,166,315; and 5,792,608). Examples of phosphorus-containing modified backbones include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having 3′-5′ linkages, or 2′-5′ linkages. Such backbones also include those having inverted polarity, i.e., 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Modified backbones that do not include a phosphorus atom are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. Such backbones include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. In another example, the aptamers described herein include one or more substituted sugar moieties. Such substituted sugar moieties can include one of the following groups at their 2′ position: OH; F; O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl; O-alkynyl, S-alkynyl, N-alkynyl, and O-alkyl-O-alkyl. In these groups, the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. They may also include at their 2′ position heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide. Preferred substituted sugar moieties include those having 2′-methoxyethoxy, 2′-dimethylaminooxyethoxy, and 2′-dimethylaminoethoxyethoxy. See Martin et al., Helv. Chim. Acta, 1995, 78, 486-504.
Alternatively or in addition, aptamers described herein may include one or more modified native nucleobases (i.e., adenine, guanine, thymine, cytosine and uracil). Modified nucleobases include those described in U.S. Pat. No. 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of aptamer molecules to their targeting sites. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyl-adenine, 5-propynyluracil and 5-propynylcytosine). See Sanghvi, et al., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
Any of the aptamers described herein can be prepared by conventional methods, e.g., chemical synthesis or in vitro transcription. Their intended bioactivity as described herein can be verified by, e.g., those described in the Examples below. Vectors for expressing any of the anti-CTLA-4 aptamers are also within the scope of the present disclosure.
Any of the aptamers described herein may be conjugated to one or more polyether moieties, such as polyethylene glycol (PEG) moieties, via covalent linkage, non-covalent linkage, or both. Accordingly, in some embodiments, aptamers described herein are pegylated. The disclosure is not meant to be limiting with respect to a PEG moiety of a specific molecular weight. In some embodiments, the polyethylene glycol moiety has a molecular weight ranging from 5 kDa to 100 kDa, 10 kDa to 80 kDa, 20 kDa to 70 kDa, 20 kDa to 60 kDa, 20 kDa to 50 kDa, or 30 kDa to 50 kDa. In some examples, the PEG moiety has a molecular weight of 40 kDa. The PEG moiety conjugated to the anti-CTLA-4 aptamer described herein can be linear or branched. It may be conjugated to the 5′ end of the nucleic acid aptamer, the 3′ end of the aptamer, or both. When needed, the PEG moiety can be conjugated to the 3′ end of the nucleic acid aptamer covalently.
Methods for conjugating PEG moieties to nucleic acids are known in the art and have been described previously, for example, in PCT Publication No. WO 2009/073820, the relevant teachings of which are incorporated by reference herein. It should be appreciated that the PEG conjugated nucleic acid aptamers and methods for conjugating PEG to the nucleic acid aptamers described herein, are exemplary and not meant to be limiting.
The present disclosure also provides dimers of any of the anti-CTLA-4 nucleic acid aptamers described herein. In some embodiments, an anti-CTLA-4 aptamer dimer comprises two anti-CTLA-4 aptamers linked by a suitable polymer moiety, which can be a PEG moiety as those described herein. Either one or both of the two aptamers in a dimer may comprise a nucleotide sequence of SEQ ID NOs: 1-2. Alternatively, one or both of the two aptamers in a dimer may comprise a nucleotide sequence of SEQ ID NO:3, 4, or 5, or the boldfaced region therein. The two anti-CTLA-4 aptamers may be identical or different. For example, one or both of the anti-CTLA-4 aptamers may comprise (SEQ ID NO: 1). In another example, the anti-CTLA-4 aptamer dimer as described herein may have one aptamer comprising (SEQ ID NO: 1) and another aptamer comprising (SEQ ID NO: 2).
In some embodiments, the polymer moiety of any of the anti-CTLA-4 aptamer dimers provided herein is PEG, which may have a molecular weight as described herein.
In some embodiments, the anti-CTLA-4 aptamer dimers provided herein comprise aptamers that are linked to the polymer moiety via a linker. In one example, the first aptamer is linked to the polymer moiety via a linker. In another example, the second aptamer is linked to the polymer moiety via a linker. In yet another example, the first aptamer and the second aptamer is linked to the polymer moiety via a linker. A “linker” as used herein, refers to a chemical moiety linking two molecules or moieties. In some examples, the linker comprises one or more nucleotides, which may be deoxyribonucleotides. In some examples the nucleic linker is from 1 to 50 nucleotides in length. Such linkers may be from 1 to 5, from 1 to 10, from 1 to 15, from 1 to 20, from 1 to 30, from 1 to 40, from 10 to 15, from 10 to 20, from 10 to 30, from 10 to 40, from 10 to 50, from 20 to 30, from 20 to 40, from 20 to 50, from 30 to 40, from 30 to 50, or from 40 to 50 nucleotides in length. In some examples, the linker is 11 nucleotides in length. The linker may comprise adenine (A), cytosine (C), thymine (T) and/or guanine (G). In some examples, the linker comprises a polyT fragment. A “polyT fragment” refers to a stretch of 2 or more consecutive thymine (T) nucleotide residues. For example, the polyT linker may comprise from 2 to 50 T residues. In some examples, the polyT linker is from 2 to 40, from 2 to 35, from 2 to 30, from 2 to 25, from 2 to 20, from 5 to 15, or from 10 to 15 nucleotides in length. In some embodiments, the poly T linker comprises 11 consecutive thymine (T) nucleotides.Pharmaceutical Compositions
Any of the anti-CTLA-4 aptamers or PEG conjugates as described herein can be mixed with a pharmaceutically acceptable carrier to form a pharmaceutical composition for use, e.g., in treating a target disease. “Acceptable” means that the carrier must be compatible with the active ingredient of the composition (and preferably, capable of stabilizing the active ingredient) and not deleterious to the subject to be treated. Pharmaceutically acceptable excipients (carriers) including buffers, which are well known in the art. See, e.g., Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. K. E. Hoover.
The pharmaceutical compositions to be used in the present methods can comprise pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions. See, e.g., Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. K. E. Hoover). Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations used, and may comprise buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrans; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).
In some examples, the pharmaceutical composition described herein comprises liposomes containing the CTLA-4 binding aptamers (or a vector carrying the nucleotide sequence of the aptamer), which can be prepared by methods, such as those described in Epstein, et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang, et al., Proc. Natl. Acad. Sci. USA 77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Pat. No. 5,013,556. Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.
The anti-CTLA-4 aptamers may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are known in the art, see, e.g., Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing (2000).
In other examples, the pharmaceutical composition described herein can be formulated in sustained-release format. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the anti-CTLA-4 aptamer, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and 7 ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), sucrose acetate isobutyrate, and poly-D-(−)-3-hydroxybutyric acid.
The pharmaceutical compositions to be used for in vivo administration must be sterile. This is readily accomplished by, for example, filtration through sterile filtration membranes. Therapeutic anti-CTLA-4 aptamer compositions may be placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
The pharmaceutical compositions described herein can be in unit dosage forms such as tablets, pills, capsules, powders, granules, solutions or suspensions, or suppositories, for oral, parenteral or rectal administration, or administration by inhalation or insufflation.
For preparing solid compositions such as tablets, the principal active ingredient can be mixed with a pharmaceutical carrier, e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gums, and other pharmaceutical diluents, e.g., water, to form a solid preformulation composition containing a homogeneous mixture of a compound of the present invention, or a non-toxic pharmaceutically acceptable salt thereof. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules. This solid preformulation composition is then subdivided into unit dosage forms of the type described above containing from 0.1 to about 500 mg of the active ingredient of the present invention. The tablets or pills of the novel composition can be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer that serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol and cellulose acetate.
Suitable surface-active agents include, in particular, non-ionic agents, such as polyoxyethylenesorbitans (e.g., Tween™ 20, 40, 60, 80 or 85) and other sorbitans (e.g., Span™ 20, 40, 60, 80 or 85). Compositions with a surface-active agent will conveniently comprise between 0.05 and 5% surface-active agent, and can be between 0.1 and 2.5%. It will be appreciated that other ingredients may be added, for example mannitol or other pharmaceutically acceptable vehicles, if necessary.
Suitable emulsions may be prepared using commercially available fat emulsions, such as Intralipid™, Liposyn™, Infonutrol™, Lipofundin™ and Lipiphysan™. The active ingredient may be either dissolved in a pre-mixed emulsion composition or alternatively it may be dissolved in an oil (e.g., soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil or almond oil) and an emulsion formed upon mixing with a phospholipid (e.g., egg phospholipids, soybean phospholipids or soybean lecithin) and water. It will be appreciated that other ingredients may be added, for example glycerol or glucose, to adjust the tonicity of the emulsion. Suitable emulsions will typically contain up to 20% oil, for example, between 5 and 20%. The fat emulsion can comprise fat droplets between 0.1 and 1.0 .im, particularly 0.1 and 0.5 .im, and have a pH in the range of 5.5 to 8.0.
The emulsion compositions can be those prepared by mixing anti-CTLA-4 aptamers with Intralipid™ or the components thereof (soybean oil, egg phospholipids, glycerol and water).
Pharmaceutical compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as set out above. In some embodiments, the compositions are administered by the oral or nasal respiratory route for local or systemic effect.
Compositions in preferably sterile pharmaceutically acceptable solvents may be nebulised by use of gases. Nebulised solutions may be breathed directly from the nebulising device or the nebulising device may be attached to a face mask, tent or intermittent positive pressure breathing machine. Solution, suspension or powder compositions may be administered, preferably orally or nasally, from devices which deliver the formulation in an appropriate manner.Methods of Treatment
Any of the anti-CTLA-4 aptamers (including PEG conjugates) described herein can be used to enhance immune activity, particularly T cell activity, thereby effective in treating cancer or infectious diseases such as viral (e.g., HIV) infection or bacterial infection.
To practice the method disclosed herein, an effective amount of the pharmaceutical composition described herein that contains at least one anti-CTLA-4 aptamer can be administered to a subject (e.g., a human) in need of the treatment via a suitable route, such as intravenous administration, e.g., as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, inhalation or topical routes. Commercially available nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers are useful for administration. Liquid formulations can be directly nebulized and lyophilized powder can be nebulized after reconstitution. Alternatively, the anti-CTLA-4 aptamer-containing composition as described herein can be aerosolized using a fluorocarbon formulation and a metered dose inhaler, or inhaled as a lyophilized and milled powder.
As used herein, “an effective amount” refers to the amount of each active agent required to confer therapeutic effect on the subject, either alone or in combination with one or more other active agents. In some embodiments, the therapeutic effect is reduced tumor burden, reduction of cancer cells, or increased immune activity. Determination of whether an amount of the CTLA-4 binding aptamers achieved the therapeutic effect would be evident to one of skill in the art. Effective amounts vary, as recognized by those skilled in the art, depending on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size, gender and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment.
Empirical considerations, such as the half-life, generally will contribute to the determination of the dosage. Frequency of administration may be determined and adjusted over the course of therapy, and is generally, but not necessarily, based on treatment and/or suppression and/or amelioration and/or delay of a target disease/disorder. Alternatively, sustained continuous release formulations of a CTLA-4 binding aptamer may be appropriate. Various formulations and devices for achieving sustained release are known in the art.
In one example, dosages for a CTLA-4 binding aptamer as described herein may be determined empirically in individuals who have been given one or more administration(s) of the CTLA-4 binding aptamer. Individuals are given incremental dosages of the antagonist. To assess efficacy of the antagonist, an indicator of the disease/disorder can be followed.
Generally, for administration of any of the anti-CTLA-4 aptamers described herein, an initial candidate dosage can be about 2 mg/kg. For the purpose of the present disclosure, a typical daily dosage might range from about any of 0.1 μg/kg to 3 μg/kg to 30 μg/kg to 300 μg/kg to 3 mg/kg, to 30 mg/kg to 100 mg/kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of symptoms occurs or until sufficient therapeutic levels are achieved to alleviate a target disease or disorder, or a symptom thereof. An exemplary dosing regimen comprises administering an initial dose of about 2 mg/kg, followed by a weekly maintenance dose of about 1 mg/kg of the CTLA-4 binding aptamer, or followed by a maintenance dose of about 1 mg/kg every other week. However, other dosage regimens may be useful, depending on the pattern of pharmacokinetic decay that the practitioner wishes to achieve. For example, dosing from one-four times a week is contemplated. In some embodiments, dosing ranging from about 3 μg/mg to about 2 mg/kg (such as about 3 μg/mg, about 10 μg/mg, about 30 μg/mg, about 100 μg/mg, about 300 μg/mg, about 1 mg/kg, and about 2 mg/kg) may be used. In some embodiments, dosing frequency is once every week, every 2 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks; or once every month, every 2 months, or every 3 months, or longer. The progress of this therapy is easily monitored by conventional techniques and assays. The dosing regimen (including the CTLA-4 binding aptamer used) can vary over time.
In some embodiments, for an adult patient of normal weight, doses ranging from about 0.3 to 5.00 mg/kg may be administered. The particular dosage regimen, i.e., dose, timing and repetition, will depend on the particular individual and that individual's medical history, as well as the properties of the individual agents (such as the half-life of the agent, and other considerations well known in the art).
For the purpose of the present disclosure, the appropriate dosage of a CTLA-4 binding aptamer as described herein will depend on the specific CTLA-4 binding aptamer, CTLA-4 binding aptamers, the type and severity of the disease/disorder, whether the CTLA-4 binding aptamer is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antagonist, and the discretion of the attending physician. A clinician may administer a CTLA-4 binding aptamer, until a dosage is reached that achieves the desired result. In some embodiments, the desired result is a decrease in tumor burden, a decrease in cancer cells, or increased immune activity. Methods of determining whether a dosage resulted in the desired result would be evident to one of skill in the art. Administration of one or more CTLA-4 binding aptamers can be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners. The administration of a CTLA-4 binding aptamer may be essentially continuous over a preselected period of time or may be in a series of spaced dose, e.g., either before, during, or after developing a target disease or disorder.
As used herein, the term “treating” refers to the application or administration of a composition including one or more active agents to a subject, who has a target disease or disorder, a symptom of the disease/disorder, or a predisposition toward the disease/disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward the disease or disorder.
Alleviating a target disease/disorder includes delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, “delaying” the development of a target disease or disorder means to defer, hinder, slow, retard, stabilize, and/or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and/or individuals being treated. A method that “delays” or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and/or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.
“Development” or “progression” of a disease means initial manifestations and/or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. “Development” includes occurrence, recurrence, and onset. As used herein “onset” or “occurrence” of a target disease or disorder includes initial onset and/or recurrence.
In some embodiments, the CTLA-4 binding aptamers described herein are administered to a subject in need of the treatment at an amount sufficient to reduce tumor burden or cancer cell growth, or HIV proliferation by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater) in vivo. In other embodiments, the CTLA-4 binding aptamers are administered in an amount effective in reducing the activity level of CTLA-4 by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater). In other embodiments, the CTLA-4 binding aptamers are administered in an amount effective in increasing immune activity by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater).
Conventional methods, known to those of ordinary skill in the art of medicine, can be used to administer the pharmaceutical composition to the subject, depending upon the type of disease to be treated or the site of the disease. This composition can also be administered via other conventional routes, e.g., administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. The term “parenteral” as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. In addition, it can be administered to the subject via injectable depot routes of administration such as using 1-, 3-, or 6-month depot injectable or biodegradable materials and methods. In some examples, the pharmaceutical composition is administered intraocularlly or intravitreally.
Injectable compositions may contain various carriers such as vegetable oils, dimethylactamide, dimethyformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, and polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like). For intravenous injection, water soluble CTLA-4 binding aptamers can be administered by the drip method, whereby a pharmaceutical formulation containing the CTLA-4 binding aptamer and a physiologically acceptable excipients is infused. Physiologically acceptable excipients may include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipients. Intramuscular preparations, e.g., a sterile formulation of a suitable soluble salt form of the CTLA-4 binding aptamer, can be dissolved and administered in a pharmaceutical excipient such as Water-for-Injection, 0.9% saline, or 5% glucose solution.
In one embodiment, a CTLA-4 binding aptamer is administered via site-specific or targeted local delivery techniques. Examples of site-specific or targeted local delivery techniques include various implantable depot sources of the CTLA-4 binding aptamer or local delivery catheters, such as infusion catheters, an indwelling catheter, or a needle catheter, synthetic grafts, adventitial wraps, shunts and stents or other implantable devices, site specific carriers, direct injection, or direct application. See, e.g., PCT Publication No. WO 00/53211 and U.S. Pat. No. 5,981,568.
Targeted delivery of therapeutic compositions containing an antisense polynucleotide, expression vector, or subgenomic polynucleotides can also be used. Receptor-mediated DNA delivery techniques are described in, for example, Findeis et al., Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol. Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad. Sci. USA (1990) 87:3655; Wu et al., J. Biol. Chem. (1991) 266:338.
Therapeutic compositions containing a polynucleotide (e.g., the CTLA-4 binding aptamers described herein or vectors for producing such) are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. In some embodiments, concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA or more can also be used during a gene therapy protocol.
The subject to be treated by the methods described herein can be a mammal, such as a farm animals, sport animals, pets, primates, horses, dogs, cats, mice and rats. In one example, the subject is a human. The anti-CTLA-4 aptamer-containing composition may be used for enhancing immune activity, for example, T cell activity, in a subject in need of the treatment. In some examples, the subject may be a human patient having, suspected of having, or at risk for a cancer, such as lung cancer, melanoma, colorectal cancer, or renal-cell cancer. In other examples, the subject can be a human patient having or suspected of having HIV infection. Such a patient can also be identified by routine medical practices.
A subject having a target disease or disorder (e.g., cancer or viral infection such as HIV infection, or bacterial infection) can be identified by routine medical examination, e.g., laboratory tests, organ functional tests, CT scans, or ultrasounds. A subject suspected of having any of such target disease/disorder might show one or more symptoms of the disease/disorder. A subject at risk for the disease/disorder can be a subject having one or more of the risk factors associated with that disease/disorder. Such a subject can also be identified by routine medical practices.
The particular dosage regimen, i.e., dose, timing and repetition, used in the method described herein will depend on the particular subject (e.g., a human patient) and that subject's medical history.
In some embodiments, the anti-CTLA-4 aptamer may be co-used with another suitable therapeutic agent (e.g., an anti-cancer agent or an anti-HIV agent). Alternatively or in addition, the anti-CTLA-4 aptamer may also be used in conjunction with other agents that serve to enhance and/or complement the effectiveness of the agents.
Treatment efficacy for a target disease/disorder can be assessed by, e.g., a method described in the Examples below.Kits for Use in Alleviating a Target Disease
The present disclosure also provides kits for use in enhancing immune activity (e.g., T cell activity), alleviating cancer (e.g., lung cancer, melanoma, colorectal cancer, or renal-cell cancer), and/or treating or reducing the risk for HIV infection. Such kits can include one or more containers comprising an aptamer that binds CTLA-4, e.g., any of those described herein.
In some embodiments, the kit can comprise instructions for use in accordance with any of the methods described herein. The included instructions can comprise a description of administration of the aptamer to treat, delay the onset, or alleviate a target disease as those described herein. The kit may further comprise a description of selecting an individual suitable for treatment based on identifying whether that individual has the target disease. In still other embodiments, the instructions comprise a description of administering the aptamer to an individual at risk of the target disease.
The instructions relating to the use of a CTLA-4 binding aptamer generally include information as to dosage, dosing schedule, and route of administration for the intended treatment. The containers may be unit doses, bulk packages (e.g., multi-dose packages) or sub-unit doses. Instructions supplied in the kits of the invention are typically written instructions on a label or package insert (e.g., a paper sheet included in the kit), but machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.
The label or package insert indicates that the composition is used for treating, delaying the onset and/or alleviating a disease or disorder associated with cancer, such as those described herein. Instructions may be provided for practicing any of the methods described herein.
The kits of this invention are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. Also contemplated are packages for use in combination with a specific device, such as an inhaler, nasal administration device (e.g., an atomizer) or an infusion device such as a minipump. A kit may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The container may also have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is a CTLA-4 binding aptamer as those described herein.
Kits may optionally provide additional components such as buffers and interpretive information. Normally, the kit comprises a container and a label or package insert(s) on or associated with the container. In some embodiments, the invention provides articles of manufacture comprising contents of the kits described above.General Techniques
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J. E. Cellis, ed., 1998) Academic Press; Animal Cell Culture (R. I. Freshney, ed., 1987); Introduction to Cell and Tissue Culture (J. P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds., 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds., 1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds., Harwood Academic Publishers, 1995).
Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.EXAMPLE 1 Screening for Anti-CTLA-4 Aptamers by Immunoprecipitate-SELEX
The present study employed methods for systematic evolution of ligands by exponential enrichment (SELEX), in which binding molecules are selected from a large and diverse library of nucleic acids (either DNAs or RNAs). See, e.g., Mol. Cell Biol (Oliphant A. R., et al., 1989); Science (Tuerk C. et al., 1990); Nature (Ellington A. D., et al., 1990).
To increase the successful rate of aptamer selection, a selection strategy combined with Immunoprecipitate-SELEX (IP-SELEX) and cell-based SELEX was adopted. IP-SELEX can largely reduce the non-specific aptamer from the pool and, on the other hand, cell-based SELEX can reduce the aptamers which fail to recognize target protein on cell membrane. Sixteen rounds of SELEX procedure were performed for FOLR-2 and CTLA-4, respectively. The IP-SELEX was used in the 2nd, 3rd and 4th rounds, while cell-based SELEX was in the rest rounds. For showing the successful evolution of aptamer pools, aptamer pools from round 4, 8, 12, and 16 of CTLA-4 selection were selected and analyzed. The binding affinity and specificity were measured by total binding assay coupled with RT-qPCR (as shown in
Four aptamers (CA7, CA21, CA32 and CA82) isolated by the method described in Example 1 were selected by their higher structural stability. The binding specificity of these four aptamers were analyzed by flow cytometry. All four of these apatmers specifically recognized CTLA-4-expressing cells, except a relatively low non-specific binding signal in CA7 against wild type 293 cells (
The nucleic acid sequence of aptamers CA7, CA32, and CA82 is shown below.
The italicized regions refer to the primer sites and the boldfaced regions refer to the core regions of these anti-CTLA4 aptamers.EXAMPLE 3 CTLA-4 Antagonistic Aptamer Inhibited Tumor Growth In Vivo
After analyzing 50 isolated CTLA-4 aptamers, 5 aptamers that recognized binding site of B7-1 and B7-2 protein on CTLA-4 were identified. One of the aptamers, CA21, which cross-reacted with mouse CTLA-4, was selected for tumor inhibition assay in a syngeneic mice model.
Mouse TC-1 lung cancer cells (3×105) were subcutaneously transplanted into C57BL/6 mice. When the short axis of tumors reached 8 mm, 0.3 nmole CA21 in PBS or control PBS were injected into peritoneal spaces of the mice. The day of injection was recorded as Day 0 and tumor size were measured 2 times per week. The results indicated that CA21 can efficiently inhibit tumor growth compared to control PBS treatment control (
A syngeneic mouse model was used to demonstrate the inhibitory activity of the CTLA-4 antagonistic aptamer CA21 on the growth of colon cancer in vivo. Briefly, mouse CT26 colorectal cancer cells (ATCC CRL-2638) were subcutaneously transplanted into BALB/c mice at day 0 (2×105 CT26 cells per mouse). After tumors reached 8 mm on the short axis, 0.3 nmole of CA21 in PBS or control PBS was injected into the peritoneal spaces of the mice. As shown in
A syngeneic lung cancer mouse model was used to demonstrate the inhibitory activity of the CTLA-4 antagonistic aptamer CA21 on the growth of lung cancer in vivo. Briefly, mouse Lewis lung cancer cells (ATCC, CRL1642) were subcutaneously transplanted into C57BL/6 mice at day 0 (1×105 Lewis lung cells per mouse). After tumors reached 8 mm on the short axis, 0.3 nmole of CA21 in PBS or control PBS was injected into the peritoneal spaces of the mice. As shown in
The inhibitory activity of a pegylated form of CA21 (CA21-PEG) on cancer cell growth in vivo was assessed in this study.
The CA21 aptamer was conjugated to polyethylene glycol (PEG) using maleimide. To generate CA21-PEG, a 3′-thiol CA21 aptamer (3 nmol) in 20 μL of 18 mM ammonium formate pH 4 was added to 30 nmol of PEG having a molecular weight of 40 KDa (1:5 reduced aptamer to PEG molar ratio). The mixture was mixed in a thiol and maleimide reaction at 37° C. After 1 hour, the mixture was subjected to polyacrylamide gel electrophoresis (PAGE) to isolate the CA21-PEG, which was extracted from the polyacrylamide gel using standard techniques. The molecular weight of PEG used was 40 KDa, which was attached to the 3′ end of the CA21 aptamer.
The anti-cancer activity of CA21-PEG was determined in a syngeneic lung cancer mouse model by intravenous administration. Lewis lung cancer cells (ATCC, CRL1642) were subcutaneously transplanted into C57BL/6 mice at day 0 (1×105 Lewis lung cells per mouse) After tumors reached 8 mm on the short axis, one dose of 0.3 nmole of CA21 in PBS, 0.3 nmole of CA21-PEG in PBS, or control PBS was injected into the tail-vein of the mice. Tumor size was measured two times per week. The formula used to calculate tumor size was (L×D2)/2, where L is the long diameter of the tumor, and D is the short diameter of the tumor. The tumor size in the CA21-PEG treated mice was reduced by approximately 50% as compared to the tumor size of mice treated with CA21 (
All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
1. A nucleic acid aptamer, comprising a nucleic acid sequence that is at least 85% identical to a nucleotide sequence selected from the group consisting of: (i) (SEQ ID NO: 1) GATGGTGAAAATGGGCCTAGGGTGGACGGT; (ii) (SEQ ID NO: 6) GATGACTGGATGCAAAAATGCTGTGGGGTA; (iii) (SEQ ID NO: 7) GTCCACACTCAGAAAACAGAATAGGGGGTA; and (iv) (SEQ ID NO: 8) CGATCGAAAATGTCCAGGGAGTTGTCTGTA;
- wherein the aptamer binds CTLA-4.
2. The nucleic acid aptamer of claim 1, wherein the aptamer comprises a nucleic acid sequence that is at least 90% identical to a nucleotide sequence selected from the group consisting of: (i) (SEQ ID NO: 1) GATGGTGAAAATGGGCCTAGGGTGGACGGT; (ii) (SEQ ID NO: 6) GATGACTGGATGCAAAAATGCTGTGGGGTA; (iii) (SEQ ID NO: 7) GTCCACACTCAGAAAACAGAATAGGGGGTA; and (iv) (SEQ ID NO: 8) CGATCGAAAATGTCCAGGGAGTTGTCTGTA;
3. The nucleic acid aptamer of claim 2, wherein the aptamer comprises a nucleic acid sequence that is at least 95% identical to a nucleotide sequence selected from the group consisting of: (i) (SEQ ID NO: 1) GATGGTGAAAATGGGCCTAGGGTGGACGGT; (ii) (SEQ ID NO: 6) GATGACTGGATGCAAAAATGCTGTGGGGTA; (iii) (SEQ ID NO: 7) GTCCACACTCAGAAAACAGAATAGGGGGTA; and (iv) (SEQ ID NO: 8) CGATCGAAAATGTCCAGGGAGTTGTCTGTA;
4. The nucleic acid aptamer of claim 3, wherein the aptamer comprises the nucleic acid sequence selected from the group consisting of: (i) (SEQ ID NO: 1) GATGGTGAAAATGGGCCTAGGGTGGACGGT; (ii) (SEQ ID NO: 6) GATGACTGGATGCAAAAATGCTGTGGGGTA; (iii) (SEQ ID NO: 7) GTCCACACTCAGAAAACAGAATAGGGGGTA; and (iv) (SEQ ID NO: 8) CGATCGAAAATGTCCAGGGAGTTGTCTGTA;
5. The nucleic acid aptamer of claim 4, wherein the aptamer consists of a nucleic acid sequence selected from the group consisting of: (a) (SEQ ID NO: 2) TCCCTACGGCGCTAACGATGGTGAAAATGGGCCTAGGGTGGACGGTGCC ACCGTGCTACAAC; (b) (SEQ ID NO: 3) TCCCTACGGCGCTAACGATGACTGGATGCAAAAATGCTGTGGGGTAGCCA CCGTGCTACAAC; (c) (SEQ ID NO: 4) TCCCTACGGCGCTAACGTCCACACTCAGAAAACAGAATAGGGGGTAGCC ACCGTGCTACAAC; and (d) (SEQ ID NO: 5) TCCCTACGGCGCTAACCGATCGAAAATGTCCAGGGAGTTGTCTGTAGCCA CCGTGCTACAAC.
6. The nucleic acid aptamer of claim 1, wherein the aptamer binds to CTLA-4 with a dissociation constant (Kd) lower than 20 nM.
7. The nucleic acid aptamer of claim 1, wherein the nucleic acid aptamer is conjugated with polyethylene glycol (PEG).
8. The nucleic acid aptamer of claim 7, wherein the PEG is conjugated to the 3′ end of the nucleic acid aptamer.
9. The nucleic acid aptamer of claim 7 or claim 8, wherein the PEG has a molecular weight ranging from 30 kDa to 50 kDa.
10. The nucleic acid aptamer of claim 9, wherein the PEG has a molecular weight of 40 kDa.
11. A pharmaceutical composition, comprising the nucleic acid aptamer of claim 1 and a pharmaceutically acceptable carrier.
