text
stringlengths
181
608k
id
stringlengths
47
47
dump
stringclasses
3 values
url
stringlengths
13
2.97k
file_path
stringlengths
125
140
language
stringclasses
1 value
language_score
float64
0.65
1
token_count
int64
50
138k
score
float64
1.5
5
int_score
int64
2
5
Combine These Strategies To Help Students Find Appropriate Reading Materials On Google's advanced search page there is a tool for refining searches according to reading level. This tool on its own can be very helpful in helping students locate materials that are appropriate for their reading abilities. It can also be helpful to combine use of the reading level refinement tool with a domain level refinement. For example, if my students are studying the American Civil War they might search for materials hosted on a ".k12.me.us" domain and refine that search according to reading level. See the screenshots below for examples.
<urn:uuid:188bdda0-a6d1-4f36-92d1-d98d22ebff83>
CC-MAIN-2017-04
http://www.freetech4teachers.com/2013/08/combine-these-strategies-to-help.html?m=1
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285289.45/warc/CC-MAIN-20170116095125-00153-ip-10-171-10-70.ec2.internal.warc.gz
en
0.914345
118
2.90625
3
Could your cat be in pain? Cats are experts when it comes to masking illness, making it difficult as a pet parent to know that something is wrong. You can watch for subtle signs and changes in behavior that suggest your cat may be in pain. Just like with people, chronic pain can affect your pet’s quality of life. In order to make life more comfortable and healthy for your cat, learn the signs, causes and how to work with your pet to get to the root of your cat’s pain and start a pain management program. Cats in the wild hide their pain to protect themselves from predators. Your indoor cat’s wildest moment may be the feline race through the house when you’re trying to sleep, but he is really not all that far removed from his wild counterparts. Here are some signs to look for that may indicate your cat is in pain. - Acting quiet and withdrawn or hiding frequently - Acting out – hissing, biting or running – when certain parts of the body are touched - Altered movement or gait - Changes in personality, particularly aggression - Loss of appetite - Rapid breathing or excessive panting - Weight loss - Unkempt coat There’s a variety of causes that could be triggering pain for your cat. Some of the more common sources are as follows: - Dental disease or oral infection - Disease of the back or spine - GI issues - Eye, ear or skin infections - Ingesting poisons - Trauma or injury - Bladder or kidney stones - Urinary tract infection As you can see, many signs that your cat is dealing with pain are subtle but most of the causes are complex. It pays to watch closely and monitor any changes in behavior. Reach out to your veterinarian to help you get to the root of the problem and start a course of action. Pay particular attention to senior pets since there are many aches and pains connected to aging that can be managed. Once you find out the cause of your cat's pain, your veterinarian can work on a course of treatment. If it’s a health related issue, you may need to treat both the illness or injury and work on treating the pain. If your cat is facing surgery, many veterinarians will set up medication options prior to surgery that should decrease your cat’s pain and increase the effectiveness of anesthesia. Work with your vet if your cat is extremely stressed by vet visits to ease that stress – excess stress can also trigger excess pain for your cat. If your cat does need medication to manage pain, work closely with your vet to find the right solution and monitor how your cat reacts to that medication. Northern Illinois Cat Clinic is a full service cat-only veterinary clinic that has been providing exceptional cat care with state-of-the-art technology since 1982. Their goal is to make your cat feel at home in their comfortable, safe and loving environment. The American Association of Feline Practitioners has recently certified the Northern Illinois Cat Clinic as a Cat-Friendly Practice. Learn more at online at http://northernilcatclinic.com, visit them at 295 Peterson in Libertyville, or follow them on Facebook at https://www.facebook.com/NorthernIllinoisCatClinic.
<urn:uuid:085b0451-00b0-4d19-9c97-e40553f4145c>
CC-MAIN-2017-04
http://www.chicagotribune.com/suburbs/libertyville/community/chi-ugc-article-helping-your-cat-deal-with-excess-pain-2013-11-12-story.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280128.70/warc/CC-MAIN-20170116095120-00390-ip-10-171-10-70.ec2.internal.warc.gz
en
0.943297
685
2.40625
2
The Chinese digital currency will not be used to strengthen control over the personal data of citizens, but will only help to find a balance between ensuring confidentiality and the needs of the authorities in obtaining reliable information, the representative of the People’s Bank of China (PBoC) said. China is preparing to become the first country to launch a national digital currency. Although not to much is known about PBoC stablecoin, the initiative of the Chinese authorities caused a lot of controversy and fears regarding the potential impact of digital currency on the global financial system. It is assumed that the new currency like Facebook’s Libra and other cryptocurrencies will partially work on the blockchain and be used through digital wallets. However, the stablecoin design will allow Beijing to fully control cash flows and manage the country’s economy, giving the government power that most central banks do not have. At the same time, Mu Changchun, head of the PBoC research institute, claims that the launch of the state digital currency has completely different goals, including the creation of a new payment system that is integrated into China’s existing financial infrastructure and accessible in the most remote areas of the country. “We know that the main requirement of the public is to ensure anonymity when using fiat money, and the government guarantees the confidentiality of transactions with the new digital currency. However, we intend to maintain a balance between controlled anonymity and the fight against money laundering, combating the financing of terrorism and issues related to taxation, online gambling and any illegal activity. Our goal is not full control over the information, but maintaining this balance” – Mu said at a conference in Singapore.
<urn:uuid:074a819d-cd94-41ba-b139-6e7c9609ff93>
CC-MAIN-2022-33
https://cryptocoinsinfo.pl/digital-yuan-will-not-be-used-to-control-users/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00665.warc.gz
en
0.932724
339
2.421875
2
Think before you tweet! Oh dear Frank, you really should think more carefully before posting on social media - learn this valuable lesson at Frank's expense! Who reads what you write online? Aunt Mabel, pals from the pub, your best friend's ex wife - who are you talking to when you post online? Filter bubbles and fake news Have you ever noticed you only see opinions on social media that match your own? Maybe you are trapped in a filter bubble! And what is all this fake news we hear about in the... news...? Survive social media and learn with the OU: Who's to blame for the rapid spread of fake news in social media site Facebook? Are you a model citizen or a menace to society when it comes to divulging personal details? Take the test from the Ministry of Sharing and find out whether you share too much information. Is emoji another example of the dumbing-down of our language and culture or is there a more educational purpose to the little pictures used to communicate? Creating Facebook is a project run by Philip Seargeant and Caroline Tagg of The Open University’s Applied Linguistics and Literacies (ALL) Research Group. The pair collaborated with us on a Twitter and Facebook poll as part of Brainteaser Month which asked how people respond to feeling offended on Facebook. This free course, Childhood in the digital age, delves into the lives of children and discuss the potential benefits and limitations of technology in their lives. What is it about new technology that is making many of us anxious and stressed? Dr Gini Harrison and Dr Mathijs Lucassen explore the top five stressors: How food advertising and marketing can affect children and young people in the digital age
<urn:uuid:326c8449-400b-4d3e-90b2-1647084c98c8>
CC-MAIN-2022-33
https://www.open.edu/openlearn/education-development/education/social-media-fake-news-filter-bubbles-and-sharing-wisely
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571745.28/warc/CC-MAIN-20220812170436-20220812200436-00467.warc.gz
en
0.919108
373
2.6875
3
A new generation of nanoscale devices are being developed based on inspiration found in nature. Grazyna Sroga, a postdoctoral researcher at Rensselaer Polytechnic Institute, is using DNA and related proteins to construct microscopic structures that may one day conduct electricity, deliver drugs, boost computer memory, or sense the presence or absence of chemicals. She is working in the laboratory of Jonathan S. Dordick, the Howard P. Isermann 42 professor of chemical engineering. Sroga is presenting her research at the 225th national meeting of the American Chemical Society, held March 23-27 in New Orleans, La. Taking Advantage of Years of Evolution Joely Johnson | EurekAlert! Lego-like wall produces acoustic holograms 17.10.2016 | Duke University New evidence on terrestrial and oceanic responses to climate change over last millennium 11.10.2016 | University of Granada Researchers from the Institute for Quantum Computing (IQC) at the University of Waterloo led the development of a new extensible wiring technique capable of controlling superconducting quantum bits, representing a significant step towards to the realization of a scalable quantum computer. "The quantum socket is a wiring method that uses three-dimensional wires based on spring-loaded pins to address individual qubits," said Jeremy Béjanin, a PhD... In a paper in Scientific Reports, a research team at Worcester Polytechnic Institute describes a novel light-activated phenomenon that could become the basis for applications as diverse as microscopic robotic grippers and more efficient solar cells. A research team at Worcester Polytechnic Institute (WPI) has developed a revolutionary, light-activated semiconductor nanocomposite material that can be used... By forcefully embedding two silicon atoms in a diamond matrix, Sandia researchers have demonstrated for the first time on a single chip all the components needed to create a quantum bridge to link quantum computers together. "People have already built small quantum computers," says Sandia researcher Ryan Camacho. "Maybe the first useful one won't be a single giant quantum computer... COMPAMED has become the leading international marketplace for suppliers of medical manufacturing. The trade fair, which takes place every November and is co-located to MEDICA in Dusseldorf, has been steadily growing over the past years and shows that medical technology remains a rapidly growing market. In 2016, the joint pavilion by the IVAM Microtechnology Network, the Product Market “High-tech for Medical Devices”, will be located in Hall 8a again and will... 'Ferroelectric' materials can switch between different states of electrical polarization in response to an external electric field. This flexibility means they show promise for many applications, for example in electronic devices and computer memory. Current ferroelectric materials are highly valued for their thermal and chemical stability and rapid electro-mechanical responses, but creating a material that is scalable down to the tiny sizes needed for technologies like silicon-based semiconductors (Si-based CMOS) has proven challenging. Now, Hiroshi Funakubo and co-workers at the Tokyo Institute of Technology, in collaboration with researchers across Japan, have conducted experiments to... 14.10.2016 | Event News 14.10.2016 | Event News 12.10.2016 | Event News 21.10.2016 | Health and Medicine 21.10.2016 | Information Technology 21.10.2016 | Materials Sciences
<urn:uuid:dd0c0493-a3c7-4212-b181-2b84ab487482>
CC-MAIN-2016-44
http://www.innovations-report.com/html/reports/interdisciplinary-research/report-17334.html
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719416.57/warc/CC-MAIN-20161020183839-00365-ip-10-171-6-4.ec2.internal.warc.gz
en
0.908871
718
2.984375
3
HARRISBURG, Pa., Nov. 13, 2012 /PRNewswire-USNewswire/ -- The Pennsylvania eHealth Collaborative announced today that it has signed up 3,449 healthcare providers for DIRECT messaging, exceeding the 1,000 goal set by the federal government. "Healthcare providers across Pennsylvania are taking advantage of modern technology that allows them to communicate electronically – and securely – with one another," Alix Goss, Program Manager for the Collaborative said. "Rather than using fax machines and the mail, they can now transmit patient records instantly via a secure email. It's a simple solution that can lead to better care and outcomes." DIRECT is a simple, secure way to transmit patient care records, referrals, discharge summaries and other clinical documents among health care providers, particularly those providers that do not have the resources or technical capacity to engage in more comprehensive health information exchange. Both the sender and recipient must be DIRECT subscribers. Through an innovative grant program offered by the Collaborative, doctors and other licensed health care providers received one year of free DIRECT messaging services when they signed up with a certified health information service provider (HISP). From May 1 to Oct. 31, the Collaborative provided $250 to the HISPs for each provider they registered. In all, more than $862,000 is to be distributed. Health information exchange (HIE) is the electronic movement of health–related information among unaffiliated organizations according to nationally recognized standards. Pennsylvania was awarded $17.1 million under the American Recovery and Reinvestment Act to help establish a health information exchange. The PA eHealth Collaborative is working to meet federal requirements and enable the use of information technology to advance HIE, which has been shown to improve healthcare quality and efficiency, ensure patient safety and provide secure, confidential access to health information for making the best possible health decisions. For more information, visit the PA eHealth Collaborative website at www.paehealthcollab.com. Media contact: Dan Egan, 717-772-4237 SOURCE Pennsylvania Office of Administration
<urn:uuid:8335fb6d-722d-4894-be56-c4b9b4929f2a>
CC-MAIN-2017-04
http://www.prnewswire.com/news-releases/pennsylvania-exceeds-national-goals-for-signing-up-providers-to-exchange-health-information-electronically-179121971.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280504.74/warc/CC-MAIN-20170116095120-00135-ip-10-171-10-70.ec2.internal.warc.gz
en
0.928377
430
1.53125
2
Image 1-Most of the tumor is centered within the deeper dermis with minimal epidermal alterations. Image 2 -The infiltrate has varying areas of cellularity with areas of sclerosis alternating with denser cellular nodules. Image 3-The cytology of the infiltrate varies from larger epithelioid appearing cells with a mixed chronic inflammation. Image 4-Considerable pleomorphism is noted. Image 5-Occasional mitotic figures, including atypical mitotic figures are noted. Image 6-Large epithelioid appearing cells with prominent nucleoli are noted admixed with chronic inflammatory cells including plasma cells and eosinophils. What is your diagnosis? This is a 44 year old man who presents with a tumor in the right hip. Last Updated June 2, 2005 Send Emails to Webmaster at DermpathMD Read the Medical Disclaimer
<urn:uuid:ea7166f3-2718-4b63-a9ac-4de5424284e3>
CC-MAIN-2017-04
http://www.dermpathmd.com/Case%20Studies/case_study_06.02.2005.htm
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281069.89/warc/CC-MAIN-20170116095121-00272-ip-10-171-10-70.ec2.internal.warc.gz
en
0.889726
185
1.507813
2
Famous for his longtime support of conservative causes like the National Rifle Assn., Charlton Heston played against public perceptions Tuesday when he appeared before a House Appropriations subcommittee to support a prime budgetary target of Congress' new Republican majority, the National Endowment for the Arts. After first saluting the Republican representatives for winning last November, he proceeded to quote Shakespeare to them, and then made an ardent pitch for the survival of the agency, which House Speaker Newt Gingrich (R-Ga.), in particular, has targeted for extinction. "I have an attachment to the NEA that some people would say blurs my vision," Heston said in an interview Thursday at his Coldwater Canyon home. "But I have been active in a lot of stuff, the civil rights movement for instance, before it got popular out here. And I'm very proud of that. A lot of the stuff I do is a good way of contributing, and I know how to do it." Being an arts advocate is a role the actor has grown comfortable with in the 29 years since he was appointed by President Lyndon Johnson to the NEA's executive body, the National Council on the Arts, a position Heston credits with providing him with particular insight into the NEA's current struggles. With subsequent stints as chairman of the American Film Institute and president of the Center Theatre Group at the Music Center, Heston has long been an outspoken supporter of government funding for the arts, a role that many have credited with preserving the NEA's current structure when he co-chaired Ronald Reagan's Presidential Task Force on the Arts in 1981. While proud of those past victories, Heston is quick to point out the recent shift in Washington's political climate and the impact it will have on the NEA's future. "There's a Republican majority now, and they are determined to move their agenda," Heston said. "And as I said to the subcommittee and to the people at the NEA, if you're going to cut veterans' affairs, and agriculture, and welfare, you're sure enough going to cut the arts. But my position, which I think is the only position to have, is to leave the structure of the (the NEA and the National Endowment for the Humanities) in place with minimum funding." Attacks on the NEA and the NEH have been ongoing by conservatives for years, but have become more heated in recent months since Gingrich, as well as former NEH chairwoman Lynne V. Cheney and William Bennett have called for its elimination, the latter claiming that the humanities endowment had become too corrupt to be salvaged. The fierceness of these attacks have led some to question whether conservatives are threatening the endowment and its relatively small budget for ideological, rather than budgetary, concerns. "I don't think there is anything like a vendetta, and God knows if there was I would know it," said Heston, noting that both of the endowments have made some "terrible blunders," including the funding of the now-legendary Robert Mapplethorpe exhibition whose work some considered obscene. In addition, Heston agreed with critics' claims that some NEA grant panelists have put individual interests above the good of the endowment. "There's something to be said (for Bennett's remarks), that it has gotten to be much more money than was envisioned at first. The whole thrust of government now is less. Less government, less money. Don't do so many things. There's a strong case to be made for that, and I agree with it myself." Heston served as one of three chairs of the National Council on the Arts from 1966-72, a time when the NEA's budget was $14 million--it is currently $167 million, and the NEH budget is $177 million. Heston says a lot can still be accomplished with a reduction in the NEA budget, including a renewed emphasis on institutional, as opposed to individual, funding. "If a painter asks for a grant so he can do a series of paintings above all the vistas along Mulholland Drive, he would have to borrow the money, or someone else might give it to him," Heston said. "But painters have asked people to give them money for centuries. That's what happened to Michelangelo. But if you're talking about a museum or an orchestra, they can't do it without money from somewhere. Those things have never been financially successful." At the hearings, Heston quoted from Shakespeare's "The Tempest" and toasted regional theater as one of the "spectacular successes" of the NEA. Whatever the endowment's future, the actor said that the chance to have his opinion heard was well worth the effort. "Anybody has the right to shoot his mouth off in this country, but I can do it and (a reporter) will come out and ask me questions about it," he said. "But to get to speak in a chamber of Congress? It's quite a feeling to sit in those rooms and to think most of the things of significance that have happened in this country happened there. It's kind of neat."
<urn:uuid:5b95e8dc-71b3-439e-84e8-e40e0dd620da>
CC-MAIN-2017-04
http://articles.latimes.com/1995-01-28/entertainment/ca-25242_1_charlton-heston
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283689.98/warc/CC-MAIN-20170116095123-00344-ip-10-171-10-70.ec2.internal.warc.gz
en
0.981952
1,066
1.5
2
There are several ways to send big files across the Internet, but the easiest way to do so is to use a cloud storage service to create a download link that you can send to your recipient. Dropbox is one of the most popular of these services.Continue Reading Using a Web browser, go to Dropbox.com. Click Sign Up and follow the steps to create a Dropbox account. While logged into your Dropbox account, click on your username at the upper right hand corner of the page. Click Install, then click the download link to begin downloading the Dropbox installer. Run the Dropbox installer you downloaded. Follow the steps provided to complete the installation. The Dropbox installer creates a special folder on your computer. Access this folder using the Dropbox shortcut on your desktop. Drag the big file that you want to send into the Dropbox folder. As long as there is enough space in your Dropbox account to accept the file, it can be uploaded regardless of size. A check-marked icon signifies that the upload is complete. Right click on the file you wish to send and select Share Dropbox link. Paste the link to the uploaded file in an email or instant message to your recipient. The recipient downloads the file by clicking on the link you provided.
<urn:uuid:728d5400-85b8-46a7-8eeb-f191e61fc50d>
CC-MAIN-2017-04
https://www.reference.com/technology/send-big-files-1c916edc14ae87e1
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285315.77/warc/CC-MAIN-20170116095125-00565-ip-10-171-10-70.ec2.internal.warc.gz
en
0.879666
251
1.65625
2
Assume a person pondering his/her head in front of laptop trying to get some serious concentration on the work and suddenly a not at all important pop up adds, “popped up” on the screen. It will certainly be an irritation. Even tough pop up add are much better innovation for promoting and marketing, but it can sometimes be a nuisance too. But you didn’t have to worry at all all you need to do is install trustnav adblock into your PC or laptop and conveniently stop those add that were bothering you. Some basic issues of pop up add There are various sorts of adware out there, some of which would all be able to include distinctive dimensions of security dangers, for example, spyware and, in any event, make irritation factors. It is by and large suggested that PCs have probably some type of insurance on the off chance that they surf the web, as some adware and spyware projects can affect data transfer capacity use, as well as release classified data. Finally, not all essential enemy of popup program highlights can keep all types of adware, and some will even now get past. When finding the correct programming for your necessities and your financial plan, you are protecting any fragile or private data, as well as different issues also. One technique for finding the best value for your money with regards to various security programs out there is to check audits, and also gauging every item against the other so as to see which offers the most advantages and at the best cost. Finding the right Ad Blocker for your browser By finding a product program that offers signals for while active traffic is being recognized, you can all the more likely guarantee that infection dangers, for example, trojans or dialers are being blocked. Such projects regularly enable you to have increasingly point by point command over such things as firewalls, framework helplessness, and checking, giving better generally speaking assurance. Beside advertisement blocking programs, a great principle guideline is to guarantee that your product and working framework are a la mode and to examine for infection and spyware dangers might cause issues on your PC. It might likewise be a smart thought to guarantee that your program is additionally state-of-the-art, as safety efforts are frequently refreshed after some time. While popups might be an ordinary unavoidable truth and a progressing annoyance, they are in any event something that can be made reasonable. There numerous techniques accessible, free and something else, however figuring out how to square popups with adware blocker programs that can secure your classification and your PC is regularly viewed as the most shrewd decision, and can likewise make your web surfing knowledge increasingly charming and more secure. The web is a place to play and a place to learn. That doesn’t imply that specific threats don’t exist on a few sites that individuals coincidentally surf to. It’s less about the substance a site may contain and increasingly about what’s going on in the background. Malignant projects are regularly downloaded without clients knowing, and they can assume control over a working framework rapidly. It’s imperative to figure out how to stop popups with spyware adware cleaner programs, to deal with this inconvenience. Harmful programs, for example, spyware and adware can access a PC without the client knowing. They are customized with the goal that they stow away inside a working framework. Something they do is demonstrating popups, now and again without the client notwithstanding getting to the web. Figuring out how to stop popups with spyware adware cleaner is an imperative advance to stop this movement.
<urn:uuid:f99c1f48-8620-478a-98aa-60296f52f94b>
CC-MAIN-2022-33
http://www.lac-de-villedon.com/stopping-ads-on-your-browser-is-no-more-a-hassle/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570913.16/warc/CC-MAIN-20220809064307-20220809094307-00067.warc.gz
en
0.951925
743
1.9375
2
Jahi McMath, the 13-year-old girl declared brain-dead after a tonsillectomy, may be moved to a facility in Southern California. Children’s Hospital Oakland agreed to transfer Jahi on Friday, and family members have said they'd like to move her to a medical facility in Southern California. They did not name the facility. Doctors at the hospital want to disconnect the girl's ventilator, but her family is fighting to keep her on life support. A judge has ruled that she be kept on life support until 5 p.m. Monday. A facility in the Bay Area that had agreed to keep the girl on a ventilator indefinitely no longer has room, the family’s attorney, Christopher Dolan, told KGO-TV in San Francisco. Dolan blamed the situation on a delay caused by Children’s Hospital’s refusal to perform a tracheotomy and insert a feeding tube. After initially suggesting it would oppose a transfer, Children’s Hospital said on Friday that it was willing to work with the family. "Children’s Hospital will of course continue to do everything legally and ethically permissible to support the family of Jahi McMath,” the hospital said in a letter to Dolan. “In that regard, Children’s will allow a lawful transfer of Jahi’s body in its current state to another location if the family can arrange such a transfer and Children's can legally do so.”
<urn:uuid:5f5ca87c-15fc-46fd-bea4-c454a55a8aab>
CC-MAIN-2017-04
http://www.latimes.com/local/lanow/la-me-ln-jahi-mcmath-family-wants-brain-dead-girl-moved-to-southland-20131228-story.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285289.45/warc/CC-MAIN-20170116095125-00146-ip-10-171-10-70.ec2.internal.warc.gz
en
0.974498
313
1.546875
2
Best Practice: Team Tennis Summer Break Definition and Example: USA Team Tennis SummerBreak is a summer drill and play program for former high school tennis players and intermediate to upper levels adults. Some players are current or former college players, some are USA Tennis league players, some played high school tennis and graduated in 2003 and some played high school tennis and graduated in 1970! Some are self taught and never played in an organized program. Players range in age from 18 to 60! SummerBreak is unique in that it employs a format that is very social yet is very competitive at the same time. The format also makes it very easy to organize a large group with a variety of skill levels. Most nights in 2003, we had close to forty participants. A mailing about the upcoming program is done each spring to all participants from the previous year by Anoka Hennepin Community Education. All participants provide email addresses and are notified of tennis events, USA league tennis and activites throughout the year by the site director. Also, contact information on all in the program is emailed out so players can set up matches with each other. In 1999, the first year of the program, area high school coaches were contacted and asked to provide contact information for former players. A mailing was done and phone calls were made to over 100 people. The program had over 50 participants the first year. Now, Anoka Hennepin Community Education includes SummerBreak in their program brochure every spring and they do a mailing to previous participants. Five other communities have started SummerBreak programs and the Greater Twin Cities Tennis Association promotes all metro sites to graduating high school players at the state tournaments and through high school coaches. The site has 14 tennis courts, which allow for large numbers of participants and allow for singles play if desired. Each session starts out with a large group drill that practices a skill or tactic. Then players are sent out in groups of four to play three sets. The four may choose to play one set of singles against each player or to play one set of doubles with each player in the group. Regular scoring is used but groups may elect to use no-ad scoring or may start each set at 2 all if time is an issue. Players keep track of total games won in each set and report their total at the end of the night. The games are entered for each player each week using an Excel spreadsheet. Total games are divided by the number of matches played to provide a cumulative average each week for each player. Players are grouped each week based on cumulative average. This allows for flexibility in case a player misses, their average does not go down and they are put with players that are competitive with when they return. The four winners at the end of the program are the players with the most games won, which does reward participation. A skill or tactic is focused on each session. The tactic is introduced, explained why it is important and key points in executing the tactic are pointed out. Participants or instructor demonstrate the tactic and the drill. Players are set up to drill using "King of the Court" formats, winners move up, etc. to practice the tactic. The participants get a USA Team Tennis T-shirt. Players play three sets each week and report total games won. The top four players win a Wilson tennis bag. All communities with SummerBreak and beginning level adult programs are invited to an end of season team tennis event organized by the Greater Twin Cities Tennis Association. A local pizza restaurant sponsors the event and provides free pizza. Former high school players and upper level adults. The program is scheduled to run for six-weeks, one night a week from 6 - 8 PM. The cost of the program is $30.00. About 2/3 of the players keep playing beyond the six weeks and go until October.
<urn:uuid:6ec1b797-1573-47b4-a5ca-ba962d1c004c>
CC-MAIN-2017-04
https://www.usta.com/About-USTA/Organization/Best-Practices/9437_Best_Practice_Team_Tennis_Summer_Break/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281746.82/warc/CC-MAIN-20170116095121-00289-ip-10-171-10-70.ec2.internal.warc.gz
en
0.97111
774
2.328125
2
ISOFLEX Under the Microscope Taking a purely scientific look at the best products in the world of sports supplements. Originally published in Muscle & Fitness Magazine, UK We examine the critical active ingredients in various sports supplements. We award high marks to those with existing supportive data, real-world results and innovation in formulation. Here we put ALLMAX ISOFLEX under the microscope. WHEY PROTEIN ISOLATE is a fast digesting and easy to absorb source of whey protein. Whey quickly delivers building blocks known as amino acids to muscles for growth and repair. Whey protein isolates are also rich in branched chain amino acids (BCAAs), which are instrumental in muscle growth. REASON: Quick delivery. Isolates release muscle-building amino acids faster than any other source of protein. HYDROLYSED WHEY PROTEIN ISOLATE is the other super-fast-digesting whey protein available. Whey proteins are superior because they provide branched chain amino acids (BCAAs) and an abundance of the antioxidant glutathione, which can strengthen the immune system. There are numerous studies that show adding whey protein to a weight training program supports measurable gains in muscle mass. Some studies also show a gain in mass along with a simultaneous drop in bodyfat. ‘Hydrolyzed whey’ is whey protein that has been enzymatically treated so the protein is digested even faster than all other forms of whey. Fast-digesting amino acids are especially important before and after training. Before training, fast-digesting aminos can block tissue breakdown and when used after training, fast-digesting amino acids immediately restart the muscle-building process. Using hydrolyzed whey protein isolate throughout the day is an effective way to keep special reserves of amino acids called ‘amino acid pools’ saturated, which, in turn, helps support tissue repair. REASON: Fast-digesting amino acids always help tissue repair and by hydrolyzing protein, it allows protein to more efficiently get into the blood stream to support muscle growth. L-ARGININE is an amino acid that increases nitric oxide (NO) release, which opens up blood vessels allowing for greater blood flow and nutrient delivery to muscles. Arginine has also been shown to lower bodyfat levels when combined with a moderately lower calorie diet. Arginine increases growth hormone (GH), which can block muscle breakdown associated with training. It also has the ability, especially when added to whey proteins, to increase insulin secretion. Insulin is a hormone that tends to reverse or interrupt the muscle fiber breakdown that is associated with hard training. REASON: Research has shown numerous times L-arginine’s ability to boost nitric oxide levels and boost GH release. FOLIC ACID is a B vitamin that regulates amino acid metabolism in the body. A lack of folic acid leads to anemia, a lack of energy and possibly poor growth. REASON: Often very hard to get adequate amounts from the daily diet unless generous amounts of vegetables are consumed. NAC (N-acetyl -L-cysteine) is a metabolite of the amino acid cysteine and produces glutathione in the body. Glutathione is a very strong antioxidant, which directly fights free radicals that are produced during training. Left unchecked, free radicals can punch microscopic holes in muscle tissue decreasing muscle recovery as well as interfering with a muscle’s ability to uptake and utilize glucose from carbohydrates. Interfering with glucose uptake decreases growth and recovery, as well as leading to gains in bodyfat. Compromised glucose uptake also plays a secondary role in amino acid metabolism. In theory, protein synthesis can be compromised when excess free radicals production impacts muscle tissue. REASON: In post-training nutrition, limiting free radical production can lead to better growth and recovery. GLUTAMINE PEPTIDES are a superior source of the amino acid glutamine. Glutamine lowers ammonia levels, the by-product of training that can interfere with muscle growth, and can also block the uptake of cortisol by muscle tissue. Cortisol is a muscle-wasting hormone that is released during training that causes muscle breakdown. Glutamine, however, can maintain adequate levels of branched chain amino acids (BCAAs), which are extremely important in muscle recovery and growth. Studies have also shown it can help the body store glucose as muscle glycogen which can enhance training intensity and support recovery. Peptide bonded glutamine is two singular glutamine molecules bonded or attracted together by a special connection called a peptide bond. This bonding makes it more bio-available for the body and is superior to regular glutamine. REASON: The best choice of glutamine for tissue repair and muscle support. ALPHA LIPOIC ACID (ALA) helps move glucose from carbohydrates into muscle cells where it is stored as muscle glycogen; and greater muscle glycogen stores are associated with greater training endurance. ALA also supports the production of glutathione, which exerts a very strong immune-boosting effect, not to mention being able to block insulin’s effect on fat cells. Generally insulin has fat-storing, as well as muscle-building, properties but ALA appears to limit the fat-storing ability. Finally, ALA can help testosterone bind and lock-up with testosterone receptors on muscles. REASON: Exerts several positive effects on muscle growth and fat loss. D-PINITOL helps the body improve the use of the hormone insulin. Pinitol seems to help insulin exert a stronger ‘driving’ effect; insulin drives or pushes both glucose from carbohydrates and amino acids from protein into muscle tissue for growth and repair. Accentuating that ‘push’ could result in better muscle recovery and improved growth, provided the user is consuming sufficient high quality protein. REASON: Insulin support is helpful in preventing muscle breakdown and increasing protein syntheses (muscle-building). 4- HYDROXYISOLEUCINE is derived from fenugreek. It has the ability to keep blood sugar (the total amount of digested carbohydrates floating in the blood stream) stable. Stable blood sugar levels are correlated with better recovery and less bodyfat. Hydroxyisoleucine has also been shown to increase amino acid and glucose uptake by muscles, which may support a leaner and more muscular physique. REASON: Glucose stabilizer and the ability to possibly transport both glucose and amino acids make it an effective ingredient. ***** Outstanding scientific research on humans available. **** Solid research available; anecdotally effective. *** Not much human research available but premise is sound.
<urn:uuid:d7ea7a3a-b9b1-4537-82fc-b6ce0b683a0a>
CC-MAIN-2017-04
http://www.allmaxnutrition.com/post-articles/supplements/isoflex-under-the-microscope/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280266.9/warc/CC-MAIN-20170116095120-00502-ip-10-171-10-70.ec2.internal.warc.gz
en
0.934541
1,402
1.835938
2
Visiting Distinguished Professor Richard K. Emmerson was honored for the influence and depth of his scholarship in 2021 with a Festschrift by colleagues and former students. Dr. Emmerson researches, teaches, and publishes on medieval apocalypticism and its representation in art, drama, and visionary poetry. He was professor and chair of the Department of Art History from 2006–2009. Tributes in Honor of Richard K. Emmerson: Crossing Medieval Disciplines was published in July 2021. The Festschrift is an interdisciplinary collection of essays celebrating the scholarship of one of the most prominent medievalists of his generation. Two of Emmerson’s former students and FSU alumnae, Deirdre Carter (PhD 2017) and Karlyn Griffith (PhD 2014), along with Case Western Reserve University professor Elina Gertsman, edited the essays by Emmerson’s colleagues and former students. Notable contributors include Professors Jack Freiberg and Paula Gerson, former FSU English professor Elaine Treharne, and FSU Art History alumnae Sarah Andyshak (PhD 2015) and Jennifer Feltman (PhD 2011), as well as Carter and Griffith. The authors have donated a copy of the publication to the Department of Art History’s Rose Library in the William Johnston Building. As the Festschrift’s subtitle implies, Emmerson’s career has crossed numerous academic disciplines through which he has developed an authoritative and enduring voice in the fields of manuscript and Apocalypse studies. He received his doctorate in English from Stanford University and began teaching and researching medieval English drama, literature, and theology. At Stanford, Emmerson had studied with renowned medieval art historian, Suzanne Lewis, with whom he would later co-author the three-part “Census and Bibliography of Medieval Manuscripts Containing Apocalypse Illustrations” in Traditio. His early publications regularly focused on art historical topics as they relate to what Emmerson has coined “visual exegesis,” or the informative way images are received by reader/viewers. The publication is a testament to Emmerson’s influence on colleagues and students, and their deep regard for him as an educator and a friend. Doctoral candidate Britt Boler Hunter writes, In my first class with Prof. Emmerson, he described the aim of scholarship as contributing to collective knowledge by ‘standing on the shoulders of giants,’ referring to the famous medieval metaphor. I think his contributions to the fields of medieval literature, drama, theology, art, and especially apocalypticism are gigantic and the most deserving of this fabulous Festschrift. On top of being a world-class scholar, he’s also a world-class teacher, advisor, and mentor and it’s been a joy to learn from him. Emmerson joined the FSU Art History department in 2006 as Professor and Chair after having served as the Executive Director of the Medieval Academy of America from 1999 to 2006. Some of his most esteemed career highlights include serving as Deputy Director at the National Endowment for the Humanities, editing top medieval journals Speculum and Studies in Iconography, and participating on the editorial board of Gesta. Emmerson’s numerous publications include authoring or editing nine books, including his most recent monograph Apocalypse Illuminated: The Visual Exegesis of Revelation in Medieval Manuscripts (2018) and his two apocalypse commentaries, The Apocalypse of Jean Duc de Berry (2020) and Picture-Book Apocalypse with the Life of St. John and the Apocalypse (2020), co-authored with Britt Boler Hunter and provenance researcher Peter Kidd. Emmerson has recently retired to New Hampshire with his wife Sandi and rescue dog Bella to be closer to family and friends in surrounding New England and New York.
<urn:uuid:794e82ec-abc7-4881-b806-0e66d3dfd2eb>
CC-MAIN-2022-33
https://arthistory.fsu.edu/emmerson-festschrift/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00275.warc.gz
en
0.958948
806
1.523438
2
An exciting crowd funding opportunity has been launched to send two Reaseheath animal science lecturers to Ecuador to help in the study of two rare and endangered species of lizard, Riama yumborum and Riama oculata. The lecturers will receive specific training so they can gather data on the ecology, breeding biology and population dynamics of the lizards, which are found only in the Santa Lucia Cloud Forest Reserve in the northwest of the country. This essential research will help to predict how changes in climate and habitat may affect the biodiversity of the area and the future of the two species. The lecturers will also use their extensive teaching expertise to train people within the local community so they can continue to gather data and monitor the lizards and other reptiles and amphibians in the reserve. The lecturers’ training will be delivered in Ecuador by Dr Simon Maddock, a Reaseheath Animal Management Course Manager and Scientific Associate of the Natural History Museum, London, who helped to identify R. yumborum during his studies of the country’s reptiles and amphibians. Simon explained: “This project is critical to our understanding of these two little-studied species. We cannot do anything to preserve species like these, which have highly restricted distribution, until we know more about their biological requirements and how these could be affected by climate change and habitat loss. Even basic information such as their population size is unknown. “The lecturers will also play an important part by passing on their skills to communities who live within the reserve. These local people will be encouraged and empowered to become part of the project and in turn will be at the forefront of driving the conservation of the entire area.” For more information, endorsements and to help fund this important project visit:
<urn:uuid:b86dbe75-7b2b-4942-bc37-ad28d929f0f7>
CC-MAIN-2022-33
https://www.reaseheath.ac.uk/chance-fund-research-rare-lizards/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573029.81/warc/CC-MAIN-20220817153027-20220817183027-00278.warc.gz
en
0.949455
364
2.703125
3
Tarot in the Land of Mystereum Author: Jordan Hoggard Artist: Jordan Hoggard “Meditate Your Contemplation, Contemplate Your Meditation” from the book “Tarot in the Land of Mystereum” is based on architect/artist/Tarotist (can we just say Renaissance man!) Jordan Hoggard’s independently published “Mystereum Tarot” (2008). Created with the vector technology found in his architecture background, the “Mystereum Tarot” showed a strong sense of (geometric) form, backed up with an intense use of color. The deck has been revised to a small extent for “Tarot in the Land of Mystereum”, primarily to take out the nudity so that the deck would be able to be used with children (or with adults that have amore conservative mindset). The independently produced deck focused on the connection between architecture, the Magician and the High Priestess – the first spark (or inception) of an idea, and the creation (manifestation) of that idea. The Magician sparked ideas, while the High Priestess gave them form (brought them into manifestation). There was a significant shift in thought with “Tarot in the Land of the Mystereum”. The working concept here is “Imagination Primer”. The Tarot, and the journey that is the Tarot, is meant to open the Seeker’s ability to imagine, and to develop their ideas. The Seeker is also the Guide, in the guise of the Fool. The aim is for the Seeker to develop a harmonious relationship with their ideas and feelings. Life in a nutshell! The Seeker’s identity and personality are explored through their ideas. Jordan states that intuition and imagination are the voice and place of our inner essence. Through their intuition and imagination the Seeker learns to work with their memories, ideas and dreams. Everything comes together in the Land of Mystereum! The deck is a traditional 78 card deck, with Jordan’s suggestion that the card back become the 79th card. There is a reason for this – the card back (which is reversible) shows a window with a vine running across the top of it. It acts as the window into our imagination, and into our soul. (The last little thought there was mine.) Traditional titles are used for the Major Arcana, with the suit titles being Wands, Cups, Swords and Pentacles, and the Court Cards titles of King, Queen, Knight and Page. Justice is VIII, Strength is XI. The presentation for this book/deck set is awesome! When I first saw it, my thought was “How am I supposed to store this?” That lasted for a very fleeting second! The reason for the thought is that the box is cigar-style, approximately 5 ¾” by 11 ¾” – game board size. Well, duh! It is meant to be a game … a journey! The box is perfect! It is a flip top box, with a magnetic catch. No worries about anything falling out if it gets accidentally knocked over. The colors are the vibrant colors from the deck, with the imagery from the Hermit, the Six of Pentacles, the Ten of Wands and the Two of Swords. There are ribbons on both sides of the top, so that it does not open further than it needs to (which could crack the spine). The front features a ribbon pull to open the box. Very professional, very beautiful! Go Schiffer! The 192-page companion book is entitled “An Imagination Primer”. The Welcome section presents the thought behind the deck, and its use as a tool to develop imagination and creativity. Each family within the deck deals with a different aspect of imagination. From the book: “Archetypal Imagination is about the Major Arcana with big ideas. Grounding Imagination is about Pentacles with solid things that you can touch. Fulfilling Imagination is about Cups with flow and how you feel. Energizing Imagination is about Wands with energy that invigorates you. Communicative Imagination is about Swords with communication and how you interact.” There is an exercise at the end of the Welcome section that is really very interesting. Using a rubber band, you form a circle, and then you twist the circle to form a lemniscate (infinity symbol). Jordan goes on to suggest that the center of the circle is not necessarily the middle of the circle – it is where we are on our journey, and it is that which is vibrant and alive. There is an interesting set of questions to ponder at the very end of the Welcome section. It is suggested that the Seeker think about them before reading the book, and then again after they have met the characters along the journey that is the Tarot. Sample questions include: “Does infinity have a middle? What is an infinite feeling? Is there a difference between a center and a middle?” The cards are presented with a black and white scan, a description of the card’s energy, Entering the card (each card speaks in its own voice), and Imagination Tools. Examples of Imagination Tools are: “ The Fool: Feel and remember natural new directions you create as you move as you move and evolve your ideas with imagination and creativity!” “Ace of Pentacles: I gift you the ability to sense inner inheritances as they prepare to come to light.” “Queen of Cups: I am in harmony with my emotional and intuitive realms.” The cards themselves are 3 ½” by 5”, and of good quality, glossy card stock. The backs I have already described. The card face has a ¼” white border, surrounding a “window” that frames the card’s imagery. The bottom of the border, and the lower 2/3 of each side of the border are orange. The upper third of the border is blue/green, and curved. The upper right and left hand corners are dark blue. There is a white border across the bottom of the card, where it is identified. For the Major Arcana, the Roman numeral for the card is in the center, with the card title (in English, French, German and Spanish) on either side. For the Pips (numbered cards), the number is in the center of the card, with the suit name (in English, French, German and Spanish) on either side. For the Court Cards, the title is in the center of the card, with the suit name on either side (in English, French, German and Spanish). The colors in this deck are both vibrant and intense. There is significant imagery from the esoteric world, and an interesting continuity of imagery throughout the deck. The Hanged Man and the Page of Cups are the same person. The rope that ties the figure’s hands runs through a lemniscate,with another lemniscate appearing behind the figure’s head. The imagery of the four pillars appears in several cards – the Fool, the Lovers, the Devil, the Tower, the Sun, the Two of Swords, the Knight of Pentacles, and the Knight of Cups. The imagery on the Court Cards is interesting: for the Queens, the figures are identical on Pentacles and Swords, and on Wands and Cups. The King shows the same figure on all four suits, while the Knight shows the same figure for Cups, Swords and Pentacles. The Pips (numbered cards) are semi-Marseilles style, in that they make use of the suit icons and limited figures. The Fool shows black holes where the eyes appear, very much like Johanna Gargiula-Sherman’s work in the “Sacred Rose Tarot”. The Emperor is shown as a figure in the middle of a tree, while the Wheel uses watch-like imagery and astrological glyphs. The Tower shows the Fool poised over the four pillars in the upper left hand side of the card,, with the vibrations from his voice acting as the lightening that strikes the Tower. To know the depth of this work, and the intention, I am going to share Jordan’s acknowledgment statement, from the book: “Susan B. Hale. You gave me two lithographs when I was three months old. I cherish them. They have lived with me since.” If you want to wander into the land of imagination with intent and purpose, this book and these cards are for you. Suitable for any age group, from any background. I see this deck as being akin to James Wanless’ “Voyager Tarot”. It opens the mind, and the soul. Enjoy the journey! © January 2011 Bonnie Cehovet
<urn:uuid:320fa7f6-0b92-4945-89ae-d0b7f34aa434>
CC-MAIN-2022-33
https://bonniecehovet.wordpress.com/2011/01/23/tarotin-the-landof-mystereum/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571147.84/warc/CC-MAIN-20220810040253-20220810070253-00474.warc.gz
en
0.944611
1,904
1.984375
2
Audio | view transcript A traditional exposition of Buddhist meditation looking at why we meditate; preparation for meditation; the five meditation practices designed to counteract the five mental poisons; and the three stages of meditation. Talk given in 1967. |2.||Buddhism and the mind (8:14)| |3.||Why we meditate (5:54)| |4.||Food, sex, and sleep (9:42)| |5.||Ethical preparation for meditation (5:16)| |6.||Teachers and devotional exercises (3:14)| |7.||Mindfulness of breathing and Metta Bhavana (9:25)| |8.||Contemplation of decay (5:47)| |9.||Contemplation of the twelve nidanas (5:42)| |10.||Analysis of the six elements (9:16)| |11.||Meditative experience (7:30)| Total running time: 1:17:38
<urn:uuid:ae191cf8-eb4e-4673-9c73-c8ab4a5c2af2>
CC-MAIN-2017-04
https://www.freebuddhistaudio.com/audio/details?num=33
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282926.64/warc/CC-MAIN-20170116095122-00391-ip-10-171-10-70.ec2.internal.warc.gz
en
0.701625
217
2.5
2
In cold climates, a thick knitted scarf (sometimes known as a "muffler"), often made of wool, is tied around the neck to keep warm. This is usually accompanied by a heavy jacket or coat. Also, the scarf could be used to wrap around the face and ears for additional cover from the cold. In drier, dustier warm climates, or in environments where there are many airborne contaminants, a thin headscarf, kerchief, or bandanna is often worn over the eyes and nose and mouth to keep the hair clean. Over time, this custom has evolved into a fashionable item in many cultures, particularly among women. The cravat, an ancestor of the necktie and bow tie, evolved from scarves of this sort in Croatia. Scarves that are used to cover the lower part of face are sometimes called a cowl. Scarves can be colloquially called a neck-wrap. Scarfs can be tied in many ways including the pussy-cat bow, the square knot, the cowboy bib, the ascot knot, the loop, the necktie, and the gypsy kerchief. Scarfs can also be tied in various ways on the head. |Delivery Time||Ready to ship in 2-3 Business Days| |Shop Location||Berlin, Berlin, Germany| No reviews found!
