text stringlengths 181 608k | id stringlengths 47 47 | dump stringclasses 3 values | url stringlengths 13 2.97k | file_path stringlengths 125 140 | language stringclasses 1 value | language_score float64 0.65 1 | token_count int64 50 138k | score float64 1.5 5 | int_score int64 2 5 |
|---|---|---|---|---|---|---|---|---|---|
Investigation into the Effect of the Duration of Exposure on the Behaviour of GPC at Elevated Temperatures
University of New South Wales at the Australian Defence Force Academy, School of Engineering and Information Technology, Canberra, Australia
Ordinary Portland Cement (OPC) Concrete has long been used in the construction industry as a primary material owing to its versatility, superior performance, low cost, easy workability and availability of accepted standards of practice. The readily available raw materials for the manufacture of cement, and subsequently for concrete itself, have been a driving force for the acceptance of concrete as a construction material worldwide. Recently however, OPC concrete has come under scrutiny over its large carbon footprint. This is largely due to the energy intensive manufacturing process of cement and the extensive use of virgin material in cement production. Focus is therefore shifting to engineer new construction materials that offer similar advantages to that of OPC concrete while being environmentally friendly. Geopolymer Concrete (GPC) is such a material. It has emerged during the last decades, and has been found to possess excellent engineering properties as well as enormous benefits on the sustainability front. The current study is conducted to investigate the compressive strength of GPC up to temperatures of 1000°C for varying duration of exposure time. It was found that when tested at temperatures of 600°C, 800°C and 1000°C, the GPC samples exhibited a higher compressive strength (8-18%). However, the samples tested after cooling recorded a residual compressive strength 25-50% lower than the ambient strength. Yet, the residual strength of GPC is significantly higher than that of OPC. The duration of exposure time was found to have an insignificant effect on the strength properties of GPC, especially at higher temperatures. Scanning Electron Microscopy (SEM) was used to reveal the changes to the micro-structure that took place after exposure to high temperatures and to get a useful insight into the behaviour of geopolymers.
© Owned by the authors, published by EDP Sciences, 2014
This is an Open Access article distributed under the terms of the Creative Commons Attribution License 2.0, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. | <urn:uuid:6620fca0-aa39-4019-8a11-b98e391d9a5b> | CC-MAIN-2016-44 | http://www.matec-conferences.org/articles/matecconf/abs/2014/02/matecconf_cmss2013_01003/matecconf_cmss2013_01003.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721558.87/warc/CC-MAIN-20161020183841-00044-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.951746 | 459 | 2.46875 | 2 |
London's Air Ambulance has today (March 6th) become the first air ambulance in the UK to carry blood.
Previously, medical teams on-board the service's aircraft and cars were unable to transfuse blood at incident scenes, because of the special containers needed to store blood at a specific temperature.
But extensive research carried out at Barts and the London NHS Trust means aircraft and rapid response cars can now carry four units of O-negative blood in each specially designed box.
The move could help to save the lives of victims of major trauma with catastrophic bleeding.
Dr Anne Weaver, lead clinician for London's Air Ambulance, said: 'For several years we have felt that there was more we could do for patients suffering from serious bleeding.
'We have always provided highly trained, expert teams to care for injured Londoners and today we are pleased to further improve our service by carrying blood.'
London mayor Boris Johnson also welcomed the advance, noting that other medical procedures pioneered by London's Air Ambulance have been adopted around the world.
'It provides a great service across the capital and being able to carry blood on board means the team will be able to save even more lives,' he added.
London's Air Ambulance was founded in 1989 and attends seven incidents every 24 hours, on average. | <urn:uuid:e38eda66-a9b5-42f5-b142-2e0241198ca1> | CC-MAIN-2017-04 | http://www.netdoctor.co.uk/healthy-living/news/a22156/londons-air-ambulance-first-to-carry-blood/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281419.3/warc/CC-MAIN-20170116095121-00487-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.966302 | 272 | 2.8125 | 3 |
Interesting news re SCA2 research
An early-phase clinical trial in people with Spinocerebellar Ataxia Type 2 (SCA2) has tested a potential therapy called human-recombinant erythropoietin (NeuroEPO).
This drug was administered through the nose. The trial found that the 6-month changes in an ataxia score, called the spinocerebellar ataxia functional index, were slightly higher in NeuroEPO group than in the placebo group. However, the NeuroEPO group had a significant decrease in an eye movement measure of reaction time. Overall, these results suggest that NeuroEPO may have a small clinical effect, however further studies are needed on this. | <urn:uuid:61b895da-552e-4bb3-9942-547d5fedf0ae> | CC-MAIN-2022-33 | https://www.livingwithataxia.org/t/sca-2-research-july-2022-neuroepo/8777 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571097.39/warc/CC-MAIN-20220810010059-20220810040059-00268.warc.gz | en | 0.960601 | 155 | 2.359375 | 2 |
The human ncRNA gene RGM249 regulates the extent of differentiation of cancer cells and the conversion of 293FT cells to hiPSCs. To identify the factors underlying this process, we investigated the effects of lentivirally inducing miR-520d expression in 293FT and HLF cells in vitro. Subsequently, we evaluated tumor formation in a xenograft model. Transformed HLF cells were Oct4 and Nanog positive within 24 h, showed p53 upregulation and hTERT downregulation and mostly lost their migration abilities. After lentiviral infection, the cells were intraperitoneally injected into mice, resulting in benign teratomas (6%), the absence of tumors (87%) or differentiation into benign liver tissues (7%) at the injection site after 1 month. We are the first to demonstrate the loss of malignant properties in cancer cells in vivo through the expression of a single microRNA (miRNA). This miRNA successfully converted 293FT and hepatoma cells to hiPSC-like cells. The regulation of malignancy by miR-520d appears to be through the conversion of cancer cells to normal stem cells, maintaining p53 upregulation.
Mature microRNAs (miRNAs; single-stranded 20–23-nucleotide RNA molecules) control the expression of genes involved in many cellular processes1. miRNAs typically reduce the stability of mRNAs, including those encoding genes that mediate tumorigenic processes, such as apoptosis, cell cycle regulation, differentiation, inflammation, invasion and stress responses2. Mammalian miRNAs mediate cellular differentiation and reprogramming and play crucial roles in the initiation and progression of human cancers3. Alterations in miRNA expression can influence tumor growth by targeting and modulating the functional expression of genes that regulate tumor cell apoptosis or proliferation4. miRNAs can serve as tumor suppressors (suppressor miRs) and/or oncogenes (oncomiRs) and their expression has been found to be dysregulated in many malignancies5. miRNA targeting is primarily achieved through specific base-pair interactions between the 5′ ends (‘seed’ region) of miRNAs and target sites within the coding and/or untranslated regions (UTRs) of mRNAs; target sites in the 3'UTR lead to more effective mRNA destabilization6. Because miRNAs frequently target hundreds of mRNAs, miRNA regulatory pathways are complex7. It is extremely difficult to achieve control of a cancer by manipulating a single factor, because cancer cells easily escape from induced chemical, physical and molecular stresses through alternative pathways8. However, miRNAs involved in stemness and the benign state through the simultaneous control of multiple pathways could be expected to curatively convert cancer cells9. Given that the presence or absence of miRNAs plays a critical role in tumorigenic processes and that miRNA expression occurs in a disease-specific manner, miRNAs possess great potential as therapeutic targets and novel biomarkers10.
miRNAs synergistically induce stemness and pluripotency in cancer cells and specifically in 293FT cells11. For example, recent studies in reprogrammed human pluripotent stem cells have suggested that the elevated expression of miR-302 family members influenced the cell cycle transition toward homogeneous proliferation. In vivo studies have shown that miR-302 inhibits the tumorigenicity of human pluripotent stem cells (hPSCs) by enhancing multiple G1 phase arrest pathways, rather than by silencing p21Cip112.
Human miR-520d is a minor miRNA that is involved in HER2/neu receptor-related and osteoblast differentiation, although its function in these processes remains unclear13. miR-520d-5p upregulation was observed to induce suppressive effects and inhibit metastasis when the expression of human RGM249 (which is present on 10p15) was abrogated by gene silencing14. Thus, RGM249 was identified as a candidate miRNA precursor gene that might orchestrate the target genes involved in modulating differentiation, proliferation, malignant alteration or stemness. RGM249 is strongly expressed in poorly differentiated or undifferentiated malignant tumor cell lines (e.g., hepatoma, sarcoma, glioblastoma, thyroid cancer and malignant melanoma) and might play a role in carcinogenesis or the maintenance of differentiation levels. Here we report a novel and striking role for miR-520d-5p in cancer development and stemness in undifferentiated hepatoma cell lines (HLF). In this study, we also analyzed the metabolomics profiles of miR-520d-5p transfectants to evaluate the reprogramming levels, as metabolite levels have been reported to play a role in regulating the epigenetic changes that occur during reprogramming15. Furthermore, we examined a key gene that can interact with miR-520d-5p.
In vitro study of miR-520d-5p-lentivirus-infected HLF
HLF cells that were infected with a miR-520d-5p-expressing lentiviral vector (520d-HLF; hsa-miR-520d-5p-overexpressing HLF) were converted to spherical cell populations of 20–50 cells per 10-cm plate in ReproStem (Fig. 1A; top middle) and were found to express the pluripotent marker Nanog (Fig. 1A; top right). Fig. 1A shows the morphological changes in the HLF cells (top left). Cells that were cultured in RPMI1640 expressed GFP and the pluripotent marker Oct4 (bottom). GFP was used for the identification of transfectants by fluorescence microscopy. In all cases, the transcription of Oct4, Nanog and p53 was upregulated in 520d-HLF cells compared with mock-HLF cells at three days post-transfection. Representative immunocytochemical findings are shown in Fig. 1A. In contrast, the RGM249, CD44 and albumin (Alb) expression levels were significantly downregulated (**: P < 0.01; Fig. 1B). Western blotting showed that the Oct4 and p53 protein levels were upregulated. The expression of activation-induced cytidine deaminase (AID), Alb and Dicer1 were suppressed in 520d-HLF cells (Fig. 1C). In migration assays, most of the pluripotent marker-positive cells could not pass through the fibronectin membranes (5 μg/ml per 6-well dish), whereas mock-HLF cells could pass through easily (Fig. 1D). The 520d-HLF cells also had significantly lower levels of methylation markers (histone deacetylase (HDAC), Sin3A and methyl-CpG binding domain protein 3 (MBD3)) than did the mock-HLF cells (P < 0.01; Supplementary Fig. 2C; bottom). 520d-HLF cells showed a characteristic proliferative network structure (Fig. 1E). A cell cycle analysis of 520d-HLF cells showed increases and decreases in the S and G1/G0 phases, respectively, relative to the mock-HLF cells (Fig. 1F). hTERT (human telomerase reverse transcriptase) and Alb were found to be downregulated in all 520d-HLF clones (n = 9) that had been cultured for more than a month in ES cell medium, compared with the levels in the HLF cells. In contrast, the Oct4 and p53 expression levels were significantly upregulated in 520d-HLF cells and Nanog expression was elevated in eight clones. There were no significant regulatory changes in c-Myc expression. The expression of CSC markers (PROM1) was not significantly different between HLF, hiPSCs (human induced pluripotent stem cells) and 520d-HLF cells (Fig. 1G), but CD44 expression was significantly decreased in 520d-HLF cells (P < 0.01; Fig. 1B). From the PE-positive HLF cells, GFP (+) and alkaline phosphatase (ALP)-PE (+) cells were selected and maintained as immature populations for 2 weeks after sorting (Fig. 1H, Supplementary Fig. 2E). The ALP-PE (+) populations strongly expressed Nanog (Fig. 1I). To confirm whether changes in the expression of these genes provided clues regarding the underlying mechanism, we lentivirally transfected cells with a short interfering RNA (si-520d) that corresponded to miR-520d-5p. We observed that the levels of AID and Nanog expression were the converse of those observed in cases of miR-520d-5p overexpression (520dOE). There was a significant inverse correlation between the Nanog and AID expression levels in the si-520d and 520dOE cells. However, neither p53 nor Oct4 was downregulated in the HLF cells transfected with si-520d (Fig. 1J). The results from the same experiments conducted in 293FT cells (rather than in HLF cells) are shown in Supplementary Fig. 2 and S1.
In vivo study of miR-520d-virus-infected HLF
To examine the correlation of the in vivo results with viral titer-dependent efficacies, 1.0 × 106 HLF cells were infected with 1.0 × 105 to 1.0 × 106 viral copies and athymic KSN/Slc mice were then inoculated with the cells. Infection of cells with 1.0 × 105 (n = 8) or 3.0 × 105 (n = 22) viral copies resulted in the generation of approximately 10-mm or 1-mm undifferentiated hepatomas, respectively, upon inoculation of mice; each mouse in the xenograft model developed a malignant tumor. Tumor volumes were significantly lower in mice that had been inoculated with cells infected with more than 3.0 × 105 viral copies, than in mice received cells infected with 1.0 × 105 viral copies. In contrast, HLF cells that were infected with 1.0 × 106 viral copies (n = 22) did not generate any malignant tumors in mice; each recipient developed a benign tumor. Of the mice that received cells infected with 6.0 × 105 copies (n = 29), two generated homogeneous malignant tumors, one generated a teratoma, one generated homogeneous liver tissue and one generated heterogeneous tissue that comprised both mature undifferentiated tumor cells, which were categorized in pathological terms as a mature teratoma and normal liver tissue, which was partly accompanied by calcification (Fig. 2A). In contrast, 100% of the mock-injected mice (n = 20) had white nodules (histologically undifferentiated hepatoma cells according to hematoxylin and eosin (HE) staining) in the peritoneum or liver (Fig. 2A; right). Only one of 20 mice that received intraperitoneal injections generated an intraperitoneal teratoma; one mouse formed a subcutaneous liver tissue or teratoma (along the injection site) and 18 mice never developed intraperitoneal or subcutaneous tumors or benign tissues. Heterogeneous tissues that comprised mature teratomas and liver tissues were also observed in a mouse that received cells transfected with 6.0 × 105 copies. Thus, a viral dose-dependent suppression of tumorigenicity was observed and the ratio of malignant tumors to all tumors indicated a dose-dependent transition to benignancy (Fig. 2B). In this study, two distinct types of benign tissues, specifically normal liver and mature teratoma-like tumors, were observed subcutaneously or intraperitoneally. These representative tumors comprised normal liver tissue with calcification (top) and a mature teratoma with normal liver tissue (bottom; Fig. 2C). A summarized in vivo study of a sufficient and effective viral titer (1 copy/cell) demonstrated that 7% and 6% of murine recipients developed normal liver tissues and mature teratomas, respectively, whereas those that received mock-HLF cells developed undifferentiated tumors. Overall, among the 520d-HLF-injected mice, 90% (n = 64 of 71; the 71 mice included n = 22 in Fig. 2A that received 1.0 × 106 copies) did not develop tumors, although they did generate benign or normal tissues (n = 7); each of these mice exhibited a benign tumor. Eighty-seven percent of the murine recipients of transfected HLF cells did not form tumors or metastases. Mock-HLF recipients formed multiple peritoneal cavity nodules (Fig. 2D). A mouse that had been inoculated with 520d-HLF cells generated intraperitoneal teratoma tissue (dermoid cyst) over an 8-week period (Fig. 2E, 2H; left, histological specimen with HE staining); during the same period, mice that had been inoculated with mock-HLF cells generated multiple metastatic nodules that comprised undifferentiated cells (Fig. 2F). Other mice that had been inoculated with 520d-HLF generated intraperitoneal teratomas (Fig. 2G; top, HE staining) and subcutaneous liver tissues (Fig. 2G; bottom, HE staining) over an 8-week period (size, >10 mm). The benign liver tissue specimens included the central vein, bile ducts (Fig. 2H; right, white arrow) and hepatic cords (Fig. 2H; second from right). Moreover, in mice, 520d-HLF cells gave rise to teratomas that comprised dermoid cysts with epidermis, sudoriferous glands, sebaceous glands (Fig. 2H; 2nd to left: white arrow) and apocrine-secreting glands over an 8-week period (Fig. 2H; top by HE staining). The generated teratomas and liver tissues expressed GFP protein (Fig. 2I; left, HE and right, GFP, respectively). Other transfected cells did not generate any specific tissues or tumors, including metastatic nodules. ALP and GFP-sorted 520d-HLF cells (R1, R2), which were subsequently used for metabolomic analyses and secretory protein arrays, never generated subcutaneous or intraperitoneal tumors or other tissues in immunodeficient mice. Almost all of the hepatocytes in the liver tissues strongly expressed albumin (hAlb), as determined by immunohistochemical staining (Supplementary Fig. S3A; left). hAlb was used as a differentiated hepatocyte marker and the in vivo results indicated differentiation (Supplementary Fig. S3A; left), whereas the in vitro results revealed an undifferentiated state (Fig. 1B). α-fetoprotein (hAFP), shown in Supplementary Fig. S3A (middle) and the hepatic stellate cell/myofibroblast marker glial fibrillary acidic protein (hGFAP), shown in Supplementary Fig. S3A (right), were weakly expressed, suggesting that 520d-HLF cells differentiated into immature liver tissues (top, 100× and bottom, 400× magnification). Moreover, an in vitro stimulation with 2 μM purmorphamine, an agent that promotes osteoblast differentiation, in RPMI1640 converted 520d-HLF cells to an osteoblast-like phenotype (Supplementary Fig. S3B; top) and induced the significant upregulation of IBSP (osteopontin) and SPP1 expression (bone sialoprotein; P < 0.01; Supplementary Fig. S3C).
We also examined miR-520d-5p-mediated pluripotency induction in Huh7 (well-differentiated hepatoma) cells. Oct4 and Nanog expression in the small round cell population was more elevated compared to that with mock vector induction. Four 7-day infection sessions with 1.0 × 106 copies of the viral vector per 1.0 × 106 cells were required to induce Oct4 and Nanog expression in 520d-Huh7 cells (Supplementary Fig. S3D; top left, GFP and top right, Oct4). The Nanog, p53, Oct4, Lin28 and miR-520d-5p expression levels were upregulated, while the hAlb, AID and RGM249 levels were downregulated (Supplementary Fig. S3D; bottom, see the Supplementary Figure S3D legend for an explanation of the genes examined in this study). Additionally, Oct4, Nanog and p53 expression was upregulated and AID was downregulated in HLF cells transfected with lentiviral expression vectors (FU-tet-hOCT4, Efla_NANOG_Ires-Puro, GFP-p53 and shAID-pLKO.1); the cells transfected with these four expression vectors grew slowly, were similar to 520d-HLF cells in vitro and lost their tumorigenicity in vivo.
The following cell lines were used in this analysis: HLF, mock-HLF, 520d-HLF (5 days after transfection (5D)), 520d-HLF (7 days after transfection (7D)) and 520d-HLF (R1 and R2), sorted with both GFP and alkaline phosphatase (ALP). We first examined the global metabolomic profiles of induced pluripotent cells derived from cancer cells relative to the mock-HLF or 5D cells with cancerous properties that were used as controls. We detected peaks for 165 metabolites (72 cations and 93 anions) in all groups (see Supplementary Fig. S4A for the summarized HMT analysis scheme and Supplementary Fig. S4B and S4C for a heat map and PCA, respectively).
The metabolomic profiles of 520d-HLF, R1 and R2 are very similar, which agrees with the overall genetic, epigenetic and functional similarities that have been reported for these pluripotent cell types. We identified 165 metabolites in this study that showed a greater than two-fold difference (P < 0.01) between the 520d-HLF (5D, 7D, R1 or R2) and mock-HLF cells (5D and 7D). Seventy-six metabolites showed a greater than 1.5-fold difference (P < 0.05) between 7D, R1 or R2 (benign cells) and 5D (malignant cells) (Fig. 3; red or yellow columns indicate quantitative changes of greater than 2.0-fold or 1.5–2.0-fold, respectively). The data indicated high activity with regard to nucleotide synthesis, bioenergetic production, the S-adenosyl methionine (SAM) cycle, glycolysis, the urea cycle and the production of amino acids, such as glutamine; these findings were characteristic of cells with pluripotent or benign properties. We found that the inhibition of oxidative pathways was important to maintain pluripotency. Ketone body production and urea cycle promotion were observed; these functions are mainly observed in the liver. Gluconeogenesis and lipid metabolism were not elevated in these transfectants, indicating that the transformed cells might be immature and nonessential to hepatic development. Generally, the TCA cycle was not elevated in this study, although we found significant elevations in four metabolites (malate, fumarate, succinate and cis-aconitate). Furthermore, other key metabolites were elevated, including GABA(R) and adenosyl methionine.
Measurement of 5-hydroxymethyl-cytosine (5-hmC; %)
The general methylation levels in the transfectants were estimated and indicated slight hypermethylation in 5D and hypomethylation in R1 and R2; in particular, there was almost no methylation in R2 (Fig. 4; top left).
Altered gene expression during the 520d-mediated inductive process in HLF after transfection
During the inductive process from HLF to iPS-like cells, mediated by miR-520d-5p, the expression levels of p53, Nanog and SIRT1 were significantly upregulated (n = 4; *P < 0.05, Mann-Whitney U test), indicating that p53, AID, Nanog and even ELAVL2 expression are correlated with benignancy and/or immaturity (pluripotency; Fig. 4).