12. A method for treating cancer, comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of claim 11.
13. The method of claim 12, wherein the subject is a human patient having, suspected of having, or at risk for cancer.
14. The method of claim 12, wherein the cancer is lung cancer, melanoma, colorectal cancer, or renal-cell cancer.
15. The method of claim 12, wherein the pharmaceutical composition is administered to the subject intravenously.
16. A method of enhancing immune activity in a subject, the method comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of claim 11.
17. The method of claim 16, wherein the subject is a human patient having, suspected of having, or at risk for cancer.
18. The method of claim 16, wherein the cancer is lung cancer, melanoma, colorectal cancer, or renal-cell cancer.
19. The method of claim 17, wherein the subject is a human patient having or suspected of having HIV infection.
20. The method of claim 16, wherein the amount of the pharmaceutical composition is effective in increasing T cell activation.
21. The method of claim 16, wherein the pharmaceutical composition is administered to the subject intravenously.
Filed: Jul 31, 2015
Publication Date: Jul 27, 2017
Patent Grant number: 10533179
Applicants: Academia Sinica (Taipei), National Taiwan University (Taipei), Taipei Medical University (Taipei City)
Inventors: Konan Peck (Taipei City), Pan-Chyr Yang (Taipei), Yi-Chung Chang (Taipei City), Bo-Tsang Huang (Taipei City), Shauh-Der Yeh (Taipei City)
Application Number: 15/500,345 | <urn:uuid:28aedab4-6f7f-40ae-b56e-d63a71f90156> | CC-MAIN-2022-33 | https://patents.justia.com/patent/20170211067 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.870992 | 16,156 | 1.78125 | 2 |
About a year ago I posted about two children’s books that combine interesting stories, beautiful illustrations, and factual information about dinosaurs and other extinct animals: Ankylosaur Attack and Pterosaur Trouble. Moving on to another group of extinct reptile, Daniel Loxton rounds out this trilogy in the Tales of Prehistoric Life series: Plesiosaur Peril (Tonawanda, NY: Kids Can Press, 2014, 32 pp.).
Again combining beautiful digital illustrations with landscape photography (or should I say, seascape photography) by Loxton and Jim W.W. Smith, this book recounts the “day in the life” of a family of ocean-dwelling Cryptoclidus as they evade the hungry jaws of a much larger plesiosaur, Liopleurodon. Young readers will enjoy the action, while parents will appreciate the theme of family bonds. Educators will enjoy the current paleontological information (paleontologist Darren Naish was a consultant, and he posted on his blog a lot of information about plesiosaurs and the process of working on the book), while everyone will enjoy the beautiful rendering of plesiosaurs, ammonites, ichthyosaurs, and belemnites (squid-like creatures). This trilogy is perfect for science-minded kids, and would be great set of books to have on elementary school library shelves. | <urn:uuid:8b76dfb1-3b80-4649-aee1-70c3c8c68425> | CC-MAIN-2022-33 | https://thedispersalofdarwin.wordpress.com/2014/03/05/book-review-plesiosaur-peril/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00265.warc.gz | en | 0.905333 | 289 | 2.46875 | 2 |
Tips for Living Bright 5/29: REASSESS YOUR THOUGHTS
“The heaviest burdens that we carry
are the thoughts in our head.”
I saw that quote yesterday and it struck me hard. Our thoughts carry so much weight.
They can help us be happy or they can convince us that we are sad.
They can fester and consume us.
They can distort reality.
They can deceive.
There are many times when I wished that a gigantic vacuum could just suck my thoughts away. And while this is not possible, it is possible to reprogram our thinking process.
When the negative thoughts try to take hold, ask yourself:
Do I have control over the thought–can I make changes to eliminate this?
If so, start making those changes.
Would talking to someone help?
If so, speak to a friend, an expert, or a family member. You are not alone. Even the most polished, happy seeming people are challenged with pesky, negative thoughts.
Are my thoughts accurate?
Many, many times, we convince ourselves of something (e.g., someone thinks badly of us, this person is upset with us) that is, in fact, NOT TRUE.
Are they productive?
If not, then try this technique . . .
It’s called CANCEL-CANCEL and it involves immediately replacing a negative thought with a positive one (even if you are having trouble believing the positive thought).
Negative thoughts can come hard and fast, and when they do, you are to say to yourself, “Cancel-Cancel”.
This method (as cheesy as it may sound) is similar to electric shock only without the pain. It is designed to stop you cold when a negative thought emerges–to TRAIN yourself to control what consumes your thoughts. It takes practice — sometimes lots and lots of practice. But eventually, it will become easier.
Mind over matter is one of the toughest things to master.
Be kind to yourself.
Remember, we are ALL works in progress. | <urn:uuid:31176b23-7211-48a6-838d-1dcd33136b88> | CC-MAIN-2022-33 | https://brightlightliving.com/2022/05/29/reassess-your-thoughts/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.95157 | 432 | 2.03125 | 2 |
On June 15, three years ago, SEKEM’s founder Ibrahim Abouleish passed away, exactly 40 years after he founded the SEKEM initiative. SEKEM community continues to realize his vision of holistic sustainable development in the areas of environment, culture, social affairs, and economy. Out of the inspirations and impulses that guided Ibrahim Abouleish to realize his vision, SEKEM community has developed a vision for the next 40 years – similarly innovative and ambitious – for a sustainable future as the founder exemplified. Two years later, the 2019 annual report shows which vision goals SEKEM was able to implement and promote for a sustainable change in Egypt.
“The endless confidence, with which my father carried the SEKEM vision into the world against all odds, is a leading inspiration for our way towards change. We are grateful that we were able to take many fundamental steps in 2019 in order to realize our vision for holistic sustainable development in Egypt.” SEKEM’s CEO, Helmy Abouleish.
By 2057, in the Ecology Dimension, SEKEM aims to spread Organic and Biodynamic agricultural methods in Egypt to such an extent that the majority of the country is applying sustainable agricultural practices.
In this context, the first phase of the “SEKEM Wahat” project was successfully accomplished in December 2019. A crowdfunding campaign raised 400,000 euros, which allowed 63 hectares of former desert land to be reclaimed. The first medicinal herbs are growing on the SEKEM farm in Wahat El-Bahareya, and cultural events are taking place so that a sustainable community can grow.
By 2057, in the Economy Dimension, SEKEM aims to introduce, among other things, the circular economy model and the concept of the “Economy of Love” in Egypt.
In 2019, SEKEM developed specific standards for an “Economy of Love” certification, laying the foundation for innovative redesigning and holistic tracking of economic activities. The economic vision of SEKEM is based on the idea of an associative economy where the requirements for dealing with the environment and people go far beyond the so far known and applied standards.
By 2057, in the Societal Dimension, SEKEM aims to inspire the Egyptian society in such a way that a social transformation can take place, by which all people develop awareness on their opportunities to shape their country and the future.
SEKEM was recognized as an “Outstanding Practice in Agroecology 2019” for its leading role and holistic commitment as a social business in the world, by the World Future Council in 2019.
With seminars on the topic of “SEKEM Vision”, a format was created in 2019 that helps to carry the impulses of SEKEM Vision for 2057 into the world.
By 2057, in the Cultural Dimension, SEKEM aims to integrate a holistic approach into Egypt’s educational system that enables individual potential unfolding – from schools to universities to research.
In 2019, SEKEM and Heliopolis University hosted the “Social Initiative Forum”. More than 250 people from all over the world came to learn from each other and to exchange ideas on individual potential unfolding. The focus of the forum was on empowering people as individuals and, at the same time, as members of the community. | <urn:uuid:052f2824-9816-42a2-84ee-3beb211365bd> | CC-MAIN-2022-33 | https://www.sekem.com/en/in-memory-of-ibrahim-abouleish-sekems-annual-report-2019/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.95165 | 696 | 1.554688 | 2 |
What people are saying - Write a review
We haven't found any reviews in the usual places.
Other editions - View all
already appears authority become believe Bishop British brought called carried cause character Christian Church classes clergy common Constitution course desire doubt duty effect England English Europe existing fact feeling force foreign France give given Government hand hope House hymns important influence interest island Italy King known least less letter live look Lord means mind Miss nature never object once party passed Pitt political Porte position possessed practical present Prince Princess principles probably question reason received regard religious remain respect result schools seems ships side society Spain spirit taken things thought tion train true Turner United whole young
Page 253 - Every state shall abide by the determinations of the United States in congress assembled, on all questions which, by this confederation, are submitted to them. And the articles of this confederation shall be inviolably observed by every state ; and the Union shall be perpetual.
Page 342 - But what to those who find ? Ah ! this Nor tongue nor pen can show : The love of Jesus, what it is, None but his loved ones know.
Page 491 - Whatever fruits in different climes are found, That proudly rise, or humbly court the ground ; Whatever blooms in torrid tracts appear, Whose bright succession decks the varied year ; Whatever sweets salute the northern sky With vernal lives, that blossom but to die ; These here disporting, own the kindred soil, Nor ask luxuriance from the planter's toil ; While sea-born gales their gelid wings expand To winnow fragrance round the smiling land.
Page 250 - But this momentous question, like a firebell in the night, awakened and filled me with terror. I considered it at once as the knell of the Union. It is hushed, indeed, for the moment. But this is a reprieve only, not a final sentence. A geographical line, coinciding with a marked principle, moral and political, once conceived and held up to the angry passions of men, will never be obliterated; and every new irritation will mark it deeper and deeper.
Page 245 - Kansas, and when admitted as a state or states, the said territory, or any portion of the same, shall be received into the union with or without slavery, as their constitution may prescribe at the time of their admission...
Page 323 - Thou dost conduct Thy people Through torrents of temptation ; Nor will we fear, while Thou art near, The fire of tribulation : The world, with sin and Satan, In vain our march opposes ; By Thee we shall break through them all, And sing the song of Moses.
Page 241 - I now reiterate these sentiments ; and, in doing so, I only press upon the public attention the most conclusive evidence of which the case is susceptible, that the property, peace, and security of no section are to be in anywise endangered by the now incoming administration.
Page 241 - I understand a proposed amendment to the Constitution — which amendment, however, I have not seen— has passed Congress, to the effect that the federal government shall never interfere with the domestic institutions of the States, including that of persons held to service. | <urn:uuid:cf53268c-26bb-4e88-a364-404701864710> | CC-MAIN-2022-33 | https://books.google.com.ph/books?id=UZBZAAAAIAAJ&dq=editions:OXFORD591032688&output=html_text&lr=&as_brr=0 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.925325 | 658 | 1.5 | 2 |
I'm sure that you're well aware of the money-making potential that exists by creating and marketing your own information products.
Selling short reports and e-courses is one of the best ways to make money online - and if you're serious about it then you'll understand that having products with your own name on them is the way to go.
But there's a BIG problem...
Producing your own information products from scratch is HARD!
First of all you've got to come up with an actual subject or idea.
And you can't just take a wild stab in the dark either because what's the point in producing a product that nobody is interested in?
No - you need to do your research and be sure of your market.
But things get even harder when it's time to start the actual work...
Let's face it - sitting in front of a blank Word screen and not having a clue what to write about is not a nice feeling for anyone.
I've been there and the prospect of producing something from scratch that's high quality is pretty daunting to say the least.
But there IS a solution...
It's called Private Label Rights (PLR)
A PLR product is essentially a ready-made information product that you buy the license to resell, distribute and edit.
PLR is the perfect solution because it removes most of the hard work involved in creating your own products.
But most people use PLR in completely the wrong way...
Listen. This is your chance to take a huge shortcut towards online profits... But ONLY if you use it in the right way.
Inside I'll show you EXACTLY how to take a cheap, ready-made PLR product and then turn around and sell it or use it to move your business forward fast...
- How To Find The Best PLR Products To Work With (Note: Not all PLR products are equal. I'll show you exactly what to look out for and how to always choose the best ones.)
- Why You MUST Make Your PLR Product Unique - and How To Do It FAST.
- How To Re-Package Your Product Quickly and Easily For Maximum Profit.
- How To Turn Around and Sell Your Product... Or Use It To Create a Huge List That You Can Sell To Again and Again.
- The Mistake That Most People Make With PLR... and How To Avoid It Yourself
... and much, much more.
If you follow this report theen by the time you've finished you'll have your own completely unique information product that you can turn around and do whatever you want with.
Trust me - PLR really is the fastest and easiest way to start profiting from info products - and I'll show you exactly how to do it, step-by-step. | <urn:uuid:739ae997-4215-440d-a36d-4bd517e1245a> | CC-MAIN-2022-33 | https://www.youbux.com/Profiting-From-PLR-Products_p_1223.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.935687 | 580 | 1.554688 | 2 |
So far in our Good Food Kids series, we’ve given you three strategies for changing the food on your family’s plates, and we’ve told you what you can expect from your kids during that transition. Today, it’s time to get down to the nitty-gritty. Whole9’s own Robin Strathdee asked (and then answered) some of the most frequently asked questions about nurturing Good Food Kids.
Note: all photos are from our friend Michele Tam at NomNomPaleo.com. Her site is a treasure trove of family-friendly recipes, so click on any photo when you’re done reading and see what Nom Nom has to offer your kiddos.
What should my kid’s plate look like?
For the most part, we think your kids’ plates should look like yours – some protein, plenty of fat, and lots of veggies. You can use our meal planning template as a jumping-off point, but don’t stress if your kids don’t seem to want eat according to plan. Offer plenty of good food at each meal, let them help decide what goes on their plates, and your kids will work it out in the end. Keep a mindful eye, but help your kids learn to trust their bodies when it comes to their food.
Making mealtimes relaxed and social can help with teaching them to pay attention to their hunger and satiety cues. Model good mealtime behavior, eating slowly, chewing carefully, and doing so without outside distractions like phones, iPads, or television.
It’s important to note here that when you first make the transition, you may meet with more resistance than usual at meal times. Relax, take a deep breath, and remember that your kids will not starve themselves. Most kids don’t have the willpower to resist a marshmallow, let alone go hungry long enough to cause real problems. (As added back-up, Paleo Super-Mom Sarah Fragoso agrees – check out her interview with Whole9.)
Any kid’s lunch is cooler when you serve it in Lunchbots stainless steel containers. Visit our special Whole30 link to score a 15% discount and free shipping on their nine most popular lunchtime container offerings!
How much protein do my kids need? Can they eat too much?
Researchers at Baylor University recommend the following daily allowances of protein for children:
- 1-3 years: 0.55g of protein per pound of bodyweight
- 4-6 years: 0.5g per lb.
- 7-14 years: 0.45g per lb
However, protein is one of nature’s most naturally self-regulating foods. Dense in satiety factors and nutrition, it’s really hard for anyone (even kids) to over-eat protein from real food. In addition, this information is not designed to encourage you to weigh, measure and track your children’s food intake. If you have specific concerns about their nutrient intake, keep track of a day or two to set a baseline, but don’t stress – kids who are fed Good Food will balance their own diets instinctively.
Unless your kiddos have a kidney disease that affects their ability to process the nitrogen your body makes when it breaks down proteins, your kids couldn’t eat enough food to reach an undesirable protein level. You’re more likely to encounter a kid who doesn’t get enough protein – which is why it’s important to experiment with different cuts, cooking techniques, and preparation methods.
The Whole9 program emphasizes eating fat – is that good for my kids?
It’s important to clarify here: We emphasize the consumption of healthy, high quality fats like coconut, olives, and avocado. We discourage the use of volatile, easily damaged fats like vegetable oils, or fats found in processed foods like french fries. That said, consumption of fats that make us healthier is essential for proper growth and function in children. Prepare your foods using our recommended cooking fats, and offer your kids healthy fats like avocado and coconut milk every day to ensure they get enough for proper growth and development.
If I remove dairy from my kids’ diet, where will they get their calcium?
Calcium is a key factor in building strong, healthy bones, but it’s important to remember that it’s not the only factor. Other vitamins and minerals play a big role in bone development, as do lifestyle choices like activity levels and stress. In addition, the calcium added to dairy products (and orange juice) is not in its most easily accessible form. We think you should look to other, naturally calcium-rich foods for your daily intake.
Want the science? Check out our full article What About Calcium, which applies to you and your children!
If my kids don’t eat whole grains, will they still get enough fiber?
Many Americans believe that whole grains are the best source of fiber in their diets, and their misconceptions are reinforced by many nutritional agencies. Still, despite the emphasis on whole grains, current opinion is that many children get less than half of their recommended intake of fiber each day. The National Academy of Sciences Research Council recommends that children between the ages of 4 and 18 consume 25-38 grams of dietary fiber per day, based on their gender and age.
The truth is that fruits, vegetables, nuts, and seeds are packed with fiber, plus vitamins, minerals, antioxidants, calcium, and gobs of other compounds that make you healthier.
- 1 cup of raspberries has more fiber than 1 cup of whole wheat spaghetti (8.0>6.3)
- 1 cup of broccoli (cooked) has more fiber than 1 cup of instant oatmeal (5.1>4.0)
- 1 ounce of almonds has more fiber than 1 slice of whole wheat, multi-grain or rye bread (3.5>1.9)
If we cut out milk, soda, and juice, what’s left for my kids to drink?
We tackled this topic in a detailed article recently. Some kid-friendly hydration options: plain ol’ water, water infused with fruit for fun and flavor, sparkling mineral water, fruity herbal teas, kombucha (it has great probiotic properties, but start off slowly), and coconut milk (from a can, thinned with water if needed).
Want more ideas? This was also a hot topic on our Whole30 forum . Follow the link to find out what they came up with: What Can I Drink?
My little one still drinks milk. What can I replace that with?
Once your kiddos are past the age where they need breast milk as their main source of nutrition, they can drink water (or anything else appropriate). However, we recognize that there’s a psychological connection there for your kiddo. For young ones, bottles or sippy cups (and the liquids contained therein) are often comfort items. Thinned down coconut milk (from a can, not the sweetened stuff in a milk-like carton) is a good option for parents and kids working through that phase. Homemade almond milk is also an option, but consumption of nuts (in any form) should be fairly moderate – and who has time to make your own almond milk?
Note, rice milk or soy milk are not recommended healthy substitutes for cow’s milk.
How much water should kids drink every day?
According to the Institutes of Medicine (at the NAS):
- Kids ages 1-8 should take in about 1.5 L (or 48 oz) per day.
- Kids ages 9-13 need between 2 and 2.5 L (64-96 oz) per day.
Again, don’t stress about measuring their intake, but on hot days or especially active days, make sure they have the means to hydrate all day long (using a sippy cup, a non-plastic bottle, or another age-appropriate container). Note: Melissa and Dallas just bought a few of these Pura Kiki stainless steel bottles for their soon-to-be kiddo – they’re plastic-free, and convert to sippy cups when the infant is ready.
My kid won’t eat (fill in the food group here). Can we still make this transition?
Absolutely! You’re just going to need to put on your patience cap, set some boundaries and let things happen on their own. Here’s the answer I gave to one of our forum members having the same problem with her son (and protein):
“Kids at are continually exploring their autonomy, discovering that they are in control of their own minds and bodies and learning that we, as parents, cannot read their minds or move their bodies. These seemingly random exercises of will come and go and take some really interesting forms.
I suggest a little experiment: Give him a week of no nagging, no forcing, no rules. If he eats fruits and veggies well, let him load up. Fill him full of whatever fats he’ll eat. Take the pressure off and don’t even address the issue. But, don’t take him to any restaurants either (In a more general sense, don’t make your kids alternative meals). He eats what you’ve cooked – protein or no….There’s a chance that, once he sees that you respect his autonomy, he’ll choose to partake with you. If he doesn’t, then you can start working through some other plans. At the very least, though, you’ll get some fight-free meals under your belt and it will help return the sanity we so very much need as parents.
The guiding principle I use with my girls is this: As a parent, I can control what they eat in my home. But life is so much more than being told what to do. I want my girls to learn how to eat – what, when, why – and (IMHO) deciding what goes into their mouths is a part of that.”
And remember to re-read this article to help you craft just the right strategy to transition your child.
Are there any tricks to getting my kids to eat (and like!) vegetables?
Absolutely! We’ve done the research, and created five ways science can help your kiddos eat their greens (and reds, oranges, and yellows, too). Read this Whole9 article for the best strategies, and feel free to mix-and-match.
Should I let my kids have less healthy foods outside of my house (school, daycare, parties, etc)?
That’s really up to you (and, in some cases, your kids). In my house, we base those decisions on what the food is/will be and how we know that food affects my kids. For example, High Fructose Corn Syrup transforms my children from relatively well-behaved humans to something akin to Damien from The Omen. I (obviously) recognize that and, at this point, my kids do too. My four year old says that “yucky sugar” makes her feel like she will never go to Disneyland again. So, HFCS is never an option for us. Gluten, on the other hand, doesn’t have too much impact on them in occasional, single serving doses. So, if I forget to bring a back up treat to a party, I know it’s okay if they have a cupcake.
The bottom line – you have to make the healthiest, and most liveable choice you can for you and yours, and being too restrictive can lead to a backfire the likes of which will see your child cramming candy into her pie-hole at every available opportunity, even if it makes her feel awful.
What should I do if my kids get accidentally “dosed” with less healthy food?
First things first, unless there’s a significant sensitivity or an allergy involved, take a deep breath and calm down. It’s not that big of a deal. This is a great opportunity to open up the discussion about food, how it works in our body, and how it makes us feel. Time to revisit our A is for Awareness article, and talk to your kids about the experience and how their bodies feel. Remind them that some foods are more healthy (anytime) choices and some foods are less healthy (sometimes or never) choices.
If the “dosing” happened when you weren’t present, take that opportunity to inform or remind your caregiver (teacher, neighbor, grandparent, etc.) of your family’s food boundaries. Be polite. Offer to bring in alternatives for your kids, if that will work for you.
What are some simple foods I can pack my kids for snack or lunch at school or daycare?
My default combination is protein, fruit, veggie (and sometimes a condiment, like a dipping sauce). It really doesn’t have to be more complicated than that. For a closer look at the lunches of some pretty well-fed kids, check out Nom Nom Paleo’s Week of School Lunches and Primal Bliss’ Month of Real Food School Lunches.
Have a question you don’t see here? Ask us in comments below!
We can help you live the Whole9 life.
Fill out the form below to join the Whole9 Newsletter. | <urn:uuid:afc5ef05-b80a-46d8-ad58-35253f0645b0> | CC-MAIN-2022-33 | http://whole9life.com/2013/03/raising-good-food-kids-faq/?shared=email&msg=fail | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.948935 | 2,822 | 2 | 2 |
Retired Marlboro Teacher Celeste Ricciardone still has her hand in educating students through the 1,000 Book Club; a program that is a partnership between the Marlboro Faculty Association and the Marlboro and Milton Libraries.
Last week Kaylee Keane was honored for having read 1,000 books and Keane’s mother, Kathy, is a teacher in the district. Ricciardone noted that doing this during the pandemic was a particular challenge.
Ricciardone said families with children ages 3 to 6 sign can up for the program at the library.
“They take out a pack of 10 books and they do that 100 times and they’ve read 1,000 books,” she said. “The Faculty Association started the program twenty years ago because the 1st grade teachers at that point realized that our children were not reading at the level that we wanted them to read to be successful in Middle and High School.”
Ricciardone said a consultant suggested the district have the students read 1,000 books, something that seemed impossible to achieve. The consultant suggested the district not only get the parents involved but form partnerships with the local libraries.
“It’s wonderful for the families, the parents and the kids. It’s just a wonderful program; so we started it,” she said.
Kaylee addressed the school board, saying, “My new goal is to help Mrs. Ricciardone and my mom revamp the 1,000 book club and add new books to its collection...I would love to start a book drive in the Elementary School and help the MFA redo the book packs. My donation flier would say, New year, new books. I want to give the gift of reading to others. I have been saving up money since September with the help of my family and would love to donate 20 new books to the book club to make it even better.”
Ricciardone took a moment to acknowledge Kaylee’s grandmother, Marie Corcoran, “who worked for the district for many years, an absolutely wonderful person who got me started in the book club.” | <urn:uuid:8ecf4a8c-8c27-4aaf-b544-a6b1ec890b23> | CC-MAIN-2022-33 | https://timeshudsonvalley.com/stories/marlboro-presents-1000-book-club-award,34156 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.976117 | 458 | 1.820313 | 2 |
|Eastern Market Open Air Farmers Market|
|Address||North Carolina Avenue and 7th Street SE on Capitol Hill, Washington, DC|
|Dates||Saturday & Sunday|
|Times||8:00 - 6:00|
Washington, DC's Eastern Market has been in continuous operation since 1873 and is a designated National Historic Landmark.
Fresh food stalls including meat, poultry, dairy, greengrocers, and fish are found in the South Hall Tuesday through Sunday except on holidays. Market Lunch is also located in the South Hall and is open for breakfast from Tuesday through Saturday. It is known for homemade bread, blueberry pancakes, and crabcakes. Farmers selling local produce can also be found on the surrounding sidewalks on Saturdays.
The North Hall houses Market Five Gallery, a non-profit to promote the arts. | <urn:uuid:59d39259-a448-47db-89c8-1ef9f3b2769e> | CC-MAIN-2022-33 | https://green.fandom.com/wiki/Eastern_Market_Open_Air_Farmers%27_Market?mobileaction=toggle_view_mobile | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.958867 | 190 | 1.671875 | 2 |
The province’s ranchers can now apply for up to $200 per head as part of a $340 million AgriRecovery drought support program announced Tuesday. The 2021 Canada-Alberta Livestock Feed Assistance Initiative will help cover feed and water access costs for Alberta’s breeding female livestock.
“Alberta’s livestock producers have experienced exceedingly dry conditions for months, putting additional stress on the very Albertans who feed Canadian families,” said Devin Dreeshen, Minister of Agriculture and Forestry. “Alberta’s government is proud to support the delivery of up to $340 million in much-needed relief to help our livestock producers make it through this difficult season.”
The province says payments will follow shortly after applications are received, and approved applications will be processed fastest for those who sign up for direct deposit.
A secondary additional payment of up to $106 per head is available to producers with extraordinary drought-related costs; however, receipts will be required.
Additionally, cattle and bison ranchers are eligible for an initial payment of $94 per head and a second payment of $106 per head, for a total of $200 per head. Other livestock will be subject to a different per head payment.
Agriculture Financial Services Corporation (AFSC) will administer the program, and terms and conditions can be found online at https://afsc.ca/income-stabilization/agrirecovery/ | <urn:uuid:d5f7f9be-ee4b-4f86-b961-1ee5b5346c2a> | CC-MAIN-2022-33 | https://morinvillenews.com/2021/09/07/province-offering-340-million-in-drought-relief/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.934567 | 301 | 1.59375 | 2 |
by Ann Garrison
Human Rights Watch acts as an arm of U.S. foreign policy. This phony “rights” organization backs the deportation and prosecution of Rwandan dissidents like Joseph Nkusi, who dared to maintain that Hutus were also massacred in the Rwanda bloodbath. Under a minority Tutsi dictatorship, “even using the description ‘Rwandan Genocide’ is a crime; authorities enforce a law passed in 2008 making ‘genocide against the Tutsi’ the only legal description.”
Rwanda: The Absolutist Truth of Human Rights Watch
by Ann Garrison
“Human Rights Watch is OK with Nkusi's prosecution because its own absolutist conclusions about the genocide are compatible with those of Rwanda’s absolutist, totalitarian government.”
Human Rights Watch (HRW) is well known for accepting U.S. wars of aggression so long as they’re conducted according to the Geneva Conventions. HRW famously crusades for the same U.S. wars of aggression for the purpose of protecting citizens of other nations from their own governments. Its warmongering catechism includes Halabja, Rwanda, Srebrenica and now Aleppo, all of which it cites as failures to protect civilians that compel the U.S. to humanitarian war evermore.
This month HRW’s Central Africa Director, Ida Sawyer, produced an HRW absolutist classic, A March 8th HRW “dispatch." It tells the story of Joseph Nkusi, a Rwandan blogger and political asylum seeker who was deported from Norway after a court rejected his claim that he would be persecuted if he were deported to Rwanda. Nkusi was arrested upon arrival, like most Rwandan emigrés who fail to convince Western courts that they will be persecuted in Rwanda. He is now on trial for “genocide ideology,” a Rwandan crime modeled on European “Holocaust denial” laws, which makes it illegal to publicly “deny, revise, trivialize, or negate” the Rwandan Genocide. In Rwanda, even using the description “Rwandan Genocide” is a crime; authorities enforce a law passed in 2008 making “genocide against the Tutsi” the only legal description.
“Both Kagame’s Tutsi army and Tutsi civilians targeted Hutu people for mass killing.”
Joseph Nkusi is on trial for claiming that both Hutus and Tutsis were targeted in a “double genocide,” meaning that members of both groups killed each other during the Rwandan war and massacres of 1990 - 1994. Human Rights Watch is OK with Nkusi's prosecution because its own absolutist conclusions about the genocide are compatible with those of Rwanda’s absolutist, totalitarian government:
“Some of the writings on Nkusi’s blog relay claims about the genocide that are unfounded -- stating, for example, that both Hutus and Tutsis were targeted in a ‘double genocide.’ This is offensive to genocide survivors [Tutsis], and contrary to research findings by Human Rights Watch and other independent organizations. Other writings criticize the Rwandan government’s human rights record.”