<urn:uuid:9e5b1713-3125-439d-b83e-f22edaf0e5ab>
CC-MAIN-2022-33
http://farmers.co.zw/adidas-daily-unisex-shoes-45
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00075.warc.gz
en
0.952439
286
2.1875
2
Sample Mathematics Problem Type Examination (Math Problem Sample) THIS IS A SAMPLE OF MATHEMATICS PROBLEM TYPED EXAMINATION FOR STUDENTS.source.. TIME: 2½ HOURS ANESTAR SCHOOLS FORM 4 MID TERM EXAM INSTRUCTIONS TO CANDIDATES * This paper contains two sections: section A and section B * Show all the steps in your calculations, giving your answers at each stage in the spaces below each question. * Marks may be given for correct working even if the answer is wrong. * Non programmable silent electronic calculators and KNEC mathematical tables may be used, except where stated otherwise. For Examiner’s Use only This paper consists of 15 printed pages. Candidates should check the question paper to ensure that all the pages are printed as indicated and no questions are missing. SECTION A (50 MARKS) 1. Using logarithms, evaluate correct to 4d.p.(4mks) 25.48 X 0.0212 2. Solve the equation below. 72x – 8 X 7x + 7 = 0 (3mks) 3.Given that x2 – 4x + y2 – 6y + 4 = 0 is an equation of a circle, determine the centre and radius of the circle. (3 marks) 4.Y varies partly as x and partly as the square of X. When X = 2, Y = 14 and when X = 4,Y = 44. Find Y when X = 6.(4 marks) 5.a)Expand in ascending powers of x.(2 marks) b)Use the first three terms of the expansion above to approximate the value of (3.025)4 to 3 decimal places.(2 marks) 6.A student recorded the length of a copper wire as 20.66 cm. If the actual length was 20.6 cm, calculate the fractional error committed. (3 marks) 7.If, find the value of a and b where a and b are rational numbers.(3marks) 8. Given the matrix 5-x23x4 has no inverse, find the value of x.(2 marks) 1 Find the percentage area in calculating the perimeter of a triangle whose dimensions are 5cm, 6.3cm and 7.0cm. (3mks) 10.A coffee trader buys two grades of coffee at sh.80 and sh.100 per packet. Find the ratio at which she should mix them so that by selling the mixture at sh.120, a profits of 25% is realized. (3mks) 11.Without using a calculator or mathematical tables rationalize and simplify. QUOTE - QUOTE 12.(a) The consecutive terms in a G.P are 3x+1/2, 9x and34. Calculate the value ofx. (2mks) (b) Given that the 5th and 7th terms of the G.P. in (a) above form the first two consecutive terms of an AP. Calculate the sum of the first 10 terms. (2mks) 13.Determine the ratio in which P(11,0) divides AB, where A and B are the point (2,-3) and (17, 2) respectively (2mks) 14. Make x the subject in the formula:(3mks) 15.Solve for x: (log3 x)2 - ½ 1og3 x = 3/2 (3mks) 16. Find the longest side of the right-angled triangle whose other sides are; (2 + l)cm and (2 - l)cm long, leaving your answer in surd form. (3mks) SECTION B ( 50 MARKS) ANSWER ANY 5 QUESTIONS 17.In the figure angle CBD = 37o, angle BCD = 20o, CDE is a straight line and ABC is a tangent to the circle at B. a)Find with reasons i)Angle BED.(2 marks) ii)Angle ABE(2 marks) iii)Angle BDC(2 marks) b)With reasons state whether triangle BDC is similar to triangle CBE.2 marks) c)Given that the radius of the circle is 2.5 cm find the length of B(2 marks) 18.a)A plane flew from airport X (600S, 300E) due North to airport Y (300N, 300E) at 180knots. After 20 minutes stop over for fuelling at Y, the plane flew due West to an airport Z (300N, 150E) at the same speed. (i)Calculate the total distance covered by the plane in nautical miles4 marks) (ii)Calculate the total time taken to complete the journey from X through Y to Z. (4marks) b)P and Q are two towns on the surface of the earth. Their local times differ by hours. If the longitude of P is 150E, find two possible longitudes of Q.(2marks) ABDOC19.The diagram given below shows a triangle OAB. OA = a andOB = b. A point C divides OA in the ratio 2:3, D divides OB in the ratio 3:4 and the lines AD and BC meet at E. a)Find in terms of a and b the vectors (b)Given that CE = mCB and DE = nDA where m and n are scalars (i)Write down two distinct expressions for OE (3 marks) (ii)Hence find the values of m and n(4 marks) ~(iii) Find OE in terms of a and b only(1 mk) 20. a)ABCD is a quadrilateral with vertices as follows: A (3, 1), B (2, 4),C (4, 3) and D (5, 1) (i)A'B'C'D'is the image ofABCDunder a transformation whose matrix is. On the grid provided draw the quadrilateralABCD and its image A'B'C'D' - Calculating Mean, Range, and Standard DeviationDescription: Use the data to calculate the following: a. Mean - 104.25b. Median – 104 c. Range – 35d. Q1 – 101 e. Q3 – 108.5f. IQR – 7.5 2. Create a boxplot of the data from question #1. 3. Answer the following questions using the box plot below. a. Give the 5-number summary (approximate) of actors. Min - 30 Q1...4 pages/≈1100 words| No Sources | Other | Literature & Language | Math Problem | - Statistics Questions Literature & Language Math ProblemDescription: 1 Assume you are trying to forecast US Tesla car sales by using the number of elephants in Africa as an explanatory variable. Write a regression equation showing a zero intercept and that US Tesla sales is insensitive (unaffected by) the number of elephants in Africa....1 page/≈275 words| No Sources | Other | Literature & Language | Math Problem | - Extra Credit Literature & Language Math Problem PaperDescription: In a particular sports competition motorcyclists have to jump over a canyon that is 30 meters wide. Now, assume that in attempts to jump over the canyon one of the participants decides to lift his motorcycle at an angle of 20 degrees between the edge of the canyon and the air....2 pages/≈550 words| No Sources | Other | Literature & Language | Math Problem |
<urn:uuid:f01b5b33-6629-44f3-9ca5-1871648a7923>
CC-MAIN-2022-33
https://essaykitchen.net/math-problem/other/english/sample-mathematics-problem-type-examination.php
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570741.21/warc/CC-MAIN-20220808001418-20220808031418-00070.warc.gz
en
0.837142
1,771
2.71875
3
In a somewhat startling reversal for the religious leader of a nation, Allama Tahir Ashrafi, the Chairman of Pakistan’s Ulema Council, announced yesterday that his recent statement endorsing suicide attacks and other forms of violent jihad in “occupied” Muslim countries was taken out of context and that harming civilians is acceptable to none. It was widely reported that on March 1 Ashrafi stated: “Palestine is occupied by Israel, Kashmir by India and Afghanistan by the US. So if Muslims don’t have the atomic bomb, they should sacrifice their lives. We want America to leave the region.” [See LWJ report, Pakistani clerics endorse suicide bombings, reject proposed peace conference.] Ashrafi told Pajhwok Afghan News yesterday, however, that “I’ve never supported suicide attacks that cause civilian casualties in Afghanistan,” and he added that such bombings had also been banned by Taliban emir Mullah Omar. Despite Ashrafi’s claim that Mullah Omar does not support suicide attacks, the tactic has been used with regularity by his Taliban forces. Since the first such attack on Sept. 9, 2001, suicide attacks have killed well over 3,755 people in Afghanistan, and the vast majority of the victims of these attacks have been civilians. According to the United Nations’ 2012 Report on Protection of Civilians in Armed Conflict in Afghanistan, 22% of all civilian casualties inflicted by antigovernment elements in 2012 were caused by suicide attacks. The UN documented 1,507 civilian casualties in 2012 (328 killed and 1,179 injured) from 73 incidents of suicide and complex attacks (the latter include suicide attacks). Three children died executing suicide attacks in 2012, and 48 more were arrested for planning to conduct such attacks. The UNAMA report also states: “In 2012 UNAMA documented 46 separate incidents for which the Taliban publically claimed responsibility. These incidents accounted for a total of 513 civilian casualties and included 15 targeted killings, 12 suicide and complex attacks, nine IED incidents and seven ground engagements.” Ashrafi’s assertion yesterday that a suicide attack against a purely military target would be permissible is also curious, given that many suicide bombers are themselves civilians. The ranks of suicide bombers include children as young as eight, women, and the mentally handicapped. [See LWJ reports, Taliban rebuild children’s suicide camp in South Waziristan, Pakistani Taliban kidnap young girl to turn her into a suicide bomber, and Female suicide bomber strikes in Peshawar, and see also LWJ report, Al Qaeda in Iraq uses disabled women in Baghdad bombings.] Ashrafi’s statement endorsing suicide attacks triggered widespread condemnation from Afghan clerics and government officials, among others. The Afghan High Peace Council issued a statement castigating Ashrafi’s declaration on jihad as contradicting every Islamic principle, and a group of Afghan Islamic scholars and clerics said that it was not for the head of Pakistan’s ulema council to issue a fatwa, according to TOLOnews. Afghan national security advisor Rangin Dadfar Spanta warned that the “fatwa” issued by Ashrafi demonstrated the strong current of violence that threatened the Afghan people, Khaama Press reported. Deputy national security advisor and former spy chief Rahmatullah Nabil called for the international community to blacklist both Ashrafi and Pakistan’s Inter-Services Intelligence Agency, according to TOLOnews. Nabil said the fact that Pakistani clerics had responded to the conference invitation with “a religious Fatwa and [that they] consider Jihad in Afghanistan as permissible” amounted to a “very shameless confession” that Pakistan does not want a peaceful and powerful Afghanistan. Ashrafi’s fatwa also drew a reaction from NATO. Secretary General Anders Fogh Rasmussen stated in Kabul today after meeting with President Hamid Karzai: “I strongly condemn endorsing suicide attacks and there is no justification for such a terrorist attacks.” Speaking at the joint press conference with Rasmussen, Karzai said the chief Pakistani cleric’s fatwa endorsing suicide attacks served to clarify Pakistan’s position regarding Afghanistan, Khaama Press reported. The speed and the nature of Ashrafi’s apparent shift in position yesterday on the issue of suicide attacks suggest that forces are working on him to ‘shape the message.’
<urn:uuid:f538f4c3-cd81-478a-8656-9a55e35e34ce>
CC-MAIN-2017-04
http://www.longwarjournal.org/archives/2013/03/in_a_somewhat_startl.php
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280730.27/warc/CC-MAIN-20170116095120-00254-ip-10-171-10-70.ec2.internal.warc.gz
en
0.954966
913
1.695313
2
The federal government has reached a $40-billion agreement in principle related to First Nations child welfare, with half the money earmarked to compensate adults who went through the system as children and the other half directed toward reform. The parties reached the agreement on New Year’s Eve, on the last day of negotiations, which included the Assembly of First Nations, the First Nations Child and Family Caring Society, and representatives of class-action lawsuits related to Indigenous child welfare. The federal government will reveal details of the non-binding agreement on Tuesday. Mary Teegee, who represents British Columbia on the First Nations Child and Family Caring Society’s board, confirmed on Sunday that $20-billion will be directed toward compensation and $20-billion to reform. “The Caring Society’s bottom line has always been about ensuring that the children and the families that [have] been affected are definitely compensated, for one thing, but also to ensure that there are safeguards to ensure that discrimination doesn’t happen again,” she said. Ms. Teegee said some of the agreement’s details must still be ironed out. Cowessess First Nation in Saskatchewan last summer became the first First Nation to strike a deal with Ottawa to return jurisdiction over children’s services to the community. On Sunday, Cadmus Delorme, Cowessess’s chief, said the shift has been successful, albeit with hiccups. The agreement in principle reached on Friday recognizes the harm done in the past and will help bring equality for First Nations children today, Mr. Delorme said. “Half of it is going to the road behind us. The ones that were in the system, that were not treated right. And so they will be compensated,” he said in an interview. “The other half is the headlights. How do you reform child welfare so that one day there is no children in care? How do you make sure that First Nations control their destiny when it comes to children in care and prevention services?” Indigenous Services Minister Patty Hajdu and Crown-Indigenous Relations Minister Marc Miller, along with parties involved in the child-welfare discussions, will hold a news conference on Tuesday to provide an update on the agreement. Ottawa has been keen to reach a settlement on the issue, which has been a source of controversy for the Liberals for years. Opposition parties and advocates have repeatedly criticized the federal government on the matter, arguing its approach is harmful to First Nations children. In December, the federal government said it would earmark $40-billion to compensate First Nations children and families for the failures of Canada’s child-welfare system and to pay for long-term reform, in hopes of settling the matter of court before the end of 2021. The $40-billion pledge is related to class-action lawsuits, as well as a court battle over a finding by the Canadian Human Rights Tribunal (CHRT). It required Ottawa to provide up to $40,000 in compensation to each First Nations child unnecessarily taken into foster care because of underfunded government services since 2006. The order also required payments to parents and grandparents. In October, the government announced it would appeal a Federal Court decision the month before that upheld the CHRT finding, despite calls not to pursue further legal action from representatives from the Canadian Bar Association, the Canadian Medical Association, as well as from opposition parties. Ottawa also said at the time that it had agreed to put a pause on the litigation while it negotiated outside of court with First Nations groups. Mr. Miller said in December that if Mr. Sinclair was not facilitating the discussions, they probably would have broken down. Mr. Miller also said progress made in the talks would have taken years in an “adversarial process.” Our Morning Update and Evening Update newsletters are written by Globe editors, giving you a concise summary of the day’s most important headlines. Sign up today.
<urn:uuid:b905e1f8-7de8-497d-a11d-1b46f62f8f19>
CC-MAIN-2022-33
https://www.theglobeandmail.com/canada/article-ottawa-reaches-40-billion-deal-with-first-nations-over-child-welfare/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573118.26/warc/CC-MAIN-20220817213446-20220818003446-00674.warc.gz
en
0.969934
823
2.203125
2
Global citizenship in education is the civil society aspect of globalization, the responsibilities that go with increasing interdependence in the world. Global citizens respect social and economic equality, human rights and the environment. In accordance with the school values and charter, AGGS has introduced and will further develop Global Citizenship as an integrating theme that supports the numerous initiatives running throughout the school both curricula and co-curricula. In broad terms three areas are covered: - the promotion and protection of human rights, - protection of the environment, - and the fostering of closer connections in the international community. AGGS was the first school partner in Human Rights in Education, the school has grounded the rights and responsibilities of citizenship in human rights: Auckland Girls' Grammar is a rights respecting school. All areas of school life are conducted with respect to the principles of the Universal Declaration of Human Rights and the United Nations Convention on the Rights of the Child. All members of our school community have the responsibility to ensure that one another's rights are respected.
<urn:uuid:1c765546-5196-4527-adce-9df6c3c0621e>
CC-MAIN-2022-33
http://www.aggs.school.nz/curriculum/global-citizenship
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573104.24/warc/CC-MAIN-20220817183340-20220817213340-00465.warc.gz
en
0.94682
212
2.890625
3
When I was a small child, my parents used to hide Easter eggs in our garden early morning on Easter Sunday. It always was very exciting, and they would call my brother and me, telling us "the Easter Bunny was just here and hid some chocolate eggs in the garden. Quick! Quick! If you hurry, you might still see him!" We would rush out with excitement...but we always missed him. Except for one year, when I was convinced that I saw the Easter Bunny's woolly tail as he jumped over the wall to our neighbours. I was beside myself with excitement. My elder brother and sister scoffed at me, but I insisted that I saw him. It was then that they very cheekily told me that the Easter Bunny did not exist. However, I refused to believe them and stuck to my story. I know what I saw! Today I still have a vivid imagination, and I still have a love for chocolate eggs. It's these little traditions that create great childhood memories. The only problem with my love for chocolate nowadays, is that it tends to leave memories as well - around my hips. So, with Easter around the corner, what are we to do? The answer is very simple: you can still enjoy some chocolate but go for the dark variety. Dark chocolate contains less sugar and fat than its paler cousins and is rich in flavonoids - antioxidants that are believe to improve heart health and boost your immune system. Dark chocolate also helps to lower blood pressure and improves your body's sensitivity to insulin. And, last but not least, it provides you with energy and puts you in a great mood thanks to the amino acid tryptophan which is used by the brain to produce the feel-good hormone serotonin. The latest research has found that chocolate could even help you stay thin! Remember to enjoy your chocolate treats in moderation and go easy on the kilojoule-loaded hot cross buns. Rather focus on the message of Easter and enjoy the togetherness with your loved ones. - (Birgit Ottermann, Eat well newsletter, March 2012)
<urn:uuid:854cb6f0-7680-48ba-a316-8d261bf42e10>
CC-MAIN-2016-44
http://www.health24.com/Columnists/Hopping-mad-for-Easter-eggs-20120721
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719908.93/warc/CC-MAIN-20161020183839-00159-ip-10-171-6-4.ec2.internal.warc.gz
en
0.976226
431
1.945313
2
Published in journal "International relations", 2013-4 in rubric "Russian foreign policy", pages 443-451. Resume: The article presents a conceptual position of the author on a topical issue of formation of a complex multi-level innovative “soft power” strategy in the foreign policy of the Russian Federation, recovery and development of the “soft power” of Russia in the post — Soviet area and further abroad. The text contains analysis of the conditions necessary for the formation of the Russian public diplomacy and foreign cultural and information policy of the new generation. In spite of the fact that the modern international agenda is still centered upon the use of military force by the states as a priority means to achieve security, the cultural and communications globalization, powered by the growing economic interdependency leads to complementing of the military resources with the non-military political influence factors, which can be generally referred to as the “soft power”. In the opinions of the American political scientists, the tendencies in the development of international relations shall be for greater influence of the “soft power” in the general power balance of the states, and even the largest and most developed states shall not be able to resolve their problems purely by military means. They explain it by interdependency of economics (and interdependency management becomes a key force behind the American efforts in this sphere), and lowering of the role of “military glory” among the values of modern post-industrial societies. Keywords: international relations, foreign politics, Russia, soft force, political instability, diplomacy, state, interests, values, security. 1. Kontseptsiya vneshney politiki RF // URL: http://www.mid.ru/brp_4.nsf/0/6D84DDEDEDBF7DA644257B160051BF7F 2. Sukharev A.I. Politicheskoe stanovlenie sub'ektov setevykh gumanitarnykh vzaimodeystviy v mezhdunarodnykh otnosheniyakh global'nogo mira: avtoref. dis. na soisk. uch. st. ... d-ra polit. nauk. M., 2011. S. 44. 3. Starchak M.A. Rossiyskoe obrazovanie na russkom yazyke kak faktor vliyaniya Rossii v Tsentral'noy Azii: chto proiskhodit i chto delat' // URL: http://www.russkiymir.ru/russkiymir/ru/analytics/article/news0003.html 4. Dolinskiy A.V. Prakticheskie voprosy optimizatsii rossiyskoy publichnoy diplomatii // URL: http://www. Correct link to this article: just copy this link to clipboard
<urn:uuid:aac259ea-77c2-4f13-9a0c-bafba97fe8f7>
CC-MAIN-2022-33
https://en.nbpublish.com/library_read_article.php?id=-26151
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00272.warc.gz
en
0.780929
695
2.109375
2
Manila, Philippines, November 5, 2015— Forest fires generated from pulp, paper, and palm oil production in West Java are choking Indonesia and neighboring countries in a thick blanket of haze, and the equatorial winds have brought the haze to the Philippines. Exposure to haze pollutants such as ozone, particulate matter, carbon monoxide, and sulfur dioxide pose health risks, particularly respiratory and lung problems. Residents, especially those living in Mindanao and Cebu, should take precautionary measures to stay protected from these health hazards. One way is to use a Sharp Plasmacluster Air Purifiers with Haze Mode, for clean and pollutant-free air inside the home. PCI Technology: Purging the home of haze pollutants With PCI Technology, those residing in areas affected by haze pollution can now worry less about airborne viruses and hazardous particles penetrating their homes. Certain models of Plasmacluster Air Purifier are equipped with Haze Mode, which is truly effective in getting rid of haze particles that manage to sneak indoors. PCI Technology uses a natural air defense mechanism that reverses air pollution and eliminating 99% of airborne threats. When Plasmacluster Ions come in contact with airborne threats, OH radicals form on its surface. These OH radicals take away the hydrogen and decompose protein found in viruses, bacteria, microbes and allergens. Without protein, airborne threats are disabled and, in effect, deactivated. The hydrogen left combines with OH radicals, and together they transform into water which is released into the air. Recently, researchers from the University of Tokyo Hospital discovered that using PCI Technology substantially reduces the dosage period and volume of medication prescribed for respiratory symptoms, especially in children with atopic asthma, while improving the condition of respiratory tract inflammation in patients with infantile atopic-type asthma. This means a stronger safeguard from respiratory and lung problems that come along with haze exposure. Made even better with Haze Mode Children, having smaller respiratory tracts, make them susceptible to respiratory conditions by inhaling harmful particles. Even adults, when exposed to pollution can cause asthma, chronic pulmonary disease, and recurring symptoms like coughing, difficulty breathing, and chest tightening. Protect the family from pollutants and dust brought in by haze. The powerful Haze Mode in select PCI Air Purifier models work together with True HEPA Filter, which captures 99.97% of particles as tiny as 0.3 microns. Secure your home and protect the whole family by using a Sharp Plasmacluster Air Purifier with Haze Mode to ensure air that’s safe to breathe. Availability and Pricing Plasmacluster Air Purifiers with Haze Mode (FP-F30E-H, FP-F40E-W, FP-FM40E-B, KC-D40E-W, KC-D60E-W) are available at all leading appliance stores nationwide, with pricing that starts from Php 7,498. For more information on Plasmacluster Ion Technology, and other exceptional products of Sharp Philippines Corporation, visitwww.sharp.ph or join us on www.facebook.com/SharpPhilippines and Instagram at @Sharp.PH. Karina is not your ordinary supermom. She juggles her time bonding with her three amazing kids while being in the loop on the latest happenings in the tech and lifestyle scene. Follow me on Instagram (@digitalfilipina) regularly visit www.digitalfilipina.com for daily dose of updates not just for moms but for everyone!
<urn:uuid:73165ac0-03e0-4d9e-abfb-f21d070421d3>
CC-MAIN-2022-33
https://www.digitalfilipina.com/beat-the-haze-with-sharp-plasmacluster-air-purifier/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00278.warc.gz
en
0.911466
721
2.796875
3
The 16th to 18th century The development of the mitre lock, a double-leaf gate the closure of which formed an angle pointing upstream, heralded a period of extensive canal construction during the 16th and 17th centuries. The canals and canalized rivers of that period foreshadowed the European network to be developed over many years. In France the Briare and Languedoc canals were built, the former linking the Loire and Seine and the latter, also known as the Canal du Midi, linking Toulouse with the Mediterranean. Both were remarkable feats of engineering. The Briare Canal (completed 1642) rose 128 feet to a plateau with a summit level 3.75 miles long and then dropped 266 feet to the Loing at Montargis. It included 40 locks, of which a unique feature was a staircase of six locks to cope with the fall of 65 feet on the descent from the Loing to Rogny. Construction of the 150-mile Canal du Midi joining the Bay of Biscay and the Mediterranean via the Garonne and the Aude ran through very rugged terrain. Begun in 1666 and finished in 1692, it rose 206 feet in 32 miles from the Garonne at Toulouse to the summit through 26 locks, and, after a three-mile stretch along the summit, then descended 620 feet through 74 locks for 115 miles. Near Béziers a staircase of eight locks was built, and six miles farther upstream a tunnel 180 yards long was constructed; three major aqueducts carried it over rivers, and numerous streams were diverted beneath it in culverts. The most notable technical achievement was a complex summit water supply that included unique diversion of flows and storage provision. The canal system in Flanders included one from Brussels to Willebroeck on the Rupel to shorten navigation by half, an 18 1/2-mile canal with four locks; another of 44 miles was constructed from Brugge to Passchendaele, Nieuport, and Dunkirk and was later extended to Ostend, while Dunkirk was linked with the Aa River, at the mouth of which a large tide lock was constructed at Gravelines. The outstanding achievement in Flanders was a lock at Boesinghe on the canal from Ypres to Boesinghe beside the Yser River. The fall of 20 feet on this four-mile stretch was contained by a single large lock. Side ponds with ground sluices were provided for the first time to reduce the loss of water during the lock’s operation. The ponds took one-third of the water when the lock was emptied and returned it for the filling. In Germany the 15-mile Friedrich Wilhelm Summit Canal, completed in 1669, rose from Neuhaus on the Spree for 10 feet in two locks and from west of the summit fell 65 feet to Brieskow on the Oder. An extensive system of waterways in this part of Germany was finally established with the opening of the Plauer Canal in 1746, which ran from the Elbe to the Havel. The 25-mile Finow Canal along the Havel to the Liepe, a tributary of the Oder, had been built earlier but fell into decay because of flooding and neglect and was not rebuilt until 1751. In the late 17th and early 18th centuries, under the great elector of Brandenburg and Frederick I of Prussia, the three great rivers, the Elbe, Oder, and Weser, were linked by canal for commercial and political reasons, including the bypassing of tolls charged by the numerous states and petty principalities of the Holy Roman Empire. In the Low Countries, wars, political considerations, and the rivalry between the Dutch and Belgian ports handicapped canal building. The Dutch, for example, strongly opposed a Rhine-Meuse-Schelde canal, fearing diversion of trade to Antwerp. Test Your Knowledge Strange Geographical Features: Fact or Fiction? The first lock was not built on an English canal until the 16th century, and the canal era proper dates from the construction of the Bridgewater Canal to carry coal from Worsley to Manchester in the 18th century by the engineer James Brindley. Opened for navigation in 1761, it was extended to the Mersey in 1776. Its success promoted a period of intense canal construction that established a network of inland waterways serving the Industrial Revolution and contributing to Britain’s prosperity in the half-century preceding the railway era, which began in the mid-19th century. The Grand Trunk Canal established a cross-England route by linking the Mersey to the Trent, opened up the Midlands, and provided water transport for exports to European markets. There followed the link between the Thames and the Bristol Channel provided by the Severn Canal and the Gloucester and Berkeley Ship Canal from Sharpness on the Severn to Gloucester. Birmingham’s growth and industrial prosperity were stimulated because the city became the centre of a canal system that connected London, the Bristol Channel, the Mersey, and the Humber. The Caledonian Ship Canal across Scotland, joining the chain of freshwater lakes along the line of the Great Glen, was built between 1803 and 1822. One of the few canals to be built after the canal era was the 36-mile-long Manchester Ship Canal, which was opened in 1894 to give oceangoing vessels access from the Mersey estuary to Manchester. This spate of canal construction was accompanied by technological development in both construction methods and operation. Locks, inclined planes, and lifts were developed to cope with changes in water level. At Bingley, for example, on the Leeds and Liverpool Canal, a lock staircase was built; and on the hilly areas at Ketley in Shropshire, inclined planes were constructed in 1788 to haul tugboats from one level to another. The longest plane, about 225 feet, was on the Hobbacott Down plane of the Bude Canal in Cornwall. Vertical lifts counterweighted by water were also used; a set of seven was built on the Grand Western Canal; while at Anderton in Cheshire a lift was later converted to electrical power and was still operating in the 20th century. The most spectacular inclined plane was built in the United States on the Morris Canal, which linked the Hudson and Delaware rivers. For a rise of 900 feet to the Alleghenies watershed, 22 locks were installed at the head of an inclined plane and, descending on a gradient of 1 in 10 to 1 in 12, ran down to the pound below. Barges 79 feet long with loads up to 30 tons were hauled up by trolleys running on rails, on which they settled as the lock emptied; the barges descended under gravity into the lower pound to float on an even keel when the water leveled off. In the reverse direction, they were hauled up by a drum-and-cable mechanism.
<urn:uuid:2895b411-62d1-4916-9513-9488587e803c>
CC-MAIN-2017-04
https://www.britannica.com/technology/canal-waterway/The-16th-to-18th-century
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282935.68/warc/CC-MAIN-20170116095122-00238-ip-10-171-10-70.ec2.internal.warc.gz
en
0.970991
1,438
4.03125
4
A 14-year-old boy admitted yesterday that he threw a piece of burning coal into the Carmel Forest and caused the most devastating fire in Israel's history. Under interrogation, the teen admitted that he smoked a water pipe in the forest and later disposed of a piece of burning coal in an open area there, starting the fire. He said he was so astonished by what had happened he ran back to school and didn't report the incident. He was arrested after police gathered testimony from a number of local residents. The teen reenacted the incident for the police yesterday afternoon. He will be brought before the Haifa Magistrate's Court today for a hearing on extending his detention. Earlier yesterday, the Haifa Magistrate's Court released two teenagers who had been suspected of igniting the fire. Police had arrested the brothers, 14- and 15-year-old residents of the Druze village of Isfiya, on Saturday. The court had remanded them for three days. The brothers' father said the two were not responsible for starting the fire and were not present when the blaze started. The court ruled that there was no solid evidence implicating them. "My sons are innocent," the father said. "The policemen came and took them away from home as if they were terrorists." According to the father, the fire broke out several kilometers away from the family's house. He claimed that he and his children had no connection to the fire and that they later helped in efforts to put the blaze out. "They are not connected to this, they do not smoke and they did not build a campfire. They are good and innocent kids and we will not let them be maliciously framed." He added: "I am pleased with the court's decision. I have good feelings because the children have returned to me." He said he was pained by the disaster that the region was suffering. Two other young suspects were also questioned in the case but were released due to a lack of evidence. During a situation assessment on Saturday at the northern police headquarters, Police Commissioner David Cohen confirmed that the fire was caused by negligence, not arson. The Carmel fire claimed 42 lives and destroyed nearly 50,000 dunams of land in the region. Want to enjoy 'Zen' reading - with no ads and just the article? Subscribe todaySubscribe now
<urn:uuid:90855d63-a119-4737-b123-839a56ed8a11>
CC-MAIN-2017-04
http://www.haaretz.com/teen-admits-to-inadvertently-sparking-fire-that-started-carmel-blaze-1.329237
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283008.19/warc/CC-MAIN-20170116095123-00089-ip-10-171-10-70.ec2.internal.warc.gz
en
0.989473
480
1.640625
2
170 Southern Historical Society Papers. the best achievement of the Arkansas. That we were under the bat- teries of Vicksburg did not amount to anything. I do not believe that either vessel was injured by an army gun that day. We were left to our fate, and if we had been lost it would have been no unusual or une.xpected thing. The Essex used, in one of her guns that day, projectiles that were probably never used before, to- wit : Marbles that boys used for playing. We picked up a hundred un- broken ones on our forecastle. There were "white-allies," "chinas," and some glass marbles. I wish the naval reader to understand that the Essex did not return the fire as she lay alongside us, did not at- tempt to board, although he had a picked crew for that purpose, and fired but three guns in the fight, and thereafter kept her ports closed. Brown, no longer able to play the lion, assumed the role of the fox with consummate skill. Sketch of the Third Maryland Artillery. By Captain William L. Ritter. RETREAT FROM NASHVILLE. Now commenced one of the most disastrous retreats of the war. Seventy-two pieces of artillery were lost at Nashville, and hundreds of wagons were abandoned for want of mules to pull them. The roads were in wretched condition in consequence of the inclemency of the weather. The heavy rains rendered the streams almost im- passible. Short rations, provender and clothing added much to the suffering of both man and beast. The pelting of the rain, sleet and snow upon the backs of half naked, half starved men as they marched day and night before a relentless foe is only a part of the true story. Many mules were taken from the ordnance wagons to be used in the pontoon train. The battalion marched to Franklin the night of the i6th of Decem- ber, 1864, and on the morning of the i8th, reached Columbia, where the battalion encamped for the night. The next day, the 19th, the retreat was resumed, marching all day and the greater part of the night through rain and snow. This was the most inclement day of the retreat and the most intense suffering was experienced by the entire army. Shoeless men marched all the way from Nashville to Mississippi, without any protection whatever to their feet, and they only can describe the suffering they endured.
<urn:uuid:bfc0f919-9d61-4f9c-a66f-6e826a6a104e>
CC-MAIN-2017-04
https://en.wikisource.org/wiki/Page:Southern_Historical_Society_Papers_volume_12.djvu/180
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281746.82/warc/CC-MAIN-20170116095121-00287-ip-10-171-10-70.ec2.internal.warc.gz
en
0.979571
519
2.109375
2
1ST file extension - Visual FoxPro Documenting wizard list What is 1st file? How to open 1st files? File type specification: The 1ST file extension is mainly related to Visual FoxPro and used for files that contain saved documenting wizard list. Most likely used in some of the older versions of Visual FoxPro. The default software associated to 1st file type: Company or developer: Microsoft Visual FoxPro is set of tools that is used to create database applications, desktop applications and web applications. Visual FoxPro uses own proprietary data centric object oriented and procedural programming language. Visual FoxPro is available for Microsoft Windows. List of recommended software applications associated to the .1st file extension Recommended software programs are sorted by OS platform (Windows, Mac OS X etc.) and possible program actions that can be done with the file: like open 1st file, edit 1st file, convert 1st file, view 1st file, play 1st file etc. (if exist software for corresponding action in File-Extensions.org's database). - Others 1st file Unspecified and all other actions for computer programs working with 1st file - Visual FoxPro Documenting wizard list Click on the software link for more information about Visual FoxPro. Visual FoxPro uses 1st file type for its internal purposes and/or also by different way than common edit or open file actions (eg. to install/execute/support an application itself, to store application or user data, configure program etc.).
<urn:uuid:7374d39f-24e8-49f2-ae50-252b33a16de8>
CC-MAIN-2017-04
https://www.file-extensions.org/1st-file-extension
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280221.47/warc/CC-MAIN-20170116095120-00234-ip-10-171-10-70.ec2.internal.warc.gz
en
0.881937
314
2.0625
2
The 6 Most Important Decisions You'll Ever Make A Guide for Teens, by Covey, Sean - ISBN: 9780743265041 | 0743265041 - Cover: Paperback - Copyright: 10/3/2006 |The 6 Big Ones||1||(14)| |The 7 Habits Crash Course||15||(18)| |Decision 1: School||33||(56)| |Decision 2: Friends||89||(36)| |Decision 3: Parents||125||(44)| |Decision 4: Dating & Sex||169||(54)| |Decision 5: Addictions||223||(42)| |Decision 6: Self-Worth||265||(38)| |Stick to the Cale||303||(3)| |About Franklin Covey||321||(3)| The Choice Is Yours Call me Sean. I'm the author and I'm glad you're here. Don't worry. This won't be another boring book. This one's different. It's written just for teens and deals with your life, your problems, your stuff. It also has a lot of great cartoons (I had to hire several artists and pay them a fortune because I can't draw worth squat.) This book is about one idea. I'll get straight to the point. There are six key decisions you make during your teen years that can make or break your future. So, choose wisely, and don't blow it. If you do happen to blow it, however, it's not the end of the world. Just get back on track quickly and start making smarter choices. Being a teen today is tougher than ever. While your grandparents may have had to walk uphill to school in the snow, you have a different set of challenges to navigate: like media overload, party drugs, Internet porn, date rape, terrorism, global competition, depression, and heavy peer pressure. It's a totally different world! Although I still shoot spit wads, I'm no longer a teen, but I vividly remember the ups and downs I went through. Most of my problems began at birth. My dad said, "Sean, when you were born your cheeks were so fat the doctor didn't know which end to spank." He wasn't kidding. You should see my baby pictures. My cheeks hung off my face like water balloons. You can imagine how often I was teased. Once I was with all the neighborhood kids jumping on our trampoline. We were playing a game of add-on and it was my turn. Susan, my neighbor, couldn't resist saying what everyone was thinking, "Man, look at Sean's bouncing cheeks. They're so fat." David, my younger brother, in an effort to defend me said, "They're not fat. They're muscle." His valiant effort backfired, and everyone got a kick out of my new nickname, "Muscle Cheeks." My problems continued into junior high school. I hated seventh grade and have chosen to forget most of it. I do remember that I still had fat cheeks and an eighth grader named Scott kept trying to pick a fight with me. I don't know why he picked on me. I'd never met the guy. Maybe it was because he was confident he could pound me. He'd wait in the hallway with a couple of his friends and challenge me to a fight every day after my algebra class. I was petrified and tried to stay away from him. One day he cornered me. "Hey, Covey. You big fat sissy. Why don't you fight me?" He then slugged me in the stomach real hard, knocking my breath out. I was too scared to fight back. He left me alone after that. But I was humiliated and felt like a loser. (By the way, I'm bigger than Scott now and I'm still looking for him. Kidding!) As I began high school, to my pleasant surprise, my face grew into my cheeks, but a new set of problems arose. Suddenly I had to make a lot of important decisions that I wasn't ready for. During the first week, I was invited to join a club with seniors who drank a lot. I didn't want to join but I also didn't want to offend them. I started to make new friends. Then, there were all these new girls. One even started liking me. She was pretty and aggressive and it was exciting and scary all at once. I had so many questions. Should I like this girl? Who should I hang out with? What classes should I take? Should I go to that party? How can I juggle school, sports, and friends? I didn't realize it at the time, but these were some of the most important decisions I'd ever make in my life. The idea for this book started when I sent out surveys to hundreds of teens from all over and asked, "What are your biggest challenges?" Here's what a few of them said: "Stress. Trying to fit everything in is my number one challenge because I have a lot on my plate." "Dealing with sexuality. I have to be able to make the right choices now so that I don't have to live with my mistakes later. It seems like if you're not having sex when you're a teenager, then you're a prude or something." "Parents. I have to deal with them every day and it's exhausting." "School and grades. My mom screams at me." "Preparing for college. It's right around the corner and I haven't really given it much thought. Every time I try to think about it, I just end up getting a huge headache, so I don't." "Divorce of my parents. They always fight over who gets visitation." "High-school drama. Who's going out with who? Popularity. Best hair. Most athletic. Who's got money? Who said this about them? It's ridiculous!" "Money. Barely enough money to live." "Peer pressure is a major problem. I give in really easy, with the right people." "I worry about the safety of my family because you can walk the streets and get killed. Most people are not going to school just to do drugs. I fear for my lil' brother and sister." "Body and appearance. I struggle with my weight all the time." "Friends. They are just bugging the heck out of me. I don't relate to them anymore. They ignore me and stay in their little cliques. I feel excluded, so lately I have just been staying away from them." "Dating. I don't date whatsoever and here I am at 17. My friends dog me and make me feel like I'm not doing something I should." "Body and appearance. I struggle with my weight all the time." I carefully studied all the surveys I got back. I also interviewed numerous teens from various locations over a three-year period. And a pattern began to emerge. Out of the 999 different challenges that were mentioned, six stood out above all the rest. As I looked deeper, I discovered that with each challenge there was a choice (or series of choices) to be made. Some teens I interviewed had made smart choices; others, dumb ones. As a result, some were happy and some messed up. These challenges represented fork-in-the-road decisions and the consequences were huge. It became clear that what you do about these challenges are the six most important decisions you'll ever make as a teen! The Six Most Im portant Decisions You'll Ever Make - School.What are you going to do about your education? - Friends.What type of friends will you choose and what kind of - friend will you be? - Parents.Are you going to get along with your parents? - Dating and Sex.Who will you date and what will you do about sex? - Addictions.What will you do about smoking, drinking, drugs, - and other addictive stuff? - Self-Worth.Will you choose to like yourself? You may not have thought much about these decisions. Or you may be struggling with one of them or all of them. Whatever your situation, you need to learn all you can about each decision, the ins and outs, the good and bad, so that you can makeinformeddecisions, with your eyes wide open. You don't want to get down the road and find yourself saying, "If only I'd known better." Many decisions you make as a teen can impact your life forever. In his bookStanding for Something,religious leader Gordon B. Hinckley tells this story about when he was young: While working in a Denver railroad office, I was in charge of the baggage and express traffic carried in passenger trains. One day I received a call from my counterpart in New Jersey who said that a passenger train had arrived without its baggage car. Three hundred patrons were angry, as well they had a right to be. We discovered that the train had traveled from Oakland, California, to St. Louis, where a switchman had mistakenly moved a piece of steel just three inches. That piece of steel was a switch point, and the baggage car that should have been in Newark was in New Orleans, fourteen hundred miles away. Prisons all over the world are filled with people who made unwise and even destructive choices, individuals who moved a switch point in their lives just a little and were soon on the wrong track going to the wrong place. Each of these six decisions is like a switch point, a small three-inch piece of steel that will lead us down the right or wrong track for hundreds of miles. A Tale Of Two Teens Imagine two 19-year-old girls about to graduate from teenagehood. At age 13, they were in similar situations. At 19, they are in very different places, because of their choices. Meet Allie.She smiles a lot. She is attending a local university and has two great roommates; they have a riot together. Allie has a tuition scholarship, and also works part time as a teacher's assistant. She plans to graduate in two years with a degree in English and become a teacher. Allie is dating two different guys right now, but isn't really serious with either yet. Throughout her teen years, she didn't date much and felt a little insecure about it, but she's proud that she didn't sleep around with every other guy. She hopes to meet a wonderful guy and get married someday. At fifteen, Allie tried drugs once but, afterward, realized how stupid it was. Since then, except for an occasional glass of wine, Allie doesn't drink, smoke, or do drugs. She's free of addictions. Every Sunday night, Allie calls her mom, whom she calls her "best friend." Although she has problems, overall, she is confident, goal-driven, and happy with herself. Meet Desiree.She is strikingly beautiful but suffers from low self-esteem. When asked why, she replies, "I don't know. It's just that I'm always thinking I'm fat and ugly." Desiree started smoking when she was fourteen and smokes two packs a day now. She claims she could quit tomorrow. She works full-time at a grocery store making minimum wage. Although she completed high school, she never really tried in school and doesn't see a need to get more education. She lives in an apartment by herself and has various live-in boyfriends. During high-school, she fooled around with lots of guys and was involved in many abusive relationships. "I always seemed to pick losers," she says. Desiree doesn't have much of a relationship with her parents. And she has little contact with any of her best friends from high school. She doesn't know what she wants to do with her future and often gets depressed. Two girls. Two totally different outcomes. Why? Because of their choices. Can you begin to see why making smart choices about school, friends, parents, dating, sex, addictions, and self-esteem is so huge? The Ten-Year Experiment Before going any further, try this little experiment: Your job is to introduce yourself to someone as you were exactly ten years ago today and tell them a few things about yourself. If your name is Jeremie and you're seventeen, you would say something like: "Hi, my name is Jeremie. I'm seven years old and I live in Toronto, Canada, with my parents and my younger brother, who is four. I just finished first grade. I have a goldfish named Spot and I love to color and play soccer. I feel happy inside." If you're reading this book and you're near someone, try this experiment with them. Tell them it's part of a book assignment, so they don't think you've gone psycho. Introduce yourself as you were ten years ago, then have them do the same. If no one's around or you're too embarrassed (no big deal), just fill in the blanks below. The date ten years ago today is: My name is: I am ______ years old. I live in: I live with: My favorite things to do are: Now, shift gears. Your job is to introduce yourself to the same person as you would like to be ten years into the future. Tell them what you're doing and a little about yourself. Remember, this is howyou would like to beten years from now. So, Jeremie would say something like: "Hi. I'm Jeremie. I'm 27 years old and I live in Vancouver, Canada. I just got married to a wonderful woman named Jasmine. A few years ago I graduated in music from the University of Toronto and I now teach piano at a private music school. I love my family and I hang out with them a lot. I'm feelin' really good about where I'm headed with my life." The date ten years from now is: My name is: I am _____ years old. I live in: I live with: Over the past ten years I have: You just practiced time travel. When you went back ten years, what memories surfaced? Were you in a good spot or a bad one? And what about the future? What did you see ten years from now? What do you want to do and who do you want to become over the next decade? Free To Choose The good news is, where you end up ten years from now is up to you. You are free to choose what you want to make of your life. It's calledfree agencyorfree willand it's your birthright. What's more, you can turn it on instantly! At any moment, you can choose to start showing more respect for yourself or stop hanging out with friends who bring you down. Ultimately, you choose to be happy or miserable. The reality is that although you are free to choose, you can't choose the consequences of your choices. They're preloaded. It's a package deal. As the old saying goes, "If you pick up one end of the stick, you pick up the other." Choice and consequence go together like mashed potatoes and gravy. For example, if you decide to do poorly in school and not go to college, you'll suffer the natural consequences of finding it hard even to get an interview for a high-paying job. Likewise, if you date intelligently and avoid casual intimacy, you'll enjoy the consequences of having a good reputation and not worrying about STDs and pregnancy. The worddecisioncomes from the Latin root meaning "to cut off from." Saying "yes" to one thing means saying "no" to another. That's why decisions can be hard sometimes. You're always better off making a decision once and being done with it instead of making it again and again. For example, as a teen, I decided I wasn't going to smoke, or drink, or do drugs. (Now, I'm not making myself out be a hero, because I made lots of mistakes as a teen, as I'll show you later. But I did do this one thing right.) So, I avoided parties where everyone got plastered. I chose not to hang out with guys who did drugs. I never felt peer pressure to do this stuff because I'd already made up my mind once and didn't have to keep making that decision over and over. Some might say that I missed out on a lot of fun. Maybe so. To me, it gave me freedom: freedom from getting stoned and doing something stupid; freedom from a drunk driving offense; freedom from forming an addiction. A Quick Overview There are different ways in which you can read this book. You can read it from start to finish (probably the best way), or skip around and go to the chapters that interest you the most. If you're really lazy, just look at the cartoons. Here is a quick overview of the chapters. School -- I'm Totally Stressed Out! Of all your challenges, school ranks #1. Why? It's the stress! As one teen put it, "School...Argh! People put pressure on students that school is everything and it stresses me out!" You have to deal with gossip and grades, teachers and tests, labels and lunch ladies. Yikes! You have to cope with parents who actually expect you to try your best in school, for crying out loud. On top of that, you have to worry about preparing to get a real job someday. Why is what you choose to do about education such a big decision? Probably because what you do about it will open doors of opportunity or slam them shut for a very long time. In the chapter on school, we'll hit many important topics like: Freinds -- So Fun...So Fickle Some teens find it easy to make good friends. For many, though, it's a struggle. We don't fit in. Or we're judged because we don't have a perfect body or wear the right clothes. It's especially hard when your family has to move and, suddenly, you're the new kid at school trying to break into established cliques. Many of us have had times when we've not had any friends at all. Or we have such a great need to be accepted we become friends with anyone willing to accept us even if they bring us down. And then there's all the drama. It is the weirdest thing, but virtually every girl I've spoken to tells me, "Any two girls get along fine, but three never works." Us guys have a different set of challenges, like punching each other and dating each other's girlfriends. Who you choose as friends and the kind of friend you choose to be is a huge decision. In this chapter, we'll talk about lots of interesting stuff such as: Parents -- How Embarrassing! "My mom is OK. She tries to understand me. But it's like the more she tries the more she annoys me. And then my dad is just crazy. And I just can't relate to him at all." This is Sabrina. She's pretty normal. She loves her parents but can't figure them out half the time. Part of the problem with parents is how we see them. When I was in grade school, my parents were cool. But when I turned 13, they morphed into nerds and became so embarrassing. Suddenly, they forgot how to dress, talk, or walk upright. I'll never forget the time in eighth grade when I was on the sidelines during a football game and I felt a tap on my shoulder. "Hey, Sean. It's me. Dad. Do you and your buddies want a piece?" I was shocked. There stood my dad on the sidelines, where he wasn't supposed to be, with a 16- inch pizza, during the middle of my football game, asking me if I wanted a piece of freaking pizza. I was horrified. And, in front of all my teammates, I denied that I even knew him. But, trust me, when you get a little older you'll find that your parents will instantly mature and become cool again and your friends will start saying things like, "Dude, your mom is awesome." The quality of the relationship you want to have with your mom and dad is a choice and it's one of the most important decisions you'll ever make. In this chapter, we'll discuss many vital issues, including: - How to build an awesome relationship with your mom and dad - Disarming your parents in one line or less - Four magical expressions to use with your parents that work every time - Surviving a divorce - Coping with the "Why can't you be like your brother?" syndrome - What to do when your parents are really messed up and you have to raise them Dating & Sex -- Do We Have to Talk About This? I wish we didn't have to talk about it, but we do. If we didn't, I'd be irresponsible, because it's one of the most important decisions you'll ever make. Perhaps themostimportant. (Parents, if you're secretly reading your teen's book right now to see what I have to say about this topic, just relax and trust me. I won't botch it.) When I was a boy, my parents never talked about the birds and the bees. My dad would turn red in the face if he even thought about it. So, I learned all about it from the neighborhood boys that were in the know. But times have changed and you'd better get real clear on what kind of people you're going to date and what you're going to do about sex. If you don't, someone else will make the decision for you and you don't want that. In this chapter we'll get into stuff like: Addictions -- It's Not Hard to Quit...I've Done It a Dozen Times I admit it. I picked up an addiction in high school -- to nachos. I couldn't get enough of them. I couldn't watch a movie without nachos. I couldn't pass a 7-Eleven without getting my nacho fix. I'm still hooked. I've never stopped to think about what goes into that greasy, cheesy stuff, but I'm sure it ain't cheese. I'm so lucky I didn't pick up any other addictions during my teens. I feel bad for a coworker who has to go outside every two hours in the rain or heat to have his smoke. I feel bad for a family friend who messed up his brain so bad from drugs that he's just not in there anymore. Clearly, the decisions you make around this challenge often stick with you for life. Today, there's pressure to binge-drink, smoke, do drugs, take steroids, sniff glue, and do a number of other enticing things. As a couple of teens put it: "A ton of people do it, so it's hard to stay away from it." "I've stopped, but I still want it." You won't want to miss this section. Your peers have some really good stories to share. We'll chat about: Self-Worth -- If Only I Were Better Looking One girl said, "My biggest challenge is selfesteem. There are too many beautiful people. I feel ugly." If you ever feel this way, you're not alone. Compared to the models we see plastered inCosmopolitanandGQ,we all feel ugly. There's nothing wrong with wanting to look your best. But if your self-confidence or lack of it comes from how you stack up on the good-looks gauge, you've got serious problems. The fact is, there are lots of kids with big noses and dorky clothes that are full of self-confidence. And there are loads of well-dressed, popular kids who have no self-confidence at all. Obviously, there's so much more to healthy self-worth than beauty and biceps. When all is said and done, learning to like yourself is a choice. It may not seem that way, but it is. It's a matter of learning to get your security from within, not from without -- or from what others say about you. This chapter will cover: The 7 Habits Crash Course -- They Make You or Break You In addition to a chapter on each of the six decisions, there's a short chapter called The 7 Habits Crash Course. It's up next. A few years ago, I wrote a book calledThe 7 Habits of Highly Effective Teens.If you've already read that book, the chapter will serve as a good review of the habits. If you haven't read it, the crash course will get you up to speed. It doesn't really matter in which order you read these books. It's sort of like the Star Wars movies. They all go together but it doesn't really matter which one you watch first. In this book, we'll use the 7 Habits as a tool kit to help you make these big decisions. So just what are the 7 habits of highly effective teens? Simply put, they are the habits that successful and happy teenagers from Africa to Alaska have in common. Don't leave home without them! Ready for Tomorrow My purpose in writing this book is simple: I want to help you make smart choices around each of the six decisions so you can be happy and healthy today, and ready for tomorrow -- a future so bright you'll have to wear shades. When you turn twenty and retire from being a teen, I want you to be able to say: - I have a solid education! - I have good friends that bring out the best in me! - I have good relationships with my parents! - I don't have an STD, am not pregnant (nor gotten anyone pregnant), - and have made smart choices about dating and sex! - I am addiction-free! - I like myself and am OK with who I am! Of course, you'll make mistakes during your teen years, face many struggles, and have many highs and lows. No one expects you to be perfect. But please don't make it harder than it has to be. By simply making smarter choices starting today your teenage journey can be so much smoother. I like what the poet Robert Frost had to say about the importancI like what the poet Robert Frost had to say about the importance of decisions. "Two roads diverged in a wood, and I -- I took the one less traveled by, And that has made all the difference." Oh, by the way, I encourage you to personalize your book. A teen named Carol said, "I come from a book-oriented family. I've been reading since the age of three, and writing anything in a book is a sin." I was raised this way too. But let's change that rule, right now. The new rule is: Mark up your book! Get out your pen, colored pencils, highlighter -- whatever -- and go to town. Scribble. Doodle. Have some fun with it. Write in the margins. Circle quotes you want to remember. Highlight stories that inspire you. Record insights as they come. You'll get a lot more out of this book if you make it your own. Copyright © 2006 by FranklinCovey, Co. Excerpted from The 6 Most Important Decisions You'll Ever Make: A Guide for Teens by Stephen R. Covey All rights reserved by the original copyright owners. Excerpts are provided for display purposes only and may not be reproduced, reprinted or distributed without the written permission of the publisher.
<urn:uuid:9ec8f9a7-229a-4362-a155-42db09e812f5>
CC-MAIN-2017-04
http://www.biggerbooks.com/6-most-important-decisions-youll-ever/bk/9780743265041
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279224.13/warc/CC-MAIN-20170116095119-00479-ip-10-171-10-70.ec2.internal.warc.gz
en
0.978909
5,822
1.765625
2
Google has pitched itself in the race for online storage dominance with Google Drive. Although only released recently, it has proved useful for people relying on the ability to integrate their files with Google’s services. Gmail Attachments To Drive is a Chrome extension that exemplifies this. It lets you save any attachments from Gmail straight to your Google Drive by adding a “Save to Docs” link on your received e-mail. This feature might be simple, but it is very much useful for those who rely on Gmail while working on the cloud. With this extension, you can quickly sync your files on the cloud and on your computer without having to take the extra step of dragging and dropping files through folders. Google Drive is a new product, and like newbies, it is yet to have the ubiquity of more mature apps like Dropbox. But with Google and the strong APIs behind it, we will see more apps harnessing the power of Google Drive. Chrome extensions like Gmail Attachment To Drive is just the start. - Chrome extension that saves attachments directly to Google Drive. - Generate “Save To Docs” on your e-mail. - Easily integrates with your e-mail message. Check out GMail Attachment To Drive @
<urn:uuid:b8ffd9cb-4c5c-4503-b40a-a9fe4bfdb73d>
CC-MAIN-2017-04
http://www.makeuseof.com/tag/gmail-attachments-drive-save-gmail-attachments-direct-google-drive/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280292.50/warc/CC-MAIN-20170116095120-00347-ip-10-171-10-70.ec2.internal.warc.gz
en
0.92941
263
1.71875
2
Wolverine and Wolf Wolverines and wolves are seen at Martinselkonen only occasionally. If you are interested in photographing these species, we will provide you with the opportunity to visit the Boreal Wildlife Centre in Kuhmo (www.viiksimo.fi). The Boreal Wildlife Centre has been a wonderful location for photographing especially the wolverine. The moose is not necessarily easy to see or photograph. However, our guides are closely familiar with the Martinselkonen area, and they can take you to the best locations for moose watching. The best way to see a moose is from a moving car at the right time of day. It may be difficult to photograph the moose, however, because they are very shy animals. Capercaillie and Black Grouse The Martinselkonen area has small populations of capercaillie and black grouse. During the past few years, however, more capercaillies and black grouses have been met in Kuhmo at the Boreal Wildlife Centre. We organize photography safaris during the mating season of these birds in April–May and also in the fall for the black grouse. Outside the Martinselkonen Wildlife Center there is a bird-feeding area where you can take photos of the small birds common in the region, such as the bullfinch, the great tit, the jay, the wood pigeon and the great spotted woodpecker. In spring and late summer, the Siberian jay is also a common visitor. The feeding area also attracts many red squirrels. Short distance drive from our Centre is located three bird watching towers. These you can visit freely on your own. From the bird towers is possible to see many water birds especially in May. The Martinselkonen area has a modest owl population. In good years, they build their natural nests in the nearby region, and we can offer owl watching and photography safaris to those locations. Owls usually nest at the end of May or early June, which is the best time to see them. The owls seen near Martinselkonen are Great Grey Owl, Ural Owl and Pygmy Owl.