Effects of siELAVL2 on HLF cells in vitro or in vivo
ELAVL2 (embryonic lethal, abnormal vision, Drosophila-like 2) was predicted to be a common target candidate of miR-520d-5p, although more than 8000 genes were predicted by the databases DIANA-MICROT, miRDB, MicroRNA.org and TargetScan VERT (Fig. 5A). Four siRNAs (short interfering RNAs) specific for ELAVL2 (siELAVL2) could induce HLF cells to form similar spheroid colonies to those induced by miR-520d-5p (Fig. 5B). Oct4, Nanog and p53 expression were upregulated both transcriptionally (Fig. 5C) and translationally (Fig. 5D) following treatment with the four siELAVL2, suggesting compatibility with the effects of miR-520d-5p. Immunocytochemistry revealed the upregulation of both Oct4 (upper) and Nanog (bottom) in the spheroid colonies (Fig. 5E). We determined whether the upregulation of Oct4, Nanog and p53 and the downregulation of AID resulted in similar outcomes in vivo. After the regulatory protein expression levels were confirmed in transfectants, the cells were inoculated into the right hindquarters of KSN/Slc mice (n = 8); these mice did not generate any tumors. A cell cycle analysis of HLF, pLKO.1-HLF (mock-HLF) and siELAVL2-HLF cells (cultured in RPMI1640 or ReproStem) suggested the conversion to cell populations with homogeneous growth in phases S to G2M in the siELAVL2-HLF cells (Fig. 5F; bottom). These cells formed a network that radiated from scattered spheroid cells (Fig. 5G; top, pLKO.1-HLF as a mock control and bottom, siELAVL2-HLF). A luciferase reporter expression assay demonstrated the suppression of ELAVL2 gene expression by the binding of miR-520d-5p to the 3'UTR of ELAVL2. The ELAVL2 3'UTR sequence (1356–3805) contains 10 putative binding sites for miR-520d-5p (Supplementary Fig. S5) and miR-520d-5p bound to two of the most potent sites (508–525 and 880–894 in the 3'UTR and 1853–1880 and 2235–2249 of ELAVL2 gene) in the ELAVL2 3'UTR, resulting in the inhibition of ELAVL2 translation relative to the controls miR-520d-3p or pLKO.1 (contains a mismatch sequence within miR-520d-5p (see Methods); Fig. 5H). Both synthesized miR-520d-5p and the miR-520d-5p expression vector could specifically reduce ELAVL2 translation by approximately 50–70%, compared to controls transfected with synthesized miR-520d-3p or pLKO.1. A control expression vector that included mismatch sequences within miR-520d-5p did not significantly affect the luciferase expression, which was similar to that of the empty pLKO.1 vector. An in vivo study in mice inoculated with ReproStem-cultured siELAVL2-HLF cells did not result in the formation of tumors, liver tissues or scars (Fig. 5I). Xenografted mice, which received siELAVL2-HLF cells that had been maintained with RPMI1640, generated undifferentiated tumors (2/16), no tumors (4/16), scars (8/16; top in Figure 5I) and differentiated tumors (2/16). The individual cells had swollen and clear nucleoli and cytoplasm with weak basophilia, a vacuole and a fat drop. Many neoplastic cells resembled fibroblasts or myofibroblasts and the presence of a blood vessel system supported the possibility of differentiation. The immature differentiated tumors revealed the possible presence of fibroblasts, myofibroblastic forms, fat drops, collagen fibers, cytoplasmic vacuoles and/or an immature blood vessel system (Fig. 5I; bottom right, 200× HE staining). However, because ELAVL2 expression increased toward the mock level in siELAVL2-HLF, Huh7 or 293FT cells, presumably it was not needed to maintain the undifferentiated status. Additionally, a mouse that received HLF cells with upregulated Nanog and downregulated AID expression generated a small tumor that comprised immature and differentiated regions such as collagen fibers or cytoplasmic vacuoles (1/16).
miR-520d-related dedifferentiation induction in Huh7 cells in vivo
Once per week, we infected cells with viral constructs in vitro. All mock-Huh7 recipients formed well-differentiated hepatomas (Supplementary Fig. S3E; n = 10), but 50% (n = 4) of the mice inoculated with 520d-Huh7 cells after a 1-week transfection generated less-differentiated tumors after a month (Supplementary Fig. S3F; left); the remaining mice did not generate tumors. HE staining (200× magnification) revealed poorly differentiated hepatomas (Supplementary Fig. S3G; left) and poorly-differentiated hepatoma cells (Supplementary Fig. S3G; right). Mice that received the transfection for one month did not generate tumors after one month (n = 4), indicating the induction of dedifferentiation in a dose-dependent manner; however, more time was required for the loss of tumorigenicity in the Huh7 recipients.
Additionally, we examined the tumorigenicity of HLF cells with upregulated Nanog and downregulated AID expression (Fig. 1J; n = 16); these cells led to no tumor formation (n = 15) or small undifferentiated subcutaneous tumors with an immature and differentiated tumor including collagen fibers or cytoplasmic vacuoles, unlike the undifferentiated hepatoma cells. The pathological findings were similar to those of HLF cells treated with siELAVL2 (n = 2; Fig. 5I; bottom). Subsequently, we examined the tumorigenicity of HLF cells with upregulated Oct4, Nanog and p53 and downregulated AID expression in athymic mice; these cells yielded no tumor formation (n = 8). The observed phenotypic changes in HLF cells that were infected with four lentiviral vectors were similar to those observed in 520d-HLF cells in vitro.
Effect of miR-520d-5p on human fibroblasts
NHDF-Neo (left) and Ad (right; Supplementary Fig. S6A; 200× magnification) were infected with a miR-520d-5p-expressing lentiviral vector, as described previously. The transfectants showed no phenotypic changes when compared with parental cells, but they had a longer lifespan (more than three months) until senescence induction than did the parental cells. Immunocytochemistry revealed upregulated Nanog (right) or Oct4 expression (middle) in the miR-520d-5p-expressing fibroblasts (520d-NHDF-Neo and 520d-NHDF-Ad in each; Supplementary Fig. S6B, S6C). To examine the tumorigenicity of the 520d-NHDF-Neo or 520d-NHDF-Ad cells in KSN/Slc mice, transfectants were inoculated into the right hindquarters of KSN/Slc mice. Neither the 520d-NHDF-Neo (n = 8) nor the Ad (n = 8; right) cells generated tumors in mice at 12 weeks post-inoculation (Supplementary Fig. S6D).
miRNAs have been implicated in numerous biological processes16. Accumulating data suggest that miRNA dysregulation occurs frequently in various carcinomas, including those of the lung, colon, stomach, pancreas and liver3,17. Many recent studies have attempted to better understand the roles of miRNAs and reveal the function and importance of miRNA-mediated regulation in cancer and normal cells18. Aberrant miRNA expression profiles that correlate with particular tumor phenotypes can also be used to distinguish between normal tissues and tumors19. Perturbations of miRNA expression levels might also lead to anti-tumorigenesis20. Thus, the dual effects of miRNAs in carcinogenesis and normal stem cell differentiation strongly suggest that miRNAs might be involved in the transformation of normal stem cells to CSCs. Although our current understanding of miRNA functions remains incomplete, this study has helped elucidate the intricate roles of miRNAs in the regulation of cellular processes such as differentiation, reprogramming and oncogenesis.
This is the first study to provide evidence that a single miRNA can convert malignant or immortalized cells to benign or normal cells. The stemness-mediated process does not necessarily result in normal cells, but normal hiPSCs form teratomas in vivo21,22,23 and it was thought that tumorigenicity might cause methylation in cells prior to developmental growth24,25,26. In this study, western blotting and RT-PCR were used to show that p53 was stably upregulated in both miR-520d-5p-lentivirus-infected 293FT cells (520d-293FT; hsa-miR-520d-5p-overexpressing 293FT) and 520d-HLF cells, unlike the p53 levels in hiPSCs (Figure 1, Supplementary Fig. S2). High titers (600,000–1,000,000 copies) of the miR-520d-5p-expressing lentiviral vector increased the efficacy of this induction through stable changes in translational regulation (Figure 2). Compared to the mock virus-infected 293FT (mock-293FT) and mock-HLF cells, the DNA contents of the 520d-293FT and 520d-HLF cells were increased in the subG1 and S phases, respectively (Figure 1F, Supplementary Fig. S1A). A comparative analysis of the DNA methylation patterns in 520d-293FT and 520d-HLF cells showed the reverse pattern (Supplementary Fig. S1C), presumably due to differences in the cell differentiation levels. AID, which binds to the promoter regions of Nanog or Oct4 and regulates pluripotency, was downregulated in both cell types, compared to the parental cells. However, in culture conditions intended to maintain undifferentiated cells, post-transfection AID expression was upregulated in 520d-293FT and downregulated in 520d-HLF cells, indicating the AID-independent regulation of pluripotent markers (Oct4 and Nanog), as these proteins were upregulated in both cell types27. Many cancer cells also express Oct4 and Nanog and there are many similarities between cancer cells and embryonic stem cells in terms of the stemness process28. However, many types of cancer cells downregulate p53 and cannot generate teratomas or original tissues in vivo. DNMT1 (DNA (cytosine-5-)-methyltransferase), which is upregulated in preneoplastic lesions and poorly differentiated tumors, was also downregulated29 and a compensatory HDAC dysregulation was possibly induced because DNMT1 could not bind to HDAC. Sin3A upregulation might repress Myc and thus exert an anti-oncogenic effect on 293FT cells30. The crucial step toward normal methylation or epigenetic modification might be the suppressive regulation of AID and DNMT1, as both proteins play important roles in carcinogenesis and cancer progression24,25,26,27. It is possible that either a DNMT or an AID inhibitor alone could reprogram mouse fibroblasts to iPSCs without viral induction, but this has not yet been achieved and we think that AID might be a crucial factor in the reprogramming of cancer cells such as KLM-1, PK9, PK-45p or HT1080, as well as HLF, because AID expression might negatively regulate Oct4, Nanog and p53 (Figure 6).
miR-520d-5p converted even well-differentiated hepatoma cells (Huh7) to non-tumorigenic cells via less-differentiated and tumorigenic hepatoma cells. A stringent conditioning regimen directed toward differentiation should be determined because the histology of the generated tissues was almost homogeneous and the outcomes of the diverse phenotypes (teratoma, hepatic tissue or no tumor formation) in vivo might depend on the reprogramming level and/or p53 expression levels. Additionally, the metastatic properties of 520d-HLF were suppressed in vitro and in vivo. The DNA percentage of 520d-HLF cells was increased in the S phase; this result might be compatible with a report in which mir-302a/b/c/d coexpression drove homogeneous proliferation without apoptosis and enhanced the G1 phase pathways31. This unexpected conversion to normal liver tissues implies therapeutic potential against well-differentiated and poorly differentiated hepatomas.
Similarly, the regulation of malignancy by miR-520d-5p in other cancers appears not to be caused by a loss of metastatic properties but by the conversion of cancer cells to normal stem cells through a dedifferentiation process and the maintenance of upregulated p53 levels; this has not been observed previously in hiPSCs (Fig. 4)32. Differences between the normal liver tissues and benign teratomas (dermoid cysts) might depend on the cellular miR-520d-5p or p53 expression levels. In vivo, the upregulation of Oct4, p53 and RGM249 and the downregulation of c-Myc, hTERT and Alb expression were characteristic genetic changes. The PROM1 expression levels did not change significantly33, but the downregulation of CD4434 and upregulation of CD90, CD105 and CD13, which are mesenchymal stem cell markers, were significant at the transcriptional level (P < 0.01)35. This study further indicates that the miR-520d-5p overexpression in HLF cells downregulated Dicer1 expression, although the opposite was observed in 293FT cells. Major regulators of miRNA biogenesis (e.g., Dicer and Drosha) are downregulated in cancer cells36, suggesting that the miRNA regulatory mechanisms and requirements might be different in cancer cells and 293FT cells and these differences might be required to reprogram cancer cells and suppress miRNA biogenesis.
The optimal conditions for the induction of each phenotype from HLF in vivo remain undetermined, although these inductions are assumed to be associated with reprogramming states or the homogeneity of the cellular states37. In the in vivo study, infection of HLF cells with a sufficient lentiviral titer induced the generation of homogeneous benign or normal tissues, whereas HLF cells infected with virus at an insufficient titer induced the generation of heterogeneous tissues that comprised two populations (normal liver tissue and mature teratoma); we therefore concluded that lentiviral integration did not promote the differentiation of transfectants into diverse phenotypes and that sufficient transfection efficiencies would reproducibly induce the transition of malignant cells to benign or normal states. In vitro, 520d-HLF differentiated into osteoblasts38, suggesting differentiation into mesodermal tissue. Additionally, these cells demonstrated differentiation into endodermal (liver tissue) and ectodermal (epidermis) tissues in vivo, indicating that 520d-HLF the homogeneously converted to hPSCs, not CSCs. Surprisingly, undifferentiated cancer cells with strong metastatic and chemotherapy-resistant properties also converted to normal liver tissues. In a preliminary study of other types of undifferentiated malignant cells (glioblastoma multiforme, anaplastic thyroid cancer, pancreatic cancer and fibrosarcoma cells), we confirmed no tumor formation, the loss of malignant properties and ductal cell carcinoma conversion to pancreatic acinar cells or lipid-producing cells despite a presumably similar mechanism as that involved in the miR-520d-5p-induced conversion of HLF (data not yet available). These malignancies might be treated easily with miR-520d-5p, although they are known clinically to be extremely intractable malignancies. miR-520d-5p induction might be more sensitive in CSC because undifferentiated malignancies should contain CSCs.
Although Nanog or Oct4 can bind to the DNMT1 promoter region to drive transcriptional upregulation39, DNMT1 expression was downregulated during this conversion in the current study. Methylation or demethylation might not be crucial events in the maintenance of pluripotency or the upregulation of p53. Although AID upregulation induces p53 mutations in somatic cells, leading to p53 downregulation and subsequent carcinogenesis40, AID downregulation might play a part in p53 upregulation; however, the mechanism of p53 upregulation remains unclear. Unlike miR-520d-5p, siAID alone was not able to induce a phenotypic change. Gene-specific hypermethylation might silence developmentally related genes, leading to dedifferentiation41. The measurement of 5-hydroxymethyl-cytosine (5-hmC) revealed a more hypomethylated status in 7D, R1 and R2 and slight hypermethylation in 5D (Fig. 4)42. Therefore, we propose a mechanism for how this miRNA induces the upregulation of both Nanog and Oct4 in normal cells and cancer cells, as shown in Fig. 6.
In a previous report, a comparative metabolomic analysis of ESCs and iPSCs revealed similar differences in the levels of metabolites that are involved in transmethylation, cellular respiration and energy production; however, the S adenosylmethionine (SAM) cycle includes 5′-methylthioadenosine, hypoxanthine and inosine, which drive the methylation process and all of these were significantly elevated in iPSCs compared with ESCs. Additionally, adenosyl methionine decarboxylase (AMD1) plays a crucial role in the renewal of normal stem cell pluripotency43. The methyl group belonging to SAM is the most common substrate in transmethylation reactions such as DNA methylation15. Additionally, the fatty acid (ω-3 and ω-6) levels were elevated in ESCs. In other words, the unsaturated fatty lipid levels were lower in iPSCs than in ESCs. In somatic cells, the oxidative: glycolytic energy production ratios were close to those in iPSCs. However, the oxidative: glycolytic energy production ratios in 520d-transfectants were lower than those in iPSCs. According to a comparative metabolic analysis of laser-dissected normal tissues and colon or gastric cancer tissues, the TCA cycle metabolites were not significantly elevated in the normal tissues44. Additionally, increased levels of citric acids in the TCA cycle lead to the suppression of glycolysis, but the citric acid levels were not found to be significantly increased in this study, suggesting that glycolysis was occurring. Thus, comparative metabolic profiling of the transfectants with malignant properties and with normal or benign properties showed that glycolysis, the urea cycle and amino acid synthesis were promoted, indicating the possibility that HLF cells might be converted to cells with stemness and immature somatic properties because the profile results were compatible with those of previous reports. Given that the bioenergetics of various somatic cells correlated with their reprogramming efficiencies15, these findings might be applicable to cancer cells derived from somatic cells; more immature hepatomas might revert more easily to normal pluripotent cells with somatic properties because more immature cancers have higher bioenergetic levels. However, changes in the activities of different pathways such as glycolysis, nucleotide synthesis and the urea cycle cannot be ascertained from differences in the total metabolite statuses between different cell types alone and therefore the use of stable isotope tracers, coupled with metabolomics analysis, must be conducted to warrant conclusions on metabolic pathway activity in future studies. This is because a given metabolite, such as lactate or ATP, can be synthesized from or consumed by a number of different pathways. Without isotope tracing, it would not be possible to confirm that lactate accumulation comes from glycolysis or that ATP buildup results from de novo nucleotide synthesis. Moreover, the majority of lactate produced during glycolysis is expected to be released into the medium, which was not analyzed in this report; also, the total ATP level is most likely sustained by oxidative or substrate-level phosphorylation (not measured in this report). Therefore, the present data only showed a tendency with regard to the difference between the malignant properties and benign properties of 520d-HLF cells. However, there might be a meaningful relationship between the overall reduced metabolism in 5D cells and the progression of demethylation (Figure 3, 4 & Supplementary Fig. S3H).
ELAVL2 (HuB) might be a target gene of miR-520d-5p. ELAVL2 is predicted to contain ten binding sites for miR-520d-5p (Supplementary Fig. S5) in its 3'UTR sequence (1356–3805), suggesting that miR-520d-5p and siELAVL2 might bind at least two sites in the 3'UTR. ELAVL2 might play a crucial role in carcinogenesis or cancer stemness because transfectants (by miR-520d-5p or siELAVL2) that were cultured in ReproStem for more than two weeks did not generate tumors. The upregulation of p53, as well as Oct4 and Nanog, was induced by miR-520d-5p and siELAVL2 in an AID- or DNMT1-independent manner. Additionally, a month was required (four times at 1.0 × 106 copies/week) to convert well-differentiated hepatoma cells (Huh7) to non-tumor forming cells, suggesting that miR-520d-5p might drive transfectants strongly toward dedifferentiation. Additionally, 520d-5p overexpression in fibroblasts (both NHDF-Ad and Neo) did not induce the formation of spheroid pluripotent cells in vitro or promote the acquisition of tumorigenicity in these cells (n = 6 for each; Supplementary Fig. S6D).
In conclusion, herein, we did not elucidate the target gene of miR-520d-5p. However, we report a noteworthy function of hsa-miR-520d-5p and describe presumably key roles for p53, AID, Nanog and the miR-520d-5p target genes, including ELAVL2, TEAD1, SBF2, PUM2, GATAD2B and SEH1L, in the benign conversion process (Fig. 5), in which well-differentiated and undifferentiated hepatoma cells were converted to normal/benign phenotypes via stemness induction, resulting in a reversal of malignancy in vivo. At present, we cannot explain these phenomena with regard to gene expression and metabolite production. Hence, this report contains speculations derived from raw data. Although the notion that cancerous cells cannot revert to their original, healthy, states is widely accepted, this idea might no longer be valid.
To determine the in vitro and in vivo effects of hsa-miR-520d-5p expression, we used two cell lines and lentiviral vectors. hiPSCs (HPS0001 and HPS0002) and hepatoma cells (HLF and Huh7) were provided by the RIKEN BioResource Center Cell Bank45 and the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer Tohoku University, respectively. Poorly differentiated or undifferentiated (HLF) and well-differentiated (Huh7) human hepatoma cell lines with strong and weak RGM249 expression, respectively, were cultured in RPMI1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin. To maintain the undifferentiated states of virus-transformed cells, the cells were cultured in ReproStem medium (ReproCell, Tokyo, Japan) with 10 ng/ml of bFGF-2. To examine the effects of miR-520d-5p on normal human dermal fibroblasts in vitro and in vivo, we used adult NHDF (NHDF-Ad) and neonatal NHDF (NHDF-neo) cells (TAKARA BIO, Tokyo, Japan) and cultured them with the FGM-CD Bullet Kit (TAKARA BIO). Additionally, for comparison with HLF cells or hiPSCs, the human mesangial cell line 293FT (Invitrogen Japan K.K., Tokyo, Japan) was used for its potent facility for hiPSC induction, as previously reported46. 293FT cells were cultured in DMEM supplemented with 10% FBS, 0.1 mM MEM non-essential amino acid solution, 2 mM L-glutamine and 1% penicillin/streptomycin.
Lentiviral vector construct
To examine the effects of miR-520d-5p overexpression, we transfected pMIRNA1-miR-520d-5p/GFP (20 μg; System Biosciences, Mountain View, CA, USA) or the mock vector pCDH (20 μg) into 293FT and HLF cells (5 × 106 cells/10 cm culture dish). To investigate the effects of miR-520d-5p silencing, we transfected pRNATinH1.4/Lenti-520d-5p (20 μg; Genscript, Piscataway, NJ, USA) or the mock vector pRNATinH1.4/Lenti (20 μg) into HLF cells. To harvest viral particles, the cells were centrifuged at 170,000 × g (120 min, 4°C). The viral pellets were collected and viral copy numbers were measured with a Lenti-X™ qRT-PCR Titration kit (Clontech, Mountain View, CA, USA). For 293FT or HLF cell infection, one million lentiviral copies were used per 10-cm culture dish. We transfected 50 nM synthesized oligonucleotides into 293FT cells with FuGENE HD Transfection Reagent (Roche Diagnostics, Basel, Switzerland). To confirm the induction of 520d-HLF differentiation into osteoblasts, the cells were treated with 2 M purmorphamine in routine RPMI1640 medium for one week. To confirm the status of ELAVL2 as a candidate target gene of miR-520d-5p, four siRNAs (AAD63-B9, 10, 11 and 12) specific for ELAVL2 (shELAVL2-pLKO.1) were purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). pLKO.1 and scramble siRNAs were used as controls. The siRNAs were transfected together into HLF cells via lentiviral constructs according to the optimized method. The representative gene expression levels in HLF cells that were treated with si-520d or 520dOE via pRNATinH1.4/Lenti or pMIRNA/Lenti/GFP, respectively, are shown. To estimate the effects of doxycycline-treated si-520d or 520dOE, doxycycline-untreated HLF cells or pCDH/lenti/GFP-treated cells were used as controls. To confirm the effects of Oct4, Nanog and p53 upregulation and AID downregulation in HLF cells, lentiviral vectors (FU-tet-hOCT4, Efla_NANOG_Ires-Puro and GFP-p53) were purchased from Addgene (Cambridge, MA, USA), while shAID-pLKO.1 was purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). The ELAVL2-specific shRNA was purchased from Genecopoeia (Rockville, MD, USA). The siRNA sequences for ELAVL2 were as follows: B9, 5′-ccgugacuuuaacaccautaa-3′; B10, 5′-cgcauuauuacuucucguauu-3′; B11, 5′-gucuccuuuaagacaaacaaa-3′ and B12, 5′-gcuucuaucagagaugcaaau-3′. The scrambled sequences for miR-520d-5p and ELAVL2 were 5′-gaguccgcctcuatagacaa-3′ and 5′-auucguuguuauugu-3′, respectively.