There is abundant evidence that both Kagame’s Tutsi army and Tutsi civilians targeted Hutu people for mass killing, not only in Rwanda but also in the Democratic Republic of the Congo (DRC). Canadian journalist Judi Rever has documented the massacre of Hutu people committed by Kagame’s army with the help of Tutsi technocrats in, for example, "What Remains Hidden in Rwanda: The Role of Tutsi Civilians in Killing Hutus." Australian peacekeepers and Australian artist George Gittoes observed and documented the Kibeho Massacre of Hutu refugees in Rwanda on April 22,1995. The UN Mapping Report on Human Rights Abuse, 1993 - 2003, documented the massacre of Rwandan Hutu refugees who fled into DRC to escape Kagame’s advancing army. In Dying to Live: A Rwandan Family's Five-Year Flight Across the Congo, Hutu refugee Pierre-Claver Ndacyayisenga recounts their harrowing journey all the way through the Congolese jungle, from east to west, with Kagame’s Rwandan Patriotic Army in pursuit. In Surviving the Slaughter, Marie Beatrice Umutesi recounts the same horrors, as does the five part documentary Tingi Tingi Hutu Refugee Massacre.
“The UN Mapping Report on Human Rights Abuse documented the massacre of Rwandan Hutu refugees who fled into DRC to escape Kagame’s advancing army.”
Other well documented challenges to the Human Rights Watch narrative include Robin Philpot's Rwanda and the New Scramble for Africa: from Tragedy to Useful Fiction, Peter Erlinder's The Accidental Genocide, and Barrie Collins's' Rwanda Genocide: The Myth of the Akazu Genocide Experience and Its Consequences.
It seems that none of this evidence has reached Human Rights Watch or, if it did, the organization remained unwilling to recant its own absolutist conclusions about "genocide against the Tutsi." According to Ida Sawyer, Nkusi’s arrest for daring to differ is justifiable. However, Sawyer is concerned about Rwandans’ freedom to criticize the Rwandan government's human rights record:
“Nkusi's trial is an opportunity for Rwanda to show that it clearly distinguishes between ‘genocide ideology’ -- a criminal offense in Rwandan law -- and free speech, or the freedom to criticize the government or the ruling party. ...
“While some of his writings are reprehensible, the Rwandan authorities should ensure that Joseph Nkusi gets a fair trial and is not prosecuted nor convicted for criticism of the government or the ruling party. International actors, including the government of Norway, should closely monitor the trial proceedings and be prepared to publicly denounce any breaches of fair trial standards or violation of free speech.”
As is so often the case, Human Rights Watch knows the one, the only, and the absolute truth and deploys it to justify human rights crimes, from bombing Libya and Syria to the imprisonment of a Rwandan blogger who dares to differ with the Rwandan government and with HRW's own "research findings."
Ann Garrison an independent journalist based in Oakland, USA. | <urn:uuid:b73c7739-611a-435d-9266-1c24b11dd13f> | CC-MAIN-2022-33 | https://blackagendareport.com/rwanda_absolutist_human_rights_watch?page=1 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.926874 | 1,365 | 1.882813 | 2 |
Keywords: HF; Operator Performance; human performance; Cab Technology Integration Lab; CTIL; simulation; simulator; human-in-the-loop; Trip Optimizer; TO; energy management; locomotive cab; train handling
Abstract: The study’s purpose was to gain insight into expert operator intent and train handling strategies to develop and evaluate a new manual mode of locomotive operation using a...
Keywords: HF; operator performance; human performance; locomotive cab; train handling; system design; operating configurations; survey; human-automation interaction
Abstract: The objective of this work was...
The objective of this work was...
Keywords: Training, Part 243
Keywords: PPP, Public Private Partnership, station development | <urn:uuid:35b03ead-9816-469c-b10c-ecd8e0d5b9d4> | CC-MAIN-2022-33 | https://dotcms.fra.dot.gov/elibrary-search?f%5B0%5D=document_series%3A14901&f%5B1%5D=subject%3A14291&f%5B2%5D=subject%3A14381&f%5B3%5D=subject%3A14386&f%5B4%5D=subject%3A14411&f%5B5%5D=subject%3A14416&f%5B6%5D=subject%3A14446&f%5B7%5D=subject%3A14541&f%5B8%5D=subject%3A14581 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.809311 | 189 | 1.773438 | 2 |
Dimensões ecológicas do controle e gerenciamento de doenças transmitidas por vetores
Brett R. EllisI; Bruce A. WilcoxII
ICentro de Pesquisas Aggeu Magalhães, Fundação Oswaldo Cruz, Recife, Brasil
IIAsia-Pacific Institute for Tropical Medicine and Infectious Diseases, John A. Burns School of Medicine, Honolulu, U.S.A.
Alarming trends in the resurgence of vector-borne diseases are anticipated to continue unless more effective action is taken to address the variety of underlying causes. Social factors, anthropogenic environmental modifications and/or ecological changes appear to be the primary drivers. The ecological dimension of vector-borne disease research and management is a pervasive element because this issue is essentially an ecological problem with biophysical, social, and economic dimensions. However there is often a lack of clarity about the ecological dimension, the field of ecology (e.g. role, limitations), and related concepts pertinent to ecosystem approaches to health. An ecological perspective can provide foresight into the appropriateness of interventions, provide answers to unexpected vector control responses, and contribute to effective management solutions in an ever-changing environment. The aim of this paper is to explore the ecological dimension of vector-borne diseases and to provide further clarity about the role of "ecological thinking" in the development and implementation of vector control activities (i.e. ecosystem approaches to vector-borne diseases).
Dengue; Chagas Disease; Communicable Diseases; Ecological Studies; Ecosystem
A tendência alarmante em direção ao ressurgimento de doenças transmitidas por vetores continuará, a menos que ações eficazes sejam tomadas para controlar suas causas primárias. Fatores sociais, mudanças ambientais causadas pelo homem e/ou mudanças ecológicas são, aparentemente, a base do problema. A dimensão ecológica da pesquisa e do gerenciamento dessas doenças é um elemento difuso e constante, já que consiste, essencialmente, em um problema de caráter ecológico com dimensões biofísica, social e econômica. No entanto, há pouca discussão sobre a dimensão ecológica, sobre o campo da ecologia (p.ex.: seu papel e suas limitações) e sobre os conceitos relacionados à abordagem ecossistêmica na saúde. Uma perspectiva ecológica poderá permitir uma análise antecipada da eficácia de intervenções, oferecer respostas para resultados inesperados provenientes de ações para controle de vetores e contribuir para o planejamento de medidas eficazes de gerenciamento em um ambiente em constante mudança. O objetivo deste trabalho é explorar a dimensão ecológica de doenças transmitidas por vetores e esclarecer o papel do "pensamento ecológico" no desenvolvimento e implantação de ações de controle vetorial, ou seja, abordagem ecossistêmica para o controle de doenças transmitidas por vetores.
Dengue; Doença de Chagas; Doenças Transmissíveis; Estudos Ecológicos; Ecossistema
Vector-borne diseases pose a significant public health problem today, with a number of "old" diseases resurging in recent decades alongside newly emerging infectious diseases 1. Some of these were effectively controlled just 50 years ago but these previous hard-won gains are now threatened or have already been lost 2,3. Dengue is perhaps the most striking example. From 1950-1959 less than 1,000 cases were reported worldwide 4. Now an estimated 50-100 million cases occur annually 5. At least 20 other vector-borne diseases have also emerged during this time, having increased in incidence and/or expanding their geographical range 5.
Coinciding with this increase in vector-borne diseases have been dramatic ecological changes. Marked increases in the rate and extent of environmental degradation over the last century, largely attributable to human activity, have fueled growing concern and acceptance of the interdependence of man and the environment 6,7.
The association of anthropogenic environmental change and infectious diseases in particular has recently begun to attract attention and prominence in relation to policy (e.g. Millenium Ecosystem Assessment, 2005). The growing interest in ecosystem approaches to health is a response to an increasing recognition of "the inextricable links between humans and their biophysical, social, and economic environments, and that these links are reflected in a population's state of health" 8 (p. 1).
The alarming trends in vector-borne disease emergence are anticipated to continue unless more effective action is taken to address the variety of underlying causes - of which social factors, anthropogenic environmental modifications and/or ecological changes appear to be the primary drivers 9. The systemic nature of these changes and complexity of interactions among factors make simple, targeted or "silver-bullet" solutions ineffective, except for in the short term. As a result, ecosystem-based approaches are now advocated to provide sustainable solutions, as they previously have been the areas of natural resource management and agricultural pest management 10. However, public health research and policy have yet to incorporate the ecological dimension into management and control strategies to any significant degree. This may in large part be due to the complex and abstract nature of the ecosystem concept as well as the lack of an operationally explicit description of what constitutes "the ecosystem approach". The aim of this paper is to partially address this need by exploring the relevance of ecological science to vector-borne diseases, explaining "ecological thinking" and attempting to describe its role in the development and implementation of vector control activities (i.e. an ecosystem approach to vector-borne diseases).
History of ecology in vector-borne disease research and control
The importance of the ecological context in the management of vector-borne diseases was likely realized immediately following the discovery of arthropods as vectors of disease in 1877. As early as 1935 Klinger 11 (p. 244) pointed to the "need to have a thorough knowledge of breeding places and habits and to apply the most suitable methods to the situation". Since about this time a large body of ecologically relevant knowledge has accumulated for these diseases. Basic ecological science has grown in parallel, but neither area has consistently benefited from the knowledge generated by the other 12.
Akin to the initial focus of ecological science in the late 19th and early to mid 20th centuries, early vector-borne disease research concentrated on explaining the natural history, taxonomy, biology and distribution of organisms (i.e. vectors and pathogens). This quickly resulted in a great deal of ecological knowledge that was immediately applied to develop vector management strategies. This includes a number of notable early successes, such as the first systematic effort to control mosquito vectors in 1901 by William Gorgas, the eradication of a number of important diseases in the United States from 1910-1948 (e.g. yellow fever, dengue and malaria), and the successful eradication of the dengue vector Aedes aegypti and, as a result, dengue throughout much of the Americas from 1950-1970 13,14.
Ecology-based vector control methods received a boost beginning in the 1960s when the use of persistent chemical pesticides like DDT came into question due to their potentially negative environmental health and ecological impacts. The importance of using biological and ecological approaches, including undertaking ecosystem studies, thus began to be advocated 15. In fact, the ecological impacts of DDT and other chemicals became the environmental cause célèbre of this period and arguably helped usher in the modern "environmental awakening" 16. To this day, ecology is often equated solely with research and policy that deals with the natural environment and its protection. That is, with humans as being outside of nature and external stressors. This is contrary to the perspective, discussed further below, that humans and nature are intertwined and interdependent. Nonetheless, these concerns and the extensive environmental protection legislation that emerged led vector ecology research and policy toward more environmentally sound methodologies. These methods went beyond chemical control to include environmental management and biological and social control methods.
Subsequently, another set of environmental challenges to vector control has emerged stemming from the profound ecological changes, particularly (but not limited to) the tropics where most vector-borne diseases originate and by far the largest number of people suffer or are at risk. A phase shift has taken place during the past few decades in which most regional ecosystems in the world have transformed from what largely was natural landscape and non-intensively cultivated cropland to primarily human dominated landscape 17. Rapid and widespread urbanization, agricultural intensification and exploitation of natural resources now make it difficult to draw boundaries between urban and rural as well as rural and natural landscape - thus between what is human and what is nature. Exceptions include the boundaries of national parks or other protected areas, assuming they are aggressively and effectively enforced. Nonetheless, people often flock in great numbers to many of these areas or aggregate outside the boundaries, so that the effects of dramatically increased human densities are not necessarily limited to urban areas. As a result of this shift, marked by the recent discovery that humans now or will soon be responsible for essentially "consuming" over 50% of the earth's net ecological productivity 18, science is increasingly emphasizing an integrated, human-nature model for understanding ecosystems and their dynamics (e.g., Michener et al. 19).
This has resulted in a growing shift in ecological research towards concern with not only the degradation of the natural environment but an acceptance and recognition by a growing number of ecological scientists and researchers who focus on the "human-built" environment of our inseparable role as part of all ecosystems 20. This is evidenced by the new journal Urban Ecosystems (Springer) for example. None of this should be taken to suggest that (predominantly) natural ecosystems, landscapes and natural populations do not remain a significant aspect of ecology research or vector-borne diseases. However, vector ecology and control now face a dramatically different set of challenges as the disease transmission arena today is fundamentally different from what it was just a few decades ago. As is the case for all "complex adaptive systems", ecosystems are continuously evolving as non-equilibrium systems within the environment - in which host-vector-pathogen complexes are inextricably embedded 21,22.
In sum, despite some set-backs, such as the over-reliance on chemical pesticide solutions that is characteristic of the post-WWII era of technological "quick fixes", vector borne disease management has been evolving towards a more integrated, holistic, ecology-based science. This is reflected in the emergence of "integrated control" in the 1960s, followed by "integrated pest management" in the 1970s and "integrated vector control" and "community-based participatory" approaches emerging in the 1980s 12,23. What is by far the most holistic and disciplinarily inclusive approach yet, "the ecosystem approach" began in the 1990s 8. It is noteworthy that in all of these approaches the idea and policy impetus behind them generally has been out in front of the science (the conventional hypothesis-driven experimental evidence) and the capacity of academic and public health institutions to readily grasp and implement them.
The ecology of dengue and Chagas disease
Vector-borne disease transmission cycles typically involve a set of important pathogen(s), arthropod vector(s), vertebrate host(s), and occur within a variety of particular environments (Figure 1). Dengue and Chagas are examples discussed here and occupy different ends of a wide spectrum of vector borne disease ecologies. Thus they provide an illustrative comparison of how the ecosystem approach may be applied to vector borne diseases. The pathogens (a virus versus protozoan) and vectors (mosquitoes and triatomines) could not be more different in their life histories. The hosts of dengue have only been found to include humans and nonhuman primates whereas Chagas disease is capable of infecting over 200 species of mammals 24,25,26. The habitats for these diseases are also quite different. Dengue has primarily been a disease of urban areas, while Chagas predominates in rural settings. Chagas transmission has also occasionally been found on the fringes of peri-urban areas, and the pathogen and vector do occur in some large urban areas, but natural transmission involving humans is rarely documented 27,28. Dengue is also found in peri-urban and rural areas, and apparently is increasingly being transmitted between these and urban areas 4,29.
Vector-borne diseases in general are especially ecologically sensitive since environmental conditions can have dramatic effects on the vectors, pathogens, and potential hosts involved in transmission 10. The diversity of environmental factors and contexts associated with vector-borne disease emergence is illustrated in Table 1 1,6,30. In simple ecological terms, the association between environment and disease epidemiology is a consequence of vectors and non-human reservoir hosts, as is the case for all species, having specific habitat requirements. As habitats change, whether due to natural or human processes involving a range of possible causal mechanisms and factors, so too does disease epidemiology.
How habitat changes and how this affects the biology of a pathogen is varied and complex, within as well as among vector-borne diseases. One way to simplify this complexity using an ecosystem perspective is to view the emergence and/or resurgence of vector-borne disease in terms of regional environmental changes 31,32. An ecosystem considered on a regional scale (i.e., a major river basin, upland area or any geographically distinct area) necessarily includes human built/modified and natural zones and "infrastructure". On this spatial scale (and considering an approximately decadal time scale), changes in land use and resource production (urbanization, agricultural expansion and intensification, and natural habitat alteration) driven by human population and economic expansion are among the most obvious changes associated with vector-borne disease emergence. At least 25 vector-borne diseases have been associated with changes in urbanization, deforestation, and agricultural practices 2,31,32. In Amazonian regions of Brazil alone there have been at least nine emerging arboviruses (including dengue) that have been associated with recent environmental changes 33.
Environmental factors (and their driving variables) and ecological factors are sometimes referenced interchangeably; however, there is a subtle and important difference between the two. "Ecological" refers not only to those factors or processes directly related to interactions of humans/vectors/pathogens with their natural or human-modified environments. It also includes those changes affecting interactions and processes (e.g., pathogen spillover and viral evolution) within and/or between humans, vectors, and pathogens that influence pathogen transmission.
Moreover, as the above case of the Brazilian Amazon illustrates, the changing "environment" includes demographic and social patterns (e.g. migration), public health and basic infrastructure, along with political and economic circumstances. It is this entire system of interactions involving human and natural constituents and processes, causal relations including driving forces, modulating factors, and effects (including disease emergence) that collectively constitute an ecosystem. A spectrum of these elements is presented in Figure 2, from which this ecological perspective and the interconnectedness of these diverse interactions is evident.
Ecology, systems thinking and vector-borne disease management
Unfortunately, there is often a lack of clarity among non-ecologists about what constitutes ecology, its potential role, limitations and concepts pertinent to ecosystem approaches to health and vector-borne disease management. As a scientific discipline ecology is an area of scholarly research that has generated principles, concepts, methods and tools to understand the natural world. Academically, the field of ecology has been largely dominated by research on the natural (i.e. non-human) environment and non-human study systems. However, it has been adapted to human environments and health 34. Yet a serious shortcoming of ecological science has been the lack of models that incorporate the behavior of people, as part of "the system".
Systems ecology, one of many sub-disciplines of ecology, explicitly applies the systems approach to natural as well as human built environments. The systems approach not only draws on a body of theory and methods (though not a discipline per se) but is often described as a "way of thinking". Thus, systems ecology largely involves the use of methods (drawn from outside and within biology) for studying natural or hybrid human-natural systems (e.g., urban or agricultural) that consider the system as a "whole" 35.
Most researchers are quite familiar with the systems approach and its central idea that "the whole is greater than the sum of the parts." However, it is often less clear how to define the system and regrettably there are no simple rules.
Boundaries and interacting components
Fortunately, ecosystems have been found to have general properties and characteristics with which it is helpful to be familiar in order to understand how they and their parts behave dynamically, including host-vector-pathogen complexes. As a start, all systems, conceptually speaking, have boundaries. These may be visible, such as when the edges of an urban area are distinguishable by a sharp change in human infrastructure and density. Or, they may involve a more gradual transition, requiring the boundaries to be decided upon operationally. In either case, imposing boundaries and placing limits on the number of relevant elements considered focuses management resources/activities and provides a preliminary exploration of the potential scales involved (see below). Differentiating between the variables (i.e. health determinants) that are within or outside of the system is particularly useful in separating those which are actionable versus those which may be monitored as potential confounders 36.
A systems perspective is also conceptually critical for considering the interactions among the set of relevant elements influencing the transmission of vector-borne diseases, including those involving management activities. An understanding of these interactions makes possible the effective targeting of management actions. Moreover an understanding of the multiplicity of interactions allows for flexibility in the types of appropriate actions that may be applied. This perspective also promotes an understanding of the dynamic changes that may occur within a system as a result of ecological changes and/or vector management activities.
The concept of scale is typically applied in reference to physical dimensions of space and time but broadly definable as "the spatial, temporal, quantitative, or analytical dimensions used to measure and study any phenomena" 37 (p. 11). In research and management activities, more frequent reference is made to levels: the points of observations (i.e. measurements) performed at a particular scale.
Geographical and temporal scales are intimately tied to an accurate understanding of the distribution of vectors, incidence of disease, and scope of management activities. Social and policy relevant scales also need to be considered because of the importance of human dimensions and the applied nature of these activities. Vector management and inter-sectoral activities often utilize jurisdictional scales that include local, municipal, state/provincial, national, and multilateral levels 37. In addition, many community-based programs employ social scales and research at individual, family/household, and neighborhood/community levels. However, in ecology the most common scale is based on ecological organization and related research is performed at discrete levels including ecosystem, landscape, community, population and genetic levels. These levels are less explicitly addressed in ecosystem approaches to human health and may or may not correlate with geographical, social, and policy relevant scales.
The wide variety of levels and scales embedded in the ecological problem of vector-borne diseases certainly poses a challenge for both research and management activities. The central challenge lies in understanding the appropriate scales in which disease transmission, environmental influences, and/or anthropogenic changes may be best understood and most efficiently mitigated. Oftentimes management activities may be more appropriate or have greater impact at specific scales. Scaling up vector control programs, without regard to ecological differences between areas, can be just as ineffective as top-down programs with the opposite demands. Furthermore many environmental drivers and causal factors may function at different levels or scales, and act independently of and/or in concert with the system. For example, the impact of independent actions at local levels may result in broader city-wide, regional, or global trends. Conversely, global factors such as climate change may act broadly and/or have varying impacts at local levels 38,39.
Ecosystems can be analyzed according to the organization of system elements and interactions, relative to defined scales, and this has proven useful in understanding natural ecosystems and the idea of nested hierarchies 36,40,41. This type of organization occurs as a result of asymmetric system interactions between levels and provides a structured approach for exploring the significance of these interactions and their dynamics. Many interactions, patterns, and processes will tend to aggregate at certain levels. At the heart of hierarchy theory is that those elements present at higher levels typically impose constraints on lower levels; conversely, the combined elements at lower levels dictate what is physically possible at upper levels. Upper-level elements often occur over a larger spatial area and temporal range. Those at lower levels tend to operate over smaller areas and shorter periods of time 40.
These ideas have a variety of conceptually liberal implications to vector-borne disease management, irrespective of the dimension in which it is approached (i.e. biophysical, social, economic). As an example, some vector management activities (e.g. community-based strategies, improved housing) at local levels may be constrained by upper level phenomena (e.g. economic commitment, climate change). In addition, potentially broadly effective upper level interactions and processes (e.g. inter-sectoral coordination) may be negated by lower level phenomena (e.g. insecticide resistance, behavioral changes, individual commitment). Furthermore, some phenomena (e.g. climate change, city-wide vector eradication) may be of great significance but operate at spatial and temporal scales that require sustained commitment by funding sources with limited patience. In complex ecosystems this theory may demand a fairly comprehensive understanding to provide reasonable direction. Fortunately, in vector-borne disease transmission and management activities a great deal is already known about specific situations and the number of significant elements/interactions/processes that are actionable may be quite limited and worth exploring.
The linkage of ecosystem characteristics and vector population density
The objective of vector control initiatives (e.g. integrated, biological, community-based, health promotion and ecosystem based approaches) is to reduce vector populations to low enough levels to interrupt transmission. It makes sense to ultimately direct ecosystem management efforts towards the ecological regulation of vector populations whether it be from biophysical, social or economic perspectives 42. Thus understanding the connection between ecosystem properties and vector population dynamics (i.e., what regulates their size and distribution) is fundamental.
Ecologists distinguish two modes of regulation in animal populations: density-independent and density-dependent regulation. In the former, factors (e.g. temperature, humidity, and rainfall and other abiotic factors) affect population size and operate independently of how many individuals there are in a population. In the case of the latter the regulating factors involved (e.g. competition, predation, parasitism and other biotic factors) tend to increase in their effect with population density. The observation that vector populations can rebound to levels higher than those prior to intervention, because the mode of intervention had ecosystem level impacts such as eliminating biotic factors that naturally control the vector population, suggests density-dependent regulation is operating in those cases 42.
In human modified environments there may be a diminished capacity of the ecosystem to regulate vector abundance naturally; however, density-dependent regulation of Chagas and dengue vectors is believed to occur. Laboratory studies have suggested that the feeding behavior of domestic Chagas vectors at lower densities may result in more efficient Chagas transmission. While this finding may not readily occur it raises an interesting point because reductions in adult vector abundances may not always be reflected in a proportional decrease in disease. Density-dependent regulation is also at least partly evident in Ae. aegypti populations based upon their feeding success 42. The implication is that vector management strategies aimed at stages other than the adult (e.g. larval breeding source reduction) may be more effective, and others have noted that there are at least "theoretical reasons that suggest that killing the adults is not the most efficient way of reducing vector populations and minimizing dengue epidemics" 43 (p. 97).
Density-independent factors such as seasonality and climate variability are especially significant in regulating vector populations 42. Seasonal rainfall regulates the types and number of sites for container breeding mosquitoes, and recruitment rates are tied to seasonality because Ae. aegypti eggs can survive between rainfall seasons. A density-independent factor such as temperature can affect dengue transmission rates by altering the extrinsic incubation period in mosquitoes 44.
Seasonality is also observed in Chagas vector populations and transmission. In combination with density-dependent regulation, these characteristics have led to the belief that insecticide control of these vectors could be improved if seasonally timed 42,45. Unfortunately, many of these factors are often not directly actionable with the exception of the timing of management activities and finding creative solutions to mitigate their impact.
The importance of density-dependent and density-independent factors is also evident in the spatial distribution of vector populations. The relationship between abundance and distribution are often inseparable because the dispersal of vectors frequently depends upon the local density 46. In a study from rural Argentina, the authors found that the number of Triatoma vectors that spatially dispersed were proportional to the abundance of vectors and that "high-density sites were apparently producing more dispersers" 47 (p. 8). Sylvan Chagas vectors also likely disperse further when their primary hosts are reduced or the density of vectors to these hosts is proportionally high, and these populations pose a significant challenge since they are difficult to control and provide a source for transient or permanent infestation of peri-domestic habitats 47,48. It seems intuitive that greater abundances of Ae. aegypti vectors may also follow similar trends in the relationship between abundance and dispersal. However, it is also likely that in drier seasons (or areas) that Ae. aegypti may disperse further in search of suitable oviposition sites, at which time populations may not be at their greatest 49.
The persistence of a vector species within a particular ecosystem or landscape is often understood as a balance between the extinction and recolonization of populations between heterogeneous patches of habitat 50. This is physically apparent in the mosaic appearance of a landscape, the common exception being agricultural monocrops, and reflects the discontinuous distribution of habitat, including that of vector species. A vector's capacity to disperse between patches may result in spatiotemporal "hot spots" of vector abundance and be predicated by physical barriers, distance, vector behavior, and/or other population regulatory factors. Otherwise a suitable habitat may not always be occupied, or may be at low numbers, but it nonetheless can be an important site as a "stepping stone." These characteristics are important because the abundance and dispersal of vectors may quickly negate control efforts. Thus basing intervention strategies on an understanding of these "patch-dynamics" including intra-patch dispersal is key to the long-term success of vector control operations. In some areas this is already understood well enough to suggest the spatial extent that control efforts need to cover 51.
Discontinuous vector populations and the efficiency of population dispersal can result in genetically differentiated populations within the same ecosystem. A high degree of genetic variability and selective pressure on these populations can result in the possible emergence, spread, and persistence of insecticide resistant genes or vector behavioral changes that facilitate transmission. Dengue vector populations display a great deal of heterogeneity in their population dynamics, especially during drier seasons. Further demonstrating their spatially fragmented structure, they can exhibit a high degree of genetic variability even in urban areas 52. The spread and possible persistence of insecticide resistant genes are a function of metapopulation spatial structures and temporal dynamics in these populations. Domestic vectors of Chagas differ in these regards by exhibiting low genetic variability and comparatively low dispersal rates. These characteristics and their susceptibility to insecticides at all life stages (except eggs) likely contribute to the effectiveness of insecticide against domestic Chagas vectors. Sylvan populations of Chagas vectors pose a more significant challenge because they are difficult to control with insecticides 47.
We have only touched on how the problems and principles linked to population regulation in ecology bear on vector borne disease. However, it should be clear from the broad perspective offered by ecosystem thinking that the patterns and processes associated with vector populations are dynamic, and the outcome of a combination of factors reflect the population biology of the species, as well as the size, spatial distribution, and heterogeneity of habitat patches. The landscape structure, community composition and diversity (not only epidemiologically important vectors, hosts, and pathogens) - that is, the collective affect of biodiversity - characterize the ecosystem and its spatiotemporal dynamics, resilience, and resistance to invasion, stressors, and vector management related activities 53.
The need for a more integrated, transdisciplinary, systems-based approach to understanding and controlling disease transmission has become increasingly obvious due to the wide range of social and biophysical factors involved. The integrative ecological paradigm gaining increased acceptance in science that views humans and nature as part of a single "complex adaptive system" provides a hopeful basis for better understanding, developing, and implementing sustainable disease control strategies 41,54. The impetus for adopting a similar approach in regard to vector-borne disease problems currently exists and has been accompanied by increasing calls for a better understanding of the ecology of these diseases 7,10,55.
Holistic frameworks for understanding health and disease have been proposed and are evidenced in recent discussions and funding opportunities including those termed EcoHealth, (eco)nomic-(bio)physical-(soc)ial, ecosystem, socio-ecological, and others 8,56,57,58,59,60,61. The ecological dimension can also be viewed similarly: as a system of interactions within and between hosts, vectors, pathogens, and the environments associated with disease transmission. From this perspective even human-human interactions and behavior associated with disease transmission, although not traditionally the topic of ecological research, can be viewed as ecological in nature. Regardless of the specific framework or interpretation, the ecological dimension remains a pervasive element because vector-borne diseases are essentially ecological problems that span biophysical, social, and economic environments.
Ecosystem concepts and methodologies have long been utilized in understanding the complex interactions associated with natural ecosystems; however, as these environments have become increasingly dominated by humans, a growing need to understand the human dimension of these systems has arisen. This need is also mirrored among vector-borne disease problems as these diseases have continued to emerge from natural ecosystems and become entrenched in human-dominated environments 5. The integration of knowledge from other disciplines (e.g. sociology, anthropology, economics) with the capacity to address the human dimension are greatly needed in order to better understand coupled human-natural systems, particularly in urban environments 62,63,64,65,66. The basic concepts presented in this review (e.g. scale, heterogeneity, boundaries, organization, etc.) were chosen because they are central ecological themes that are pervasive in natural, human, disease, and/or integrated systems.