<urn:uuid:2432197e-0e0a-450c-b0ca-0ba8ef0422fb>
CC-MAIN-2022-33
https://www.martinselkonen.fi/en/bear-watching-and-photography/other-species/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00070.warc.gz
en
0.950517
463
1.851563
2
By Micha’el Tanchum December 30, 2019 Turkey upended the Eastern Mediterranean's strategic equation with its late November 2019 signing of maritime boundary and military cooperation agreements with the Tripoli-based Government of National Accord in war-divided Libya. By defining maritime borders with the internationally recognized administration in Tripoli, Ankara ostensibly has broken its regional isolation and gained greater legal standing to challenge the boundaries Greece established with Cyprus and Egypt upon which the current arrangements for Eastern Mediterranean natural gas development depend. While previously compartmentalized, Turkey's formalization of its commitment to Tripoli has interlinked an already tense maritime stand-off in the Eastern Mediterranean to a new escalation spiral in the Libyan Civil War in which Turkey's rivals possess escalation dominance over Turkey. The Turkey Analyst is a publication of the Central Asia-Caucasus Institute & Silk Road Studies Joint Center, designed to bring authoritative analysis and news on the rapidly developing domestic and foreign policy issues in Turkey. It includes topical analysis, as well as a summary of the Turkish media debate.
<urn:uuid:68d5c562-bbd3-4aa6-b7ad-9343dc437014>
CC-MAIN-2022-33
http://turkeyanalyst.org/publications/turkey-analyst-articles/itemlist/tag/Government%20of%20National%20Accord%20GNA.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00068.warc.gz
en
0.928979
207
2.03125
2
These 3 Companies Can Reap the Low-Hanging Fruit of Mexican Energy The shale revolution in North America has unleashed a burst of oil and gas production, and it shows no signs of abating. This unanticipated surge in production hasn't spread in neighboring Mexico yet. Mexico is a silent observer in the shale revolution unfolding in the U.S., while a lack of deepwater drilling technology prevents the country from exploiting its hard-to-reach deepwater oil reserves. As a result, Mexico is one of these nations that has been struggling to keep up its oil and gas production. Although the country is one of the 10 largest oil producers in the world, the amount of oil produced in Mexico has been on a steady decline since 2004 due to natural production declines from Cantarell, Ku-Maloob-Zaap, and other large offshore fields. Oil output has dropped from 3.4 million barrels per day (bpd) in 2004 to 2.5 million bpd, and Mexico currently imports half the petrol it consumes. Mexico is an importer of natural gas too. The U.S. is Mexico's largest supplier of natural gas, and U.S. shipments to Mexico account for a little less than 3% of U.S. production. Some estimate that U.S. gas exports to Mexico will double by 2017 because Mexico's natural gas consumption is increasing, and the need for new supplies of gas is steadily growing. Meanwhile, Mexico has the world's fourth largest shale gas reserves, with 681 trillion cubic feet of recoverable reserves plus a further 13 billion barrels of recoverable shale oil reserves, according to the U.S. Energy Information Administration. Mexico had to face this energy shortage, but Pemex didn't have enough cash and technical expertise to fund the development of Mexican oil and gas resources. So the shake-up of Pemex and the opening of oil and gas exploration and production to foreign companies took place a few days ago. Last week, President Nieto signed a law that opens Mexico's oil industry to foreign investment for the first time in 75 years. The "game changer" bill modifies three articles of Mexico's constitution, aiming at attracting foreign investment with profit and production-sharing contracts. Under the previous status quo, Pemex's private partners hadn't any incentive to take risks because Pemex was paying them not "in kind" (i.e. a percentage of extracted oil and gas) but in cash. Major international companies have required such provisions as a condition of investing in the Mexican oil and gas industry. President Nieto calls these energy reforms "the grand transformation" that aims at shoring up the Mexican economy, reducing violent crime, upending the public school system, and increasing tax collection, as Pemex's revenue funds a third of government operations. How can an investor benefit from these reforms that will unlock Mexico's oil and gas potential? Which companies will benefit from the radical transformation of Mexico's energy sector? Being an early mover is a strategic advantage in cases like this, where the private investments go across the entire hydrocarbon value chain from drilling all the way down to refineries and pipelines. Key Energy Services is an oilfield-services company with significant exposure to Mexico, where it generates almost 10% of its total revenue. Key's patented KeyView system has played a critical role in winning initial direct assignment from Pemex because it delivers cost reductions to customers while improving safety and efficiency. However, the company's presence in Mexico was problematic in 2013 because of the extreme dependence on its work with Pemex. Revenue and margins were adversely affected by Pemex's budgetary constraints, and Key had to reduce its operating costs as the utilization rate of its Mexican rigs dropped to approximately 50%. Nevertheless, Key estimates that this disruption is short term, and management expects their Mexican services to come alive in early 2014 because a significant backlog of wells in the area will soon need servicing. Mexico's current pipeline network is clearly insufficient, and TransCanada is well positioned to benefit from this lack of infrastructure. In the 1990s, TransCanada built the Mayakan and the El Bajio pipelines, which were the first non-Pemex pipelines in Mexico. In 2009, TransCanada was the successful bidder on a contract to build, own, and operate the Guadalajara pipeline in Mexico. The Guadalajara pipeline followed a 193-mile route from Mexico's Pacific Coast to Guadalajara, the second largest city in Mexico. This Canadian firm also owns and operates the Tamazunchale Pipeline in central Mexico. TransCanada's CEO sees opportunities to build new oil pipelines in Mexico and emphasizes the company's expertise in "startling topography," which includes difficult terrain and mountain ranges. The reevaluation of budgeting by Pemex hit TETRA Technologies too. TETRA provides a wide variety of oilfield services and saw a significant reduction in its Mexican activities in the first half of 2013. Things started to change in the third quarter of 2013 when TETRA saw a slow increase in activity. It expects this trend to continue through Q4 2013 and into 2014. TETRA is optimistic and remains confident that Mexico will be a major contributor to the company's growth in the intermediate-to-long term. TETRA is also the majority owner and general partner in Compressco Partners. When TETRA opens the door with a customer through production testing or other services, Compressco follows up with well enhancement services. In 2013, Compressco continued its international expansion to liquids-rich shale plays and invested significant capital in Mexico, where it anticipates a slow recovery effective 2014. Foolish bottom line Despite Mexico's untapped deposits in shale-rock formations, Mexico's nationalistic approach has resulted in an energy shortage amid booming industrial demand and dwindling output from the domestic oil and gas fields. Fortunately, Mexico took the decision to make some reforms and allow more experienced foreign players to develop its resources. This stunning change can trigger an economic boom in Mexico and materially affect the operations of the companies mentioned above. The North American energy boom is just getting started Record oil and natural gas production is revolutionizing the United States' energy position. Finding the right plays while historic amounts of capital expenditures are flooding the industry will pad your investment nest egg. For this reason, the Motley Fool is offering a comprehensive look at three energy companies set to soar during this transformation in the energy industry. To find out which three companies are spreading their wings, check out the special free report, "3 Stocks for the American Energy Bonanza." Don't miss out on this timely opportunity; click here to access your report -- it's absolutely free. The article These 3 Companies Can Reap the Low-Hanging Fruit of Mexican Energy originally appeared on Fool.com.Nathan Kirykos has no position in any stocks mentioned. The Motley Fool has no position in any of the stocks mentioned. Try any of our Foolish newsletter services free for 30 days. We Fools may not all hold the same opinions, but we all believe that considering a diverse range of insights makes us better investors. The Motley Fool has a disclosure policy. Copyright © 1995 - 2013 The Motley Fool, LLC. All rights reserved. The Motley Fool has a disclosure policy.
<urn:uuid:b62a5ac8-cf3f-4fd7-a3e8-641092baf1bf>
CC-MAIN-2017-04
https://www.aol.com/article/2013/12/30/these-3-companies-can-reap-the-low-hanging-fruit-o/20797348/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281746.82/warc/CC-MAIN-20170116095121-00291-ip-10-171-10-70.ec2.internal.warc.gz
en
0.951687
1,504
2.15625
2
We believe that every student at Green Bay West High School can attend college. We believe that with proper assistance all students can realize that goal. Our mission is to encourage and assist Green Bay West High School students to become college-ready, understand the financial aid available to them and secure the funding to alleviate their financial gap burden. Our vision is to create a community-based program that invests in the students at Green Bay West High School and has a positive impact on the quality of life for citizens of the GB West community. We hope to encourage alumni and local business leaders to form “close the gap” scholarships that can be awarded to students and allow them to make their dream to attend college a reality. The Do Great Things Scholarship Initiative was started by Jim and Tracy Ryan, 1989 graduates of Marquette University. Jim is also a graduate of Green Bay West High School, class of 1985. Jim and Tracy are active Marquette University alumni and in 2012 donated funds to Marquette to create an endowed scholarship that aided students with financial need. In 2021, upon learning of the limited number of students from Green Bay West High School that apply to and attend Marquette, Jim and Tracy decided to create two Marquette University scholarships that award funds to Green Bay West students. While working with the staff and faculty at Green Bay West High School, Jim and Tracy became passionate about helping more students realize that they have control over their future. With motivation, hard work and assistance more students can attend college and in turn Do Great Things for themselves and their community. The great thing about passion is that there is no “one size fits all” definition of what a person is passionate about. While one person may be passionate about medicine or law, another may find service and giving back more rewarding. Regardless of one’s own definition of success, the best way to go out and Do Great Things is to pursue one’s own, individual passion during and after college. The single best way to set up a person to Do Great Things is to have them follow what they love. The Do Great Things Initiative starts with the message for all students: “You can do anything, and WE BELIEVE IN YOU!” Regrettably, not all kids are raised in an environment where encouragement and/or a ‘can do’ attitude is prevalent. The program is designed to provide encouragement, structure, and guidance to the students, which is essential for young people as they work their way into the professional world. No one does anything alone. The Do Great Things Initiative is a partnership with Green Bay West High School, the students who need our help, colleges and universities including Marquette, and the Green Bay community around the high school. Sharing the mission and passion to send more Green Bay West students to college will ensure the Initiative’s effectiveness. The Advisory Board for the Do Great Things Initiative is comprised of alum and staff of Green Bay West High School, donors, and business leaders in the Green Bay community. We meet on a regular basis to further the growth of the Do Great Things Initiative and ensure the Initiative is meeting the needs of the students at Green Bay West High School.
<urn:uuid:edeb149b-2cfb-4fef-8f80-75148193d4b7>
CC-MAIN-2022-33
https://do-great-things.org/who-we-are/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570868.47/warc/CC-MAIN-20220808152744-20220808182744-00073.warc.gz
en
0.963
653
1.789063
2
1. The problem statement, all variables and given/known data In a vacuum, a straight conductor has 18-A current that goes upward. An electron is traveling at 8.92 x 10^4 m/s. If the electron is 0.2 m from the conductor and its instantaneous velocity is parallel to the conductor (albeit heading downward), find the magnitude and direction of the force on the electron. Explain whether the force will be constant. Here is my attempt: Known: I (current) = 18 A [upward] v (speed) = 8.92 x 10^4 m/s r (radius) = 0.2 m q (charge) = 1.602 x 10^-19 C Unknown: Fe F magnetic = F centripetal qvB = (m x v^2) / r Therefore, B = mv / qr = (9.11 x 10^-31) x (8.92 x 10^4) / (1.602 x 10^-19) x (0.20) = 0.000002536 T F magnetic = qvB sin[tex]Theta[/tex] = (1.602 x 10^-19) x (8.92 x 10^4) x 0.000002536 x sin90 = 3.6 x 10^-20 N I think it went horribly, horribly wrong. Was I supposed to use to F magnetic equation at all? It's difficult to know which F equation to use. I'd appreciate any guidance with this problem. Thank you.
<urn:uuid:687cbe3b-efae-462a-9983-cc6cbb6c3b35>
CC-MAIN-2017-04
https://www.physicsforums.com/threads/force-on-electron-as-it-travels-through-conductor.245406/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279933.49/warc/CC-MAIN-20170116095119-00129-ip-10-171-10-70.ec2.internal.warc.gz
en
0.884034
323
3.59375
4
Slam dunks and behind-the-back passes may make the highlights, but consistent, correct execution of essential skills will win more basketball games for you and your team. The NABC’s Basketball Fundamentals Video Series is a complete instructional clinic on passing, dribbling, moving without the ball, shooting, rebounding, and defending for players and coaches. One of the most memorable NCAA tournament game-winning shots was made by Valparaiso University’s Bryce Drew in 1998 as the Crusaders nipped the University of Mississippi at the buzzer. In NABC’s Shooting Fundamentals Video, Bryce’s father and highly respected Valpo head coach Homer Drew teaches the shooting techniques that make such unlikely attempts possible. Drew’s teams are known for shooting good shots and making such a high percentage of shots that the teams are perennial conference champions and postseason tourney participants. Homer Drew has been head basketball coach a successful collegiate head coach since 1976. He has been at Valparaiso University since 1988. In that time he has led the Crusaders to six straight Mid-Continent Conference tournament championships and five consecutive NCAA Tournament appearances as well as five Mid-Continent regular season titles. In 1998 the Crusaders advanced to the Sweet 16 of the NCAA Tournament for the first time in school history. Under Drew's guidance, the Crusaders won 20 or more games for six straight seasons in the 1990s. With numerous successful seasons under his belt, Drew is Valparaiso University's winningest coach and has received the Mid-Continent Conference Coach of the Year award three times (1993-94, 1994-95, and 1995-96). The Crusaders led the nation in three-point field goal percentage for the 1992-93 season. Before taking over at Valparaiso University, Drew rebuilt programs at Bethel College (Ind.) and Indiana University-South Bend. He was named the NCCAA District Coach of the Year in 1978, 1980, 1982, and 1983 while Drew and his wife, Janet, reside in Valparaiso, Indiana. They have three grown children, Scott, Dana, and Bryce. Bryce is a guard with the “These informative videos, endorsed by the NABC, teach the essential skills to excel as a basketball player. Both players and coaches will learn from this series. Lon Kruger, Barry Collier, and Homer Drew are exceptional teachers of the game of basketball.” Gene Keady, head men's basketball coach Purdue University “Basketball players never outgrow the need for solid fundamentals. Even the most seasoned coaches and players will gain new insights from these great technicians. The NABC's Basketball Fundamentals Video Series can help your team to the next level.” Kelvin Sampson, head men's basketball coach University of Oklahoma
<urn:uuid:65ddaf0c-952a-4e97-8cce-e1a7db5408d6>
CC-MAIN-2017-04
http://www.humankinetics.com/products/all-products/nabcs-shooting-fundamentals-video-ntsc?isbn=0736032622
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280504.74/warc/CC-MAIN-20170116095120-00139-ip-10-171-10-70.ec2.internal.warc.gz
en
0.949457
605
1.65625
2
The cross-over (or crossover) CAT5 UTP cable has to be one of the most used cables after the classic straight-thru cable. The cross-over cable allows us to connect two computers without needing a hub or switch. If you recall, the hub does the cross-over for you internally, so you only need to use a straight thru cable from the PC to the hub. Since now we don't have a hub, we need to manually do the cross-over. Why do we need an cross-over cable? When sending or receiving data between two devices (I.E. computers) one will be sending while the other receives. All this is done via the network cable and if you look at a network cable you will notice that it contains multiple cables. Some of these cables are used to send data, while others are used to receive data and this is exactly what we take into account when creating a crossover cable. We basically connect the TX (transmit) of one end to the RX (receive) of the other! The diagram below shows this in the simplest way possible: There is only one way to make a CAT5e crossover cable and it's pretty simple. Those who read the "Wiring UTP" article know a crossover cable is a 568A on one end and a 568B on the other. If you haven't read the wiring section, don't worry because we’ll provide enough information to help understand about the concept. As mentioned previously, the purpose of a crossover cable to connect the transmitting side (TX) from one end, to the Receiving side (RX) at the other end, and vice versa. Let's now have a look at the pinouts of a typical crossover CAT5e cable: As you can see, only four pins are needed for a crossover cable. When you purchase a crossover cable, you might find that all eight pins are used, these cables aren't any different from the above, as the rest of the pins are not used. Whether your crossover cable has 4 or 8 pins connected, it won’t make any difference in performance. Here are the pinouts for a crossover cable with all eight pins connected: It is important to note that Gigabit Ethernet does not require crossover cables. Straight-thru cables are used and the two ends are automatically crossed over by the network cards (Auto-MDIX). Where else can I use a cross-over? Crossover cables are not just used to connect computers, but a variety of other devices. Prime example are switches and hubs. If you have two hubs and you need to connect them, you would usually use the special uplink port which, when activated through a little switch (in most cases), makes that particular port not cross the tx and rx, but leave them as if they were straight through. What happens though if you haven't got any uplink ports or they are already used? The Crossover cable will allow you to connect them and solve your problem. The diagram below shows a few examples to make it simpler: As you can see in the above diagram, thanks to the uplink port, there is no need for a crossover cable. Let's now have a look at how to cope when we don't have an uplink to spare, in which case we must make a crossover cable to connect the two hubs: Almost all switches on the market today support the Auto-MDIX feature, allowing the connection between two switches with the use of a straight-thru network cable. All the above should explain a cross-over cable, where we use it and why we need it. I thought it would be a good idea to include, as a last picture, the pinouts of a straight thru and a cross-over cable so you can compare them side by side: This completes our discussion on UTP CAT5, CAT5e, CAT6 cross-over cables. We' explained why cross-over cables are necessary, when we use them, their pinouts and much more. Next article deals with 10Base-T/2/5/F/35 - Ethernet standard, analyzing the 10BaseT technology and specification.
<urn:uuid:c05125e6-1ea2-47ad-a32a-31aaad6b578a>
CC-MAIN-2017-04
http://www.firewall.cx/networking-topics/cabling-utp-fibre/114-network-cabling-utp-xover.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281419.3/warc/CC-MAIN-20170116095121-00494-ip-10-171-10-70.ec2.internal.warc.gz
en
0.932746
870
3.21875
3
An Orthodox Jewish school in Brooklyn has banned its students from wearing the thick-framed retro glasses that are currently in style. Borough Park’s Bobover Yeshiva B’Nei Zion wrote a letter to parents advising them about the school’s new policy. “We are asking that everyone buy simple glasses,” reads the letter. “The yeshiva will not tolerate thick plastic eye glasses. Thick frames, often seen on celebrities such as LeBron James and Justin Timberlake, give the child a very fat look.” The school is not interested in catering to the latest fashion trends and wants its students to wear traditional clothing and eyewear, The New York Post reported. “What we have to commit ourselves to is we have to stand on top of this and not tolerate the new modernism. The good deed that accompanied the Jews in Egypt was that they didn’t change their names and clothes, and this same strength is still accompanying us and maintaining us in exile — in all generations.” At least one person isn’t impressed by the school’s new policy. “Instead of spending their energy and resources on teaching students important things about Judaism. these ultra-Orthodox Jewish schools spend their time, energy, and resources on how the children should or shouldn't dress. What a shame. It is time for new leadership,” said Brooklyn resident Moshe Drummer. “It doesn’t matter what age — a student cannot come to yeshiva with these glasses,” the letter reads.
<urn:uuid:9e4901ea-95ef-44f0-b88c-cc360a385cf1>
CC-MAIN-2022-33
https://www.opposingviews.com/religion/brooklyn-orthodox-jewish-school-bans-hip-glasses
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571147.84/warc/CC-MAIN-20220810040253-20220810070253-00476.warc.gz
en
0.964651
332
1.5
2
LETTERS: Taking jobs for granted The federal and B.C. provincial governments – ‘ConservaLibs’ – have teamed up to give cash rewards to companies who will give Canadian jobs away to immigrants. It is called the Immigrant Employment Council of B.C. They give ‘grants’ of up to $200,000 per organization. The total amount of your tax dollars you unwittingly contributed has risen 260 per cent in three years to $1.8 million. In 2004, the BC Liberals gutted the apprenticeship program in B.C. and created an artificial labour shortage. Now they are trying to reap the rewards by exploiting cheap offshore labour. According to the last Stats Canada report, immigrant males get 63 per cent of the wages that their Canadian-born counterparts receive. For women it was 56 per cent. An immigrant worker is a compliant worker, because he has no recourse. These are 2005 figures, as the feds gutted Stats Canada a few years ago. Big business, on the other hand, gives ‘contributions’ to the ConservaLibs in return for ‘grants’. Cozy. But the ‘grants’ are coming off of the backs of taxpayers. And the taxpayers are assuaged by the calming TV ads, $64 million for the two years leading up to the last election by the BC Liberals, and $600 million from the Conservative feds since they got into power; paid for by you and me. Isn’t it time we stopped using euphemisms like ‘contributions’ and ‘grants’ and call them what they really are: bribes. With all these millions flowing between business and politicians, the ConservaLibs are shills for the rich. R.K. Grace, Surrey
<urn:uuid:7afd97bf-11f1-47b8-b667-37440fc90fc2>
CC-MAIN-2017-04
http://www.peacearchnews.com/opinion/letters/254550811.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281331.15/warc/CC-MAIN-20170116095121-00226-ip-10-171-10-70.ec2.internal.warc.gz
en
0.943668
381
1.648438
2
Summits | Meetings | Publications | Research | Search | Home | About the G7 Research Group UK's G7 Trade Track Opening Statement The Rt Hon Liz Truss, UK International Trade Secretary, March 31, 2021 As the world recovers from coronavirus, we are coming together today to show that the best way forward lies in free and fair trade. Just as trade built our nations, it will help us build back better by creating high-quality jobs in the industries which are key for our future. We cannot squander our opportune moment. The World Trade Organization (WTO) has a new Director-General, Dr Ngozi Okonjo-Iweala, who I am glad is with us today. The US has a new administration, with Ambassador Katherine Tai as Trade Representative. The United Kingdom is a newly independent trading nation. Today marks the start of the inaugural G7 Trade Track, an initiative pioneered by the UK. Fundamentally, our like-minded democracies need to win the battle for the soul of global trade… making sure the WTO works for people across the world. Together, we can fully back Dr Ngozi in driving much-needed reforms at the twelfth WTO Ministerial Conference to be held in December in Geneva, the first such conference for three years. We would be derelict in our duties if we were not to make progress today, and to build on it in person at our next meetings in May and October. The G7 covers half of global GDP — we need to make our voices heard and bring more of our friends and allies on board to push trade into the 21st century. Let us be clear: if we fail to act, then we risk global trade fragmenting under the tyranny of the largest… in which the big players feel they get to set the rules. That winner-takes-all future would ultimately leave people across the world worse off. The WTO is over a quarter of a century old. It was founded in 1995, before Google had even set up their first website, when China's economy was a tenth the size of the US, and the UN was holding its first Climate Conference — COP1 — in Berlin. But the WTO still reflects that world in too many ways, despite the incredible rise of digital trade and China… and the UK now preparing to host COP26. We need to reflect the world as it is now, particularly in areas like digital and data, the environment and women's economic empowerment, rather than stay stuck in the 1990s. We have been held back by a rule book which has not kept pace with the modern world. Pernicious practices by non-market economies have given trade a bad name, from forced labour and forced technology transfer to mass unreported subsidies and environmental degradation. It is ludicrous that some countries can evade market disciplines by claiming to be developing nations when they are not. The fact is the trading system has not delivered — by not being fair to people across the world or relevant to their lives. With the WTO under Dr Ngozi's fresh and dynamic leadership, we must work together to set a roadmap to Geneva delivering change in two big ways. Firstly, we need to make sure the WTO is fair for all its members. We need to reform the dispute settlement system, stamp out unfair industrial subsidies and make sure everybody — large or small — is following the rules and being transparent. Secondly, we must modernise the WTO by making progress on rules for data and digital trade, properly addressing the issue of carbon leakage and improving the inclusion of women in global trade. We can demonstrate our commitment to delivering reform by helping resolve issues which should be common sense like the fisheries negotiation by this summer. Together, we can come out of the Covid crisis to change global trade for good. Let us no longer be hampered by rules which were written a generation ago, when we need them to propel us forward, now and for the next 25 years. Through free and fair trade, we will spark a jobs-led and exports-led recovery. By bringing the global trading system into the 21st century, we will herald a new era rich in jobs, opportunity, and prosperity for our people. Together, we are taking a big step in making this bright future a reality. Source: United Kingdom Department for International Trade |This Information System is provided by the University of Toronto Libraries and the G7 Research Group at the University of Toronto.| Please send comments to: This page was last updated March 31, 2021. All contents copyright © 2022. University of Toronto unless otherwise stated. All rights reserved.
<urn:uuid:e6e6f99b-6b62-4ed4-99e5-7901f02160bc>
CC-MAIN-2022-33
http://www.g8.utoronto.ca/trade/210331-opening-statement.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00269.warc.gz
en
0.947793
994
1.679688
2
Posted on June 29, 2013 by Tony McMahon At the Templar castle of Kerak in Jordan is a carved image that was once believed to be Saladin but actually is a thousand years older Category: Templar History Tags: carved, castle, East Jerusalem, fortress, jerusalem, Kerak, Knight Templar, knights, muslim, Nabataeans, Nabatean, Petra, saladin, saracen, Warrior Come and join the growing army of Knights Templar! Sign me up! Follow the Templar on Facebook Powered by WordPress.com. You must be logged in to post a comment.
<urn:uuid:e35d299f-aac7-4c4d-8c81-387d89c74270>
CC-MAIN-2022-33
https://thetemplarknight.com/tag/nabatean/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00067.warc.gz
en
0.872662
135
2.171875
2
Featured tile layers Featured tile layers refer to the set of different map styles featured on the OpenStreetMap web site. These can be accessed and selected by activating the "Layers" sidebar and then looking under the "Map Layers" section. There are currently five layers featured, and of these the "Standard" layer is the default. Proposals for new tile layers to be included on the web site may be added to the table below. Any such proposals must follow the guidelines for new tile layers. Other servers, not appearing on the main page but available to public are listed at Tiles#Servers. |Support||Global||Traffic||Reliable||Up to date||Non Comm||Free/ Open||Uniqueness||Significance| |Currently featured layers| |Standard||OK||OK||OK||OK||minutes||OK||OK ||Also known as the "Default" layer. or "openstreetmap-carto". Sometime mistaken/misleading name Mapnik is used.| |Cycle Map||OK||OK||OK||OK||daily||OK||No style sheet| |Transport Map||OK||OK||OK||OK||daily||OK||No style sheet||Displays routes, and public transport||Roads are not most prominent feature|| Promotes the same features as ÖPNVKarte.| Featured in November 2011. |Humanitarian||OK||OK||OK||OK||OK||OK||CC0||Focuses on the developing countries with an emphasis on features related to development and humanitarian work.||Good contrasting style in terms of overall colour choices. Terrain shading. Many new/different icons (particularly for basic amenities in developing countries) and more nuanced surface track-type rendering.||See demo and legend. Style developed and maintained by HOT (openly on github) Hosted on OpenStreetMap.fr servers, which expect to handle the traffic.| |MapQuest Open ||Not OK||OK||OK||OK||~15 minutes||Run by MapQuest||||Different styles for different countries. Renders U.S. highway shields.||Commercial service "Simpler" style using fewer colours.|| Featured in November 2011.| June 2015 they've discontinued their documentation site and broken various things. Not looking too good for future availability. The tile service will no longer be free after 11 July 2016 (will require subscription and authorization keys). |NoName||Dead||Dead||Dead||Dead||Dead||Run by CloudMade||No style sheet||Debugging style for nameless roads||Removed in November 2011. There are other QA tools that display the same information and are more updated.| |Tiles@home||Dead||Dead||Dead||Dead||Dead||OK||OK ||Used Osmarender renderer||Removed in Feb 2012. Developer support reduced Feb 2011.| |OSM France||OK||OK||OK||OK|| z1-z11 weekly; z12+ ~5 minutes |OK||OK||World coverage up to zoom level 20. Priority given to French names and symbols (baguette instead of pretzel for bakery!).||Fork of openstreetmap-carto. Special display for sport fields.||Some newer features are sometimes experimented and are discussed on the French OpenStreetmap mailing list. Guided tour of improved features. CartoCSS based stylesheet available on https://github.com/cquest/osmfr-cartocss| |ÖPNVKarte||OK||OK||OK||OK|| z15-18: daily?; |OK||Unknown||Displays routes, and public transport||Roads are not most prominent feature||Promotes the same features as the OpenCycleMap Transport Layer| |openptmap||OK||OK||OK||OK||daily||OK||OK||Public transport overlay||lines of railways, subways, trams, ferries, aerialways||It's just a PT overlay, it can be combined with every base map.| |OpenSeaMap - the free nautical chart||OK||OK||OK||OK||< hourly||OK||OK||including weather charts, wiki port pilot book, bathymetry, Wikipedia, etc.||for all 'water sports enthusiast'||SourceForge SOTM| |Wikipedia/Wikimedia "Multilingual Maps" with nearly 300 language-versions (demo)||OK||OK||see Remarks |OK||daily||OK||OK||First map, that allows every citizen of the world to navigate the whole world in his writing system No other map made by Google, Bing, Yahoo, etc. provides this feature.||nearly 300 languages and dialects available, animates OSM-users to add the name:language tags. Software is free and open.||has been coded by Jochen Topf as "Multilingual Maps", see here. At present Wikimedia Germany tackles the installation process on its tool servers and will provide the required server power. The aim is to include these OSM-maps in every geographical Wikipedia article, English is pending, demo i.e. in German: (click "Karte" (= Map) next to the coordinates in the upper right corner)| |Name and link to tile-layer||OK||Maybe OK||Not OK||OK||minutes||OK||OK||Explain the uniqueness of this tile-layer||Explain the special significance of this tile-layer| - For a long time, the OpenStreetMap web site featured two layers, Standard (then called "Mapnik") and Tiles@home. Cycle Map and NoName were added sometime later. - April 2011 — The OpenStreetMap Foundation Board approved the proposed guidelines for adding new tile layers. - November 2011 — Transport Map and MapQuest Open were added under the new guidelines. At the same time NoName was removed due to not being very updated and because other QA tools do it better. - February 2012 — Tiles@home was removed due to unavailable support. - September 2013 — Humanitarian was added. See the OSM Blog announcement and the HOTOSM blog post. - June 2016 — The Mapquest default rendering has been removed, as it will no longer support the free tile service without paid subscription and authorization keys for each website domain, starting on 11 July 2016.
<urn:uuid:cb81a3e3-bfdd-4d99-91da-849e856fc897>
CC-MAIN-2017-04
http://wiki.openstreetmap.org/wiki/Featured_tiles
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281069.89/warc/CC-MAIN-20170116095121-00264-ip-10-171-10-70.ec2.internal.warc.gz
en
0.830817
1,327
2.09375
2
|Abnormal features in skeletal muscle from mice lacking mitsugumin29.| |Jump to Full Text| |PMID: 10613905 Owner: NLM Status: MEDLINE| |Physiological roles of the members of the synaptophysin family, carrying four transmembrane segments and being basically distributed on intracellular membranes including synaptic vesicles, have not been established yet. Recently, mitsugumin29 (MG29) was identified as a novel member of the synaptophysin family from skeletal muscle. MG29 is expressed in the junctional membrane complex between the cell surface transverse (T) tubule and the sarcoplasmic reticulum (SR), called the triad junction, where the depolarization signal is converted to Ca(2+) release from the SR. In this study, we examined biological functions of MG29 by generating knockout mice. The MG29-deficient mice exhibited normal health and reproduction but were slightly reduced in body weight. Ultrastructural abnormalities of the membranes around the triad junction were detected in skeletal muscle from the mutant mice, i.e., swollen T tubules, irregular SR structures, and partial misformation of triad junctions. In the mutant muscle, apparently normal tetanus tension was observed, whereas twitch tension was significantly reduced. Moreover, the mutant muscle showed faster decrease of twitch tension under Ca(2+)-free conditions. The morphological and functional abnormalities of the mutant muscle seem to be related to each other and indicate that MG29 is essential for both refinement of the membrane structures and effective excitation-contraction coupling in the skeletal muscle triad junction. Our results further imply a role of MG29 as a synaptophysin family member in the accurate formation of junctional complexes between the cell surface and intracellular membranes.| |M Nishi; S Komazaki; N Kurebayashi; Y Ogawa; T Noda; M Iino; H Takeshima| Related Documents : |921875 - Calcium and magnesium contents of malignant hyperpyrexia-susceptible human muscle. 6538815 - Calcium binding capacity and calcium sensitive protein content in denervated frog muscles. 2933425 - Inhibition of tension development and actomyosin atpase activity in barnacle muscle by ... 12537995 - Dantrolene analogues revisited: general synthesis and specific functions capable of dis... 23461795 - A nanofibrous phbv tube with schwann cell as artificial nerve graft contributing to rat... 7491905 - Thiophosphorylation independently activates each head of smooth muscle myosin in vitro. |Type: Journal Article; Research Support, Non-U.S. Gov't| |Title: The Journal of cell biology Volume: 147 ISSN: 0021-9525 ISO Abbreviation: J. Cell Biol. Publication Date: 1999 Dec| |Created Date: 2000-02-04 Completed Date: 2000-02-04 Revised Date: 2009-11-18| Medline Journal Info: |Nlm Unique ID: 0375356 Medline TA: J Cell Biol Country: UNITED STATES| |Languages: eng Pagination: 1473-80 Citation Subset: IM| |Department of Pharmacology, Faculty of Medicine, University of Tokyo, Tokyo 113-8654, Japan.| |APA/MLA Format Download EndNote Download BibTex| Amino Acid Sequence Body Weight / genetics Hindlimb / abnormalities, physiopathology, ultrastructure Mice, Inbred C57BL Molecular Sequence Data Muscle Contraction / genetics Muscle Proteins / deficiency*, genetics*, physiology Muscle, Skeletal / abnormalities*, physiopathology, ultrastructure Synaptophysin / analogs & derivatives*, deficiency, genetics, physiology |0/Mg29 protein, mouse; 0/Muscle Proteins; 0/Synaptophysin| Journal ID (nlm-ta): J Cell Biol Publisher: The Rockefeller University Press © 1999 The Rockefeller University Press Received Day: 28 Month: 9 Year: 1999 Revision Requested Day: 8 Month: 11 Year: 1999 Accepted Day: 9 Month: 11 Year: 1999 Print publication date: Day: 27 Month: 12 Year: 1999 Volume: 147 Issue: 7 First Page: 1473 Last Page: 1480 Publisher Id: 9909118 PubMed Id: 10613905 |Abnormal Features in Skeletal Muscle from Mice Lacking Mitsugumin29| Address: Department of Pharmacology, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654, Japan. 81-3-5841-3390 81-3-5841-3429 aDepartment of Pharmacology, Faculty of Medicine, University of Tokyo, Tokyo 113-8654, Japan bDepartment of Anatomy, Saitama Medical School, Saitama 350-0495, Japan cDepartment of Pharmacology, Juntendo University School of Medicine, Tokyo 113-8421, Japan dDepartment of Cell Biology, Cancer Institute, Tokyo 170-8455, Japan eCore Research for Evolutional Science and Technology, Japan Science and Technology Corporation SYNAPTOPHYSIN is known as a major membrane protein on neurotransmitter-containing vesicles in the presynaptic regions of neurons (Jahn and Sudhof 1994; Matthews 1996). Recent DNA cloning studies have identified at least five synaptophysin-related proteins, namely synaptoporin (Knaus et al. 1990), synaptogyrin (Stenius et al. 1995), pantophysin (Haass et al. 1996), cellugyrin (Janz and Sudhof 1998), and mitsugumin29 (MG29) (Takeshima et al. 1998). Synaptophysin has been the best characterized among the family members. Synaptophysin forms an oligomeric structure and exhibits ionic channel activity in lipid bilayers (Thomas et al. 1988). Antibody and antisense oligonucleotides to synaptophysin inhibit neurotransmitter release (Alder et al. 1992a,Alder et al. 1992b). Therefore, it has been proposed that synaptophysin might form a protein component of the fusion pore during exocytosis in the presynaptic nerve ending (Betz 1990). However, neurons from mutant mice lacking synaptophysin show normal neurotransmitter release (McMahon et al. 1996), and no synaptophysin-related protein is found in the yeast genome, indicating that synaptophysin is unlikely to be essential for exocytosis. Thus, the physiological roles of synaptophysin and other family members have not been established yet. In skeletal muscle, excitation-contraction (E-C) coupling requires the signal transduction system to convert depolarization of the cell surface transverse (T) tubule into Ca2+ release from the sarcoplasmic reticulum (SR) without the entry of extracellular Ca2+ (Schneider 1994). The two major molecules participating in this signal conversion are the dihydropyridine receptor (DHPR) as the T tubular voltage sensor (Tanabe et al. 1988), and the ryanodine receptor (RyR) as the SR Ca2+ release channel (Takeshima et al. 1994). Both receptor proteins are thought to be linked to each other functionally and mechanically at the junctional membrane region, called the triad junction, where the T tubule faces the SR membrane on both sides (Franzini-Armstrong and Jorgensen 1994). On the other hand, previous studies have suggested that an as-yet unidentified component(s) other than DHPR and RyR is required for the formation of the triad junction, which may provide a structural foundation for the direct interaction of the receptor molecules (Takekura et al. 1995; Ikemoto et al. 1997; Suda et al. 1997). In this context, we started to identify protein components unique to the triad junction using the mAb technique, and recently found several novel transmembrane proteins (Nishi et al. 1998; Takeshima et al. 1998). Of the identified proteins, MG29 shows high sequence homologies and shares structural features with the synaptophysin family members. Immunochemical and RNA blot experiments showed that MG29 is expressed abundantly in the skeletal muscle and at moderate levels in renal tubular cells (Shimuta et al. 1998). MG29 starts to appear on the developing SR before the onset of T tubule formation during skeletal muscle maturation, and then is localized to the triad junction in mature muscle cells. Furthermore, overexpression of MG29 in an amphibian expression system resulted in the generation of abnormal tubular ER (Komazaki et al. 1999). The molecular structure and subcellular distribution suggest that MG29 may be involved in the formation of specialized SR–ER network systems and in the communication between the SR–ER and cell surface membranes. In recent years, knockout mice have been used to understand the molecular basis of physiological functions of specific gene products. We report here the generation and characterization of mutant mice lacking MG29. Although MG29-deficient muscle retained the triad junctions, the results obtained clearly indicate that MG29 is important for the proper organization of both the intracellular and cell surface membranes, and for the signal transduction of E-C coupling in skeletal muscle cells. The targeting vector was constructed using the mouse genomic DNA fragments obtained in our previous experiments (Shimuta et al. 1998): the 1.1-kb XhoI/SalI fragment from pMC1 Neo polyA (Stratagene), the 0.7-kb XhoI/SalI fragment from pMC1-DT-A (Yagi et al. 1990), and pBluescript SK(−) (Stratagene). The short arm of the vector is the ∼2.2-kb genomic fragment containing the partial sequence of exon 1 and full sequence of exon 2, and the long arm is the ∼7.8-kb fragment containing the 5′-flanking sequence in the gene (see Fig. 1 A). The vector was linearized with XhoI and transfected into J1 embryonic stem (ES) cells (Li et al. 1992). Of ∼350 G418-resistant ES clones screened by Southern blot hybridization, two clones carried the expected homologous mutation. Chimeric mice produced with the ES clone numbered 171 were crossed with C57BL/6J mice and could transmit the mutant gene to their pups (F1). F2 mice obtained by crossing the heterozygous F1 mice were used for the biochemical, morphological, and physiological analyses in this study. To determine the mouse genotype, PCR was carried out using mouse genomic DNA as the template (see Fig. 1 A); the nucleotide sequences of the synthetic primers used are P29-1 (TACGCGCGGAAAAAGGGGAGAGCAAGG), neo-5′a (GCCACACGCGTCACCTTAATATGCG), and P29-2 (CTTACCTGCTGGCGCGGAGACTTGTCC). Genomic DNA and total RNA were prepared from mice tissues, and Southern and Northern blot hybridization analyses were performed as described previously (Takeshima et al. 1994). A peptide derived from the primary structure of mouse MG29, SSTESPGRTSDKSPR (in one-letter code), was synthesized and coupled to keyhole limpet hemocyanin (KLH) as a carrier protein using glutaraldehyde. An adult rabbit was repeatedly immunized with the peptide–KLH complex, and antibody against mouse MG29 was recovered from the antiserum using a protein G–Sepharose column (Amersham Pharmacia Biotech). Total microsomal proteins were prepared from hind limb muscle of mice (Saito et al. 1984) and were subjected to immunoblot analysis as described previously (Takeshima et al. 1994). Skeletal muscle preparations were treated with a prefixative solution (2.5% glutaraldehyde and 0.1 M sodium cacodylate, pH 7.4). For specific staining of the T tubule (Franzini-Armstrong 1991), skeletal muscle was treated with the prefixative solution supplemented with 50 mM CaCl2. The prefixed muscle was then postfixed with a buffer containing 1% OsO4 and 0.1 M sodium cacodylate, pH 7.4. The fixed muscle was washed, dehydrated with alcohol and acetone, and embedded in Epon. Thin sections were prepared, stained with uranyl acetate and lead citrate, and observed under an electron microscope (JEM-200CX, JEOL). Skeletal muscle preparations of whole extensor digitorum longus (EDL) muscle and diaphragm strips, including a part of the rib and central tendon, were dissected from mice. The muscle preparations were mounted between a force transducer (UL-100; Minebea Co.) and fixed hock in a chamber containing Krebs solution (120 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 1 mM NaH2PO4, 25 mM NaHCO3, and 11 mM glucose) bubbled with 95% O2 and 5% CO2 at 25°C. The preparations were stretched with a resting tension of 0.7 g and field-stimulated with supramaximal voltage. For inducing tetanic contractions, train stimulations of total 50 times were delivered at various frequencies. The effects of Ca2+ removal from the Krebs solution were examined on twitches evoked at the rate of 0.5 Hz for 20 min. Genomic DNA segments containing the mouse MG29 gene isolated in our previous experiments were used for constructing a targeting vector (Fig. 1 A). In the vector, the genomic sequence containing parts of the putative promoter and first exon is replaced by the neomycin resistance gene for positive selection, and the diphtheria toxin gene is attached at the 3′ terminus of the genomic sequence for negative selection. ES cells were transfected with the targeting vector, and the resultant G418-resistant clones were screened by Southern blot hybridization. The ES clones harboring the introduced mutant gene (MG29m1) were shown to have the expected pattern of arrangement in genomic DNA by the blot analysis using several restriction enzymes and specific probes for the gene (Fig. 1 B). Chimeric male mice were generated by injecting the ES cells into blastocysts, and bred to yield mice carrying the mutant gene. Mice homozygous for the mutation, obtained by crossing between heterozygous mice, did not exhibit lethality. Blot analyses showed absence of both MG29 mRNA (Fig. 1 C) and its protein product (Fig. 1 D) in skeletal muscle from the homozygous mutants, demonstrating that the introduced mutation is a null mutation of the gene. The MG29-deficient mice exhibited no abnormalities in health or reproduction under our conventional housing conditions. Because MG29 is expressed at high levels in skeletal muscle cells and at moderate levels in renal tubular cells (Shimuta et al. 1998; Takeshima et al. 1998), we expected physiological defects in skeletal muscle and kidney in the mutant mice. However, light microscopic observations did not reveal any morphological abnormalities in the kidneys from the mutant mice (data not shown). This observation, together with normal health of the mutant mice, indicates that the loss of MG29 causes no significant defects in the kidney. This report deals with abnormalities in skeletal muscle from the mutant mice. The MG29-deficient mice were slightly smaller in body size and lighter in body weight than their wild-type littermates (Fig. 2). The heterozygous mutants showed values intermediate between those of the wild-type and homozygous mice. The reduced body weight in the mutant mice may be mainly due to lightened skeletal muscle systems as shown below. To survey gross defects of motor function in the MG29-deficient mice, four behavioral tasks that reflect skeletal muscle performance were used. In any of the tasks (the fixed-bar test, rotarod test, open-field locomotion test, and forced swimming test), no obvious differences were detected between the mutant and wild-type mice (Kuriyama, K., S. Shibata, and H. Takeshima, unpublished observations). The results indicate that the loss of MG29 produces no significant defects in motor coordination or motor ability on the whole-animal level. Because MG29 is expressed predominantly in skeletal muscle, we examined the morphological abnormalities in hind limb muscle from the MG29-deficient mice (young adults, 8–9 wk old). The averaged wet weight of whole EDL muscle from the mutant mice was significantly reduced in comparison with that of controls (see Table ). Therefore, sections of EDL muscle were examined by light microscopy and EM (Fig. 3). The cross-sectional areas of muscle cells from MG29-deficient mice (mean ± SD, 705 ± 315 μm2, n = 399 cells from two typical EDL bundles) were significantly smaller (P < 0.001, t test) than those from wild-type mice (1154 ± 526 μm2, n = 382 cells from two bundles). However, there was no significant difference in the cell number in the muscle bundles between the mutant and wild-type mice; EDL bundle from either genotype was composed of ∼900 muscle cells. EM analysis of EDL muscle showed that the cytoplasmic region was full of contractile filaments in both MG29-deficient and wild-type muscle cells, and no significant difference was observed in the sectional areas of myofibrils between the genotypes. Therefore, the reduced weight of mutant EDL muscle is considered to be caused mainly by the smaller cell size. Abnormalities in the T tubules in the mutant muscle cells were examined by the well-established method of T tubule–specific staining (Fig. 4). In cross sections, the T tubules in wild-type muscle were flat and elliptical (short axis 0.01–0.03 μm and long axis 0.08–0.12 μm), whereas the T tubules in MG29-deficient muscle were almost round (diameter 0.1–0.2 μm). In wild-type muscle the T tubules ran straight in a right-angled direction to myofibrils at the interphases between the A- and I-bands (A-I junction). However, abnormal running route of the T tubules was conspicuous in MG29-deficient muscle. Such abnormal orientation of the T tubules was not detected in wild-type muscle. Next, we analyzed the triad junctions from the MG29-deficient muscle cells (Fig. 5). In wild-type muscle, the triad junction between the T tubule and SR was well-established, and the SR network was well-organized. However, the SR network was poorly formed in MG29-deficient muscle. For example, vacuolated, highly fragmented, or simple tubular SR structures were frequently observed in mutant muscle; such irregular structures were detected in 8% of the SR examined in wild-type muscle (n = 231) and 55% of those in mutant muscle (n = 442). As could be expected from the abnormal routes of T tubules (Fig. 4), it was further confirmed that the lack of triad junctions in the A-I junctions was frequent in MG29-deficient muscle. The ratios for the absence of triads were 1.4% in wild-type muscle (triad junctions observed, n = 1,665) and 24% in MG29-deficient muscle (n = 2,616). The morphological abnormalities detected in mutant hind limb muscle, such as swollen and irregularly running T tubules, partial misformation of triad junctions, and poorly developed SR networks were also observed in mutant diaphragm muscle (data not shown). The results demonstrate that the ultrastructural abnormalities around the triad junction were shared by both fast and slow muscle fibers in the MG29-deficient mice. To survey functional abnormalities of MG29-deficient muscle, we examined the contractile properties of EDL and diaphragm muscles, containing mainly fast and slow muscle fibers, respectively. Both mutant muscle preparations showed contractile responses evoked by electrical stimulation, even in a Ca2+-free solution, and no obvious difference in the basic mechanism of E-C coupling was observed between mutant and wild-type muscles. However, two major abnormalities were found in mutant muscle as described below. Because of the different wet weight between mutant and control EDL muscles, the developed force was normalized to the weight, assuming that there was no difference in the length of the muscle preparations between the genotypes. MG29-deficient EDL muscle developed less normalized twitch tension than wild-type muscle, although no significant difference was observed in the maximum force evoked by tetanic stimulation between the genotypes (Table ). Therefore, the twitch/tetanus ratio of mutant muscle (mean ± SD, 0.12 ± 0.015) was significantly smaller than that of control muscle (0.21 ± 0.036). Furthermore, the force-frequency curve was shifted right in mutant muscle compared with that in wild-type muscle (Fig. 6). In experiments using diaphragm preparations, a similar right-shifted force-frequency curve was observed in mutant muscle, although the degree of differences between the genotypes was less impressive than that in EDL muscle (data not shown). The twitch/tetanus ratios of diaphragm muscles from the mutant and wild-type mice were 0.23 ± 0.016 and 0.26 ± 0.011, respectively (P < 0.01, t test). The right-shifted force-frequency relationship in the mutant muscle does not seem to reflect an increase in the number of immature or slow muscle fibers, which exhibit left-shifted curves compared with mature or fast muscle fibers (Close 1964). These observations show that the loss of MG29 partly impairs E-C coupling at low-frequency stimuli. Because the differences in the developed force between the genotypes diminished at higher-frequency stimuli, MG29 deficiency probably reduced the efficiency of signal conversion during E-C coupling. It has been reported that dantrolene, a muscle relaxant drug, preferentially inhibits twitch and shifts the force-frequency curve to the right in skeletal muscle tension measurements (Leslie and Part 1981). Therefore, MG29-deficient and dantrolene-treated muscles show similar contractile properties. The pharmacological action of dantrolene is still unclear, and the results here raise the possibility that MG29 may be a target site of dantrolene. However, dantrolene was still effective in MG29-deficient muscle (data not shown). Next, we examined the effects of Ca2+ removal from the bath solution on twitches of diaphragm, which is composed of only several muscle layers. Under nominally Ca2+-free conditions, mutant diaphragm muscle showed a more rapid decrease of twitch tension than control muscle (Fig. 7). The apparent rate constants of the decay in wild-type and MG29-deficient muscles were roughly estimated to be 0.01 and 0.02 (min−1), respectively. The tension of EDL muscle was highly resistant under Ca2+-free conditions, probably because EDL muscle is composed of multiple layers of muscle fibers and diffusion of the bathing solution is highly restricted. Faster decrease of twitch tension under nominally Ca2+-free conditions was also observed in mutant EDL muscle (data not shown). The partial misformation of the triad junction and the abnormalities of SR structures may correlate well with the reduced twitch tension in MG29-deficient muscle. The smaller twitch tension is probably caused by the low efficiency of signal conversion during E-C coupling in the mutant muscle, because no significant differences were detected in normalized maximum tension and density of cellular contractile filaments between the genotypes. It may be that the partial loss of the triad junctions directly reduces the efficiency of E-C coupling, and that the abnormal SR structures decrease the available Ca2+ for twitch responses in the mutant muscle. The apparently normal phenotype of the mutant mice in the behavioral tasks to test motor performance is likely due to compensatory mechanisms by motor neurons and/or upper motor centers in the brain. The faster decrease of twitch tension under Ca2+-free conditions and the swollen T tubules in MG29-deficient muscle may be related. Although E-C coupling is retained under Ca2+-free conditions in skeletal muscle, contraction responses gradually decrease, likely due to the reduction of Ca2+ content in the SR or the inactivation of DHPR as the T tubular voltage sensor. Assuming that passive diffusion restricted by the area of the T tubule rather than that of the sarcolemma was mainly responsible for the Ca2+ leak in skeletal muscle, it might be reasonable to expect quick Ca2+ depletion in the mutant muscle bearing the expanded T tubules. Alternatively, the abnormal T tubular structures might affect the functions of DHPRs in the mutant muscle. In view of the abundant expression of MG29 in the triad junction (Takeshima et al. 1998), the lack of a failure in membrane organization or E-C coupling in mutant skeletal muscle is rather surprising. We need to consider the possibility that the functions of MG29 are partly compensated by related molecules. Indeed, of the synaptophysin family members, pantophysin and cellugyrin are ubiquitously expressed in various cell types (Haass et al. 1996; Janz and Sudhof 1998). It has been suggested that synaptophysin may play a role in the structural organization of the synaptic vesicle as a small and highly curved organelle (Jahn and Sudhof 1994). This possibility may not be supported by MG29-deficient muscle, in which curvilineal membrane structures were preserved in the triad junction. On the other hand, the abnormalities of the mutant muscle described above suggest another important biological function of MG29. After the random formation of junction membrane structures between the disorganized SR and primitive T tubules, the membrane systems gradually mature during muscle differentiation. The processes include the rearrangement of the transverse-oriented T tubules, flattening of the junctional T tubular regions, specific localization of the triad junctions at the A-I junctions and development of differentiated regions of the SR (Franzini-Armstrong 1991; Flucher 1992). Since the formation of junctional membrane complexes seems to be normal in MG29-deficient muscle, our results indicate that the loss of MG29 specifically impairs the maturation processes to generate the refined membrane systems. It is unlikely that the deficiency of MG29 simply delays the maturation or induces degeneration after the maturation, because skeletal muscle cells from the 4-, 8-, and 12-wk-old mutant mice essentially shared the same abnormalities around the triad junction (Komazaki, S., unpublished observations). These observations suggest that synaptophysin family members, including MG29, may be important for the structural refinement of junctional membranes commonly observed in the triad junction, subsurface cisternae, and presynaptic regions. MG29 is recovered in both SR and T tubular fractions in biochemical membrane preparations (Takeshima et al. 1998; Brandt and Caswell 1999), and MG29 deficiency results in abnormalities of membrane structures in both the SR and T tubular systems as described above, indicating that MG29 is distributed on both the membranes in intact skeletal muscle cells. The molecular action of MG29 during the refinement of the membrane structures is still uncertain, and at the present several possibilities may be proposed in the explanation. For example, MG29 might be involved in the transport between the SR and T tubule to support the refined structures of junctional membranes, although the vesicular transport system in the triad junction is not known. Alternatively, it may be possible to presume that MG29-mediated reactions may stiffen the junctional T tubular region to generate the flattened structure and may facilitate the translocation of the stiffened T tubule to the A-I junctions. In either case, the presumed functions of MG29 may underlie intermolecular interaction. It would be important to identify the proposed binding partner(s) of MG29 in future studies. Abbreviations used in this paper: DHPR, dihydropyridine receptor; E-C, excitation-contraction; EDL, extensor digitorum longus; ES, embryonic stem; MG29, mitsugumin29; SR, sarcoplasmic reticulum; T tubule, transverse tubule. We thank Izumi Dobashi, Akiko Sakamoto, and Miki Matsunaga for their help in some of the experiments. This work was supported in part by grants from the Ministry of Education, Science, Sports and Culture, the Ministry of Health and Welfare, the TMFC, the Ichiro Kanehara Memorial Foundation and the Inamori Foundation. |Alder, J.. Lu, B.. Valtorta, F.. Greengard, P.. Poo, M.. Calcium-dependent transmitter secretion reconstituted in Xenopus oocytesrequirement for synaptophysinScience. 257 1992657661a [pmid: 1353905]| |Alder, J.. Xie, Z.P.. Valtorta, F.. Greengard, P.. Poo, M.. Antibodies to synaptophysin interfere with transmitter secretion at neuromuscular synapsesNeuron. 9 1992759768b [pmid: 1356373]| |Betz H.. Homology and analogy in transmembrane channel designlessons from synaptic membrane proteinsBiochemistry. 291990;:3591–3599. [pmid: 1692731]| |Brandt N.R.,Caswell A.H.. Localization of mitsugumin29 to transverse tubules in rabbit skeletal muscleArch. Biochem. Biophys. 3711999;:348–350. [pmid: 10545225]| |Close R.. Dynamic properties of fast and slow skeletal muscle of the rat during developmentJ. Physiol. 1731964;:74–95. [pmid: 14205033]| |Flucher D.E.. Structural analysis of muscle developmenttransverse tubules, sarcoplasmic reticulum, and the triadDev. Biol. 1541992;:245–260. [pmid: 1426638]| |Franzini-Armstrong C.. Simultaneous maturation of transverse tubules and sarcoplasmic reticulum during muscle differentiation in the mouseDev. Biol. 1461991;:353–363. [pmid: 1864461]| |Franzini-Armstrong C.,Jorgensen A.O.. Structure and development of E-C coupling units in skeletal muscleAnnu. Rev. Physiol. 561994;:509–534. [pmid: 8010750]| |Haass N.K.,Kartenbeck J.,Leube R.E.. Pantophysin is a ubiquitously expressed synaptophysin homologue and defines constitutive transport vesiclesJ. Cell Biol. 1341996;:731–746. [pmid: 8707851]| |Ikemoto T.,Komazaki S.,Takeshima H.,Nishi M.,Noda T.,Iino M.,Endo M.. Functional and morphological features of skeletal muscle from mutant mice lacking both type 1 and type 3 ryanodine receptorsJ. Physiol. 5011997;:305–312. [pmid: 9192302]| |Jahn R.,Sudhof T.C.. Synaptic vesicles and exocytosisAnnu. Rev. Neurosci. 171994;:219–246. [pmid: 8210174]| |Janz R.,Sudhof T.C.. Cellugyrin, a novel ubiquitous form of synaptogyrin that is phosphorylated by pp60c-srcJ. Biol. Chem. 2731998;:2851–2857. [pmid: 9446595]| |Knaus P.,Marqueze-Pouey B.,Scherer H.,Betz H.. Synaptoporin, a novel putative channel protein of synaptic vesiclesNeuron. 51990;:453–462. [pmid: 2206533]| |Komazaki S.,Nishi M.,Kangawa K.,Takeshima H.. Immunolocalization of mitsugumin29 in developing skeletal muscle and effects of the protein expressed in amphibian embryonic cellsDev. Dyn. 2151999;:87–95. [pmid: 10373013]| |Leslie G.C.,Part N.J.. The action of dantrolene sodium on rat fast and slow muscle in vivoBr. J. Pharmacol. 721981;:665–672. [pmid: 7284684]| |Li E.,Bestor T.H.,Jaenisch R.. Targeted mutation of the DNA methyltransferase gene results in embryonic lethalityCell. 691992;:915–926. [pmid: 1606615]| |Matthews G.. Neurotransmitter releaseAnnu. Rev. Neurosci. 191996;:219–233. [pmid: 8833442]| |McMahon H.T.,Bolshakov V.Y.,Janz R.,Hammer R.E.,Siegelbaum S.A.,Sudhof T.C.. Synaptophysin, a major synaptic vesicle protein, is not essential for neurotransmitter releaseProc. Natl. Acad. Sci. USA. 931996;:4760–4764. [pmid: 8643476]| |Nishi M.,Komazaki S.,Iino M.,Kangawa K.,Takeshima H.. Mitsugumin23, a novel transmembrane protein on endoplasmic reticulum and nuclear membranesFEBS Lett. 4321998;:191–196. [pmid: 9720923]| |Saito A.,Seiler S.,Cho A.,Fleischer S.. Preparation and morphology of sarcoplasmic reticulum terminal cisternae from rabbit skeletal muscleJ. Cell Biol. 991984;:875–885. [pmid: 6147356]| |Schneider M.F.. Control of calcium release in functioning skeletal muscle fibersAnnu. Rev. Physiol. 561994;:463–484. [pmid: 8010748]| |Shimuta M.,Komazaki S.,Nishi M.,Iino M.,Nakagawara K.,Takeshima H.. Structure and expression of mitsugumin29 geneFEBS Lett. 4311998;:263–267. [pmid: 9708916]| |Stenius K.,Janz R.,Sudhof T.C.,Jahn R.. Structure of synaptogyrin (p29) defines novel synaptic vesicle proteinJ. Cell Biol. 1311995;:1801–1809. [pmid: 8557746]| |Suda N.,Franzius D.,Fleig A.,Nishimura S.,Bodding M.,Hoth M.,Takeshima H.,Penner R.. Ca2+-induced Ca2+ release in Chinese hamster ovary (CHO) cells co-expressing dihydropyridine and ryanodine receptorsJ. Gen. Physiol. 1091997;:619–631. [pmid: 9154908]| |Takekura H.,Takeshima H.,Nishimura S.,Takahashi M.,Tanabe T.,Flockerzi V.,Hofmann F.,Franzini-Armstrong C.. Co-expression in CHO cells of two muscle proteins involved in excitation-contraction couplingJ. Muscle Res. Cell Motil. 161995;:465–480. [pmid: 8567934]| |Takeshima H.,Iino M.,Takekura H.,Nishi M.,Kuno J.,Minowa O.,Takano H.,Noda T.. Excitation-contraction uncoupling and muscular degeneration in mice lacking functional skeletal muscle ryanodine-receptor geneNature. 3691994;:556–559. [pmid: 7515481]| |Takeshima H.,Shimuta M.,Komazaki S.,Ohmi K.,Nishi M.,Iino M.,Miyata A.,Kangawa K.. Mitsugumin29, a novel synaptophysin family member from the triad junction in skeletal muscleBiochem. J. 3311998;:317–322. [pmid: 9512495]| |Tanabe T.,Beam K.G.,Powell J.A.,Numa S.. Restoration of excitation-contraction coupling and slow calcium current in dysgenic muscle by dihydropyridine receptor complementary DNANature. 3361988;:134–139. [pmid: 2903448]| |Thomas L.,Hartung K.,Langosch D.,Rehm H.,Bamberg E.,Franke W.W.,Betz H.. Identification of synaptophysin as a hexameric channel protein of the synaptic vesicle membraneScience. 2421988;:1050–1053. [pmid: 2461586]| |Yagi T.,Ikawa Y.,Yoshida K.,Shigetani Y.,Takeda N.,Mabuchi I.,Yamamoto T.,Aizawa S.. Homologous recombination at c-fyn locus of mouse embryonic stem cells with use of diphtheria toxin A-fragment gene in negative selectionProc. Natl. Acad. Sci. USA. 871990;:9918–9922. [pmid: 2263643]| Keywords: excitation-contraction coupling, sarcoplasmic reticulum, synaptophysin family, transverse tubule, triad junction. Previous Document: ER/Golgi intermediates acquire Golgi enzymes by brefeldin A-sensitive retrograde transport in vitro. Next Document: Alternative splicing regulates the subcellular localization of A-kinase anchoring protein 18 isoform...