Immunodeficient mice and in vivo experiments
After a 1-week lentiviral infection, 5 × 107 HLF cells were harvested and injected intraperitoneally or subcutaneously into the right flank (injection volume, 200 μl) of each mouse. Six-week-old immunodeficient mice (KSN/Slc; Shimizu Laboratory Supplies, Kyoto, Japan) were fasted for 24 hours before the experiments but were allowed free access to water and feed for 4–12 weeks after the injections; subcutaneously injected mice (n = 51) were observed for 4–8 weeks, while intraperitoneally injected mice (n = 20) were observed for 8 weeks prior to anesthetization with 100 mg/kg Nembutal and then sacrificed for anatomic and histological examinations. Prior to the endpoint, 59 mice were inoculated subcutaneously in a dose-dependent manner (8 mice for a 10% transduction efficiency, 22 for 30% and 29 for 60%). Next, 20 mice received 520d-HLF cells that had been sorted for ALP and GFP positivity to examine the influence of differences in culture conditions between media that maintained the undifferentiated status and RPMI1640/10% FBS. Tumor volumes were determined according to the following formula: volume = π/6 × width × length × height. To examine the conversion of well-differentiated hepatoma cells (Huh7) to pluripotent cells with concomitant p53 upregulation or examine the effects of miR-520d-5p on human fibroblast cell lines, an in vivo study was performed in immunodeficient mice. After transfection with the same viral vehicle titer used in the previous in vivo study with HLF cells, the tumorigenicities of the transfectants (520d-5p-Huh7, 520d-5p-NHDF-neo and 520d-5p-NHDF-ad) were confirmed at one week or one month after inoculation for 520d-5p-Huh7 or at three months for 520d-5p-NHDFs.
All animals were housed and fed in the Division of Laboratory Animal Science of Tottori University under a protocol that was approved by the Japanese Association for Accreditation for Laboratory Animal Care and the animal research and handling were performed in strict conformance with federal Institutional Animal Care and Use Committee guidelines. All experiments reported in this study were approved by an institutional committee.
Total RNA, inclusive of the small RNA fraction, was extracted from cultured cells or homogenized mouse tissues with the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA). Mature miRNAs were quantified with a Mir-X™ miRNA qRT-PCR SYBR kit (Clontech) according to the manufacturer's instructions. miRNA (25 ng/μl) was quantified with a Mir-X miRNA qRT-PCR SYBR Kit (Takara Bio Inc., Tokyo, Japan) to confirm siRNA suppression and evaluate changes in miRNA expression. Gels were run under the same experimental conditions. PCR and data collection analyses were performed with a BioFlux LineGene (Toyobo, Nagoya, Japan). The expression levels in the samples were determined according to the standard curve method. All data, except those for hTERT, were normalized to the internal control β-actin. hTERT expression was estimated from the copy number, according to a previously developed quantification method47. U6 small nuclear RNA was used as an internal control. Total RNA (50 ng/μl) was reverse transcribed and amplified with the OneStep RT-PCR kit (Qiagen, Tokyo, Japan). RNA quantification was confirmed by high-reproducibility sequencing. Supplementary Table S1 shows the primer sequences that were used for mRNA or miRNA quantification. The data were analyzed statistically with a one-way ANOVA or Mann-Whitney U test and significant differences are shown as *: P < 0.05 and **: P < 0.01.
We performed western blotting with 20 μg/μl of proteins and the i-Blot gel transfer system (Invitrogen, Tokyo, Japan). Anti-hTERT, p53, Oct4, DICER1, AID, albumin (Alb) and ELAVL2 antibodies were used at 1:500 dilutions and the anti-β-actin antibody was diluted 1:1,000 according to the manufacturer's instructions. Chemiluminescent signals were detected within 1 min with LAS-4000 (Fujifilm, Tokyo, Japan). The gels were run under the same experimental conditions.
The invasive abilities of transfectants were estimated with a CIM-Plate 16, which detects cell invasion/migration in real time, according to the manufacturer's instructions (xCELLigence system, Roche, Basel, Switzerland).
The immunohistochemical examination was performed with antibodies to detect pluripotent markers (anti-Oct4 or anti-Nanog) and with an Embryonic Stem Cell Marker Antibody Panel, according to the manufacturer's instructions (R&D Systems, Minneapolis, MN, USA). 293FT, Huh7 and HLF cells were infected with lentiviral particles that contained hsa-miR-520d-5p. Floating transfectants were harvested and transferred to new culture dishes for microscopic examinations or to slide chambers for immunostaining.
During the immunohistochemical analyses, 4% paraformaldehyde-fixed liver tissue specimens were processed48. The following monoclonal antibodies were used: anti-hAlb, anti-hAFP and anti-hGFAP (Sigma, St Louis, MO, USA). As a negative control, tissues were stained without the primary antibody. A pathologist estimated the degree of protein expression.
Cell cycle and cell sorting analysis
Cell cycle analysis and cell sorting were conducted to confirm that the 520d-293FT and 520d-HLF cells comprised pluripotent cell populations. The DNA content was analyzed with a flow cytometer (Epics Altra; Beckman Coulter Inc., CA, USA); the cells were assessed from approximately 20,000 collected events after the transfection of a pMIRNA1-miR-520d-5p/GFP clone, using EXPO32 ADC Analysis software. GFP-positive cells were sorted on a Moflo XDP cell sorter (Epics Altra; Beckman Coulter Inc.). In detail, for cell cycle analysis, a single cell suspension was washed once with cold PBS. The cell pellet was loosened by shaking the tube gently and was fixed with 3.7% formalin in ddH2O, added dropwise. The cells were then incubated at least overnight at −20°C. After fixation, the cells were washed twice with cold PBS to remove the EtOH, resuspended at 1 × 106 cells/ml in PBS with 100 U/ml RNaseA and incubated for 50 min at 37°C. Next, 50 μg/ml of propidium iodide were added and the mixture was incubated for 40 min on ice in the dark. The DNA content was analyzed with a flow cytometer; the cells were assessed from approximately 20,000 collected events after the transfection of a pMIRNA1-miR-520d-5p/GFP clone, using the EXPO32 ADC Analysis software. GFP-positive cells were sorted on a Moflo XDP cell sorter.
Next, the flow cytometric purification of GFP-expressing or PE-positive cells was performed. The cells were maintained in an immature state for two weeks after viral transduction. 293FT and HLF cells were resuspended in PBS with 5% FCS. After the cells were stained with a PE-conjugated anti-ALP antibody, GFP or PE-positive cells were sorted and analyzed on a Moflo XDP cell sorter against an argon laser (488 nm, 100 mW). A total of 1 × 108 cells were analyzed for forward scatter, side scatter and PE and GFP fluorescence. The FL1 and FL2 channels were used to detect GFP and PE, respectively.
Lung, liver, intraperitoneal or postperitoneal metastases and tumor volumes were investigated macroscopically or under a dissecting microscope with bright-field imaging. Tissue samples were fixed in 10% buffered formalin overnight, washed with PBS, transferred to 70% ethanol, embedded in paraffin, sectioned and stained with hematoxylin and eosin (HE).
Fluorescence detection in cells
To estimate the efficacy of infection with the miR-520d-5p-expressing lentiviral vector, GFP expression was detected with an OLYMPUS IX71 microscope and TH4-100 power supply for the microscope (Tokyo, Japan).
Target prediction of specific miRNA
Algorithms were used to predict the specific miRNA targets (Cosmo Bio, Tokyo, Japan). Fig. 5A shows the predicted target genes of hsa-miR-520d-5p. For the Venn diagram, we used the following databases: TargetScanHman6.0 (http://www.targetscan.org/vert_60/), microRNA.org (http://www.microrna.org/microrna/getMirnaForm.do), Pictar (http://pictar.mdc-berlin.de/), RNA hybrid (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html) and miRBase (http://www.mirbase.org/).
Metabolomic analysis and sample preparation
To examine the metabolic profiles associated with induced pluripotency accompanied by non-cancerous properties, we used an untargeted metabolomics approach to analyze the relative abundances of metabolites in normal or pluripotent cells derived from human hepatoma cells (HLF). The quantified measurements and analysis of approximately 900 metabolites were performed by Human Metabolome Technologies (HMT; Tsuruoka, Yamagata, Japan). The following cell types were used in this study: HLF, mock-HLF, 520d-HLF (5D), 520d-HLF (7D) and 520d-HLF (R1 and R2) sorted with both GFP and alkaline phosphatase (ALP). In detail, the five days post-transfection group (5D) presented with malignant tumors in vivo, whereas 7D, R1 (cells sorted with pluripotent markers and GFP that led to teratoma formation or normal liver tissue development) and R2 (cells sorted with pluripotent markers and GFP that led to no tumor development) presented with benign phenotypes in vivo. CE-TOFMS was conducted using an Agilent Capillary Electrophoresis System equipped with an Agilent 6210 Time of Flight mass spectrometer, an Agilent 1100 isocratic HPLC pump, an Agilent G1603A CE-MS adaptor kit and an Agilent G1607A CE-ESI-MS sprayer kit (Agilent Technologies, Waldbronn, Germany). LC-TOFMS was conducted on an Agilent 1200 HPLC pump equipped with an Agilent 6210 Time of Flight mass spectrometer (Agilent Technologies). These systems were controlled by the Agilent G2201AA ChemStation, version B.03.01, for CE and MassHunter for LC software packages (Agilent Technologies). Data acquisition was performed with Analyst QS Build: 7222 software for the Agilent TOF (Applied Biosystems, Foster City, CA, USA/MDS Sciex, Ontario, Canada).
Measurements of the extracted metabolites were performed using CE-TOFMS as described previously49 with a commercial electrophoresis buffer (Solution ID H3302-1021; Human Metabolome Technologies Inc., Tsuruoka, Japan). Peak extraction was conducted with a modified version of the open source software MathDAMP50. Peak alignment was performed according to the m/z values and normalized migration times. Next, the peak areas were normalized against those of the internal standards MetSul and CSA for cationic and anionic metabolites, respectively. The resulting relative area values were further normalized to the sample amount (105 cells) and the average values were calculated for each group. Annotation tables were produced from the CE-TOFMS and LC-TOFMS measurements of standard compounds and aligned with the datasets according to similar m/z values and shifts in the retention times of the LC-TOFMS measurements. Student's t test was used for comparisons of compound levels between sample groups. The metabolic pathway map used was the Analysis of Networks containing Experimental Data (VANTED, http://vanted.ipk-gatersleben.de/)51. To examine the metabolic profile associated with induced pluripotency accompanied by non-cancerous properties, we used an untargeted metabolomics approach to analyze the relative abundances of metabolites in normal or pluripotent cells derived from HLF.
Measurement of 5-hydroxymethyl-cytosine (5-hmC; %)
5-Hydroxymethlyl-cytosine was measured in HLF, mock-HLF and 520d-HLF cells (3D, 5D, 7D, R1 and R2; 200 ng each) with the MethylFlash Hydroxymethylated DNA Quantification kit (Colorimetric) according to the manufacturer's instructions (EPIGENTEK, Farmingdale, NY, USA).
Estimation of ELAVL2 as a target gene of miR-520d-5p
Based on the predicted target genes of miR-520d-5p (MIMAT0002855: cuacaaagggaagcccuuuc) according to various databases (miRBase; http://www.mirbase.org, DIANA-MICROT; http://diana.cslab.ece.ntua.gr/DianaTools/, miRDB; http://mirdb.org, RNA22-HAS; http://cm.jefferson.edu/rna22v1.0, TargetMiner; http://www.isical.ac.in/~bioinfo_miu, mircoRNA.org; http://www.microrna.org/microrna and TargetScan-VERT; http://www.targetscan.org/cgi-bin/targetscan/vert_50) and after confirming gene downregulation by RT-PCR, we examined gene expression in cells transfected with four types of siRNAs against ELAVL2 (siELAVL2-HLF; see the lentiviral vector construct section) and compared this with gene expression in 520d-HLF cells. We performed RT-PCR, western blotting, immunocytochemistry and cell cycle analysis as described previously. To investigate the binding of miR-520d-5p to the 3'UTR of ELAVL2, sequences (or mock mismatch sequences) that corresponded to predicted sites were ligated into the multiple cloning site (MCS; PmeI and XhoI) of psiCHECK-2 (Promega KK, Tokyo, Japan). The signals were detected with a dual luciferase reporter expression assay (Promega KK, Tokyo, Japan). Synthesized miR-520d-5p (MBL, Nagoya, Japan) or pMIR-520d-5p were co-transfected into HLF cells with each prepared expression vector. Synthesized hsa-miR-520-3p (MBL, Nagoya, Japan) or pLKO.1 (Addgene, Cambridge, MA, USA) with the mismatch sequence were used as controls. Forty-eight hours after transfection, the luciferin expression (RLU) was measured on an Infinite F500 (TECAN, Männedorf, Switzerland). RLU (renilla/firefly) activity was standardized to that of a control (n = 4). siELAVL2-HLF cells were injected into the right hindquarters of immunodeficient mice that were fed routinely for two months and observed for tumorigenicity and estimations of tumor quality.
The following four pairs of sequences were inserted into psiCHECK-2: ELAVL2-3'UTR sense 1, 5′-TCGAGAACAGTATTTATTTTGTAAGTTT-3′; ELAVL2-3'UTR antisense 1, 5′-AAACTTACAAAATAAATACTGTTC-3′; ELAVL2-3'UTR sense mock 1, 5′-TCGAGAACAGTATTaaTATTTTGTAAGTTT-3′; ELAVL2-3'UTR antisense mock 1, 5′-AAACTTACAAAATAttAATACTGTTC-3′; ELAVL2-3'UTR sense 2, 5′-TCGAGACGTCCTGCTTTTTGTAGTTT-3′; ELAVL2-3'UTR antisense 2, 5′- AAACTACAAAAAGCAGGACGTC-3′; ELAVL2-3'UTR sense mock 2, 5′- TCGAGACGTCCTGCaaTTTTTGTAGTTT-3′; and ELAVL2-3'UTR antisense mock 2, 5′-AAACTACAAAAAttGCAGGACGTC-3′.
A Mann-Whitney U test or one-way ANOVA was used for comparisons between the control, mock and miR-520d-5p or si-520d groups with one observed variable. P < 0.05 was considered significant (*: P < 0.05, **: P < 0.01). In the box plots, the top and bottom of each box represent the twenty-fifth and seventy-fifth percentiles, respectively, thus providing an interquartile range. The line through the box indicates the median and the error bars indicate the fifth and ninety-fifth percentiles.
Lee, Y. et al. MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, 4663–4670 (2002).
Zeng, Y. & Cullen, B. R. Sequence requirements for micro RNA processing and function in human cells. RNA 9, 112–123 (2003).
Farazi, T. A., Spitzer, J. I., Morozov, P. & Tuschl, T. X. miRNA in human cancer. J. Pathol. 223, 102–15 (2011).
Guo, H., Ingolia, N. T., Weissman, J. S. & Bartel, D. P. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466, 835–840 (2010).
Lee, Y. S. & Dutta, A. MicroRNAs: small but potent oncogenes or tumor suppressors. Curr. Opin. Investig. Drugs 7, 560–564 (2006).
Lai, E. C. Micro RNAs are complementary to 3′ UTR sequence motifs that mediate negative post-transcriptional regulation. Nat. Genet. 30, 363–364 (2002).
Saetrom, O., Snøve, O., Jr & Saetrom, P. Weighted sequence motifs as an improved seeding step in microRNA target prediction algorithms. RNA 11, 995–1003 (2005).
Meltzer, P. S. Cancer genomics: small RNAs with big impacts. Nature 435, 745–746 (2005).
Calin, G. A. et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci USA 101, 11755–11760 (2004).
Lu, J. et al. MicroRNA expression profiles classify human cancers. Nature 435, 834–838 (2005).
Li, Z., Yang, C. S., Nakashima, K. & Rana, T. M. Small RNA-mediated regulation of iPS cell generation. EMBO J. 30, 823–834 (2011).
Lin, S. L. et al. Mir-302 reprograms human skin cancer cells into a pluripotent ES-cell-like state. RNA 14, 2115–2124 (2008).
Lowery, A. J. et al. MicroRNA signatures predict oestrogen receptor, progesterone receptor and HER2/neu receptor status in breast cancer. Breast Cancer Res. 11, R27 (2009).
Miura, N. et al. A noncoding RNA gene on chromosome 10p15.3 may function upstream of hTERT. BMC Mol. Biol. 2, 10:5 (2009).
Panopoulos, A. D. et al. The metabolome of induced pluripotent stem cells reveals metabolic changes occurring in somatic cell reprogramming. Cell Res. 22, 168–177 (2012).
Ghildiyal, M. & Zamore, P. D. Small silencing RNAs: an expanding universe. Nat. Rev. Genet. 10, 94–108 (2009).
Ladeiro, Y. et al. MicroRNA profiling in hepatocellular tumors is associated with clinical features and oncogene/tumor suppressor gene mutations. Hepatology 47, 1955–1963 (2008).
Farazi, T. A., Hoell, J. I., Morozov, P. & Tuschl, T. MicroRNAs in human cancer. Adv. Exp. Med. Biol. 774, 1–20 (2013).
He, L. et al. A microRNA polycistron as a potential human oncogene. Nature 435, 828–833 (2005).
Goodarzi, H., Elemento, O. & Tavazoie, S. Revealing global regulatory perturbations across human cancers. Mol. Cell 36, 900–911 (2009).
Okita, K., Ichisaka, T. & Yamanaka, S. Generation of germline-competent induced pluripotent stem cells. Nature 448, 313–317 (2007).
Fujioka, T. et al. Establishment of induced pluripotent stem cells from human neonatal tissues. Hum. Cell 23, 113–118 (2010).
Yehezkel, S. et al. Reprogramming of telomeric regions during the generation of human induced pluripotent stem cells and subsequent differentiation into fibroblast-like derivatives. Epigenetics 21, 6 (2010).
Bhutani, N. et al. Reprogramming towards pluripotency requires AID-dependent DNA demethylation. Nature 463, 1042–1047 (2010).
De Carvalho, D. D., You, J. S. & Jones, P. A. DNA methylation and cellular reprogramming. Trends Cell Biol. 20, 609–617 (2010).
Saito, Y. et al. Increased protein expression of DNA methyltransferase (DNMT) 1 is significantly correlated with the malignant potential and poor prognosis of human hepatocellular carcinomas. Int. J. Cancer 105, 527–532 (2003).
Tatemichi, M., Hata, H. & Nakadate, T. Ectopic expression of activation-induced cytidine deaminase caused by epigenetics modification. Oncol. Rep. 25, 153–158 (2011).
Gunaratne, P. H. Embryonic stem cell microRNAs: defining factors in induced pluripotent (iPS) and cancer (CSC) stem cells? Curr. Stem Cell Res. Ther. 4, 168–177 (2009).
Sen, G. L. et al. DNMT1 maintains progenitor function in self-renewing somatic tissue. Nature 463, 563–567 (2010).
Nascimento, E. M., Cox, C. L., MacArthur, S., Hussain, S., Trotter, M. et al. The opposing transcriptional functions of Sin3a and c-Myc are required to maintain tissue homeostasis. Nat. Cell Biol. 13, 1395–1405 (2011).
Lin, S. L. et al. Regulation of somatic cell reprogramming through inducible mir-302 expression. Nucleic Acids Res. 39, 1054–1065 (2010).
Kawamura, T. et al. Linking the p53 tumour suppressor pathway to somatic cell reprogramming. Nature 460, 1140–1144 (2009).
Zhu, Z. et al. Cancer stem/progenitor cells are highly enriched in CD133+CD44+ population in hepatocellular carcinoma. Int. J. Cancer 126, 2067–2078 (2010).
Henry, J. C. et al. miR-199a-3p targets CD44 and reduces proliferation of CD44 positive hepatocellular carcinoma cell lines. Biochem. Biophys. Res. Commun. 403, 120–125 (2010).
Liu, T. et al. High efficiency of reprogramming CD34+ cells derived from human amniotic fluid into induced pluripotent stem cells with Oct4. Stem Cells Dev. 21, 2322–2332 (2012).
Sand, M. et al. Expression levels of the microRNA processing enzymes Drosha and dicer in epithelial skin cancer. Cancer Invest. 28, 649–653 (2010).
Chen, M. et al. Serum starvation induced cell cycle synchronization facilitates human somatic cells reprogramming. PLoS One 7, e28203 (2012).
Plaisant, M. et al. Activation of hedgehog signaling inhibits osteoblast differentiation of human mesenchymal stem cells. Stem Cells 27, 703–713 (2009).
Tsai, C. C. et al. Oct4 and Nanog directly regulate Dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells. Molecular Cell 47, 169–182 (2012).
Takai, A. et al. A novel mouse model of hepatocarcinogenesis triggered by AID causing deleterious p53 mutations. Oncogene 28, 1469–1478 (2009).
Han, J., Sachdev, P. S. & Sidhu, K. S. A combined epigenetic and non-genetic approach for reprogramming human somatic cells. PLoS One 5, e12297 (2010).