More commonly, the ecological dimension is associated with traditional topics of ecological research that are applicable to vector-borne disease research and management needs. A variety of current needs were highlighted in a recent Institute of Medicine report which cited: an improved understanding of anthropogenic change and the emergence of disease; more accurate risk assessments that merge ecological and epidemiological information; responses to insecticide resistance; and novel methods to manage vector-borne diseases 55. These needs are wide-ranging, both in topic and scale, and many are important in developing more accurate system based understandings of vector-borne disease transmission. These needs also span the continuum of ecology sub-disciplines and levels of ecological organization (besides the ecosystem/system level) including landscape, community, population, and genetic levels.
In the last decades, significant advances have been made in integrating concepts and tools from the field of ecology, particularly in regard to landscape ecology, remote sensing, spatial analyses and vector-borne diseases 67,68,69. Central to landscape ecology is the study of spatial heterogeneity and studies of vector-borne diseases from this perspective have included the spatial distribution of vectors across or within landscapes (particularly urban areas), spatial and temporal analyses that reveal relevant scales for surveillance and improved understanding of transmission dynamics, predictive models of disease and vector distributions, and the potential impact of environmental and anthropogenic change 69,70,71,72,73,74,75. The use of landscape ecology concepts and spatial analysis tools are increasingly being integrated with vector-borne disease epidemiological efforts, which have been reviewed elsewhere and include: malaria, Lyme disease, Tsetse-borne trypanosomiasis, arboviral diseases, leishmaniasis, Chagas, and others 68. As a result, more accurate risk assessments (at least at course levels) have been achieved for some diseases, especially for those with vectors and/or vertebrate hosts in which their distribution can be associated with specific geographical characteristics and features (e.g. climate, vegetation, urbanization, socio-economic demographics) 68,73.
Vector-borne disease research efforts have also benefited from greater interdisciplinary collaboration between the fields of epidemiology and community ecology, which is concerned primarily with the study of assemblages of organisms and their interactions with each other and the environment. Others have noted the importance of these types of endeavors stating: ecological community structure is a key factor in understanding the public health risk of communicable disease emergence, mode of transmission, and control options 57,76. The models and analyses associated with these efforts are important in understanding the impact of change, biodiversity loss, and impact of invasive species. These efforts show promise in the development of predictive models and understanding responses to change for vector-borne diseases such as lyme disease and others, especially for zoonotic and multiple host/vector systems 76,77. However, these types of analyses also require obtaining a wealth of data that may not be practical for many applied purposes.
At the population level of ecological research, efforts are typically focused on understanding the dynamics of a particular species and their interactions with the environment. This is an important area for vector-borne disease research because there is a need to advance an understanding of the factors regulating vector populations and accurate vector abundances, which can be used in predicting risk. For diseases such as dengue improved methods in estimating vector densities have been a priority, especially efficient methods that can be used in surveillance over large areas, identification of at risk populations, and targeting control strategies 78,79,80,81. These topics are beyond the current discussion but provide an additional example of the need for further integration of ecological and epidemiological related research.
A common thread in the integration of ecological studies and vector-borne disease research and management has been the use of geographical information systems (GIS), relational databases, predictive modeling, and spatial analyses. These types of tools are extremely valuable in exploring the dynamic interactions between humans, vectors, pathogens, and changing physical, social, and economic environments. The use of these enabling technologies and integrative methodologies are important in providing additional capacity to address many of the ecological challenges reviewed here and have significant potential in facilitating the integration of data from different fields.
Pragmatic approaches that can be used in efficiently acquiring, monitoring, and synthesizing information regarding system interactions associated with vector-borne disease transmission risk, which can then be used to guide and adapt effective management activities, has remained largely elusive to date but ecosystem approaches to these problems are certainly progressing towards this goal. Fortunately, there is a wealth of information that has and is being obtained that can be used in these efforts and applied to local contexts. The use of the integrative tools discussed here, interdisciplinary knowledge, and the dynamics at various ecological levels of organization are important in assessing current strategies and the appropriate scales for surveillance and control.
We argue that the ecological dimension is a unifying element of vector-borne diseases that is capable of providing research direction and a holistic perspective important for all participants/stakeholders involved. Unfortunately, the ecological dimension often appears initially forbiddingly complex, requiring a thorough understanding including all relevant linkages, regardless of discipline, in which the methodologies for defining and assessing a system of interest may remain unclear. However, it is important to differentiate between gaps in ecological understanding that may be filled by basic research and the needs of applied public health and management activities.
For applied vector-borne disease management activities and specific environments, populations, and locations there may often only be a limited number of significant factors regulating disease transmission, and appropriate and/or actionable responses. A progressive step forward for these types of applied activities is the collection of spatially and temporally explicit data that are more easily incorporated into system based analyses and decision making support systems. Ultimately, the true strength of these types of approaches will likely not to be in an extremely detailed understanding of ecosystem complexity but will be derived from a diversity of perspectives and flexibility in finding creative and pragmatic solutions.
The development of this manuscript was an integrative effort of ideas, backgrounds, and expertise. B. A. Wilcox contributed his knowledge of disease ecology and the history of ecological theory and concepts, and their application. B. R. Ellis has a background in vector-borne infectious diseases and was responsible for drafting the document with the support of B. A. Wilcox who provided editing and revisions.
1. Smolinski MS, Hamburg MA, Lederberg J. Microbial threats to health: emergence, detection, and response. Washington DC: National Academies Press; 2003.
2. Gubler DJ. The global emergence/resurgence of arboviral diseases as public health problems. Arch Med Res 2002; 33:330-42.
3. Gubler DJ. The emergence of epidemic dengue fever and dengue hemorrhagic fever in the Americas: a case of failed public health policy. Rev Panam Salud Pública 2005; 17:221-4.
4. Guha-Sapir D, Schimmer B. Dengue fever: new paradigms for a changing epidemiology. Emerg Themes Epidemiol 2005; 2:1.
5. Gubler DJ. Resurgent vector-borne diseases as a global health problem. Emerg Infect Dis 1998; 4:442-450.
6. Hassan RM, Scholes R, Ash N. Ecosystems and human well-being: current state and trends: findings of the Condition and Trends Working Group of the Millennium Ecosystem Assessment. Washington DC: Island Press; 2005.
7. World Health Organization. Ecosystems and human well-being: health synthesis. Geneva: World Health Organization; 2005
8. Lebel J. Health: an ecosystem approach. Ottawa: International Development Research Centre; 2003.
9. Jones KE, Patel NG, Levy MA, Storeygard A, Balk D, Gittleman JL, et al. Global trends in emerging infectious diseases. Nature 2008; 451:990-3.
10. Campbell-Lendrum D, Molyneux D. Ecosystems and vector-borne disease control. In: Epstein P, Githeko A, Rabinovich J, Weinstein P, editors. Ecosystems and human well-being: policy responses. v. 2. Washington DC: Island Press; 2005. p. 353-72.
11. Klinger IJ. The epidemiology and control of malaria in Palestine. Chicago: University of Chicago Press; 1930.
12. Fontaine RE. Integrated vector control and selection measures suitable for specific epidemiological conditions. Geneva: World Health Organization; 1987.
13. The feasibility of eradicating Aedes aegypti in the Americas. Rev Panam Salud Pública 1997; 1:68-72.
14. Schliessmann DJ, Calheiros LB. A review of the status of yellow fever and Aedes aegypti eradication programs in the Americas. Mosq News 1974; 34:1-9.
15. Laird M. Vector ecology and integrated control procedures. Bull World Health Organ 1963; 29:147-51.
16. Carson R. Silent spring. New York: Fawcett Crest; 1964.
17. Turner BL, Clark WC, Kates RW, Richards JF, Mathews JT, Meyer WB. The earth as transformed by human action: global and regional changes in the biosphere over the last 300 years. Cambridge: Cambridge University Press; 1993.
18. Vitousek PM, Mooney HA, Lubchenco J, Melillo JM. Human domination of Earth's ecosystems. Science 1997; 277:494-9.
19. Michener WK, Baerwald TJ, Firth P, Palmer MA, Rosenberger JL, Sandim EA, et al. Defining and unraveling biocomplexity. Bioscience 2001; 51:1018-23.
20. McDonnell MJ. A paradigm shift. Urban Ecosystems 1997; 1:85-6.
21. Horwitz P, Wilcox BA. Parasites, ecosystems and sustainability: an ecological and complex systems perspective. Int J Parasitol 2005; 35:725-32.
22. O'Neill RV, DeAngelis DL, Waide JB, Allen TFH. A hierarchical concept of ecosystems. Princeton: Princeton University Press; 1986.
23. Kogan M. Integrated pest management: historical perspectives and contemporary developments. Annu Rev Entomol 1998; 43:243-70.
24. Barretto MP. Epidemiologia. In: Brener Z, Andrade Z, editors. Trypanosoma cruzi e doença de Chagas. Rio de Janeiro: Editora Guanabara Koogan; 1979. p. 89-151.
25. Gubler DJ. Perspectives on the prevention and control of dengue hemorrhagic fever. Gaoxiong Yi Xue Ke Xue Za Zhi 1994; 10 Suppl:S15-8.
26. Herrera L, Urdaneta-Morales S. Synanthropic rodent reservoirs of Trypanosoma (Schizotrypanum) cruzi in the valley of Caracas, Venezuela. Rev Inst Med Trop São Paulo 1997; 39:279-82.
27. Vallvé SL, Rojo H, Wisnivesky-Colli C. Urban ecology of Triatoma infestans in San Juan, Argentina. Mem Inst Oswaldo Cruz 1996; 91:405-8.
28. Zeledon R, Rabinovich JE. Chagas' disease: an ecological appraisal with special emphasis on its insect vectors. Annu Rev Entomol 1981; 26:101-33.
29. Chareonsook O, Foy HM, Teeraratkul A, Silarug N. Changing epidemiology of dengue hemorrhagic fever in Thailand. Epidemiol Infect 1999; 122:161-6.
30. Morse SS. Factors in the emergence of infectious diseases. Emerg Infect Dis 1995; 1:7-15.
31. Wilcox BA, Colwell RR. Emerging and reemerging infectious diseases: biocomplexity as an interdisciplinary paradigm. EcoHealth 2005; 2:244-57.
32. Wilcox BA, Gubler DJ. Disease ecology and the global emergence of zoonotic pathogens. Environ Health Prev Med 2005; 10:263-72.
33. Vasconcelos PF, Travassos-da-Rosa AP, Rodrigues SG, Travassos-da-Rosa ES, Degallier N, Travassos-da-Rosa JF. Inadequate management of natural ecosystem in the Brazilian Amazon region results in the emergence and reemergence of arboviruses. Cad Saúde Pública 2001; 17 Suppl:155-64.
34. Lawrence RJ. Urban health: an ecological perspective. Rev Environ Health 1999; 14:1-10.
35. Golley FB. A history of the ecosystem concept in ecology: more than the sum of the parts. New Haven: Yale University Press; 1993.
36. Dale MB. Systems analysis and ecology. Ecology 1970; 51:2-16.
37. Cash DW, Adger WN, Berkes F, Garden P, Lebel L, Olsson P, et al. Scale and cross-scale dynamics: governance and information in a multilevel world. Ecol Soc 2006; 11:8. http://www.ecologyandsociety.org/vol11/iss2/art8/.
38. Patz JA, Epstein PR, Burke TA, Balbus JM. Global climate change and emerging infectious diseases. JAMA. 1996; 275:217-23.
39. Sutherst RW. Global change and human vulnerability to vector-borne diseases. Clin Microbiol Rev 2004; 17:136-73.
40. Folke C, Pritchard L, Berkes F, Colding J, Svedin U. Scaling issues in the social sciences. Bonn: International Human Dimensions Programme on Global Environmental Change; 1998. (IDHP Working Paper, 1).
41. Levin SA. Self-organization and the emergence of complexity in ecological systems. Bioscience 2005; 55:1075-9.
42. Schofield CJ. Vector population responses to control interventions. Ann Soc Belg Med Trop 1991; 71 Suppl 1:201-17.
43. Service MW. Vector control. Where are we now? Bull Soc Vector Ecol 1992; 17:94-108.
44. Jetten TH, Focks DA. Potential changes in the distribution of dengue transmission under climate warming. Am J Trop Med Hyg 1997; 57:285-97.
45. Gorla DE. Seasonal effects on control strategies of Chagas' disease vectors. Rev Argent Microbiol 1988; 20:71-80.
46. Diffendorfer JE. Testing models of source-sink dynamics and balanced dispersal. Oikos 1998; 81:417-33.
47. Dohna HZ, Cecere MC, Gurtler RE, Kitron U, Cohen JE. Re-establishment of local populations of vectors of Chagas disease after insecticide spraying. J Appl Ecol 2007; 44:220-7.
48. Teixeira AR, Monteiro PS, Rebelo JM, Argañaraz ER, Vieira D, Lauria-Pires L, et al. Emerging Chagas disease: trophic network and cycle of transmission of Trypanosoma cruzi from palm trees in the Amazon. Emerg Infect Dis 2001; 7:100-12.
49. Reiter P. Oviposition, dispersal, and survival in Aedes aegypti: implications for the efficacy of control strategies. Vector Borne Zoonotic Dis 2007; 7:261-73.
50. Farina A. Principles and methods in landscape ecology: toward a science of landscape. Dordrecht: Springer; 2006.
51. Cecere MC, Vasquez-Prokopec GM, Gurtler RE, Kitron U. Reinfestation sources for Chagas disease vector, Triatoma infestans, Argentina. Emerg Infect Dis 2006; 12:1096-102.
52. Ocampo CB, Wesson DM. Population dynamics of Aedes aegypti from a dengue hyperendemic urban setting in Colombia. Am J Trop Med Hyg 2004; 71:506-13.
53. Keesing F, Holt RD, Ostfeld RS. Effects of species diversity on disease risk. Ecol Lett 2006; 9:485-98.
54. Levin SA. Fragile dominion: complexity and the commons. Cambridge: Perseus Books; 1999.
55. Lemon SM, Sparling PF, Hamburg MA, Relman DA, Choffness ER, Mack A. Vector-borne diseases: understanding the environmental, human health, and ecological connections. Washington DC: National Academies Press; 2008.
56. Capistrano D. Ecosystems and human well-being: multi-scale assessments: findings of the Sub-global Assessments Working Group of the Millennium Ecosystem Assessment. Washington DC: Island Press; 2005.
57. Forget G, Lebel J. An ecosystem approach to human health. Int J Occup Environ Health 2001; 7 (2 Suppl):S3-38.
58. Nielsen NO. Ecosystem approaches to human health. Cad Saúde Pública 2001; 17 Suppl:69-75.
59. Ostrom E. Panarchy: understanding transformations in human and natural systems. Ecol Econ 2004; 49:488-91.
60. Spiegel J, Bennett S, Hattersley L, Hayden MH, Kittayapong P, Nalim S, et al. Barriers and bridges to prevention and control of dengue: the need for a social-ecological approach. EcoHealth 2005; 2:273-90.
61. Waltner-Toews D. An ecosystem approach to health and its applications to tropical and emerging diseases. Cad Saúde Pública 2001; 17 Suppl:7-36.
62. Kendall C, Hudelson P, Leontsini E, Winch PL. Urbanization, dengue and the health transition: anthropological contribution to international health. Med Anthropol Q 1991; 53:257-68.
63. Knudsen AB, Slooff R. Vector-borne disease problems in rapid urbanization: new approaches to vector control. Bull World Health Organ 1992; 70:1-6.
64. Niemelä J. Is there a need for a theory of urban ecology? Urban Ecosystems 1999; 3:57-65.
65. Pickett STA, Burch WR, Dalton SE, Foresman TW, JM. A conceptual framework for the study of human ecosystems in urban areas. Urban Ecosystems 1997; 1:185-99.
66. Tauil PL. Urbanização e ecologia do dengue. Cad Saúde Pública 2001; 17 Suppl:99-102.
67. Kalluri S, Gilruth P, Rogers D, Szczur M. Surveillance of arthropod vector-borne infectious diseases using remote sensing techniques: a review. PLoS Pathog 2007; 3:1361-71.
68. Kitron U. Landscape ecology and epidemiology of vector-borne diseases: tools for spatial analysis. J Med Entomol 1998; 35:435-45.
69. Malone JB, Nieto P, Tadesse A. Biology-based mapping of vector-borne parasites by geographic information systems and remote sensing. Parassitologia 2006; 48:77-9.
70. Cox J, Grillet ME, Ramos OM, Amador M, Barrera R. Habitat segregation of dengue vectors along an urban environmental gradient. Am J Trop Med Hyg 2007; 76:820-6.
71. Cummings DA, Irizarry RA, Huang NE, Endy TP, Nisalak A, Ungchusak K, et al. Travelling waves in the occurrence of dengue haemorrhagic fever in Thailand. Nature 2004; 427:344-7.
72. Morrison AC, Getis A, Santiago M, Rigau-Perez JG, Reiter P. Exploratory space-time analysis of reported dengue cases during an outbreak in Florida, Puerto Rico, 1991-1992. Am J Trop Med Hyg 1998; 58:287-98.
73. Olson JG, Reeves WC, Emmons RW, Milby MM. Correlation of Culex tarsalis population indices with the incidence of St. Louis encephalitis and western equine encephalomyelitis in California. Am J Trop Med Hyg 1979; 28:335-43.
74. Richards SL, Apperson CS, Ghosh SK, Cheshire HM, Zeichner BC. Spatial analysis of Aedes albopictus (Diptera: Culicidae) oviposition in suburban neighborhoods of a Piedmont community in North Carolina. J Med Entomol 2006; 43:976-89.
75. Siqueira JB, Martelli CM, Maciel IJ, Oliveira RM, Ribeiro MG, Amorim FP, et al. Household survey of dengue infection in central Brazil: spatial point pattern analysis and risk factors assessment. Am J Trop Med Hyg 2004; 71:646-51.
76. Zavaleta JO, Rossignol PA. Community-level analysis of risk of vector-borne disease. Trans R Soc Trop Med Hyg 2004; 98:610-8.
77. Koopman JS, Longini IMJ. The ecological effects of individual exposures and nonlinear disease dynamics in populations. Am J Public Health 1994; 84:836-42.
78. Alexander N, Lenhart AE, Romero-Vivas CM, Barbazan P, Morrison AC, Barrera R, et al. Sample sizes for identifying the key types of container occupied by dengue-vector pupae: the use of entropy in analyses of compositional data. Ann Trop Med Parasitol 2006; 100 Suppl 1:S5-16.
79. Focks DA. A review of entomological sampling methods and indicators for dengue vectors. Geneva: Special Programme for Research and Training in Tropical Diseases, World Health Organization; 2003.
80. Morrison AC, Astete H, Chapilliquen F, Ramirez-Prada C, Diaz G, Getis A, et al. Evaluation of a sampling methodology for rapid assessment of Aedes aegypti infestation levels in Iquitos, Peru. J Med Entomol 2004; 41:502-10.
81. Nathan MB, Focks DA, Kroeger A. Pupal/demographic surveys to inform dengue-vector control. Ann Trop Med Parasitol 2006; 100 Suppl 1:S1-3.
B. R. Ellis
Departamento de Entomologia
Centro de Pesquisas Aggeu Magalhães
Fundação Oswaldo Cruz
Av. Moraes Rêgo s/n, Cidade Universitária
Recife, PE 50670-420, Brasil
Submitted on 28/Mar/2008
Final version resubmitted on 13/Oct/2008
Approved on 18/Nov/2008 | <urn:uuid:c1ba733f-3950-4b39-9dbf-6fe1a25a2b1f> | CC-MAIN-2022-33 | https://www.scielosp.org/article/csp/2009.v25suppl1/S155-S167/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.902231 | 11,651 | 1.890625 | 2 |
Consumer credit is any type of loan given by some lending institution, usually a bank, to individuals for the purchase of consumer goods. Many people in Burlington, Wisconsin deal with consumer credit every day in the form of credit cards. In fact, credit cards are one of the largest sources of individual debt in the U.S.
Why can't I Get Credit in Burlington, Wisconsin?
The most likely explanation as to why a Burlington, Wisconsin bank won't give you a credit card or loan is that you have bad credit. In Burlington, Wisconsin, credit scores are created by private corporations called "credit bureaus." These companies gather all the available financial information on a person (such as the amount of credit currently available to them, and its ratio to their debt) and use it to calculate a simple numerical score. This number gives would-be lenders an easy way to assess a person's risk as a borrower. It is not known to many people exactly how your credit score is calculated, because the formulas used by these companies are closely-guarded trade secrets.
Under U.S. law, you are legally entitled to one free credit report per year. This allows you to perform a simple financial check-up, to see what's hurting your credit, and to report any false information contained in your report. There are many websites that provide easy access to this information, but most of them require registration with a credit card. Once you view your free report, they will begin charging you a monthly fee unless you opt out. Some of them make this hard by requiring that you cancel your membership by phone, rather than letting you do it online.
How Can I Improve My Credit Score in Burlington, Wisconsin?
The first thing you can do to improve your credit score is to check your report for errors. These companies are not infallible, and sometimes make mistakes in compiling your credit report, including very serious ones. If you find an error, you should report it to the credit bureau, and they will normally fix it. It also helps to show that you are willing to use credit, but can do so responsibly. For example, if you have little to no credit history in Burlington you might consider getting a credit card, making a few small purchases each month on it, and then paying off the balance in full at the end of each month. This takes a bit of discipline, but it is a good way to quickly establish a good credit rating.
Credit reports are usually meant to be used by lenders to assess the risk of a prospective borrower. For this reason, how one handles debt is a major factor in one's credit score. Paying all of your debts in a timely manner is a good way to maintain a high credit score.
How Can a Burlington, Wisconsin Lawyer Help?
A good Lawyer in Burlington, Wisconsin can be extremely useful in helping you resolve any consumer credit issue, such as bankruptcy, or getting errors removed from your report if the credit bureau is being difficult. | <urn:uuid:65503a30-3781-4860-ac4e-5a43473c20e3> | CC-MAIN-2022-33 | https://bankruptcyattorneys.legalmatch.com/WI/Burlington/consumer-credit-lawyers.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.964208 | 607 | 1.835938 | 2 |
To ditch or not to ditch, THAT is the question. Have you ever wondered what you would do if you were driving down the road and spotted a tornado heading your way? Our nature might direct us towards the nearest underpass and hide there until it is over. Surely an underpass is strong enough to shield vehicles seeking shelter, right? Wrong! You will want to seek shelter inside any nearby sturdy building. If that is not an option, find a ditch, but try to get as far away from your vehicle as possible so the winds do not roll or toss it on top of you. Be sure to cover your head. Ideally, having a helmet of any kind would be great, but that is not always an option. So, do your best to keep your head down and covered to avoid head injuries and trauma.
If you happen to be at home or in some type of building or shelter, avoid windows, and move into the centermost parts like a hallway or a bathroom. Typically, the further in you can go, the more walls that a tornado must tear down to get to you. Never stay in a mobile home during a tornado. Always make sure you have a shelter or sturdy building to ride out the storm. Unless you live in a mobile home and must seek shelter elsewhere, never leave your home to try to outrun a tornado. Tornadoes are unpredictable and can change their path quickly.
It is always best to have a family safety plan in place in the event of tornadoes or other natural or manmade disasters. And while very few people can go through a tornadic event unscathed, being prepared can make all the difference between lives saved and lives lost. Know where to go, and where not to go—what to do, and what not to do, and put your own family safety plan together today! | <urn:uuid:4c81a025-1261-46d6-ab49-d6351daa6a0e> | CC-MAIN-2022-33 | https://survive-a-storm.com/2017/03/take-shelter-tornadoes-not/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.967403 | 371 | 2.15625 | 2 |
The red-wine chemical resveratrol has the potential to fight diabetes, cancer, heart disease and dementia, according to a flurry of studies in the past decade. And a more tantalizing theory for some medical researchers suggests that the chemical, found in grape skins and other plants, could extend lifespan. But a new study casts serious doubt on the original research that suggested that theory. Resveratrol is no fountain of youth, the authors argue.
Resveratrol activates sirtuins, a group of proteins that regulate cell metabolism. That fact has been a cornerstone of recent medical research into longevity because of a 2001 study that showed that sirtuins extend lifespan on a cellular level. But an international team of gerontology researchers, lead by the Institute of Healthy Aging and the genetics department of University College London, was unable to replicate the results of that study.
The belief that resveratrol kicks sirtuins into gear and extends lifespan, originally observed in worms in 2001, was the foundation of multiple longevity studies. Just two years after the initial research, another study theorized that sirtuins increased the endurance of lab mice and attributed that to resveratrol's contributions to cellular energy levels.
These results spurred multimillion dollar investments in resveratrol, in hopes of creating a pharmacological fountain of youth. In 2008, pharmaceutical giant GlaxoSmithKline paid $720 million to buy Sirtris, a biotechnology company that was developing drugs to stimulate sirtuins. Recently though, doubts have emerged on whether or not resveratrol can directly increase lifespan, as originally observed in lesser species. And it may be, as the current study suggests, that sirtuins have no impact on aging in the first place.
In the recent study, published in Nature, worms were genetically manipulated so that their sirtuin gene was overactive. As expected, these worms lived longer than the control worms. However, the team concluded that the longer lifespan was due to an unrelated mutation at a second location in the genome. When that second mutation was bred out, they found no evidence that sirtuins boosted lifespan.
"We found that sirtuins don't actually increase lifespan in the animals that we looked at, the nematode worms and fruit flies," said co-author David Gems, a geneticist at the university. "This suggests that even a drug that did activate sirtuins would not slow aging."
Leonard Guarente, the sirtuins researcher at the Massachusetts Institute of Technology who published the original 2001 study, disputed the new findings. He argued that while a mutation is responsible for some of the anti-aging seen in the worms, sirtuins also have an impact.
So far, no one is suggesting that the resveratrol doesn't still work with anticancer and anti-inflammatory properties. The potential reduction of chronic disease risks associated with red-wine consumption may still help humans live longer through the prevention of ailments. Gems said that he believed his research will allow scientists to focus on sirtuins' (and resveratrol's) real health benefits, rather than on suspect anti-aging properties.
"The new paper is not a witch hunt," said Johan Auwerx, co-author of the 2006 report on mouse endurance and currently a professor of energy metabolism at the Laboratory of Integrative and Systems Physiology in Lausanne, Switzerland. "Most likely, sirtuins are not extending lifespan but it is a health-span gene, which is a rather discrete difference. It protects us against various stresses inflicted by our unhealthy lifespan. Whether it is a lifespan gene does not really matter for humans, because what counts is that it improves health."
"From what I have read over the years, my impression is that moderate consumption of alcohol in various forms can have health benefits," said Gems. "The idea that wine has some bioactive things in it apart from alcohol that are beneficial to health is an interesting one—more work should be done on it. As for red wine in particular, I just don't know—I prefer whiskey myself." | <urn:uuid:e6c9c2a3-0be7-4f72-8f46-419f4f86e907> | CC-MAIN-2022-33 | https://www.winespectator.com/articles/resveratrol-is-no-fountain-of-youth-researchers-say-45788 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.967004 | 853 | 2.765625 | 3 |
Link to message in Portuguese: https://sementecrista.org/2020/05/construcao-de-valores-nobres/
We are experiencing a moment when we should deconstruct the walls of ignorance that imprison us in our evolutionary march, time to disarm the evil feelings that propel us to the obstacle of conquering a land of peace and harmony. It is essential in these hours of uncertainty to closely agree on the noble values found in the moral maxims of Christ, in order to overcome the dungeons of our doubts and insecurities. There is no conquest without effort, nor the pleasure of victory without redemptive work.
Humanity is awakening from a catalytic sleep that has subordinated it to the imperatives of the powerful and inconsequential children of selfishness and pride, nevertheless the light of truth is on, signaling the direction to be taken. Awakening is an unequivocal choice of everyone who wants to walk in a better world, based on the construction of internal ideals within themselves. We are worlds in formation, in divine vibration, constellations of knowledge and feelings that are updated as time runs fast towards the infinite, nothing remains static, everything changes, everything passes.
The investment that is being asked of the children of the new age is not a novelty of this century, the investment that the messengers of God have been bringing as a proposal for renewal is a universal manifesto, which is permeated everywhere the will of God is blowing. This investment translates the language of love that happens to be yeast, the active chisel of human deformities. Love has never been more evident, so sought after and recommended as it is today. The divine being by nature is immersed in this love, like the fetus in the amniotic fluid, in the planning of a new being.
Our struggle today is with disbelief, the abandonment of rational thought and emotional insecurity, which unbalances and deconstructs the most intimate foundational values. The world is devoid of dignifying purposes, a large portion suffers from the worst crisis of anguish that can be known in the trajectory of the Earth, the lack of God in their hearts, the inconsequential inversion of values that has precipitated the creatures to the most unfortunate folly that you can see.
Finally, life awaits decisions from all of us relevant to the calls of Christ Jesus: “To love one another”; it is time to recommend lucidity and discernment to ourselves in our choices, to work hard for an education of feelings and to leverage the implantation of the good news of the beloved master. The beginning of a new era commences with the end of another, and every change shakes the foundation of what is out of harmony with the perfection that God expects of everyone. Let us therefore build the noble values that grant us the ticket to remain in this world, still of trials and atonements, but in progress towards a better world, where good will prevail.