<urn:uuid:bdfa6851-5def-4530-bcec-76185f5da693>
CC-MAIN-2017-04
http://www.biomedsearch.com/nih/Abnormal-features-in-skeletal-muscle/10613905.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00429-ip-10-171-10-70.ec2.internal.warc.gz
en
0.875261
8,268
1.695313
2
Atefeh is facilitating a workshop called "Music and colours". A group zoom session where you can listen to music and express your feelings in colours! You will listen to an improvisation on Santoor and get in touch with your feelings. You just need to find what feeling you identify in yourself while you are listening to music. Then, you need to ask yourself if this feeling had a color, shape and form, what would it be like? So, you imagine all your feelings and put them on your paper. I would recommend to but some paints for this session but you could participate in this workshop even with one paper and a pencil. You know there is no right and wrong. You can create an image as you go without having your picture in your head beforehand. We all have some kinds of experience with art but we really rare to use art as a way to express our feelings. So, it can be difficult to do this at first but when we listen to music, we could get an access to those feelings and express them on to paper easily. We want to draw or paint our feelings because we need to express our feelings and words do have a limit. We express our feelings because we need to be heard, to be listened to. That is really hard to get that sometimes. That is why we have art. We can hear ourselves; we can see our feelings in front of us.
<urn:uuid:bcbd9e5c-5ba8-41eb-9aeb-04cde4b4813b>
CC-MAIN-2022-33
https://www.atefeheinali.com/atefeh-einali-is-facilitating-a-wor
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00272.warc.gz
en
0.971916
290
2.125
2
Women's Rights Groups Use Internet to Fight Taliban Oppression of Women Cyberspace is crucial to uniting Afghan women against the Taliban oppression and heightening public awareness of the regime's atrocities. Mavis Leno, a spokesperson for the Feminist Majority's Campaign To Stop Gender Apartheid remarked, "It creates a brilliant way to have a very active participation in world politics, particularly with regard to human rights, a way that was never available to people without the Internet." The Feminist Majority's Campaign to Stop Gender Apartheid website (http://www.feminist.org/afghan/intro.html) is a proven organizing tool to pressure the United States Government and the United Nations, through American public action, not to support the Taliban. Women's rights organizations all over the world, including the Revolutionary Association of the Women of Afghanistan (RAWA), have seized the power of the Internet in advocating women's issues that are often not a focal point of international media. Thanks to the websites and ongoing issue raising by groups like the Feminist Majority and RAWA, the catastrophic situation of Afghan women and girls brought on by sadistic Taliban laws are included in U.S. and U.N. humanitarian and foreign policy matters. Media Resources: CNN News 14 July 2000 Take Action Against Gender A
<urn:uuid:1fa9ce5d-0812-4ef9-8660-a2677d36c1c5>
CC-MAIN-2017-04
http://www.msmagazine.com/news/printnews.asp?id=5063
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279489.14/warc/CC-MAIN-20170116095119-00013-ip-10-171-10-70.ec2.internal.warc.gz
en
0.922663
260
2.75
3
Combine Looker and Dataform for the complete analytics solution Looker has revolutionised the way data teams operate: rather than creating one-off dashboards, data teams use LookML to define the relationships between datasets, enabling business teams to explore data directly. Dataform helps teams prepare the datasets that form the foundation of a successful Looker implementation. Looker PDTs are a simple tool for transforming data. But for a growing team, and an organization with complex data needs, PDTs are missing some key features: data tests, fine-grained scheduling, integrated SQL developer tools and incremental table builds. Dataform is the data modeling tool built for enterprise scale. With Dataform you can write queries in SQL IDE, preview and inspect the results, and validate your SQL queries, all from a rich web interface. Queries are automatically deployed to BigQuery, creating tables and views that can be accessed in LookML. After defining your transformations in Dataform, add a few extra lines of code to ensure your datasets are tested by Dataform’s automated CI/CD platform. Errors will be picked up before being released to your production environment; incorrect data making its way to Looker reports will be a thing of the past. Being able to produce analytics tables that we are confident in the output of (because of assertions) and are as up to date as we need them to be (because of scheduling) makes our lives really easy. The UI is incredibly easy and intuitive to use, meaning we spend little of our time setting these things up, and most of our time writing SQL! I love the dependency tree in Dataform. For me this is a central place for sanity checking my data flows, understanding if I'm reimplementing a dataset which already exists, and verifying logic. Secondly, I love SQLX for generating SQL of a similar structure again and again, it really speeds up development and let's your abstract away logic. Having modeled data using other tools in the past, this is much simpler and an easier environment to code in. The code compiles in real time and lets you know if there are errors in the syntax. It also helps generate a dependency graph for the data pipeline which is insanely useful.
<urn:uuid:b0fe270c-f73d-4dd3-a5d9-8f597f8246dc>
CC-MAIN-2022-33
https://dataform.co/solutions/looker
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573699.52/warc/CC-MAIN-20220819131019-20220819161019-00276.warc.gz
en
0.913532
454
1.515625
2
What is jQuery? jQuery is a Art, technology, development, coding and hobby. The coder don’t want wait for the designer for the color and basic images. They can perform very well as a best designer as per the visitors view. Why should I use jQuery ? The jQuery Framework is SEO friendly work. How do I use jQuery? The developers can use the JQuery with following four easy steps. - Map the JQuery framework JS file and required Plugin JS file - Create or Alter the Style sheet file with your colors. - Create your required content with the suitable div, ul, li tags with respective id and css. - Make the relationship with the JQuery framework and the respective div, ul and li Where can I download jQuery ? JQuery download is available in JQuery website (http://jquery.com). Otherwise you can download from google code (http://code.google.com/p/jqueryjs/)
<urn:uuid:a382ee66-5f22-4637-b4cf-8881093b0597>
CC-MAIN-2017-04
https://www.codeproject.com/tips/49259/how-do-jquery-i-include-in-my-page-and-where-can-i
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279224.13/warc/CC-MAIN-20170116095119-00480-ip-10-171-10-70.ec2.internal.warc.gz
en
0.892762
205
1.578125
2
Item description for Who's Who And Where's Where in The Bible by Stephen M. Miller... Overview This illustrated, easy-reading, A-Z dictionary, written in magazine style, isloaded with fresh and surprising insights about the most important people andplaces in the Bible--500 in all. Shouldn't every Bible come with a handy tool like Who's Who & Where's Where in the Bible? This illustrated, easy reading A-Z dictionary is loaded with fresh and surprising insights about the most important people and places in the Bible-five hundred in all. Not a dry textbook, it's written in magazine style by critically acclaimed Christian journalist and Bible history author Stephen M. Miller. Color maps, photos, and paintings transport readers to sacred lands. There, they'll meet fascinating people: lovers and liars, healers and hoodlums, warriors and wimps. This captivating book will appeal to Bible newcomers as well as long-time Christians. Promise Angels is dedicated to bringing you great books at great prices. Whether you read for entertainment, to learn, or for literacy - you will find what you want at promiseangels.com! Studio: Barbour Publishing Est. Packaging Dimensions: Length: 8.98" Width: 6.1" Height: 0.71" Weight: 1.39 lbs. Release Date Jan 1, 2005 Publisher Barbour Books ISBN 1593101112 ISBN13 9781593101114 Availability 0 units. More About Stephen M. Miller Stephen M. Miller is the bestselling author of Who s Who and Where s Where in the Bible (Retailer s Choice Award for best nonfiction book of the year), The Complete Guide to the Bible (400,000 copies sold), and many other books, which have sold over a million copies. He and his wife, Linda, live in Kansas and have two adult children. Stephen M. Miller was born in 1952. Stephen M. Miller has published or released items in the following series... Reviews - What do customers think about Who's Who And Where's Where in The Bible? Who's Who and Where's Where in the Bible (Bible Reference Library) Jul 29, 2008 Another great biblical resource that is packed with great illustration pictures, concise information and easy to carry along. Who's Who and Where's Where in the Bible Jul 19, 2008 I purchased this book as a gift for my mother-in-law. My parents have the same book and they love it. My mother-in-law had been trying to find the book after seeing their's. The book is great to just flip through for interesting Bible facts or to find answers to questions. The book is outstanding for quick reference study! Nov 15, 2007 I teach Bible Church School and this book is great when you need to understand the gist of a person or place in the bible. It's not your exhaustive detailed reference work, but it is a 'to the point book'. This Answers Your Questions Sep 14, 2007 Great little pocket/purse size for information on just about anything in the bible. Places, people, etc...fun to read! A Bible Resource Jul 5, 2006 A super resource for anyone interested in Bible characters and Bible places.
<urn:uuid:297f0ffe-184c-487f-af90-07b625798cca>
CC-MAIN-2017-04
http://www.promiseangels.com/stephen-m-miller/whos-who-and-wheres-where-in-the-bible/SKU/16959
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281574.78/warc/CC-MAIN-20170116095121-00018-ip-10-171-10-70.ec2.internal.warc.gz
en
0.92967
676
2.125
2
How’s my life going with a cochlear implant (CI)? Well, for starters—although I can’t speak for other recipients—it’s a lot LOUDER. All sounds are louder: the ones that I recognize as well as new ones that, without any visual clues, I need help in identifying. Luckily, there are trained people standing by for this job. For years, my family, friends and I have been playing a game familiar to any person affected by hearing loss—Whazzat?, short for What’s That Sound? And now, thanks to my new bimodal hearing (I wear a ReSound LiNX2 hearing aid on my left and a Cochlear Kanso Sound Processor on my right), we’re playing Whazzat a lot. All the time, actually. But my family and friends don’t mind telling me what I’m hearing, because they know if they don’t, I’ll keep pestering them—and possibly leave them for a nicer group of loved ones. Besides, playing Whazzat let’s them show off their good hearing; they also enjoy my reaction to the excruciating sound of people chewing potato chips. But at only 32 days since activation, most familiar sounds bear little resemblance to how I hear them acoustically through my hearing aid. The voices of strangers sound curiously alike, as if they’re crying while they speak. What I hear do hear clearly, however, are those high frequency sibilant sounds. Think of the hiss of snakes and steam and the grocery checkout woman who asks “do you want bagss-SSS?” I groan f I’ve forgotten my sound-less cloth bags in the car; paper bags are noisy enough, but the loud crackling of plastic bags has become my Most Annoying Sound ever. In Wired for Sound: A Journey into Hearing, my friend Bev Biderman writes about her surprise at their harshness—she had expected that they “rustled softly in peace.” On the plus side, I can hear butter melting in a pan—yes, yellow makes a sound! I hear water running in a sink which lessens the chance of my flooding the kitchen again. And after years of theatre-going, I now understand the fuss about people opening candy wrappers during the show. I hereby apologize to anyone, ever, who has suffered because of my oblivious, thunderous opening of candy and chips at the movies. I’m also hearing lots barmping. ‘Barmp’ is what Newfoundlanders do when they lean on their car horn. Say ‘barmp’ out loud, drawing out the “arrr”. What you just said—ba-aar-rmp—perfectly describes what I’m hearing through my CI. Me (in my dad’s house): Whazzat? Louise, my sister: The fridge coming on. Me: Oh, good heavens, WHAZZAT? Louise: Dad listening to the obituaries on the radio. (Loudly. With organ music. But he’s 90 and losing friends fast; who’s going to ask him to turn it down?) Me (in the car with the Hearing Husband): Whazzat? HH: What’s what? Me: That ba-aar-rmp! HH: The car motor. And air brakes on big trucks. Also, drivers barmping their horns. Me: That’s a lot of barmping. There are exciting moments when I identify a sound all by myself. On a walk with the Hearing Husband, I heard a chittering sound, like birdies over there in the bushes. He said no, look up, it’s Canada geese flying over. I said I could hear them barmping, this was something different. He listened—and there were little birdies in the bush. Score one for Gaelie! Nature is wonderful but so is the technical marvel of complementary devices that work with my cochlear implant and hearing aid. My smartphone rings directly in in my ears through the help of my Cochlear Phone Clip; I must look odd, jumping up for seemingly no reason and running around to find my phone. (I can’t locate it by sound, can I? It’s ringing in my ears!) I also have an up-close-and-personal relationship with the Cochlear Mini Microphone, which is paired with both my CI and hearing aid. I plug it into my laptop to watch streamed movies and TV series, leaving me free to do yoga stretches while I watch, if I wanted to, which I usually don’t. (Previously, using my hearing aid’s telecoil and neck loop, I would occasionally forget that I was attached to the computer and, getting up suddenly, I would just about self-decapitate.) As part of my daily aural rehab with my CI, I watch shows that are well-articulated and well-captioned and the voices are now starting to sound richer and truer, although there’s still a pervasive hissy-ness and barmping quality. Sound effects are getting better with every “listen” but music remains a challenge; I get the real high frequency percussion, but the other instruments and voices are off key, with no resemblance to how my memory of how the songs should sound. In other breaking news—when someone covers their mouth and gives me numbers from 1 to 999, I’m doing very well, if I do say so myself, although ffff and thhhh sound the same, making some words difficult to identify. To think that a hearing person can tell the difference, without peeking, makes me feel almost anxious. I can’t imagine ever doing that. Can all hearing people differentiate between nnnn and nggg? My father always told me it’s good to have goals. (Actually, he said it’s good to want things—which meant he wasn’t going to buy me whatever it was I wanted.) But the more I practice listening and hearing with my new devices, the clearer my goals become. And I’ve got a lot of resources, both human and technical, to achieve them. Next in the Changing Cochleas series: Part 7, Service, Service, Service! Thank you to Cochlear Americas and to HearingHealthMatters.org for their support in the development of the “Changing Cochleas” series. As always, my choices and opinions are mine alone.
<urn:uuid:0cba4b18-5d8c-42cc-8ccb-c4062c40c1d0>
CC-MAIN-2022-33
https://hearinghealthmatters.org/betterhearingconsumer/2017/whazzat-changing-cochleas-part-6/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00265.warc.gz
en
0.95385
1,418
1.5625
2
Fifth Period: Direct Communication (1848-51) On Authority And Revelation (The Book On Adler) - On Authority and Revelation (The Book on Adler, or A Cycle of Ethical-Religious Essays) - Bogen om Adler, eller en Cyclus ethisk-religieuse Afhandlinger - 1846-47, revised 1848, published posthumously - Kw24, SKS15, Søren Kierkegaards Papirer Of all of Kierkegaard's works, this work is easily the most labored over. He made a few attempts at publishing it, writing a new preface for it each time, but could not bring it to press for reasons which we will soon address. Typically, Kierkegaard would write a work and revise it once or twice. Either/Or, by way of example, is over 800 pages long, but was written in just eleven months. The Book On Adler was, by contrast, revised throughout. W. Lowrie, who translated most of the passages quoted here, complained that it was a very laborious task to review the additions, deletions, and copious emendations. Indeed, there are three different versions of the preface. Originally Kierkegaard wrote a work entitled A Cycle of Ethical-Religious Essays, which was not published. A portion of it was published separately as an essay in Two Minor Ethical-Religious Essays, while the whole was left unpublished. Kierkegaard considered using the pseudonym Johannes Climacus, but declined, since this is a religious work, and Johannes represents the philosophical. He also contemplated new and similar pseudonyms: Petrus Minor, Thomas Minor, Vincentius Minor, and Ataraxius Minor. Ultimately, Kierkegaard decided that if he published the work, he would do so under his own name. He did, however, eventually publish the Two Minor Ethical-Religious Essays under the pseudonym H. H. Because of the different versions, H. Hong and E. Hong have translated this work with the title "The Religious of the Present Age Illustrated by Magister Adler as a Phenomenon". This work was written in reaction to the writings of Adolf Peter Adler (1812-1869), who was a pastor in Hasle and Rutsker, on the Danish island of Bornholm. He became an avid Hegelian and took a pastorate in 1841. He claimed to have had a "vision of light" in 1842, which turned him against Hegelianism. In this vision Jesus commanded him to burn his former books and stated that he would dictate to him a new work. This book was entitled Several Sermons (Nogle Prædikener), and was published in 1843. Bishop Mynster suspended him in 1844. Adler was then deposed in 1845. He later conceded that his revelation was a mistake, that "revelation was perhaps too strong an expression". To make matters much worse, Adler later published other works, and declared that his former "revelation" was instead a work of genius. Moreover, Kierkegaard met with Adler, who, in reading his own works to Kierkegaard, would alternate between a regular speaking voice and a shrill "whistling" voice, as if the latter were to convey weightier and more spiritual truths. It was clear that the man was deranged. But beyond the mere fact of his delusions, Kierkegaard was impressed by the issues that the case of Adler raised, being particularly interested in Adler's confusion over the categories of genius and inspiration. F. Sontag speculates that Kierkegaard had reason to be reluctant about publishing the work. First, it might appear to be unfair to oppose Adler after he had already been publicly humiliated. This is why he could publish Two Minor Ethical-Religious Essays, because it makes no mention of Adler. Furthermore, Kierkegaard had asserted the primacy of the subjective approach to truth. Adler in a sense epitomized a lunatic example of someone guided solely by subjectivity, without the grounding in theology that someone like Kierkegaard possessed. Sontag thinks that Adler's works made Kierkegaard re-think his own views on subjectivity. And in fact Kierkegaard makes more objective and dogmatic theological statements here. In contradistinction to his other works, he envisions his reader to be a theologian. In the second of the three prefaces, Kierkegaard says, The whole book is essentially an ethical investigation of the concept of revelation; about what it means to be called by a revelation; about how he who has had a revelation is related to the race, the universal, and we others to him; about the confusion from which the concept of revelation suffers in our confused age (p. 3). In his Introduction Kierkegaard contrasts what he called "premise-authors" and "essential-authors". The former make known the battle-cry, and think that that will solve the problem. The latter writer has his own perspective. He never raises more doubt that he can explain.... For he has a definite world-view and life-view which he follows, and with this he is in advance of his individual literary productions, as the whole is always before the parts (p. 13). The essential-author communicates himself, while the premise-author has no need to do so. The art of all communication consists in coming as close as possible to reality, i. e. to contemporaries who are in the position of readers, and yet at the same time to have a viewpoint, to preserve the comforting and endless distance of ideality (p. 15). The relationship between the premise-authors and essential-authors is further likened to the relationship between a sick man and a physician. On Adler's abilities as a writer, Kierkegaard says, For it is certain that in his books there are many passages which one who is well-disposed cannot read without edification, that sometimes he is moving, not rarely entertaining by his liveliness, and does not altogether lack profundity, though he entirely lacks consistency in his thought (Lowrie, p. 12). Again, Kierkegaard has no dispute with the mere claim of someone having had a revelation, but that Adler did not cling to his former claim of having had one. I do not deny or affirm it. I regard myself simply as a learner. This at least is certain, that had he held fast to this fact of revelation as an unshakeable fact, though others might consider him mad or else bow to his authority—had he done that, had he not indecisively, waveringly, higgled about it and privately interpreted it away, I would not have been justified in calling him a premise-author (Lowrie, p. 12). Kierkegaard does not judge Adler's work esthetically, nor as a critic normally would. For in the role of a critic one usually considers the work, and not the author. However, in this work, it is precisely the nature of authorship which is in question. Moreover, this helps us to appreciate Kierkegaard's work as well, though in a very different way, since his works are often laced with autobiographical material. At any rate, Kierkegaard does not judge Adler's doctrine either. How then does he justify his approach? He has an "ethical justification". With geniuses I can hold my own fairly well. God preserve me—if it is in truth the greatest genius, then with esthetic propriety I gladly express my reverence for the superior mind from whom I am learning; but that I show him religious subjection, that I should submit my judgment to his divine authority—no, that I do not do, neither does any genius require it of me. But when a man coolly wishes to explain away what was intended to be an apostolic experience into being a genius, without revoking the first claim—then he confounds the situation terribly (p. 26). Chapter 1: The Historical Situation The Collision Of Magister Adler, As A Teacher In The State Church, With The Established Order; The Special Individual Who Has A Revelation-Fact The first of four chapters is concerned with the claims of Adler. Adler distinguished sermons written with and without the aid of the Holy Spirit, but, Kierkegaard complained, he did not explain their different qualities and functions. This was especially odd since Adler published the inspired, dictated sermons with his own sermons, thereby obscuring his purpose. Kierkegaard finds it odd that Adler appeals to the content of the writing rather than the mere claim to inspiration, as if Adler expected that the product of a revelation would somehow be superior to other works and, what is more alarming for Kierkegaard, that somehow a revelation must be proven to be a revelation, rather than accepted for what it is. The divine authority is the category, and here quite rightly the sign of it is: the possibility of offense. For a genius may very well at one time or another in the course of 50 or 100 years cause esthetically a shock, but never ethically can he cause an offense, for the offense is that a man possesses divine authority (p. 33). Kierkegaard stresses that it is the reaction to the revelation that is important. That reaction is based on who the author is, and whether he has divine authority. The question is quite simple: Will you obey? or will you not obey? Will you bow in faith before his divine authority? Or will you be offended? Or will you perhaps take no side? Beware! this also is offense (Lowrie, p. 26). Kierkegaard is thinking not only of the general reading public, but especially of liberal theologians. This is marked in the following quote: "People treat the Scriptures so scientifically that they might quite as well be anonymous writings" (Lowrie, p. 27). Kierkegaard would later treat the offense of Christianity at length in Practice In Christianity, which would be one of his more direct assaults on Official Christianity. In this chapter Kierkegaard also notes three general types of people: the universal, the individual and the extraordinarius, or special individual. The first type recognizes the demands of moral law, what Kierkegaard calls the universal in Fear and Trembling. He is not a simpleton or uncreative, but he simply recognizes the good and tries to do it. The individual is a person who counters the establishment. No doubt Kierkegaard had himself in mind when he delineated this category. In Fear and Trembling he is characterized by Abraham who was commanded to contravene the universal in order to obey the Absolute (God). The last category is the divinely inspired individual, such as the apostle Paul. Kierkegaard emphatically and repeatedly said that he was "without authority". This category did not refer to him. The Latin extraordinarius, as Kierkegaard himself points out, means "out of the rank". He is someone set apart. Chapter 2: A Revelation in the Situation of the Present Age Kierkegaard begins this chapter by countering the current notion that Christianity was true merely on account of its venerability and endurance. The fact that the eternal once came into existence in time is not a something which has to be tested in time, not something which men are to test, but is the paradox by which men are to be tested.... To this end it is important above all that there be fixed an unshakable qualitative difference between the historical element in Christianity (the paradox that the eternal came into existence once in time) and the history of Christianity, the history of its followers, etc. (p. 37f.). Kierkegaard complains, as he does in many places, that apologists try to make Christianity "plausible". Kierkegaard describes his first reaction to having heard that Adler claimed to have had a revelation, before he had read Adler's Sermons. He thought that either Adler was a possessor of divine originality or else a "knave" who wished "to demolish everything". But after reading the Sermons he thought of a third possibility. Adler is neither of the above. He is a "phenomenon", a "sign". "He is a very serious proof that Christianity is a power which is not to be jested with". Chapter 3: Adler's Own Shifting of His Essential Point of View, or That He Does not Understand Himself, Does Not Himself Believe That a Revelation Has Been Given to Him. Light is thrown upon this Directly-Indirectly by a Booklet that Contains Documents on his Dismissal Case, and Indirectly by his Four Latest Books. In this chapter Kierkegaard addresses Adler's subsequent retraction of his claim, and his new literary output. Kierkegaard marvels that Adler published four works simultaneously (1846). Yet, he notes, due to their common themes, and the fact that several passages were identical, the works should have been released as one. Kierkegaard comments on Adler's retraction. In case Adler is a genius, in God's name! I certainly shall not envy him for that. But he began by having had a revelation—though summa summarum by this we are to understand that he is a genius. This is a hitherto unheard-of confusion! After all, the category of genius is surely something other than and qualitatively different from that of having by a revelation from the Savior received a new doctrine!... A genius and an apostle are qualitatively distinct, they are categories which belong each of them to their own qualitative spheres: that of immanence and that of transcendence. (1) The genius may well have something new to contribute, but this newness vanishes.... The apostle has paradoxically something new to contribute, the newness of which, precisely because it is paradoxical and not an anticipation of what may eventually be developed in the race, remains constant.... (2) The genius is what he is by reason of himself, i. e. by what he is himself: an apostle is what he is by reason of his divine authority. (3) The genius has only immanent teleology: the apostle's position is that of absolute paradoxical teleology.... A genius may perhaps be a century ahead of his age and hence stand there as a paradox, but in the end the race will assimilate what was once a paradox, so that it is no longer paradoxical (p. 85ff.). Kierkegaard may have had himself in mind as he contemplated the genius who is ahead of his age. At any rate, he appeals to the etymology of the words genius and apostle. Genius is from the Latin ingenium, which is inborn talent or ability. Apostle is from the Greek apostolos, meaning one who is sent, i. e. by God. For previously to being an apostle he possessed no potential possibility. Every man is equally near to being an apostle.... A genius is approved on purely esthetic grounds, according to the content and specific gravity his productions are found to have; an apostle is what he is by reason of the divine authority he has. The divine authority is the qualitatively decisive factor. It is not by appraising esthetically or philosophically the doctrine that I must and can reach the conclusion that ergo he who has taught this doctrine was called by a revelation, ergo he is an apostle. The order of sequence is exactly the reverse: the man called by a revelation, to whom was entrusted a doctrine argues from the fact that this was a revelation, from the fact that he has authority (p. 106f.). Kierkegaard notes that it is not the content of the revelation so much as the fact that it is revelation. By way of example he says that even if one were to quote Christ verbatim, only Christ is inspired. Kierkegaard held a prolonged fascination with the topic of inspiration, authority and the pastor's vocation. He himself had always said that he was "without authority", that is, that he lacked apostolic authority of an Apostle Paul. One or another reader perhaps recalls that I have always used this expression about myself qua author, that I am without authority, and have used it so emphatically that it has been repeated as a formula in every preface. Even though as an author I have had no benefit, I have at least done everything finitely possible not to confuse the highest and holiest. I am a poor individual human being. If I am, as some think, a bit of a genius, about that I would say: Let it go hang. But an apostle is in all eternity qualitatively just as different from me as from the greatest genius who has ever lived and from the most obtuse person who has ever lived (Journals, VII 2 B 235). Chapter 4: A Psychological View of Adler as a Phenomenon and as a Satire on Hegelian Philosophy and the Present Age At the time that Adler had his alleged vision in which he was instructed to burn his books, he claimed to have abandoned Hegelianism. Kierkegaard maintains that Adler still demonstrates Hegelian thinking in his reasoning and displays indecisiveness in his leap away from Hegel, especially since he later retracts the use of the word "revelation". Moreover, alleges Kierkegaard, he confuses subjectivity and objectivity. ...he confounds the subjective with the objective, his subjectively altered condition with an external event, the experience that there rose up a light before him with the notion that outside of him there came about something new, the fact that the veil fell from his eyes with the notion that he had a revelation. Subjectively his emotion reached the highest pitch, he chose the highest expression to indicate it, and by a mental deception he used the objective determinant that he had had a revelation (p. 119). Throughout this chapter, Kierkegaard seeks to show that an understanding of the phenomenon of Adler is indicative of his confused age. Broadly speaking, Kierkegaard criticizes his age for the following shortcomings, which he will return to in many other works. His age is objective rather than subjective. His age is still under the influence of Hegel. His age confuses the esthetic category of genius with the religious category of divine inspiration, that is, the office of an apostle with the professor. His age is under the influence of the French revolution, and therefore acts like a mob, rather than as a collective of thinking individuals. Because Adler came under the power of these influences, he was so able to confuse important categories, and then unthinkingly change his position, thereby worsening his credibility. Lastly, Kierkegaard is decidedly apolitical, as is evidenced by a postscript to the entire work. In an excised draft Kierkegaard returns to the dichotomy of God versus the crowd. As for the present treatise, the reader, I hope, will constantly get from reading it the impression that it is ethical-religious and has nothing to do with politics, that it investigates ethical-religiously how it comes about that a new point of departure is created in relation to the established order; that it comes about by the fact that the point of departure is FROM ABOVE, from God, and the formula is this paradox that an individual is employed. Humanly understood, an individual is nothing in comparison with the established order (the universal), so it is a paradox that the individual is the stronger. This can be explained only by the fact that it is God who makes use of him, God who stands behind him.... This abstraction is an inhuman something, the power of which is, to be sure, prodigious, but it is a prodigious power which cannot be defined in human terms, but more properly as one defines the power of a machine, calling it so and so many horsepower: the power of the multitude is always horsepower. This abstraction, whether you call it public or the multitude or the majority or the senseless people—this abstraction is used politically to bring about movement... (p. 317f.).
<urn:uuid:1955e092-6918-4821-b26c-f66c7171e925>
CC-MAIN-2017-04
http://www.sorenkierkegaard.org/book-on-adler.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00473-ip-10-171-10-70.ec2.internal.warc.gz
en
0.976115
4,203
2.171875
2
All listings for this product About this product - DescriptionThis volume completes the monumental work on the prophet Jeremiah by one of the world's most widely recognized scholars of the Old Testament. Unequalled in scope and detail, these volumes draw on textual and linguistic interpretation of the Hebrew Bible and its versions as well as on the work of later commentaries and scholars. The completion of this work is a landmark event in Old Testament scholarship, and will provide a rich source of information for students and researchers for many years to come. - Author BiographyWilliam McKane was Emeritus Professor of Hebrew and Oriental Languages, University of St Andrews. - Author(s)William McKane - PublisherBloomsbury Publishing PLC - Date of Publication01/02/1986 - SubjectChristianity: Bibles & Liturgy - Series TitleInternational Critical Commentary - Place of PublicationEdinburgh - Country of PublicationUnited Kingdom - ImprintT.& T.Clark Ltd - Content Noteblack & white illustrations - Weight907 g - Width130 mm - Height190 mm - Spine41 mm Best-selling in Textbooks Save on Textbooks - AU $192.00Trending at AU $201.78 - AU $67.99Trending at AU $70.86 - AU $73.99Trending at AU $75.47 - AU $64.77Trending at AU $68.89 - AU $76.88Trending at AU $78.38 - AU $108.88Trending at AU $111.38 - AU $90.00Trending at AU $91.76 This item doesn't belong on this page. Thanks, we'll look into this.
<urn:uuid:0fd6595c-6c27-4381-907d-d98ff1438cf5>
CC-MAIN-2017-04
http://www.ebay.com.au/p/Jeremiah-v-1-Chapters-1-25-by-William-McKane-Hardback-1986/94424193
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00464-ip-10-171-10-70.ec2.internal.warc.gz
en
0.864948
367
1.789063
2
Washington — Israel's Prime Minister Menachem Begin is expected to get a warm reception from the Reagan administration when he arrives here for a visit next week. Relations between the two nations have improved substantially since the tension produced a year ago by Israel's invasion of Lebanon. But there are a few clouds gathering on the horizon which could eventually create new tensions between the United States and Israel. They will be of concern not only to the American government, but also to the American taxpayer: * One is the growing cost of trying to maintain Israel on a war footing against an array of Arab nations. A much-censored, much-talked-about, but little-read report by the General Accounting Office (GAO), a congressional watchdog agency, predicts that Israel may face difficulties in paying its financial debts to the US in coming years unless it obtains additional amounts of grant aid. According to the GAO report, the State Department disagreed with that assessment and does not see the development of a severe debt problem. The Agency for International Development went one step further and reported that there is cause for optimism about Israel's balance of payments prospects, the GAO said. * A smaller but significant cloud of concern is gathering around Israel's plans to build a new fighter plane, the Lion, or ''Lavi,'' in the Hebrew. US Defense Department officials say that it would be much more economical for the Israelis to buy or coproduce an American fighter than it would be for them to try to develop another of their own. But the Israelis are obviously interested in cutting their military dependence on the United States, strengthening their own aircraft and high-technology industries, and creating the new jobs that would go along with the production of a new fighter plane. At this point, the Lavi is mostly a matter for debate among specialists in the Defense Department, the American aircraft industry, and Congress. But at some point, specialists say, it is likely to be the subject of congressional hearings. As the GAO report on US assistance to Israel points out, Israel will be ''significantly dependent on US technology and financing for major portions of the aircraft.'' Israel will need US approval for planned sales of the Lavi to other nations because of the American parts and technology that are to be used in the plane. Nevertheless, the GAO says that the Israelis are expected to be able to make the Lavi competitive with US aircraft producers and exporters. The GAO report says that some US officials ''recognize the domestic, political, and economic repercussions for the United States of aiding a foreign country's aircraft program,'' espcially since the US govermment does not provide the same assistance to US firms. The Northrop Corporation, for example, developed the F-20 fighter specifically for export using its own funding. It has subsequently had trouble marketing the F-20. ''Our only problem with the Lavi deal is that Northrop was required to fund every last nickel of the F-20 with our own corporate assets,'' said a Northrop official. ''Now is the US government going to roll over and play dead when Israel says, 'Let's develop a competitor'?'' What appears to be most disturbing to the GAO is that Israel wants US foreign military sales credits to be spent inside Israel for the Lavi program. Normally, such credits are used for purchases in the United States. The GAO is concerned that preferential treatment given to Israel in many instances could set precedents for other US aid recipients who would then request similar treatment. According to the GAO, the Israelis originally wanted to make the Lavi a low-cost, low-technology fighter to replace its aging A-4 and Kfir aircraft. But the GAO says that the Israelis later decided to make it a ''very advanced fighter,'' and its ''fly away'' price has now more than doubled, from an original estimate of $7 million per unit to the current estimate of more than $ 15 million. The GAO said that the Israelis gave as a reason for the advanced version the US decision to sell advanced fighters to Arab nations, thus ''threatening to erode Israel's qualitative edge over the Arabs.'' One of the most controversial parts of the GAO report relates to the economic impact of Israel's invasion of Lebanon. Israeli officials argue that the cost of the Lebanon campaign is being financed by domestic Israeli sources. But in one censored portion of its report, the GAO asserts that there is ''a substantial foreign-exchange component'' related to the Lebanon campaign which increases Israel's balance-of-payments deficit. This in turn, could have an effect on Israel's requests for economic support from the US, GAO says. One of the most heavily censored portions of the report shows how US defense officials have disagreed with Israel's assessment of the Arab threat to Israel. According to an uncensored draft of the GAO report obtained by this newspaper, an assessment by the US Joint Chiefs of Staff concludes that Israel has sufficient forces to defend against any likely Arab offensive. The report says that the Israelis conclude, on the other hand, that their forces are ''just barely sufficient.'' The Israelis base their plans on a ''total Arab threat,'' which the Joint Chiefs believe is unlikely to be brought to bear against Israel. Defense Department officials at the working level are said to believe that Israel can make do with less than the level of US military aid being proposed.
<urn:uuid:663316cd-2e2e-4265-8917-e461a0a4b1b7>
CC-MAIN-2016-44
http://www.csmonitor.com/1983/0718/071837.html
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720737.84/warc/CC-MAIN-20161020183840-00221-ip-10-171-6-4.ec2.internal.warc.gz
en
0.964589
1,100
1.789063
2
’s Movement Essay, Research Paper Legislation Concerning the Women’s Movement in the United States In the 1900s, state and federal laws that discriminated against women posed some of the most significant obstacles in gaining women s rights. The earliest campaigns to improve women s legal status in the United States focused on gaining property rights for women. Women also led legislative efforts in the 19th and 20th centuries to ensure their voting and employment rights. Beginning in the 1830s, states passed laws that gradually gave married women greater control over property. New York state passed the Married Women s Property Act in 1848, allowing women to acquire and retain assets independently of their husbands. This was the first law that clearly established the idea that a married woman had an independent legal identity. The New York law inspired nearly all other states to eventually pass similar legislation. The Right to Vote American women did not gain the right to vote until 1920, after amendments were made to the Constitution. The passage of the 14th Amendment in 1866 and the 15th Amendment in 1870 helped to focus the women s rights movement on suffrage. The 14th Amendment provided that all citizens were guaranteed equal protection under the law and that no citizen could be denied due process of law. The 15th Amendment stated that citizens could not be denied the right to vote on the basis of race, color, or previous status as a slave. Activists like Elizabeth Cady Stanton and Susan B. Anthony argued that the 15th Amendment be expanded to guarantee suffrage to women. With the formation of the National American Woman Suffrage Association in 1890, the women s rights movement zeroed in almost exclusively on attaining the right to vote. In 1920 the 19th Amendment granted women this right. (In theory, the 19th Amendment should’ve extended voting rights to all women.) Protective Labor Legislation Increasing numbers of women began to enter the industrial labor force in the 19th century. As a result, some social reformers grew concerned about the impact of long hours and poor working conditions on women. The National Consumers League, founded in 1899, and the Women s Trade Union League, founded in 1903, began efforts to limit women s work hours and the types of work they could do. By 1908 the states had passed 19 laws limiting work hours or completely ending the option of night work for women. Even greater numbers of women entered the workforce during World War I (1914-1918), prompting the establishment of the Women s Bureau of the Department of Labor in 1920, which began the passage of legislation to protect working women. Protective legislation has been challenged repeatedly in the courts. In Ritchie v. People (1895), the Illinois Supreme Court ruled that limiting women s work day to eight hours infringed upon a woman s right to contract for her labor, and therefore violated her 14th Amendment right to equal protection under the law. In Lochner v. New York (1905) the Supreme Court deemed all protective labor legislation to be unconstitutional. The Lochner decision was revised three years later in Muller v. Oregon (1908). In that case, American jurist Louis D. Brandeis argued that the woman s role as a mother required that she be given special protection in the workplace. American courts repeatedly struck down statutes establishing minimum wages for women. In Adkins v. Children s Hospital (1923), the Supreme Court decided that a minimum wage for women violated the right to freedom of contract. But the passage of the National Fair Labor Standards Act (1938) established a national minimum wage for both men and women. In 1969 the Equal Employment Opportunity Commission (EEOC) declared protective legislation for women invalid. Equal Rights Amendment After the passage of the 19th Amendment granting women the right to vote, members of the women s movement focused on gaining other rights for women. Alice Paul and Lucy Burns directed their efforts toward prohibiting all other inequities between men and women. Paul and Burns had founded the National Women s Party in 1916 which worked for women s suffrage. However, they believed that winning the right to vote marked only the beginning of the women s struggle for equality. In the early 1920s the National Women s Party aimed to pass an Equal Rights Amendment (ERA) to the Constitution that would make illegal all forms of discrimination based on sex. Under the influence of the National Women s Party, the U.S. Congress introduced the ERA in 1923, but the issue failed to gain significant support. Some people who had previously supported women s right to vote opposed the ERA. They included moderate social reformers and administrators in the Women s Bureau of the Department of Labor. These people opposed the ERA because they believed that strict enforcement of equal rights would mean the elimination of protective legislation for women. They thought that the ERA would be bad for the working-class woman. In the 1960s the so-called “second wave” of the women s rights movement stirred up the ERA debate. President John F. Kennedy set up the first national Commission on the Status of Women in 1962. In 1963 the commission issued a report detailing employment discrimination, unequal pay, legal inequality, and insufficient support services for working women. Still, the majority of the commission members opposed the ERA, because they said that equal rights were already guaranteed in the Constitution. The ERA policy became the 27th Amendment in 1972, but it had to be ratified by at least 38 states to become a law. In 1982 the ERA was defeated when only 35 states had passed the measure, three short of the 38 required for ratification. Equal Pay Act The 1963 report by the Commission on the Status of Women led directly to the passage of the Equal Pay Act the same year. The Equal Pay Act made it illegal to pay different wages to men and women who performed the same work. However, the new law had little effect on narrowing the wage gap between the sexes. Most female workers remained in jobs traditionally held by women, offering low wages and little prospect for advancement. In 1963 the average female worker made 58 cents for every dollar the average male made. In 1995 women s earnings had increased, but they were only 71 cents for every dollar that men earned. Civil Rights Act (Title VII) Title VII of the 1964 Civil Rights Act barred employment discrimination based on sex, race, color, or ethnic origin. The act originally prohibited only racial and ethnic discrimination, but Virginia congressman Howard W. Smith added the word sex in an amendment to the act, hoping to ensure its defeat. Instead, congresswoman Martha Griffiths and Senator Margaret Chase Smith led the campaign for approval of the act. Title VII also set up the Equal Employment Opportunity Commission (EEOC) to enforce the act. However, women quickly realized that they needed more political influence if their grievances were to be heard by the EEOC. Betty Friedan started the National Organization for Women (NOW) in 1966 in an effort to increase women s political power in the United States. In its early years, NOW focused on the rights of women as individuals. This strategy appealed to professional women and failed to gain a large following. Membership in NOW expanded dramatically after the organization sponsored the Women s Strike for Equality, a massive demonstration on August 26, 1970 (the 50th anniversary of women s suffrage).