Mitchell, N. E. et al. Real-time methylomic aberrations during initiation and progression of induced human mammary epithelial cell tumorigenesis. Epigenomics 5, 155–165 (2013).
Zhang, D. et al. AMD1 is essential for ESC self-renewal and is translationally down-regulated on differentiation to neural precursor cells. Genes Dev. 26, 461–473 (2012).
Hirayama, A. et al. Quantitative metabolome profiling of colon and stomach cancer microenvironment by capillary electrophoresis time-of-flight mass spectrometry. Cancer Res. 69, 4918–4925 (2009).
Nakagawa, M. et al. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 26, 101–106 (2008).
Takahashi, K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872 (2007).
Miura, N. et al. Clinical usefulness of serum telomerase reverse transcriptase (hTERT) mRNA and epidermal growth factor receptor (EGFR) mRNA as a novel tumor marker for lung cancer. Cancer Sci. 97, 1366–1373 (2006).
Shomori, K. et al. Thymidine phosphorylase expression in human colorectal mucosa, adenoma and carcinoma: role of p53 expression. Pathol. Int. 49, 491–499 (1999).
Ohashi, Y. et al. Depiction of metabolome changes in histidine-starved Escherichia coli by CE-TOFMS. Mol. Biosyst. 4, 135–147 (2008).
Baran, R. et al. MathDAMP: a package for differential analysis of metabolite profiles. BMC Bioinformatics 13, 7:530 (2006).
Klukas, C. & Schreiber, F. Integration of -omics data and networks for biomedical research with VANTED. J. Integr. Bioinform. 2, 7:112 (2010).
This work was supported by a Grant-in-Aid of Research for Promoting Technological Seeds B (development type), the Takeda Science Foundation, the Princess Takamatsu Cancer Research Fund, the Adaptable and Seamless Technology Transfer Program through Target-driven R&D (Exploratory Research) of the Japan Science and Technology Agency (JST) and a JSPS KAKENHI Grant (Grant-in-Aid for Challenging Exploratory Research) Number 23659285; none of these sources present a conflict of interest. The cell lines used in this study were provided by the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University, Japan and the American Type Culture Collection (ATCC). All PCR primers were designed by the INTEC Web and Genome Informatics Corporation (Tokyo, Japan). We thank Dr. Satoshi Kuwamoto regarding the pathological examination of xenografted tumor cells.
The authors declare no competing financial interests.
About this article
Cite this article
Tsuno, S., Wang, X., Shomori, K. et al. Hsa-miR-520d induces hepatoma cells to form normal liver tissues via a stemness-mediated process. Sci Rep 4, 3852 (2014). https://doi.org/10.1038/srep03852
BMC Cancer (2019)
miR-524-5p of the primate-specific C19MC miRNA cluster targets TP53IPN1- and EMT-associated genes to regulate cellular reprogramming
Stem Cell Research & Therapy (2017)
Scientific Reports (2017)
SIRP Alpha Protein Downregulates in Human Astrocytoma: Presumptive Involvement of Hsa-miR-520d-5p and Hsa-miR-520d-3p
Molecular Neurobiology (2017)
Tumor-suppressive effects of atelocollagen-conjugated hsa-miR-520d-5p on un-differentiated cancer cells in a mouse xenograft model
BMC Cancer (2016) | <urn:uuid:fb93059e-e953-41f9-9182-66a550b26429> | CC-MAIN-2022-33 | https://www.nature.com/articles/srep03852?error=cookies_not_supported&code=a992760f-19d6-4bd1-865d-8ca0932483fa | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571147.84/warc/CC-MAIN-20220810040253-20220810070253-00466.warc.gz | en | 0.912174 | 17,521 | 2.15625 | 2 |
The findings of India’s latest National Family Health Survey (NFHS-5) (2019-20) provide some reason for cheer but also concern. The survey reveals that the country is undergoing some interesting demographic transitions but there are serious developmental challenges too.
First conducted in 1992-93, the NFHS is “a large-scale, multi-round survey.” Some 0.6 million sample households from 707 districts were surveyed in two phases for NFHS-5.
Data collected is on a variety of issues and provides fascinating and useful insights into India’s population, demographic transitions, health and family welfare issues, nutrition, women’s empowerment, reproductive health, use of contraception, etc.
However, demographers take the NFHS figures with a pinch of salt. The sample size is very small, unlike the national decennial census which counts the entire population of the country. But since census figures take an inordinately long time to collect, collate and dissemble, NFHS findings provide policy makers with useful input of what they can expect in the upcoming census.
The fourth round of NFHS was conducted five years ago in 2015-16.
A positive finding of the NFHS-5 (2019-2020) survey is that India’s population has stabilized. Its total fertility rate (TFR), which is the average number of children a woman might bear during her lifetime, which was been declining – it was 2.7 in 2005-06 and 2.2 in 2015-16—is now 2; just below the replacement level of 2.1.
In his 2019 Independence Day speech, Prime Minister Narendra Modi said that India needs to “worry about the population explosion.” He called on governments at the state and central levels to take measures to control it.
India’s ruling Bharatiya Janata Party (BJP) has long-favored strong measures to control India’s population growth. In July this year, the BJP-ruled state of Uttar Pradesh introduced a population control bill that denies government jobs, promotions, subsidies and the right to contest elections to a person who has more than two children. Several other state governments are considering this measure too.
Population experts had disagreed with Modi back in 2019. They had argued that India’s population growth is slowing. The NFHS-5 survey confirms their view. The “findings bust the population-explosion myth and show that India must steer away from coercive measures of population control,” the Population Foundation of India said in a statement.
NFHS-5 also reveals that there are more women than men in India; 1,020 women for every 1,000 men compared to 991 for every 1,000 men as per NFHS-4 (2015-16) data. While women outnumbering men is a heartening new development, experts have raised doubts over the reliability of the data.
As activist Sabu George points out census figures have shown that there have been more men in India than women over the last 100 years. Even the 2011 census said that there were just 940 women for every 1,000 men. How did the “drastic change” of women outnumbering men happen over a span of just ten years, George asks. He has dismissed the NFHS-5 results as “suspect.”
India’s sex ratio at birth (SRB) has improved from 919 females to 1,000 males as per NFHS-4 to 929 females to 1,000 males in NFHS-5. Yet, this development provides cold comfort as India’s SRB is below the 952, the natural SRB recommended by World Health Organization.
India’s low SRB can be attributed to the deep prejudice that girls face. Unlike girls, who are seen as an economic burden on parents because of the practice of dowry, sons are preferred. Families celebrate the birth of a boy, a girl child’s arrival is reason for mourning.
If in earlier decades, people chose to kill new-born girls, the availability of technology to identify the sex of the fetus has resulted in women committing sex selective abortions to prevent a girl from being born. Pre-natal sex screening is banned in the country. Yet female feticide continues as reflected in India’s low SRB.
NFHS-5 reveals that institutional births have increased substantially from 79 percent to 89 percent nationwide. Institutional births mean that pregnant women and newborns get proper medical attention and this is visible in improving maternal and child health in the country. In addition, more women are opting for C-section deliveries.
Meanwhile, child marriage has come down only marginally over the past five years.
NFHS-5 data reveals that 78.6 percent of women have their own bank account compared to 53 percent five years ago. The percentage of women who said they had a say in making decisions relating to healthcare and major purchases for the family increased from 73.8 percent in 2015-16 to 92 percent in 2020-21.
Although Indian women seem to have a say in household decision-making, their situation is in the household is far from secure and is in fact worsening. NFHS-5 shows that the percentage of married women in the 18-49-year age group that have suffered spousal violence has more than doubled from 20.6 percent in 2014-15 to 44.5 percent per NFHS-5.
Distressingly, 30 percent of women surveyed said their husband was justified in beating them.
Patriarchal and misogynist attitudes continue to hold an iron grip over the thinking of Indian men and women. | <urn:uuid:49a72130-df1c-49cd-952f-b7acd55b2aa6> | CC-MAIN-2022-33 | https://thediplomat.com/2021/12/a-snapshot-of-indias-population/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00271.warc.gz | en | 0.965283 | 1,174 | 2.5625 | 3 |
Spectron FM53 two stage cylinder regulator
Flame atomic absorption spectroscopy (AAS) is applied in many contract laboratories engaged in food and environmental work. The main application is the detection of metals which may be present in the ground water, drinking water, food or soil sample at trace quantities. One such example is the determination of mercury levels in tuna fish. Tuna is a higher order predator and mercury from the entire lower food chain accumulates in the fatty tissues in the fish. Clearly high levels of mercury in tuna would render it unsafe for human consumption and it is common to analyse tuna fish samples regularly to prevent mercury entering the human food chain.
The detection principle in flame AAS is the absorption of light by the metal ions. A cathode lamp light source emits light, some of which is absorbed by the metal ions. The resultant light is received by a detector and the missing wavelengths are interpreted to represent the presence of metals in the sample. Flame temperatures in this technique are generally either 2300°C when burning instrument grade acetylene fuel gas in air to 2700°C which can be achieved by burning instrument grade acetylene in the instrument grade nitrous oxide.
It is essential to use specialty gases instrument grade products for this application, not industrial grade acetylene or medical nitrous oxide. The instrument grade acetylene has been produced in a way to eliminate any traces of metallic elements that might interfere with the highly sensitive analytical results. The medical grade nitrous oxide cylinder is fitted with a pin index valve for use in hospitals and will not fit a normal laboratory specialty gases regulator connection. Pin index valves are uniquely used in medical gases applications to avoid cross-contamination with industrial applications and to ensure that the correct gas is connected to the correct gas delivery system in the hospital.
Another leading technique for similar types of analysis is the ICP-MS instrument. It is notable that the use of flame AAS in Australia is more predominant than other parts of the world and this might be due to the fact that development of modern AAS instrumentation was developed during the 1950s by a team of Australian chemists led by Sir Alan Walsh at the CSIRO Division of Chemical Physics in Melbourne. Similar to flame AAS, ICP-MS has earned its place in environmental and food testing laboratories to detect metals in water, soil and food samples. ICP-MS has been adopted more heavily, for example in parts of Europe, than flame AAS. | <urn:uuid:cb2890f6-769e-48cb-8796-7f578a14b281> | CC-MAIN-2022-33 | https://www.coregas.com.au/specialty-gases/applications/analytical-instrumentation/aas-atomic-absorption-spectroscopy | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573760.75/warc/CC-MAIN-20220819191655-20220819221655-00668.warc.gz | en | 0.942833 | 498 | 2.90625 | 3 |
Holbein transparent watercolors contain no ox-gall, dispersing agents, or other animal by-products which allow these paints to move slowly. This unique consistency allows the artist greater color density and brush control but also remains smooth without cracking, crumbling, chipping or molding to the palette.
Holbein Artists Watercolors Raw Umber is formulated from Native Earth (Iron-Manganese Oxide-Hydroxide) ( 77491, 77492, 77499, 77727 and 77730).
This watercolor paint has the following properties:
- Absolutely Permanent
Holbein professional watercolor paints are available from Cheap Joe’s Art Stuff in a 15 ml. tube.
|Series||Artists' Water Color| | <urn:uuid:3198fdc7-0dc9-484f-8ce4-759e012b3ab2> | CC-MAIN-2017-04 | http://www.cheapjoes.com/holbein-artists-watercolor-raw-umber-15-ml.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285289.45/warc/CC-MAIN-20170116095125-00154-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.758353 | 156 | 1.71875 | 2 |
โกจิ ครีม - ครีมฟื้นฟูสภาพผิว
Rambler's site rating system and counter from Russia.
Sleek, intuitive, and powerful mobile first front-end framework for faster and easier web development.
nginx [engine x] is a HTTP server and mail proxy server written by Igor Sysoev.
PHP is a widely-used general-purpose scripting language that is especially suited for Web development and can be embedded into HTML.
Ubuntu Linux operating system
Content Security Policy is best used as defense-in-depth, to reduce the harm caused by content injection attacks. | <urn:uuid:f95956a8-1977-4eff-b49e-bf97d0edff7c> | CC-MAIN-2017-04 | https://www.similartech.com/websites/thai-gojicream.com | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280221.47/warc/CC-MAIN-20170116095120-00228-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.795822 | 167 | 1.570313 | 2 |
Winter in the Sacramento Valley is high season for birds. Seasonal refugees fleeing the cold from as far away as Siberia flock here. The headliners are sandhill cranes, snow geese and the exotic hawks and ducks in our wildlife preserves.
However, there are many interesting “little brown birds” that take up seasonal residence right here in our own backyards. Regular winter visitors include several species of sparrows – such as white-crowned sparrows, golden-crowned sparrows, fox sparrows and dark-eyed juncos – that are missing the rest of the year.
Identifying them is easy, especially if you have binoculars to look at them carefully. White-crowns and golden-crowns give you a clue in their names. Fox sparrows have heavily spotted or streaked chests. Juncos have gray or black hoods with a cheerful splash of white on the tail that gives them away when they fly.
In the fall, you can occasionally hear the primeval calling of sandhill cranes, migrating south. Often they are so high in the sky that you cannot even see them.
Much closer at hand, the sweet whistling song from your shrubs of returning white-crown sparrows is just as sure a marker of seasonal change.
Attending to the changes in your yard bird cast is one simple way to connect with the web of wildlife that girdles our globe. | <urn:uuid:925be1b3-284b-4e58-aabc-116e66eae402> | CC-MAIN-2022-33 | https://sierra2.org/feathered-visitors-from-afar-reside-here-in-wintertime/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572043.2/warc/CC-MAIN-20220814143522-20220814173522-00471.warc.gz | en | 0.961492 | 304 | 2.84375 | 3 |
|Action||Amendments Regarding Use of Controversial or Sensitive Instructional Materials|
|Comment Period||Ends 1/15/2014|
If the ramifications of this policy weren't so serious, I would find a bit of humor in the concept. Students listening to rap music obscenities, viewing any and all adult content on their technology devices, and the language used in the halls on a daily basis gives me pause to think about parental discipline at home. I fully realize that our present culture for young people presents them with toxic role models to emulate. The idea of protecting students from "sensitive" materials in school simply flies in the face of logic, given that for many individuals, school is most likely the only entity where they can find a semblance of normalcy. Exposure to issues of race, gender, sexual activity, genocide, and drugs by teaching professionals, in an academic setting where ignorance and misconceptions are replaced with factual information, seems to me to be a far preferable alternative. I know some parents who monitor their children's exposure to media, but based on my informal surveys of asking students what limitations they have at home, the majority are free to view and listen to whatever, and whenever they wish. Could staying up until 3:00 a.m. playing Halo 4, trying to get a high body count, be considered too sensitive? Watching pornography on their computer while shut up in their room with no one around? Teachers and Librarians are well-equipped to present controversial materials to students, and allowing them to reach their own conclusions through though-provoking discussions. The Head-in-the-Sand approach being embraced here yet again by Legislators does a tremendous disservice to both educators and students. Instead of allowing young people to "Opt Out" of discussions of crucial issues that affect them on a daily basis, let teachers do the job for which they were hired, and not saddle them with even more restrictions. | <urn:uuid:b0734d32-f925-4d82-89a3-707338e25053> | CC-MAIN-2022-33 | https://townhall.virginia.gov/l/viewcomments.cfm?commentid=29689 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572304.13/warc/CC-MAIN-20220816120802-20220816150802-00477.warc.gz | en | 0.959076 | 400 | 2.234375 | 2 |
With unlimited user entry, you can give entry to your accountant, tax agent, or other advisers. What’s extra, you possibly can set particular permissions for every user, so that you can be assured that all users will solely have entry to the information that they need. Whether you’re simply starting out otherwise you’ve been in business for years, it’s essential to have a stable grip on your finances. After all, should you don’t know should you’re making a profit, or have a healthy cash move place, you’ll quickly end up in hassle.
Financial statements are often audited by accounting companies, and are prepared in accordance with generally accepted accounting rules . GAAP is about by varied standard-setting organizations such because the Financial Accounting Standards Board within the United States and the Financial Reporting Council in the United Kingdom. As of 2012, “all main economies” have plans to converge in direction of or adopt the International Financial Reporting Standards .
- Professional our bodies for subfields of the accounting professions additionally exist, for example the Chartered Institute of Management Accountants within the UK and Institute of administration accountants within the United States.
- Financial accounting focuses on the reporting of a company’s monetary info to external users of the information, such as investors, potential buyers and collectors.
- It calculates and records enterprise transactions and prepares monetary statements for the exterior users in accordance with usually accepted accounting ideas .
- Many of those skilled bodies supply education and training together with qualification and administration for numerous accounting designations, corresponding to licensed public accountant and chartered accountant.
- Accounting is the practice of recording and reporting on enterprise transactions.
- GAAP, in flip, arises from the wide agreement between accounting theory and practice, and alter over time to fulfill the needs of determination-makers.
Lockdown 3: Accountants Involved For 2021
Involves planning to scale back or defer tax payments, in addition to filing many forms of tax returns. Involves the review of product prices, examining working variances, participating in profitability studies, bottleneck analysis, and many other operational matters.
Accounting Software Program For Business Finance Administration
This doc presents the sources and uses of cash during the reporting period. It is very helpful when the amount of internet income appearing on the income statement varies from the online change in cash in the course of the reporting interval. Requires the collection of time labored info from employees, which is then used to provide gross wage info, tax deductions, and different deductions, resulting in net pay to staff. ICAEW is working to make sure that the chartered accountancy profession is able to function as seamlessly as attainable across Europe and further afield within the post-Brexit setting. Audit is presently present process an unprecedented degree of public scrutiny. ICAEW is on the coronary heart of the worldwide debate about the way forward for audit. If you’d like a easy bookkeeping software program answer for restricted firms or sole traders, our Crunch Free software is just what you want – best of all it’s free!
Manage all your invoicing and bills and choose add-on services as you want them. Ideal when you’re simply starting out, our free software will get you organised and unlock your time.
AccountsPortal is an accounts package at an inexpensive value, and a friendly interface. AccountsPortal has been working closely with HMRC, and we’re proud to be listed as a recognised software program provider supporting Making Tax Digital for VAT. From April 2019 businesses which are VAT registered and above the VAT threshold (£85,000) should submit their returns digitally. AccountsPortal makes it simple to manage your invoicing, books and accounts. Discover how using Sage Accounting can help you handle your corporation processes with ease once the Brexit transition interval ends. Jonathan Wingfield of Ensors Chartered Accountants shares seven pieces of recommendation that will help you file your Self Assessment tax return on time. The Social Media Makes Sense founder talks about the significance of understanding funding and finances when taking a facet hustle full time. | <urn:uuid:2826334d-d3cb-417e-9667-658c58a0ef73> | CC-MAIN-2022-33 | https://pasarkreasi.com/accounting-software-program-2.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572163.61/warc/CC-MAIN-20220815085006-20220815115006-00670.warc.gz | en | 0.928344 | 843 | 1.914063 | 2 |
There is not enough clearance to get a socket wrench on the hex part of the tensioner due to the windshield washer reservoir being to very close to the tensioner. Do I remove the reservoir, get a special tool or what do I do to make this replacement?I need to put a wrench on the tensioner to release the old belt and provide clearance for the new belt when it is installed.Thanks.
a 6ya expert can help you resolve that issue over the phone in a minute or two.
best thing about this new service is that you are never placed on hold and get to talk to real repairmen in the US.
the service is completely free and covers almost anything you can think of (from cars to computers, handyman, and even drones).
click here to download the app (for users in the US for now) and get all the help you need. goodluck!
- If you need clarification, ask it in the comment box above.
- Better answers use proper spelling and grammar.
- Provide details, support with references or personal experience.
Tell us some more! Your answer needs to include more details to help people.You can't post answers that contain an email address.Please enter a valid email address.The email address entered is already associated to an account.Login to postPlease use English characters only.
Tip: The max point reward for answering a question is 15.
You'd better hope you have a belt routing picture under the hood. Usually the belt is released at the tensioner pulley, which is spring loaded to keep the belt tight. The pulley is unloaded by using a 3/8 long handled socket wrench. Find the square hole.
Serpentine belt replacement is not complicated and requires only one tool. Find the tension pulley located at the bottom of the motor. This pulley is attached to a very strong spring and holds the belt tight against the pulleys through its serpentine route around the engine. Use a socket wrench with a matching socket the same size as the hex head bolt in the center of the tension pulley. Attach the socket and set the direction to tighten the same direction the spring action allows the pulley to move. Turn the wrench handle, the pulley moves and the tension on the belt slackens. Take the belt off the pulley and let it hang.
To install the new belt Once the belt is around the pulleys allow it to hang freely at the bottom of the engine. Again, use the socket wrench to turn the tension pulley far enough so the belt can be wrapped around the pulley. Once the belt is around the tension pulley, release the socket wrench and allow the tension pulley to take up the slack.
if you're not mechanically inclined then don't attempt it , but if you are then get a 3/8 long handled ratchet or breaker bar and locate your belt tensioner simply push the ratchet or breaker bar into the square opening in the tensioner and pull toward front of car or push towards back of car and you will fell it give you shouldn't have to push hard once this is done make sure you have a firm grip and pull belt off top pulley which ever is closer and easier to access then follow diagram on front above radiator or on strut tower
ALL serpentine belts have a tension pulley which holds the belt tight to the various equipment it turns (water pump, alternator, a/c compressor, etc). Find the one spot where the belt goes over a component that has nothing connected to it, and you have found the belt tensioner. The tensioner is designer with a nut on the face of it so that you can put a socket wrench on it; by 'unscrewing' the socket wrench, you should be able to release the tension on the belt - it will take some pressure to release. Once you have tested this, you can pull onthe socket wrench and remove the belt; replace it witha new one and take off the socket wrench. Make SURE you have the correct belt and be careful with the socket wrench; it takes lots of pressure to keep the belt tight.