Psychographed message on May 16, 2020 / Parnaíba-Piauí
By the spirit: Miguel
Medium: Mario Lúcio Marinho | <urn:uuid:696864f0-6637-464f-b96d-4e51fc36864c> | CC-MAIN-2022-33 | https://nwspiritism.com/2021/03/18/message-from-the-spirit-miguel-we-need-to-reconstruct-noble-values/?rel=author | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.935647 | 637 | 1.554688 | 2 |
August 2, 2022, New York – In response to the U.S. government’s extrajudicial killing of Al Qaeda leader Ayman al-Zawahiri, the Center for Constitutional Rights issued the following statement:
More than twenty years after 9/11 and nearly a year after President Biden withdrew troops from Afghanistan, his words accompanying the extrajudicial killing of al-Zawahiri were jarring, dissonant: “No matter how long it takes, no matter where you hide, if you are a threat to our people, the United States will find you and take you out," he said, maintaining that “justice has been delivered.”
Two decades of endless and unbounded war and the mounting crises of these painful, cruel, and exhausting times – from Covid to climate change, from police killings of Black Americans to the attack on reproductive freedom – should have sparked reflection and reprioritization of public resources away from militarism and into communities. The drone strike in a country where the United States is not at war, which rendered a balcony a battlefield, is more of the brutal same. The United States has abandoned Afghans, doing little to resolve the humanitarian emergency it helped to create, yet it claims the authority to duck back into the county to unleash an extrajudicial killing. This was not justice. The “war on terror” has brought not a shred of justice, only suffering and destruction. Justice requires reparations for the hundreds of thousands of people the U.S. government has killed and the millions it has displaced – nearly all of them Muslim – in the name of fighting “terror.” It requires a recalibration of national priorities and a commitment to accountability. Justice has not been delivered by abandoning the rule of law once again.
The struggle for genuine justice continues.
The Center for Constitutional Rights works with communities under threat to fight for justice and liberation through litigation, advocacy, and strategic communications. Since 1966, the Center for Constitutional Rights has taken on oppressive systems of power, including structural racism, gender oppression, economic inequity, and governmental overreach. Learn more at ccrjustice.org. | <urn:uuid:e29f8fec-b4d8-40e3-ad86-39fc13ef5e3d> | CC-MAIN-2022-33 | https://ccrjustice.org/home/press-center/press-releases/extrajudicial-killing-al-zawahiri | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.950361 | 448 | 1.867188 | 2 |
Recently the world lost a shining star, Justice Ruth Bader Ginsberg, or commonly known by mainstream media and pop-culture, Notorious RBG.
She was an associate justice of the Supreme Court of the United States from 1993 until her death and was breaking boundaries and setting precedents long before that. She was a mother when she became one of the only women in her class at Harvard Law before transferring to Columbia Law school where she tied for first in her class.
She spent a vast majority of her legal career advocating for gender equality and women’s rights and won many arguments before the Supreme Court. Her life and many of her early achievements including one of her first monumental cases that set a precedent for the equal treatment of men and women in the work force are put to the screen in the 2018 film “On the Basis of Sex” — a brilliant movie that I highly recommend watching.
Ginsberg played a massive role in forwarding gender equality and women’s rights in America and in society —from work rights to issues of protection and bodily autonomy.
At the time of her death, Ginsberg was one of the only Supreme Court Justices left that was in support of a woman’s right to choose when it came to bearing children, in other words she was in favour of upholding Roe vs. Wade, and its obligations that a woman should not have to jump through near impossible hoops to have an abortion.
Her death, while devastatingly sad, is also terrifying for many women across America. Ginsberg knew that she was one of the last strong hold advocates for abortion and on her deathbed, at 87-years-old, made her dying wish that her seat at the Supreme Court not be filled until after the upcoming US election.
She knew that if that seat was filled before the election, not only could it be used as a pawn for political gain, but that if it was filled with somebody who decided to rule against abortion, that there stood a chance of the Supreme Court of USA ruling in favour of making abortion illegal across the nation, stripping women of their reproductive rights and choices like certain states such as Alabama and Arkansas already have.
Notorious RBG was a hero, and truly a feminist icon. I worry for what will happen in the states without her tenacity and experience stepping up for women and their rights.
There are many moving pawns happening with the upcoming US election, and I just hope that denying Ginsberg’s dying wish and setting back women’s rights by decades isn’t one of them. | <urn:uuid:19786da1-96d0-44ec-b469-d4be94b5859d> | CC-MAIN-2022-33 | https://www.ponokanews.com/columns/notorious-rbg/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00265.warc.gz | en | 0.979494 | 525 | 2.265625 | 2 |
Dr. Scott Helfstein presented research at a Googleideas sponsored event titled Illicit Networks: Forces in Opposition held July 16-18, 2012. In the video, Scott previews findings from a center project looking at the interrelationships between criminal and terrorist networks. The research, based on a network of 2,800 individuals and 11,000 relationships, shows that criminals and terrorists are highly connected. It concludes that both criminal and terrorist actors leverage political violence to weaken governance and exploit arbitrage opportunities given common means of operation despite different motivations. The event was co-sponsored by the Council on Foreign Relations and the Tribeca Foundation. The video can be viewed here. | <urn:uuid:fa80c2a1-ca87-4a89-aa9d-3f9059ca798b> | CC-MAIN-2022-33 | https://ctc.westpoint.edu/ctc-speaks-at-googleideas-event-previewing-research-findings-on-illicit-networks/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.955721 | 134 | 1.71875 | 2 |
* By Starcoin Community, inspirations from Starcoin core developer, Hugo.
Why is Starcoin valuable?
Starcoin, A New Generation of Layered Smart Contract And Distrbuted Financial Network. There are great innovations in Starcoin, such as:
- Smart Contract
- Distributed Finance
- New Generation
As you might be aware, the first layer is public blockchain if you have some knowledge about blockchain technology. From a technical standpoint, there are many delicate designs in Starcoin, including, enhanced PoW consensus, billable state, bootstrap economic model, unbeatable on-chain governance DAO, scalable standard library Stdlib, the new generation of smart contract language Move. All these designs make Starcoin is valuable.
Here are some examples to demonstrate Starcoin’s value.
- Example 1. Enhanced PoW Consensus: On-chain value belongs to everyone in the blockchain, not only particular one person. To serve the on-chain value, PoW could do better than Pos. There are many optimizations in PoW on Starcoin.
- Example 2. On-chain Governance: Our world is changing fast, blockchain does the same! With on-chain governance, Starcoin has the capability of embracing changes.
- Example 3. Billable state: On-chain value is rare, the layer 1 should focus on value selection, not information storage.Over time, the layer 1 will filter value, and at the same time,clean out expired information which was considered to be valuable, but now is not.Billable state can easily solve the state explosion problem which caused by expired information.
- Example 4. Move: Starcoin smart contract programming language Move is designed to define custom resource types, and one of the important features of resource is value. That is to say, Move can empower on-chain value.
We have mentioned in the layer 1 on Starcoin, we focus on value streams. Let’s move on to the Layer 2 of Starcoin. The layer 2 is committed to connecting each person. With the layer 2 technology on Starcoin, everyone could enjoy the convenience which blockchain has offered, such as: micropayment, listening to music,watching movies, and playing games.
From a technical perspective, Starcoin has many solutions,such as: state channels, rollup, side chains,etc. With these solutions, details of the technical things are hidden to the general user, users can use these solutions just as using a faucet.
Move is a resource-oriented programming language. Just in my own opinion, Move is a revolution of smart contract programming language. Why am I saying this? Our common programming language is information-oriented. But, information can be copied and transmitted at any time. Here is a simple example, one twitter post, you can forward without any notice,this is information. Your identity number or your phone number is a string, you can use in bank A, while use in bank B, this is also information.On the contrary, the resource is different with information,and it’s rare, it’s impossible to copy. It’s a secure bug if you can copy one-dollar to two-dollar. In a centralized scenario, using information to express resources, to ensure information data right, we need to do lots of manual tests. But, at the end, we have to change the database if we still have errors. But in a decentralized scenario, changing databases is impossible. What do we need to do? We need resource-oriented programming, to make sure that resources cannot be copied and changed at virtual machine level. This is the core of Move.
DeFi has attracted huge attention, Starcoin also concentrates on DeFi. With layer 1 technology and Move, selecting value and empowering value have been done. Next, let the value flow to achieve value reinvention, this is the vision of Starcoin. Some people who have been paying attention to Starcoin should have noticed that Starcoin’s DeFi infrastructure and products have been implemented and be able to launch soon.
DeFi, from value selection to value empowerment, to achieve value reinvention, at the end, on the layer 2, everyone will be connected together. Centering the value,blockchain has made a friendly closed ecological system.
Why does Starcoin use Move?
This is a brilliant question.
First,we need to realise one fact: everything is moving forward, from binary to assembly language to high-level programming language. The same is true for smart contracts, from Bitcoin Script to Ethereum Solidity, this is an advance. But, is Solidity the best one? In fact, endless security issues have been bothering us and restricted the growth of the entire industry, Poly Network attack is notorious,a hacker has stolen more than $611 million in funds from the cross-chain Poly Network. In a financial sense,security is more important than ever. We cannot ignore these issues if we hope that blockchain is sustainable, we need more powerful smart contract language. Move is designed to meet all the requirements.
We have said above, common programming is information-oriented, you can copy and change the information any time, just like a twitter post. In a centralized scenario, much detailed information cannot be exposed, we have many methods to solve these issues. But In the decentralized era,to implement DeFi and Opensource, even subtle errors will be magnified to be a big problem. For example, simple addition and subtraction operation could have significant security hazards, some real bugs such as: fake deposit attack,over money creation,overflow,ect. All these bugs are caused by the subtle errors.This is a big challenge to developers.
Resource-oriented programming can solve many security issues.
Let’s get a quick feel of what resources are. One item cannot be obtained easily if it has real values, we can treat this item as a resource. Resource-oriented programming means this resource cannot be copied and changed arbitrarily.
From a technical perspective,Move can guarantee that resources can only be transmitted,cannot be copied or implicitly discarded in Move virtual machines. Code cannot be compiled if you try to copy or modify or discard.
From a non-technical perspective, a resource is quite like a real house. You must have equivalent values and resources to build a house, this is a real trade. To finance and values,a resource is a more appropriate abstraction compared to information.Therefore, we can also say that Move has enhanced the financial scene through resources. To put it more succinctly, Move is a smart contract language that does not affect cryptocurrency functions.
We have taken tons of research and comparison when we decided to use Move as a smart contract programming language, we even considered developing a new language.But after learning Move, we think Move is our best choice.
You are really welcome to keep your eyes on our competition “Hackathon” which is held by the Starcoin community, you will meet some blockchain geniuses.
How do you develop applications on Starcoin?
We already have Starcoin public blockchain, Stdlib, browser plug-in StarMask, Starcoin browser, Starcoin vote Dapp.
At this stage, many open source communities have join us, below are some applications we are working on:
- 1 Cross-chain Bridge: including cross other public blockchain and exchanges. The initial version is ready now, and is being launched in phase, and will further maintain.
- 2 Oracle:Starcoin has developed a completed Oracle standard protocol, an oracle has been developed according to the protocol,which can provide off-chain data to Starcoin, and will be deployed on the main network.
- 3 NFT: Move has a natural advantage in NFT, Starcoin has developed a complete standard protocol, and has been integrating with other NFT platforms.StarMask is going to display NFT soon.
- 4 Swap: Starcoin will support in a short time, we are preparing for releasing.
- 5 Lending: It’s almost done now, and currently, in the test and optimization stage.
- 6 IDO: Starcoin has integrated with one IDO platform, and will be deployed on Starcoin soon.
More applications will come soon, some applications are developed, and also integrated with some famous platforms, what we have done is for value reinvention.
We are open and really appreciate everyone’s help! | <urn:uuid:a8a4c9ab-0c99-4b44-a1e9-31e9d38218ab> | CC-MAIN-2022-33 | https://starcoin.org/en/developers/others/starcoin_move_resource/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.91235 | 1,776 | 1.53125 | 2 |
When performing an external environment analysis it is important to distinguish between the macro environment (that can be analysed using a PEST analysis) and the micro environment – industry (that can be analysed using a Porter 5 forces analysis). Concerning the macro environment, this can be usually analysed using the PEST (Political, Economic, Societal, and Technological factors), more recently the PESTEL or PESTLE (which adds ecological and legal factors), the ScanStep© (Pitt and Koufopoulos, 2012) (which also includes security and cultural issues), or the ESTEMPLE (Angwin et al., 2011) (which adds ethical and media factors) analysis. But the important thing to keep in mind is not how many factors of the micro environment you are going to analyse, but how these impact the industry and thereby your company. Specifically, all these factors of the macro environment, impact the micro environment (industry) in which your company is operating in. Therefore, by impacting the industry that the company is operating in, they have an impact on the strategy that the company is following or has to follow. This is why companies have to constantly monitor the external environment to see for and predict changes, so as to adjust their strategy to achieve competitive advantage. Therefore it is important to identify and analyse the most important external environment factors that will (or have the potential to) impact the industry and thereby the company.
Similarly the stakeholder analysis is mainly performed to identify the main stakeholders that will have an impact on company (Mitchell et al., 1997). Based on these stakeholders’ expectations the company will have to formulate a strategy to meet and exceed their expectations. Thereby, the first step in this process is to again identify the most important stakeholders that will (or have the potential) to impact the company.
Based on the above, which factors of the external environment and which stakeholders do you consider to be most important for Thermo Fisher Scientific that you have analysed?References
Angwin, D., S. Cummings & C. Smith, (2011) The Strategy Pathfinder: Core Concepts and Live Cases,Chichester: John Wiley & Sons.
Mitchell, R. K., B. R. Agle & D. J. Wood, (1997) 'Toward a Theory of Stakeholder Identification and Salience: Defining the Principle of Who and What Really Counts', Academy of Management Review, 22 (4) pp.853-886.
Pitt, M. R. & D. Koufopoulos, (2012) Essentials of Strategic Management,London: Sage. | <urn:uuid:6fee8276-9f7b-4f8e-afeb-169186810c9c> | CC-MAIN-2022-33 | https://submityourassignment.com/when-performing-an-external-environment-analysis-it-is-important-to-distinguish-between-the-macro-1-answer-below/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.925158 | 538 | 2.53125 | 3 |
Home > Mental Health Worksheets
PTSD Discrimination Worksheet
On this page, we will provide you with the PTSD Discrimination Worksheet. It will help you know about the factors that trigger memories of the trauma.
What is a PTSD Discrimination Worksheet?
Trauma is inevitable; even if you survive it, you carry some part of it with you. In PTSD, you feel anxious and scared whenever you are reminded of the trauma. It can be in the form of intrusive rumination, flashbacks, or images of that stressful event. The trauma haunts you, and you keep re-living the involuntary recollection of your trauma memories.
Stimulus discrimination can be categorized as a ‘brain training’ exercise with the rationale that your mind is attending to stimuli associated with the trauma and incorrectly interpreting them as signs of danger in the here-and-now.
How will PTSD Discrimination Worksheet help?
The worksheet is about differentiating between the traumatic events and memories that when you recall the trauma, how much different or similar it is from the traumatic event itself. In this worksheet, you will be able to identify what makes you recall or triggers your traumatic events. So that for the future you will be able to avoid or learn effective coping strategies to deal with trauma.
Instructions on PTSD Discrimination Worksheet
Post-traumatic stress disorder is a mental health condition in which you experience some symptoms after witnessing any trauma. Use this worksheet to identify the common triggers, similarities, and differences regarding trauma.
On this page, we provided you with the PTSD Discrimination Worksheet, which hopefully helped you know about the factors that trigger memories of the trauma.
If you have any questions or comments, please let us know.
You can download this worksheet here.
Other worksheets you maybe interested in
Below are links to a few more worksheets which are closely related to the worksheet above.
Mental help Resources
The worksheets on this site should not be used in place of professional advice from a mental health professional.
You should always seek help from a mental health professional or medical professional. We are not providing any advice or recommendations here.
There are various resources where you can seek help.
If you live in the UK then this list of resources from the NHS may help you find help.
If you live in the USA then you could contact Mental Health America who may be able to assist you further. | <urn:uuid:0ef89f34-0d25-44f2-9702-edab55047a2f> | CC-MAIN-2022-33 | https://mentalhealthworksheets.com/ptsd-discrimination-worksheet/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.92378 | 503 | 3.359375 | 3 |
No suffering in dialogue between Dalai Lama, neuroscientists
Is craving a good thing or a bad thing? Buddhists and scientists try to reconcile different views of its value
His Holiness the 14th Dalai Lama, Tenzin Gyatso, has demonstrated his many gifts as the spiritual leader of the Tibetan people, but how often does he get asked to become a reviewer for a neuroscience journal?
That proposal came at a medical school panel on Nov. 5 at Memorial Auditorium from a neuroscientist who had just heard the Dalai Lama's critique of her imaging study. While her suggestion was somewhat tongue in cheek, she was dead serious in her admission that she might have conducted her research differently if she had spoken with him first.
The study showed that empathy for others causes activity in the same areas of the brain as does pain itself. The researchers used loved ones to elicit empathy from the test subjects. In Buddhism, the belief is that empathy and compassion for loved ones is an extension of the self. But real compassion comes from feelings for those unrelated—or even enemies. So a more telling experiment, the Dalai Lama remarked, would be to examine such feelings toward these less-related people to see if activation arises in the same areas of the brain.
It was but one of many shared insights in an all-day discussion that featured the Dalai Lama and a panel of 15 neuroscientists, psychologists and Buddhist scholars. The event was titled, "Craving, suffering, and choice: Spiritual and scientific explorations of human experience."
"This was an important event that truly helped create a sense of mutual enlightenment and engagement," said medical school dean Philip Pizzo, MD, adding that the discussion was "not about applying the scientific method to religion, or faith to research." It was about accepting the reality that humans are multidimensional and that they can learn from different perspectives.
The question of the day, posed early on by event organizer William Mobley, MD, PhD, the Cahill Professor in the School of Medicine, and echoed throughout the day was: "Can neuroscience, with its tools and concepts, bring to Buddhism, with its contemplative practice, something useful and vice-versa?" The discussions then sought to identify the common ground between the fields that could lead to greater insights.
To keep the panel focused, Mobley, who is the director of the Neuroscience Institute at Stanford, said there were certain concepts they would not address—such concepts as reincarnation, karma and enlightenment. "Neuroscientists avoid all kinds of things we don't understand," he said.
Instead, the participants concentrated on the concepts of craving and suffering. One challenge was reaching a consensus on the meaning of the term "craving." In Buddhism, a craving, by its very nature, is an afflicted state. In Western science, craving is simply something that motivates someone to make a decision. After much discussion, the group agreed that a different word might have to be used, maybe "desire."
As the dialogue delved deeper, easy answers were not immediately apparent. At one point even the Dalai Lama admitted he was "so confused" about how to determine when there are unhealthy levels of desire and if there is a form of desire that is not a form of suffering.
Still, there were many "aha" moments on both sides.
In reference to a study published last year showing that the brains of experienced meditators have long-term changes in activity, the Dalai Lama said, "Now they are beginning to realize that our approach is something useful. I am extremely happy to see more and more science showing interest in our approach."
In a presentation of the neuroscience perspective of craving, Howard Fields, MD, PhD, director of the Wheeler Center for the Neurobiology of Addiction at UCSF, mentioned a drug called Rimonabant, which acts on the area of the brain associated with craving to decrease smoking in smokers. They also lose weight, an announcement that elicited a collective gasp from the audience.
Fields posed the question about whether it was a good approach to use pharmacological intervention to decrease craving—or could there be a way to use cultivated feelings of wisdom and compassion to shift decisions in patients?
The Dalai Lama contemplated this idea and wondered whether there was such a drug that would reduce or eliminate all forms of craving. While that concept might represent spiritual enlightenment to Buddhists, Fields replied that such a drug might be the equivalent of inducing a state of coma. To this the Dalai Lama commented, "That is a disaster."
Throughout the day, the discussion of the concept of "suffering" also underscored significant cultural differences in the meaning of that word. The Western world attempts to avoid suffering and alleviate it if it occurs. In Buddhism, it is an expected part of life.
Maybe, as Helen Mayberg, MD, professor of psychiatry and of neurology at Emory University, observed, the extreme pain of illness must be reduced—through drugs, deep brain stimulation or therapy—to let the mind reach a more positive state. People could try to do this on their own, but she asked was it necessary that it be so hard and take so long?
The Dalai Lama, who sat cross-legged in his chair in his flowing red robe, provided a koan-like answer. He scratched his head. He talked about flowers growing and yogic energy. Apparently, it's just the way things are.
Throughout the day, the participants defined the common ground: an emphasis on finding the truth, the need to rescue minds from "hijacking" and the goal of achieving transformation. This, of course, meant they had to acknowledge points of divergence. Stanford professor of neurobiology William Newsome, PhD, noted, "Neuroscience may not be ready to address the high-level craving of Buddhism yet."
But there was much hope for future dialogue. The concept of "choice" in determining decisions and feelings is one that both Western science and Tibetan Buddhism share, and it provides a foundation for continued inquiry.
"The conference was a true success and certainly exceeded my hopes and expectations," Pizzo said afterward. "While this is still a beginning it offers guidance for new roads to travel." | <urn:uuid:b831bc9d-48dd-4ecc-896f-ccbcc671beac> | CC-MAIN-2022-33 | https://news.stanford.edu/news/2005/november9/med-dalai-110905.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.969092 | 1,271 | 2.640625 | 3 |
What are the 2 types of gamelan?
Explore the history, definition, instruments, and music of gamelan, and learn more by reviewing tuning systems, gamelan’s two traditions, and the Balinese and Javanese orchestras.
What are the types of gamelan orchestra differentiate the two?
What are the two types of gamelan? The two main types of gamelan scales are the pelong and slendro scales. Pelong is a septatonic scale and is more recent than the Slendro scale. Gamelan typically only uses five of the seven notes in the package.
What are the most popular gamelan in Indonesia?
Just like many other cultural elements in Indonesia, there are different variations and takes on this traditional art throughout the diverse culture of the archipelago, but perhaps the Javanese and Balinese gamelan are the best preserved and most popular. | <urn:uuid:b48d6e4e-f8d0-4aa1-acd3-ac62ab552a4f> | CC-MAIN-2022-33 | https://colours-indonesia.com/where-to-go-to-sea/what-are-the-two-types-of-gamelan-in-indonesia.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.927927 | 195 | 3.265625 | 3 |
Francis Scott Key Post 11
The American Legion believes national security must be maintained to fulfill the mandate for a strong national defense. As stated in the Preamble, “FOR GOD AND COUNTRY WE ASSOCIATE OURSELVES TOGETHER FOR THE FOLLOWING PURPOSES: To uphold and defend the Constitution of the United States of America… To safeguard and transmit to posterity the principles of justice, freedom and democracy.”
The Legion is an organization of veterans who fought for freedoms, which they are dedicated to keeping and preserving. As one of the Four Pillars it was founded on, the Legion believes national security is upheld by keeping a well-funded Department of Defense, a good quality of life for troops and a sensible transition between service and separation. | <urn:uuid:da77ef5c-6dba-450a-a689-e1d84c7e5f71> | CC-MAIN-2022-33 | https://fskpost11.org/programs/national-security/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.9217 | 164 | 2.53125 | 3 |
Heat recycling sorption dehumidifier
Facilities that handle large amounts of water can become very humid. High humidity may lead to corrosion in installed machinery and control systems. A dehumidifier is necessary to protect the installed machinery in these cases. The dehumidifier itself must have a robust construction to withstand these harsh conditions.
Dehumidify medium sized spaces with robust heat recycling technology
RECUSORB R series dehumidifiers are built on the Recusorb R sorption technology from DST Seibu Giken. They incorporate a washable, silica gel desiccant rotor and integrated heat recycling technology. Heat absorbed during rotor regeneration is recycled to pre-heat and partly dehumidify the incoming air.
The compact R-units have a stainless steel construction and offer a long life of robust performance in both indoor and outdoor settings. They are suitable for small to medium sized storage and processing facilities as well as museums, power plants and pumping stations.
The R series dehumidifiers are available in the following capacities:
R-060BR: 4.6kg/h*, dry air flow rate 1,000m3/h
R-51/61R: 7.3-10kg/h*, dry air flow rate 1,250– 1,450m3/h
* at 20°C and 60%RH
- Cut energy costs with Recusorb heat recycling technology that delivers dry air at low temperatures
- Save space with a small footprint and compact humidifier that delivers great performance
- Excellent corrosion resistance and good hygiene due to stainless steel chassis and panels
- Easily remove contaminants from the system with the washable rotor
- Easy installation with duct connection | <urn:uuid:5f3bbbd0-682d-4d9a-baeb-03cf88ae48a1> | CC-MAIN-2022-33 | https://making.com/equipment/heat-recycling-sorption-dehumidifier/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.890352 | 355 | 1.859375 | 2 |
site specific installation
photography | installation | illusion | archive
mountain is a three-dimensional collage comprising hundreds of photographs of depicted landscapes from all over the world. the installation is an assemblage created from images made by different people which are accessible on the internet for all sorts of reasons. already with its invention photography became a handy tool to fulfil people's desire to keep the memory about visited places. the photograph became a kind of a souvenir that can be taken home from adventures and travels. through time little has changed in people's desires. the only thing that has changed is the amount of images that have risen enormously and more places than ever have been appropriated through photography. today it is possible to talk about a virtual copy of the world composed from numerous images that is constantly growing and making the model more and more complete. mountain is a photograph of a landscape taken in this virtual environment, a new type of picture that depicts the results of modern developments in visual culture. one of the many beautiful vistas that can be found in the visual model of the world created and maintained collectively.
about 350 images found online arranged into a hanging installation adjustable to spaces of various dimensions. | <urn:uuid:e4ffd243-59dd-426b-a036-ee19bb901ad7> | CC-MAIN-2022-33 | https://www.olalanko.com/mountain | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.968103 | 243 | 1.609375 | 2 |
Admetos is one of the eight hypothetical planets (also called the Transneptunian planets or TNPs) of the Hamburg School. Admetos is extremely intense. It is associated with matters that get blocked and come to a standstill. It can also take matters to the depths, symbolizing total concentration.
A planet is considered to be afflicted if it is cadent, retrograde, combust or in hostile aspect (ie. Conjunct, square or opposed a malefic Mars, Saturn and Cauda [South Node]). A house is afflicted if ruled by a malefic or occupied by one, particularly a malefic in debility.
Translates as "The Winner/Victor". Calculated using the five Essential Dignities (Rulership, Exaltation, Triplicity, Term & Face) for any zodiacal degree. The word "Almutem" is more commonly used for the chart ruler - the Almutem Figuris, whilst the word Almuten is used in reference to house rulership. The Almutem/Almuten is determined by assigning points (or virtues) to the Sun, Moon, Mercury, Venus, Mars, Jupiter, and Saturn. The planet that gets the highest score is the Almutem or Almuten of the chart or house respectively.
The Angles are the four "power points" of the horoscope. Planets placed near any of these four points are strengthened according to their natures. The Angles indicate where the angular houses begin in quadrant house charts.
The Four Angles are:
Angular houses are the 1st, 4th, 7th and 10th. They are the strongest and most dynamic houses. Planets placed in angular houses are able to manifest their power 100%, positively or negatively, according to their nature and condition. A planet is angular if it is within 5 degrees of the cusp of the Ascendant, Descendant, Midheaven or Imum Coeli and before 5 degrees of the next house. Eg. if the Ascendant is 10 degrees Aquarius and a planet falls in the 12th house at 5 degrees Aquarius it is considered angular and of 1st house strength. Likewise, if a planet is located in the 4th house and is more than 5 degrees away from the 5th house cusp it too is angular.
Anti-culminating is a term used to describe a planet reaching its lowest elevation (on the Imum Coeli) below the horizon due to the rotation of the earth.
This is the mirror image of planetary positions about the Cancer/Capricorn axis. Example: The antiscion of a planet at 2 degrees Cancer is at 28 degrees Gemini. The antiscion point can be activated when occupied by another natal planet, by transit or direction. Generally, antiscia is considered to be a favourable influence.
William Lilly has this to say about antiscia on p.90 of Christian Astrology:
"The Antiscion signs are those, which are of the same virtue and are equally distant from the first degree of the two tropic signs, Cancer, Capricorn, and in which degrees whilst the Sun is, the days and nights are of equal length; by example it will be plain; when the Sun is in the tenth degree of Taurus, he is as far distant from the first degree of Cancer as when in the twentieth degree of Leo; therefore when the Sun is in the tenth of Taurus, he hath his Antiscion to the twentieth of Leo; that is, he giveth virtue or influence to any star or planet that at that time either is in the same degree by conjunction, or casteth any aspect unto it".
|Antiscia and the Signs|
On page 92 of 'Christian Astrology' Lilly provides a table for easy calculation of the antiscion degree and minutes.
|Antiscia in Degrees||Antiscia in Minutes of a Degree|
The name given to the point in a planet's orbit when it is farthest from the Sun.
The point in the Moon's orbit when it is farthest from the Earth.