<urn:uuid:da5e9a00-993c-461e-9c0a-1f8395712838>
CC-MAIN-2017-04
http://mirznanii.com/a/82790/legislation-concerning-the-women
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285315.77/warc/CC-MAIN-20170116095125-00566-ip-10-171-10-70.ec2.internal.warc.gz
en
0.966395
1,486
4.28125
4
The effectiveness of health provision for women and girls in the context of gender inequalities and climate change. A case study of Misungwi District, Tanzania Climate-related risks to agriculture dependent and other poor households will continue to increase. Inter-seasonal and inter-annual variability of rainfall and temperatures will increase. Socio-cultural issues influence gender-based violence, including control over agricultural incomes. Both climate vulnerability (exposure and sensitivity) and the coping strategies available put women and girls at a disadvantage. Both exposure to and sensitivity of women and girls to gender-based violence increase with increased climatic variability. However, climate variability and climate change are not the main drivers of the violence suffered by women and girls. Women and girls face different types of violence when the climate conditions allow good harvests and market conditions enable good prices for harvests, and they face other types of violence when climate conditions lead to poor harvests and resource scarcity. Socio-cultural and economic factors are more important drivers of gender-based violence. But climate change will act as an exacerbating factor of gender-based violence. This cycle is likely to increase the need for health service provision for women and girls. Socio-economic development in Misungwi district without a gender responsive climate adaptive approach will increase risk burden for women & girls.
<urn:uuid:cd44ed88-1aad-42e2-8efa-17b763a5568e>
CC-MAIN-2022-33
https://www.climatelearningplatform.org/effectiveness-health-provision-women-and-girls-context-gender-inequalities-and-climate-change-case
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573760.75/warc/CC-MAIN-20220819191655-20220819221655-00674.warc.gz
en
0.930812
271
2.890625
3
Rarely does the world of Biblical archaeology make as much news as when filmmakers James Cameron and Simcha Jacobovici announced at a press conference in late February 2007 that they had identified the remains of Jesus. Those remains, the two filmmakers claimed, had been in an ossuary, or bone box, inscribed “Jesus son of Joseph” that had been uncovered in 1980 during construction of an apartment building in the Jerusalem neighborhood of East Talpiot. As if that were not news enough, Cameron and Jacobovici further claimed that the tomb also contained the ossuaries of Mary, the mother of Jesus, and of Mary Magdalene. And if that weren’t enough, they went on to claim that another ossuary in the tomb, inscribed “Yehudah [Judah, or Judas in Greek] son of Jesus,” was the son of Jesus of Nazareth and of Mary Magdalene, who, the filmmakers said, were married. The Talpiot tomb, they concluded, was nothing less than the tomb of Jesus and his closest family. Cameron and Jacobovici’s views were elaborated soon after the press conference in The Lost Tomb of Jesus, a program that aired on the Discovery Channel. It did not take long for the criticism against the show’s claims to mount. Some of the criticism was personal and ugly, sometimes motivated by a misguided sense of defending Christianity. Much of the criticism, however, came from scholars who raised substantive objections to the program’s claims. Some quickly pointed out that the Talpiot tombñ cut into bedrock and containing niches for ossuariesñ was a type of tomb popular among Jerusalem’s wealthy in the first century. Jesus’s family was not wealthy, these scholars noted, and would not have had such a family tomb. Several other criticisms were raised: Jesus’s family, coming from Galilee, would not have had a tomb in Jerusalem; if they had one at all, it would have been in their home region. The scholars also noted that the purported ossuary of Jesus is inscribed simply as “Jesus son of Joseph.” People from outside Judea, these scholars argued, would have been called by their city or region of originñ Mary of Magdala, Paul of Tarsus and, indeed, Jesus of Nazareth. Scholars also pointed out that Jesus, in the Gospels, is invariably called “Jesus of Nazareth” and not “Jesus son of Joseph,” which is how the Talpiot ossuary is inscribed. Other objections included the fact that the Jesus ossuary contained no title, such as Master or Messiah, that we might expect Jesus’s earliest followers to have inscribed on the bone box of their revered teacher. Also missing was any history of veneration of the Talpiot tomb as the burial place of Jesus; the Church of the Holy Sepulchre, in contrast, was thought by early Christians to be the site of Jesus’ death and burial as far back as the second century. None of the proceeding objections are by themselves strong enough to be fatal to the claim that the Talpiot tomb was the tomb of Jesus and his family. But note that every one of those objections has to be wrong for the claim to be rightñ even if one of those objections is correct, the Talpiot tomb is not the tomb of Jesus of Nazareth. But, for the sake of argument, let’s assume that these objections are indeed all wrong. Even if we grant that Jesus’ family had a tomb in Jerusalem (and not in Galilee), that they could afford (and had a desire to own) a rock-cut family tomb of the type favored by Jerusalem’s wealthy, that Jesus’ ossuary would have been inscribed simply as “Jesus son of Joseph” (and not “Jesus of Nazareth” or with the title Master or Messiah), and that the early Christian community in Jerusalem not only would have forgotten where their leader had been buried but would later come up with an entirely spurious tradition that he was buried where the Holy Sepulchre would later be builtñ if we assume all that, how strong a case do the makers of The Lost Tomb of Jesus have? The answer is: a surprisingly weak one. When the Talpiot tomb was discovered in 1980, the excavators found ten ossuaries inside; six were inscribed. In addition to the one inscribed “Jesus son of Joseph,” there were ossuaries inscribed “Mariamne Mara,” “Maria,” “Mattia,” “Judah son Jesus” and “Joseh.” The “Mariamne Mara” inscription is written in Greek letters; the others are in Hebrew/Aramaic. The “Mariamne Mara” ossuary is key to the filmmakers’ argumentñ and it is the one over which their claims are particularly unconvincing. They argue that Mariamne, one of several Greek variations on the Hebrew name Miriam, refers to none other than Mary Magdalene (the name Mary, too, derives from Miriam). They point to the fourth-century apocryphal work the Acts of Philip, in which a woman named Mariamne plays a prominent role. The filmmakers, basing themselves on an interpretation by Francois Bovon, of Harvard Divinity School, argue that this Mariamne was thought by the author of the Acts of Philip to be Mary Magdalene. There are several severe problems with this theory, however. The Mariamne in the Acts of Philip is not identified as Mary Magdalene and does not do any of the notable things Mary Magdalene does in the Gospels (for example, Mary Magdalene is healed by Jesus in Luke 8:8; is witness to Jesus’ place of burial in Mark 15:40-47; and is witness to the resurrection of Jesus in Mark 16:1-8). The Mariamne of the Acts of Philip also does numerous things for which we have no parallel in the Gospel accounts (such as converting talking animals and slaying a dragon!). Indeed, the Mariamne of the Acts of Philip is identified as the sister of Martha. So whatever we are to make of the Mariamne of the Acts of Philip, she is not Mary Magdalene. But even if we accept Bovon’s theory that the Mariamne in the Acts of Philip was meant to be Mary Magdalene (and Bovon has recently stated that he does not think Mariamne is the real name of the historical Mary Magdalene), what bearing does a fourth-century work, composed far from Palestine (probably in Asia Minor), have on first-century artifacts from Jerusalem? About eight times in the Gospels the form Maria is used to refer to Mary Magdalene (and a ninth time, if one counts Mark 16:9, part of Mark’s ending added much later). Four times the Semitic form Mariam is used. We see the same variation of names in reference to Mary, the sister of Martha, and to Mary, the mother of Jesus. In fact, Mariam is used in reference to the mother of Jesus more than a dozen times. Accordingly, to identify the Mariamne of the Talpiot ossuary with one specific Mary of the New Testament is little more than special pleading. The Mariamne in the Talpiot tomb is almost certainly someone else. The filmmakers also take the second name on that ossuaryñ Marañ to be a title, the feminine form of the Aramaic title for “Master” or “Teacher.” To the filmmakers, this gives added weight to their identification of the Mariamne in the ossuary with Mary Magdalene. In their view, Mary Magdalene was a central and honored early leader in the church, and her role was acknowledged by the inscription on the ossuaryñ “The Honored Teacher Mariamne.” But here, too, the filmmakers are almost certainly wrong. Some epigraphers think the Greek inscription on the ossuary actually reads “Mariamne and Mara.” This interpretation is supported by similar, even identical, forms in Greek papyri (for example, P.Oslo 2.47; P.Oxy. 2.399; 4.745; P.Columbia 18a; and, from Palestine, 5/6Hev 12; 5/6Hev 16; and XHev/Seiyal 63 and 69). And, in fact, there is another ossuary, at Dominus Flevit, in which the names “Martha and Mary” are inscribed, thus providing an example where the names of two women are given. In any case, we have no certain examples of “Mara” as a title (besides, the Aramaic Mara is normally masculine). The inscription on this ossuary should be read either as “Mariamne, known as Martha” or perhaps as “Mariamne and Martha,” to indicate that there were two women in the ossuary (it was common for ossuaries to hold the remains of several people). The Lost Tomb of Jesus suggests that “Mariah” (written in Hebrew letters) is a “Latinized” form of Miriam and is quite rare and thus supports an identification with Mary the mother of Jesus. This is not convincing, however, for “Mariah” (written in Hebrew letters) is found on ossuaries from Mount Scopus (see L. Y. Rahmani, A Catalogue of Jewish Ossuaries in the Collections of the State of Israel, ossuary no. 26), the Mount of Olives (no. 27), Jericho (no. 55), in Jerusalem (for example, nos. 48, 49, 53, 56-58) and elsewhere (nos. 33-36, 41). Moreover, the name “Maria” (written in Greek letters) occurs in Josephus (Jewish Wars 6.201) and on ossuaries (Rahmani nos. 25, 28, 46). There is nothing about the nameñ written in Hebrew or in Greekñ that points to Mary the mother of Jesus. There are also problems with the interpretations of the other names found in the Talpiot tomb. We know of no one in the family of Jesus by the name of “Mattia” (Matthew). The filmmakers point to ancestors of Jesus who had forms of that name, but their point is not convincing and is another example of special pleading. The filmmakers also misunderstand another of the names found in the Talpiot tomb. The name YWSH should be pronounced “Yosah” (as Professor Tal Ilan in fact does in the documentary), not “Yoseh,” as the documentary consistently does. “Yosah” is not the Hebrew equivalent of the Greek form Joses, the name of Jesus’ brother (as in Mark 6:3 and elsewhere). The Hebrew equivalent is YWSY (and is found on a number of ossuaries in Greek and in Hebrew). The documentary’s discussion of this name is very misleading. The Talpiot tomb also contained a “Judah son of Jesus.” The filmmakers suggest this Judah is the son of Jesus and of his wife Mary Magdalene. This whole line of interpretation needs to be challenged. There is no credible evidence anywhere, at any time, that suggests that Jesus had a wife or a child. Had he a wife, it would not have been an embarrassment or something that needed to be kept secret. A wife of Jesus would have been a celebrated figure; children would have occupied honored places in the church. But there is no hint of this. Even the second century Gnostic Gospels of Mary and of Philip do not support the claim some make that Jesus and Mary Magdalene were married or were lovers. This important point seems not to have registered with the filmmakers. The inscription “Judah son of Jesus” argues against the identification of the Talpiot tomb as the tomb of Jesus and his family. Whoever this Jesus was, he had a son named Judah; Jesus of Nazareth had no children and he had no wife. The filmmakers also suggest that a tenth ossuary from the Talpiot tomb, now lost, was in fact the now-famous James ossuary, whose inscription reads “James son of Joseph brother of Jesus.” Amos Kloner, who excavated the Talpiot tomb, rejects the suggestion; he says the tenth ossuary from Talpiot was not inscribed. In addition, the owner of the James ossuary claims that he has photographic evidence that shows that the James ossuary was in his possession years before the discovery of the Talpiot tomb in 1980. And finally, the filmmakers also misinterpret the pointed gable (or “chevron,” as they call it) above the rosette (or “circle”) at the entrance to the Talpiot tomb. They suggest that the gable and rosette were an early Jewish-Christian symbol. They also call our attention to an ossuary at the Dominus Flevit church (some of whose ossuaries may have belonged to early Christians), which on one end has markings similar to those of the Talpiot tomb entrance. The pointed gable and rosette pattern has nothing to do with Christianity. In fact, this pattern predates Jesus and the Christian movement by many years. It is found on Hasmonean coins and on coins struck by the tetrarch Philip, son of Herod the Great, well before the activities of Jesus and the emergence of his movement. The gable and rosette pattern is also found in Jewish funerary and synagogue art, usually symbolizing the Temple or the Ark of the Covenant. The pattern is seen on several ossuaries that we have no reason to think are Christian (see Rahmani nos. 282, 294, 392, 408, 893). The pointed gable over the rosette is a pre-Christian Jewish symbol that referred to the Temple and is not a Jewish Christian symbol. Given Jesus’ criticism of the Temple cult, it is especially ironic that the filmmakers have confused a Temple symbol for a sign used by the earliest Christians. Was there a Jesus family tomb in ancient Jerusalem? We think there likely was not, but if there was it was almost certainly not the Talpiot tomb. Steven Feldman is the former Web Editor of the Biblical Archaeology Society. Craig Evans is Payzant Distinguished Professor of New Testament at Acadia Divinity College, Acadia University, in Wolfville, Nova Scotia, Canada. He earned a doctorate in biblical studies at Claremont Graduate University in 1983. Prior to his appointment at Acadia he was Visiting Assistant Professor of Religious Studies at McMaster University in Hamilton, Ontario, Canada, and for twenty-one years was Professor of Biblical Studies at Trinity Western University in Langley, British Columbia, where for many years he chaired the Religious Studies Department and directed the graduate program in Biblical Studies. He was also for one year a Visiting Fellow at Princeton Theological Seminary in Princeton, New Jersey. Professor Evans is author or editor of more than fifty books. Among his authored books are To See and Not Perceive: Isaiah 6.9Ð10 in Early Jewish and Christian Interpretation (1989), Luke (1990), Jesus (1992), Noncanonical Writings and New Testament Interpretation (1992), Word and Glory: On the Exegetical and Theological Background of John’s Prologue (1993), Luke and Scripture: The Function of Sacred Tradition in Luke-Acts (1993), Jesus and His Contemporaries: Comparative Studies (1995), Jesus in Context: Temple, Purity, and Restoration (1997), Mark (2001), The Bible Knowledge Background Commentary: MatthewÐLuke (2003), Jesus and the Ossuaries (2003), and Ancient Texts for New Testament Studies (2005). Professor Evans has also authored more than two hundred articles and reviews. He served as senior editor of the Bulletin for Biblical Research (1995Ð2004) and the Dictionary of New Testament Background (2000), winner of a Gold Medallion. Currently Evans is serving on the editorial boards of Dead Sea Discoveries, the Journal for the Study of the Historical Jesus, and New Testament Studies. He is also writing Matthew for the New Cambridge Bible Commentary series and a book on the Dead Sea Scrolls and Christian faith. His newest book, Fabricating Jesus: How Modern Scholars Distort the Gospels, was released by InterVarsity Press in December 2006. At the spring 2006 commencement the Alumni Association of Acadia University honoured Professor Evans with the Excellence in Research Award. Professor Evans has given lectures at Cambridge, Durham, Oxford, Yale, and other universities, colleges, seminaries, and museums, such as the Field Museum in Chicago and the Canadian Museum of Civilization in Ottawa. He also regularly lectures and gives talks at popular conferences and retreats on the Bible and Archaeology, including the Biblical Archaeology Society summer sessions, as well as fall sessions at the annual Society of Biblical Literature meetings. He has lectured on the Dead Sea Scrolls, Jesus and archaeology, canonical and extra-canonical Gospels, and the controversial James Ossuary and has appeared several times on the television programs Faith and Reason and the John Ankerberg Show. He has appeared in the History Channel presentation on the Historical Jesus and the recent BBC and Discovery Channel presentation on Peter the apostle. He was also featured in Dateline NBC’s specials “The Last Days of Jesus” and “Jesus the Healer,” which aired in 2004 and were watched by more than 25 million North Americans. In 2005 he appeared on Dateline NBC’s “The Mystery of Miracles” and “The Birth of Jesus,” as well as History Channel’s “The Search for John the Baptist.” Professor Evans also appeared in 2006 in National Geographic Channel’s documentary on the recently discovered Gospel of Judas and in Dateline NBC’s “The Mystery of the Jesus Papers.” He also appeared in National Geographic Channel’s recently aired documentary sequel to the Gospel of Judas, entitled “The Secret Lives of Jesus.” He has recently been interviewed for documentaries investigating the extracanonical Gospels, the resurrection of Jesus, and the controversial Talpiot Tomb in Jerusalem. Professor Evans lives in Kentville, Nova Scotia, with his wife Ginny; they have two grown daughters and a grandson.
<urn:uuid:aee01e78-faba-47b5-9152-377a6da0b48b>
CC-MAIN-2016-44
http://www.biblicalarchaeology.org/daily/archaeology-today/biblical-archaeology-topics/the-tomb-of-jesus-wrong-on-every-count/
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719465.22/warc/CC-MAIN-20161020183839-00097-ip-10-171-6-4.ec2.internal.warc.gz
en
0.969373
3,936
2.78125
3
Objective: Prevent contaminants from vehicles using the A38 from impacting the wildlife at Stover Country Park. - Date of completion: July 2019 - Cost: £2.9m - Location: Newton Abbot, Devon The aim of the project was to prevent contaminants from vehicles using the A38 from impacting the wildlife at Stover Country Park, a Site of Special Scientific Interest (SSSI), located alongside a busy trunk road. The project comprised of the construction of a new sustainable drainage system between the A38 and Stover Country Park, which has provided significant environmental, sustainability and social benefits. Challenges and solutions Stover Lake, at the heart of Stover Country Park was previously renowned for its lilies and invertebrate diversity. However, in the last 20 years, its biodiversity had been slowly deteriorating, in part, due to the contaminated silt from the A38 runoff. Collaboratively, Highways England and the project team worked together to design and implement the most appropriate sustainable solution for mitigating the problem within the sensitive natural environment. Works included drainage realignments, and the installation of in line silts traps, oil interceptors, pollution control values and reed beds that reduce silt, oil and soluble metals. Due to the sensitive nature of the environment, it was essential that any construction and drainage alteration works undertaken did not impact negatively on wildlife. Collaboratively, it was decided that a sustainable drainage system using reed beds provided the most sustainable solution in keeping with the park’s natural environment. Teamwork in the design process was imperative, successfully combining the environmental expertise of Natural England, the Environment Agency and Stover Country Park with the design and construction experience of the contractors. Benefits and achievements The project has not only provided significant environmental benefits, but also helped to maintain the long-term social benefits the park brings to the local area and community. The park is popular with a range of visitors including wildlife enthusiasts, local school groups, families and individuals, community volunteers, and those with specialist needs. B y protecting and reversing the decline of the diversity of wildlife at Stover Country Park, the sustainable drainage system will help to ensure that this valuable natural area can be enjoyed for years to come, with the park’s key environmental messages continuing to spread through communities. The new sustainable drainage system has not only provided the benefits of treating the polluted run-off from the A38, but the new reed beds have also provided a biodiversity improvement. It will take up to 12 months for the reeds to fully establish themselves. However, the success of this scheme is already being seen through preliminary surveys showing that water exiting the reedbed system has improved. Wildlife such as the Common Sandpiper, Heron, Emperor Dragonfly and Sand Martin have also already been observed within this area. Stover Country Park Following the establishment of the new sustainable reed bed system, Stover Country Park has reported its first sightings of the rare Lesser Emperor Dragonfly and Green Sandpiper. 1,500 trees have been planted around the new reed bed system to mitigate the environmental impact of clearing the area for the construction. The original budget for the Project was nearly £4.5 million, however, through effective collaboration, the project team achieved a delivery cost of just over £2.9 million. The people who made it happen - Client: Highways England (works undertaken by Highways England’s South West Community) - Designer: Kier - Principal Contractor: South West Highways Ltd - Environmental Specialists/Collaborators: Stover Country Park, Devon County Council, Natural England, Environment Agency
<urn:uuid:71d699d4-9f84-4c44-a4b7-961bfd75ded9>
CC-MAIN-2022-33
https://southwestinfrastructurepartnership.co.uk/case-study/a38-stover-country-park-wetland-2/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00071.warc.gz
en
0.941027
782
2.296875
2
“Farther Away” by Jonathan Franzen (Farrar, Straus and Giroux, 321 pages, $26) Essays are an acquired taste. We read them for insights into subjects that interest us. We look for information about issues, places or people we want to know more about. Or we may be drawn to writers whose prose we like. Jonathan Franzen is best known as a novelist who won the 2001 National Book Award for “The Corrections” and was featured on the cover of Time after his last novel, “Freedom,” came out in 2010. But he also writes nonfiction. “Farther Away” is his second collection of essays, and is dominated by his twin passions — fiction and birding. The title essay — the best in the bunch and one of the better essays you may read — addresses both topics. In this long piece first published in The New Yorker, Franzen recounts his journey to an island 500 miles off the coast of central Chile that is “populated by millions of seabirds and thousands of fur seals but is devoid of people.” The island is officially named Alejandro Selkirk, but locals use its original name, Masafuera, or Farther Away. Franzen takes a copy of Daniel Defoe’s “Robinson Crusoe,” based on the experiences of a Scottish seaman named Alexander Selkirk. He then deftly combines these elements and the death of his good friend David Foster Wallace, the writer who committed suicide in 2008, to reflect on the nature of love. Addressing Wallace’s mental illness and pathological self-involvement, Franzen writes: “How easy and natural love is if you are well! And how gruesomely difficult — what a philosophically daunting contraption of self-interest and self-delusion love appears to be — if you are not!” He goes on to show how Defoe showed us how sick and crazy radical individualism really is. “No matter how carefully we defend our selves,” Franzen writes, “all it takes is one footprint of another real person to recall us to the endlessly interesting hazards of living relationships.” The 22 essays are presented in reverse chronological order, from 2011 to 1998. Many are reviews or appreciations of works of fiction or authors. These include Alice Munro, Paula Fox and James Purdy, plus such obscure works as Christina Stead’s “The Man Who Loved Children,” Donald Antrim’s “The Hundred Brothers” and Frank Wedekind’s “Spring Awakening.” I especially liked Franzen’s insights into writing, as in the essay “On Autobiographical Fiction,” in which he responds to FAQs of writers. He notes that “the greater the autobiographical content of a fiction writer’s work, the smaller its superficial resemblance to the writer’s actual life.” His focus is usually on literary fiction, and argues that “unless the writer is personally at risk — unless the book has been, in some way, for the writer, an adventure into the unknown; unless the writer has set himself or herself a personal problem not easily solved; unless the finished book represents the surmounting of some great resistance — it’s not worth reading.” Franzen includes a rant against the use of cellphones (“I Just Called to Say I Love You”) to inflict “the personal and individual on the public and communal.” He has two long travel pieces related to birding, one in Cyprus (“The Ugly Mediterranean”), where endangered bird species are being slaughtered, and one in China (“The Chinese Puffin”), where he visits fellow birding enthusiasts. He notes that Southeast Asia is “well on its way to being clear-cut and strip-mined into one vast muddy pit, since China itself is hopelessly short on natural resources to supply the factories that supply us.” And while the Chinese people bear the brunt of Chinese pollution, “the trauma to biodiversity is being reexported around the world.” While readers may not always share Franzen’s interests, his writing is incisive, specific and, like his fiction, confessional in its narrative. His honest exploration of literature and of our world can help us look at our own involvement as we seek love that is willing to experience pain.
<urn:uuid:5bde2183-32c0-48e5-acac-899f5c1256ce>
CC-MAIN-2017-04
http://www.kansas.com/entertainment/books/article1105981.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283008.19/warc/CC-MAIN-20170116095123-00079-ip-10-171-10-70.ec2.internal.warc.gz
en
0.955584
947
2.09375
2
You check out a library book or borrow a book from a friend. When you crack open the pages, you see underlining, maybe even highlighting. Words are written in the margins of the book, too. You’re annoyed, outraged and intrigued. In past centuries, sellers bleached their books to remove the markings from the pages of their books. In the 19th century, many people considered writing in books taboo. This is in sharp contrast to how people view book annotations today, said Claudia Funke, the rare book curator for the Wilson Round Library. Book annotations, or marginalia as it’s called in academia because the notes are often written in the margins, are becoming sought after by book collectors and studied by academics. “It’s a general feeling in academia that no text is really static,” Funke said. “No text has a meaning that stays the same.“ While reading a book might seem like a private experience, writing in books provides future generations with the ability of seeing how a book was perceived like few things can, she said. But scribbles don’t bring warm feelings to all. The kinds of annotations that readers encounter at Davis Library are usually mundane study notes accompanied by crude highlighting and underlining, said Andrew Hart, the preservation librarian at Davis. “It’s something that the next reader may not find as profound or interesting and may not appreciate in the way that the person who wrote it did,” Hart said.
<urn:uuid:5b57b8c0-7c47-4c71-9fd1-28a1e5ebf79b>
CC-MAIN-2016-44
http://reesenews.org/2011/08/10/why-we-write-in-books/17627/
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721558.87/warc/CC-MAIN-20161020183841-00046-ip-10-171-6-4.ec2.internal.warc.gz
en
0.963825
317
2.875
3
Heavy metals are naturally occurring elements that can be found throughout the environment. Given their prevalence in the foods that we eat and even the air we breathe, we are exposed to high levels of heavy metals every day. Certain metals– including zinc, copper, and iron—are beneficial for your health in small doses. However, overexposure to other heavy metals poses serious health risks. Cadmium, arsenic, chromium, lead, and mercury are some of the most toxic. Heavy metal poisoning has become a growing health concern as human activity has increased their presence in our environment. Risks and Symptoms of Heavy Metals In The Body A doctor can test your level of exposure to harmful heavy metals in your blood, urine, and hair. If toxicity is high, you may be experiencing symptoms such as: - Abdominal pain - General feeling of weakness In more severe and chronic cases of heavy metal poisoning, symptoms may include: - Burning and tingling sensations - Brain fog - Chronic infections The toxicity of heavy metals can have serious effects on the brain, liver, and lungs. Long term exposure is even associated with cancer. Who is most at risk? Although heavy metal exposure poses a risk to everyone, it is a special concern for pregnant and breastfeeding women. This is due to the fact that toxins can be passed to the child through the placenta and breast milk. How To Reduce Your Exposure to Heavy Metals While they can hardly be escaped in everyday life, there are certain sources of heavy metals you can deliberately avoid and cut back on to prevent overexposure. 1- Be mindful of your seafood consumption Certain types of fish tend to contain high levels of the heavy metal mercury, which can be harmful in large amounts. The FDA has guidelines for avoiding mercury when eating fish– those with the highest levels are typically larger fish including: - King mackerel - Orange roughly Fish (and seafood) with the least amount of mercury include wild caught salmon, trout, herring, haddock, sole, shrimp and shellfish such as oysters, scallops and mussels. 2 – Quit smoking Cigarettes and e-cigarettes both contain high levels of cadmium, a heavy metal linked with increased cancer risk, among many other harmful ingredients. Avoid smoking to avoid this toxic element, among others. 3 – Opt for organic You’ve heard it before – organic is best. But some foods even more so to avoid heavy metals. Rice tends to contain high levels of the heavy metal arsenic. This is due to its absorbent property—rice absorbs arsenic from pesticide-ridden soil, irrigation water, and even the water that you cook it in. Buying organic rice can prevent overexposure to the heavy metal. Be sure to always rinse your rice well (until the water runs clear) before cooking it. Bone broth is a popular health food for lowering inflammation and promoting gastrointestinal health. However, when animals are exposed to heavy metals, they can store it within their bone materials. Choose organic bone broth from grass fed cows and pasture raised chickens. 4 – Clean cosmetics and body care There are numerous heavy metals—including lead, cadmium, and aluminum—which are often present in makeup and skin products. Many deodorants and antiperspirants also contain aluminum salts, which clog the pores and can enter the body through injured skin (after shaving). Exposure to aluminum can contribute to serious diseases such as breast cancer. Find an aluminum-free deodorant to reduce this risk and seek out organic cosmetics. 5 – Invest in clean water and safe cookware Due to environmental contamination, heavy metals tend to build up in groundwater and then enter the human body in large amounts. Water pipes also are frequently made with lead or copper, two metals which can be harmful to health. Investing in a water filtration system can help reduce absorption of these heavy metals into your body. Heat can increase the chance of toxins leaching into food, making cookware an important place to start when trying to limit heavy metal and toxin exposure. Research shows the safest cookware is that made of ceramic, glass, cast iron, or stainless steel, especially higher qualities without contaminated glazing. 6 – Sweat it out Far infrared saunas have become an increasingly mainstream addition to any heavy metal detox protocol. Research shows that sweat produced by an infrared sauna is only 80 to 85% water, with the remainder made up of harmful substances like cholesterol, sulfuric acid, ammonia, and heavy metals. Infrared saunas produce a heat that penetrates more deeply into tissue than a traditional sauna, helping to mobilize and excrete the mercury and other toxins stored in fat. If you find upon medical testing that your exposure to heavy metals has reached harmful levels, there are medical treatments available. It can take time to safely detox heavy metals from the body, but it is possible. Medications can be delivered intravenously to remove toxins. These medications bind to the metal, a process called chelation. Note that chelation therapy should only be used in serious cases of heavy metal toxin build up, and under the close supervision of a medical professional. There are, however, alternative and more gradual ways to detox heavy metals from the body. One way is consuming certain foods which electrically attract metal and will help move it out. These foods include: - Lemon water - Green tea - Dietary fiber Another option is taking supplements. For instance, selenium helps detox mercury, and Alpha-lipoic acid can renew antioxidants and detox metals. Furthermore, vitamin B, B-6, and C deficiencies can lead to poor tolerance of heavy metals and easier toxicity, so it may be worth supplementing with these vitamins if you find that you are deficient. As always, take care to consult with a healthcare professional before adding any supplements or detoxification substances to your diet. Exposure to high levels of heavy metals can cause serious health concerns. And while human activity has increased their prevalence in our environment, there are certain steps you can take to avoid overexposure to these harmful substances. Heavy metal exposure can feel frightening, but there are plenty of steps to minimize its impact. A healthy lifestyle, including regular exercise and plenty of sleep can help. If you have any questions about heavy metal exposure, reach out to me and schedule a free clarity call! - Tchounwou, P.B., Yedjou, C.G., Patlolla, A.K., Sutton, D.J. (2012). Heavy Metal Toxicity and the Environment. In: Luch, A. (eds) Molecular, Clinical and Environmental Toxicology. Experientia Supplementum, vol 101. Springer, Basel. https://doi.org/10.1007/978-3-7643-8340-4_6 - Zhai Q, Narbad A, Chen W. Dietary strategies for the treatment of cadmium and lead toxicity. Nutrients. 2015 Jan 14;7(1):552-71. doi: 10.3390/nu7010552. PMID: 25594439; PMCID: PMC4303853. - Monro JA, Leon R, Puri BK. The risk of lead contamination in bone broth diets. Med Hypotheses. 2013 Apr;80(4):389-90. doi: 10.1016/j.mehy.2012.12.026. Epub 2013 Jan 31. PMID: 23375414. - TatahMentan M, Nyachoti S, Scott L, Phan N, Okwori FO, Felemban N, Godebo TR. Toxic and Essential Elements in Rice and Other Grains from the United States and Other Countries. Int J Environ Res Public Health. 2020 Nov 3;17(21):8128. doi: 10.3390/ijerph17218128. PMID: 33153201; PMCID: PMC7663342. - Sears ME. Chelation: harnessing and enhancing heavy metal detoxification–a review. ScientificWorldJournal. 2013 Apr 18;2013:219840. doi: 10.1155/2013/219840. PMID: 23690738; PMCID: PMC3654245.
<urn:uuid:f031fab4-b0fe-418d-8f3f-fb9093797379>
CC-MAIN-2022-33
https://www.thyrosisters.com/heavy-metals-in-the-body-what-you-need-to-know/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570871.10/warc/CC-MAIN-20220808183040-20220808213040-00268.warc.gz
en
0.895862
1,812
3.546875
4
COMMENT: Will there be a tomorrow? —Mujahid Eshai The issues of the small landowners, shopkeepers and tradesmen must be resolved at the earliest. Restoring them will create confidence in the majority. That is the need of the hour. But one does not see any midnight oil being burnt in Islamabad or any of the provincial capitals The secretary general of the UN has come and gone. He has promised to tell the world that the flood catastrophe in Pakistan is phenomenal and the world needs to help the people in every way. The prime minister and the head of the Pakistan Muslim League-Nawaz (PML-N), in a joint press conference, declared that they were going to live together, fight together and re-build Pakistan together by dispensing with their political differences in this hour of need. The high point of their joint appearance was the formulation of a committee comprising of apolitical persons of repute in the country for the collection of funds for relief and subsequent rehabilitation of the flood affectees. All well and good, but are these words and promises enough for the family that has lost all its possessions in the great flood, which is so traumatised that they will not be able to walk back to the land that they used to own as the well-beaten track and the three neem trees that marked the way are no longer there. Is anyone out there telling them how will they re-establish the ownership to the precise spot of land the family had owned for generations? Perhaps, the patwari’s records were not washed away; perhaps there is a duplicate copy of all his records in the main cities? The crop that had been stored for the family’s need is not going to be there, so how and from where will the family eat and survive until the next crop, if there will be a next crop? The two buffaloes and the pair of oxen were not evacuated. The stock of consumables in the shop, the tools of the trade have all been washed away. Who is going to pay or provide for their substitutes? How much money will be demanded by those who will be appointed to help us? Why do they not let it all be handled by the armed forces? Questions and more questions but no answers. The loss of property, moveable and immoveable, a sense of nothingness, of hopelessness and oblivion. A sense of the unknown. These are the main problems that concern the vast majority of the flood affectees as they await some relief from wherever. The physical loss and the psychological trauma are enough to cause permanent damage to these people. They need to be reassured very quickly. They need concrete answers to their questions. The questions may have been easier to answer if it was a matter of reconstructing a town or a city. Here we are talking of land that may have been in the family since at least 1947 and if not before. How does one give that very piece of land back to someone, where, perhaps, no landmarks exist? The redress of the immediate and longer-term issues of the small farmers, shopkeepers and tradesmen is extremely important. They in any case constitute the vast majority of the affectees and need the most help. We should be concentrating on their problems. They are the people who form the backbone of the economy and they are the people whose issues are to be resolved first and foremost. The big landlords, business houses and industries can take care of themselves as they still have the means available to them. The need, in the absence of local governments, is to establish yet more committees in each of the affected districts with identical terms of reference. The committees should include the elderly of the district from amongst the small landowners, shopkeepers and tradesmen as the knowledge of the terrain that these people possess would be of great benefit in redrawing the lines. These committees will be tasked to obtain revenue records, establish a permanent roll with identification in that district and details of their claims, vet the same and then recommend to the government that allotment be made. Not an easy task and certainly not work that is going to end in a very short time. Thereafter, the committee will have to disburse funds for the purchase of a minimum number of livestock, reconstruction of homes and start-up expenses. The terms of reference would have to be precise in terms of defining the financial help that would be given throughout the affected districts regardless of the province or the particular area. A suitable system of monitoring and auditing the work of the committees will need to be put in place. The entire exercise will have to be transparent, equitable and auditable. If we do not want to repeat the mistakes of the past it would be preferable to keep the political party stalwarts and our illustrious bureaucracy out of this entire exercise. The politicos should stay out because the entire exercise has to be seen to be performed equitably without any party leanings. The bureaucracy has to have a role in providing information, records, maps and other details to the committee, but none in so far as developing and executing its work. Why? Simply because they are under the executive, that is a political party, and hence the objective of the committee in being equitable and fair to all would not be achieved and the committee could stand accused of being influenced in favour of one or the other. The issues of the small landowners, shopkeepers and tradesmen must be resolved at the earliest. Restoring them will create confidence in the majority. That is the need of the hour. But one does not see any midnight oil being burnt in Islamabad or any of the provincial capitals. Business seems to be as usual with more frequent photo-shoot opportunities being availed. The vast majority of the affectees still continue to lie under the open sky, still waiting for succour, still waiting to be told by someone, anyone, that there is certainly going to be a tomorrow, a better tomorrow. The government appears to be more worried about the International Monetary Fund (IMF) and the non-achievement of targets. The people affected by the floods could not care less for the IMF and its targets. They want their problems resolved. If there is a government out there then it should move and move very fast. Patience is wearing out. So let us not bring any other catastrophe on our heads. Let us act now. The writer is a fellow and former president of the Institute of Chartered Accountants of Pakistan. He also served as a member of the Federal Ad Hoc Public Accounts Committee
<urn:uuid:382d7689-e2f7-4072-babd-82f849a07254>
CC-MAIN-2022-33
https://mmabbasi.com/2010/08/21/will-there-be-a-tomorrow/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572161.46/warc/CC-MAIN-20220815054743-20220815084743-00467.warc.gz
en
0.974888
1,330
1.546875
2
According to the firm, monitoring these factors is important in connecting their clients to the right, targeted audience. Ottawa, ON (PRWEB) August 10, 2012 The London Olympics lived up to its reputation as the first social media Olympics when Twitter followers of Jamaican sprint gold-medalist, Usain Bolt, overwhelmed Twitter with 80,000 tweets per minute according to Twitter reports. The tweets associating Bolt’s name also struck the measuring threads of social media solutions provider, Buy Real Marketing, as user tweets referencing to Bolt gained record highs in the company’s monitoring system. Buy Real Marketing has always been monitoring Twitter activity to spot trends and measure the effectiveness of the social services it provides its client. The followers pulse serves as the prime indicator of what topic, industry, or kinds of people Twitter users are inclined to follow, tweet about, retweet, and mention in their posts. According to the firm, monitoring these factors is important in connecting businesses with the right, targeted audience. Bolt tweets was announced recently by Twitter as a new record high confirming the firm’s sight of the rising of its pool of audience sentiments tweeting about Usain Bolt in the wake of Men’s 200-meter Final at the Olympic Games which brought the athlete his second gold in this year’s biggest sports event. By setting measures on gauging tweeter thoughts and sentiments, the company intensifies its accuracy in bridging clients looking to gain real Twitter followers fast to jumpstart their social media presence and credibility as a brand or an individual. The social media marketing landscape can quickly become a running race that Usain Bolt participated in the London Olympics this year. While the athlete has taken years to train to get to the shining reputation he has now as a star runner, marketers need to compete with the speed of the digital pace in a world of tight competition. Having the edge, the power to push one to the finish line ahead of the competition, is what the service offer to business and enterprise owners including professionals looking for wide exposure. One can learn more about the Twitter service offered by Buy Real Marketing including other social platforms at http://www.buyrealmarketing.com Buy Real Marketing is well-established internet marketing firm founded in 2010 by Jean-Patrick Bisson, Diana Quartin and Jonathan Kennedy. The company specializes in driving search marketing and social media traffic, social web app development and conversion optimization. Each product or service specifically helps small/medium website owners increase online visibility and improve online sales.
<urn:uuid:9363c5fa-2966-4493-9dbf-86f31a1dbd1a>
CC-MAIN-2016-44
http://www.prweb.com/releases/2012/8/prweb9788074.htm
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719784.62/warc/CC-MAIN-20161020183839-00425-ip-10-171-6-4.ec2.internal.warc.gz
en
0.944363
513
1.539063
2
Our High 10 Kenya Safari Excursions & Holidays Visitors also can indulge in picnics, trout fishing in the rivers and tenting within the moorlands. Bird viewing is rewarding when travelling to Aberdare with over 250 species of birds current on this park. On our independent safaris you can select your personal Kenya Safaris camps and lodges and we’ll create a bespoke itinerary. All of our independent tailor-made safaris operate on a private basis, but you might be travelling with like-minded guests on gentle aircraft flights and recreation drives. The wildebeest migration throughout August to October is legendary, but all 12 months long there may be nonetheless an abundance of wildlife in the park, together with the ‘big five’, zebra, cheetah, topi, giraffe, impala, baboons and over 500 species of bird. The best time to go on a Kenya safari is in the course of the drier weather from late June to mid-October and from late December to mid-March. The wildebeest migration is often in the Masai Mara from late July until early November, with different wildlife being excellent year-round in Kenya. Low-season journey (from late January-March and through June and November) is also a good time to go to Kenya, with fewer vacationers in the parks and significantly better rates on supply for a less expensive trip. The easiest and most comfy possibility is a fly-in safari package deal out of Nairobi. This could be arranged by way of … any reputable operator, either as a standalone safari or as a half of an extended countrywide itinerary. In all cases, it is best to make preparations with an skilled safari firm, each national parks are serviced by constitution flights. Tsavo East and West and Taita Hills Wildlife Sanctuary are all served by a number of upmarket lodges and tented camps. Budget lodging can be found within the cities of Voi or Mtito Andei, which stand alongside the Nairobi-Mombasa freeway near the main gates for Tsavo East and West respectively. Sharing an unfenced border with Tsavo West, Taita Hills Wildlife Sanctuary lies on the scrubby plains beneath the mountains for which it’s misleadingly named. It is most often visited on a standalone overnight safari bundle from the coast, inclusive of day and night drives – the latter offering a great probability of recognizing secretive nocturnal species corresponding to leopard, White-tailed mongoose, Honey badger and genet. The park was established in 1961 and is residence to over 450 fowl species, 56 different species of mammals corresponding to waterbucks, rhinos, over 550 plant species like the yellow acacia woodlands and euphorbia candelabrum forest, Makalia waterfalls and tons of more points of interest. Maasai Mara also recognized as “The Mara” by the locals is likely certainly one of the most wonderful recreation reserves discovered the Great Rift Valley with a lot of animal focus on the Western escarpment. It is situated in the Southwestern a half of Kenya in Narok County, overlaying an area of 1510sqkm. Large recent pats often seen on the park’s intensive community of roads and strolling trails serve to remind that it’s also home to a furtive and infrequently seen population of 120 elephants. Africa’s oldest marine reserve, Malindi Marine National Reserve protects 213 km2 of offshore reefs and open water, working south from Malindi to Mida Creek. It provides some of East Africa’s finest marine wildlife-viewing, with the calm coral gardens of Watamu’s Turtle Bay being ideal for snorkelling, while diving is normally undertaken on the bigger barrier reefs further out to sea. A shallow sump-like waterbody set within the far south of Tsavo West beneath Tanzania’s North Pare Mountains, Lake Jipe attracts loads of elephants and helps large numbers of hippo and crocodiles. Boat journeys offer an opportunity to see localised aquatic birds such as Lesser jacana, Pygmy goose and Black coucal. Created in 1986 to protect the Tsavo West’s last few black rhino, Ngulia Rhino Sanctuary is enclosed by a tall electric fence and guarded by a dedicated anti-poaching unit.
<urn:uuid:cd78fa95-db73-4e39-bbe0-a2bf3ef4fd29>
CC-MAIN-2022-33
https://nangua002.com/our-high-10-kenya-safari-excursions-holidays/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571147.84/warc/CC-MAIN-20220810040253-20220810070253-00478.warc.gz
en
0.94049
919
1.53125
2
The Dehumanization of America Living in America, we experience comfort, luxury, and independence. Essentially, we are able to think how we want to think and live how we want to live without ever having to worry about some petty act of violence or other misconduct befalling us. We are in control of our own lives. Because of our incredibly fortunate situation, it has become nearly impossible for us to grasp the adversity that people in all other walks of life have to deal with. The short stories Rape Fantasies, The Metamorphosis, and The Lottery each help illustrate that the people of America have truly become desensitized. In Rape Fantasies, by Margaret Atwood, several women give their own portrayal of what it would be like to be raped. It becomes abundantly clear that without experiencing the horrific terror of rape, you cannot come close to understanding what it feels like. Some of the women in the story actually see rape as some sort of bizarre sexual fantasy. They can't relate to the millions of women who have been raped because it has never happened to them. It is not within their grasp of reality. Even the levelheaded narrator cannot imagine a rape scenario in which she doesn't regain control of the situation. Margaret Atwood attributes many of these misinterpretations of rape to the media. She makes a point of how magazines take a light-hearted approach when dealing with serious topics, and consequently they make unspeakable actions seem trivial and insignificant. The Metamorphosis, by Franz Kafka, also makes the point that it is hard for us to sympathize with problems that we have not yet faced. In this story the main character, Gregor, is transformed into an enormous bug. Before the metamorphosis occurs, Gregor is the sole provider for his family, but afterwards he is left incapacitated and helpless. This overnight change can be interpreted as someone growing old and senile, someone falling victim of an accident and being left crippled, or any other situation in which a person becomes a general burden to the people around him. In The Metamorphosis, Gregor's family forgets about everything he did for them in the past and they grow to despise him. The same thing often happens to the elderly in America. They raise us, they take care of us, they love us, and we claim to be indebted to them. The second they grow too old to take care of themselves, we put them in an elderly home and demean their entire existence into two or three uncomfortable visits a year. Subconsciously we think that we are going to be fully functional for the rest of our lives. Nevertheless, with our poor health habits and our "I'm going to do what I want at the cost of anything"� mentality, my generation will probably be twice the burden that our grandparents are on us. Still we can only think about our unheroic demise for a second before we put the thought out of our mind because we know that we're never going to face this same predicament. We all believe that it can't possibly happen to us. The character Tessie Hutchinson in Shirley Jackson's The Lottery is the perfect example of how we are able to stomach the inhumane until we find ourselves the victim. In The Lottery, a small and relatively unimportant village participates in a sadistic ritual where the loser of a random drawing is stoned to death by their neighbors, friends and loved ones. Tessie Hutchinson, who grew up in the small village, took part in the atrocious festivities every year of her life, and she probably enjoyed the lottery as much as everyone else. She was only able to come to grips with the evil of the whole affair after she herself had lost the lottery. When her family was selected, Tessie cried out, "You didn't give him time enough to take any paper he wanted. I saw you. It wasn't fair"� (Jackson 743). Every other year she had found the lottery fair. Every other time she heard men, women, and children crying for mercy, she thought they were just poor sports who didn't understand the concept of the few suffering for the good of the majority. Many citizens of America have similar outlooks on other nations. One example of this "As long as it's not me"� mindset is war. For the most part, Americans have few qualms with war. As long as it's not our friends and family fighting off in the Middle East, and it's not our peaceful town getting blown to hell, most will agree that war is great. The fact that innocent people we've never met are paying the price with their lives (because self-indulging politicians thousands of miles away from them have deemed their suffering as necessary) seems perfectly normal. As long as gasoline prices stay low, the American public apparently sees these deaths as acceptable means that are justified by the end. But what if it was our home that was a constant war-zone? What if it was our land being raped of its resources to satisfy the gluttonous appetite of complete strangers living an eternity away? It is highly unlikely that we would find the situation necessary or fair. But it seems that until we face these same problems, we will continue making these third world countries our bitches without ever really thinking twice. The fact that we are not living in oppressed, poverty-ridden countries is something that we all take for granted. We never know when we will be the ones getting raped, getting put in an old folks home, or having our homes raided by sadistic militiamen. Atwood, Kafka, and Jackson each make a point that it has become way too easy for us to stand oblivious to the problems facing the rest of humanity. Our inexperience with suffering has left us naÃÂïve and unprepared to deal with actual affliction. Much like Tessie Hutchinson, if we continue to ignore the injustice placed on others, we will have no grounds to oppose the same injustice placed on ourselves. Works Cited Cassill, R.V., ed. The Norton Anthology of Short Fiction. New York: W.W. Norton & Company, 1990. Atwood, Margaret. Rape Fantasies. Cassill 10-18. Jackson, Shirley. The Lottery. Cassill 738-745. Kafka, Franz. The Metamorphosis. Cassill 842-881.