You have to turn the tensioner pulley clockwise using a ratchet wrench with a 2 or 3 foot bar attached to it for leverage to get the belt off. Then install the new belt according to the diagram sticker at the front of the engine compartment.
The 96 Riviera has a motor mount that interferes with the removal and replacement of the serpentine belt. The motor mount must be loosened and the engine need to be lifted slightly to accomplish the replacement. Not good engineering on this model year. | <urn:uuid:bdbf9f98-9620-4fb8-a754-48f98bad48bb> | CC-MAIN-2017-04 | http://www.fixya.com/cars/t1462644-change_serpentine_belt_2000_buick_regal | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280410.21/warc/CC-MAIN-20170116095120-00453-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.937155 | 953 | 1.539063 | 2 |
2022 Structural Geology and Tectonics Forum
Brunswick, Maine, June 22-24, 2022; optional field trips and workshops before and after the meeting
Note that all abstracts should be presumed as accepted.
SGTF is an interactive venue for discussing important frontiers, new ideas, and current research in structural geology and tectonics. The Forum also provides opportunities to discuss effective and inclusive teaching of structural geology and tectonics, including integrating research with teaching. The three-day Forum includes "one-at-a-time" technical sessions and an all-conference field trip to see rocks exposed along the Maine coast and discuss inclusive, equitable, and accessible teaching practices. Optional workshops and field trips are scheduled before and after the Forum. Although the Forum is aimed at professional geologists, we encourage advanced graduate students to attend.
This is the 6th Structural Geology and Tectonics Forum. The prior five successful ones were held at Arizona State University in January 2018, Sonoma State University in August 2016, Colorado School of Mines in June 2014, Williams College in June 2012, and the University of Wisconsin, Madison, in May 2010.
US National Science Foundation
Structural Geology and Tectonics Division of the Geological Society of America. Thank you! | <urn:uuid:539e84c3-3c50-4d90-b120-4a8245174585> | CC-MAIN-2022-33 | https://serc.carleton.edu/NAGTWorkshops/structure/2022_Forum/index.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570977.50/warc/CC-MAIN-20220809124724-20220809154724-00465.warc.gz | en | 0.937845 | 281 | 1.6875 | 2 |
Progress made on the regeneration of Govan was outlined at a council meeting today (19 November).
There are a number of regeneration projects currently ongoing in Govan or contributing to the development of the area, including:
- The Central Govan Action Plan and the Govan Cross Townscape Heritage Initiative (which have together delivered £88million in targeted regeneration since 2006);
- The £114million Glasgow City Deal West End & Waterfront Innovation Quarter, with key local projects delivering public realm improvements in Central Govan, the forthcoming Govan-Partick bridge, active travel schemes, and a mixed-use development at Water Row;
In addition, Govan has benefited from significant levels of housing investment and development frameworks for both the Govan-Partick ‘district’ and the river corridor points the way to ensuring the area maximises its potential as part of a revitalised Clyde waterfront.
The council is working with the University of Glasgow to develop the Glasgow Riverside Innovation District (GRID), a riverside quarter connecting the University, Central Govan and the Queen Elizabeth University Hospital. The aims behind the development of the GRID are the attraction of high-value tech businesses and an educated workforce, and inclusive economic growth, social innovation and civic renewal for Govan.
As part of the GRID, the University of Glasgow is being supported by the council in the development of the Clyde Waterfront Innovation Campus (CWIC) on areas of vacant and derelict land at Linthouse Road and Holmfauld Road. The campus will be a centre of excellence for a range of new industries, co-locating industry and world-class research.
Other ongoing projects in Govan that the committee was told about included the redevelopment of the former Old Govan Parish Church (overseen by Govan Heritage Trust), the first stage repair works at Elder Park Library and the interest – led by Govan Housing Association – in converting the B listed former Lyceum cinema into a community-owned music venue. | <urn:uuid:6603bea3-164b-4c35-b530-d21f8632cb44> | CC-MAIN-2022-33 | https://www.glasgownews.org.uk/update-on-regeneration-of-govan-given-to-council/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573744.90/warc/CC-MAIN-20220819161440-20220819191440-00475.warc.gz | en | 0.934759 | 406 | 1.570313 | 2 |
Huaiyuan eight-treasure rice pudding
On Jan 28, Wei Xiulan, a Huaiyuan eight-treasure rice pudding production skills inheritor in Huaiyuan town, Hechi’s Yizhou district, displays her eight-treasure rice pudding. [Photo/VCG]
Huaiyuan town is located in Yizhou district, Hechi city. It is one of the four famous ancient towns in Guangxi Zhuang autonomous region with a history of more than 1,300 years. In 2018, the production technique of Huaiyuan eight-treasure rice pudding (ba bao fan) was selected in the seventh batch of representative projects of intangible cultural heritages in Guangxi.
The ingredients for Huaiyuan eight-treasure rice pudding are particular, needing only high-quality glutinous rice from the surrounding area. Red dates, wolfberries, Barbecued pork, winter melon sugar, lotus seeds, green fruits, melons, and kernels are among the ingredients. Making sweet, delectable eight-treasure rice pudding upon entering the lunar December has become an important part of local residents' Chinese New Year's celebrations.
Copyright © Hechi Municipal Government. All rights reserved.
Presented by China Daily.京ICP备13028878号-6 | <urn:uuid:dc1a5f35-0015-425c-96f4-ebc63f1785c9> | CC-MAIN-2022-33 | http://guangxi.chinadaily.com.cn/hechi/2022-05/19/c_754910.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00072.warc.gz | en | 0.916282 | 281 | 2.046875 | 2 |
The Blessing of Reminders
July 12, 2022
by Maria Fontaine
The Blessing of Reminders
I often think of how much I need reminders regarding the essentials in my Christian life. I wrote about this topic previously, and I’m continuing to see how helpful reminders can be.
Sometimes I get distracted when I’m tired, busy, or trying to juggle many things at once, and I forget to calm down and sit quietly at Jesus’ feet so He can remind me of the things that are truly important that I might be missing or neglecting.
But Jesus, in His love and compassion, doesn’t limit providing these reminders to times when we get quiet before Him. He also brings them to our attention through other avenues.
For me, Jesus brings some of those reminders through others like Peter or one of my co-workers who remind me of the spiritual principles and practices that we all value but may not always be paying enough attention to. These reminders can be about such things as praising the Lord in the face of difficulties, trusting God for my work, or not allowing myself to be stressed over troubles and challenges that others are facing.
It may not always feel good in the moment to be reminded of the need to reemphasize these things. Refocusing my priorities often takes a conscious effort. Sometimes, it can also be a little embarrassing to have to admit, even to myself, that something I should have known to do needs to be reestablished as a priority in some area of my life.
One of the problems with others offering us a reminder is that we are all human and sometimes flawed in how we express or receive these reminders. Whether we are sharing a reminder with someone or someone else is sharing a reminder with us, it should always be done with humility and the assumption that the one sharing these reminders is sincerely trying to help. The Lord will always guide us in the best way to apply those reminders if we look to Him for His confirmation.
The Apostle Peter gave reminders to the believers in Asia Minor in an effort to help them. He wrote:
I think it right, as long as I am in this body, to stir you up by way of reminder. And I will make every effort so that after my departure you may be able at any time to recall these things.—2 Peter 1:13, 15 ESV
In 2015 Peter wrote: “Godly reminders are an important component in our spiritual growth; they can keep us spiritually active, healthy, and well rounded. … We all need reminders to keep us striving to be like Jesus—gracious, loving, compassionate, honest, longsuffering, gentle, good, slow to criticize, and generous with encouragement.”1
* * *
There will probably be times when we don’t have someone available to help us stay on track through reminders. In that case, the responsibility falls to us to make the effort to safeguard ourselves by finding ways to draw our attention back to the important spiritual principles on which our lives need to be anchored. I know of someone who has a large, decorative blackboard in her kitchen where she writes herself inspirational reminders such as Bible verses, thoughts that motivate her, or quotes about areas in her life where she needs to grow.
Here is an example of the kind of encouraging reminders that might be used. We might picture Jesus saying these things to us. Any one of these phrases, or all of them together, can be helpful reminders of how much we mean to Jesus.
I am with you.
I am strengthening you.
I am answering you.
I am protecting you.
I am providing for you.
I am giving you peace.
I love you. (ALWAYS HAVE AND ALWAYS WILL!)
So much depends on how we look at reminders. We can see them as a chore or something that we grudgingly endure while feeling guilty that we’re not perfect. That is unlikely to produce the motivation we need to use reminders constructively.
The alternative is that we can see these things as fresh opportunities to refine our skills by refocusing on the principles that the Lord loves to see us grow in. How we perceive these things can be pivotal in gaining more wisdom as we reapply a principle in our lives and our walk with Jesus. If we look at reminders as challenges to further refine what is pleasing to Jesus in our lives, then these reminders become opportunities to prepare us for the future.
The spiritual principles in God’s Word, such as following God, prayer, praise, resting in the Lord, spreading His love and truth, giving to others, having patience, kindness, forgiveness, compassion, mercy, serving one another in love, and many more are enhanced with use. Revisiting them can often help to keep our use of them updated with new ways to apply them.
As Jesus told me:
Learn from the past, its successes and mistakes;
Light your present, with joy and transformation;
Look forward to the future, the wonderful things that await you.
* * *
God’s Spirit can show us ways to stay young at heart, no matter what our age. For example, adding a new twist to our witnessing approach or trying out something that takes a step of faith can bring inspiration to our lives and keep our hearts and minds challenged. And, if you have the blessing of working together with someone else, you can cheer each other on and remind each other of your new plan or commitment.
Joni Eareckson Tada described how a friend of hers worked together with others and added a new challenge to their witness. Joni wrote:
God gave my friend Jennifer a burden for waitresses. Once every two weeks, Jennifer and her Christian friends regularly meet for lunch, but before they choose a restaurant, they pray. Once it’s decided where to lunch, they sit down and strike up a friendly chat with the waitress. They learn her name and ask for her suggestions from the menu.
Jennifer and her friends visit the same restaurant at least five times, asking the maître d’ that they be given the same waitress. After so many luncheons, the women become friends with the waitress. … Jennifer and her friends not only have fun together over lunch, but they make an outreach of it. Waitresses are, in fact, their main reason for getting together.
No matter where we go or whom we meet, we can have an effective outreach for Christ in our community. No, Jennifer will never organize a group called “Eating Out for Jesus,” or plan a budget or print up brochures. But she will keep on doing what comes naturally: being a witness for the Lord.2
* * *
In this often hectic world, there may be times when our focus is so fully engaged with what can seem most urgent that the long-term priorities get pushed into the background. However, the Lord has given us the blessing of reminders to help ensure that these foundational principles are not left in the background for long.
Whatever ways the Lord chooses to bring reminders to your attention, welcome them as the friends they are, and they in turn will help you to accomplish the most important things that the Lord asks you to do.
2 “Be a Witness” devotional, April 15, 2022, by Joni Eareckson Tada. | <urn:uuid:595bcd5f-0354-496f-9629-848df8b40fad> | CC-MAIN-2022-33 | https://directors.tfionline.com/post/the-blessing-of-reminders/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00672.warc.gz | en | 0.955528 | 1,519 | 1.632813 | 2 |
Erfurt (Agenzia Fides) – September 6 to 8, there will be a conference on "Challenges of the pastoral mission, organized by the Office for Missionary Pastoral Work (Arbeitsstelle für Katholische Missionarische Pastoral, KAMP) based in Erfurt in eastern Germany. The new office was created earlier this year by the German Bishops (see Fides 14/01/2010).
According to a statement from the German Bishops' Conference (DBK), at the focus of this debate are the premises, difficulties, and possibilities of missionary apostolate today. Participants will address the topic from the point of systematic, ecumenical, and pastoral theology, based on the concrete experiences of the delegates present at the meeting. A second goal of the conference is the creation of a network among those involved in missionary apostolate and the new evangelization in the diocese, in religious orders, associations, and in Catholic communities.
Nearly 50 delegates, representing 20 German dioceses, 6 religious orders, 5 ecclesial communities, and 4 Catholic associations, will participate. There will also be a delegation from the German Protestant Church (Evangelische Kirche Deutschland, EKD). (MS) (Agenzia Fides 08/10/2010) | <urn:uuid:bf742d38-bf5a-4eb4-95ed-10ee5be4930a> | CC-MAIN-2017-04 | http://www.fides.org/en/news/27229 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281162.88/warc/CC-MAIN-20170116095121-00530-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.927758 | 272 | 1.695313 | 2 |
Total employment in the region was 376,400 and the number of employed residents totalled 280,300, up by 800 and 1,100 respectively from the previous period.
According to the Statistics and Census Service (DSEC), both the general unemployment rate (2.8%) and the unemployment rate of local residents (3.8%) for August-October 2021 decreased by 0.1 percentage point from the previous period (July-September 2021). Meanwhile, the underemployment rate increased by 0.6 percentage points to 4.5%.
The number of unemployed decreased by 300 to 10,900. Among the unemployed searching for a new job, most were previously engaged in Gaming & Junket Activities or in the Construction sector. The proportion of new labor market entrants seeking their first job increased by 1 percentage point to 15.9% of the total unemployed.
The number of underemployed rose by 2,500 to 17,500, as some establishments suspended operations due to the pandemic during the September to October period. Most of the underemployed were working in Gaming & Junket Activities, Hotels & Similar Activities, Restaurants & Similar Activities and in the Construction sector.
According to the preliminary estimates from movement records, an average of about 83,400 residents and non-resident workers worked in Macau but lived outside the territory during the reference period. When these individuals are included, the total labor force is found to decrease by 700 to 470,700. Staff Reporter | <urn:uuid:a1c076f1-72f8-4f04-9713-3bda3602024b> | CC-MAIN-2022-33 | https://macaudailytimes.com.mo/local-residents-unemployment-rate-3-8.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00670.warc.gz | en | 0.964106 | 305 | 1.726563 | 2 |
WebMail is a complete server-side Web-based e-mail system that gives all of your mail...
Added Jun 10, 2001
This is an HTML form mailer and manager. It mails the results of form submissions and...
Use this program to process forms on Web sites. It uses simple templates to format all...
NetAuth allows users to create and manage their own e-mail accounts, manage accounts...
Added Apr 18, 2004
This is a groupware system designed to manage the information flows in company structures.
Integrated Web based e-mail client, file explorer and RSS reader that supports HTML,...
TWIG is a Web-based information client, written with PHP3, that uses no frames or...
Added Dec 15, 2002
This mail client allows users to check their e-mail through any Web browser.It can send...
Added Aug 21, 2002
phpQLAdmin is a Web-based administration tool for managing a qmail-ldap-based mailserver.
Added Jul 21, 2002
Netmania Mail is a Web-based e-mail service that lets you check your e-mail with your Web...
Added Jul 4, 2001 | <urn:uuid:158b9880-5927-4407-bdc4-618158fb25d2> | CC-MAIN-2017-04 | http://www.tucows.com/linux/business/e-mail-news/web-mail/?f=pop | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279489.14/warc/CC-MAIN-20170116095119-00013-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.852529 | 246 | 1.65625 | 2 |
As the world continues to show its support for Ukraine amid a Russian invasion, many Americans, both at the federal and local levels, are calling for bans and boycotts of widely purchased Russian products and resources.
Russia’s invasion of Ukraine has prompted sanctions, boycotts and limited access to social media platforms by the U.S.
Governors are calling for local liquor stores to clear their shelves of Russian alcohol and President Joe Biden continues to add stricter sanctions including putting a stop to imports of some of Russia’s highly-imported natural resources.
The United States placed bans on imports of "luxury products" from Russia as further punishment for its invasion of Ukraine.
The broad trade shift, which revokes the "most favored nation" status for Russia, is being taken in coordination with the European Union and Group of Seven countries.
"The free world is coming together to confront Putin," Biden said from the Roosevelt Room of the White House. He also said countries were adding new names to a list of Russian oligarchs who are facing sanctions, and the U.S. is cutting the flow of high-end American products such as expensive watches, cars and clothing.
"We’re banning the export of luxury goods to Russia," he said.
Earlier sanctions imposed on Russian oil, gas and coal cut off about 60% of U.S. imports from the country.
In 2021, the U.S. imported roughly 245 million barrels of crude oil and petroleum products from Russia — a one-year increase of 24%, according to the U.S. Energy Information Administration.
"It’s an important step to show Russia that energy is on the table," said Max Bergmann, a former State Department official who is now a senior fellow at the Democratic-leaning Center for American Progress.
Russia provided less than 1% of U.S. vodka imports in December, according to the Distilled Spirits Council of the United States.
Over the past week, the boycott against vodka has grown. In an effort to support Ukraine, Total Wine and More, which operates 229 stores across 27 states, announced on social media it "removed all Russian-made products from our shelves."
FILE - An empty space on a shelve, formerly held for Russian-owned brand mixers, following a state ban on Russian liquor at a store in New Hampshire.
Social media users also fired at Russia by sharing videos of people dumping Russian vodka and brandishing the #BoycottRussia, #DumpRussianVodka and #BuyUkrainianVodka to encourage others to do the same.
"If you want to boycott Russian vodka, here are the ones to take off the shelf," the user wrote.
The Associated Press and FOX News contributed to this report. This story was reported out of Los Angeles. | <urn:uuid:43686345-adbf-4d4a-83cd-4d6ea69a2a5d> | CC-MAIN-2022-33 | https://www.fox32chicago.com/news/list-of-russian-goods-that-are-banned-boycotted-in-us | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.37/warc/CC-MAIN-20220809003642-20220809033642-00677.warc.gz | en | 0.955994 | 612 | 1.835938 | 2 |
Neuroscientist Bobby Kasthuri wants to do the near impossible: Map the entire human brain.
That means identifying each of the trillions of neural connections that exist inside the mind—a number bigger than the stars in the Milky Way galaxy. His success could mean understanding ourselves unlike ever before.
“I want to turn anatomy of the structure of the brain into what we did for the genome,” Kasthuri said. A scientist at the University of Chicago and Argonne National Laboratory, he believes a map of neurons could tell us everything that makes a human being unique—from an individual’s memories and dreams, to a more intricate understanding of mental illness.
On this episode of Big Brains, Kasthuri explains how high-powered microscopes and supercomputers help him study the brains of mice, what makes humans distinct from all other living creatures and why the term “dim bulb” is more accurate you think.
- Neuroscientist leads unprecedented research to map billions of brain cells
- New Brain Initiative Aims to Fully Map the Human Brain—Chicago Tonight
- Neuroscientist Explains One Concept in 5 Levels of Difficulty—Wired
- Supercomputing Is Allowing Us to Map Brain Function at the Deepest Levels—Futurism
PAUL RAND: As you’ll hear, I had a lot of fun recording this episode with neuroscientist Bobby Kasthuri. Bobby’s working on some pretty astounding stuff in an effort to map the human brain. There are trillions of neural connections in the brain, and Bobby believes that all together they make up everything that makes us human. To map all those brain cells is a harder task than counting all the stars in our galaxy, not that Bobby isn’t going to try.
RAND: Don’t forget to rate and review Big Brains on Apple Podcasts, or wherever you listen to the show.
RAND: All right, well, Bobby, I have to tell you, I’ve been a little nervous about having you come in. The name of this podcast is Big Brains.
BOBBY KASTHURI: OK.
RAND And I was kind of terrified you were going to say, well, that’s a really stupid name, because big brains don’t equal more intelligence, because here I am talking to a foremost neuroscientist and brain expert. So I, guess tell me maybe right up front, does big brains equal more intelligence?
KASTHURI: Actually, it’s an interesting point, because I’m interested in this idea of size and intelligence. And in general, when you think about animals that are smart, humans, whales, dolphins, elephants, they all have big brains, but a better measure is the ratio of the size of your brain to the size of your body.
KASTHURI: And when you use measures like that, then things like whales and elephants, which normally just by absolute size would be smarter than us, kind of scale more closely to us.
RAND: But big brains can indicate, if there’s proportionally more intelligence. So the podcast actually, is appropriately named. All right, so I’m going to back up now that I feel relieved that my name of the podcast is not completely wrong.
KASTHURI: Big relative brains.
RAND: Big relative brains, a little long. So let’s talk about how you got to the University. How would you describe what you do now?
KASTHURI: I guess one way to describe it is we are anatomy on steroids.
KASTHURI: There has always been a place for figuring out the structure of the brain. What does the brain look like at various scales, at the whole brain scale, at the single cell or neuron scale? KASTURHI: But it was always done in a kind of like cottage industry fashion. We have a little lab. I do my little part of it. Someone else does another little part of it. I want to do that at industrial scale. I want to turn anatomy of the structure of the brain into what we did for the genome, which is we collect these enormous data sets that most people can’t access and then distribute them widely to the community.
KASTHURI: We generally talk about three things when we think about if we had a full map of a brain.
RAND: Clarify this. When you say a map of the brain, what does that literally mean?
KASTHURI: Yeah, so for about 100 years now, neuroscientists know that your brain it isn’t made up of a little person inside of you. For a long time, there was this theory, it was called the homunculus. And it was this idea that there was a little person sitting inside your head, who also had eyes and arms and legs, etc. And as they move their arms and legs, your arms and legs moved. It was an instantiation of you.
KASTHURI: But over time, we realized that the only thing that’s in there are cells. There’s nothing magical or human, like you inside of it. And in fact, we think that in a human brain there’s 100 billion brain cells, or neurons. And the special thing about neurons that’s different than any other cell in your body, a stomach cell, a skin cell, is that neurons make long connections, processes that connect with each other.
KASTHURI: On average, in a human each neuron makes 10,000 connections. So if you take the number 10,000 and you multiply it by the number 100 billion, you get an even bigger number, that’s something like a quadrillion or whatever.
KASTHURI: I don’t actually know what that number means, but one way to think about it is there are more connections between neurons than there are stars in the Milky Way galaxy. And I want to map every one of those.
RAND: And the purpose of mapping that means you’ll be able to trace start, finish, links, everything else.