One of the eight hypothetical planets (also called the Transneptunian planets or TNPs) of the Hamburg School. Apollon has the quality of expansiveness. It symbolises commerce, science, peace and success.
This term is used to describe the apparent brightness of a star. By way of an example, the brightest star, Sirius, has an apparent magnitude of -1.4
11th Sign of the Zodiac.
Key Word: I know
Sun travels through it: 20 January to 19 February
Mode (Quality): Fixed
Planetary ruler: Saturn (Traditional) Uranus (Modern)
Exalted ruler: None
Part of the body: Calves and ankles
Words descriptive of Aquarius are: independent, objective, detached, original, humanitarian, intellectual, friendly, people-oriented, progressive, intuitive, unique, innovative, inventive, rebellious, radical, unpredictable, contradictory and eccentric.
The Arabic Parts are zodiacal points arrived at by comparing the longitudes of two bodies or points and taking the distance between these in longitude and adding it to the ascendant or a house cusp. Another way of looking at this, is to use the formula Ascendant plus a planet minus another planet using zodiacal degrees of longitude, Part = Asc + Planet A - Planet B. In some calculations the Ascendant can be replaced by a planet or a house cusp, and the planets can be replaced by a house cusp. For instance: the Part of Soul is 4th + Moon - Sun. Some of the Arabic Parts use the same formula for both day and night births. Other Arabic Parts use one formula for diurnal charts (day time birth, Sun above the horizon) and another formula for nocturnal charts (night birth time, Sun below the horizon).
For example, the Part of Fortune formula is:
PF = Ascendant + Moon - Sun (for a diurnal chart).
PF = Ascendant + Sun - Moon (for a nocturnal chart).
Arabic Parts were known in Greek astrology, but were more fully developed in Arabic astrology. They are also known as Arabic Points, Arabian Parts, Arabian Points, and Lots.
1st Sign of the Zodiac.
Key Word: I AM.
Sun travels through it: 21 March to 19 April
Mode (Quality): Cardinal (Mobile)
Planetary ruler: Mars
Exalted ruler: Sun
Part of the body: Head
The symbol for Aries suggests the ram's horns. Words descriptive of Aries are: bold, assertive, the need to forge ahead, pioneering, enterprising, adventurous, ambitious, energetic, competitive, direct, self-centred, aggressive, impatient, bossy, rough, argumentative and overbearing.
This is where the Eastern Horizon intersects the Ecliptic. The Ascendant (also known as the Sign rising in the East at birth) is opposite the Descendant (i.e. where the celestial horizon and ecliptic intersect in the West). In most house systems the Ascendant forms the 1st House Cusp. In interpretation, it represents the moment of birth; the native of the nativity, the response to the world or the environment in general; the personality, the face others see, the impact of the self on others; the primary motivation in life of the native. In horary astrology it represents the querent.
The 4 main asteroids Ceres, Pallas, Juno and Vesta are included in Janus. The orbits of the asteroids lie between Mars and Jupiter. Calculation range: From 1487 AD to 2102 AD.
This is a mapping technique showing those locations on the Earth's surface where planets are angular at the time of birth (in natal and mundane astrology). The method graphically displays planetary lines on a map. It shows geographically where a planet would be seen rising, setting, culminating or anti-culminating at the time the horoscope is cast. For example, Venus would have 4 lines, one each for the Venus on the Medium Coeli (M), Venus on the Imum Coeli (I), Venus on the Ascendant (A), Venus on the Descendant (D) displayed on the map. This technique, also known as ACG ™, A*C*G ™, Astrocartography ™, Astro*Carto*Graphy ™, Astro-geography and Astro-Mapping, was pioneered by Brigadier Firebrace and further developed and popularised by Jim Lewis in the 1970s using the computer.
The science that interprets the relationship between cosmic events and life on Earth.
This is a term used to describe the difference between the Sidereal and Tropical Zodiac. There is a range of different Ayanamsa values commonly in use. The Sidereal Zodiac (fixed) excludes precession and keeps in step with the constellations (stars). Two examples of Ayanamsa are: The Fagan-Allen Ayanamsa (commonly used by Western Sideralists) with a value of -23°20'38" corresponding to the 1st January 1900 (1900.0), and the Lahiri Ayanamsa which has a value of -22°27'38" corresponding to the 1st January 1900 (1900.0) and is commonly used by Eastern astrologers.
One of the measurements used to describe a planet's or star's position in the sky using the Horizon Co-ordinate System. It is the distance in angular degrees in a clockwise direction from the North Point in the Northern Hemisphere, and the South Point in the Southern Hemisphere.
The horizon system is based on the great circle called the rational horizon, parallel to the visible horizon, and its plane passes through the centre of the Earth, dividing the celestial sphere into two hemispheres, upper and lower. The poles of the horizon are the point directly overhead (the Zenith), and the point directly below (the Nadir).
This circle is divided into 360 degrees of Azimuth.
Azimuth is usually measured 0 - 360 degrees clockwise from the North Point.
Azimuth is sometimes measured counter-clockwise from the East Point.
Azimuth is sometimes measured 0 to +/- 180 degrees from the North Point, positive to the east, and negative to the west.
Azimuth is sometimes measured 0 to +/- 180 degrees from the South Point, positive to the east, and negative to the west.
Angular distance away from the horizon is measured in degrees of positive Altitude toward the Zenith (above the horizon), and negative Altitude toward the Nadir (below the horizon).
These coordinates are only valid for a particular location on the Earth, and these coordinates are constantly changing with time, due to the rotation of the earth. | <urn:uuid:20d3f80c-4ebc-4a1a-8364-9dd5f58e97ae> | CC-MAIN-2022-33 | https://astrology-house.com/glossary.cfm?section=a | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.890062 | 2,627 | 1.945313 | 2 |
In the Bible, in the book of Exodus, Moses asks God, “Who should I tell the people who sent me.” In other words, ‘What’s your name?”
In Exodus 3:14 God answers Moses by saying,
“I am who I am. This is what you are to say to the Israelites: ‘I am has sent me to you.’”
I recently heard someone say that because God calls himself, “I AM,” we could be using God’s name in vain by saying “I am ____” and filling in the blank with something negative.
Exodus 20:7 “You shall not misuse the name of the Lord your God.”
I still believe that we shouldn’t use God’s name as a swear word, but perhaps we should also avoid calling ourselves something that contradicts who God made us to be!
When my children say something negative about themselves, it hurts this mama’s heart. I immediately correct them. How much more does it hurt God’s heart when we talk negatively about ourselves – His Creation…His child?
Who does God say that you are?
You are fearfully and wonderfully made. Psalm 139:14
You are righteous Romans 3:22
You are loved Jer 31:3, Ephesians 3:18, I John 3:1
You are created with a purpose Jeremiah 29:11
You are chosen, special, royalty 1 Peter 2:9
You are protected Psalm 121:3, 2 Thessalonians 3:3
You are strong 1 Peter 5:10, 2 Timothy 1:7, Isaiah 41:10
You are a child of God 1 John 3:1
You are Holy and Blameless Ephesians 1:4
You lack nothing Psalm 23:1
You are honorable Psalm 8:5 | <urn:uuid:90c76496-566a-43f9-b825-375bcbab0c24> | CC-MAIN-2022-33 | https://injesusname.blog/2021/07/31/who-are-you-11/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.938428 | 406 | 1.84375 | 2 |
Accurate valuations depend on reliable data
Before you even begin to think about insuring your most precious items, it is essential to have an idea of their value. In fact, some policies insist on a reliable valuation before they will provide cover.
Of course prices for items such as cameras, luxury goods and jewellery fluctuate, so it can be challenging to ensure the appropriate level of cover is maintained for individual items throughout the life of the insurance policy.
Take watches as an example. According to a new report from Morgan Stanley Research, valuations in the secondary watch market have been contracting in the last three months with values of luxury watches including Rolex, Patek Philippe and Audemars Piguet dropping by double digit percentage points. That said, the report, which is based on WatchCharts data has found that second-hand prices of the 30 most traded Rolex watches, are still up a cumulated +35% since January 2021.
Morgan Stanley is not the only reputable organisation to rely on WatchCharts data to keep them abreast of pricing in the market. At KoverNow, we also use the firm to inform our valuation and insurance services when it comes to establishing the current value of our policy-holders’ watches.
Clients not only choose to use KoverNow because it provides them with a convenient, mobile app-based insurance service and puts them in control of their policy, but also because they can access valuations for free. Whether they are purchasing cover for watches, electronics or handbags, the valuations they receive and the insurance policies they take out are based on the kind of solid, market-tested data provided by WatchCharts.
Consumers quite rightly want accuracy when it comes to the value of their goods, and informed data allows us to meet their expectations. | <urn:uuid:da0f7cb6-cc9b-4c7d-88ed-7339a6a12c4a> | CC-MAIN-2022-33 | https://kovernow.com/blog/accurate-valuations-depend-on-reliable-data/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.956256 | 372 | 1.53125 | 2 |
We need to stop building bad places. We don’t need to build Rome or Paris. We just need to stop building Houston.
The following eight rules apply to every major and mid-sized city with no exceptions. If your leaders don’t do these, somebody else will. And, you’ll have people asking in 10 years time why you haven’t already done them.
1. Make accessory dwelling units legal
This is the easiest way to add density without adding “density”. This won’t change your city overnight, but it’ll help lay the groundwork for improved urbanism. We need to see a rise in these types of dwellings because they add to affordable housing stock, expand housing options, add tax revenue, and are Jane Jacobs’ “eyes on the street”. Except in this case, it’s eyes on the alleyway. Read more about accessory dwelling units here.
2. Eliminate parking minimums as soon as possible
There is no bigger detriment to urban centers than parking. It adds costs to private development and drives up rents. Car storage is a terribly inefficient way to allocate land, especially in existing walkable neighborhoods. If you want to make your downtown more livable, the first policy move should be to eliminate (or, reduce if elimination is not politically feasible) all parking requirements.
If you worry about parking (and “congestion”), you might lose great local institutions to the suburbs. I’m looking at you, St. Paul.
3. Four-three conversions of stroads
Most four lane collector roads are ugly, unsafe and do a poor job of moving traffic. They are the worst of all worlds.
These stroads take up a lot of space and don’t allow for either bike lanes or on-street parking. Conversions have been well studied and the results are conclusive. They improve pedestrian and bicycle safety, calm traffic, improve emergency response and have reduced vehicle crash rates (between a low of 17 to a high of 62 percent (source)). When it comes to re-striping roads, four-three conversations are nearly always a solid bet. These are easy sells because they usually don’t effect Level of Service (by the way, which is something cities need to stop caring so much about). We also need to take the time to reduce the size of these roadways in general and add on-street parking and/or bike facilities.
4. Sell public surface parking lots for $1
Cities and towns are sitting on a gold mine of under-utilized land, specifically public open-surface parking lots. What is open surface parking getting you? The answer is very little.
This is easy: sell them to the highest bidder. Have an auction, start at $1 and sell to the highest bidder. Code the specific site to hit all the urban guidelines fitting of a form based code and require development start within 3 to 5 years. Imagine the benefit to a City like Minneapolis or St. Paul if someone put (just) mediocre mixed-use buildings on each city own surface lot.
5. Better transit, not (necessarily) more transit
Light Rail is awesome. But, it’s also expensive. Let’s start small and improve the transit that we have, precisely bus service. Adding a bus shelter is relatively cheap ($5,000 to $6,000). BRT is also great and relatively affordable. Make these moves first. They are political feasible and improve the lives of people who are currently using transit. This means, making what we have run on time and run faster.
Don’t let great be the enemy of good. Let’s not make the ridiculously expensive be the enemy of the reasonable and effective. Support small incremental improvements to our transit service and don’t wait for the “big and shiny” project. Because, if you’re lucky enough to get Federal funding for a new streetcar or light rail, it’ll be 25 years away before any improvements happen (take note St. Paul). Read more about improving transit in a cost-effective way here.
6. Allow more beer/wine licenses
Retail is dying a slow death. Every sale on Amazon, Etsy, or Zappos represents one less sale at a brick-and-mortar book store, gift shop or clothing store. These, and a shift of the nature of work, will make filling retail storefronts more difficult. We need to fill frontages. It’s essentially to walkability.
Food is the rational response as it’s not easily outsourced. And, to make margins for these places, they’ll likely need to sell beer and wine. There is a changing cultural dichotomy going on. More expensive local craft beer sales and high-end cocktails are shifting the nature of traditional 60/40 (or 70/30, etc.) beer to food sale requirements. These need to change, too.
If you want to fill your empty storefronts, you’ll need to look beyond retail.
7. Eliminate one way streets
The case against one way streets is already solved. The verdict is in.
Converting streets to two-ways has many benefits. These types of streets, as opposed to one-ways, improve pedestrian and bike safety, improve vehicle navigation and overall safety, lower speeds, and improve the financial health of local businesses (source). Many cities have already converted their one way streets to two ways. Your city should too.
8. Allow the “sharing” economy to be legal
Whether the establishment likes it or not, it’s going to happen. The question is, how will you let it happen? Be smart. Be fair. But for God’s sake, don’t make it illegal (I’m looking at you Miami).
Uber and Lyft aren’t competing against taxis. They’re competing against the cost of owning a car. If these services can remove just a handful of cars (or reduce drunk driving) that should be viewed as an urban benefit. And, AirBNB isn’t competing against hotels (which can be expensive), but it more so about providing options for people to safely rent our there apartments and make extra money to off-set the costs of living in an more high-demand urban settings.
The sharing economy might be hard for many to swallow, but it needs to be legal.
Now, these eight suggestions won’t make your city a success overnight, but they are politically-feasible, small, incremental changes that you can make to help inch your city in the right direction. | <urn:uuid:0faf5be6-7b4a-420a-b2c1-323c29329eb1> | CC-MAIN-2022-33 | https://streets.mn/2014/07/26/eight-steps-to-improve-urbanism/?shared=email&msg=fail | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.931958 | 1,391 | 1.9375 | 2 |
From the New York Times bestselling creators of Click, Clack, Moo, comes an entertaning introduction to politics.
My fellow Americans:
It is our pleasure, our honor, our duty as citizens to present to you Duck for President. Here is a duck who began in a humble pond. Who worked his way to farmer. To governor. And now, perhaps, to the highest office in the land.
Some say, if he walks like a duck and talks like a duck, he is a duck.
We say, if he walks like a duck and talks like a duck, he will be the next president of the United States of America.
Doreen Cronin is the author of many bestselling and New York Times bestselling picture books, including Click, Clack, Quack to School!; Click, Clack, Surprise!; Click, Clack, Ho, Ho, Ho; Click, Clack, Peep; Click, Clack, Boo!; Dooby Dooby Moo; Thump, Quack, Moo: A Whacky Adventure; Bounce; Wiggle; Duck for President; Giggle, Giggle, Quack; Bloom; and the Caldecott Honor Book Click, Clack, Moo: Cows That Type as well as The Chicken Squad series and Cyclone. She lives in Brooklyn, New York. Visit her at DoreenCronin.com.
Betsy Lewin is the Caldecott Honor–winning illustrator of Click, Clack, Moo: Cows That Type and its sequels, including Click, Clack, Quack to School!; Click, Clack, Ho, Ho, Ho; Click, Clack, Peep; Click, Clack, Boo!; Giggle, Giggle, Quack; Duck for President; Dooby Dooby Moo; and Thump, Quack, Moo; in addition to a number of other picture books, including So, What’s It Like to Be a Cat? and Where Is Tippy Toes?. She lives in Brooklyn, New York.
Publisher: Atheneum Books for Young Readers (March 2, 2004)
Length: 32 pages
Grades: P - 3
Ages: 4 - 8
Lexile ® AD680L
The Lexile reading levels have been certified by the Lexile developer, MetaMetrics®
Fountas & Pinnell™ M
These books have been officially leveled by using the F&P Text Level Gradient™ Leveling System | <urn:uuid:852e9cf1-b8fd-4a49-9814-ce94b6c3f91d> | CC-MAIN-2022-33 | https://www.simonandschuster.com/books/Duck-for-President/Doreen-Cronin/A-Click-Clack-Book/9780689863776 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.899332 | 539 | 2.296875 | 2 |
August 15, 2019 feature
Quantum system virtually cooled to half of its actual temperature
Physicists have developed a quantum simulation method that can "virtually cool" an experimental quantum system to a fraction of its actual temperature. The method could potentially allow access to extremely low-temperature phenomena, such as unusual forms of superconductivity, that have never been observed before. The simulation involves preparing multiple copies of the system's quantum state, interfering the states, and making measurements on each copy, which ultimately yields a simulated measurement on the same system at a lower temperature.
The team of physicists, Jordan Cotler at Stanford University and coauthors, has published a paper on the quantum virtual cooling method in a recent issue of Physical Review X.
As the researchers explained, the results are based on the idea that there is a strong connection between temperature and quantum entanglement.
"A modern perspective in physics is that temperature is an emergent property of quantum entanglement," Cotler told Phys.org. "In other words, certain patterns of quantum entanglement give rise to the familiar notion of temperature. By purposefully manipulating the pattern of entanglement in a system, we can gain access to lower temperatures. While these remarkable ideas were previously understood theoretically, we figured out how to implement them experimentally."
Future experimental realizations of the virtual cooling technique could enable researchers to measure temperature in seemingly impossible ways.
"We may be able to use quantum virtual cooling to 'cross' what are called finite-temperature phase transitions," Cotler said. "This seems quite bizarre—it would be like taking two glasses of liquid water, and by making a quantum measurement, you learn about the properties of solid ice. Remarkably, this seems possible in principle, but in practice, we need to use systems that are easier to control than water. Nonetheless, we still may be able to prepare a system in one phase, and use quantum virtual cooling to probe a different phase that only occurs at a lower temperature."
How it works
The virtual cooling method is designed to work on a type of system called a strongly correlated quantum many-body system. An example of such a system is a system of ultracold atoms trapped by a grid of lasers called an "optical lattice." The atoms can hop from grid point to grid point and interact with one another. Strongly correlated quantum many-body systems like ultracold trapped atoms are theoretically predicted to reveal interesting behavior at ultracold temperatures. Unfortunately, many of the predicted low-temperature phenomena have never been observed due to the difficulty of cooling to such cold temperatures.
One recently developed approach to cooling is to use a quantum simulator—a physical system consisting of atoms, photons, quantum dots, or some other physical object, which is used to model another physical system that is not as well understood. In the quantum simulator introduced in the new paper, atoms at some accessible temperature are used to model atoms at a colder, traditionally inaccessible temperature. In other words, a quantum system is being used to simulate a subset of itself at a lower temperature. Due to their quantum properties, quantum simulators can perform certain tasks like this that are out of the reach of classical computers, which cannot leverage quantum entanglement and superposition.
One of the key things about the new simulator is that there is no actual physical cooling involved at all. Instead, the virtual cooling is achieved by interfering many atoms, measuring those atoms, and then processing the measurement data. To demonstrate, the physicists used the method to simulate measurements of the density of atoms in what is called a "Bose-Hubbard Model," which specifies certain kinds of interactions between the atoms. The basic procedure involves preparing two or more identical copies of the many-atom quantum state in different physical locations (here, the optical lattices). Then quantum tunneling is induced between the copies, which allows atomic interference between them. Finally, the number of atoms occupying each site is measured for every lattice site, which is done by using a quantum gas microscope.
After repeating the procedure several times at the actual temperature, and then taking the average, the method gives the local density of atoms at a reduced temperature of T/n, where T is the system's actual temperature and n is the number of copies used. In the initial demonstration, the researchers used two copies, which allowed access to the system at half of its original temperature. These experimental results closely matched theoretical predictions.
While the method theoretically allows the system to be virtually cooled all the way to its ground state, i.e., the zero-temperature state, in practice the amount of cooling is limited by scaling difficulties involved in measuring multiple copies of the system with sufficiently high precision. Still, due to the fact that no physical cooling is involved, the researchers expect that the simulation method could be used to virtually reduce the temperature of a quantum system after all physical cooling methods have been used, so it could provide additional cooling for any other method.
Cool future plans
In the future, the physicists plan to further extend the approach to extend quantum virtual cooling to measure more complicated properties. While the current set-up was designed to measure only atomic density at low temperatures, the physicists developed an alternative cooling approach to measure other properties. This approach uses qubits in a quantum circuit, similar to entanglement purification protocols.
The researchers also hope to apply quantum virtual cooling to investigate low-temperature phenomena such as d-wave superconductivity, a type of high-temperature superconductivity, which is not as well understood as low-temperature superconductivity.
"Regarding d-wave superconductivity, it would be interesting to observe it as a low-temperature phase of the Fermion-Hubbard model, which can be experimentally realized in the lab," Cotler said. "Here, 'Fermion-Hubbard model' is physics jargon for a system with specific kinds of interactions, and with constituent particles that are fermions (of which electrons are a well-known example).
"You might ask, why is this particular set of interactions interesting, and why do we care about the observation of a d-wave superconducting phase at low temperatures? There are several reasons. One is that the Fermion-Hubbard model is a nice system from a theoretical point of view, and it may yield insights into more complicated systems that we either observe in nature, or want to engineer.
"However, it is difficult to understand low-temperature superconductivity in the system—the equations are too hard, and simulating the system on a computer is nearly impossible, even if we have a supercomputer. One approach is to simulate the Fermion-Hubbard model on a quantum computer, but we do not have one yet that can do so. Instead, we can build a Fermion-Hubbard model in the lab, and explore its low-temperature properties by cooling it. In other words, we do not need a quantum computer because we are actually building the desired system in the lab. But now the problem is actually cooling down the experimental system to low enough temperatures that you can see a superconducting phase. This is currently out of reach, but it seems that quantum virtual cooling can help."
© 2019 Science X Network | <urn:uuid:e25a5113-46d9-45a8-9c3a-739046882120> | CC-MAIN-2022-33 | https://phys.org/news/2019-08-quantum-virtually-cooled-actual-temperature.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.938424 | 1,494 | 3.75 | 4 |
There is great potential to improve drug delivery through the use of in-situ gelling delivery systems. Here we demonstrate a technique capable of measuring changes in rheology (gelation and/or dissolution) of in-situ gelling delivery systems on contact with physiological fluid, while simultaneously analysing drug release. An ocular in-situ gelling formulation (gellan and timolol maleate) and an in-situ gelling oral liquid (alginate and metronidazole) were used as exemplar formulations. The method allowed profiling of increasing gellan concentration resulting in a reduction of timolol maleate released into simulated lacrimal fluid. When alginate was used as an in-situ gelling oral formulation there was a rapid increase in Gʹ on contact with simulated gastric fluid. When this was changed to simulated intestinal fluid, drug release rate increased rapidly, coinciding with alginate gel dissolution. This work highlights the potential of this technology as a tool in development and optimisation of these increasingly popular delivery systems. | <urn:uuid:ef9cb1dc-2ccb-4d90-b829-9d97a7f96f75> | CC-MAIN-2022-33 | https://pure.hud.ac.uk/en/publications/rheo-dissolution-a-new-platform-for-the-simultaneous-measurement- | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.920482 | 222 | 1.953125 | 2 |
Do we want to take the modern convenient bus or celebrate the new hybrid car? That's the choice, says Sunita Narain.
A new decade. For me, three decades of work in the field of environment. I wonder: Have earth matters improved since the early 1980s, when I began? Or, are things worse off? Where do we go from here?
Two things are evident. First, there is no doubt that environment holds centre stage in the country. It is talked about extensively; considered in policy; frankly, nobody today would dare to say they aren't environment-friendly.
Car companies sell their products for luxury and sustainability; real estate giants boast about rainwater harvesting systems; Bollywood stars dance their fondness for all things green. And governments say they want low-carbon economies for the future. Being green is the "in-thing".
This is an achievement of three decades of environmental activism, but a key difference as well. In the early 1980s, there was some awareness about environmental issues, but these were thought fringe, marginal, seen at best as a fad of some lovers of bees and birds.
Second, in spite of this phenomenal growth in green consciousness, the real matter is going from bad to worse. The pollution in our rivers is worse today than what it was three decades ago.
The garbage in cities is growing by the day, even as governments scramble to find ways of reducing plastic and hiding the rest in landfills in far-off places. Air pollution in cities is worse and toxins hurt our bodies, damaging our lungs. All in all, the report card is not good.
Perhaps, the only sector which can claim success is forest protection -- remote-sensing data shows green areas are growing. But such protection has come at the cost of local economic growth of people who live in and around these areas. The poorest people of India still live in its richest forests. Clearly, not the way ahead.
So, where do we go from here? As a society, we increasingly care about environmental issues. This is good. But as a society, we are increasingly failing to manage the environment. We are failing in two ways here. One, in managing the ecological fallout of economic growth -- pollution and toxification, which come from generating wealth.
Two, how to use the wealth of the natural environment to build economic well-being, what I call the development challenge of environment.
This is really because we, as a society, have to now graduate to not just caring about environment but also doing something. Very difficult: The answers will not come easy or cheap. They will require a new understanding of the way we do things, tough policies which change the direction of growth and difficult choices we make in our personal lives. This is the crossroads.
These are the same choices the environmental movement of the rich countries asked their countries to make, some two generations ago. They failed. This is why the challenge of climate change remains a challenge.
Today, these societies are rich; they have cleaned up their streams and their black smoke. But their economic growth and their lifestyle are putting the entire world at risk and they have no real answers to the future because they want to keep tinkering with the present.
They are looking to find small solutions to the massive problem of increased emissions, linked to growth.
The western environmental movement also has a history different to ours. It began after these societies had acquired wealth. So, the movement was a response to the garbage, the toxic air or the polluted water, resulting from the growth of their economies.
They had the money to invest in cleaning and they did. But because they never looked for big solutions, they always stayed behind the problem -- local air pollution is still a problem in most western cities, even if the air is not as black as ours. It is just that the toxin is smaller, more difficult to find or to smell.
They keep spending -- keep investing in technology to deal with the present. As such, the rich world's environmentalists are garbage managers, nothing more.
We want to emulate them, with much lesser resources and much more inequity and poverty. The fact is we cannot find answers in the same half solutions they invested in. This is the challenge of our next decade.
The next decade awaits us. Will we drown in our excreta and the spit of our cars and pretend that the problem has gone away? More talk, more conferences and more buzz about all things green? Or will we do things differently?
For instance, take the modern, convenient bus, and not just celebrate the answer of the fuel-efficient or hybrid car? Find different answers. The choice is ours to learn and make. Only ours. | <urn:uuid:78afb061-96a3-43b2-a3be-5cc86aa6cec0> | CC-MAIN-2022-33 | http://business.rediff.com/column/2010/jan/15/guest-going-green-take-the-bus-or-buy-a-hybrid-car.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.968704 | 968 | 2 | 2 |
Larry W. Reaugh, President and C.E.O. of American Manganese Inc.(TSX-V:AMY)( OTC PINK:AMYZF) (FSE:2AM) is pleased to report on new government actions that will positively affect lithium-ion battery recycling around the world.
The regulations and government actions are as follows:
“These actions are signs that governments are looking to incentivize innovation,” said Larry Reaugh, CEO of American Manganese. “AMY’s pilot testing has surpassed the proposed recovery regulations and positions the Company front and center in the effort to meet these new government objectives”.
AMY also reports progress on other fronts:
AMY’s research and development contractor, Kemetco Research, has obtained preliminary results on the previously announced cathode material samples received from the U.S. Department of Energy’s Critical Materials Institute project and will be announced when completed.
batteries greatly favours AMY’s Pilot Plant tested technology as a leader in closed circuit green technology for recovering of up to 100% of the valuable cathode metals,” said Mr. Reaugh.
The Company expects to receive a proposal from Kemetco on the budget for the Preliminary Economic Assessment and engineering design in the near term. In support of the commercialization plans, American Manganese is applying for a second grant application from the Canadian Government. American Manganese looks forward to providing updates to these initiatives when possible.
American Manganese Inc. is a critical metals company focused on the recycling of lithium-ion batteries with the RecycLiCoTM Patented Process. The process provides high extraction of cathode metals, such as lithium, cobalt, nickel, manganese, and aluminum at battery-grade purity, with minimal processing steps. American Manganese Inc. aims to commercialize its breakthrough RecycLiCoTM Patented Process and become an industry leader in recycling cathode materials from spent lithium-ion batteries.
Talisker Resources Ltd. (TSX: TSK) (OTCQB: TSKFF) is pleased to a... READ MORE
GoGold Resources Inc. (TSX: GGD) (OTCQX: GLGDF) is pleased to an... READ MORE
HIGHLIGHTS New high-grade silver and lead vein system discovered ... READ MORE
Drill Highlights: 100% of all holes completed to date on the Sure... READ MORE
Titan Mining Corporation (TSX: TI) announces the results for the... READ MORE
We acknowledge the [financial] support of the Government of Canada. | <urn:uuid:ea8b5a6f-8d93-400d-8073-8c3e0866fdf6> | CC-MAIN-2022-33 | https://theprospectornews.com/american-manganese-inc-reports-on-significant-international-government-actions-to-boost-recycling-of-lithium-ion-batteries/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.927788 | 549 | 1.625 | 2 |
Cnemaspis anandani, a rocky gecko endemic to the Western Ghats; Sphaerotheca magadha, a burrowing frog found in the agricultural fields of Jharkhand; Enoplotrupes (Enoplotrupes) tawangensis, a Tawang dung beetle; Ginger Amomum nagamiense, a variety of wild ginger found in the forest behind Kohina Zoo in Nagaland; and Pteris subeiana, a wild fern found not only in Kerala, but also in Tamil Nadu and Maharashtra; These are just some of the 544 reasons India needs to applaud, with the Zoological Survey of India (ZSI) and Botanical Survey of India (BSI) kicking off the 2019 Animal Discoveries and 2019 Plant Findings on Friday.