<urn:uuid:49260193-5fb4-4564-a54c-10d6a4f143c7>
CC-MAIN-2017-04
http://www.writework.com/essay/dehuminization-amarica
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279224.13/warc/CC-MAIN-20170116095119-00481-ip-10-171-10-70.ec2.internal.warc.gz
en
0.973114
1,321
2.234375
2
Ohio could follow in the footsteps of neighboring Michigan and Indiana to enact right-to-work legislation. Republican state Reps. Ron Maag of Lebanon and Kristina Roegner of Hudson plan to introduce two bills — one for the public sector and one for the private sector — that would end mandatory membership and dues payments to unions. In letters seeking support from House members, the representatives wrote their respective bills would eliminate any requirements that public employees join or pay dues to unions and prohibit private employers from requiring union membership. Right-to-work proponents say the legislation frees workers from union obligations and leads to more business growth, while opponents say unions protect workers’ rights when employers don’t. If enacted, Ohio would become the 25th right-to-work state — Michigan was 24th and Indiana was 23rd in 2012. Banning mandatory dues was included in 2011’s Senate Bill 5, which was voted down by Ohio voters 62 percent-38 percent. Republican Gov. John Kasich said late last year that right-to-work was not a top priority for him. Both Maag and Roegner voted for SB 5. The representatives’ staff members deferred questions to a press conference scheduled for Wednesday afternoon. Roegner told a Dix Newspapers reporter that right-to-work gives states a competitive edge over other states and Ohio should discuss it. “This is not at all Senate Bill 5. Senate Bill 5 was putting guardrails and restrictions around collective bargaining,” Roegner said. “This is giving the workers freedom, to me it’s two totally separate things.” Democrats and labor organizations seized the issue, releasing statements condemning the proposed legislation. House Minority Leader Armond Budish, D-Beachwood, said Republicans “didn’t get the message” in 2011. “So-called right to work means fewer rights, not more, for working Ohioans,” Budish said. “It would negatively impact the lives of all Ohioans, and it would particularly harm the ability of our police, firefighters and teachers to bargain for safety equipment, proper staffing levels, and class sizes, just to mention a few.” Greg Lawson, policy analyst for free market think tank Buckeye Institute for Public Policy Solutions said companies consider a state’s union membership policy when starting a new business or expanding. “It’s not the only thing they look for but they do look for this,” Lawson said. “It doesn’t kill unions but it’s going to be a friendlier environment, easier to set up shop.”
<urn:uuid:fc7efa64-eaa3-453b-af86-6702cf29850b>
CC-MAIN-2017-04
http://www.springfieldnewssun.com/news/state--regional-govt--politics/ohio-lawmakers-push-right-work-legislation/Udhhx6p7dDzyJv3XI4pjDM/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285315.77/warc/CC-MAIN-20170116095125-00566-ip-10-171-10-70.ec2.internal.warc.gz
en
0.945577
553
1.5625
2
15 August 2018 The Dormition is a reminder that we too will depart from this life ‘to the source of life’ This week, the Calendar of the Church of Ireland commemorates Saint Muredach or Murtagh of Killala (12 August), Jeremy Taylor, bishop. Down and Connor and Dromore (13 August), Saint Fachtna or Fachanan of Ross (14 August) and Charles Inglis, missionary bishop in (16 August). But the calendar is strangely silent today, 15 August. Although the Church of Ireland commemorates the Virgin Mary on 25 March (the Annunciation), 31 May (the Visitation), and 8 September (her birth), the feast that recalls her death – the day on which most saints are commemorated – is missing from the calendar. This is in sharp contrast to the Calendar in Common Worship in the Church of England, and to calendars in other parts of the Anglican Communion. In the Eastern Church, the Dormition of the Theotokos commemorates the death, resurrection and glorification of Christ’s mother, and is celebrated annually on 15 August. Since the days of the Early Church, Christians have honoured the Virgin Mary, the Mother of God, with special solemnity on 15 August. From the sixth century on, that celebration has been explicitly associated with her death, as the end of her human life. The tradition of the Church simply maintains that the Virgin Mary died by the necessity of her mortal human nature. There are no biblical or historical sources to support the feast, and there is no known date when it was first celebrated, though it is presumed to have occurred for the first time between the first and fourth century. The earliest known celebration of the Dormition is between the first and fourth century, although there is no surviving documentation to prove this. The first real evidence that the feast was observed was in Jerusalem after the Council of Ephesus, in the year 431. From Patristic times, if not earlier, theologians have sought to interpret her Dormition, or ‘falling asleep’ in the Lord, in the light of the whole Paschal Mystery. In a well-known sermon (Hom. Dorm. John), Archbishop John of Thessaloniki (610-649) provides the earliest ‘official’ retelling by a bishop of the traditional narrative of the Virgin Mary’s entry into heavenly glory. This homily is an effort to encourage the adoption of the feast of the Dormition in Thessaloniki. John wishes also to present to his readers a story of the Virgin’s departure that is not corrupted by heretical traditions. The text’s agreements with sixth-century Greek and Syriac versions makes it an important witness to the Dormition tradition. John narrates the process of the Virgin Mary’s departure from the world over a three-day period in which the apostles and the palm branch play a key role. An angel comes to the Virgin Mary and tells her about her funeral and how the apostles will preserve her dignity and will carry out her final rites. The palm branch will be held by the apostles and it yields healing powers. On the Mount of Olives, the Virgin Mary has a discussion with the angel who tells her that he will take her to heaven. She becomes agitated and prays to the Lord, reminding him of his promise that he would be the one to take her to heaven. To garner support, she asks her ‘brothers and relatives’ to accompany her for the remaining days of her human life. She asks them to do so by lighting lamps. In addition, the Virgin Mary talks about the two angels that exist: one that claims the souls of the righteous and the other the wicked. The women with the Virgin Mary tell her that she does not need to be concerned that she will be taken by the wicked angel as she is the very definition of the virtue of abstinence. She tells the Apostle John, appointed by Christ to care for her, to look after her body as she is afraid of the people who despised Christ and that her body will be the victim of their anger. Even when she prepares for her final hours, she tells Saint John to donate her possessions to the remaining widows. She also instructs him to carry the palm branch while the other apostles bear her coffin. But Saint John says that all the apostles will carry the palm branch together as they are superior to him. Saint John tells the other apostles not to be sad but to rejoice in her greatness. Saint Peter explains the significance of the lamps they carry by saying that ‘this is the threefold lamp of the inner person, which is body, soul and spirit.’ Thus, the lamp represents the Virgin Mary’s life of virtue. Saint Peter continues his preaching until, with a clap of thunder, Christ makes his appearance along with the Archangel Michael. The two depart with the Virgin Mary’s soul and Christ tells Saint Peter to take care of her body. After Christ leaves, the people are told by Satan to attack the apostles and burn the Virgin Mary’s body, but the angels blind them. One of the chief priests manage to touch the bier and his hands are severed. After the priest repents and prays, his hands are restored. The palm branch is then used to cure the people of their blindness. The text ends with the Virgin Mary’s body being placed into the tomb that Christ had arranged for her. After three days, the apostles open the sarcophagus and find that the Virgin Mary’s body has vanished. Saint John of Damascus (676-749) later records the canon for this feast. The Virgin Mary has central importance in Christian faith and spirituality as the one in whom God’s Word has become human, and in whom the community of Christ’s disciples sees the first full realisation of its own share in the risen life of Christ. In the liturgical celebration of her Dormition, the teachers in the early Church offered a kind of icon of Christian hope for the transfiguration of our common humanity, both at the time of our own ‘falling asleep’ and at the end of history. In his encyclical marking the Feast of the Dormition this year [15 August 2018], Metropolitan Gerasimos of San Francisco writes: ‘We are accustomed to seeing and venerating icons of the Virgin Mary holding Jesus Christ.’ He refers to Saint Photios, who says in his Homily XVII, ‘The Virgin is holding the Creator in her arms as an infant.’ ‘As we contemplate and prepare for the Feast of the Dormition of the Theotokos,’ Metropolitan Gerasimos says ‘we are challenged by the converse.’ Today, ‘[i]n the icon of the Feast of the Dormition, the Creator holds the Virgin in His arms.’ Orthodox tradition holds that at her falling asleep, the Lord entered the room and received her soul from the Archangel Michael, while an angelic choir sang nearby. ‘The icon for the Feast presents our hope to pass through death and into eternal life with Christ,’ Metropolitan Gerasimos writes. ‘We can only sing praises to God when we encounter this miracle … The Dormition of the Theotokos is a reminder that we too will depart from this life “to the source of life.” We must also call to mind the words Saint Paul uses when instructing the Philippians about death: “For me, to live is Christ, and to die is gain”.’ The feast of the Blessed Virgin Mary is being celebrated in Lichfield Cathedral today with the Mid-Day Eucharist, at which the preacher is the Dean, the Very Revd Adrian Dorber, and at Solemn Evensong, when the setting is Stanford’s Evening Service in A and the anthem is Mother of God, here I stand by John Taverner.
<urn:uuid:762885cf-70e4-4b51-a352-d4dc5bac99ff>
CC-MAIN-2022-33
http://www.patrickcomerford.com/2018/08/the-dormition-is-reminder-that-we-too.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571246.56/warc/CC-MAIN-20220811073058-20220811103058-00274.warc.gz
en
0.957786
1,692
2.890625
3
Ford Motor Company has partnered with the Michigan Science Center (MiSci) to educate the community on the future of transportation, creating MiSci’s first AV exhibit. Built by Ford engineers and developers working closely with MiSci, the installation resembles a vehicle of the future that guests can engage with and explore inside to learn about AVs through interactive displays and a simulation. The exhibit shows how AVs operate and make decisions without a human driver, using data that is collected through 3D maps, cameras, sensors and lidar. It also includes an interactive lidar simulation to show how an autonomous vehicle sees the environment around it, such as pedestrians and other cars, as it drives. Users will even be able to take a photo of their experience to keep and share digitally. “A key part of Ford’s efforts to build a self-driving business across this country is educating people on how the vehicles operate autonomously, as well as the benefits they provide,” said John Rich, director of autonomous vehicle technology, Ford Autonomous Vehicles. “Through this interactive experience at the Michigan Science Center, our goal is to build trust in self-driving technology and inspire the next generation of engineers, scientists and mathematicians to pursue a career in transportation.” Ford is working closely with its self-driving technology partner Argo AI to test self-driving vehicles on public roads in Metro Detroit, including the Corktown neighborhood, among other US cities. Ford also plans to launch a self-driving commercial service in Austin, Miami and Washington DC to provide a mobility solution.
<urn:uuid:e01ebda0-96c9-4e48-b376-f2b70310a8fd>
CC-MAIN-2022-33
https://www.autonomousvehicleinternational.com/news/adas/ford-partners-with-michigan-science-center-for-interactive-av-experience.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00266.warc.gz
en
0.957583
325
2.53125
3
Arguably the most popular hard rock band of the '80s (and definitely one of the most tragedy-prone) was Def Leppard, fronted by singer Joe Elliot. Born in Sheffield, England, on August 1, 1959, Elliot became transfixed by such rockers as David Bowie, T. Rex, Queen, and Thin Lizzy as a teen. As an escape from Birmingham's tough, steel-town streets, Elliot would often fantasize about fronting his own band, one that he made billboards for even though it was purely fictional: Deaf Leopard. By the late '70s, he hooked up with the band Atomic Mass (who contained guitarist Pete Willis and bassist Rick Savage, among other members who came and went), taking the name of Elliot's imaginary band but changing the spelling to resemble one of their favorite bands, Led Zeppelin. Drummer Rick Allen and second guitarist Steve Clark were welcomed aboard shortly thereafter, as the band quickly built up a following with their heavy yet melodic rock, becoming part of the burgeoning New Wave of British Heavy Metal movement (which included Iron Maiden, Saxon, Motörhead, and Judas Priest). Getcha Rocks Off. Their major-label debut followed a year later, On Through the Night, while 1981 saw the release of their sophomore effort (and first to be produced by Mutt Lange), High N' Dry. Willis was replaced with Phil Collen for the band's third release, Pyromania, which saw the group sweeten their sound even more and indulge in a complete image makeover (especially Elliot, who barely resembled his old self in the video for the album's first single, "Photograph," sporting newly frosted hair and such hip '80s fashions as leg warmers and a union jack t-shirt). The album quickly rocketed up the charts and became 1983's most popular rock release, as Def Leppard became worldwide arena headliners. A long four-year layoff followed (in which drummer Rick Allen lost his arm in a car accident) before the release of the band's much-delayed fourth album, Hysteria, saw the light of day. But the album was worth the wait, as it somehow even outsold its mega-platinum predecessor, spawning a total of seven hit singles and videos. After releasing two classic rock releases back to back, the band took a break, but tragedy struck the band again in early 1991 when Clarke died after a long bout with alcoholism. The band regrouped with ex-Dio/Whitesnake guitarist Vivian Campbell and soldiered on throughout the rest of the decade with such albums as 1992's Adrenalize, 1996's Slang, and 1999's Euphoria, as well as the compilations Retro Active and Vault: Def Leppard's Greatest Hits. Elliot has appeared on other artist's recordings, including Mick Ronson's (his idol) 1994 release Heaven and Hull and Ron Wood's Slide on This, as well as singing "All the Young Dudes" alongside another idol, Ian Hunter, at the 1992 Freddie Mercury Tribute Concert at Wembley Stadium. Elliot also penned a pair of songs for the 1996 British motion picture When Saturday Comes (the title track and an instrumental ballad called "Jimmy's Theme"), and lent his vocal talents to a rendition of "Under My Wheels" for the Alice Cooper tribute disc Humanary Stew. In addition to his musical activities, in 1998 Elliot and Savage opened up an American-style restaurant/bar in Sheffield called the Players Café.
<urn:uuid:9c5ab689-608f-4295-8e2b-91072378a8d2>
CC-MAIN-2017-04
http://www.allmusic.com/artist/joe-elliott-mn0000512774/biography
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281353.56/warc/CC-MAIN-20170116095121-00068-ip-10-171-10-70.ec2.internal.warc.gz
en
0.965759
724
1.671875
2
While politicians argue about whether or not a Supreme Court justice should be appointed now or in 2017, very serious rulings are being handed down from a hung court. One such case is set to be looked at on March 2nd, and is the most important abortion rights cases to be seen by the Supreme Court in decades. The case going before the court is Whole Woman’s Health v. Hellerstedt and it seeks to outlaw Texas’ strict abortion laws which have shut down the majority of clinics in the state, making it all but impossible to safely terminate a pregnancy. The case is looking at whether or not Texas’ strict laws impede the ruling from Roe v. Wade which requires that no law place an “undue burden” on women seeking abortions. Of course states all over the nation have challenged this wording, forcing women to undergo invasive ultrasounds and even see their fetus before termination in a sick attempt to guilt women into not aborting. These states claim that their unnessesary regulation is put in place in the interest in the health of women seeking abortions, but in places like Texas, these restrictions increase women’s waiting time and force them to travel long distances to obtain a safe abortion. Texas’ regulations are particularly restricting as they target the clinics themselves, requiring that doctors at the clinics have specific admitting privileges at hospitals and forcing the clinics to undergo massive renovations which would make the clinics live up to hospital standards. Previous regulations in the state have reduced the number of clinics in Texas from 44 to 19. If the Supreme Court rules in favor of the law, or if there is a 4-4 tie, the restrictive laws will stand and reduce that number further to 9. ` As Vox points out in their extensive investigation and surveys, part of the problem is that the average American has been misled or under-educated about the details of abortion in America. In general, Americans believe that abortion is rarer, more dangerous, more complicated, and less well-regulated than it actually is. In actuality, most abortions are safer than a wisdom tooth removal, with many not requiring any sort of invasive or surgical methods. Americans are also generally unaware that the Supreme Court will be ruling on this important abortion rights case as they are usually pretty unaware of the goings-ons of the high court. This ruling is so very important. If the Supreme Court upholds Texas’ strict laws, it could set a precedent for the rest of the nation and we would begin to see the same restrictive rules placed upon abortion providers nationwide. As has been proven before, this will not reduce the number of abortions as pro-lifers would love to see. We would just see the death of more women as they go to whatever lengths necessary to obtain an abortion, whether it be in a doctor’s office or a back alley. The Supreme Court ruled in favor of Roe v. Wade so many years ago, and now it is time for them to defend it.
<urn:uuid:d945c077-21ed-4f0b-88e2-105bd8ebdd83>
CC-MAIN-2022-33
https://trofire.com/2016/03/01/samantha-bee-looks-at-what-is-at-stake-with-supreme-court-stalemate-abortion-in-texas/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00277.warc.gz
en
0.959568
603
1.921875
2
What is the procure-to-pay (P2P) process? The procure-to-pay (P2P) process, also sometimes referred to as purchase-to-pay, is a structured workflow that involves receiving goods or services and issuing payments. The procure-to-pay process is often automated in order to reduce risk and improve efficiency. Most often, procure-to-pay is managed with a low-code business process automation tool. Procure-to-pay is related to, but different from, the larger process of procurement, which includes sourcing goods and/or services, production planning, forecasting services, and negotiating terms. While this may vary based on company needs, the procure-to-pay process typically involves automated key features like: - Selecting goods and services from a catalog of approved suppliers. - Sending purchase requisitions. - Creating purchase orders. - Processing and reconciling invoices. - Submitted approved payments. Why is procure-to-pay important? Procurement managers know that a procure-to-pay process is a critical part of managing an organization’s spending and complex procurement workflows that involve myriad parties across departments. Procure-to-pay is important because it saves costs by reducing manual, laborious work, increasing accuracy, and improving efficiency and financial controls. A bonus benefit that the procure-to-pay process provides is enforcing compliance and order, which is essential for guaranteeing accuracy and maximizing contract values. Buyer’s Guide to Automation Platforms Download the guide Benefits of the procure-to-pay process Given the numerous parties and steps involved in the procurement process, there is significant room for automation to improve workflow efficiencies, lower costs, and build better relationships with suppliers. With procure-to-pay solutions, teams can: Approvals, requisitions, purchase orders, notifications, and payments are processes that follow basic and consistent rules. Automating this can reduce friction and improve efficiency to make the procurement process much leaner and minimize the propensity for error. In addition to making the procurement process more consistent, automation can reduce the costs associated with maintaining them. The more steps you can automate, the more man-hours can be reduced or assigned to more productive tasks. Gain total visibility into purchasing. By tracking each step of the process and centralizing data through stack extensibility, managers have a complete picture of historical and planned purchases and expenditures. Strengthen relationships with vendors and suppliers. By speeding up approval and payment processes, vendors receive purchase orders quickly and get paid on time. Everyone benefits from predictable, smooth processes. Negotiate with authority. Negotiations are about business leverage and access to information. Automation gives a business the flexibility to choose from a larger pool of vendors because managing those vendors is less of a burden. 7 steps in the procure-to-pay process While every business is unique, most companies will follow a common series of steps for their procure-to-pay process. Below is a detailed breakdown of the seven steps that make up the procure-to-pay process: Step 1: Create a purchase requisition. When an employee needs to purchase a good or service, they create a document called a purchase requisition and send it to a manager for approval. Depending on the purchase amount, the purchase requisition may require multiple approvals. Step 2: Select a vendor. After a manager approves a purchase requisition, employees must consult an approved-vendor list when deciding where they’ll purchase the item(s). This decision may involve factors such as industry, location, and price. Step 3: Create a purchase order. A procurement employee then creates a purchase order (PO) to send to the chosen vendor. Depending on the size and type of purchase, there may be multiple POs sent to multiple vendors. Step 4: Receive goods and services. After the vendor(s) receive the purchase order(s), they deliver the goods or services to the purchaser. Assuming there are no issues that the vendor must address, procurement managers approve the transaction and mark the purchase order as “‘fulfilled.” Step 5: Receive an invoice matching the purchase. The vendor issues an invoice to the purchaser that includes the amount owed and the due date. The invoice will specify the goods or services provided. Step 6: Reconcile and approve the invoice. In order to appropriately determine the status of the purchase, the vendor invoice must be reconciled with the original purchase order. When the purchaser and other managers formally indicate that they’ve received the product/service, the invoice can move on to the payment process. Step 7: Pay the vendor. Finally, the procurement department sends the approved invoice to the accounts payable team, who schedules the payment. Typically, this results in an outgoing payment via a check, ACH, or wire transfer to the vendor’s bank account. However, there may be different payment requirements, particularly for international transactions. Read Low-code Automation: Good for Business, Great for ITDownload report Common procure-to-pay challenges Like any business process, procure-to-pay processes can experience issues that keep them from operating smoothly. These issues can stem from challenges related to: - Adopting new technology. - Managing and efficiently implementing process integrations, changes, and optimizations. - Lacking an overall layer of governance and compliance control. Procure-to-pay solutions & best practices Using a solution like low-code BPA software to automate the procure-to-pay process will ensure that the steps are performed consistently, efficiently, and affordably. It also is a scalable solution that can enable the procurement department to manage large operations without having to increase staff to handle all the moving parts. Here are some best practices to keep in mind as you build and optimize your procure-to-pay process: Automate when and where you can. In traditional procurement workflows, the request and approvals steps usually are the most time-consuming and error-prone steps. Workflow automation software can help standardize request creation, define requirements that must be completed to ensure consistency and quality, quickly send and track active approvals, and designate rules about who needs to approve certain types of purchases. Centralize your procurement process to skip rework and improve efficiency. Further, business procurement management software helps to centralize all of the information about ongoing and historical procurement processes so that no one has to waste time scrounging through documents or emails to understand the state of a project. This also helps to ensure that information is not lost and steps are not forgotten. Gain control & visibility over your procure-to-pay process with Pipefy A well-designed and implemented procure-to-pay process can help to improve the efficiency and quality of the procurement process in a scalable manner — and Pipefy’s low-code automation platform can help do that. When you need to take control of your finance department and procure-to-pay process with the big picture in mind, Pipefy is the perfect partner. Pipefy improves workflows by adding automation that cuts repetitive, time-consuming tasks, and streamlines communication and connections between teams, departments, and processes. Pipefy’s platform centralizes operations by easily integrating with your favorite software to unlock a seamless, streamlined, accurate, and secure, procure-to-pay operation — all from a single platform.
<urn:uuid:58a0dc10-ea64-4ffd-9efe-1e4565f83982>
CC-MAIN-2022-33
https://www.pipefy.com/blog/procure-to-pay/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00677.warc.gz
en
0.920566
1,574
2.359375
2
Try our free symptom checker Get a thorough self-assessment before your visit to the doctor. What are enlarged lymph nodes in the neck? Lymph nodes are the glands in your body that contain the cells of the immune system. Enlarged lymph nodes occur when the nodes fill with inflammatory cells, usually as a response to a bacterial or viral infection. Swelling can be small—and not really noticeable—or they may be large enough for you to feel them. Symptoms you may also have: In rare cases, enlarged lymph nodes may be due to an autoimmune disease. Or the cause may be a mystery. Enlarged lymph nodes can also be a sign of cancer. But when it’s from cancer, the lymph nodes are usually not painful. Enlarged lymph nodes caused by infections go away on their own when the infection is gone or within a couple of weeks. To speed up the process, try applying a warm, wet compress to the affected area. If the cause is cancer, the enlarged bump will not go away on its own. See your doctor about any enlarged lymph node that does not go away in several weeks. Was this article helpful?
<urn:uuid:1646b66c-c5eb-4346-a122-63111d006577>
CC-MAIN-2022-33
https://www.buoyhealth.com/learn/enlarged-lymph-nodes-in-the-neck
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00670.warc.gz
en
0.939934
248
3.296875
3
Travel in major cities, as well as the major game parks is generally safe during daylight hours. However, serious crimes can and do occur, like armed robberies, home invasions and sexual assault. Vehicle hijackings happen across the country from time to time. Take particular care when approaching locked gateways at night. Don’t stop to give lifts to people at the roadside. Watch out for objects that have been placed to block the road. Be vigilant, keep all vehicle doors locked and windows closed when driving, and remain aware of your surroundings, especially after dark. Bag snatching, pick pocketing and theft from parked cars are common at some restaurants and internet cafes in downtown areas, particularly near bus and railway stations and in some shopping areas. Keep large amounts of money, expensive jewellery, cameras and phones out of sight. Don’t change large sums of money in busy public areas. Thieves have followed people after they have withdrawn money from banks and later robbed them at gunpoint. Security risks increase after dark, especially in tourist areas and city centres. In April 2016, a series of ‘ritual’ murders in some of the poorer neighborhoods of Lusaka resulted in riots and looting of mainly foreign-owned shops and businesses. Keep valuables and originals of important documents in a safe place and carry a copy of your passport and immigration permit. Use reputable banks, bureaux de change or ATMs to exchange money. A general election took place in August 2016. The presidential result was disputed by the main opposition party. Initial large-scale protests have now subsided; occasionally small gatherings of opposition supporters take place outside the main Courthouse compound in Lusaka. You should exercise caution, avoid any political rallies, demonstrations and monitor local media. There are also occasional student demonstrations, which can be violent, at the University of Zambia on the Great East Road (the main route to and from Lusaka International Airport), and around Copperbelt University. There are also occasional demonstrations in the central business district along Cairo Road. Don’t attempt to cross protester roadblocks as this commonly provokes a violent reaction from demonstrators. Monitor local and international media and keep up to date with this travel advice by subscribing to email alerts. Take care when travelling in rural parts of North Western, Copperbelt, Central and Luapula provinces close to the border with the Democratic Republic of Congo (DRC), particularly after dark. Using legitimate border crossings in these areas is generally safe, although Congolese officials may ask for payment to cross the border. Avoid travelling in the bush along this border for hunting or prospecting. There is a risk of explosive remnants of war in remote areas near the borders with Angola, Mozambique and DRC. Take care if you venture off road in these areas. Wild animals in the bush, including venomous snakes, are unpredictable and do kill. Whether you are travelling on land or water, you are at risk of potentially fatal animal attacks. Always observe local regulations and follow your tour or safari guide’s instructions. Adventure sports, including in the Victoria Falls area, carry risks. Serious accidents and deaths sometimes occur. The quality of medical care varies greatly. Follow safety instructions closely and make sure your insurance policy covers you. You can drive using a UK driving licence for up to 90 days. If you intend to stay longer you will need to get an International Driving Permit or a Zambian driving licence. Take care when driving. Vehicles are often poorly lit, inadequately maintained and badly driven. Drink driving and driving while talking on a mobile telephone is illegal. Road travel at night in rural areas can be hazardous. Abandoned vehicles, pedestrians and stray animals are a danger. Many roads are severely pot-holed or otherwise unsafe, especially during the rainy season (November-April) when bridges and roads risk being washed away by sudden floods. There are frequent fatal crashes. Don’t drive at night outside the main towns. Travel by long-distance public transport can be dangerous due to poor standards of driving, lack of rest periods for drivers, the poor quality of vehicles and poor road conditions. Minibuses used in urban areas are usually severely overcrowded, poorly maintained and badly driven. The Road Traffic and Safety Agency has recently started to more vigorously enforce an existing law to prosecute traffic offenders: drink driving; speeding; careless driving, etc through a fast track court system. Penalties include fines and/or imprisonment. The European Union lifted a ban on Zambian air carriers in June 2016. Previously Zambian airlines were refused permission to operate services to the EU because of the inability of Zambian civil aviation authorities to ensure the safe operation of airlines.
<urn:uuid:9f691359-0ebf-40a4-8bcb-5728af169bea>
CC-MAIN-2017-04
http://www.worldtravelguide.net/zambia/travel-advice
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280730.27/warc/CC-MAIN-20170116095120-00252-ip-10-171-10-70.ec2.internal.warc.gz
en
0.95185
967
2.046875
2
ARLINGTON, Va. (WNEW) — White lab coat. Thick goggles. Maybe geeky. Probably male. The stereotype of a scientist is fairly well set, but a young Arlingtonian is trying to shake that up. “I like to shake things up,” Yale student Olivia Pavko-Giaccia says. People passing by Pavko-Giaccia, who was bitten by the science bug while she was a student at the Potomac School in McLean, can’t help but comment on her multi-colored lab coat and bejeweled goggles. The 20-year-old CEO of LabCandy LLC, which launched a Kickstarter campaign this month, hopes to help every little girl picture herself as a scientist. Right now, an $80 LabCandy package includes the coat, the decorate-it-yourself goggles, a storybook, and hopefully a seed that will steer young girls to science. Pavko-Giaccia and a team of classmates at Yale are trying to reach girls in kindergarten through third grade, early enough so they don’t have time to form the stereotype. More From Maryland - Police Officer Pleads Guilty to Taking Upskirt Photos - 2 Troopers, Officer Struck on Road While Helping Driver - Md. Man Stabbed Wife, Relative, Tried to Kill Himself, Police Say - Crew Hurt When Laser Beam Is Pointed at Police Helicopter
<urn:uuid:c3f89d2a-c3ad-44cd-9e7a-bfcf24177064>
CC-MAIN-2017-04
http://washington.cbslocal.com/2014/08/21/arlington-native-hopes-to-break-scientist-stereotype-with-labcandy/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280242.65/warc/CC-MAIN-20170116095120-00082-ip-10-171-10-70.ec2.internal.warc.gz
en
0.930513
304
1.742188
2
Redoubt volcano is rumbling again. The volcano 100 miles Southwest of Anchorage produced several explosive events this spring, disrupting air travel and sending ash over the most populated areas of the state. Redoubt has been quiet since late July, but scientists say it may be waking up again. Annie Feidt, APRN – Anchorage Download Audio (MP3)
<urn:uuid:40e8f3b2-d7a1-4a45-b950-767d4733f7dd>
CC-MAIN-2017-04
http://www.alaskapublic.org/2009/12/28/redoubt-rumbling-again/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280763.38/warc/CC-MAIN-20170116095120-00520-ip-10-171-10-70.ec2.internal.warc.gz
en
0.945361
74
1.625
2
Updated: Nov 11, 2020 Happy Day! NaNoWriMo is upon us, fellow writers! For anyone not in the know, NaNoWriMo is the abbreviated name for National Novel Writing Month, also affectionately nicknamed NaNo. Taking place each November, NaNoWriMo is a free, voluntary challenge for all writers to put 50,000 words to paper in thirty days. Completing the challenge unlocks a number of prizes which are usually discounts to various writing software, masterclasses, and other NaNoWriMo paraphernalia. Yet if you ask anyone who has ever competed and completed the challenge, they will tell you the real reward is the sense of accomplishment and the 50,000-word rough draft you can add to your folio of work. The bragging rights don’t hurt either. Telling your family over the holidays that you wrote a 50,000-word novel in a month may blow their minds, although they may ask you about publishing—but that’s a whole different matter. I have taken part in NaNoWriMo for the past four years, making this year my fifth. My record is two completed challenges and two uncompleted. You might think that writing 50,000 words in 30 days is tough for a gainfully employed person, and you would be right. It breaks down to 1667 words a day, which—if you are typing at the average 40 words per minute—will take you about 42 minutes. That, of course, means you are constantly typing and not pausing to think about what you want to actually write and that you can actually type at that speed to begin with, which isn’t a given. The NaNoWriMo challenge does become more daunting as you consider it. Let’s say you have a concept you are quite excited about (I have been at least four times on record now). First week is easy—you find that hour each day to get your roughly 1667 words down and even get some extra words on the day. But maybe you are not writing at your top words per minute as you consider how to word sentences and structure dialogue and paragraphs. Maybe you hit stumbling blocks with creativity as you get beyond all the things you were really excited for and find yourself needing to find another 15,000 words to fill before you get to the exciting climax you’ve planned. Maybe you miss a couple days with work or family. Thanksgiving is right at the end of November and whether or not you carve out time to write along with your turkey can mean success or failure. The first day you miss means you need an additional 58 words. So what? That’s only two more minutes of writing, right? Two days is 119 more words per day and three days is 185 more words per day. Every missed day puts an ever-increasing burden on all your other days’ quotas, and that burden increases at an exponential rate. Now we see the true challenge of NaNoWriMo. Coming up with a story of 50,000 words is not terribly difficult. The undoing of many excited authors is consistency and time management, not the often vilified writer’s block. So, how do I intend to reclaim a winning record and complete my third NaNoWriMo challenge in five years? Well, I’m doing a few things differently this year, and I’m all too happy to share. “Plans are nothing, planning is everything” – Dwight D Eisenhower First thing is to decide what you are going to write. My first suggestion is to have a few concepts you think can work together and not just one. A young man from a farm who is descended from kings who gets a magic sword to slay the dark lord. That is one concept. You are going to need more than that in all likelihood, especially if you want someone to eventually read it, because we have all read that story a dozen times. You’re a writer; you’ve had plenty of creative ideas over the years. Pick three to start and see if there is enough going on with those to make you feel like you can tell a captivating story from start to finish. Second suggestion is to know if you are someone who needs an outline or someone who’s good with a couple mental notes and just discovery writes. Many successful authors will tell you to be one or the other, and that’s based on whichever one helped them become successful. A handful of authors will tell you the truth though: you already are one or the other or somewhere on that spectrum. Find out where you are on the spectrum and have the appropriate amount of notes and outlining ready to tackle an intense month of writing. Third suggestion, and one that is new to my approach this year, is get some advice on writing short novels. 50,000 words may seem like a lot but the shortest Harry Potter book is over 75,000. The Hunger Games is just under 100,000, and Twilight nearly 120,000. These are titles everyone knows. For a true perspective on how small 50,000 words is in the world of writing, let's check the average word counts for some fantasy series I enjoy. The Wheel of Time average is 294,003. A Song of Ice and Fire average is 354,000. The Stormlight Archive is 423,591. NaNoWriMo’s 50,000 words is short, and if you were gearing up to write a 100,000-word novel, you may find yourself at the end of the month and the end of your word count yet the middle of your story. This was an issue for me, so I found some advice online. I watched a video on writing short fiction, a guest lecture given by author Mary Robinette Kowal in one of Brandon Sanderson’s classes he teaches (and posts online). Sanderson is the opposite of short fiction, so the guest lecturer for such a topic was a solid decision, and I plan on implementing a few of her tips from the lecture. Time is what we want most, but what we use worst. – William Penn Scheduling is also part of preparation, but it truly deserves its own place. If anything can ruin our weekend, sidetrack our goals, or end a Dungeons and Dragons campaign, it’s scheduling conflicts. As I previously mentioned, being gainfully employed will take up a large part of your day. Most full-time employees can say goodbye to half of their waking hours on a day they work, and the majority of us do not have jobs where we can work on our novels on the clock. Outside of work, we have other demands on our time like friends and family. Friends are not as big of a factor for many in 2020 with most people’s social lives taking a huge nose dive. Yet plenty of us have family. A partner will require a good portion of your time even if they understand you are on a mission, and let’s not get started on kids. Schedule a time for writing and make sure everyone is on board (or asleep). Consistency is the other factor of time. As previously mentioned, every missed day puts a burden on what’s required for every other day. The NaNoWriMo site is lovely in that it has a word tracker to keep you on target, but you want to be ahead of target and not trying to play catch up with a 5,000-word day. Find an hour every day. If it’s a slower hour than other days and you don’t make the daily quota, that is okay. But put in the hour. Much like trying to start any good habit, consistency is what makes or breaks it. It takes more than thirty days to make a habit, but anyone who’s done something for half that long can tell you it starts to get easier. To be continued... There are my tips for myself and for you, fellow writers. These tips will not only serve you in NaNoWriMo but also in all your writing endeavors. Be prepared for what you are writing and take some pro-tips on how to write that style of story. Manage your time and stay committed. Perhaps they are a bit general, even obvious, but sometimes sound advice is just someone reminding us of something we already know but have forgotten. I’ve operated without it for past years, so I’m excited to see how this year goes. Check in for future posts on my NaNoWriMo progress, pitfalls, and maybe even some excerpts.
<urn:uuid:a9bbd3ab-19aa-4004-97fb-a43773057654>
CC-MAIN-2022-33
https://www.emergentrealms.com/post/2020-nanowrimo-challenge-week-1
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00269.warc.gz
en
0.96919
1,789
1.601563
2
In obstructive sleep apnea, the airway narrows or closes during sleep. This can lead to loud snoring and pauses in breathing. These pauses in breathing can occur hundreds of times a night in severe cases. Many people with OSA are not aware that they have a sleep disorder because they do not report daytime sleepiness or are not aware of snoring or pauses in breathing during sleep. Many times it is a family member or bed partner that notices these symptoms. The frequent interruptions of restorative sleep caused by OSA can result in unrestful sleep, excessive daytime sleepiness and, in some cases, early-morning headaches. Left untreated, OSA may lead to serious medical problems. These include heart attack, high blood pressure, and stroke. Children with OSA, on the other hand, may become hyperactive, rather than sleepy, during the day. This can cause problems with their performance at school. Like people with obstructive sleep apnea, those with central sleep apnea may also sleep poorly, and be sleepy during the day. The symptoms below can indicate many sleep disorders. If you experience one or more of these symptoms, discuss your sleeping problems or concerns with your healthcare provider: - Excessive sleepiness or fatigue during the day - Difficulty sleeping, including trouble falling asleep, waking frequently during the night, waking too early and not being able to fall back asleep, or waking unrefreshed - Loud snoring - Pauses in breathing or gasping for breath during sleep, as reported by others - Difficulty concentrating or memory problems - Irritability or depression - Morning headaches - Hypertension, or high blood pressure
<urn:uuid:d69497ce-25c1-4780-9fc7-93d6e8a8ea78>
CC-MAIN-2017-04
https://www.nationaljewish.org/conditions/obstructive-sleep-apnea-osa/symptoms
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560284411.66/warc/CC-MAIN-20170116095124-00464-ip-10-171-10-70.ec2.internal.warc.gz
en
0.954794
343
3.28125
3
Masterpieces and Uncommon Commons XLI This lot is closed for bidding. Bidding ended on 6/21/2012 “It’s great to be young and a Giant.” If the great John McGraw could have concocted a witch’s potion to create the model infielder for his Giants, he could never have dreamed of a second baseman better than “Laughing Larry” Doyle. Doyle broke in with the Giants in 1907 and McGraw immediately recognized his potential. The young Caseyville, Illinois native became the roommate of Christy Mathewson at McGraw’s suggestion so the youngster could learn how to be a big leaguer both on and off the diamond. Doyle responded with his first .300 season in 1908, a season that saw him named Giants team captain, while placing third in the National League batting race. Doyle’s greatest single season was without question, 1912. The Giant great hit a career high .330 and won the Chalmers Award as the NL MVP. That same season, the second sacker paced the league in hits with 189 and doubles with 40. Not known as a power hitter, amassing only 74 career roundtrippers, Doyle will always be remembered as the first hitter to ever hit a ball out of the cavernous Polo Grounds, accomplishing the feat in 1913. Playing on three consecutive pennant winners from 1911-1913, Doyle was considered the NL’s premier second baseman during the first half of the decade of the teens. Always a threat on the bases, Doyle served as a table-setter for his Giant teammates, stealing 300 bases in his career. After baseball, Doyle contracted tuberculosis in 1942 and was admitted to the Trudeau Sanitorium in Saranac Lake, New York. When the institution was forced to close its doors thanks to medical breakthroughs to cure TB, Doyle was the last resident to leave the facility. Life Magazine photographers documented the former Giant’s last meal and his departure, on foot, from Trudeau. He never left Saranac Lake and called the village his home until his death in 1974 at the age of 87. The Drum example of this amazing player’s T206 from baseball’s formative early years is a treasure not to be denied. A true 1 of 1, the probability of another Drum backed Doyle is virtually non-existent. So make this treasure your own. And remember the man who will forever be “young and a Giant” to the world. POP REPORT: Only graded example. 1 of 1. Some content courtesy of Charlotte Observer Click on a thumbnail above to display a larger image below Hold down the mouse button and slide side to side to see more thumbnails(if available). Click above for larger image.
<urn:uuid:31594fbb-9ca8-4868-ab9a-97be7364ada2>
CC-MAIN-2017-04
http://www.goodwinandco.com/LotDetail.aspx?lotid=23579
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280872.69/warc/CC-MAIN-20170116095120-00312-ip-10-171-10-70.ec2.internal.warc.gz
en
0.960966
580
2.09375
2
Scuba diving in Kai Sei 113 Wreck The wreck of Kei Sei 113 is situated on the west of the island of Mauritius. The average depth of the site is 35m/114ft with maximum at 40m/131ft. When to go Diving can be practiced all year round but the best season is during the summer (from November to April), when the water temperature reaches 29C/84F. What to see Former barge Kei Sei 113 sunk in 1988 to form an artificial reef and is now partially covered with corals. A lot of interesting species of fish can be met at this location including lionfish, lobsters, blue-striped snappers, big eyes, moray eels, devil fire fish, groupers, and many others. Reachable fromFlic en Flac Liveaboards with trips to Kai Sei 113 Wreck Reviews about Kai Sei 113 Wreck Do you have an insight or story on this dive site? Tell everyone about it.
<urn:uuid:6df021d8-6cc6-436b-9f57-ac4831c601e1>
CC-MAIN-2017-04
https://divebooker.com/kai-sei-113-wreck-baz10996
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281226.52/warc/CC-MAIN-20170116095121-00379-ip-10-171-10-70.ec2.internal.warc.gz
en
0.925024
216
1.757813
2
First Time Home Buyers face many challenges in today's Real Estate Market. An experienced First Time Home Buyer Specialist can help them navigate the turbulence they may encounter and make owning your first home a pleasurable experience. ARCHIVED BLOG POSTS Fannie Mae and Freddie Mac have published the Home Valuation Code of Conduct (HVCC). It is scheduled to go into effect on April 1, 2009 but lenders are requiring the information now. Much of the Code relates to appraisers and how appraisals are ordered, but the MCA (Market Conditions Addendum) wi...
<urn:uuid:fe4092e8-0368-4167-a7e6-b0d2b256933f>
CC-MAIN-2017-04
http://activerain.com/blogs/loanwizard/archives/2009/01
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279915.8/warc/CC-MAIN-20170116095119-00278-ip-10-171-10-70.ec2.internal.warc.gz
en
0.902847
120
1.585938
2
Advocates to gather for historic Reparations Summit SCORES OF reparations advocates, Pan-Africanists and social justice activists from the United States, Canada, Latin America and the Caribbean will gather in New York City this week (April 9-12) for an historic Reparations Summit which will see the formal launch of the National African-American Reparations Commission (NAARC). Among the participants will be leaders of national reparations commissions, committees and task forces from 11 Caribbean Community (CARICOM) countries, led by Sir Hilary Beckles, chairman of the Caribbean Community's Reparations Commission and including Jamaica's Professor Verene Shepherd. Both will deliver feature addresses at the three-day summit to be held across three of New York City's five boroughs - Manhattan, Brooklyn and Queens. Other keynote speakers include civil rights leader, Reverend Jesse Jackson, and Mireille Fanon, chair of the UN Working Group of Experts on Peoples of African Descent and daughter of Frantz Fanon, the Black liberation theoretician from Martinique. purpose of the Summit The purpose of the Summit is to advance discussion and debate around reparations issues and provide a platform for advocates from around the world to support and reinforce each other's campaigns. It is being hosted by the recently established NAARC, comprising some of the leading scholars, activists, attorneys and historians in Black America and follows closely on the establishment of a European Reparations Commission. CARICOM has been credited with re-energising the global reparations movement following the unanimous decision by its leaders to demand reparations from former European colonial and slave-trading powers. CARICOM's 10-point programme for 'reparitory justice' is framed as a development strategy to use reparations payments to deal collectively with economic and educational challenges facing the Caribbean. Jamaica has been the most forthright among Caribbean nations in demanding reparations when Parliament voted unanimously in January of this year to seek payment from Great Britain and to take the case of genocide to the International Court of Justice.
<urn:uuid:8d05bd07-4640-4439-9c60-9431284b2d02>
CC-MAIN-2022-33
https://jamaica-gleaner.com/article/news/20150408/advocates-gather-historic-reparations-summit
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570765.6/warc/CC-MAIN-20220808031623-20220808061623-00272.warc.gz
en
0.94045
415
2.21875
2
WELwash2 is a specialist acidic formulation which quickly and effectively removes oxidation and rust from a wide range of metals including iron, cast Iron, copper, tin, aluminium, steel and stainless steel. Best used in an ultrasonic cleaner. The solution is also ideal for removing oxides resulting from soldering or welding, cleaning rusty or corroded tools, cleaning engine parts including carburettors, valves, heat exchangers as well as metals that have been in storage. As well as removing oxides it safely removes contaminants including general soiling, carbon and grease. It is totally biodegradable and phosphate free. The solution is diluted at a rate of 1 part concentrate to 10 parts of water. Designed for industrial professional use and hobbyist use Supplied in 1 litre, 5 litres and 25 litres. Dilute 1 part concentrate with 10 parts water. |Supplied in||1 Litres / 5 Litres / 25 Litres| |Makes a total of||11 Litres / 55 Litres /275 Litres|
<urn:uuid:ae91aa90-3518-4e37-bfd5-44665d35f5ea>
CC-MAIN-2022-33
https://walkerelectronics.co.uk/shop/cleaning-solutions/horological/welwash2-oxide-remover/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571911.5/warc/CC-MAIN-20220813081639-20220813111639-00471.warc.gz
en
0.904754
233
1.539063
2
Talā aims to simplify the communication process and ease the workload of school administrator by bringing all the stakeholders – the school, the teachers, and the parents on a single platform. The school will be able to provide real-time updates regarding the child’s daily academic performance, attendance, grades including results in written tests and performance tasks accessible through mobile phones with mobile data or WiFi. By condensing all of these aspects down into an easy-to-use school mobile app, not only is the communication process with parents simplified, but substantial evidence shows that parent involvement benefits students, including raising their academic achievement. Gascloud Electronic Direct Mailer is a cloud-based email campaign software designed to solve the challenges of digital communication in behalf of the growing companies and organizations. It is an efficient and cost-effective solution in reaching-out to your customers, building brand awareness, and increase product sales, as well as fostering trust and loyalty – whether you’re just starting out, or if your brand is already established.
<urn:uuid:0ae37af6-ebc7-47d5-ae19-bc8a785d80f1>
CC-MAIN-2022-33
https://gascloud.tech/index.php
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.37/warc/CC-MAIN-20220809003642-20220809033642-00677.warc.gz
en
0.946038
208
1.625
2
Restrictions on Motorized Vehicle Recreation in the Harold Price and Blunt Creek Areas, Cassiar Forest District Through 1996 and early 1997, staff of the Bulkley/Cassiar Forest District assisted in carrying out a public process where recreational users met and developed a Recreational Access Management Plan (“RAMP”). That plan provided input for a Land and Resource Management Plan being developed by the Bulkley Valley Community Resources Board. The district manager has authority under the Act to make orders to restrict public recreational uses. However, the various recreational user groups wanted consensus based decision-making. The district manager agreed, stating early in the planning process that any such orders would be based on consensus among the user groups. Winter recreational users reached agreement on most of the eighteen “winter use areas” identified. Unfortunately historical and on-going conflict between two recreational user groups — backcountry skiers and snowmobile users — led to three highly contentious areas being designated as “unresolved”. Those areas, with high recreational use and on-going conflicts between user groups, were left in limbo. There was no negotiated resolution. The district manager refused to impose resolution.
<urn:uuid:b3c4cce6-2724-45ec-9544-244d924ac26a>
CC-MAIN-2022-33
https://www.bcfpb.ca/reports-publications/reports/restrictions-on-motorized-vehicle-recreation-in-the-harold-price-and-blunt-creek-areas-cassiar-forest-district/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571284.54/warc/CC-MAIN-20220811103305-20220811133305-00478.warc.gz
en
0.952615
238
2.296875
2
Charles de Gaulle, the magisterial president of France from 1959-69, was inordinately fond of the phrase, “Moi ou le chaos” — “Me or chaos.” It was not much of a choice. The same might be said of the imperious message the ruling Liberal Democratic Party has been sending out to the Japanese people in the lead up to August 30th’s House of Representatives election: Us or chaos. Campaigning 10 days ago, Prime Minister Taro Aso cut the hot air with his index finger, and said: “The Liberal Democratic Party is conservative, and this means that we defend.” By using “defend” as an intransitive verb, i.e. without an object, he left open the question of what, exactly, his party is defending. Foremost, presumably, would be the LDP’s right to rule Japan for another 54 years — the span of time over which, with one short hiatus, it has held power. In fact, LDP politicians and the tens of thousands of government bureaucrats who are their ideological cohorts have, for more than five decades, represented not so much Japan as a Japanese ruling class. The year the LDP was created, 1955, is considered the last year of sengo fukkoki — the period of postwar reconstruction. By 1956, national income had recovered to its 1940 level, and the populace gave over its allegiance to the party that promised rapid economic growth and the rebuilding of the nation’s pride. With this election, Japan is again, as it was in 1955, at the crossroads. The election buzzword of 2009 is undoubtedly seiken kotai (change of government). But the reality is more far-reaching. This election may, if the opposition Democratic Party of Japan takes power — either by itself or in coalition — change the course not only of government but of the values and beliefs of the citizenry at large. The postwar consensus, “defended” since 1955 by the LDP, has outlived its usefulness. Actually, it had outlived it by the middle of the 1990s, when many citizens came to the realization that constant growth for its own sake was a vacuous goal. But it has taken nearly 15 years since then for them to latch onto something that might take its place. I have been observing Japanese elections for nearly 40 years, and one thing unequivocally stands out about this one: It has been the most issue-oriented of them all. This is an election of stark choices. But to return to the national consensus that formed in 1955. It was all about people being willing to sacrifice individual needs of self and family for the good of the company, the group, the nation. People identified with the achievements of Japan Inc., and took personal pride and joy from them. The three most admired people in Japan in the late 20th century were, arguably, Akio Morita, cofounder and president of Sony Corporation; Konosuke Matsushita, founder of Panasonic; and Soichiro Honda, founder of Honda Motor Co. Those three men made their mark as inventive, hands-on managers, not as high-flying merchant bankers or stock-market speculators. They and their firms were models of social achievement, and they afforded Japanese a healthy outlet for their pride, much wounded, by their own vicious hand, due to war. However, the near-20 years of economic stagnation in Japan triggered by the collapse of its asset bubble in the early 1990s led Japanese people to question the validity of this model of pride. Who now was worthy of looking up to and modeling oneself on? By the mid-’90s, Japanese began asking themselves the big questions on TV talk shows, in letters to newspapers and in many other public forums. How to reorient our politics, they agonized, so that our personal needs and those of our families are met in terms of health care, education and welfare? And they added another question not publicly aired until then: Shouldn’t we be looking after the needs of the disadvantaged, including those of the disabled and minorities neglected during the years of rapid growth? This background concern has finally matured into a political stance set to topple the party that had taken scant notice of it. What are the real issues that have reopened the polemic and driven this election? As I see it, there are three that dominate. First, the issue of social welfare and which party is best suited to cater to the real needs of the elderly, working people (many of whom have been stripped of their “lifetime employment”) and the young people about to launch themselves into a much less secure social environment than their parents experienced. Yukio Hatoyama, leader of the DPJ and the man who appears most likely to be Japan’s next prime minister, has hammered away at the LDP during the campaign, lambasting it for having spent more time, energy and money protecting vested interests — particularly the bureaucracy’s — than on looking after the jobs and pensions of ordinary citizens. (The pension scandal of 2007, in which details of an estimated 50 million files were lost or misplaced, was symbolic of the government’s slipshod attitude toward people’s welfare.) The slogan of the DPJ is, “The Lives of the People Come First.” Second, the issue of who will formulate policy in the coming decades. The power of bureaucrats to decide social policy in every sphere of life went virtually unquestioned during the long reign of the LDP. In very many cases this power even continued beyond retirement from the bureaucracy, as high-ranking functionaries parachuted effortlessly down into high-paying jobs in the private or public sector. One of the pillars of the DPJ platform is to dismantle this system known as amakudari (descent from on high). Of course, whether in power the DPJ will manage to pull this off is another matter. After the collapse of the Soviet Union, the Russians dismantled their own elite bureaucracy, the nomenklatura, only to have it reinstated and lavishly refurbished by Vladimir Putin during his presidency from 1999 to 2008. It is easy to see how a disgruntled Japanese nomenklatura could sabotage a reformist government by feeding it disinformation while retaining its symbiotic tie with the LDP. The third major issue concerns foreign relations. No one is suggesting that a DPJ government would toss the intimate Japan-U.S. diplomatic and defense relationship to the prevailing winds in Asia. But a realignment of many foreign ties, particularly those with China and the Koreas, can be expected. There may well be at last, too, a genuine coming-to-terms by Japan with its heinous record of invasion and colonization between 1910, when Japan annexed Korea, and its 1945 defeat in World War II. How far the rightwing, arch-patriotic fringe will go to foment chaos and derail this realignment, even employing violent means, is a big unknown that may come to plague a new, progressive government. The turning point may be Aug. 30, 2009, but its lead-up has been going on for more than 10 years now. How a new, non-LDP government might fare will depend on how mature Japan’s democracy has become since 1945 — and how deeply committed its people are to it.