RAND: And to what benefit?
KASTHURI: At a very high level, the strong hypothesis in neuroscience is that that map of connections is everything about you. Like, if we could decipher that map, and we should talk about how one would decipher that map, but for now, let’s just say we could decipher that map, that map would have every memory you’ve ever had. It would have every one of your hopes, your dreams, your skills, your fears. Everything about you is stored in that map. Now, that’s at a very high level, but what could we do if we had a map like that?
KASTHURI: I would say the first thing we could do is—and you and the audience might hear—every day, we hear about how machine learning or artificial intelligence algorithms do something better than a human being does. Now an artificial algorithm can beat a human in chess. An artificial algorithm can beat a human in Go. I recently learned that an artificial algorithm can now beat humans in poker. That last one bothers me, because that involves deceit and bluffing, and etc.
KASTHURI: And those algorithms are better than us at that. Right? But the thing none of them can do, which our brains do all the time, is that in addition to playing a game, our brain knows how to move my body, sit down at that table, recognize the chess board, and move my arms with skill and grace that no algorithm can currently do. So if we had a map of the brain, I’m hoping we can reverse engineer many of these human qualities, creativity, empathy, sense of humor, that ultimately, there’s going to be a physical basis for that. And if we know that physical basis, we can reverse engineer it.
KASTHURI: So soon our algorithms and our robots will do the same things.
RAND: So let’s talk about both sides of the coin of being able to do what you’re talking about doing.
RAND: There’s a terrifying side--
RAND: Arguably, to what you’re talking about doing. And then there’s hopefully a positive side. Let’s start with the positive side.
KASTHURI: So maybe we won’t agree if a robot has a sense of humor. I think that’s a positive side, in and of itself, but the other thing that I tell people is that your brain, everyone’s brain, Einstein’s brain, Mozart’s brain, they all operate on 20 watts of energy. And these light bulbs in this room are probably 60 watts of energy. So although you may consider a lot of humans dim bulbs, they are in the sense that they can perform tasks at energy levels that we can’t comprehend for any of our algorithms. And because half the time I’m at Argonne, which is a Department of Energy lab, I’ve learned that by 2025, by 2030, the single largest growing fraction of our energy budget is not the oil that we put in our cars or in our airplanes. It’s uploading and downloading pictures to the internet.
KASTHURI: And by that time, just moving information and the amount of information that we move is going to be the single largest part of our energy budget.
RAND: My gosh.
KASTHURI: And so if we understand how a brain can move information and do calculations for 20 watts of energy, that could significantly help us in our energy crises—
RAND: That is a very unexpected answer, but a very interesting one.
KASTHURI: Another one is that for many psychiatric and mental illnesses, we don’t even know where the illness occurs. We don’t know, although, we think that many illnesses like autism or schizophrenia are missed connections, neurons that are connecting with inappropriate neurons, we have no idea where to start.
KASTHURI: And if we had a map of that brain and compared it to a map of a schizophrenic brain, we’d start to understand what the physical basis of these mental illnesses are. And the belief is that once we understand the physical basis of these mental illnesses, we’ll be able to treat them in a more rational fashion.
RAND: So those are some wonderful upsides on the side there. But even as you were talking and making the joke about the game theory and the poker playing, you start linking into things that could be a downside. And if there’s fears about artificial intelligence, those fears could go into overdrive for some of the stuff that you’re talking about.
RAND: What do you do about that?
KASTHURI: Nothing. (laughing)
RAND: OK, that’s for somebody else to worry about.
KASTHURI: A great physicist that I sometimes think about, his name was Robert Oppenheimer, and he’s often called the father of the atomic bomb. And when they interviewed him and they asked him and they say, you realize that you care fundamentally about how the nucleus works, et cetera, but you realize that that kind of science can have applications for making bombs, destroying cities, etc.
KASTHURI: And he says, I can’t help myself. I need to be able to know how the nucleus works. And if society takes my applications and applies it however it wants, there’s nothing I could do about that. And I feel like—
RAND: It’s going to happen at some point.
KASTHURI: And the one thing I can’t seem to give up is my curiosity about how the brain works.
RAND: You are pretty keen ultimately, on trying to map a mouse brain.
KASTHURI: The goal itself is data. The constraint is data. So a fly brain, which is somewhere in between the original worm brain that was done I think in the middle 80s or the early 90s and the mouse brain that we want to do, and ultimately, the human one, because there are, as I said, a quadrillion connections in your brain, the only way to make sure you capture every one of those connections is to image the brain at very fine resolution, a very high spatial resolution. Meaning, when we take pictures of the brain—
RAND: And you slice it very thinly. Is that right?
KASTHURI: Correct. It turns out that there are so many connections in your brain, each of them is unbelievably small. In fact, they are so small, they’re smaller than the wavelength of light, of the light that you use in most microscopes. The connection is actually smaller than light. So we can’t use light microscopes to map the brain. The only kind of microscopy you can use is something called electron microscopes. So the only way to do electron microscopy is to make really thin slices, physical thin slices, of a brain, any organ, and use an electron microscope to take a picture of each of those slices, physical slices, and put it all back together inside a computer.
KASTHURI: We probably do thousands and thousands of slices. And we take a picture of each slice.
KASTHURI: The reason we have to do that is that there’s so much material packed into there, our microscope has to be able to resolve things that are the difference between atoms, hundreds of atoms, at the nano scale, what we call nano meter range, is the resolution we need to apply over the entire brain.
KASTHURI: Now, if you need nanometer resolution over a brain that’s one centimeter, you soon start to collect enormous amounts of data. And so the reason, a lot of the reason that this couldn’t happen before is that the mouse brain, the thing that I want to do, and I have to remember this every time, is not a million gigabytes of data, not a billion gigabytes of data. It’s a trillion gigabytes of data to do an entire mouse brain, where I get every connection between every neuron, is going to require a trillion gigabytes of data.
KASTHURI: To give you an idea of how big that is, if you took all the written material in the Library of Congress and to a first approximation let’s just say that’s all of human knowledge. Right? That is not even 1% of the data that we’d like to collect.
RAND: Got it.
KASTHURI: If you added all the audio that had ever been recorded and put into the Library of Congress, every movie from black and white to 3D today, you still wouldn’t get to probably 20% of the data for an entire mouse brain.
RAND: My goodness.
KASTHURI: So the main constraint is it will be a data set collected about a single thing bigger than any data has ever been collected in the history of humanity.
KASTHURI: And the point of then being able to have the ability to collect the data, store the data, manipulate the data, really starts becoming the biggest task of all.
KASTHURI: It has, I think for the last five to 10 years, actually been the largest problem, but like most obvious problems, it takes a long time for people to recognize it.
KASTHURI: But now it’s beginning, and it is clear, not just the work we do, but in almost all fields of neuroscience, people are collecting more data than they know what to do with.
RAND: I mean, are there 100 people around the world trying to do what you’re doing? Is it collaborative? Is it competitive?
KASTHURI: It’s a little-- it’s everything.
RAND: It’s all those things.
KASTHURI: It’s, you know, humans working with humans.
KASTHURI: Which entails all of the things that happen when humans work with humans, but I would say the number is not 100. It’s closer to five, four or five groups. I would say in the United States there are about three or four groups that are targeting. There’s one place called Janelia that’s targeting the fly brain. There’s Allen, which is targeting a smaller part of the mouse brain. There’s us and probably Carver. Worldwide, there’s a couple of Max Planck Institutes. These are the sort of large, premier scientific institutes in Germany that are also participating.
RAND: If we think through what the ultimate goal of this entire project might be, what do you think it is? And how long do you project it would take to get there?
KASTHURI: Yeah, I mean, let me pick one, the one that I’m most interested in, which is what does it mean to be a human? What is so special about a human brain that’s different than a primate brain, than a mouse brain, than a fly brain? And to first approximation they’re all the same. The genes that a mouse neuron expresses are very similar to the genes that a human neuron expresses.
KASTHURI: The channels that led in the ions to do the electrical activity in a mouse neuron, are pretty similar to the channels that led in the ions to do the electrical activity of a human brain. Right? So we think since there’s no difference in kind, the neurons are all the same, neuron is a neuron, is a neuron, it must be the map of neurons, the actual connection map, that’s the difference between those two.
KASTHURI: Now, I’m not sure that requires an entire mouse brain to be compared to an entire human brain to get that answer. So I actually know, I think, what the difference is between a human brain and a primate brain and a mouse brain.
KASTHURI: The main difference is that-- and I have two kids and I hope they’re not listening-- the main difference is that humans are born completely useless. When you bring home your baby for the first time, you realize that without you, that baby dies.
KASTHURI: That baby literally knows nothing. Right? And that is uniquely different than any other animal born. Most animals born have a set of behavioral repertoires. A fly born knows how to fly, which is actually a pretty amazing thing to solve in 3D space, if you can. And what’s fascinating about humans is that we’re born completely useless. But the same human, my children, learn a set of skills that can’t be in their genomes. There is no gene for using the iPad. There is no gene-- in fact, there’s probably not even genes for reading, because the printing press was only invented a couple of hundred years ago.
KASTHURI: So what I think is interesting about humans is that we’re born useless, but have a capacity to learn new things that no other brain has. The other way I give this argument and it’s clear, I’m so much smarter than my daughter. I know how to drive a car. I know how to do taxes, grocery shop. There’s a set of skills that I have that she clearly doesn’t have. So almost any test, if you didn’t know who we were, you’d say this unknown person is way smarter than this unknown person. Right?
KASTHURI: But there is one way where she dominates me. And this is the thought experiment, which is that if you took us and you put us down in any location in the world, in the history of the world, and you came back 20 years later and said, who’s assimilated better? I guarantee my daughter, other than skin color differences or hair color differences, will be indistinguishable from the population that you put her down in.
KASTHURI: I’ll either be dead or still stick out like a sore thumb. Right?
RAND: She’s learned.
KASTHURI: Human brains are born in this kind of tabula rasa blank state condition and have a capacity to learn, that other animals don’t. And that’s the kind of physical basis that I’m interested in trying to figure out.
RAND: Let’s talk about how you got to the University.
KASTHURI: When I was in college, I was really interested in being a doctor. That was partly me being interested and my parents making sure I was interested in being a doctor. And when I got to medical school, the field that fascinated me the most was psychiatry, psychiatry and neurology, things that have to do with the brain.
KASTHURI: Like most students, I was interested in helping people, saving the world, et cetera. And when I got there, I realized, you know, despite the fact that many psychiatrists, neurologists they’re brilliant, off the charts brilliant, the fields themselves are like the wild, wild west. The therapies that we use on people for psychiatric illnesses, they’re never thought out a top down kind of therapy. In fact, there are often drugs that we use for other diseases that we try for these diseases. We get some success. And then we make that standard of care.
KASTHURI: I was really disappointed with how we treated psychiatric illness and mental illness. And I realized the patients had a little contribution to this too. I realized that the thing that I could do the best was not continue the same vein of sort of ad hoc therapy, but try to figure out something about the brain that would ultimately help us understand mental illness.
RAND: So that was a pretty big switch for you.
KASTHURI: You know, I didn’t enjoy medical school as much as I thought I would. I thought it would be like House. You show up and you’re just solving intellectual problem after intellectual problem. Turns out that’s not what the majority of medicine is anymore. And so it was a switch, but I think it was always here.
RAND: Let’s talk about then why you’re at Argonne, and the choice to be there, along with being at the University of Chicago.
KASTHURI: So Argonne is one of these national labs that is funded by the Department of Energy. They have currently—I can’t remember the rankings—but the fourth largest, strongest, handsomest computer in the world. And they’re one of the few places—there is very few academic centers, academic universities in the world, where as a young scientist you could show up and say, listen, I’d like to collect a trillion gigabytes of data. I don’t really have any money for the computers. Maybe you guys could help out.
KASTHURI: I couldn’t find a bunch of places that said yes to that, but when I showed up at Argonne they said, yeah, we can do this.
RAND: That seems cool.
RAND: That’s great. Now, you had thought if you could obtain $15 million-- was that the number?
KASTHURI: That you could get this done in a year and a half.
RAND: Is that still—
KASTHURI: Yeah, I mean, since we’re on the record, let’s make it 25, just in case.
KASTHURI: But yeah, on that order of magnitude. Now, to be fair, that number is to collect the data. I don’t know of anyone other than one of our close collaborators at Google knows how to analyze the data.
RAND: And Google is involved in this with you, aren’t they?
KASTHURI: It is amazing. So we can collect all of this data, but what we really need are—and we calculated this—if you calculate all the humans that currently live on the planet. And you make an estimate for all the humans that have ever lived on the planet. And you say, I’m going to have every one of those people work a 40-hour week, and trace all the neurons in a mouse brain. It’s still going to take something like 10,000 years to analyze all of that data. I might be wrong. It might be 1,000 years, but we’ll all be dead anyway, so it won’t matter.
KASTHURI: And so it turns out that the only way we can imagine this working is if we get algorithms that can see the same things in the data sets that humans see. And Google is, not for our work, but in a lot of other work, self-driving cars, recognizing people in pictures, they’re deeply invested in this space called machine learning, or artificial intelligence. I didn’t do this, but some very smart neuroscientist who is a collaborator of ours, convinced Google that if they could crack this problem, they could crack any problem in this space.
KASTHURI: And so I really think they currently, amazingly, have the best algorithms in the world for analyzing mouse brains the way we collect the data.
RAND: You wouldn’t think that about Google off the top of the chart, would you?
KASTHURI: No, but although, I will tell you they are moving more into the medical space almost every year.
RAND: Simply because of being able to have the data and the need for data to do this.
RAND: OK, fascinating. So if we look out and think through, well, what’s the path that you’re on right now? And where do you see in what’s happening over the next five years?
KASTHURI: The hard part with human brains is people have to give us samples. And for most medical—
RAND: Thanks for not asking for one when you came in, by the way.
KASTHURI: For most medical conditions, it’s hard to get a brain biopsy. So in the mouse, we want to learn general principles of how the disease works, but even this field is moving so fast, there’s a set of scientists here and set of scientists worldwide that are now being able to take a skin cell from a human being, turn it into a stem cell, a cell that can make anything, and then turn that stem cell into a 3-D mini brain from them. And apparently, that mini brain contains—if the person had epilepsy a genetic—
RAND: It would be in there.
KASTHURI: It would be in there. If the person had schizophrenia, it’s in there. So now that is a volume we can analyze before or after we deliver drugs, et cetera. And then make predictions about the actual human to really personalize therapy. Now, this is just a frontier that’s starting, but given how fast science moves, maybe in five years, you will be able to have your own personalized brain in a dish, where people can analyze that brain. And then make predictions about yours.
KASTHURI: For me it’s hard to say how we will go five years from now, but all of these threads are happening at the same time. So it’s hard for me to believe that in five to 10 years, we don’t really fundamentally understand brains, not just as things that contain the soul, but as things that are like computational units, that we will start to even understand the brain as a device, as a computational device way more than we understand it now.
RAND: It’s a good time to be alive, isn’t it?
KASTHURI: Yeah, or scary too.
RAND: Or scary.
KASTHURI: I could see the scary part.
RAND: All right, well, it is a delight having you here. I can’t wait to keep reading what you’re doing and accomplishing. Thank you for coming in and sharing your time with us today.
KASTHURI: Thank you very much for having me.
One scientist’s quest to improve technology as we transition to green energy
Scholar explores the science behind animal consciousness
Research examines—and could help predict—extreme weather events around the world
Why Air Pollution Is Cutting Years Off Our Lives, with Christa Hasenkopf and Anant Sudarshan (Ep. 95)
Scholars behind Air Quality Life Index report warn of threat to our global health
Scholar examines how the wealthy, global corporations exploit tax loopholes in the tiny U.S. state
Studying gangs and political enemies, scholar tries to understand why we fight—and how to stop conflict
From green burials to DIY funerals, how death in America is changing with Shannon Lee Dawdy (Ep. 92)
Anthropologist examines what our rituals reveal about society, especially after 9/11
Book examines how better policies can bolster families and boost early childhood development
Global health expert warns about a potential ‘pandemic in the shadows’
Scholar examines how researchers could generate greater innovation and discovery | <urn:uuid:cedc6736-c24c-49b8-bca3-1dbfdde15840> | CC-MAIN-2022-33 | https://news.uchicago.edu/podcasts/big-brains/mapping-human-brain | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571536.89/warc/CC-MAIN-20220811224716-20220812014716-00267.warc.gz | en | 0.954718 | 6,398 | 2.75 | 3 |
Diseases are inevitable in a human life. For one reason or another you may fall sick a number of times in your lifetime. But the good news is that most of the times you will beat the disease by taking right dosage of medicine on time and with a little lifestyle changes. But the sad news is even in the 21st century winning a battle against cancer is impossible.
No need to worry. Medical scenario has changed a lot in the last few decades. What seemed impossible at that time is quite possible now. In fact, there are several real life examples of cancer survivors who have won the battle against the deadly disease.
Star cyclist Lance Armstrong, Indian cricketer Yuvraj Singh, Hollywood celebrities Hugh Jackman and Robert De Niro amongst others have successfully come out of the fatal disease and living a pleasant life now. It definitely gives a glimmer of hope to all cancer patients. There is every reason to smile and feel optimist.
Some Effective Cancer Treatment Options For Quick Recovery
- Surgery: Since ancient times surgery has been considered to be the most effective cancer treatment option. It involves complete removal of a malignant tumor out of the body. Once a biopsy (the process by which a tissue from a problematic area of the body is taken out for laboratory examination) confirms the presence of cancerous cells – the doctor then follow it up with appropriate surgery.
- Chemotherapy: In recent times, chemotherapy has got wider acceptability for its effectiveness. It is done to shrink size the tumour and thus reducing the risk factor too. Oncologists or cancer specialists use chemotherapy to cure blood cancers.
- Immunotherapy: This is another cancer treatment option that includes a wide range of therapies. The aim of Immunotherapy is boost the patient’s inherent capability to fight cancer cells while improving the body’s defense power. It stops the growth and spreading of cancer cells inside body.
- Stem Cell Transplant: It restores blood forming cells inside cancer patient – who has destroyed the same due to high intake of radiation – permeated through chemotherapy while treating any other cancers. Human body consists of three types of blood cells; RBC or Red Blood Cells, WBC (White Blood Cells) or Blood Platelets. We need all these cells to work in tandem to stay healthy.
- Hormone Therapy: This cancer treatment option is extremely beneficial for persons suffering from breast or prostate cancer (both these cancers form due to hormone related factors). This therapy is highly advisable in cases when surgery or chemotherapy is not applicable. It prevents cancerous cells to grow further.
Usually doctor finalises the appropriate therapy options for cancer patients depending upon the patients’ medical history, severity of the cancer, his heredity and allergy to certain medications and drugs.
Preventing Cancer: Tips at a Glance
- Be active.
- Do Exercise Regularly.
- Have a good 8-hour sleep every day.
- Don’t expose your skin to sun for longer hours. Take adequate care of your skin. Use moisturizers on frequent basis.
- Eat lots of fresh vegetables and fruits.
- Don’t forget your daily intake of Vitamin C – found in oranges, lemon and Indian gooseberries. Also drink at least 8 to 10 liters of water every day to keep yourself hydrated. | <urn:uuid:838f24e3-0f76-41b9-b921-c2cbcd1843d1> | CC-MAIN-2017-04 | http://researchvilla.com/2016/11/08/cancer-treatment-options-trends-and-development/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281331.15/warc/CC-MAIN-20170116095121-00224-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.924876 | 681 | 2.484375 | 2 |
Notes on medieval and modern Welsh grammar and philology.
- For more information, email the repository
- Advice on accessing these materials
- Cite this description
- This material is held at
- ReferenceGB 210 NLW MSS 2457-2458C.
- Alternative Id.(alternative) vtls004332758(alternative) (WlAbNL)0000332758
- Dates of Creation[1885x1914] /
- Name of Creator
- Language of MaterialEnglish, Welsh.
- LocationARCH/MSS (GB0210)
Scope and Content
Formerly known as Anwyl 37-38.
Title based on contents.
Preferred citation: NLW MSS 2457-2458C.
Other Finding Aids
The descriptions are also available in the Handlist of Manuscripts in the National Library of Wales, Volume I (Aberystwyth, 1943). | <urn:uuid:9f8ced2e-a3e9-4777-bd1d-42d3fef5618f> | CC-MAIN-2022-33 | https://archiveshub.jisc.ac.uk/search/archives/aa9e8550-3767-3566-9646-1dfbbf6e59e1?component=29d8f6d2-c40a-3fbd-8d22-4f56518a1a72 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00677.warc.gz | en | 0.70905 | 252 | 1.765625 | 2 |
Where extreme temperatures, weathers, vibrations or mis-match surfaces exist, our selection of structural adhesives sticks them all. Performance levels are really high such that the adhesives themselves can be even stronger than the actual materials being bonded together.
There are 3 structural adhesive base types available with these important features:
- Epoxy: gives high strength at elevated temperatures and good chemical resistance
- Urethane: cures quicker to facilitate flexibility between dis-similar materials whilst retaining strong impact resistance.
- Acrylic: bonds a wide assortment of materials incliuding difficult plastics or even oily metals. The beauty here is surface preparation that can be kept to a minimum due to the adhesive chemistry;
but do check what you're bonding first as it never can be ruled out completely. | <urn:uuid:2fc31442-f1fe-4a71-8c9d-c331e3f9f5b2> | CC-MAIN-2017-04 | http://www.finecal.co.uk/adhesives/structural-adhesives | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280791.35/warc/CC-MAIN-20170116095120-00360-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.902738 | 159 | 2.078125 | 2 |
PROTAGONIST IN CHRISTOPHER
A Research Paper
Presented to the
High School Department
Holy Angel University
Zwitsel P. SuarezCristle Yumul
Alyssa Joy S. SomeraLorenz A. Zamora
Pamela Joy P. Sotto Mark Louie S. Venzon
Aira Joy Teopaco Ian Jasper Villena
Mrs, Anna Ruby S. Perez
1 March 2011
Controlling Purpose: To show the traits of the protagonist in Christopher Paolini’s “Eragon” through character analysis.