- The messages were posted by Babul Supriyo, Union Minister of State, Ministry of Environment, Forests and Climate Change, during an event at the Acharya Jagadish Chandra Bose Indian Botanical Garden in Howrah, West Bengal .
- Animal Discoveries 2019 lists 368 species of fauna as new to science and 116 species as the first records from India. “The publication provides details on 360 new species, four subspecies and four fossil species, as well as 116 species first recorded in India,” said Kailash Chandra, director of ZSI.
- Among the new discoveries, 294 species are invertebrates and 74 are vertebrates.
- Insects outnumbered other groups overall and in vertebrates fish diversity is high with 38 new species and five new records. Dr Chandra said that with the new discoveries and new records, India’s wildlife diversity is 1.02,161 species, which is equivalent to 6.52% of all species in the world.
- The director added that in addition to conventional taxonomy, ZSI has introduced modern methods such as DNA barcode, whole genome sequencing and X-rays for the identification of new species.
- Plant Discoveries 2019 lists 180 new plant species and 73 new records discovered in the country.
- New registrations in a country refer to animal or plant species discovered in other parts of the world and registered for the first time in the country.
“This volume of plant discoveries contains 134 plants with seeds; five ferns and allied ferns; six bryophytes; 18 lichens; 51 mushrooms; 23 algae; and 16 microbes. In 2019, vascular plants contributed 55% of all new discoveries and registrations, while non-vascular plants contributed 45%, ”said A. A. Mao, director of BSI.
- Dr Mao said that among the new discoveries this year were plants of horticultural value as well as those which can serve as alternative food such as arid, syzygium (wild jamun), impatiens, mushrooms and zinc fibers, among others.
- The number of plant species found in India according to BSI is 50,012 and represents about 12% of all flora species in the world.
- ZSI and BSI have published Animal Finds and Plant Findings since 2007, and this is the thirteenth publication in the series. Analysis of data from the last decade reveals that a total of 2,444 species of wildlife communities have been recently described in India, while the number of plant species described in the same period is around 3,500.
- Most of the new finds were reported from biogeographic hotspots across the country.
- Data provided by BSI indicates that 28% of all plant discoveries in 2018 were made in the Western Ghats in 2019; followed by the eastern Himalayas (21%); the east coast (11%); and the eastern plains (10%).
- The west coast contributed 7% of the total discoveries, while the western Himalayas contributed 6% of the finds.
- “The maximum number of discoveries (of flora) have been made in the state of Kerala, followed by Maharashtra, Tamil Nadu and Arunachal Pradesh,” the BSI publication said. | <urn:uuid:7f2bd059-f63d-409e-906e-d2bd6180d037> | CC-MAIN-2022-33 | https://confidantclasses.in/edu-news/2020/10/animal-discoveries-2019-lists/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.93398 | 845 | 3.21875 | 3 |
Tax Evasion Lawyers in Bloomsburg
In Pennsylvania, "tax evasion" is a crime that involves a purposeful failure to pay the taxes that the taxpayer legally owes.
Usually, tax evasion is accompanied by an attempt to make it appear to the government of Bloomsburg, Pennsylvania that one's tax liability is lower than it actually is. This can include concealing income, making fraudulent transfers of property, and other illegal activities.
You may also be acquainted with the term "tax avoidance." It is crucial that you don't confuse this with "tax evasion." Tax avoidance is perfectly legal, and is probably something that every taxpayer does whenever they file, whether they know it or not. It involves employing legal methods to make one's tax liability as small as possible, taking advantages of deductions and other tax breaks.
Penalties for Tax Evasion in Bloomsburg, Pennsylvania
Both federal law and the law of Pennsylvania treat tax evasion as a severe criminal offense.
Punishments for evading one's taxes in Bloomsburg range from paying back taxes plus interest (a relatively mild punishment) all the way up to years in prison, and penalties in the hundreds of thousands of dollars.
In the majority of tax evasion cases, however, the punishments are not so severe. This is particularly likely in first offenses, when the amount of money involved is fairly small. Minor punishments for tax evasion usually mean a small fine, on top of an order to pay whatever taxes the taxpayer owes. A minor punishment is most likely when the government has trouble proving that fraud was involved, as opposed to an honest accounting error.
But, if the government can prove that a defendant in Bloomsburg, Pennsylvania purposely concealed income, in order to get out of paying taxes, a court will most likely impose the heaviest penalties allowed by law, including enormous fines, and several years in prison.
A Bloomsburg, Pennsylvania Tax Evasion Lawyer Can Help
Attorneys in Bloomsburg, Pennsylvania who practice tax law can help you stay in conformity with your tax commitments. This is a good way to confirm that you won't be suspected of tax evasion in the first place.
In the unfortunate event that you're really charged with tax evasion, it's crucial that you hire a reliable tax attorney in Bloomsburg, Pennsylvania. If you are actually innocent, your tax attorney can help make sure that you have the best chance you can of being found not guilty. | <urn:uuid:3e1556f0-224c-4f67-9e7a-1925d8b135ad> | CC-MAIN-2022-33 | https://taxattorneys.legalmatch.com/PA/Bloomsburg/tax-evasion-lawyers.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.967649 | 506 | 1.679688 | 2 |
Nowadays, Some girls are just born with the beach in their soul poster help customers to have a good appearance. Not only work environment but also hangout purpose. Indeed, T-shirts are attributes of good materials, which made from the foremost comfy and highest quality materials. It gives positive emotion including soft and comfortable and also amazing colors bright. Which allow you to tricky or dazzling attain the desired achievement.
Some girls are just born with the beach in their soul poster
A beach is a landform alongside a body of water which consists of loose particles. The particles composing a beach are typically made from rock, such as sand, gravel, shingle, pebbles. The particles can also be biological in origin, such as mollusc shells or coralline algae. Some beaches have man-made infrastructure, such as lifeguard posts, changing rooms, showers, shacks and bars. They may also have hospitality venues (such as resorts, camps, hotels, and restaurants) nearby. Wild beaches, also known as undeveloped or undiscovered beaches, are not developed in this manner. Wild beaches can be appreciated for their untouched beauty and preserved nature. Beaches typically occur in areas along the coast where wave or current action deposits and reworks sediments.
Do you love Some girls are just born with the beach in their soul poster?
There are several conspicuous parts to a beach that relate to the processes that form and shape it. The part mostly above water (depending upon tide), and more or less actively influenced by the waves at some point in the tide, is termed the beach berm. The berm is the deposit of material comprising the active shoreline. The berm has a crest (top) and a face—the latter being the slope leading down towards the water from the crest. At the very bottom of the face, there may be a trough, and further seaward one or more long shore bars: slightly raised, underwater embankments formed where the waves first start to break.
Thanks for your support
Thank you for considering our T-shirt design to know more about my professionalism, background and also production experience. We look forward to getting an opportunity of advising with you further. And how we can significantly contribute to the ongoing of your reputable appearance. Concurrently, this professional design will be delivered to end-customer within 3-5 days. | <urn:uuid:5215909b-f6a0-41c6-8278-01681a611f0a> | CC-MAIN-2022-33 | https://shirtnation.net/product/some-girls-are-just-born-with-the-beach-in-their-soul-poster-2/?rating=3 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00265.warc.gz | en | 0.96656 | 485 | 1.695313 | 2 |
Many new writers are confused with what is the main difference between copywriting and content writing. Mostly, it’s the same but there is a KEY difference between the two.
Copywriting vs Content Writing
Copywriting is done to persuade someone to take an action, usually to get them to purchase something. While, Content writing is for education, entertainment, and brand awareness.
Think of it this way:
Let’s say you want to get people to share an article. If that article is all about pushing readers to buy something, it’s not going to get shared. No one wants to share that with their friends, but if you create an article that educates people, that article is more likely to get shared. This increases brand awareness and gets people introduced to your company/brand as an authority, which in turn could lead to people purchasing from you if done correctly.
What Does A Copywriter Do?
A copywriter has only one goal: persuade people to take action. That action is usually to get people to buy something. This could be to get people to open the email, click on a link, or even get people to pick up their phone and call.
Examples of Copywriting:
- Sales Letter
- Promotional Email
- Video Sales Letter
- Press Release
- Print Ads
What Does Content Writer Do?
A content writer writes content for the purpose of educating, and entertaining & many times for the purpose of Search Engine Optimization.
You will probably excel as a content writer if you have an in dept knowledge about a certain topic. This will allow you to simplify complex topics and write them to make people understand.
Examples of Content Writing:
- Educational blog post
- How To Guides
Copy vs Content: Which One Is More Important?
Both copywriters and content writers are part of the same coin. They are equally as important to drive more sales.
A content writer helps build a brand and brings in an audience in a non-pushy way to educate or inform them. Content writers can help you build your authority as an industry leader and the copywriter finishes the last mile, by persuading them to make the purchase. | <urn:uuid:ed97e963-398b-4fcc-bbe9-2bbd0ddd490e> | CC-MAIN-2022-33 | https://copywriter.net/copywriting-vs-content-writer-key-diffrence/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00265.warc.gz | en | 0.959503 | 465 | 2.265625 | 2 |
Written by Eli Grey, Digital Services Assistant, Genealogy & Local History Department, Downtown Main Library
On the first Thursday of each month, our Genealogy & Local History Department, opens a new window "throws back" to a time in Cincinnati's history that is featured in the Library's wide-ranging collection of more than 9 million materials.
Maud Hunt Squire and Ethel Mars are two local artists who were notable in their time but have since fallen into obscurity. Their innovations in woodblock prints are what they were most known for, but they worked in multiple mediums. Several museums, including the Cincinnati Art Museum, have their work in their collections.
Getting Schooled at the Art Academy
Maud Hunt Squire was born in Milford in 1873 and lived in Price Hill with her parents. She learned art from her mother and music from her father, who owned a music shop.
She attended the Art Academy of Cincinnati from 1894-1898. There she met the woman she’d spend the rest of her life with, Ethel Mars.
Mars was born in Springfield, Ill., in 1876. She attended the Art Academy of Cincinnati on a scholarship. She and Squire took classes, such as still life and figure drawing, taught by notable artists Frank Duvenek and L.H. Meakin.
They met their close friend Edna Boies Hopkins. Hopkins also met her lifelong partner—her husband—at the Academy. While students, Squire and Mars were in art shows and made illustrations for books, such as Robert Louis Stevenson's A Child's Garden of Verses.
Both couples traveled and then settled in Paris, where their apartments were almost next door.
French Connection: Working in Paris, Provincetown, Vence
Paris had a lively art scene and there were many American immigrants and European artists residing or traveling there. Mars and Squire met many notable artists, such as Claude Matisse and Marc Chagall. When World War I broke out many Americans left Europe. Squire, Mars, Boies Hopkins, and other artists settled down in Provincetown, where they made woodblock prints and taught others the process.
They returned to France after the war but often traveled back to the United States to visit their families, and other parts of Europe. They bought land and constructed a villa in Vence, in the southeast part of France.
Among their notable friends was Gertrude Stein, a lesbian writer and art collector. They were active in her Paris salon. Stein wrote a short story “word portrait” titled Miss Furr and Miss Skeene in 1923, based on Ethel Mars and Maud Squire. It contains oblique references to the artists’ lives, such as visiting family and Squire’s brother in Paris. It uses frequent repetition—the story is only 2,100 words but uses “gay” over 100 times.
“They were quite regularly gay there, Helen Furr and Georgine Skeene, they were regularly gay there where they were gay. They were very regularly gay.
To be regularly gay was to do every day the gay thing that they did every day. To be regularly gay was to end every day at the same time after they had been regularly gay. They were regularly gay.”
It’s considered the first literary use of “gay” used to mean homosexual, about 50 years before that became common. It plays on the multiple meanings of gay—referring to their relationship, happy attitudes, and how they loved vivid colors in dress and in their art. They were noted for their bold personal fashions; purple, “flamingo orange,” and half-bleached half-black were hair colors they sported. They favored heavy colorful makeup and bright clothing; their appearances were compared to Fauvist paintings.
How exactly the women identified is unknown, as they wrote down little about their relationship. The Helen Furr and Georgine Skeene story implies they “went with men” in some fashion and Mars was known to take lovers of unknown genders. But the over 50 years they lived together is its own testament to their commitment to each other.
Once in their 50s both women, especially Squire, stopped making as much art as they used to. They no longer made woodblock prints but did drawings, oil paintings, and watercolors. During World War II, Mars and Squire moved to another part of France to hide. They returned to Vence after the war.
Squire died around 1954 and Mars died in 1959. They are buried together in Saint-Paul-de-Vence, France.
View more Throwback Thursday blog posts from our Genealogy & Local History Department.
More to Explore
Follow in the footsteps of our Genealogy & Local History Department in their journey to tell the story of Maud Hunt Squire and Ethel Mars. Make new discoveries with resources used to inform this month’s Throwback Thursday post: | <urn:uuid:fda07e6e-c31c-47d7-b804-58f1d6b4825d> | CC-MAIN-2022-33 | https://chpl.org/blogs/post/artists-maud-hunt-squire-and-ethel-mars/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.984523 | 1,040 | 2.75 | 3 |
On Monday, December 6th, the Church will celebrate the Feast of St. Nicholas. Nicholas is reverenced by both the Orthodox churches of the East and Catholic Church, as well as by some Protestant denominations. He is invoked as the patron saint of sailors, merchants, archers, boxers, thieves (repentent), prostitutes (reformed), children (naughty and nice) pharmacists, pawnbrokers, fishermen, and still more. The Christians of the Orthodox East know the saint as “Nikolaos o Thaumaturgos” or “Nicholas the Wonderworker.” His wonders include (but are not limited to)- saving children from being murdered by an evil butcher and made into meat pies, rescuing three young ladies from a life of prostitution, multiplying grain at a time of famine, and guiding sailors safely into port by appearing in a halo of light over the mast of their ship- all this as well as numerous cures and miraculous interventions.
There is much that is memorable concerning Saint Nicholas. My favorite story is his legendary encounter with Arius or an Arian bishop at the Council of Nicea in which Nicholas decked his interlocutor. (Remember, Arius caused a great deal of mischief by asserting that Christ was a god-like being lower in divine status than God the Father). Nicholas later apologized to his brother bishops for his conduct but insisted that Arius was wrong in his construal of the relationship of Christ’s divine and human natures. The Council of Nicea sided with Nicholas, not in terms of the brawl, but in terms of the orthodox understanding of Christ’s identity.
In the year 1087, the relics of Saint Nicholas were “appropriated” for safekeeping by Italian sailors and taken from the saint’s shrine in Myra (located in Turkey) to the southeastern town of Bari. In the 1950’s the reliquary containing the saint’s remains was opened and the contents revealed a nearly intact skeleton of a man about 5 ft. tall with a broken nose. Maybe Arius was able to get in a good right jab before Nicholas cleaned his clock. Recently, the government of Turkey requested the return of his relics to Myra, citing that the circumstances by which they came to Bari was illegal. I don’t know the current status of this complaint, but I think that relics should remain in Bari until the circumstances regarding the legality of the “appropriation” of Hagia Sophia are part of the negotiations.
Saint Nicholas’ generosity is ritually re-enacted each year by children who place their shoes out the night before his feastday so that they can discover gifts left by the saint in their shoes the following morning. Children with large feet are particularly excited about and observant of this custom, but with the development of the gift card, even children with small feet now eagerly anticipate the saint’s appearance. In some European countries a costumed version of the saint, complete with miter and crozier, makes his rounds bringing gifts to the children. However, there is a dark side to this visitation, as the costumed saint is accompanied by a person dressed as an demonic imp who is there to mete out punishment to unruly children. Some children will receive a switch of wood in their shoe as a warning of what is to come if behavior does not change. Children who are particularly disruptive are to be placed in a large sack and taken to parts unknown. The manner in which grace and retribution are juxtaposed in all this must be received by the children as postively delightful. Had I known about this custom as a child, I would have spent December 6th hiding behind a locked door.
The combination of a Protestant aversion to saints and Catholic reverie along with secularist ideology created a mutated version of Saint Nicholas which is called Santa Claus (you can hear a hint of Sanctus Nicholas lingering in this character’s name). Santa Claus is not a bishop or a saint or a real person but a symbolic representation of American culture’s annual winter gift exchange (I would use the term “holiday” here but I am sensitive to the fact that the word is derivative from “holy day,” and I fear give offense to those who are offended by idea that there is something sacred or holy other than the experience of being offended). Santa Claus brings gifts as Saint Nicholas was formally allowed to do, and he has some kind of magic list of children that distinguishes the naughty and the nice, but he no longer employs a demonic imp as an assistant. I imagine elves are cheaper and reindeer more docile. The famous cultural narrative that explains the association of Santa Claus to retail culture is a film entitled “Miracle on 34th Street.” I wonder what that film would have been like if the character played by Natalie Wood had discovered that one of the employees at Macy’s Department Store was actually a fourth, century Greek bishop. Now that would be a miracle!
Each year around this time I hear stories concerning the war against Christmas, which seems to me to be about Christian resistance to the secularization of one of the holiest days of the Christian year. The popular culture hosts an annual festival of wintry themes that coincides with the Church’s observance of the birth of Christ and tries its hardest to maintain the secular obervances without disclosing the true reason for all the fuss. In fact, much of what the popular culture seeks to accomplish from the day after Halloween (I mean Thanksgiving) until December 25th is fueled by the vapors of an inherently Christian, or more specifically, Catholic cultural phenomenon. Somehow, in a culture so influenced by the starkest forms of Protestantism and secularism, the Catholic festival of Christmas (Christ-Mass) has gained a great deal of cultural prominence. Unbeknownst to many, Christmas did not receive much attention prior to the nineteenth century in either Britain or the United States owing to the work of Oliver Cromwell and his heirs to stamp out the observance because of its evident “popery”. Many of those who express a contemporary aversion of Christmas are the heirs of Cromwell, the only difference being his objections were crudely theological while modern forms are crudely ideological. Charles Dickens did much to overcome the lingering cultural aversion to Christmas and he also created the Christmas fantasia that fills so many with thoughts of holiday (am I allowed to say Christmas?) cheer.
The secularization of Christmas is also the result of more than a century of clever marketing and brand building by retailers who have discovered the celebration to be one of the greatest financial windfalls in history. Secularizing the occasion makes good business sense as it permits many who could care less about the birth of Jesus of Nazareth to share in the benefits of gift receiving and take advantage of all the sales and discounts. If it was all just for Christians, the narrowing of the market would make the celebration much less profitable, thus the conscious and deliberate strategy to tone down the Christian specifics of the celebration.
The real substance of Christmas is rooted in the liturgical observances of the Church’s year of prayer in worship in which the mysteries of salvation are displayed and remembered to the faithful. This calendar was once the basis for the popular culture of our European forebears. Protestantism rejected most of this calendar and the festivity that accompanied its practice, viewing it all as being bound by the “Law” and far too pagan for their sensibilities. I remember a few years ago a rather prominent suburban “mega church” announced that it would be closed for Christmas. Reports of outrage followed. I shrugged my shoulders and thought that they were just being good Protestants. Secularism completed the work of the Protestant reformers by further clearing the calendar of “religious” commemorations and insisted that the public festivities of the Church be sequestered from view by being placed behind closed doors. The festivities of December 25th have curiously endured, though it seems that the hold of Christmas on the culture’s imagination grows more and more tenuous each year.
In terms of the liturgical calendar, the date of Christmas is calculated nine months from the day of the Solemnity of the Annunciation on March 25th, a day which commemorates the Incarnation of Christ in the womb of his Mother. It is because of this ancient feast, one even more ancient than the liturgical and cultural observances associated with Christmas, that the Church celebrates the birth of Christ on December 25th. The liturgical calendar also includes a day which honors Saint Nicholas the Wonderworker, who is a real person whose love for Christ became the meaning and purpose of his existence.
For Catholics, what is recalled about Nicholas is not just his mighty deeds, but his continued participation in the life of the Church as a member of the Communion of Saints. Through our participation in the Eucharist we celebrate his life and witness, he celebrates with us from his place in heaven, and together we worship the Lord who took flesh in the womb of the Virgin Mary. There is therefore a spirit of Saint Nicholas that transcends the boundaries of heaven and earth, a spirit which is greater than Nicholas himself, for it is truly the Holy Spirit, sent by Christ, which every saint bears into the world. This Holy Spirit reminds us that while many in our culture wage a war against Christmas, we know that Christ’s victory has already been accomplished, and his triumph is evident in not only the witness of saints like Nicholas, but in the willingness of Christ’s followers in every age to proclaim boldly, and even defiantly, that the Holy Child born in Bethlehem is truly Christ the Lord. | <urn:uuid:b9d11f26-ccbb-421a-867f-9ca81c7d8612> | CC-MAIN-2022-33 | https://www.wordonfire.org/articles/saint-nicholas-and-the-battle-against-christmas/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.974801 | 1,994 | 2.265625 | 2 |
Perspectives on business ethics in South African small and medium enterprises
AbstractSMEs are the driving force of economies. However, they face challenges that affect their long-term survival, such as developing ethical business environments. Business ethicsrelated research is underdeveloped in SMEs, thus limiting our understanding of business ethics in SMEs. The purpose of this qualitative study was to investigate how business ethics is conceptualised in SMEs, using the Delphi Technique. In SMEs, business ethics is viewed as doing the right thing, having integrity, being transparent, trustworthy, and behaving responsibly towards internal and external parties. The contribution of this article is that business ethics is perceived as upholding quality, being transparent and trustworthy.
This journal is an open access journal, and the authors and journal should be properly acknowledged, when works are cited.
Authors may use the publisher's version for teaching purposes, in books, theses, dissertations, conferences and conference papers.
A copy of the authors’ publisher's version may also be hosted on the following websites:
- Non-commercial personal homepage or blog.
- Institutional webpage.
- Authors Institutional Repository.
The following notice should accompany such a posting on the website: “This is an electronic version of an article published in the African Journal of Business Ethics, Volume XXX, number XXX, pages XXX–XXX”, DOI. Authors should also supply a hyperlink to the original paper or indicate where the original paper (http://ajobe.journals.ac.za/pub) may be found.
The following Creative Commons license applies:
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. | <urn:uuid:b6f5e8d5-0405-4ee7-980f-e3f2a2e6c8d2> | CC-MAIN-2022-33 | https://ajobe.journals.ac.za/pub/article/view/285 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.904669 | 354 | 2.046875 | 2 |
A little extra knowledge goes a long way, especially when it is about something as complex as sex. From being taboo to a reproductive process to a pleasurable act, sex can be a lot of things to different people – and animals, too! Human sexual intercourse is both different and the same as that of animals. Get to know some amazing sex facts, animal facts, and biology-related facts that would get you mind-blown!
- The word sex came from the Latin ‘sexus’ meaning ‘state of being either male or female’.
- It was first associated with ‘sexual intercourse’ in 1929.
- Being sexually aroused makes you less likely to feel disgusted over anything or anyone.
- Sexual arousal also increases your pain threshold.
- 30 minutes of sexual intercourse can burn approximately 200 calories.
- Satisfactory sexual intercourse only lasts 3-13 minutes instead of the portrayed fantasy of having to last for hours.
- The more open you are to talking about sex, the happier you are in your sex life.
- Male orgasm usually comes from or includes vaginal intercourse.
- On the other hand, female orgasm most likely stems from multiple sex acts.
- Women tend to have a more regular menstrual cycle when they have sex at least once a week than when they do less often.
- More orgasms make you more likely to live longer.
- On average, the size of an erect penis is 5-7 inches in length and 4-6 inches in girth.
- Sperm can survive inside the female’s body for up to 7 days.
- Semelparity occurs when an animal engages in a sex episode too intense that it ends up dying.
- STIs are a common disease among dolphins.
- On average, a sex session passes with 100-500 thrusts.
- Marriage strengthens the skeletons of men who wait until after 25 to marry.
- Alabama prohibits any sort of sex toy trade and is the only state upholding said law.
- Dogs tend to get sleepy during intercourse due to the ‘rest and digest’ function that orgasms activate in their nervous system.
- Whales have the largest penis in the animal kingdom with an average length of 10 feet.
Humans go through a 4-phase sexual-response cycle during intercourse.
This cycle refers to the series of events that happens to your body when you become sexually aroused and engage in sexually arousing activities. First comes the excitement stage, followed by the plateau, orgasm and then the resolution. Each phase has no definite beginning or end and is all part of the ongoing process of sexual response.
All 4 phases of the sexual-response cycle happen to both men and women but with different timing.
During intercourse, orgasm usually occurs in men first while it can take up to 15 minutes for women. That is why simultaneous orgasm within single intercourse is a rare occurrence.
It is not only the genitals but the entire body which has the capability to experience arousal, stimulation, and pleasure.
Focusing only on the genitals during sex might lead to performance pressure. Hence, it is highly recommended to pay attention to arousing the whole body and stimulating other body parts like the torso and limbs. Genital-centered coitus is a common cause of having dissatisfactory sex even in long-term relationships.
Sexual intercourse should never be painful for anyone engaging in it.
For some reason, there is a notion dictating that sex hurts for women and that that is just how it goes. It might get uncomfortable when it is the first time, but it should not be painful after that. If it is, then you might need to seek advice from your doctor.
Sex is beneficial for your health as it is for your pleasure.
Doing the deed gives people higher levels of the substance that defends your body from viruses and germs. Research also showed that employees that are sexually active use fewer sick days.
Sex was found to induce improved sleep.
There is a reason why you relax quicker after sex, and it is a good one. After sex, orgasm releases prolactin, the hormone responsible for the sensations of relaxation and sleepiness.
Sex improves bladder control among women.
Good sex feels like a nice workout for a woman’s pelvic floor muscles. In turn, having a strong pelvic floor is essential in preventing urinary incontinence, a common condition among 30% of women. Having orgasms strengthens those muscles when prompting contractions in the area.
Sex counts as an excellent form of exercise.
People burn around 5 calories every minute of the deed, beating watching TV with over 4 calories. Aside from making you use various muscles, it also jolts your heart rate. And just like with exercise, being consistent aids in maximizing the benefits.
Having sex frequently increases the quality of a man’s sperm.
Also, it increases fertility and reduces the chances of DNA damage. ESHRE claims that men who ejaculate or have sex daily produce semen of higher quality and viability than those who do not. This approach might be helpful for couples trying to conceive yet battling mild fertility problems.
Your brain system might have an influence over the number of sexual partners that you have had or will have.
When shown sexual images, people who showed more brain activity tend to have more sexual partners than those who do not. It shows how sexual urges may vary from each individual.
Most women are not able to climax by vaginal intercourse alone.
Instead, they also need clitoral stimulation to reach the Big O. Only 29% of women reported reaching orgasm, quite a far reach for that 75 % of men who did.
Abstaining from any sexual activity for 3 weeks might just be the trick for the ultimate orgasm.
Scientifically speaking, this amount of time is how much it takes for a rise in testosterone levels and a boost in the libido.
Women whose vaginas have direct exposure to semen turn out less prone to depression.
In a more direct approach, it means having sex without using a condom. Studies show that semen has mood-altering hormones which the female body absorbs through the vagina.
An Oakland University research found that cunnilingus served as a retention strategy for men.
It means that these men only ‘go down’ on women so that they would not leave.
It is normal for your body temperature to increase during arousal.
This explanation is for when your face and chest part turns red while doing it. As the blood flow and heart rate increases during sex, pinkish-red rashes develop the ‘sex flush’ which wanes shortly afterward.
It is possible for a person to reach orgasm while sleeping.
Despite the absence of physical stimulation, female genitals can experience blood flow through a sensual dream. It can increase as much as it could during actual intercourse and this flow boost could approach orgasm. Hence, some women might reach the big O while having erotic dreams in their sleep.
Your sleep position can provoke sex dreams.
Apparently, sleeping face down on your stomach and your arms drawn above your head might give you more sexy dreams. The scope also includes having romances with celebrities.
Wine aroma has stimulating effects on both genders.
Many wines are found to give off scents that imitate human pheromones. These chemical substances generate humans’ behavioral responses.
The term ‘fetish’ came from the Portuguese word ‘feitico’ which means ‘charm’ or ‘sorcery.’
In Western culture, the most popular fetishes are the feet and shoes.
According to a physician, women have the upper hand in the bedroom when it comes to orgasmic advantages.
This concept stemmed from the research that female orgasms have an average duration of 20 seconds. Aside from having orgasms 3 times longer than men (average 6 seconds), women can also have multiple G-spot orgasms. How great would it be to have a partner that can maximize these perks!
The sole purpose of the clitoris is for a woman’s pleasure.
No, it has no use in human reproduction.
The clitoris is the female’s version of a tiny penis.
Aside from being similar to the penis in sensitivity and function, the clitoris also resembles the tip of the penis. It also becomes larger and fills with blood once a woman gets aroused.
The clitoris has 8,000 nerve endings.
It is also considered a nerve powerhouse, considering that it has twice the amount that can be found in the penis.
The English language recognizes around 1,000 vulva euphemisms.
A few of them are the coochie, cha-cha, muff, pootang, and va-jayjay.
The vagina is a self-cleaning organ.