<urn:uuid:ca6ee84c-e7dc-4026-977d-0b1437d387d1>
CC-MAIN-2017-04
http://www.japantimes.co.jp/opinion/2009/08/30/opinion/japan-at-a-crossroads-of-government-and-of-its-citizens-values/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281450.93/warc/CC-MAIN-20170116095121-00179-ip-10-171-10-70.ec2.internal.warc.gz
en
0.974177
1,539
2.046875
2
Giovan Battista Ruoppolo (1629–1693), Born and lived his life in Napes Italy. Ruoppolo was a Neapolitan painter from the Baroque era, notable for painting still-lifes. He was a disciple of Paolo Porpora (1617–1673), a contemporary of Salvatore Rosa. What are you looking for? Forgot your password? Subscribe to our newsletter Lost your password? Please enter your email address. You will receive mail with link to set new password. Back to login
<urn:uuid:3ad125c0-d2cd-4981-880c-3e5fd0249c9a>
CC-MAIN-2022-33
https://cedricdupontantiques.com/maker/giovan-battista-ruoppolo/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00070.warc.gz
en
0.944956
117
1.992188
2
Oregon State University’s College of Forestry is considering 3 management plans for the Elliott State Forest (ESF). Here’s how OSU’s preferred alternative for the ESF (“scenario B”) falls short: - Allows cutting of significant amounts of older timber (up to 160 years). - Consists largely of clearcuts and cuts taking 80% of the trees* – for the next 150 years. - Includes extensive thinning of mature stands (removing 50% of trees). - Includes clearcutting all thinned and retention (80%-cut) stands at 90 years of age. - Includes extensive thinning (2000+ acres) of old-growth stands for the first 20 years. - Perpetuates fragmentation of the forest by largely following the historic pattern of intensive land management. Note: * These cuts are referred to in the report as “Extensive Retention”, with “residual density (RD) 20”, which means all but 20% of the trees will be cut. The bigger trees will be cut, leaving smaller trees and releasing most of the stored carbon. OSU has an enormous opportunity and responsibility with regard to the Elliott. Rather than follow the traditional approach to timber management, they could make it into a world-class research forest. But this will only happen with substantial changes in their approach. How to Get Involved: If you’re already up to speed on OSU’s involvement with the Elliott State Forest (ESF) planning process and want to take action, here’s what you can do (for more background info., read the rest of this post): Submit comments to the Land Board and DSL using the contact form on the DSL website: https://www.oregon.gov/DSL/Pages/Comment.aspx Tell the Land Board to reject any OSU management plan that includes cutting stands of mature timber (over 100 years old). Ask them to prioritize carbon sequestration and ecological resources over timber production. Remind them that the Elliott belongs to ALL Oregonians, and should be managed for the common good (not to maximize revenue for the Common School Fund). Tell them both DSL and OSU need to be much more forthcoming and transparent in their efforts (many of the technical documents were only recently made available and are particularly difficult to interpret – more on this below). Email OSU’s leaders to express your views about OSU’s approach to the Elliott: - Dean of the College of Forestry: email@example.com - President Ed Ray: firstname.lastname@example.org - Board of Trustees: email@example.com OSU’s preferred management option (“Scenario B”) for the ESF would involve substantial harvests of mature timber (cutting lots of trees between 100 and 160 years of age). Tell the Dean to stop promoting harvests of mature forest under the guise of “forest research”. The 80% cuts and substantial thins (50%) they are promoting are NOT justified from a research basis! OSU’s team should be broadened to include OSU’s experts in carbon sequestration, and forest/stream/ wildlife ecology. These values should be prioritized far above timber production. What is the Elliott State Forest?: Oregon’s Elliott State Forest lies in Coos and Douglas counties, in the Coast Range between Reedsport and Coos Bay. Roughly half of the forest is considered “old growth”, providing critical habitat for marbeled murrelets, northern spotted owls, and various species of salmon. Due to previous logging and forest fires, the Elliott is a mixture of two broad age classes: trees 60 years and younger, and those aged 100 to 180 years. The majority of the timber value is in the older stands (which is why OSU’s preferred plan targets them for harvest). The substantial amount of mature forest makes the Elliott one of Oregon’s largest, old-growth ecosystems and most important sources of carbon storage. Drafting a management plan for the ESF is complicated because mature timber stands (and the threatened species they are home to) are spread widely across the Forest. Nearly 1/4 of all wild Oregon Coast Coho salmon originate in the Elliott’s watersheds. Marbeled murrelets and northern spotted owls have been detected throughout the ESF: Recent History of the ESF: The Elliott State Forest became a subject of controversy and public scrutiny when the Oregon State Land Board (comprised of the Governor, Secretary of State, and the State Treasurer), adopted a new management plan in 2011. The plan aimed to significantly increase revenue generation for Oregon’s Common School Fund (CSF) by increasing clearcutting of the forest. The Plan also included increased protections for threatened and endangered species. Litigation and declining revenue from 2013 onward prompted the Land Board to take the unprecedented (and many would contend illegal) step of preparing to sell the Elliott State Forest at their February, 2017 meeting. The planned sale of a publicly-owned State Forest to a private company (Lone Rock Timber Management, a Roseburg company with international investors, and the Cow Creek Band of Umpqua Tribe of Indians) – prompted an enormous public outcry. In response to outrage over the planned liquidation of the Elliott, the Land Board reversed its decision to sell the Elliott State Forest at its May, 2017 meeting. In December 2018, the State Land Board directed the Oregon Department of State Lands (DSL) to work collaboratively with Oregon State University to develop a plan for transforming the Elliott State Forest into a research forest. The DSL Elliott website (https://www.oregon.gov/dsl/land/pages/elliott.aspx) states: “A successful plan will be consistent with the Land Board vision for the forest, which includes: - Keeping the forest publicly owned with public access - Decoupling the forest from the Common School Fund, compensating the school fund for the forest and releasing the forest from its obligation to generate revenue for schools - Continuing habitat conservation planning to protect species and allow for harvest - Providing for multiple forest benefits, including recreation, education, and working forest research” Critics of the Land Board’s approach to the Elliott State Forest point to unrealistic expectations in their directive – especially the need to compensate the Common School Fund (CSF) through timber harvests. If the ESF could not provide adequate funding for the CSF in the past (while balancing protections for endangered and threatened species), why should we expect it to do significantly better under OSU’s management? The extra expenses associated with research and increased protections will almost certainly lower the overall revenue. How does the Land Board justify the continued focus on timber production, when climate change and the immense value of the forest for storing carbon isn’t even listed in their vision for the forest? Until our leaders recognize that we need a more holistic definition of “Greatest Permanent Value” of our natural resources, our future survival on this planet will be in jeopardy. Note that the Oregon Administrative Rules (OAR) do not even mention climate change or carbon sequestration in the definition of “Greatest Permanent Value” of our forests: https://oregon.public.law/rules/oar_629-035-0020 OSU’s Involvement with the Elliott: In December 2018, the Oregon State Land Board (comprised of the Governor, Secretary of State, and Treasurer) directed the Oregon Department of State Lands (DSL) to work collaboratively with Oregon State University to develop a plan for transforming the (~82,000-acre) Elliott State Forest (ESF) into a “research forest”. What the Land Board did not know at the time was that OSU’s College of Forestry was not the trusted leader in forestry education they assumed it was. They did not know OSU had been planning (for roughly a year and a half) to cut a cherished parcel of 200-400-year-old trees, in violation of their own management plan (that they’d abandoned a decade earlier). They did not realize that OSU’s cutting of old growth (in May of 2019) would result in national news coverage and disgrace for the College of Forestry. Even now, I doubt the Land Board understands the extent of OSU’s mismanagement of the Research Forests. You can read more about the history of these problems here: Some may wonder what the Elliott has to do with OSU’s old growth. With roughly half of the ESF comprised of old-growth forest, and OSU now developing the management (= timber harvest) plan, the fate of the older forests may very well end up in OSU’s hands. While OSU may not own the land outright, their management plan for the Elliott will almost certainly guide the harvests. The long history of problems with OSU’s management of their existing research forests is grounds for concern regarding their plans for the Elliott. Past performance is the best indication of what to expect in the future. At the same time, the ESF represents an opportunity for experts within the College to establish a truly innovative research forest. If OSU ends up managing the Elliott, it would more than quintuple the size of their research forests. Unfortunately, OSU’s current approach with the Elliott seems to be focused more on timber production under the cloak of research. Land Board Meeting: The December 10th, 2019, meeting of the Oregon Land Board in Salem was a key milestone in developing a management plan for the ESF. Governor Brown, Secretary of State Clarno, and Treasurer Read met with the Elliott Advisory Committee, Department of State Lands (DSL) staff, OSU, tribal, and various other representatives. Unfortunately, the Governor restructured the meeting on the fly, squeezing public comments in at the end. She left before the end of the meeting, missing all of the public testimony. Most of the meeting was taken up by predictable formalities and the various representatives expressing their appreciation for each other’s efforts – while the public waited patiently to voice their concerns. This disconnect between the process “insiders” and the public at large characterized the meeting. While OSU’s interim dean, Anthony Davis, quoted Aldo Leopold and spoke of climate change and sustainability, many shook their heads in disgust. One veteran observer reflected, “It was kabuki theater, until the peasants revolted!”. When the public was finally allowed to speak (for a scant 2 minutes each), those in charge got an earful. Two icons of Northwest forestry, Dr. Jerry Franklin and OSU Professor Emeritus Dr. Norm Johnson presented a 3-page letter stressing the need to protect older, natural forests in the ESF. They wrote, “There is no ecological or environmental rationale for harvesting the older, natural forests on the ESF…Harvest of naturally regenerated forests that are greater than 100 years of age has essentially ceased on public lands in the Pacific Northwest…The strong opposition that inevitably occurs whenever such harvests are proposed makes clear that there is no longer social license for such logging… Attempts to justify harvest of these forests on the ESF in the name of science will be viewed as academic license at best or yet another attempt by foresters to cut older forests despite social opposition. We expect that such an attempt will be incredibly divisive – within the University and College as well as within Oregon society at large — and the conflict will ultimately make implementation of such a research plan infeasible.” You can read the full text of the letter here: When these venerable experts of forestry and academia testify with strongly-worded concerns, we should all take note. Their letter (addressed to the OSU President, Dean and DSL Director) speaks squarely against OSU’s preferred plan for managing the Elliott – an alternative which involves cutting lots of older stands. In my brief speech, I pointed out how difficult it is for the average citizen to understand OSU’s proposal to turn the Elliott into a “research forest”. The DSL website has more than 500 pages of meeting minutes and materials (riddled with undefined acronyms and jargon), plus an extensive folder of technical documents. With so much information to process, it really gets down to trust. Why should we trust OSU to manage the ESF, or even develop the plan? The best way to understand how OSU might manage the Elliott is to look at how they’ve (mis-)managed their own research forests. I provided a long list of transgressions – from the recent cutting of old growth, to the decade-long abandonment of their research forest plans (not just for the McDonald-Dunn, but also the Blodgett), egregious violations of their plan (including the destruction of significant amounts of northern spotted owl habitat), and the 2006 Biscuit Fire publication controversy (https://en.wikipedia.org/wiki/Biscuit_Fire_publication_controversy). I argued there is already an extensive record to judge OSU’s management of “research forests” – and the record is not good. In all, about 30 members of the public spoke, representing a diverse group of interests. The vast majority expressed concerns about OSU managing the Elliott. Many asked the Land Board to prioritize carbon sequestration over timber production. Several spoke for the trees and animals. Some were harshly critical of the process and notion that DSL and the Land Board have the right to determine how the Elliott should be managed. Decoding OSU’s Plan for the Elliott: Outside experts who’ve studied the Elliott issue point to fundamental inconsistencies in OSU’s stated approach: they cannot fund the Common School Fund and their expansive program of research without cutting significant amounts of older timber – which reduces carbon sequestration and protections for threatened species. The exact amount of older timber OSU proposes to cut is buried in the technical reports. Decoding the information is a formidable task. You can find the technical reports and meeting minutes by clicking on the individual meeting summaries on the DSL Elliott webpage: https://www.oregon.gov/dsl/land/pages/elliott.aspx At the Dec. 10th meeting of the Land Board, interim dean Anthony Davis presented the following map of the Elliott: The divide between conservation and management “research watersheds” is important to note. Roughly 2/3 of the forest falls into the category of “management research”, with ~1/3 in “conservation research”. While the “conservation” section will be largely protected, the “management” section will undergo extensive management (= cutting). According to Davis, OSU’s preferred plan for the forest allocates 58% of the land for conservation, 26% to extensive, multiple-values management, and 16% to more intensive management. What he doesn’t explain is that this allocation includes substantial harvests of 100 to 160 year old trees, increasing fragmentation of the mature forest. This is illustrated by the following graph: The units along the bottom of the graph are “Age Class” (in 10-year multiples), with the section in red extending from 100 to 180 years. The vertical units of the graph are acres of “treatment” (cutting, or thinning), with each line equal to 1000 acres. The blue bars show areas of “extensive treatment”, which consists of either cuts of 80% of the trees, or thinning (cutting) 50% of the trees. The yellow bars show mature forest reserves that would not be cut (though some thinning would occur for the first 20 years). You can find all of these details in the report prepared by OSU’s consultant, US Forest Capital: https://www.oregon.gov/dsl/Land/Documents/OCT_ESRFAC_combined_1024-252019.pdf ): It is fundamentally disappointing that OSU’s consultant proposed three relatively traditional approaches to managing the ESF. The worst scenario (C) would rely on “intensive treatments” (clearcutting) throughout the Elliott to cut as much timber as legally possible. The “least worst” scenario (A) would still cut trees up to 100 years of age, and rely on clearcuts and severe thinning for the next century and a half. OSU’s preferred alternative, “Scenario B”, would cut a substantial amount of older trees (100 to 160 years of age). By failing to provide any options based on the principles of ecological forestry, both OSU and their consultant have framed the choices firmly within the bounds of traditional forestry management. By providing three poor choices and choosing the middle one, it is as if they were trying to say, “Hey, it could have been worse – we chose the one in the middle!”. The blue bars in the above graph (“Intensive Regen”) represent clearcut acres. The green bars (“Extensive Retention”) indicate cuts taking 80% of the trees. The bars with green slashes (“Extensive Thin”) and blue slashes (“Intensive Thin”) show acreage cut (thinned) by 50%. These severe cuts seem designed to produce timber, not support research. I reached out to Tom Tuchmann at US Forest Capital, the lead author of the (Oct. 25th) management plan for the ESF, to ask some questions about his report. The report is full of undefined acronyms and technical jargon, making it difficult to interpret. I wanted to make sure the details I’ve included in this blog piece are accurate. He initially agreed to talk on the phone, but later rescinded his offer after talking to the folks at OSU. The Interim Dean and his staff have been largely unresponsive to my inquiries, so his suggestion that I contact them was not very helpful. Another veteran observer of the Elliott process ran into similar problems some weeks ago. His detailed questions sent to the OSU team leader many weeks ago have yet to be answered. Next Steps: At the end of the recent meeting, the Land Board decided to have DSL and the Elliott Advisory Committee continue working with OSU to refine a management plan for the ESF. You can read DSL’s press release about this here: https://www.oregon.gov/dsl/News/Documents/ElliottStateResearchForestExplorationContinues_12.10.19.pdf The ESF represents a one-of-a-kind opportunity to implement and test principles of ecological forestry management, as well as study and protect threatened species and carbon sequestration. We will continue to monitor OSU’s role in the Elliott, advocating for positive change. Our hope is that the new Dean of the College of Forestry, Dr. Thomas DeLuca, will change the College’s direction (and their involvement in the Elliott) in a positive way. OSU could turn the Elliott into a world-class research forest – but it won’t happen without substantial changes in their approach.
<urn:uuid:cf889e93-8f04-44bb-a2be-b12f806ce6ba>
CC-MAIN-2022-33
https://friendsofosuoldgrowth.org/2019/12/13/the-osu-elliott-problem/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570651.49/warc/CC-MAIN-20220807150925-20220807180925-00466.warc.gz
en
0.943154
4,037
1.828125
2
Geneva, 30 April 2009. The 53rd and final replacement magnet for CERN's1 Large Hadron Collider (LHC) was lowered into the accelerator's tunnel today, marking the end of repair work above ground following the incident in September last year that brought LHC operations to a halt. Underground, the magnets are being interconnected, and new systems installed to prevent similar incidents happening again. The LHC is scheduled to restart in the autumn, and to run continuously until sufficient data have been accumulated for the LHC experiments to announce their first results. "This is an important milestone in the repair process," said CERN's Director for Accelerators and Technology, Steve Myers. "It gets us close to where we were before the incident, and allows us to concentrate our efforts on installing the systems that will ensure a similar incident won't happen again." The final magnet, a quadrupole designed to focus the beam, was lowered this afternoon and has started its journey to Sector 3-4, scene of the September incident. With all the magnets now underground, work in the tunnel will focus on connecting the magnets together and installing new safety systems, while on the surface, teams will shift their attention to replenishing the LHC's supply of spare magnets. In total 53 magnets were removed from Sector 3-4. Sixteen that sustained minimal damage were refurbished and put back into the tunnel. The remaining 37 were replaced by spares and will themselves be refurbished to provide spares for the future. "Now we will split our team into two parts," explained Lucio Rossi, Deputy head of CERN's Technology Department. "The main group will carry out interconnection work in the tunnel while a second will rebuild our stock of spare magnets." The LHC repair process can be divided into three parts. Firstly, the repair itself, which is nearing completion with the installation of the last magnet today. Secondly, systems are being installed to monitor the LHC closely and ensure that similar incidents to that of last September cannot happen again. This work will continue into the summer. Finally, extra pressure relief valves are being installed to release helium in a safe and controlled manner should there be leaks inside the LHC's cryostat at any time in the machine's projected 15-20 year operational lifetime. CERN, the European Organization for Nuclear Research, is the world's leading laboratory for particle physics. It has its headquarters in Geneva. At present, its Member States are Austria, Belgium, Bulgaria, the Czech Republic, Denmark, Finland, France, Germany, Greece, Hungary, Italy, the Netherlands, Norway, Poland, Portugal, Slovakia, Spain, Sweden, Switzerland and the United Kingdom. Romania is a candidate for accession. Israel is an Associate Member in the pre-stage to Membership. India, Japan, the Russian Federation, the United States of America, Turkey, the European Commission and UNESCO have Observer status.
<urn:uuid:db4c6d6e-908a-4515-956e-fbd3d325bb04>
CC-MAIN-2016-44
http://press.cern/press-releases/2009/04/final-lhc-magnet-goes-underground
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988718278.43/warc/CC-MAIN-20161020183838-00240-ip-10-171-6-4.ec2.internal.warc.gz
en
0.960464
592
2.28125
2
Used to measure the amount of oil in the oil pan If your BMW's dipstick has broken we recommend replacing it. This component is used for accurate measurement of the oil level in the oil sump, without it you have no way to check the level properly. In addition a broken handle or damaged seals can cause a vacuum leak which can cause performance problems. Fits These Cars: - 1991 BMW 525i Engine Oil Dipstick - 1992 BMW 525i Engine Oil Dipstick - 1993 BMW 525i Engine Oil Dipstick - 1994 BMW 525i Engine Oil Dipstick - 1995 BMW 525i Engine Oil Dipstick BMW Oil Dipstick - Genuine BMW 11431720875 - Genuine BMW - SKU #: - Engine Oil Dipstick - OE Numbers: - FCP ID: - Guaranteed to Fit, Guaranteed for Life We guarantee the fit and quality of our parts for life. If it doesn’t meet your expectations send it back for a replacement or refund. Learn more - Fitment Verified This product application guide has been tested to ensure it will accurately fit the cars outlined in our fitment guide. - Shop With Confidence We respect your privacy; we always keep your information confidential. - What If I Need to Return This Item? Not a problem! If you are not happy with your purchase, we will gladly help you exchange or return your items, provided you follow the guidelines outlined in our Returns Policy.
<urn:uuid:bf246f79-06d2-4f23-ab23-150067cba998>
CC-MAIN-2017-04
https://www.fcpeuro.com/products/bmw-dipstick-11431720875
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280730.27/warc/CC-MAIN-20170116095120-00252-ip-10-171-10-70.ec2.internal.warc.gz
en
0.853906
308
1.59375
2
2018-07-26 06:32:08 BdST Find out the coal culprits Prime Minister Sheikh Hasina has ordered forming a fresh committee to further investigate the disappearance of some 1.45 lakh tonnes of coal from Barapukuria coalmine and identify those responsible for it. An initial probe by the Petrobangla, the coalmine's parent company, has already found negligence of some key officials. Last week, it removed four top officials from their posts. The 525MW Barapukuria coal-fired power plant was shut down on Sunday due to coal crisis, in a direct fallout of the coal going missing from its yard. The current market price of the coal is around Tk 230 crore. In the wake of the crisis, the Petrobangla had formed a committee, which submitted its report yesterday afternoon. Later in the evening, the PM sat with Nasrul Hamid, state minister for power, energy and mineral resources, and some top officials of Petrobangla, to discuss the findings. At the meeting, Hasina asked them to form a fresh committee, including officials of the Prime Minister's Office and the energy ministry, Nasrul said. “Some names have already surfaced but we will dig deeper. There may be a case of corruption here, but right now we cannot say this for sure. However, it has been confirmed that there has been negligence of duties," he said. "The problem began in 2005. It seems all officials were involved in the process," he added. Meanwhile, the coalmine's Manager (administration) Anisur Rahman filed a case with Parbatipur Model Police Station against 19 officials on Tuesday night. According to the case statement, a small volume of coal was explored from the mine during the roadway development of the coalmine before 2005. Some of it was sold, while the rest was stockpiled. Since September 10, 2005, the Barapukuria Coal Mine Company began commercial exploration and maintained the stock record by adding the previous stock with the freshly extracted coal. The development of the mine began in 2001. Between 2001 and July 19 this year, some 1,01,66,042.33 tonnes were explored. Of that, about 66,87,029 tonnes were supplied to the power plant while 33,19,280.37 tonnes were sold to various private companies. Another 12,088.27 tonnes were used at the mine's boiler (for internal use such as for air conditioners, heating system etc). On July 19 this year, there should have been a stock of 1,47,644 tonnes, but there were only 3,000 tonnes, said the case statement. This means, there was a deficit of 1,44,644 tonnes worth about Tk 230 crore, it added. It appears that some of the accused in the case may have long been involved in the theft of the coal in connivance with the previous managements, the case statement reads. A copy of the case was sent to the Anti-Corruption Commission yesterday. The ACC has already opened a separate inquiry. A three-member ACC team visited the mine on Monday. The 19 accused are: Abu Taher Md Nuruzzaman Chowdhury, general manager (suspended), Khaledul Islam, deputy general manager (suspended), Habib Uddin Ahmed, former managing director, (withdrawn and now made OSD) Abul Kashem Prodhania, former general manager (administration) and company's secretary (stand released), Mosharaf Hossain, former general manager (exploration), Masudur Rahman Hawladar, manager (general services), Ashok Kumar Haldar, manager (production management), Arifur Rahman manager (maintenance and operation), Zahidul Islam, manager (design, construction and maintenance), Ekramul Haque, deputy manager (safety management), Muhammad Khalilur Rahman, deputy manager (coal handling and management), Morsheduzzaman, deputy manager (maintenance and operation), Habibur Rahman, deputy manager (production management), Zahidur Rahman, deputy manager (mine development), Sattyendra Nath Barman, assistant manager (ventilation management), Syed Imam Hasan, manager (security), Jobaer Ali, deputy general manager (mine planning operation), Abdul Mannan Patwari, former general manager (finance) and Gopal Chandra Saha, acting general manager (finance). Unauthorized use or reproduction of The Finance Today content for commercial purposes is strictly prohibited.
<urn:uuid:52e52400-b0c6-43d1-94ee-a4b0887d17df>
CC-MAIN-2022-33
https://thefinancetoday.net/article/spot-light/3176/Find-out-the-coal-culprits
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572198.93/warc/CC-MAIN-20220815175725-20220815205725-00274.warc.gz
en
0.95942
956
1.640625
2
How many times have you listened to a speaker just to forget what they said a few minutes later? Learning is critical to our development. We should take advantage of the possibilities to hear from professionals that are available to us. If you can’t recall what they say afterward, it’s time to work on your note-taking skills. Taking notes is a skill that requires practice and discipline. It’s not easy to sort through a deluge of information and decide what’s vital to write down and what’s not. This collection of 17 note-taking tips will come in handy in any class, meeting, or presentation: 1. Determine important content Taking notes should never be a verbatim transcript of everything stated, but rather a summary of key points and questions. You’ll want to recall names and dates in particular if you’re taking a history lesson. If a coworker is giving SEO training, you should pay special attention to terminology and best practices. Prepare ahead of time for any presentation, meeting, or class by anticipating the type of knowledge that will be critical to recall later. 2. Eliminate distractions Do you recall when your instructor asked you to switch off your phone in class? It’s possible that’s still a decent concept. Anything that unnecessarily diverts your attention during presentations should be eliminated as a source of distraction. Close any irrelevant applications or resources if you’re taking notes on a digital device. If you know Hank from accounting will be talking to you a lot, you might want to sit next to someone else. The goal is to retain your entire concentration on the topic material and take notes. 3. Keep calm If you’re apprehensive about taking notes, you’ll almost certainly make mistakes. Recognize that your notes will almost certainly not be great every time, but you can always seek assistance and clarity later. Because taking notes is tough, be aware of your errors and work to correct them. 4. Go digital Make use of a mobile app, an internet tool, or software. Note-taking programs for your laptop, iPad or phone are available. They allow you to quickly take notes and add items like photographs, links, checklists, and places. If you subsequently find that your handwriting is difficult to read, typing your notes will help. If you find yourself frantically erasing notes because you didn’t organize them properly, knowing how to copy-paste or hit control-Z can save you a lot of time. 5. Start sketching A picture is said to be worth a thousand words. Many individuals comprehend topics better when they are presented in a visual format. Make some sketches to go around the notes you’re writing. It can instantly refresh your memory about what you were thinking and make going over your notes more enjoyable. Just be careful not to get carried away and overlook essential details. You’ll still want to include a lot of actual words in your pictures. 6. Make something visual Take your notes and graphically organize them. Even if drawing isn’t your thing, you can still make your notes more interesting. To add some originality to your notes, use a program like Microsoft Publisher. As you make your flyer, imagine that it will be used to teach someone else. This strategy pushes you to spend more time with the content and can assist you in organizing it in a more logical manner. 7. Mapping method The mapping method of note-taking is based on diagramming your notes. It looks like a flowchart or a spider’s web between topics and subtopics. It’s a nice way to visually organize your notes that may be interconnected. 8. Cornell note taking method The Cornell method is an excellent way to organize your notes into sections that are easy to review To make three boxes, draw a line a couple of inches from the bottom and another a couple of inches from the left side. You can utilize the largest part to take notes in whatever way you like. The smaller left part is for quick reminders of what you should study later. Write a summary of what you learned in the bottom section. 9. Outline method The outline method turns your notes into easily digestible bullet points. Write them like you’re outlining a story. You’ll have main points from individual topics or subjects, then write bullet points underneath each one with the supporting information. 10. Charting method You’ll create a table with categories to fill up using the charting method.This is ideal for organizing material that will be organized in a specific order. If you’re studying about different types of animals, for example, you can establish columns for where each animal lives, what it eats, and how long it lives on average. Each row would have a different animal, and you would just answer each question by going across your columns. 11. Sentence method Make a basic sentence structure out of the key points from the lesson. To keep things organized, use headings and break your sentences into their own lines. This is very useful for jotting down statements or statistics. 12. Record it If you’re concerned about missing essential facts or want to improve your listening skills, you should record the presentation or class. Use the recording feature on your phone or purchase software that automatically transcribes what’s being said. Because transcription software has technical limits, you may need to keep a close eye on it to catch any errors. 13. Ask for clarification If you don’t comprehend your notes while writing them, they’re almost useless. Make sure to ask any questions you may have to the teacher or presenter. Someone else will most likely be grateful that you inquired about the identical issue that they were perplexed about. Take courage and work hard to grasp the principles the first time so you don’t become even more perplexed later. 14. Summarize afterwards Write out a summary of the main ideas after a lesson, presentation, or meeting. This is critical for remembering the subject information and determining if you have any unanswered queries. Good summaries should include not just the main themes, but also add applications to the topic material, research questions, and a to-do list. 15. Continue the discussion When you’ve finished listening and taking notes, turn to a close person and share what you’ve learned with them. You might inquire about what stood out to them or what modifications they would like to make based on the information provided. You can ask questions regarding items you didn’t understand or for which you didn’t get a clear explanation. Continuing the conversation with someone else is a great method to apply what you’ve learned and cement it in your mind. If you have a meaningful discussion about it, the information is much more likely to be remembered. 16. Review your notes If you don’t reread your notes afterward, what you remember from the first time you took them will swiftly go. Hopefully, you’ve used one of the ways listed above to make your notes easy to read and even entertaining. The most essential thing is that you review your notes afterward so that you can recall what you learned and reflect on the issues raised. 17. Share what you learned Even better than going over your notes by yourself is going over them with someone else. This allows you to share what you’ve learned with others. Use a flyer maker to show off what you’ve learned in a unique way. Doing so will assist you to realize what you didn’t comprehend or what you need to review more thoroughly. Your review partner may even ask you insightful questions to consider and apply to your notes. Don’t be scared to combine some of these note-taking techniques. You might find that an outline structure is helpful for organizing some of your notes, but that you need to build a chart for another. The important thing is to be organized and do what makes sense for you. Even though the individual next to you is plainly using the Cornell technique to organize their notes, you could prefer a different approach. Taking notes is something you should do for yourself, so do it in the method that works best for you. Now is your chance to put what you’ve learned into practice. Taking notes is only useful if you can use them afterward. If you learn anything new, think of ways to put it to use at work or at home. To uncover new uses, go over your notes frequently. Make a difference in your life or the lives of others by applying what you’ve learned. - Oxford Learning: How to Take Study Notes: 5 Effective Note Taking Methods 2. GoodNotes: The Best Note-Taking Methods 3. Classroom: How to Take Notes Using the Charting Method 4. LucidPress: Flyer Maker
<urn:uuid:06fa377a-4782-4bb4-9e9e-282ca3d74448>
CC-MAIN-2022-33
https://pakoption.org/note-taking-techniques-that-will-change-how-you-retain-information/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571210.98/warc/CC-MAIN-20220810191850-20220810221850-00474.warc.gz
en
0.925539
1,895
2.96875
3
30 Hours Childcare All three and four-year-olds living in the UK, regardless of family income or residency status, will continue to be entitled to a FREE nursery / early education place for 15 hours a week. In addition, the new entitlement which came into effect September 2017, is an 'extension' of the current 15 hour entitlement, providing an additional free 15 hours a week for 38 weeks of the year (term-time only) for children that meet the eligibility criteria. It is only the extra 15 hours that has eligibility criteria. 1. To check if you are eligible for 30 hours, please visit www.childcarechoices.gov.uk. Once you receive your code you will need to validate it by creating an account on the parent and young person's portal. You can view the full criteria and find out about the entire 30 hour process below. Already have your code? Validate your code- Log in / Create an account
<urn:uuid:49f860c1-a9aa-47d8-9b9d-f7cb9eb3ab91>
CC-MAIN-2022-33
https://synergyweb.ealing.gov.uk/Synergy/30HourHomepage.aspx
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00067.warc.gz
en
0.923599
196
1.53125
2
The second wave of Covid hit India this April with a ferocity that led to a surge in infections and overstretched hospital infrastructure. In a matter of days, India turned into the second most affected country, triggering a wave of panic, despondency and high body counts. ‘Our nation is at war,’ as former army chief, Gen. V.P. Malik, described it in an April 18 tweet as the daily death toll surged past 1,300. In the days that followed, the armed forces were brought in to plug the gaps in medical care and speed up delivery of medical infrastructure. The army has so far set up eight field hospitals with over 5,000 beds in some of the worst affected cities, including the national capital Delhi. It plans to roll out at least six more such field hospitals. Indian Navy warships have brought back ISO containers, oxygen cylinders and concentrators from the GCC (Gulf Cooperation Council) countries and Singapore. The IAF’s transport fleet, including C-17 heavy-lift aircraft that can carry nearly 70 tonnes of cargo, have flown over 400 sorties within the country and abroad, airlifting 5,669 metric tonnes of oxygen containers. (ISO containers are refillable, weigh 3.6 tonnes and can store over 21,000 litres of liquid medical oxygen or the equivalent of two tanker loads.) The defence ministry’s research wing, the DRDO (Defence Research and Development Organisation), is installing 849 medical oxygen plants in hospitals across the country by July 31. It is also teaming up with pharma major Dr Reddy’s to roll out a drug which could hasten the recovery of Covid-19 patients and cut down oxygen dependency. “This has been declared a war,” Lt Gen. Madhuri Kanitkar, deputy chief of defence staff (medical) and deputy chairman of the Covid-19 crisis committee, told India Today TV on May 3. “In this war with the virus, doctors, healthcare workers, all of us are soldiers.” As the pandemic devastated the world last year, some of the worst-affected countries turned towards their armed forces, repurposing their skills and equipment to confront a once-in-a-century pandemic. The military is a repository of skilled personnel with the logistic networks and platforms to speedily move large loads. It has a large medical corps which is trained to set up field hospitals completely staffed with doctors and medical assistants in a matter of hours. The US, the country worst hit, has deployed over 60,000 defence personnel, including 4,400 doctors, nurses and medical personnel, to fight the pandemic (mostly from the National Guard, a reservist formation under its Department of Defense). In France, the military has bolstered civilian response in three areas—healthcare, logistics and protection. Turkey has used the military to set up field hospitals. The UK defence ministry confirmed this January that their armed forces’ response to Covid-19 was the biggest ever homeland military operation in peacetime with more than 5,000 personnel involved. None of these countries, however, live with the kind of live security threats on their borders faced by the Indian armed forces. Last May, just two months after India went into a nationwide lockdown, the Chinese PLA (People’s Liberation Army) mobilised two divisions along the Line of Actual Control (LAC), leading to a nine-month standoff punctuated by a violent clash on June 15 in Galwan Valley, the first such incident along the Chinese border in 45 years. The PLA and the Indian Army mutually disengaged from areas north and south of the Pangong Lake on February 10, areas where troops, tanks and artillery were within sight of each other. A smaller number of PLA soldiers, however, continue to remain at the Gogra Post and Hot Springs, two areas north of Pangong Tso. In the past few months, the PLA has rapidly built up infrastructure and bases along the LAC in Xinjiang and Tibet, demonstrating their intention to permanently base troops close to the undemarcated boundary. Last year, the armed forces participated with gusto in mobilising resources, aircraft, manpower and field hospitals to combat the first wave of Covid. In the first week of May, there were much publicised flypasts by military helicopters showering petals on hospital staffers and health workers in Indian cities. This time around, with additional troops strung along the LAC and the PLA having sown the seeds of mistrust, there is considerably less enthusiasm to deploy additional resources in the fight against Covid. “The vision at the highest level (of government) is for us to do everything that is possible (in the fight against Covid)while maintaining operational preparedness,” a senior army official told INDIA TODAY. The army says it is stretched thin by the need to be ready for any eventuality on its two-and-a-half fronts—the Line of Control (LoC) with Pakistan and the LAC with China and counter-insurgency commitments in Jammu and Kashmir and the Northeast. These commitments will impact the deployment of the most crucial life-saving assets a military can rapidly roll out—field hospitals. These 45-bed medical facilities with an operation theatre can be set up virtually overnight. Each has a team of 10 doctors and 150 staff and usually provides secondary care to troops wounded in conflict. A field hospital performs life-saving surgeries and treatments on them before sending them to a tertiary care centre. These facilities are also set up in remote areas where there is no possibility of speedy medical attention for soldiers. Each infantry division—around 12,000 soldiers—has two field hospitals and the army has around 100 such temporary hospitals. The deployment of two additional infantry divisions in the Ladakh theatre since last year has meant additional field hospitals have had to be set up in areas where no medical facilities exist. This is the anticipated ‘battle-surge’ which military medicos warn against disturbing because it is a capability which cannot be built overnight. The Army Medical Corps, which provides medical service to serving and retired military personnel, is around 70,000 strong. This includes some 10,000 doctors, 750 dental surgeons, 7,000 nurses and 40,000 paramedics, medical assistants and battlefield nursing assistants. Military-medical experts warn against overexploiting these resources and being dragged into extended ‘aid to civil authority’ commitments. “Sometimes you cannot tap the army beyond a certain level, especially when you have an exploitable situation like China on your borders. Our hospital strength is to cater for war, not for peace time,” says Lt Gen. (Dr) Velu Nair, former director general military services (DGMS), army. On May 3, Delhi deputy chief minister Manish Sisodia had requested defence minister Rajnath Singh for the army’s assistance in creating ‘10,000 oxygenated non-ICU beds and 1,000 ICU beds along with oxygen supply’. The military heaved a sigh of relief when the Centre told the Delhi High Court on May 6 that it could not ask the army to set up more field hospitals in the national capital. Military hospitals are already dealing with a surge in cases of families of serving personnel and veterans and have little spare capacity. To bridge the acute shortage of trained medical staff, the defence ministry has stepped in to add over 600 armed forces medical services doctors into service. It is also rehiring 400 recently retired doctors on 11-month tenures and extending the term of 238 short service commissioned doctors until year-end. Retired armed forces doctors are also on the eSanjeevani portal, a health ministry telemedicine platform, for online consultation. WEAPON OF FIRST RESORT Military analysts urge caution, stressing that the armed forces are a weapon of last resort, not the state’s tool of first recourse and say it should be used only as an interim measure. “Governments need not be criticised for employing the military’s multiple organisational skills as early responders as a stopgap measure until administrative gaps are suitably overcome,” says Lt Gen. Syed Ata Hasnain, ex-military secretary and now member, National Disaster Management Agency (NDMA). “To marshal national resources on a war footing, the government should have activated the emergency laws such as the NDMA Act, Civil Defence Act, the Union War book, Defence of India Act, Epidemic Diseases Act etc. that authorises the mustering of not just doctors, paramedics and civil defence volunteers but also transportation, buildings and other essential services and facilities. They would have also placed restrictions on the general public in the national interest. Sadly, these were not drawn upon in a crisis of this scale,” says Col. D.P.K. Pillay (retired), research fellow at the Manohar Parrikar Institute for Defence Studies and Analyses (MP-IDSA). This is possibly an outcome of there being no pandemic planning within the government. The NDMA was set up after the 2004 tsunami to coordinate efforts to deal with a single incident like a flood, cyclone or gas leakage—and not for events such as a pandemic. The National Health Policy of 2017 does not even mention the possibility of an epidemic. Experts say the military could be used more effectively in creating mechanisms to tackle future waves of the pandemic or other such cataclysmic events which call for multiple arms of the government to coordinate relief and response. Such a framework could create policy guidelines for integrating ministries like home, PMO, surface transport and civil aviation to coordinate strategies for everything, including moving people and relief material across the country. The once-in-a-century crisis could become an opportunity for building structures to tackle other such nationwide health emergencies without excessively relying on the armed forces. Read India Today magazine by downloading the latest issue: https://www.indiatoday.com/emag
<urn:uuid:4082a1ac-eb3c-4248-91b9-2d1a5fb68bdf>
CC-MAIN-2022-33
https://www.indiatoday.in/magazine/cover-story/story/20210524-the-strained-forces-the-indian-army-steps-up-in-the-fight-against-the-virus-but-guarding-a-hostile-border-might-limit-what-they-can-do-1802458-2021-05-14
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00673.warc.gz
en
0.959267
2,067
2.015625
2
Barring a few exceptions India has a chronic trade deficit with most of its existing FTA partners as it is with most of its proposed FTA partners, says M R Venkatesh. In a way it is stunning, why even unprecedented. In a News Release dated 26th March 2013, the Gujarat Co-operative Milk Marketing Federation Limited – popularly known by its brand name Amul - requested Commerce Minister to be “careful while negotiating in the interest of farmers of India” and “strongly opposed to provide any kind of advantage in import duty on dairy products.” Why should one of India’s most competitive, efficient and professional organization be mistrustful of the government, warn it to be careful and oppose its moves? The answer to this question dates back to 2007 when India and EU launched negotiations for a bilateral trade agreement. Since then several rounds of negotiations have taken place covering various aspects of trade and commerce. These negotiations are expected to be concluded soon – possibly as early as next week. Though the negotiating texts are secret, broad contours of information available raise significant concerns. That explains our paranoia in the first place. Let us not forget that for past year or two, experts have been pointing to the debilitating impact of India’s trade deficits. This has been on a rising trend since 2003-04 and stands at a phenomenal $190 billion in 2011-12. This is approximately 11 % of the GDP and implies a growth rate of 56 percent over the previous year. The trade deficit for 2012-13 is no better. The 2012-13 Economic Survey indicates a trade deficit of $167 billion for 2012-13 (April-January) indicating an increase of 8 percent as compared to the corresponding ten month period of 2011-12. According to projections for 2013-14 made by the Commerce Ministry in its Report on “Strategy For Doubling Exports in Next Three Years: 2011-12 to 2013-14”, India will see a trade deficit of $282 billion under a “business-as-usual” scenario which is expected to be 11.5% of our GDP. India’s current account deficit, which nets income from services against such trade deficit, is also rising continuously. Compared to $2.66 billion in 2000-01, it now stands at $78 billion in 2011-12. The current account deficit for 2012-13 is estimated to be in excess of 5 percent of the GDP. This emerging scenario has belied the assumption held in higher echelons of the Indian government that we are an emerging super power in services. In my humble opinion we are not. While that may by itself be a matter of intense debate, the fact remains that service exports are unable to keep pace with our trade deficits. This makes the government desperate. Consequently, it is constrained to allow volatile and capital flows of doubtful origin to fund current account deficit. Beggars cannot be choosers. Can they? This has added to the financial fragility of the nation and is reflected in rupee exchange rate volatility. The only way out of the conundrum is to increase exports and simultaneously bring down our imports as a share of our GDP. Elementary economics suggest that to do either we need to improve our competitiveness. Sadly the government is missing this fundamental point. And that is the crux of the issue. India’s Flawed FTA Policy India’s FTA policy seems to be oblivious of this fundamental fact. Barring a few exceptions India has a chronic trade deficit with most of its existing FTA partners as it is with most of its proposed FTA partners. With the EU, the story is no different. India has a consistent trade deficit over several years with EU. If UPA government foolishly proceeds and consummates the India-EU FTA, the trade deficit will go up significantly in agricultural, commodity and industrial segments with possibly some gains in some usual suspects like textiles, jewelry and leather. Once the FTA becomes operational, experts opine that the EU could flood the Indian market with dairy products, poultry, farm and fisheries, some of which are of strategic importance for India. This will directly compromise India’s agricultural sovereignty and its food security. It may be pertinent to note that as the WTO negotiations hit a road block we seemed to undertake the FTA route to our trade nirvana. However, experience of the past decade suggests that the plethora of FTAs are not reversing this deficit but in effect aggravating the situation. Needless to emphasize our FTA policy should be revisited. But does FTA with developed countries make any economic sense? Let us examine. The developed countries already have low tariffs in most products. To that extent FTA for India makes little or no sense. And if India can sign one, so can other countries and thereby negate the advantage. Now let us examine the matter in greater detail. The average applied tariffs in EU range between 1.4 to 13.9 percent in agricultural products and 0.5 to 4 percent in industrial products. In comparison, India’s average applied tariffs, even after significant reductions, are 31.4 and 9.8 percent in agricultural and non agricultural products respectively. In short, the possibility of a gain just from tariff reduction is huge for the partner but very limited for India. Yet the UPA seems to be insisting on an FTA with EU. But there is another dimension to this argument. These FTAs are increasingly getting into areas of intellectual property rights commitments, government procurement, and competition policy. Interestingly, these contentious issues have stalled Doha Round of negotiations for years within the WTO. In short, wherever WTO fails, the route seems to be FTAs. What is forgotten in the melee is that such agreements threaten policy instruments of various developing countries. This in turn erodes our sovereignty. In contrast to this possibility, the EU is well protected from such external interventions. Let us not forget that even though the EU has low tariffs, it provides very high domestic subsidies to its agricultural producers which work both as a protective barrier in its domestic market, as well as a competitiveness enhancing instrument for its exporters. Our negotiators fail to understand that these subsidies are trade distorting, affect international prices and thus reduce competitiveness of our producers. Indian exports also face high non-tariff barriers (NTBs) like sanitary and phyto-sanitary [read hygiene] standards as well as technical barriers in EU, making exports to EU extremely difficult. Given the tariff and NTB structures between the two partners, the EU obviously has much more to gain in terms of tariff reduction while India’s gains lie in sorting out the NTBs and in the removal of EU subsidies – a fact lost on our negotiators. However, EU negotiators have repeatedly argued that the issues of NTBs [being multilateral] are not to be discussed under any bilateral agreement. Consequently, they opine that these can be negotiated only at the WTO level. Interestingly, India opposes such policies at a multilateral level! In case of manufactured products the story is no different. We will continue to be handicapped by market access into the EU – not through the tariff barriers but because of NTBs which we are incapable of even comprehending much less negotiating at a bilateral level with EU. Of course, there could be some gains, but these will be marginal. Crucially, the loss outweighs the gains. Since infrastructure in India including that of marketing, storage and transportation are weak, entrepreneurs feel their competitors in the developed countries have huge advantage in terms of basic facilities. In addition they get significant support from the government. Unless this is set right, it is futile to talk of FTA. And precisely to mask this failure the UPA is embarking on such adventures There is another yet another critical point that remains unanswered. As India contemplates legislating the Food Security Act, experts point to the lack of farm production to meet its target. In such a scenario, where is the question of exporting? In the alternative is the success of this legislation depending on benevolence of Europeans to export subsidized farm products into India? Either way, a disaster waiting to explode in our faces! Interestingly, a Report of the European Commission on the EU-Korea FTA concludes “the first signs are promising” and “the EU has benefited significantly and its exports to Korea are on the up.” [EU Exports to Korea increased by 37 percent while EU’s imports have marginally increased by 1 percent] Remember, Korea is no underdeveloped country. And if this can happen to Korea, what could be the fate for an underdeveloped, under prepared and under governed country like India? Trade, as we all understand, is between equals. Put differently, if there is a theoretical chance that trade may bring in some benefits to both the parties; it is surely a worthwhile try. Unfortunately the EU-India FTA is doomed to fail even at the hypothetical level. Why then go through this elaborate charade? Naturally questions arise. So why is India embarking on this suicidal mission? What are its compulsions? Whose interest is our government trying to protect? Is this a parting kick of a government on the way out? Let us watch out for the next Amul advertisement. The author is a Chennai-based Chartered Accountant. Comments can be made to firstname.lastname@example.org
<urn:uuid:4371cf53-948d-4982-89b1-efbc5342c914>
CC-MAIN-2022-33
https://www.rediff.com/business/column/column-india-eu-fta-parting-kick-from-upa/20130412.htm
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00268.warc.gz
en
0.953557
1,941
1.921875
2
ARABIC: دراسة نماذج من الأحاديث التي أعلها الدارقطني بتعارض الوصل والإرسال في كتابه الغرائب والأفراد An Empirical Study of Ahādith declared Muallal (defective) due to contradiction of narrators in chains (wasl and Irsāl) from the book (al-Gharāib and al-Afrād) of Imam al-Dārāquṭnī Authenticity of a hadith (Prophetic tradition) from the advent of Islam to the present age has been a matter of great importance to the Muslims; it is one of the two primary sources of Islam. Therefore, many hadith scholars throughout the Islamic history-such as Imam al-Dārāquṭnī- dedicated their lives to the study of prophetic traditions & laid ground rules to identify and separate the correct narrations from the wrong ones. A hadith is rendered suspicious by -among other things- a contradiction of narrators in the narration of the same hadith, which can occur either in the Sanad (the chain of narrators) or in the text of the hadith. This study attempts to discuss a variation of this contradiction, which occurs when one or more chains of narrators are connected, while other chains skip a narrator after the sahābi (a companion of Prophet ﷺ). The study includes methodologies & rules of the Scholars to resolve such contradictions as well as some practical examples of contradictory ahādith from the book al-Gharāib & al-Afrād by Imam al-Dāraquṭnī which detail the procedure of dealing with such contradictions, considering the rules & identifying the most accurate chain of narrators.