1.1. Background of the author
1.2. Summary of the novel
1.3. Definition of terms
1.3.2 Character analysis
1.3.4. Dragon Rider
1.3.9. The Spine
2.1. Background of Eragon
2.2. Traits of Eragon
Eragon is chosen to be the focus of the study because he is the main character of the story. And the researchers will brainstorm and share some ideas how to present the character of Eragon creatively.
The story talks about dragons and dragon riders who live in a magical kingdom. People live peacefully there until one day, a young dragon rider betrays his race. His name is Galbatorix. He kills all dragons and riders because he wants to be the most powerful in the kingdom. Becoming successful, he rules the kingdom of Alagaesia. But there is this Elven lady, who is a princess, taking care of the last dragon egg, which is their last and only hope. She sends it to the Spine and there, a young farm boy sees it in the middle of the forest. This young poor boy named Eragon thinks it was a precious blue stone. He tries to sell it but no one gets it. Until one day, he sees the egg cracking. He is amazed because he sees a cute little dragon coming after him. Without knowing, Eragon’s fate with the dragon is now starting. They are destined to beat Galbatorix’s reign and be the last dragon and rider. The adventures of Eragon will show his different traits, which are being highlighted in this study.
Background of the author
Christopher Paolini (born November 17, 1983 in Southern California) is an American novelist. He is best known as the author of the Inheritance Cycle, which consists of the books Eragon, Eldest, Brisingr, and a currently untitled fourth book. He lives in Paradise Valley, Montana, where he wrote his first book.
Christopher Paolini was raised in the Paradise Valley, Montana area. His family members include his parents, Kenneth Paolini and Talita Hodgkinson, and his sister, Angela Paolini. Home schooled for the duration of his education, Paolini graduated from high school at the age of 15 through a set of accredited correspondence courses from American School of Correspondence in Lansing, Illinois. Following graduation, he started his work on what would become the novel Eragon, the first of a series set in the mythical land of Alagaësia.
In 2002, Eragon was published by Paolini International LLC, Paolini's parents' company. To promote the book, Paolini toured over 135 schools and libraries, discussing reading and writing, all the while dressed in "a medieval costume of red shirt, billowy black pants, lace-up boots, and a jaunty black cap." Paolini created the cover art for the first edition of Eragon, which featured Saphira's eye. He also drew the maps on the inside covers of his books.
In summer 2002, the stepson of author Carl Hiaasen found Eragon in a bookstore and loved it, and Hiaasen brought it to the attention of his publisher, Alfred A. Knopf. Knopf subsequently made an offer to publish Eragon and the rest of the Inheritance cycle. The second edition of Eragon was published by Knopf in August 2003. At the age of nineteen, Paolini became a New York Times... | <urn:uuid:d4653807-d078-4811-b4dc-181ed90cdbb5> | CC-MAIN-2017-04 | http://www.studymode.com/essays/Research-Paper-Eragon-888125.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281151.11/warc/CC-MAIN-20170116095121-00110-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.938265 | 853 | 2.25 | 2 |
Matthew 26:1-13 : American Standard Version
1And it came to pass, when Jesus had finished all these words, he said unto his disciples, 2Ye know that after two days the passover cometh, and the Son of man is delivered up to be crucified. 3Then were gathered together the chief priests, and the elders of the people, unto the court of the high priest, who was called Caiaphas; 4and they took counsel together that they might take Jesus by subtlety, and kill him. 5But they said, Not during the feast, lest a tumult arise among people.
6Now when Jesus was in Bethany, in the house of Simon the leper, 7there came unto him a woman having an alabaster cruse of exceeding precious ointment, and she poured it upon his head, as he sat at meat. 8But when the disciples saw it, they had indignation, saying, To what purpose is this waste? 9For this ointment might have been sold for much, and given to the poor. 10But Jesus perceiving it said unto them, Why trouble ye the woman? for she hath wrought a good work upon me. 11For ye have the poor always with you; but me ye have not always. 12For in that she poured this ointment upon my body, she did it to prepare me for burial. 13Verily I say unto you, Wheresoever this gospel shall be preached in the whole world, that also which this woman hath done shall be spoken of for a memorial of her. | <urn:uuid:b172854f-925c-448d-ba71-317776766510> | CC-MAIN-2017-04 | http://bibleabc.net/bible/asv/mat26-1.htm | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00470-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.977499 | 325 | 1.820313 | 2 |
During the Digital Open Living Lab Days (DLLD2020) the best full research paper award was given to the article: “MIND THE GAP: Understanding and communicating the business value of co-creation” by Suvi Seikkula, Julia Nevmerzhitskaya and Aletta Purola. The paper was based on Suvi Seikkula’s extensive thesis work commissioned by CIRC4Life-project.
Integration of education and research and development (R&D) activities is one of the key priorities for universities of applied sciences. According to Arene (2020), a special feature of R&D work in universities of applied sciences is a significant participation of students in this work, through their studies, job placements and thesis process. Laurea’s Learning by Developing (LbD) model integrates research, development and innovation activities with teaching and learning through development projects (Raij, 2014). Practical implementation of the model happens through joint RD&I projects in which students act as developers together with research and teaching staff. Student participation can take different forms: from project-based assignment during a study module to a paid internship and thesis work.
Not all RD&I projects can be easily integrated into educational activities. Horizon2020 funds research and innovation projects helping to achieve European competitiveness with its emphasis on excellent science, industrial leadership and tackling societal challenges. This requires participation of top-level researchers and innovators. Although Horizon2020 projects do not directly tackle educational aims (as opposed to Erasmus projects, as an example), they allow for student participation, usually as a part of a project team, and support young researchers by e.g. covering the costs of conference participation. The level of integration varies from project to project, and depends on the available resources and the goals of the project.
CIRC4Life-project has provided an excellent case for the integration of education and research and development work. The project, funded by the EU under Horizon2020 under grant agreement No 776503, aims at developing circular economy business models and demonstrating these models in four industrial sectors. As a large-scale demonstration of an innovation action, the project concentrates on activities directly aiming at producing plans and arrangements or designs for new, altered or improved products, processes or services. In accordance with Horizon2020 rules for innovation actions, the project includes prototyping, testing, demonstrating, piloting, large-scale product validation and market replication. Laurea’s role in the project as the Living Lab coordinator directly supports key project activities.
A part of the CIRC4Life dissemination and exploitation activities is dedicated to the academic teaching and education. The academic partners in the consortium disseminate the knowledge gained from this project in their respective universities. The results of the project will be utilised to inform the teaching to both postgraduate and undergraduate courses in sustainable design, production, ecology, circular economy, business models and innovation, and other related areas. The project plan includes “the input to (i) the internships, (ii) taught programmes related aspects, such as teaching materials for study modules, group/individual projects, graduation theses, etc. (iii) MPhil/PhD projects” (CIRC4Life Grant Agreement, 2018).
During the first 2 years of the project, CIRC4Life was introduced at Laurea to over a hundred students, and provided project-related assignments to four different study units in both Master and Bachelor degree programs. Laurea was able to involve 18 Master students as facilitators of co-creation events such as Open Innovation Camp and Laurea CE Jam, and 2 Bachelor students into development of a mobile application. Due to innovative and applied nature of the project, the project-based assignments covered topics related to service design, usability testing, mobile app development, co-creation and circular economy business models, thus allowing for cross-disciplinary teams of students to be involved. In 2020, CIRC4Life also supports RD&I-path students (TKI-polku in Finnish) and offers possibility to conduct their studies in the project. The project offers internships and continuous thesis topics for Master students.
Laurea’s Master student Suvi Seikkula got interested in CIRC4Life project and especially the co-creation of products and services business model, as the topic was closely related to her interest in co-creation and service design. Based on the discussion with the CIRC4Life project manager, Suvi decided to tackle the challenge of how to show the value of co-creation to the companies developing new circular economy business models.
“The CIRC4Life project is based on co-creation, which is a complex and utterly intriguing and interesting subject. I am especially interested in the dynamics between people co-creating and how different personal aspects factor into it. The project also deals with the development of business models and I am especially interested in business design, focusing more on the strategic than the operational everyday aspects of running a business”
– explains Seikkula her motivation to choose CIRC4Life as her thesis topic. According to Seikkula, doing a thesis for an EU project is an easy package: you get the thesis commissioner with a real life challenge, a contact person to support the thesis process, and access to background materials.
We asked Suvi to describe the key benefits and challenges of having a thesis work commissioned by a project team. Among the benefits, Seikkula considers the practical nature and the real-life relevance, which is also a good motivating factor. At the same time, the project scope can limit the development part of a thesis process, which is a challenge, according to Suvi. She also finds it challenging to prove the relevance of the development work to the thesis commissioner and the project partners.
Project team’s perspective
CIRC4Life project specialist and service designer Aletta Purola considers that the main benefit of working with students is new viewpoints and solutions brought to the project. According to Purola, involving a sharp minded student helps to take a step back and to observe a project more objectively, which often results in recognizing pain-points and finding better ways of working and approaching challenges. As a human-centered service designer, Aletta believes that each student has a unique skillset to offer to the project. In the best occasion, these skills are harnessed and transferred into action items that can eventually benefit the whole project. Also involving students in projects addressing complex societal challenges such as sustainable behavior and circular economy helps develop inner motivation and personal interest in becoming a part of the sustainable change.
One of the key challenges from the project team’s perspective is related to balancing the resources needed for providing a good induction and support for the students, so that they are able to start working independently. This requires good cooperation with teachers and thesis supervisors, which is not always the case. As Purola puts it:
“working directly with the students on their project-related tasks has been straightforward and easy, however, when these are related to thesis, having the supervisors involved systematically throughout the process would be beneficial for both sides”.
Collaborative R&D projects such as the ones funded under Horizon2020 do not directly aim at integrating educational aspects because of their expectation to involve top scientists and researchers, but they offer a number of ways to engage students in the development work. Although the RD&I and education integration can be a time consuming process, it can also bring visible benefits both for the project team, and for the students’ professional development.
Laurea’s LbD philosophy of treating students as a part of a development team together with teachers and project specialists provides a good basis for the integration. In CIRC4Life we continue to implement different options for integrating students into the development work, starting from interactive sessions during study units, offering project-based studies, course assignments, internships, thesis work and short-term employment opportunities. The successful cooperation described in this article not only resulted in a thesis, but also received a recognition by top researchers in the field of co-creation and Living Labs. The best full research paper award shows that junior researchers have a great innovation potential, especially with the support from a project team. Seikkula mentioned that her thesis research commissioned by CIRC4Life was so thorough and allowed her to practice different research methods, that she considers it a good basis for continuing postgraduate studies. This opens up new opportunities for a project-based life-long learning.
“Mind the Gap: understanding and communicating the business value of co-creation ” by Seikkula et al (2020) is available at DLLLD Conference proceedings at https://issuu.com/enoll/docs/proceedings_final | <urn:uuid:525d92fb-05eb-4a5b-8edd-eb36332c5b94> | CC-MAIN-2022-33 | https://journal.laurea.fi/from-project-based-thesis-to-the-best-research-paper-award-success-story-of-rdi-and-education-integration/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572408.31/warc/CC-MAIN-20220816151008-20220816181008-00667.warc.gz | en | 0.946373 | 1,821 | 1.992188 | 2 |
The Internet weighs two ounces.
Driving it takes 50,000,000 horsepower. A statistically rough (one sigma) estimate might be 75-100 million servers @ ~350-550 watts each. Call it Forty Billion Watts or ~ 40 GW. Since silicon logic runs at three volts or so, and an Ampere is some ten to the eighteenth electrons a second, if the average chip runs at a Gigaherz, straightforward calculation reveals that some 50 grams of electrons in motion make up the Internet. Adamant
Gosh! I think that the internet needs to eat some more chocolate cake and ice cream! | <urn:uuid:33c637df-33a5-4e13-8042-75da75e9c477> | CC-MAIN-2017-04 | http://zaiusnation.blogspot.com/2008/07/internet-weighs-two-ounces.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281746.82/warc/CC-MAIN-20170116095121-00284-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.871068 | 126 | 1.9375 | 2 |
Nanocoating or nano sealing is a chemical process that refers to designing surfaces with certain desired characteristics. Nano structures build a consistent network of molecules on a surface and can make the surface either a hydrophobe or a hydrophil. On a hydrophobic surface, water is repelled and flows away immediately, whereas on a hydrophilic surface, water builds a plain film on the surface. Increasing demand for medical device coatings is expected to propel the global nanocoatings market
. The overall market is estimated to grow positively at a CAGR of 24.7% during the period between 2013 and 2019 and reach a valuation of US$6.75 billion by 2019.
Demand for Smart Coatings to Open New Growth Avenues for Global Nanocoatings Market
Nanocoatings are particularly in demand from industries such as medical devices, pharmaceuticals, and automotive. The low volatile organic compound (VOC) content of nanocoatings makes them more beneficial than conventional coatings owing to their lower negative impact on the environment. This is expected to further boost the global nanocoatings market.
However, various research studies have pointed out that nano materials can have certain adverse effects on human health. This can restrain the growth of the nanocoatings market. The global nanocoatings market has a huge opportunity to grow with the growing demand for smart coatings. Rising demand for nanocoatings from various industries in countries such as China and India is also expected to push the growth of the overall market.
Anti-Fingerprint Nanocoatings Segment to Grow Fastest During 2013-2019
On the basis of the product type, the global nanocoatings market has been segmented into anti-microbial, anti-fingerprint, self-cleaning, anti-fouling and easy-to-clean, and others including specialty coatings. In 2012, the demand for anti-microbial nanocoatings was the highest and accounted for 29.6% of the global demand. The high demand for anti-microbial nanocoatings can be attributed to their wide application in sectors such as food production, healthcare, and water treatment. During the period from 2013 to 2019, the anti-fingerprint nanocoatings segment is expected to witness the fastest growth in the market.
Medical and Healthcare Sector Dominated Global Nanocoatings Market in 2012
Depending on the end user segments, the global nanocoatings market has been divided into food manufacturing, medical and healthcare, marine, packaging, electronics, water treatment, automotive, buildings and construction, energy, and others including leather and engineering industries. The demand for nanocoatings from healthcare, automotive, packaging, and electronics sectors is expected to increase significantly during the next couple of years.
The medical and healthcare sector accounted for the highest demand from the nanocoatings market in 2012, owing to the extensive application of nanocoatings on medical implants and equipment. The demand from the medical and healthcare sector for nanocoatings is estimated to rise in the near future. The automotive sector has emerged as the second largest end user of nanocoatings. In the coming years, the electronics and energy sectors are anticipated to be the fastest growing end-use segments of the global nanocoatings market.
Asia Pacific to Emerge as Fastest Growing Regional Nanocoatings Market
Geographically, North America is the largest market for global nanocoatings market, closely followed by Europe. However, during the span between 2013 and 2019, Asia Pacific is expected to evolve into the fastest growing market for nanocoatings, growing at a CAGR of 25.8%. The rapid growth of the market in this region can be attributed to the thriving automotive and electronics industries.Some of the key players in the global nanocoatings market are Bio-Gate AG, Cima Nano Tech Inc., Inframat Corporation, P2i Ltd., and Nanogate AG. | <urn:uuid:dd188779-4bf1-4701-b334-0c46167593f5> | CC-MAIN-2017-04 | http://www.transparencymarketresearch.com/article/nanocoatings-market.htm | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282140.72/warc/CC-MAIN-20170116095122-00132-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.950845 | 818 | 2.53125 | 3 |
Etna - plume of ash and gases from the Northeast Crater (NEC) on 09/12/2015 - photo Boris Behncke / INGV Catania
The eruptive activity on Etna has continued with, on December 9, issue of ash gray-brownish at the northeast crater (NEC).
As INGV precise, these emissions are not associated with strombolian activity, nor lava fountains, as confirmed by visual observations and thermal camera. The plume consists of gases and pyroclastic material, pushed by the wind towards the coast of the Ionian Sea.
Etna 09.12.2015 respectively 9:01, 11:34 and 12:30- webcam Radiostudio 7 (6 -Bocca Nuova and SE Crater & 3)
The seismic swarm that marks the northeast flank of Etna has a significant decrease in frequency and magnitude of the episodes. To recall, two earthquakes of magnitude 2.9 and 3.8 were perceived by neighbors and centimeter cracks appeared on the road from Linguaglossa ro Piano Provenzana.
The INGV connects this to a dynamic environment characterized by the deflation of the volcano, after the magmatic drain generated by the paroxysms of Voragine, followed by the Strombolian activity at NSEC; it represents the response of the tectonic structures of the eastern sector of the volcano.
We are waiting anxiouslyt a representative schema of the changes during December of the morphology of the summit, specially of the summit craters of Etna.
Source: INGV Catania
Cotopaxi - the road to the National Park shelter cut by a secondary lahar to the release of the Quebrada Agualongo - photo IGEPN 09/12/2015
The IGEPN confirms a decline in Cotopaxi external activity during the last month; it is characterized by a pulsatile gas emission in form of a white plume rarely exceeding 1,000 meters above the crater.
Seismicity is also declining, both in terms of earthquakes LP that of tremor of emission. The number of volcano tectonic earthquakes remains between 30 and 150 per day.
The level of sulfur dioxide emissions remains generally under 3,000 tons / day.
Since November 7, 14 secondary lahars were detected, the most important on 11.28.2015, without harm to the population as circumscribed within the Cotopaxi National Park. A deposit of 50 cm thickness cut a road to the refuge at the exit of the Quebrada Agualongo.
Nicaraguans media report, via the INETER, that following the eruptive activity of the Momotombo early December, a lava dome would form at the top of the volcano.
To be continued | <urn:uuid:c4cdcdac-3cf9-47bb-9056-d072e5f3f9a4> | CC-MAIN-2017-04 | http://www.earth-of-fire.com/2015/12/etna-all-craters-successively-concerned-brief-news-of-cotopaxi-and-momotombo.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.22/warc/CC-MAIN-20170116095120-00050-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.933623 | 585 | 2.078125 | 2 |
The term "nurse" can mean either a licensed practical nurse or a registered nurse. Although both kinds of nurses are important to the provision of nursing care, they are not identical. LPNs and RNs both must pass national exams to practice and obtain a license, but they take different tests. Each state regulates the practice of nursing and the scope of practice for LPNs and RNs may differ from one state to another, but LPNs usually have a much more limited scope of practice in every state.
The Licensed Practical Nurse
The LPN, also called a licensed vocational nurse in some states, is authorized to provide direct patient care only under the supervision of an RN or physician; LPNs cannot practice independently. An LPN may administer medications, perform treatments ordered by a physician, change dressings or help a patient walk. LPNs work in hospitals, clinics, nursing homes or in home health care. However, some hospitals are phasing out LPNs because they cannot deliver the highly complex care many hospital patients need, according to an article on the Hospitals and Health Network website.
The Registered Nurse
Although the registered nurse provides some of the same direct care as that delivered by an LPN, RNs are expected to take leadership roles, apply critical thinking skills and deliver highly complex and sophisticated care that is not within the scope of practice for an LPN. RNs, for example, can manage central line catheters, give intravenous medications and take charge of a nursing unit. In some states, only RNs can give blood or certain kinds of medications such as insulin. RNs can also supervise LPNs, but the reverse is not true.
Education for LPNs and RNs covers similar subjects, but the RN must master more complex topics and in greater depth. A typical LPN program, available from community colleges or technical-vocation schools, is usually only one year. Students study basic nursing, anatomy, physiology and pharmacology, and obtain practical experience in patient care. RN programs last a minimum of two years, with a focus on leadership, critical thinking skills, psychology and social sciences in addition to hands-on nursing care. RNs may also go on to earn advanced degrees such as a doctorate in nursing.
Wages are another area where LPNS and RNs differ. An LPN earned an average annual income of $42,040 in 2011, according to the Bureau of Labor Statistics. Ironically, LPNs who did not work in health care tended to have higher salaries; the average annual wage of an LPN in grant making and giving services was $47,930 and in junior colleges $47,560. RNs had considerably higher wages in 2011, with an annual average wage of $69,110, according to the BLS. However, an RN in a nursing care facility might earn as little as $60,830 and an RN in a physician’s office could earn as much $72,890.
- Bureau of Labor Statistics: Licensed Practical and Licensed Vocational Nurses
- Bureau of Labor Statistics: Registered Nurse
- Mayo School of Health Sciences: Nursing
- Hospitals and Health Networks: Sun May Set on LPNs as Care Gets More Complex
- Bureau of Labor Statistics: Occupational Employment and Wages, May 2011 29-2061 Licensed Practical and Licensed Vocational Nurses
- Bureau of Labor Statistics: Occupational Employment and Wages, May 2011 29-1111 Registered Nurses
- Thinkstock Images/Comstock/Getty Images | <urn:uuid:e30fa720-4699-4827-9975-996e2ebd693d> | CC-MAIN-2017-04 | http://work.chron.com/practical-nurses-vs-registered-nurses-8037.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281162.88/warc/CC-MAIN-20170116095121-00536-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.962304 | 729 | 3.375 | 3 |
A dual scheme for the compression and restoration of sequentially transmitted images over Wireless Sensor Networks (WSNs) is presented. These networks are characterized by low transmission rates, extended packet losses and limited power resources, factors that degrade the overall system performance. Especially in the cases of transmitting multimedia content, a considerable number of data packets are dropped, with a corresponding direct effect on the received image quality. For dealing with this loss of valuable information, various retransmission schemes have been proposed that act as quality of service modules. However, this approach increases energy consumption and inserts considerable time delays, due to the rise of the traffic load in the network. This article proposes a novel dual transmission scheme, targeting mainly the area of Multimedia WSNs (WMSN), that aims to decrease the overall traffic load introduced by the retransmission schemes, by performing image restoration for lost data packets, at the receiver side. The proposed novel dual scheme is based on: (a) the quad tree decomposition algorithm that is adopted for compressing the image data before transmission over the WSN, and (b) the fast image inpainting algorithm for restoring the effect of the missing data packets. The overall proposed scheme has been applied in multiple experimental studies that prove its efficacy.