Surprisingly, that is a similarity between the genital and the eye. It also means that it is not necessary to clean the passage with anything.
That weird sound that you hear during sex is not ‘vagina fart.’
It is called ‘queef’ and it occurs when the vagina releases the trapped air. Aside from sex, queefing can also happen when a woman is sitting cross-legged, working out or when placing something inside the vagina. Unlike the real fart, it does not emit any smell.
Clitoral atrophy befalls a woman who do not have sex for long periods.
This medical condition comes in the form of a loss in sexual sensation. The clitoris withdraws into the body when it is not receiving enough blood flow. On the other hand, males also experience penile atrophy but for the reason of injury or aging.
Nipple only pertains to the center portion of the breast, while the pigmented area around it is called areola.
The nipple has a direct connection to the mammary glands and it is where the milk is produced.
Female nipples were once used to diagnose the health of women in olden times.
Doctors and nurses include determining nipple color when it comes to examining a woman’s health.
Nipple piercings were found to generate positive emotions.
A 2008 study found that women who got nipple piercings would willingly do it again, but not because of kinky stuff. In addition to how they like its appearance, some of them linked the pain to sexual gratification.
Sexual arousal can also come from nipple stimulation for both genders.
While some say that this satisfying foreplay enhances their sensual arousal, there are a few who claim otherwise. Either way, it would always be better to ask your partner first than assume.
‘Nipplegasm’ is a real thing for women.
fMRI research showed that nipple stimulation also arouses the same brain region as with the arousal of the clitoris, cervix, and vagina.
Both men and women are attracted to nipples.
When it comes to looking at women, both genders were found to follow the same eye patterns. They immediately go over the breasts and other sexualized body parts prior to looking at the other areas.
A woman’s menstrual cycle affects her libido due to hormonal fluctuations.
Some women speak of increased sex drive during ovulation, the phase 2 weeks prior to your period. Still, others claim that they feel more turned on while on their period.
Women tend to be more attractive during ovulation.
Although women may be completely unaware of it, men become subconsciously drawn to women in their ovulating phase. It is also possible for exotic dancers to earn heaps more during this week of the month than the others.
Birth control can have an effect on how women perceive men.
Studies show that women who take hormonal birth control are more attracted to men who have less masculine features and lower testosterone levels.
The most orgasms award goes to the lesbians.
From a study over the correlation between orgasm occurrence and sexual orientation, it was discovered that heterosexual women reached climax more than homosexual women and bisexual women.
Size does not really matter as much as the media makes it seem.
Extra-large penises are overemphasized more than necessary. Still, most women prefer something closer to a fun-size from their partners. The research found that women tend to cheat on their ‘large’ husbands as they associated the thing with ‘pain and discomfort’ during intercourse.
A man’s body odor is a turn on for women.
That is why it is logically a good idea to try to get it on once the guy is back from the gym and has taken his shower.
A man’s fingers have a connection to his testosterone levels.
The longer his ring finger is than his index finger, the higher his testosterone levels are.
Priapism occurs when even after ejaculation, a sore erection still persists.
As painful as it already is, it can end up in permanent damage when not treated promptly.
Men may struggle to get it on with a partner after too many self performances.
This condition is called the ‘idiosyncratic masturbation style.’ It happens when men get used to the distinct pressure and speed that they manage from manual masturbation. Hence, they end up finding difficulty in doing the deed with a partner whether orally or vaginally. In conclusion, the experience is less than satisfying for both parties.
The source of stimulation affects the size.
Men reported larger erections after having oral sex. On the other hand, those who only received handjobs did not achieve that much.
High cholesterol is one cause of erectile dysfunction.
Eventually, having erectile dysfunction can forewarn a forthcoming cardiovascular disease.
The infamous g-spot is not exclusive for the ladies.
Men also have a similar body part wherein they feel extreme pleasure upon stimulation. It can be found under his bladder and is more commonly known as the prostate. However, you can only reach it by inserting a finger inside his anus and performing a circular movement.
Men can be categorized into ‘growers’ and ‘showers’ based on their thang.
Those in the grower section have penises that look bigger during erection. On the other hand, the shower ones do not get much penis growth while erect.
A teaspoon of semen carries an approximate calorie count of 5.
Semen content has more than 30 mixed substances including ascorbic acid, vitamin B12, cholesterol, citric acid, creatine, fructose, glutathione, inositol, lactic acid, nitrogen, pyruvic acid, sorbitol, urea, uric acid and other enzymes and salt variations. On average, a single ejaculation releases 2-5 million sperm that can travel up to 28 mph.
Neither the number of sexual acts nor the size of a partner or toy affects the color or size of the vagina and labia of a woman.
Despite the widely publicized internet myth, a vagina does not stretch out or have ‘ugly flaps’ due to the said causes. The vaginal canal is a muscle, therefore, it is flexible and has the ability to bounce back instantly. No penis or toy size will give it a permanent stretch. Lastly, each woman has a unique size and shape and does not indicate her procreative history or status.
Fertilization is not necessarily a race among sperm towards the egg.
Although most illustrations put it that way, it is not entirely true. Eggs are designed with a biological mechanism sophisticated enough to determine which sperm they would let in. Accordingly, the process does not always honor the first one to reach the finish line.
Switching positions while the penis is still inside the vagina can cause penile fracture.
It is all fun and games until the injury becomes a problem. This condition can also start from aggressive pumping, but it is still highly avoidable. Safety over the fun is the rule for this one.
Monogamy is not so common among animals.
They see fidelity as a hindrance to their reproductive potential. Still, species that produce a higher number of offspring have a tendency to remain loyal. Birds, for example, require care from both parents when it comes to raising chicks. Therefore, monogamy is a frequent set up for them.
Honey bees engaging in sex are in for sexual suicide.
Male bees or ‘drones’ fight for the ultimate chance to fertilize the virgin queen. However, his victory is literally his downfall as well. After the successful mating with the female, the male gets his penis and innards get torn from his abdomen and then he falls dead to the ground.
Bed bugs reproduction takes a brutal form called the ‘traumatic insemination.’
The process starts with the male stabbing the female in the abdomen. Their needle-like penis then injects sperm upon contact. Once inside, the sperm travel throughout the female’s body until it reaches her ovaries.
Male black widow spiders have to incline into an angle between the female’s fangs during coitus.
Only then would they be successful in doing the deed. However, female black widows often remain true to their name and end up swallowing their lovers after mating.
Pandas have hidden sensual talents.
Despite broad territories, male and female pandas are experts in locating one another just in time for ovulation. They do this by inspecting urine squirts on trees containing lowkey chemical DTF messages. Moreover, fertile females tend to mate with several males to have a greater chance of winning, or rather, producing offsprings.
In spite of their talents, pandas in captivity are hesitant in mating.
This situation makes legitimate use of ‘panda porn’ wherein experts show captive pandas videos of other pandas ‘in action’. Apparently, this method gets the lovely adorable bears in the mood.
During an erection, an elephant penis can be as heavy as 30kg.
In other words, wrongly touching an elephant penis may literally have you flicked around and knocked over.
Chimpanzees have spined penises.
While it can ultimately improve stimulation, it may also end up damaging females during coitus.
Cats also have spined or barbed penises, but for a different purpose.
It turns out, these felines are actually competitive in mating. The male uses its keratin spine to scrape out any remaining sperm competitor from inside the female. Moreover, cat species are also among the few mammals that have bones in their penises.
Sadly, forced sex is a common occurrence among birds.
Female ducks have even developed a defense mechanism to avoid unwanted gestations. They can command their genital tract to contract when a male tries to fertilize her forcibly. Then, the male’s corkscrew-shaped material cannot enter.
A female chicken’s version of dumping a partner is by ejecting his sperm from her body.
They copulate with various males. But once they intend to go for another male in the coop, they will discharge what is already inside them and choose a different father for her future chicks, or eggs. Human females can only wish!
It is more common for animals to pleasure themselves rather than seek opportunities with others.
Some known animals that are active in ‘auto-eroticism’ are bats, deer, dolphins, lions, walruses, warthogs and whales.
Male alligators don't erect penises their whole lives.
National Geographic demonstrated how their genitals spurt out like toothpaste from its tube. It then bounces back as if it is attached to a rubber band. You’ve got to check out this video!
It is possible for animals to switch roles in producing eggs and producing sperms during their lifetimes.
For example, young female reef fish can grow as males which then identifies them as ‘sequential hermaphrodites.’ This phenomenon is prevalent among taxonomic groups.
Male shark genitalia is referred to as ‘claspers’ rather than penises.
On the other hand, the opening in the females is called the ‘cloaca’ and serves as both a reproductive organ and a passageway for waste.
When sexually frustrated, a dolphin is not as cute and cuddly as it may seem.
The intelligent beings that they are, dolphins are known to practice gang rape, murder on their own youngs, kill porpoises, and even sexual assault on humans.
Sea otter also has a dark side when it comes to sensuality.
Sea otters have a reputation for kidnapping, raping, and killing seal pups.
Smaller marine iguanas apply auto-eroticism by rubbing themselves against rocks while advancing toward procreative females.
This behavior results in shorter lovemaking. Hence, bigger rivals are less likely to interrupt the smaller ones. Instead, it even increases their success in mating.
Sperm can last up to 5 years inside a female snake.
Even when she mates with various males, the female can control which sperm she will use in fertilizing her eggs.
Male snakes boast of having 2 penises called ‘hemipenes.’
Still, they cannot utilize both at the same time. Each hemipenis is connected to one testis.
Some invertebrates like snails and slugs possess both male and female sex organs.
Many of them can even fertilize their own eggs. Talk about independence!
The signature rock-like motionless positions of barnacles become a challenge in fertilization during the mating season.
Even so, a male barnacle’s tool can grow up to 8 times the regular size. It then ventures into a blind reach towards neighboring shells, depositing sperm upon insertion.
Lubricants are the top-seller among all sex toys.
Contrary to what you might think, these liquids beat both vibrators and dildos to the record.
R-rated film Fifty Shades of Grey piqued the sale of bondage materials.
Adam and Eve, an American adult toy company, reported an above 50% increase in sales due to the frenzy the film has caused.
Vibrators started as a cure for women hysterics.
Symptoms for the condition included peevishness, insomnia, nervousness, anxiety, erotic fantasies, heavy feeling below the abdomen and wet feeling between the legs. These ancient vibrators came in the form of vegetable oil applied on doctors’ hands which massage the ‘hysteric’ women’s lady parts until they reach climax.
Japan helps disabled people reach the big O.
The service is known as ‘Ejaculation Help,’ done by medical sex workers under the nonprofit organization named White Hands.
People tend to marry partners with a similar DNA pattern as theirs.
Prior to that, it is already known how people incline towards significant others who have alike characteristics. It includes age, income range, race, religion, and even upbringing. However, a PNAS study revealed that there is also a tendency for them to pair up with spouses of identical genetics.
Faking orgasms is not as bad as you think it is.
The act was often associated with people who are not enjoying the act or those who only want it done ASAP. But then again, sex is a performative act, and there are times when both partners find it too pleasurable that they get carried away.
What’s more, is that men do it too. Various fluids are in the works during sex that it sometimes makes it challenging to say whether one has already ejaculated.
Feeling sad after sex is a real condition.
People who experience post-coital dysphoria often display intense emotions of anger, sadness, and distress. It can happen after sex or masturbation and is most likely to surface after an orgasm. One known cause is a preceding trauma that came from sexual assault.
The most common sexually transmitted disease in the US is chlamydia.
Patients with this condition experience abnormal genital discharge with a smell, a burning sensation while urinating, itchiness around the organ, and pain during coitus. Unfortunately, it is also the most undiagnosed STD. | <urn:uuid:5f56bd4d-6324-4e5b-8f41-eaba7855128f> | CC-MAIN-2022-33 | https://facts.net/sex-facts/?utm_source=SB-bottom&utm_medium=linklist&utm_content=news&utm_campaign=internal%2Blinkshare | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.95542 | 5,025 | 2.8125 | 3 |
Governor Arthur Ifeanyi Okowahas asked President Muhammadu Buhari to convoke a national dialogue where all country issues will be addressed.
He asked the president to ensure that powers are devolved to state governments and resources kept at their disposal for development.
The governor made the call during a special thanksgiving service to celebrate the thirtieth anniversary of the State.
While noting that there are too many voices of anger calling for justice, fairness, and equity in the country, Governor Okowa said the President must take steps to listen to such voices.
“We are still a nation where so much power rests at the Centre with the Federal Government, and I believe that it is not right and it is time for more powers to be devolved to the states and more money and resources given to states.
“Nigeria will be better for it if we restructure, but the greatest challenge we have is as a result of insecurity, and it is pushing many people more into the poverty line.
“As a country, we are troubled, and there are so many ethnoreligious crises, but it’s time for us to sit down and talk; otherwise, we may not be able to continue as a nation.
“In staying as a nation, we must find solutions to the voices of anger, and we must dispassionately look for the opinion leaders in the different parts of Nigeria and speak truth to ourselves.” | <urn:uuid:b2f5ced4-b9cc-48b5-917b-b58180f93773> | CC-MAIN-2022-33 | https://wowplus.net/delta-at-30-devolve-powers-to-states-make-resources-available-to-them-gov-okowa-to-buhari/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.958992 | 303 | 1.726563 | 2 |
We are a Filipino-Chinese couple living in the heart of Manila. We have been together for 20 years and decided to make this podcast to share our life experiences. Our podcast has no format and may discuss random things like relationships, recommended food in Binondo or about our philosophy in life. If you like our podcast, don’t forget to click the subscribe/follow button and give us a 5 star rating ^.^ Please visit our FB page @kwentuhansessionsph and ig page @kwentuhansession. You can also ...
Manage episode 331492934 series 1596188
By Alabama History Podcast and Alabama Historical Association. Discovered by Player FM and our community — copyright is owned by the publisher, not Player FM, and audio is streamed directly from their servers. Hit the Subscribe button to track updates in Player FM, or paste the feed URL into other podcast apps.
Independent scholar Dr. Melissa F. Young (University of Alabama, 2020)discusses her dissertation, "Magic City Jews: Integration and Public Memory, 1871-1911," for which she won the Alabama Historical Association's inaugural Sarah Woolfolk Wiggins Dissertation Award in 2022. Dr. Young also discusses her current project, the Beth-El Civil Rights Experience that you can find at this URL: https://templebeth-el.net/education/beth-el-civil-rights-experience/ | <urn:uuid:4310792a-16d3-4dc3-8742-4f5b1519f9e9> | CC-MAIN-2022-33 | https://cloudutil.player.fm/series/alabama-history-podcasts/episode-051-melissa-young-winner-of-the-2022-wiggins-dissertation-award | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.899309 | 294 | 1.625 | 2 |
‘It Could Be Worse’: Is This the Best Form of Consolation?
Consolation, from the Latin root word consolari, means the comfort that someone receives after a loss or disappointment, or while experiencing misery, distress, or anxiety. To console someone is try to offer support, encouragement, relief, and a more cheerful attitude. Interestingly, consolation is not a uniquely human behaviour. Scientists have discovered that a range of non-human animals have the capacity to console. For example, mice in experiments allowed to roam free will visit other mice who have been caged and injected with vinegar (this was to induce a painful experience and to then see how the mice not in pain react). Primates, especially chimpanzees, will console the losers of fights, and elephants will console each other in times of distress. These observations are indications of pro-social behaviour (behaviour that aims to benefit the group rather the individual), which depends on empathy. To console another is to enact one’s empathetic connection with that being.
Originally published at https://www.samwoolfe.com on March 2, 2020. | <urn:uuid:8c388d9b-c529-49bc-8ff6-5b5f66e575e9> | CC-MAIN-2022-33 | https://samwoolfe.medium.com/it-could-be-worse-is-this-the-best-form-of-consolation-c8826b77c48b?source=post_internal_links---------4---------------------------- | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571909.51/warc/CC-MAIN-20220813051311-20220813081311-00265.warc.gz | en | 0.92074 | 231 | 3.515625 | 4 |
How Much Wagyu Steak per Person For A Big Group
Wagyu steaks are extremely tasty, and they are also costly. It is considered one of the most expensive cuts of meat around the world because of its very high quality.
Wagyu is a type of Japanese beef cattle that has been developed in Japan and is renowned for producing meat with a lot of beef marbling. The degree of marbling is largely determined by the breed’s DNA, which keeps the beef fat in its muscles.
This Japanese A5 Wagyu beef is served in high-end restaurants and during gatherings at home. If you wonder how much wagyu steak to serve per person for a family gathering of 4 or 40 then see our handy table below.
You may also be interested in
How Much Wagyu Steak Per Person For A Large Group
Let’s start by answering the question, For one person it is common to serve 3 ounces of Wagyu per person. This is because Wagyu is commonly used in fine dining recipes which typically do not call for the traditional 6 or even 8oz often served with other steaks.
There is nothing stopping you from serving more, but we have decided to use this food catering amount in our table. If you want to serve your guests more, you can prepare extra portions. For example, you can cook two pounds of wagyu beef for four people. In this case, you will need to cut it into eight pieces. You can then divide them among your guests. This way, you will be able to give everyone their own portion and possibly have a small amount leftover for seconds.
You should know that different types of Japanese beef are available on the market. Some of these include:
- Kobe Beef – This type of wagyu beef cuts originates from Hyogo Prefecture in Japan. Kobe beef is known for having a rich flavor and tender texture.
- Matsusaka Beef – This type of beef comes from the city of Matsusaka in Mie prefecture. It is famous for being leaner than other types of Wagyu.
- Shizuoka Beef – This Japanese Wagyu is known for its special taste. It is produced in the city of Shizuoka.
- Akita Beef – This type of meat is popularly used in dishes such as sukiyaki. It is produced in Akita prefecture.
A Handy Table For How Much Wagyu Steak You Per Person for between 10 – 100 People
How Much Wagyu Steak for 10 Guests
A gathering of 10 guests should have at least 30 ounces of wagyu meat per person. You will need to buy around 45 oz of raw wagyu to allow for any trimming and shrinkage while cooking.
How Much Wagyu Steak for 20 Guests
A gathering of 20 guests should have at least 60 ounces of wagyu meat per person.
You will need to purchase 90 oz of raw wagyu to allow for any trimming and shrinkage while cooking.
How Much Wagyu Steak for 30 Guests
A gathering of 30 guests should have at least 5.6 lbs of wagyu meat total
You will need to purchase around 8 lbs of raw wagyu to allow for any trimming and shrinkage while cooking.
How Much Wagyu Steak for 50 Guests
A gathering of 50 guests should have at least 10 lbs of wagyu meat for your party.
How Much Wagyu Steak for 100 Guests
A gathering of 100 guests should have at least 20 lbs ounces of wagyu beef.
What is the Difference Between American Kobe Beef vs Japanese Wagyu Beef
American steaks, such as Kobe Beef, are generally leaner than Japanese Wagyu Beef. It is also less fatty. American Kobe Beef contains about 15 percent beef fat, while Japanese Wagyu Beef has around 25 percent fat content. The higher fat content makes Japanese Wagyu Beef tastier.
American Style Kobe Beef and Japanese Wagyu Beef are both highly prized meats. They are both made from beef cows that are raised in American cattle and Japan. Both types of beef are usually sold under the same name. However, some consumers may confuse them since they look similar.
What does American Beef Wagyu Taste like?
American Beef has a milder flavor compared to Japanese Wagyu Beef. Its flavor is often described as sweet with hints of caramelized sugar. Meanwhile, Japanese Wagyu Beef is considered to be one of the best-tasting meats in the world. It is known for its rich aroma and intense flavor. It is also one of the most tender beef in the world.
What are the Top Easy Tips in Cooking Wagyu Steak
The following tips will help you ensure that your Wagyu steak tastes great.
- To ensure that your wagyu steaks turn out delicious every time, you must use a good-quality meat thermometer. A good quality thermometer ensures that your meat is cooked perfectly and then can be take off the heat when it reaches your desired temperature.
- The ideal cooking temperature for wagyu beef is between 140 to 150 degrees Fahrenheit. Always check the temperature by using a meat thermometer. When you first put your Wagyu steak into the pan, make sure you seal in the juices. As the meat heats up, it will start to cook faster.
- When you remove the wagyu steak from the oven or grill, let it rest for 3-5 minutes before slicing. This allows the juices inside the steak to settle back down. After resting, slice your Wagyu steak thinly or to your desired thickeness
- You can add other flavors to your Wagyu steaks such as onions, and herbs.
- Add Garlic to your Wagyu Steak. Garlic adds more flavor to your wagyu steak. To do this, simply cut off the root end of a clove of garlic and place it directly onto the surface of your Wagyu steak when you are grilling.
- For stovetop cooking, it is best to use cast iron skillets or pans. It holds the heat well, which ensures even cooking, for all steaks.
- Wagyu steak is traditionally served with vegetables. For example, if you serve your wagyu steak with potatoes, carrots, and green beans, you will get a complete meal.
What is the Best Way to Cook Wagyu Steak at Home
There are three ways to cook Japanese steaks at home. You can either grill, roast, or pan fry it. If you want to serve your Wagyu steak on top of rice, you should choose brown rice instead of white rice. Brown rice absorbs the sauce better than white rice. Moreover, here are different cooking methods for a wagyu steak:
Grilling a steak is never a bad idea, but you will want to watch and handle steaks with care to avoid fire due to the high amounts of marbling and juice. When grilling, make sure to season with salt and pepper several hours before cooking. Also, cook over medium heat for 2-3 minutes on each side.
This method is usually used for thicker cuts of beef. The key to roasting a steak is to allow the meat to rest after being roasted. This will allow the juices to settle back into the meat. Then, slice the meat and serve.
To ensure maximum flavor and to sear when cooking steak, use a cast iron pan and follow these tips:
- Season steak lightly with kosher salt and freshly ground black pepper
- Butter the pan lightly so that the marbling of Wagyu produces lots of juices.
- Sear for 3-5 minutes per side depending on desired doneness (about 145 degrees F for medium-rare and 160 degrees F for medium)
Frequently Asked Questions
How Much Is an Average Wagyu Steak in 2022?
The price of a single wagyu steak varies greatly depending on where you buy it. A good quality steak can cost anywhere between $100-$300 per pound. However, some popular brands sell their wagyu steaks online for lower prices.
How Long to Cook Wagyu Steak?
Cooking time depends on how thick your steak is. Most wagyu steaks are around 1 inch thick. Cooking times vary widely depending on whether you are using a gas or electric stove. Gas stoves tend to be hotter, while electric ones tend to be cooler. In general, you’ll need about 10-15 minutes per side for a 1″ thick steak.
What Is the Best Salt for Wagyu Steak?
The best salt for Wagu Steak is Himalayan Pink Salt.
Salt helps bring out the maximum flavor of any dish. Salt also makes food taste better. So, if you are going to eat wagyu steak, you should definitely add salt to it. There are many types of salts available. Some people like sea salt, which has a sweet and mild flavor. Others prefer table salt or Kosher salt, which is more intense and salty. Both work well. Just remember not to put too much salt on your Japanese beef because it may cause the steak to dry out. | <urn:uuid:22ea7389-15d8-4677-9e67-8c8988133b53> | CC-MAIN-2022-33 | https://onepotdishrecipe.com/how-much-wagyu-steak-per-person/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00265.warc.gz | en | 0.943068 | 1,899 | 1.710938 | 2 |
- You can start a profitable side hustle without spending any money.
- Business Insider spoke with three entrepreneurs on how they created their side gigs without spending much money, and their advice on starting a business during the coronavirus pandemic.
- The experts advised against spending your $600 stimulus check on your business. In fact, you should save that money for emergencies and tap into free resources online as a start, they said.
- Creating a free blogging account, leveraging social media platforms, and interacting with your customers online are some strategies to grow your side hustle without spending a dollar.
- Visit Business Insider's homepage for more stories.
You don't need to spend any money to grow a successful side hustle.
Side gigs have become more popular amid the coronavirus outbreak, and they've actually provided more financial security for those who decided to give it a try.
According to a Harvard Business School Online survey, about 54% of people are considering starting a side gig. Another recent survey of over 1,500 US hiring managers by Upwork, a global platform for hiring and placing freelancers, found that 72% of employers are continuing or increasing hires of freelance workers amid the pandemic.
While people are working remotely or quarantined at home, they're also brainstorming business ideas and passion projects.
Most businesses need money to get off the ground, and you might be short on funds. Millions of Americans received $1,200 payments as part of the $2 trillion relief package from the US government earlier this year. Congress is set to pass another $900 billion COVID-10 aid bill, in which households would receive $600 per adult and $600 for each dependent. Americans will also receive $300 each week in federal unemployment insurance for 11 weeks through March 14, The Wall Street Journal reported.
As you're waiting for that check, you might wonder if investing your COVID-19 aid to your business would be a good idea.
Business Insider spoke with three entrepreneurs on how to start a side gig during the coronavirus pandemic. Of the three experts, two of them are personal-finance coaches, and one started her $2 million business during the recession in 2007.
All three experts advised against spending your government checks and gave tips on how to start a side hustle without spending any money.
Save that $600
How you choose to spend your government aid is entirely up to you, but if there's a time when you should be more mindful of your spending, it's now.
Cindy Zuniga, a full-time lawyer and personal-finance coach on the side, told Business Insider that she's advising her clients to save it for emergencies. Zuniga's side gig started when she paid off $215,000 of student loans in four years. Being raised by two immigrant parents in a low-income community in the Bronx, New York, she explained she didn't have prior knowledge on how to invest, save, or budget. The lawyer self-educated on the principles of money management and documented her debt-free journey on social media.
Zuniga started an Instagram account in 2018. Now, she has over 36,000 followers and a waitlist on her personal-finance coaching company, Zero-Based Budget Coaching, LLC. She said she grew her business on social media without spending any money.
"Your top priority right now should be to have an emergency fund," she said. "You need a safety net that's dedicated for food, medicine costs, and any necessary expenses that might come down the line, in case something goes wrong."
Sokunbi is a former tech consultant who started her finance blog right after college. She'd write posts on money-saving and budgeting tips, which she'd then share with her friends. Nevertheless, her hobby soon turned into a six-figure blog that helps women become better with their financial habits.
"Now more than ever, you need to be more cautious and mindful of your spending," she said. "But you've also got to remember that there are many places to start a business without spending anything. There are a lot of free resources out there. And now is also a great time to map out ideas and do some planning."
Why now is the best time to start a side hustle
If you look at difficult situations that our country has gone through, you will find that the biggest waves of successful businesses boomed during difficult times.
In fact, more than 21 successful startups — like Uber and WhatsApp — were founded during the last recession, Business Insider previously reported. Major brands like the Walt Disney Company, General Motors, and Converse are also household names that bounced back after bankruptcy.
"In this new climate, everyone is preparing for the new normal," Sokunbi said. "And when the pandemic ends, there are going to be a lot of adjustments. The wheel keeps moving, and there's a lot of opportunity there."
You can offer services in virtual conferencing, remote home-schooling to support working parents, or a telehealth platform during the pandemic, Sokunbi suggested. Whether you're working remotely or you've been furloughed or laid off, it doesn't hurt to explore some money-making ideas.
How you can grow a business online for free
Stacey Martino, a former tax accountant at Deloitte and founder of a $2 million relationship-coaching business, told Business Insider that she started her side hustle in the middle of the last financial crisis in 2007.
"I really think now is the best time to start a business," she said. "You don't need any money to start a business. Facebook is free. Social media is free. But you do need a way to support yourself while you're starting a business — especially if you're pursuing it full-time."
Most of us have social media accounts, but not many people realize they can profit from it, she added. In fact, the entrepreneur explained that you don't need a grand plan or a savings account to get started on an idea.
If you want to launch a service business, start creating content on social media platforms. If you're a good writer, create a free blogging account. You can interact with potential customers via Facebook Live, Instagram Live, or Zoom. You can tap into your professional network. You can also access the infinite resources available online.
Nevertheless, Martino stressed that a keen understanding of internet marketing is important, especially now. It's hard to get your business noticed online, and you can boost your chances by first pinpointing the kinds of customers you want to attract, figuring out where they congregate online, and place ads on those pages.
Using people's free time to your advantage
In many ways, the pandemic also created more business opportunities for existing side hustles. The key is to learn how to pivot, Martino added.
"The biggest thing we used to compete with in internet marketing was busy-ness," Martino told Business Insider. "Before, people won't make it to a webinar because they have their kids' soccer game to get to or other life priorities. It's always busy-ness. That schedule has been cleared. Now is the time where I can go live everyday because people are less busy."
More people being online also means more opportunities. And you'd also benefit if you figure out a way to support people through this pandemic. For example, Martino found that more people are in need of marital and relationship advice while they are quarantined together or navigating long-distance. She has since wrote blogs and hosted webinars about these topics.
Finance coaches Sokunbi and Zuniga are also helping their clients through the economic downturn. For example, Sokunbi made all the courses on Clever Girl Finance free to accommodate for the need.
"Right now, our goal is just to help people and show empathy," Sokunbi said. "Taking a step back on your business doesn't mean you're not moving forward. I started my business as a means to help people, and I'm going to keep doing that." | <urn:uuid:a202b73a-7cba-4ea8-9466-1462559eb796> | CC-MAIN-2022-33 | https://www.businessinsider.com/how-to-use-your-stimulus-check-to-start-side-hustles-2020-4 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00265.warc.gz | en | 0.970372 | 1,681 | 1.75 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.