<urn:uuid:96267070-1f06-457a-89e5-cfbe9df72e95>
CC-MAIN-2022-33
https://rahatulquloob.com/index.php/rahat/article/view/432
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00071.warc.gz
en
0.859573
429
2.203125
2
|Description:||This 2001 photograph depicted a left lateral, or side view of a poisonous saddleback caterpillar, which is actually the instar, or developmental stage through which the saddleback caterpillar moth, Sibine stimulea passes on its way to becoming an adult, or imago, moth.| Note that the head region had lifted off of the branch upon which the caterpillar was crawling. Beware, for the spines, also known as urticating hairs, emanating from its dorsal proturberances are capable of delivering a very painful sting, due to the irritating venom they secrete!! These moths are native to the eastern region of North America, and its instar is also known as the packsaddle caterpillar. A solitary specie, this caterpillar is often found on deciduous trees within its habitats. Note the bright breen midsection with its mid-dorsal round brown, white-ringed saddle-shaped spot.
<urn:uuid:0c226beb-8354-4522-a060-b156e34c3a3c>
CC-MAIN-2017-04
https://phil.cdc.gov/phil/details.asp?pid=10774
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00430-ip-10-171-10-70.ec2.internal.warc.gz
en
0.966343
199
3.015625
3
KG Your work is distinctive on two fronts. First is the the role of voice. Second there is a narrative interest which is not typical of a lot of contemporary dance. KP Richard and I both feel very strongly that dancers are not dumb and that means both that they are not stupid and that they are not mute, that the voice is a part of the instrument known as the body, and the body is the instrument that you have to work with in creative dance. With voice we have tried to develop a language as sophisticated as the physical. The level of writing for the voice has to match the level of choreography, and vice versa. KG How do you get that quality of voice you need in performance, since from the earliest days of a dancer’s training the focus is so much on the body. RJA I was chatting last night with a guest actor in our latest show and he said, sort of jokily, “I’m not sure you really need me, because all of you dancers are so good at speaking and dancing. Most actors couldn’t do the physical things they do and be so clear.” That was a nice comment. In the ten or more years Karen and I have been working together we’ve developed both conscious and unconscious ways of training the body so that you can use the voice fully as well as the body fully. There is a sense of freedom in the use of the voice. KG That’s fine for you, but what about for a relatively new company? KP When we were auditioning we looked for great dancers and we had more than enough to choose from. Then we asked them to speak. First of all they had to be willing to speak, willing to open their mouths. Dancers are so often trained to be quiet. It is very much a part of dance culture, especially in classical training and that is a way of showing your respect. KG Not questioning the choreographer’s intent? KP The first thing an actor has to do is to ask “why”, and that is the last thing a dancer ever does. We are now getting dancers to ask us why, and it certainly pushes the thinking of the choreographer. RJA If the choreography can’t be discussed, then it can’t be pushed further, particularly in this case where we are creating physical and verbal characters. It requires a full understanding by the dancer-actor, of why they are doing what they are doing. KP We look for dancers with clear, simple speaking voices, unmannered and malleable, which is a similar thing to what we look for in their bodies, that their years of training haven’t left marks on them that have to go. KG Presumably, Richard, you compose this text that is to be spoken well prior to the rehearsal process? RJA I’ve been writing Thursday’s Fictions for three or four years. It’s an epic poem and part of the process has been to make a stage adaptation of it. We went through a creative development period with a whole series of guest artists from Tasmania and Sydney, working with us on imagining different ways of staging this text in performance. KP The creative development project was part of the PAB-funded Time and Motion project allowing us to bring in Don Mamouney to work on the acting, Mémé Thorne on the Suzuki approach and many others from Tasmania and beyond. We had Scott Grayland working at the cross-roads of aerial work, dance and acting. We had Theresa Blake and Dan Whitton from Desoxy at the nexus of acrobatics and acting. Everybody brought ideas to the process. Don stayed on as co-director. RJA Ultimately, Karen was the dramaturg, creating ‘with the knife’. We worked on it together, and I’d say, “Yeah, that sounds good, but put that back in!” KP We had a lot of help also, Greg Methé and Ruth Hadlow of Hobart’s Terrapin Theatre were involved in the creative process both on design and dramaturgy. Their design background makes the question always come up, “Do we need to say this in words. Can’t we say it physically or visually?” RJA To me this was, in a way, a workshop for defining what is a performance script. It’s is not a traditional play, and it is not a poem anymore. It is now a performance script, and that was a lot of hard work and a lot of discussions and a lot of actual trying out. KG How much of Thursday’s Fictions is driven by the narrative, how much by dance’s sense of the moment? KP It’s structured by the narrative and it is also character-driven in the sense that each of the sections offers a quirky individual around whom we can centre our images and ideas. While it is a very rich and fascinating plot, it doesn’t move at the speed of lightning. It goes off from side to side, in a sense, and gives us horizontal views into the minds of these people. The dancers play several roles. They play the poems, Thursday’s poems, which are this central object passed from hand to hand. They play the left and right half of Friday’s brain. A set of triplets, all named Monday, run a funeral parlour. Later on, they torture Tuesday on the rack. Three dancers combine to play a large blue spider, looking like a cross between a praying mantis and a chandelier. KG What about the choreography, Karen? Are you going off in any new directions? KP I think there are some new directions. One of the places that modern dance has got stuck, in a way, is in the development by individuals of dance vocabularies that they call their own. So you can look at a dance and know immediately that it is a dance by Martha Graham, or a dance by Russell Dumas. I feel those vocabularies—like Trisha Brown’s—are wonderful, and they are rich, but they have a limited range of emotionally expressive possibilities. KG You immediately know what they are saying? KP Right, and when we get into our idea of narrative, where have the full spectrum of psychological and emotional vocabularies to work with, we are in a sense trying to let the characters develop their own vocabularies, rather than the choreographer work on his or hers. RJA That doesn’t mean that we don’t create it, but it does mean that we are trying to create specific vocabularies that suit those characters in those situations. KP There are moments in the dance where you might look at it and say ‘Martha Graham’ because one of the things she was really strong on was torture. There is a section in which I am tortured and I am really trying to make myself think in terms of very hard, bound, striking movements, as opposed to soft flowing gliding actions, which are completely inappropriate for torture, even though they are things which I personally enjoy doing. KG Given that Thursday’s Fictions is character and narrative-driven, what role does ensemble dancing play? KP A significant role in the sense of ensemble acting. There is no corps de ballet here at Tasdance. We have really selected people who are very distinctive. They look different, they dance different, they talk different. RJA It is a company of soloists, a complementary mix rather than a sort of bland sameness. KG Language is central to the work, what about sound? KP The composer and sound designer Andrew Yencken is using live musicians, recording them and manipulating the sound to evoke travel through time. He has references from moments in music history. He is also working with radio mikes on us, the performers, and he is modulating our sounds and words into the sound design as well as we perform. There’s also a pre-recorded radio component (involving a number of Tasmanian actors) which plays a surprising role. KG You say Thursday’s Fictions is a fairy tale, but its themes and sometimes graphic violence and sexual content make it definitely not for children. KP The theme of the work is the power of art to live on past us. The question at the heart of the work is, “Is it possible for a human to create something better than themselves?” Kids just aren’t going to be interested in that. I think it is adult also in the sense that it requires a very attentive audience. It’s also the question of whether the language of dance is universal in the sense that people who don’t speak your verbal language could easily understand your dance language, including children. I have a lot of problems with that. KG Richard, why the interest in re-incarnation? RJA I am personally very interested in yoga and Buddhism but Thursday’s Fictions isn’t a work of religious instruction. It is a spiritual work in the sense that it deals with issues of where we are and what our lives mean. I don’t think people are going to walk out of the theatre thinking this, but if someone was to reflect on it for a long time, they might decide that at a deeper level they’ve experienced a dialogue between a western spiritual vision of heaven and hell, and an eastern vision. KP In the first instance, we are creating a spectacle. If people can come to it without deciding in advance what dance is or what theatre is, then they will get a lot out of it. RJA I hope that people will come out delighted and intrigued and chuckling. KG Is the work ultimately about creativity through words? Is it about the poet? KP No, but do I think that dance is the most ephemeral of art forms, and poetry is one of the least ephemeral artforms. Dancers disappear and poems don’t. RJA There is another medium in Thursday’s Fictions, other than dance, acting, design, sound and radio, and that is print. Thursday tries to get her poems buried with her, so she can pick them up and keep writing them in the next life. In the end, you never hear the poems on stage, but the program contains Thursday’s 24 poems. And you can take them home with you in the innovative Paper Bark Press publication which doubles as program and poetry volume. You see these poems in the performance buffeted through time and history, and different people care about them or not, and by some miraculous chance they end up on your lap. Tasdance, Thursday’s Fictions. Text—Richard James Allen. Dramaturgy, direction, choreography—Karen Pearlman. Don Mamouney—co-director. Andrew Yencken—composer and sound designer. Dani Haski—costume designer. Greg Thompson—lighting design. Simeon Nelson—rack designer. Ben Little—radio producer. Karlin Love—music production coordinator. Dancers—Joanna Pollitt, Gregory Tebb, Kylie Tonatello, Samantha Vine, Richard James Allen, Karen Pearlman. Actor—Michael Edgar. Earl Arts Centre, Launceston, Dec 7-10; Peacock Theatre, Hobart, Dec 14-17. RealTime issue #10 Dec-Jan 1995 pg. 29 © Keith Gallasch; for permission to reproduce apply to firstname.lastname@example.org
<urn:uuid:d548e11b-e1e6-4fe3-a18a-039700d35b96>
CC-MAIN-2017-04
http://www.realtimearts.net/article/10/6136
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279224.13/warc/CC-MAIN-20170116095119-00478-ip-10-171-10-70.ec2.internal.warc.gz
en
0.970964
2,454
1.578125
2
1. This is an application in revision against an order of the District Judge of Banaras, whereby he disposed of an appeal preferred to him under Section 17, Payment of Wages Act (Act IV of 1936). 2. The facts giving rise to this application, shortly stated, were these. At Banaras there is a press called the Arya Bhushan Press, whose proprietor is one W. M. Godse. There was an industrial dispute in respect of this press, and that industrial dispute was the subject-matter of an adjudication under the Industrial Disputes Act. There was also a question about the payments of certain employees being in arrears: There were twentythree such workmen whose wages had not been paid and were as suck in arrears. The Chief Inspector of Factories came to know about it, and made a report about this matter to the Magistrate, appointed under the Payment of Wages Act for the area, to decide questions arising for decision under that Act. On the information received from the Chief Inspector of Factories the Magistrate issued a notice to the Manager of the press, one Nirmala, to show cause why an order for payment of wages be not made against the Manager of the press. This notice was issued on 15-11-1951. A written statement was filed on 4-12-1951, contesting the claim for wages. There was some sort of a compromise in the industrial disputes matter also in regard to the payment of the wages which were the subject-matter of the proceedings before the Magistrate under the Payment of Wages Act. 3. Nirmala was dismissed from the position of a Manager of the press with effect from 1-1-1952. Information of this fact was conveyed to the Chief Inspector of Factories, as required by the provisions of Section 7 of the Factories Act. The payment of wages matter came up for hearing before the Magistrate on 6-5-1952. On this date Nirmala appeared and informed the Court that he had been dismissed, and he had, therefore, no further authority or responsibility in respect of the matter pending adjudication. Nirmala also gave information to the Magistrate that Godse was the proprietor and that he should be asked to place the case of the employer before the Magistrate. The learned Magistrate, however, gave no notice to Godse, but made an order under Section 15, Payment of Wages Act, against Nirmala. Section 15(3) is in these words:-- ''When any application under Sub-section (2) is entertained, the authority shall hear the applicant and the employer or other person responsible for the payment of wages under Section 3, or give them an opportunity of being heard and, after such further enquiry (if any), as may be necessary, may, without prejudice to any other penalty to which such employer or other person is liable under this Act, direct the refund to the employed person of the amount deducted, or the payment of the delayed wages, together with the payment of such compensation as the authority may think fit, not exceeding ten times the amount deducted in the former case and not exceeding ten rupees in the latter: Provided that no direction for the payment of compensation shall be made in the case of delayed wages if the authority is satisfied that the delay was due to- (a) a bona fide error or bona fide dispute as to the amount payable to the employed person, or (b) the occurrence of an emergency, or the existence of exceptional circumstances, such that the person responsible for the payment of the wages was unable, though exercising reasonable diligence, to make prompt payment, or (c) the failure of the employed person to apply for or accept payment.' 4. On the date on which the order was made, namely, on 6-5-1952, Nirmala could not be held to be a person who could be responsible for the payment of the wages of the workmen under Section 3. The person who was and could be responsible for the payment of the wages under Section 3 on 6-5-1952, was Godse, for he was not only the proprietor on that date but was also the Manager of the press, for he had himself so notified the fact to the Chief Inspector of Factories on 5-1-1952. The wages could not, therefore, be recovered from Nirmala. The Magistrate, later, made an order under Section 19, Payment of Wages Act, for the recovery of the amount of wages found due. Section 19 is in these words:-- 'When the authority referred to in Section 15 or the Court referred to in Section 17 is unable to recover from any person (other than an employer) responsible under Section 3 for the payment of wages any amount directed by such authority under Section 15 or Section 17 to be paid by such person, the authority shall recover the amount from the employer of the employed person concerned.' The jurisdiction to make an order under Section 19 arises after there has been a proper order made under Section 15 or under Section 17. If the order made under Section 15 was a bad order, that is to say, was made without due compliance with the requirements of that section, then obviously the sum directed to be paid under Section 15 could not be made recoverable by a subsequent order under Section 19. The learned Judge has dismissed the appeal apparently, on the view that at the date when the wages fell due Nirmala was one of the persons who was responsible for the payment of such wages under Section 3 and, therefore, Nirmala's responsibility subsisted, and since Nirmala was before the Court on 6-5-1952, when the case was disposed of, there was a proper representation. I may, however, point out that the Court below has not put the matter in the same way in which I have put it, though I think, that that is what the Court meant to say. As I read Section 15(3) I read it to mean that a hearing has to be given to that person who, on the date of the hearing, is responsible for the payment of wages under Section 3. A Manager, who has been dismissed, can have no subsisting responsibility for wages that fell due while he was a Manager and question about which was being raised subsequent to his dismissal. Indeed, the Magistrate has also found that there was no responsibility in Nirmala to make the payment, and the amounts awarded to the employees could not be recovered from Nirmala. The person who was, therefore, responsible for payment of the wages under Section 3 on 6-5-1952, was Godse, and under the provisions of Section 15 no order could be made in the cause without giving him an opportunity to be heard. This was not a case of mere formality for the defence, because there was, in this case, a contention raised on behalf of the employer that wages were payable in this case in terms of a compromise which had been effected between the parties in the industrial dispute. There was, therefore, a substantial question to be gone into before final orders in the matter could have been made by the Magistrate. It is one of the fundamental principles of justice that no order can or should be made against a party without giving him an opportunity of being heard. The person from whom the amount is now being recovered, namely, Godse, has had no opportunity either directly or through a properly constituted representative to have his point of view placed before the authority who had the jurisdiction to decide this matter. The fact, therefore, that the ultimate responsibility for paying the wages is rested on the proprietor or owner under Section 19 does not make the order which was made by the Court below legal, for, as I have already pointed out, a proper order under Section 19 can only be made after there has been a proper and legal order under Section 15 of the Act. 5. For the reasons given above, I am of the view that the order of the learned Magistrate and of the learned District Judge should be set aside as being illegal and without jurisdiction, and I accordingly set them aside. The case will now go back to the authority nominated under the Payment of Wages Act for the area to decide the matter in accordance with law. There has been no representation of the opposite parties before me in this cause. I, therefore, make no order as to the costs of this petition.
<urn:uuid:1b9d6d02-27c7-4b66-a23c-4b3f1bd2e260>
CC-MAIN-2017-04
https://www.legalcrystal.com/case/464343/w-m-godse-vs-state-anr
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00430-ip-10-171-10-70.ec2.internal.warc.gz
en
0.982014
1,734
1.59375
2
Journal of Behavioral and Brain Science Vol.2 No.4(2012), Article ID:25213,8 pages DOI:10.4236/jbbs.2012.24054 Neurobehavioral and Hemodynamic Evaluation of Cognitive Shifting in Children with Autism Spectrum Disorder 1Graduate School of Arts and Sciences, The University of Tokyo, Tokyo, Japan 2Department of Developmental Disorders, National Institute of Mental Health, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan 3Department of Children, Saitama Jyunshin College, Saitama, Japan 4Department of School Education, Joetsu University of Education, Niigata, Japan 5Department of Child Neurology, NCNP Hospital, Tokyo, Japan Email: email@example.com, firstname.lastname@example.org Received September 24, 2012; revised October 16, 2012; accepted October 31, 2012 Keywords: Autism Spectrum Disorder; Executive Function; Cognitive Shifting; Frontal Lobe Function; Near-Infrared Spectroscopy The restrictive, stereotyped behavior in autism spectrum disorder (ASD) is considered to be related to deficits in executive function. In particular, cognitive shifting in executive function is deeply related to stereotyped behavior in ASD. Previous investigations have clarified that the lateral prefrontal cortex is involved in cognitive shifting when flexible changes in attention were needed. However, a few studies have revealed a direct association between cognitive shifting tasks and lateral prefrontal cortex activity in children with ASD. We examined cognitive shifting in 7- to 12-year-old children with ASD and typically developing children using the dimensional change card sort task. In addition, using near-infrared spectroscopy, we examined prefrontal brain activity in conjunction with cognitive shifting. The autistic children provided fewer correct answers and slower reaction times in the task than typically developing children. Furthermore, the autistic children displayed a decline in right lateral prefrontal cortex activity during the task compared with typically developing children. In addition, a negative correlation was observed between the severity of autism and brain activity during the task. These results suggest that the activity and physiological indices used in this study may be useful for identifying the symptoms of ASD and discriminating ASD from other disabilities. Autism spectrum disorder (ASD) is a developmental disorder characterized by restricted, repeated, and stereotyped interest and behavior . Many studies indicate that restricted interest and repeated behavior in ASD are related to deficits in executive function [2-4]. Executive functions control high-level cognitive ability that facilitates the inhibition of incorrect behavior and involves the selection of appropriate behavior . There are six domains of executive function: inhibition, working memory, sentence memory, planning, fluency, and shifting . Many researchers have found that scores of executive function tests are low for subjects with ASD [5,10]. For example, in the Tower of Hanoi test, which assesses planning ability, and the Wisconsin Card Sorting Test (WCST), which assesses cognitive shifting, children with autism had lower scores than children with typical development or attention deficit/hyperactivity disorder [9,11]. Therefore, it has been shown that deficits in executive function tasks are specific signs of ASD. However, Lopez et al. performed a covariance analysis of the scores of shifting and planning using intelligence quotient (IQ) as the covariate and observed that children with ASD had worse shifting task scores than typically developing children (TDC), although planning task scores were not significantly different between these groups of children. Therefore, it appears that the planning task score was affected by IQ. Because shifting function is an important ability that is connected with change in the mental state, deficits in this domain may be linked to the persistent and repeated behavior seen in ASD . In WCST, the subject needs to change his/her response according to the shape, color, or number, following the feedback from the experimenter. However, WCST is slightly problematic because it requires additional cognitive processes, and thus, it does not solely measure cognitive shifting. Conversely, the dimensional change card sort (DCCS) task is specific for cognitive shifting and has simple instructions; thus, permitting its use in individuals across a wide range of ages . In a previous research, 3-year-old children tended to similarly respond to a stimulus as they responded to a previous stimulus. This symptom was similar to lack of flexibility observed in patients with frontal region damage. However, 5-yearold children could alter their responses according to changes in the rules . Therefore, the DCCS task can reflect the developmental changes in executive functions and characteristics of disabilities. Thus, we believe that the DCCS task can detect lack of flexibility such as that observed in persistent and repeated behavior. During selective response tasks that require cognitive shifting, activities of the dorsolateral prefrontal cortex, ventrolateral prefrontal cortex, and anterior cingulate cortex were determined to be lower in autistic adults than in normal adults. Furthermore, by examining the network comprising the prefrontal cortex (PFC) and other domains using factor analysis, it was reported that the activity of the interval region comprising PFC and the parietal lobe and the functional connection between the hemispheres are low. Based on these findings, the specificity of executive function in the adult brain stem was believed to differ between autistic and normal individuals. In this study, we evaluated cognitive shifting function in autistic children during the DCCS task. In addition, we clarified the specifics of brain activities, particularly those in PFC, which is thought to be the domain associated with the deficits in ASD, using near-infrared spectroscopy (NIRS). NIRS is noninvasive, does not require children to be in a fixed position, and can be used for young children [14,15]. 2. Materials and Methods The ASD group consisted of 14 subjects (mean age ± standard deviation, 9.56 ± 1.44 years; 8 boys and 6 girls; all but two were right-handed) with Asperger’s syndrome or high-functioning autism (Table 1). Pediatric neurologists made the diagnoses based on DSM-IV-TR criteria . IQs of the diagnostic group were evaluated using the Wechsler Intelligence Scale for Children, Third Edition. No individual’s full IQ was lower than 80. TDC (9 boys and 11 girls, 9.15 ± 1.64 years; all but three were righthanded) were recruited as controls and paid volunteers. All subjects had normal or corrected vision and no history of neurological disorders. All subjects from both groups and their mothers provided written informed consent before the experiment. The experimental protocol was approved by the Ethics Committee of the National Center of Neurology and Psychiatry. All subjects completed Raven’s Colored Progressive Matrices test (RCPM) to determine their nonverbal intelligence. In addition, we measured their language abilities regarding sentence comprehension using the Kaufman assessment battery for children (K-ABC). Moreover, the Pervasive Developmental Disorders Autism Society Japan Rating Scale (PARS) test was conducted by interviewing the mother of each subject in the TDC and ASD groups to verify ASD severity in each subject. The PARS test consisted of two categories: questions about clinical conditions during infancy (PARS infant) and questions about current clinical conditions (PARS present). Age, the K-ABC (comprehension) score, and the RCPM score were not significantly different between the groups (age: t(32) = 0.76, not significant (n.s.): p > 0.05; reading comprehension: t(32) = 0.90, n.s.; RCPM: t(32) = 0.31, n.s.; Table 1). However, a significant main effect was observed between the groups for the two PARS subscores (PARS infant: t(32) = 9.87, p < 0.001, PARS present: t(32) = 11.52, p < 0.001; Table 1). Table 1. Characteristics of the participating groups. Comparisons of the typically developing children (TDC) and autistic spectrum disorder (ASD) groups were performed using Student’s t-test (two-tailed). 2.2. Behavioral Task and Data Analysis The subjects performed a task using a personal computer (PC). The subjects sat 50 cm away from PC [15-inch liquid crystal display (LCD) screen]. The background of the display was gray. The detailed procedures are as follows. 2.2.1. Baseline Task A white square was shown on the right or left lower side of the 15-inch LCD screen, and the subjects indicated on which side of the screen the square appeared by pressing a button corresponding to that side of the screen. The next square appeared randomly 1 s after the subjects pressed the button. A 15-s rest period was allowed before beginning a task. During the rest period, a small white circle was shown in the center of the screen, and the subjects were instructed to only watch the white circle closely. The task time was 30 s. 2.2.2. DCCS Task We used “border version” of the DCCS task to evaluate cognitive shifting in the subjects. In this task, the subjects must frequently alternate their responses according to the color or shape as the rule changes . Specifically, three cards were displayed in the form of a pyramid on the same screen. On each white card, a diamond or star shape was presented in red or blue. The subjects were required to select which of the two cards at the bottom of the pyramid (selection cards) matched the card at the top of the pyramid (reference card) according to the given rule (shape or color; Figure 1). The color and shape of the two selection cards differed from those of the reference card. If the reference card was hemmed in black, correct response was to select the selection card that matched the reference card in shape. When no black hemming was shown, then the correct response was to select the selection card that matched the reference card in color. The reference and selection cards were displayed on the screen until the subject responded, and the next set of cards appeared randomly 0.5 s after the subject pressed a button. The subjects were allowed a 15-s rest period before conducting the trial. During the rest period, the subjects stared at a small white circle on the screen, as described for the baseline task. The task time was 30 s. The DCCS and baseline tasks were performed twice, but alternatively (i.e., baseline task, DCCS task, baseline task, and DCCS task). In addition, before the actual task, the subjects underwent a practice trial (5-s rest period followed by a 20-s trial). We provided feedback to the subjects during the practice trial and confirmed that they completely understood the instructions. During the actual task, feedback was not provided and the subjects’ response and reaction times were recorded automatically. The number of correct answers and errors, reaction time of correct responses, and percentage of correct answers were evaluated for each trial. In addition, the correlations between these variables and age, intelligence, and the numerical PARS scores were calculated. The assumptions for parametric testing were checked and appeared to be violated for all dependent measures. For all behavioral measures, nonparametric Mann-Whitney U tests were applied. A significance level of p < 0.05 (two-sided) was adopted for all analyses. 2.3. Near-Infrared Spectroscopy Recording and Analysis While the subjects performed the task, we simultaneously recorded the activity of the lateral PFC, as measured by changes in oxygenated hemoglobin (ΔHbO2) using a multi-channel NIRS equipment (OEG-16; Spectratech Inc., Tokyo, Japan). In this system, near-infrared laser diodes with two wavelengths (approximately 770 and 840 nm) were used to emit the near-infrared light. The re-emitted light was detected using avalanche photodiodes located 30 mm from the emitters with a temporal resolution of 655 ms, thereby measuring ΔHbO2 at a depth of approximately 3 cm below the scalp. In our system, six emitters and six detectors were placed at alternate points on a 2 × 6 grid (Figure 2). This configuration enabled us to detect signals from 16 channels of bilateral frontal regions (Figure 2). The center of the probe matrix was placed on Fpz (International 10 - 20 system), and the bottom left and bottom right corners were located around F7 and F8, respectively, according to a previous report . The detected signal was sent to a data collection computer, which was different from the task-control computer. The timing of each trial event, such as the on- Figure 1. Illustration of the protocol of the baseline (a) and dimensional change card sort (DCCS) (b) tasks. In the baseline task, the participants have to indicate the side of the screen on which the white square appeared. In the DCCS task, if the upper card was hemmed in black, the participants had to select the lower card with the same shape as that printed on the upper card and if the upper card was not hemmed in black, they had to select the lower card of the same color as that of the upper card. Figure 2. Near-infrared spectroscopy (NIRS) settings. The NIRS probe was attached to the prefrontal area. The center of the probe matrix was placed on Fpz (International 10 - 20 system), and the bottom left and bottom right corners were located around F7 and F8, respectively. set of the sample cue, was transmitted to the data collection computer from the task-control computer through a local area network with UDP communication. A bandpass filter was set for the NIRS data at 0.01 - 0.1 Hz during the task using fast Fourier transform to reject artifacts caused by minor subject movements. To increase the signal-to-noise ratio, data from each channel were converted into a z-score because raw data cannot be compared directly across subjects and channels . The z-score was calculated using the mean and standard deviation of ΔHbO2 during the last 6 s of the rest period. Consequently, the mean and standard deviation were adjusted to a z-score of 0 and 1, respectively, for every channel. Subjects whose scores were more than two standard deviations away from the mean were excluded because of the possibility of motion artifacts. 3.1. Behavioral Results Regarding the DCCS task, the number of correct answers (U = 37.0, p < 0.001) and the reaction time (U = 213.0, p = 0.011) differed significantly between the ASD and TDC groups, although difference was not observed in the number of errors (U = 128.5, p = 0.685) (Figure 3). There was no significant difference in the percentage of correct answers (U = 128.5, p = 0.687), and the percentage exceeded 75% in both groups. In addition, the number of correct answers was negatively correlated with both PARS (infant) (r = −0.511, p = 0.002) and PARS (present) (r = −0.518, p = 0.002) (Figure 4). 3.2. Near-Infrared Spectroscopy To compare the changes in brain blood flow, we utilized Student’s t-test for each channel. Initially, we examined the differences in brain activity between the baseline and DCCS tasks to assess changes in brain activity in the two groups. Activation was recognized in 10 of 16 channels (ch 1, ch 3, ch 4, ch 6, ch 9, ch 10, ch 12, ch 13, ch 14, and ch 15) during the DCCS task in the TDC group (p < 0.05; upper panel of Figure 5). In contrast, only three channels (ch 6, ch 12, and ch 13) were activated in the ASD group (lower panel of Figure 5).We examined the differences in the mean change in brain activity during the baseline task between the ASD and TDC groups. No significant difference was observed in any channel between the two groups. However, we observed significant (p < 0.05) decreases in activity in ch 4 and ch 5 in the ASD group compared with the TDC group during the DCCS task (Figure 6). Furthermore, we examined the correlation between brain activity and behavior indices. Ch 4 was selected as the region of interest (ROI) because remarkable differences were observed in this channel between the two groups during the DCCS task. As a result, the numerical values for PARS and the activity in ROI using the mean z-scores throughout DCCS task were negatively correlated (infant; r = −0.553, p = 0.040, present; r = −0.714, p = 0.004) in the ASD group (Figure 7). 4.1. Behavioral Tasks In the DCCS task, the ASD group provided significantly fewer correct answers and exhibited slower reaction times than the TDC group. In addition, albeit without significance, the ASD group tended to have more prolonged higher numbers of incorrect responses. Consequently, a decline in cognitive shifting was suggested in autistic children, and these findings were consistent with Figure 3. Behavioral results of the dimensional change card sort task. The number of correct answers (a), reaction time (b), number of errors (c), and percentage of correct responses (d) for each group during the task. Error bars indicate the standard error. *p < 0.05; **p < 0.01. Figure 4. Correlation between the number of correct responses and the Pervasive Developmental Disorders Autism Society Japan Rating Scale (PARS infant) (a) and PARS (present) (b). TDC, typically developing children (red circle); ASD, autism spectrum disorder (blue diamond). The x-axis indicates infant score on PARS (a). The x-axis indicates the present score on PARS (b). The y-axis indicates the number of correct response (a, b). those of previous studies [19,20]. This DCCS task requires the subjects to change their responses frequently according to the stimulus. Thus, it is believed that the correct answers and reaction times reflect the clinical features of persistent and stereotyped behavior in ASD. Moreover, the children grasped the rules of the task because both groups had accuracy rates of >75%. In other words, the autistic children understood the rules of the task, but their ability of cognitive shifting was determined to be low. Compared with TDC, they tended to require more time to shift to the new rule, thus resulting in a longer reaction time and greater number of incorrect responses. Figure 5. Time course of near-infrared spectroscopy topography using the mean z-scores from all subjects. The numbers on the first image on the second row indicate the locations of the channels. The left side of the figure indicates brain activities during the baseline task; typically developing children (TDC, upper) and autism spectrum disorder (ASD, lower). The right side of the figure indicates brain activities during the dimensional change card sort task; TDC (upper) and ASD (lower). Figure 6. Temporal changes in oxygenated hemoglobin (ΔHbO2) levels in the prefrontal area during the baseline and dimensional change card sort tasks (ch 4). Data are presented as the mean for typically developing children (TDC; red line) and autistic spectrum disorder (ASD; blue line) groups. A negative correlation was observed between the number of correct answers in the DCCS tasks and the severity of ASD as measured by PARS (infant and present). That is, cognitive shifting is likely to be low when ASD severity is high. Therefore, we used the DCCS task to evaluate cognitive shifting. We believe that we could minimize working memory and specifically evaluate cognitive shifting because the present task uses two classifications (color and Figure 7. Correlation of the brain activity in the region of interest (ROI) (ch 4) with the Pervasive Developmental Disorders Autism Society Japan Rating Scale (PARS infant) (a) and PARS (present) (b). ASD, autism spectrum disorder (blue diamond). The x-axis indicates the infant score on PARS (a). The x-axis indicates the present score on PARS (b). The y-axis indicates the brain activity in ROI (a, b). shape), unlike WCST, which uses three classifications (color, shape, and number) . In addition, language impairment is observed in some instances of ASD , but the DCCS task removes this influence because of its simple instructions and rules. 4.2. Executive Function and Theory of Mind Cognitive shifting is believed to be associated with “theory of mind” (ToM) that shows lack of sociality [23-25]. ToM, which was proposed by Baron-Cohen et al. , is the ability of an individual to infer the mental state of others and understand that other people have different beliefs and desires. Baron-Cohen et al. created a task called “Surrey and Ann” and verified whether children could distinguish “phenomenon” from “thinking”. In this task, autistic children had a lower passage rate than TDC [23-25]. Therefore, we need to examine the connection between the DCCS task and the ToM problem; clarify how cognitive shifting is related to various ASD characteristics, excluding stereotyped and persistent behavior; and utilize these findings in ASD treatment. 4.3. Brain Activity During the baseline task, difference in brain activity was not observed between the ASD and TDC groups, but during the DCCS task, the difference was observed in ch 4 and ch 5. Its domain corresponded to the right lateral prefrontal cortex (LPFC). In a previous investigation, the right LPFC was believed to be responsible for cognitive shifting . In addition, negative correlations were observed between this domain and the two PARS indices (infant and present ASD severity). Thus, it was suggested that the activity of the right LPFC is correlated with ASD severity. In other words, this domain may be related to the stereotyped and persistent behavior seen in ASD. In addition, using topography, we detected decreased activation of this domain in autistic children during the DCCS task, but not during the baseline task. The right LPFC was reported to be less activated in infants who could not complete the DCCS task . Right LPFC activation was lower in the subjects of this study despite their mean age of 9 years. In fact, right LPFC activation was lower in the study population than in autistic adults . Thus, because improvements in right LPFC activity may not occur during the natural development of autistic individuals, new methods of improving stereotyped and persistent behavior that target other brain areas are required. 4.4. Near-Infrared Spectroscopy System We used NIRS to measure brain function in this study. The usefulness of NIRS was established by studies of frontal lobe function in children and adults during WCST, and it is believed to have some advantages over functional magnetic resonance imaging (fMRI) [28-31]. However, NIRS detects hemodynamic changes only at the brain surface (approximately 2 cm beneath the skull). Thus, subcortical responses cannot be addressed using NIRS. Moreover, NIRS has a relatively low spatial resolution compared with fMRI; therefore, precise analyses are limited. Despite these shortcomings, NIRS is increasingly becoming a key modality in developmental neuroscience studies involving newborns , preschool children , and school-aged children because of its excellent safety and robustness against body movements. We believe that the power of executive function can be predicted using NIRS in children who are unable to identify all language characters. Reduced cognitive shifting during the DCCS task was observed in children with ASD compared with TDC. In addition, decreased activity in the right LPFC was identified as a factor potentially responsible for the decline in cognitive shifting. According to these findings, it appears that DCCS is suitable for differentiating the symptoms of ASD from those of other disorders. This work was supported in part by the TMC Young Investigator Fellowship and an Intramural Research Grant (22 - 6; Clinical Research for Diagnostic and Therapeutic Innovations in Developmental Disorders) for Neurological and Psychiatric Disorders of National Center of Neurology and Psychiatry (NCNP). This study was also supported by a Grant for Strategic Research Program for Brain Sciences (SSPBS: Project E) by the MEXT (Mizusawa H and Inagaki M), Japan. We thank the parents and children who participated in the study. We also thank the organizers of after-school care program of the Sukage Nursery. - American Psychiatric Association, “Diagnostic and Statistical Manual of Mental Disorders,” 4th Edition, American Psychiatric Association, Washington DC, 2000. - B. A. Boyd, M. McBee, T. Holtzclaw, G. T. Baranek and J. W. Bodfish, “Relationships among Repetitive Behaviors, Sensory Features, and Executive Functions in High Functioning Autism,” Research in Autism Spectrum Disorders, Vol. 3, No. 4, 2009, pp. 959-966. doi:10.1016/j.rasd.2009.05.003 - F. Happe and A. Ronald, “The ‘Fractionable Autism Triad’: A Review of Evidence from Behavioural, Genetic, Cognitive and Neural Research,” Neuropsychology Review, Vol. 18, No. 4, 2008, pp. 287-304. doi:10.1007/s11065-008-9076-8 - E. L. Hill, “Executive Dysfunction in Autism,” Trends in Cognitive Sciences, Vol. 8, No.1, 2004, pp. 26-32. doi:10.1016/j.tics.2003.11.003 - B. F. Pennington and S. Ozonoff, “Executive Functions and Developmental Psychopathology,” Journal of Child Psychology and Psychiatry, and Allied Disciplines, Vol. 37, No. 1, 1996, pp. 51-87. doi:10.1111/j.1469-7610.1996.tb01380.x - H. M. Geurts, S. Vertie, J. Oosterlaan, H. Roeyers and J. A. Sergeant, “How Specific Are Executive Functioning Deficits in Attention Deficit Hyperactivity Disorder and Autism?” Journal of Child Psychology and Psychiatry, Vol. 45, No. 4, 2004, pp. 836-854. doi:10.1111/j.1469-7610.2004.00276.x - F. Happe, R. Booth, R. Charlton and C. Hughes, “Executive Function Deficits in Autism Spectrum Disorders and Attention-Deficit/Hyperactivity Disorder: Examining Profiles across Domains and Ages,” Brain and Cognition, Vol. 61, 2006, No.1, pp. 25-39. doi:10.1016/j.bandc.2006.03.004 - B. R. Lopez, A. J. Lincoln, S. Ozonoff and Z. Lai, “Examining the Relationship between Executive Functions and Restricted, Repetitive Symptoms of Autistic Disorder,” Journal of Autism and Developmental Disorders, Vol. 35, No. 4, 2005, pp. 445-460. doi:10.1007/s10803-005-5035-x - S. Ozonoff and J. Jensen, “Brief Report: Specific Executive Function Profiles in Three Neurodevelopmental Disorders,” Journal of Autism and Developmental Disorders, Vol. 29, No. 2, 1999, pp. 171-177. doi:10.1023/A:1023052913110 - S. Ozonoff, D. L. Strayer, W. M. McMahon and F. Filloux, “Executive Function Abilities in Autism and Tourette Syndrome: An Information Processing Approach,” Journal of Child Psychology and Psychiatry, and Allied Disciplines, Vol. 35, No. 6, 1994, pp. 1015-1032. doi:10.1111/j.1469-7610.1994.tb01807.x - ,H. M. Geurts, S. Verte, J. Oosterlaan, H. Roeyers and J. A. Sergeant, “How Specific Are Executive Functioning Deficits in Attention Deficit Hyperactivity Disorder and Autism?” Journal of Child Psychology and Psychiatry, Vol. 45, No. 4, 2004, pp. 836-854. doi:10.1111/j.1469-7610.2004.00276.x - P. D. Zelazo, “The Dimensional Change Card Sort (DCCS): A Method of Assessing Executive Function in Children,” Nature Protocols, Vol. 1, No. 1, 2006, pp. 297-301. doi:10.1038/nprot.2006.46 - Y. Moriguchi and K. Hiraki, “NEURAL ORIGIN of Cognitive Shifting in Young Children,” Proceedings of the National Academy of Sciences of the United States of America, Vol. 106, No. 14, 2009, pp. 6017-6021. doi:10.1073/pnas.0809747106 - G. Matsuda and K. Hiraki, “Sustained Decrease in Oxygenated Hemoglobin during Video Games in the Dorsal Prefrontal Cortex: A NIRS Study of Children,” Neuroimage, Vol. 29, No. 3, 2006, pp. 706-711. doi:10.1016/j.neuroimage.2005.08.019 - S. Shimada and K. Hiraki, “Infant’s Brain Responses to Live and Televised Action,” Neuroimage, Vol. 32, No. 2, 2006, pp. 930-939. doi:10.1016/j.neuroimage.2006.03.044 - J. Raven, “Coloured Progressive Matrices: Sets A, Ab, B,” OPP Ltd., Oxford, 1976. - C. PARS, “Pervasive Developmental Disorders Autism Society Japan Rating Scale [in Japanese],” Spectrum-Shuppansha, Tokyo, 2008. - Y. Kita, A. Gunji, Y. Inoue, T. Goto, K. Sakihara, et al., “Self-Face Recognition in Children with Autism Spectrum Disorders: A Near-Infrared Spectroscopy Study,” Brain Development, Vol. 33, No. 6, 2011, pp. 494-503. doi:10.1016/j.braindev.2010.11.007 - G. S. Dichter, K. J. Radonovich, L. M. Turner-Brown, K. S. L. Lam, T. N. Holtzclaw, et al., “Performance of Children with Autism Spectrum Disorders on the DimensionChange Card Sort Task,” Journal of Autism and Developmental Disorders, Vol. 40, No. 4, 2010, pp. 448-456. doi:10.1007/s10803-009-0886-1 - L. Van Eylen, B. Boets, J. Steyaert, K. Evers, J. Wagemans, et al., “Cognitive Flexibility in Autism Spectrum Disorder: Explaining the Inconsistencies?” Research in Autism Spectrum Disorders, Vol. 5, No. 4, 2011, pp. 1390- 1401. doi:10.1016/j.rasd.2011.01.025 - T. D. Watson, A. Azizian and N. K. Squires, “Eventrelated Potential Correlates of Extradimensional and Intradimensional Set-Shifts in a Modified Wisconsin Card Sorting Test,” Brain Research, Vol. 1092, No. 1, 2006, pp. 138-151. doi:10.1016/j.brainres.2006.03.098 - M. M. Kjelgaard and H. Tager-Flusberg, “An Investigation of Language Impairment in Autism: Implications for Genetic Subgroups,” Language and Cognitive Processes, Vol. 16, No. 2-3, 2001, pp. 287-308. doi:10.1080/01690960042000058 - D. Frye, P. D. Zelazo and T. Palfai, “Theory of Mind and Rule-Based Reasoning,” Cognitive Development, Vol. 10, No. 4, 1995, pp. 483-527. doi:10.1016/0885-2014(95)90024-1 - J Russell, “Agency: Its Role in Mental Development?” 1st Edition, Psychology Press, Hove, 1996. - P. D. Zelazo, S. Jacques, J. A. Burack and D. Frye, “The Relation between Theory of Mind and Rule Use: Evidence from Persons with Autism-Spectrum Disorders,” Infant and Child Development, Vol. 11, No. 2, 2002, pp. 171-195. doi:10.1002/icd.304 - S. Baron-Cohen, A. M. Leslie and U. Frith, “Does the Autistic Child Have a ‘Theory of Mind’?” Cognition, Vol. 21, No. 1, 1985, pp. 37-46. doi:10.1016/0010-0277(85)90022-8 - K. M. Shafritz, G. S. Dichter, G. T. Baranek and A. Belger, “The Neural Circuitry Mediating Shifts in Behavioral Response and Cognitive Set in Autism,” Biological Psychiatry, Vol. 63, No. 10, 2008, pp. 974-980. doi:10.1016/j.biopsych.2007.06.028 - M. Sanefuji, Y. Takada, N. Kimura, H. Torisu, R. Kira, Y. Ishizaki and T. Hara, “Strategy in Short-Term Memory for Pictures in Childhood: A Near-Infrared Spectroscopy Study,” Neuroimage, Vol. 54, No. 3, 2011, pp. 2394-2400. doi:10.1016/j.neuroimage.2010.09.090 - M. L. Schroeter, S. Zysset, M. Wahl and D. Y. von Cramon, “Prefrontal Activation Due to Stroop Interference Increases during Development—An Event-Related fNIRS Study,” Neuroimage, Vol. 23, No. 4, 2004, pp. 1317-1325. doi:10.1016/j.neuroimage.2004.08.001 - S. Sumitani, T. Tanaka, S. Y. Tayoshi, K. Ota, N. Kameoka, et al., “Activation of the Prefrontal Cortex during the Wisconsin Card Sorting Test as Measured by Multichannel Near-Infrared Spectroscopy,” Neuropsychobiology, Vol. 53, No. 2, 2006, pp. 70-76. doi:10.1159/000091722 - S. Tsujimoto, T. Yamamoto, H. Kawaguchi, H. Koizumi and T. Sawaguchi, “Prefrontal Cortical Activation Associated with Working Memory in Adults and Preschool Children: An Event-Related Optical Topography Study,” Cerebral Cortex, Vol. 14, No. 7, 2004, pp. 703-712. doi:10.1093/cercor/bhh030 - Y. Otsuka, E. Nakato, S. Kanazawa, M. K. Yamaguchi, S. Watanabe, et al., “Neural Activation to Upright and Inverted Faces in Infants Measured by Near-Infrared Spectroscopy,” Neuroimage, Vol. 34, No. 1, 2007, pp. 399- 406. doi:10.1016/j.neuroimage.2006.08.013
<urn:uuid:5d598aea-1a95-47a4-96a5-ae35157ec20f>
CC-MAIN-2016-44
http://file.scirp.org/Html/5-3900134_25213.htm
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719468.5/warc/CC-MAIN-20161020183839-00529-ip-10-171-6-4.ec2.internal.warc.gz
en
0.913415
7,785
2.5625
3
Though it is not possible to practice nursing without a license, your nursing degree doesn’t have to go to waste should you choose not to become a licensed registered nurse. Whether you would still like to work with patients or if you prefer an administrative role, plenty of related careers allow you to utilize the skills you learned in while in nursing school. Home Health and Personal Care Aide If you are still interested in working hands-on with patients, a career as a personal care or home health aide might be right for you. These individuals assist those who suffer from chronic illnesses, disabilities or other impairments with everyday activities such as bathing, dressing, feeding and, in some cases, administering medicine or checking vital signs. Home health and personal care aides visit patients in their own homes or work in smaller care communities. Job prospects in this field are excellent, according to the U.S. Bureau of Labor Statistics (BLS), as the aging baby boomer population is driving up the need for personal health care services. Medical assistants are a vital resource in most physician’s offices or healthcare facilities. Their level of direct patient interaction varies based on the particular position. Some are solely administrative, scheduling appointments and dealing with health records. Others have a clinical role, taking vital signs and recording patients’ health histories, giving injections and preparing lab tests. Like many healthcare fields, the job outlook for medical assistants is good. The BLS expects faster-than-average growth in this occupation through 2020. Medical and Clinical Lab Technologists and Technicians Though an associate or bachelor's degree is required for many medical and clinical lab technician positions, much of the coursework overlaps with that required for a nursing degree. In fact, some hospitals offer one-year certificate programs to those who already have a nursing degree. Lab technicians perform tests and analysis on collected bodily samples such as blood and tissue. Tests are then used by physicians to determine abnormalities. Although not as fast growing of a field as medical assisting, job prospects continue to be good for medical and clinical lab technicians. Medical Records Technician Like lab technicians, medical records technicians may require some specialized training. But the knowledge gained from a nursing degree can still be put to use. Although they have no direct patient interaction, they do work closely with physicians and other healthcare professionals, and they are responsible for the accuracy of healthcare records. The growing use of electronic health records is fueling the demand for skilled medical records technicians in all areas of the healthcare industry. - Jupiterimages/Photos.com/Getty Images
<urn:uuid:5dba5304-9d06-4faa-b25c-4fa385e9a310>
CC-MAIN-2017-04
http://work.chron.com/things-nursing-degree-license-27411.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.22/warc/CC-MAIN-20170116095120-00050-ip-10-171-10-70.ec2.internal.warc.gz
en
0.959378
517
2.59375
3
|Distribution:||Exposed coastal headlands beaches from the Port Macquarie area to Cape York and Torres Strait islands in Queensland. Also found in Polynesia, Micronesia and Melanesia.| |Common Name:||Screw pine| |Derivation of Name:||Pandanus... Derived from the Indonesian/Malay name of the tree, pandan. tectorius...from Latin, tectorius, a covering (application to this species uncertain). |Conservation Status:||Not considered to be at risk in the wild.| Pandanus is a genus of over 600 species worldwide with about 30 occurring in Australia where they are found in tropical and sub-tropical areas. They are dioecious shrubs or trees (male and female plants) with stems that are much-branched and with aerial roots present, usually in the form of prop roots. |Pandanus tectorius: Growth habit Photo: Murray Fagg - Australian National Botanic Gardens |Pandanus tectorius: Fruit Photo: Brian Walters Pandanus tectorius is a small tree which can reach 5-6 metres in height comprising separate male and female trees. The leaves are linear to about 1 metre in length by 5-8 cm wide with sheathing bases. They emerge from the branches in a screw-like arrangement which gives rise to the common name. The leaves have short spines along the edges and on their midribs. The plants are supported at the base by prop roots which help to anchor the plant in sandy soil. The flowers occur in clusters surrounded by large bracts and plants may flower throughout the year. Female plants produce large pineapple-like fruits comprised, when ripe, of yellow, red or orange segments containing the individual seeds. Parts of the fruit of P. tectorius are edible and it is reported to form a major source of food in Micronesia. The ripe segments of the fruit and the seeds can be roasted and eaten. There are several varieties recognised but P.tectorius var. australianus and P.tectorius var. pedunculatus are the only ones listed in the Australian Plant Name Index for Australia. The taxonomic status of other varieties is uncertain. Screw pine is a hardy plant for tropical, sub-tropical and warm temperate areas where frost is not a problem. It can be grown in most well drained soils in a sunny location and is tolerant of exposed coastal situations. Propagation can be carried out from seed collected from the woody segments of the fruit (which may take up to a year to ripen). Seed does not require pretreatment prior to sowing. Large stem cuttings can also be used for propagation by selecting stems with some aerial roots attached.
<urn:uuid:fc966b7e-cbd2-4ff5-aa55-9796706e1ad7>
CC-MAIN-2016-44
http://anpsa.org.au/p-tec.html
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719784.62/warc/CC-MAIN-20161020183839-00427-ip-10-171-6-4.ec2.internal.warc.gz
en
0.92285
579
3.109375
3