- Image inpainting
- Multimedia Wireless Sensor Networks
- Quad tree decomposition
- Wireless Sensor Networks
ASJC Scopus subject areas
- Hardware and Architecture
- Computer Networks and Communications | <urn:uuid:198338f7-19c8-4a6a-91b2-1e389818bf2b> | CC-MAIN-2022-33 | https://nyuscholars.nyu.edu/en/publications/a-dual-scheme-for-compression-and-restoration-of-sequentially-tra | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573540.20/warc/CC-MAIN-20220819005802-20220819035802-00479.warc.gz | en | 0.933943 | 303 | 2 | 2 |
Smappee provides a cost effective, plug and play solution to meet the Australian national construction code requirements for energy monitoring and reporting..
The latest revision of the Australian National Construction Code and in particular NCC 2019 Volume One – section J8.3 Facilities for energy monitoring, means a lot when it comes to power metering and gathering historical usage data for light, power and other sub distribution circuits.
New 2019 Requirements
As of the 1st of May 2019 in NSW, VIC, SA, QLD and NT, and from the 1st of June 2019 in ACT the new standards require essentially all sub-distribution boards installed in large commercial facilities to have power meters installed and require the historical time of use data to be captured and accessible via a common data hub/monitoring system.
J8.3 Facilities for energy monitoring
(a) A building or sole-occupancy unit with a floor area of more than 500 m2 must have an energy meter configured to record the time-of-use consumption of gas and electricity.
(b) A building with a floor area of more than 2 500 m2 must have energy meters configured to enable individual time-of-use energy consumption data recording, in accordance with (c), of the energy consumption of—
(i) air-conditioning plant including, where appropriate, heating plant, cooling plant and air handling fans; and
(ii) artificial lighting; and
(iii) appliance power; and
(iv) central hot water supply; and
(v) internal transport devices including lifts, escalators and moving walkways where there is more than one serving the building; and
(vi) other ancillary plant.
(c) Energy meters required by (b) must be interlinked by a communication system that collates the time-of-use energy consumption data to a single interface monitoring system where it can be stored, analysed and reviewed.
(d) The provisions of (b) do not apply to a Class 2 building with a floor area of more than 2 500 m2 where the total area of the common areas is less than 500 m2.
Previously the requirement for metering of these sub-circuits required no data gathering and meters did not need to be connected to a communications network and monitored by a common system; e.g. BMS (building management system) or EMS (energy management system). Power meters could simply be installed and essentially forgotten.
The main intent of these changes to the national construction code is to allow the energy usage data to be utilised by tenants, owners, and facilities managers to identify opportunities to improve efficiency and reduce energy costs. The individual requirements for interval data and how long the data is stored is dependant on the facility itself.
More information on the requirements for submetering per section J8.3 and the intended purpose for the metering system can be found in the Energy Efficiency Handbook – NCC Volume One, which can be downloaded from this page on the Australian Building Codes Board (ABCB) website.
Better Utilisation of Installed Meters
This is a great initiative to ensure that installed power meters are able to provide functional and accessible insights into a facility’s energy usage, offering potential cost savings by allowing property managers and tenants to make informed decisions about the way they manage energy.
However, connecting sometimes hundreds of power meters to a common network and implementing a system to monitor and capture power usage data can be very costly, often in the range of tens if not hundreds of thousands of dollars.
Enter Smappee Infinity
The Smappee Infinity system provides a perfect solution for these networked energy monitoring requirements.
Each modular system can be expanded to monitor up to 28 circuits including conductors rated up to 4,000A.
Furthermore, multiple systems can be added to a single site and all of the data can be reported from the same dashboard.
In addition to power monitoring, the Smappee Input Modules can be used to monitor gas and water consumption by interfacing via pulse output.
The Smappee Infinity range of power monitoring devices allows for one system (Gateway + Power Box + CT Hubs / CTs) to monitor up to twenty-eight conductors. This can be a combination of single and three-phase circuits.
The current clamps range from 50A all the way up to 4,000A, meaning this solution can be used for small commercial buildings all the way up to multi-level facilities with large main feeds from the grid.
By utilising this modular platform end-users can gain large cost savings compared to purchasing and installing multiple power meters, networking equipment, and a custom reporting platform.
Meets Requirement for a Single Interface Monitoring System
Leveraging IoT technology the Smappee dashboard provides the functionality to view multiple Infinity systems from the one online interface.
Each system can be viewed individually, or a common board can be created showing historical data from all systems connected to a single site.
This is called the locations function and allows for easy access to real-time and historical energy usage data at multiple switchboards.
This feature works with both multiple MSBs and DBs in the same facility, or located anywhere in the world.
Data Gathering and Reporting
In addition to the benefits provided by Smappee’s modular hardware solution, data gathering of power usage can be carried out in one of two ways.
Users can utilise the Smappee online dashboard for historical and real-time reporting, including the ability to download data to a spreadsheet file.
The Connect gateway can also provide Modbus-TCP/IP over Ethernet, which can be connected via high level interface to a BMS or EMS.
The cloud-based reporting platform only requires an internet connection to work and the gateway options can achieve this via an Ethernet or WiFi connection to a local network connected to the internet There is also the option to use a 4G USB dongle with the Genius gateway.
Data Storage and Interval Data
The gateway devices will store local data for 24-48 hours in the case that an active internet connection is lost. This is model dependant with the Genius providing 48 hours backup and the Connect series providing 24 hours.
Once the data is stored to the cloud users can access interval data down to 5 minutes for 30 days, hourly data for 90 days, and daily data for up to 12 months.
Gas and Water Monitoring
In addition to power monitoring, Smappee also offers a range of input devices that can be used to collect pulse outputs via an S0 directly or with the assistance of an optical or magnetic sensor. This means that gas and water consumption can also be monitored by the same system.
Save with Smappee
When taking all of the above into account the cost for a Smappee Infinity energy monitoring system to meet the NCC section J8.3 requirements including hardware and cloud-based software is only a fraction of the cost compared to many custom engineered systems. It makes sense to consider Smappee for commercial power monitoring as the advantages can be significant from both a technical and cost perspective.
For more information on how Smappee can provide a cost effective metering solution per the BCA requirements, check out the Smappee Infinity overview Smappee Infinity Energy Management System. | <urn:uuid:346a1697-2d96-408e-b867-9660b2f6e97b> | CC-MAIN-2022-33 | https://vpt.com.au/blog/tag/energy-monitoring/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570767.11/warc/CC-MAIN-20220808061828-20220808091828-00474.warc.gz | en | 0.908157 | 1,504 | 1.742188 | 2 |
How do stressed plants affect climate change?
Plants form a key interface between the Earth’s surface and the atmosphere by exchanging carbon, water and energy with their environment. They also release chemicals called “volatile organic compounds” (VOCs) in the atmosphere. However, the overall impact of these gas compounds is poorly understood. Ülo Niinemets and his team look at the role of plants in large-scale Earth processes and how they affect air quality and the Earth surface temperature, solar radiation and precipitation.
Apart from fixing atmospheric CO2 and releasing oxygen, plants produce numerous gases that evaporate into the atmosphere. This plant process controls the formation of toxic gases, such as ozone, and of secondary organic aerosols, and initiates a process of cloud condensation.
Plant physiologist Prof Niinemets specifically focuses on “trace” gases and VOCs emitted by vegetation in conditions of stress. While a few plant species are well-known as constitutive emitters, all species can be triggered to produce VOCs under stress situations often encountered in nature, in response to an excess in temperatures or when they are attacked by pathogens and herbivores for example. This could mean that plant emissions worldwide have been vastly underestimated.
Prof Niinemets aims to test this hypothesis and provide fundamental insight into the stress responsiveness of plants. Among other biological stress factors, his team looks at European oaks infected by the powdery mildew fungus. The researchers have also studied an outbreak of leaf beetles in alder trees. Both infestations lead to major elicitation of volatile organic compounds and the SIP-VOL+ team tries to evaluate their impact on the formation of organic aerosols and cloud condensation.
The project attracted visiting collaborators from Asia and the USA, who contributed to the design of a new model for gas emissions developed by the team. The model links the severity of a stress experienced by plants and the amount of gases they consequently produce. The team will now scale the model up to ecosystems and landscapes at the regional and global levels to better understand the roles of plant-generated gases and their impact on the Earth’s climate.
Project details:Researcher (PI):ülo NiinemetsHost institution:Eesti Maaulikool, EstoniaProject:Stress-Induced Plant Volatiles in Biosphere-Atmosphere System, (Sip-Vol+)ERC call:Advanced Grant , ERC-2012-ADG, panel LS8Max ERC funding:2,259,366 €Duration:Start date: 2013-05-01, End date: 2018-04-30 | <urn:uuid:f4b710e5-dbfc-4277-aa0c-0b4b2e38489d> | CC-MAIN-2016-44 | https://erc.europa.eu/projects-and-results/erc-stories/how-do-stressed-plants-affect-climate-change | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719155.26/warc/CC-MAIN-20161020183839-00333-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.927472 | 540 | 3.59375 | 4 |
A comprehensive plan for school reorganization in DeKalb County, Indiana under the School Corporation Reorganizatin Act of 1959.
- 1 of 1 copy available at Evergreen Indiana.
0 current holds with 1 total copy.
|Location||Call Number / Copy Notes||Barcode||Shelving Location||Status||Due Date|
|Eckhart PL - Willennar Genealogy Center||R 371.01 COM (Text)||840191001250710||Genealogy - Research Room||Available||-|
- Physical Description: pages : illustrations ; 29 cm
- Publisher: [Auburn, IN] : [The Committee],
|General Note:|| The committee appointed by Judge Harold Stump of the DeKalb County Circuit Court, October 1959, included the following members: Dr. Darrell Miller, Clarence L. Bowers, Carl Becker, Raymond Burtch, Orlo Deetz, Howard Kandel, James Habig, Ralph Seckler, and Ross Tipton.
Search for related items by subject
|Subject:||Schools > Centralization.
Schools > Indiana > De Kalb County. | <urn:uuid:2566aeb6-5920-4e4d-a44c-b12232a8b38d> | CC-MAIN-2017-04 | https://evergreen.lib.in.us/eg/opac/record/20692390 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280730.27/warc/CC-MAIN-20170116095120-00246-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.691965 | 241 | 1.773438 | 2 |
Tech researchers on earthquake team
By Liz Crumbley
Spectrum Volume 20 Issue 17 - January 22, 1998
Virginia Tech researchers are part of a national team that has received a five-year, $10 million grant from the National Science Foundation (NSF) to study the application of advanced and emerging technologies to minimize earthquake damage and losses in the U.S.
The Tech researchers are working with earthquake experts from seven other universities. They comprise the National Center for Earthquake Engineering Research (NCEER), established by the NSF in 1986 and hosted by the State University of New York at Buffalo. The current $10 million grant brings funding for the NCEER to a total of $56 million.
Virginia Tech engineering professors Daniel J. Inman, James K. Mitchell and Mahendra P. Singh will study applications of advanced technologies for preventing damage during earthquakes to critical facilities such as hospitals.
Inman and Singh will examine methods of retrofitting buildings so that they can better withstand damage. Inman will investigate the use of smart materials systems in retrofitting buildings to withstand earthquake damage. He also will study the design of monitoring systems that can detect and assess post-earthquake damage.
Singh will investigate the susceptibility to damage of non-structural components of critical facilities. Singh's research will include a study of cost-effective methods of retrofitting facilities to withstand earthquake damage.
Mitchell's research will concentrate on the geotechnical aspects of earthquake damage reduction. Mitchell and engineers at Cornell and Rensselaer will study the use of soil-strengthening techniques such as grouting and deep densification to help prevent earthquake-induced liquefaction and lateral spreading of the ground. They will employ two strategies in their research: modifying the soil around and beneath existing buildings to decrease soil and structural deformations, and isolating a building from the surrounding ground to reduce earthquake-induced forces.
James McGrath, a Virginia Tech chemistry professor, also will participate in the NCEER project. He will review advanced materials for earthquake applications and, along with Singh, will serve on the NCEER's advisory board.
Among their numerous activities during the past 11 years, NCEER researchers have retrofitted several large buildings in earthquake-prone areas of California, and have played major roles in reconnaissance efforts following earthquakes in San Francisco and Northridge, California, and in Kobe, Japan.
The other NCEER participants are Cornell University, University of Delaware, University of Nevada at Reno, University of Pennsylvania, Rensselaer Polytechnic Institute, and the University of Southern California. The NCEER is one of a consortium of three national centers that also includes the Pacific Earthquake Engineering Research Center at the University of California at Berkeley and the Mid-America Earthquake Center at the University of Illinois at Urbana-Champaign. | <urn:uuid:e03ac58c-35f3-4cab-866d-2eba6b7e80a8> | CC-MAIN-2017-04 | http://scholar.lib.vt.edu/vtpubs/spectrum/sp980122/5c.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285001.96/warc/CC-MAIN-20170116095125-00299-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.944876 | 578 | 2.640625 | 3 |
In the wake of the brutal killing of George Floyd in Minnesota, Disney has sent a letter to fellow employees addressing the horrible tragedy. The letter is signed by Disney CEO Bob Chapek, Executive Chairman Bob Iger, and Disney’s Chief Diversity Officer Latondra Newton.
This letter addresses the pain and anger being felt due to events surrounding George Floyd’s murder and also resolves to use the resources of The Walt Disney Company to foster a culture that acknowledges the feelings and pain that is being felt. Disney also re-commits to diversity inclusion. Finally, Disney also commits to a real conversation to help influence change.
The full letter can be read here:
Dear Fellow Employee,
The recent killing of George Floyd as well as other instances of lethal attacks and harassment of unarmed black citizens in our nation continue to drive outrage and calls for action by people of all cultural backgrounds, including many of our employees. Feelings of grief and anger cause us to confront the inscrutable idea that the lives of some are deemed less valuable – and less worthy of dignity, care and protection – than the lives of others.
While these devastating incidents are not new, there’s something unique about what’s happening in this moment. The pandemic coupled with these recent injustices have pushed the issues of racial disparity into the open.
We, too, are struggling to make sense of the recent tragedies that leave us feeling overcome with sorrow. While we don’t have all the answers, we resolve to use our compassion, our creative ideas and our collective sense of humanity to ensure we are fostering a culture that acknowledges our people’s feelings and their pain. We also realize that now more than ever is the time for us all to further strengthen our commitment to diversity and inclusion everywhere.
We intend to focus our efforts and resources to compassionately and constructively talk about these matters openly and honestly as we seek solutions. We intend to keep the conversation going, not just today, but for as long as it takes to bring about real change.
Bob Chapek, Bob Iger & Latondra Newton
DAPS MAGIC supports the Equal Justice Initiative. If you would like to support this organization as well, you can do so at: https://support.eji.org/give/153413/#!/donation/checkout. | <urn:uuid:192a347d-3853-43a7-8d59-b501d91d240b> | CC-MAIN-2022-33 | https://dapsmagic.com/2020/05/disney-releases-statement-on-killing-of-george-floyd/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00078.warc.gz | en | 0.94759 | 482 | 2.1875 | 2 |
Western literature begins with the Iliad and, until very recently, it was assumed that no educated person in the West could have skipped reading the story. The story of a few days towards the end of the tenth year of the Greek war with Troy, the epic most likely refers to an actual war, remembered long after and filtered through a storyline of gods interacting with men, and men being undone by pride, anger, arrogance, and lust. Kierkegaard wrote that the Iliad was the perfect epic because it combined a great poet with a great subject matter. Even today, it stands up as a flawless story abounding in heroics, psychological drama, and ironic commentary on the lives of men.
The epic in fact begins with a delicious irony: we’re going to hear a song about the damage caused by Achilles’ uncontrolled anger, and yet it’s clear from the start that it’s the arrogance of his commander, Agamemnon, that’s causing all the trouble. Agamemnon, as leader of a Greek fleet besieging Ilium, has taken for his own concubine the daughter of the local priest of Apollo and his arrogance has moved the god to strike the Greeks with plague. Finally agreeing to return the girl, Agamemnon decides instead to take Achilles’ own slave girl, a direct slap in the face of his greatest warrior. The war has been raging for nine years already and all Achilles has to look forward to is glory after his death, and now his supercilious commander has insulted him in front of all the other warriors. In a sense, the Iliad begins with a question we can all relate to: what to do when your boss is a jerk?
In the larger sense, Achilles faces the dilemma of how the individual subsumes their needs to the collective good. It’s hard to live in society for any of us; but Achilles really is the greatest warrior and the son of a man and a goddess, Thetis. Even as a demigod, he has to stifle his will in order to live within an order of his inferiors. Agamemnon is an old fool, and nobody would fault Achilles if he killed him. This is a warrior culture in which the order of authority is not set in stone, but negotiated at nearly every minute. Agamemnon is the ruler because he asserts his authority and argues down anyone who challenges him. He is getting older and irrational. But, in order to win glory, Achilles will eventually have to fall in line under this old fool.
The Iliad is the story of how Achilles finally overcomes his own anger and follows his destiny; for much of the story, he just sits out the fighting and lets the Greeks get slaughtered. The gods have their favorites and fight as angrily among themselves as the men do. Zeus agrees for Thetis’s sake to let the Greeks suffer great casualties, which in turn angers his own wife Hera, who roots for the Greeks. Hera and Zeus are really one of the greatest feuding couples in Western literature. Meanwhile, the greatest warriors all experience divine interventions from gods and goddesses that often only they can see.
If the story of Achilles and Agamemnon revolves around their quarrel over a woman, the Trojan War is also fought over a woman: Helen. The wife of the Greek king Menelaus, Helen was seduced by the young Paris (again with divine help) and taken to Troy, triggering the Greek cities to band together and send a fleet of 1,186 ships and probably 100,000 men to attack the city. In one of the great scenes in the epic, the old men of Troy, when first seeing this woman who will launch one of the great wars of history against their city, say to one another that she was worth it. Helen’s is, quite literally, the face that launched a thousand ships.
Amazingly, we will discover in the Odyssey that, following the war, Helen and Menelaus got back together! Note the similar theme too: in the Iliad, the greatest war of prehistory is launched by a cuckolded husband and an unfaithful wife; in the Odyssey, Ulysses goes through hell in order to return home and prevent his wife Penelope from being seduced by her many suitors. In the Iliad, Homer’s view of women at first seems much more in line with Hesiod, his contemporary, and at odds with the civilizing harlot of Gilgamesh. Western literature, instead, begins with unbridled female sexuality as a force of destruction. It’s complicated though. As much as we moderns might wish to see the Iliad as a patriarchal story in which men are warriors and women are property (and it is that too); it still has to be remembered that one woman’s sexual sovereignty is powerful enough to destroy Troy and nearly destroy the Greek fleet. Consider the strangeness of this- imagine if Michelle Obama shacked up with the son of the French President and, as a result, the entire US military was sent to war with France! And yet, none of the Greeks find this strange! In other words, the flipside of patriarchy is the almost supernatural power it assigns to the very female sexuality that patriarchy exists in order to channel into marriage. This isn’t just the story of the face that launched a thousand ships; it’s about the pussy that sent thousands of men rushing to their deaths. I’m guessing most High School humanities courses don’t discuss this aspect of the story!
The other reason these men rush to their deaths, and a subject those teachers love to discuss, is kleos: the glory that survives after one’s death. It is known, almost from the beginning, that Achilles will not return from this battle. His life is destined to be short-lived and filled with combat. He literally has nothing to look forward to after death; the underworld is a place of forgetting that’s almost like endless suspended animation. These men jockey and clash with each other because all they really have to look forward to in life is being remembered as heroes after their deaths. Their lives are both short and intense. Achilles talks often about this glory and we, as well as Homer, know that he will be remembered as a great hero. But, in the end, he will become a hero by losing everything and sacrificing himself. He is the first self-sacrificing hero, of a great many, in Western literature. Part of being a hero in the West is willingly giving oneself over to death. Achilles is the first self-sacrificing hero in Western literature; and Christ is the utmost self-sacrificing hero.
The greatest loss, however, is that Achilles will ultimately lose his beloved comrade, Patroclus, due to his own anger and shortsightedness. In Greek literature, fighting men often have relationships akin to love relationships. One of the other themes in the story that likely goes unmentioned in those civ classes is that Achilles is effectively in love with Patroclus, a theme that Greek listeners would have easily picked up on. The death of his buddy is as devastating as that of Enkidu is for Gilgamesh. These are men who live together and fight together; they might satisfy their lusts with captive women, but they are emotionally devoted to one another in a way that the Greeks would have understood fully. In fact, it must be pointed out that this bond of love and devotion between the men is purer and more elevating, in this story, than all of the examples of heterosexual love, which lead to destruction. Now, in the Odyssey, Homer will write the story of a great love between a man and a woman; but here the story is of the great love between two men.
There is much more to the Iliad than sexual desire and male bonding, however, and Homer is downright cinematic in the way he blends the history of a decade-long war, epic battles, and the emotional lives and loves of individuals. There is enough, in fact, that the Iliad will have to occupy two posts! | <urn:uuid:08a6a845-5d15-4bb1-8401-4495c1bd91dd> | CC-MAIN-2017-04 | http://gradstudentmadness.blogspot.com/2010/01/iliad-part-1.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281226.52/warc/CC-MAIN-20170116095121-00377-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.974959 | 1,691 | 3.453125 | 3 |
What type of RV has the most space?
Class A. This is the largest type of recreational vehicle available. Class A motorhomes range from 21 to 40 feet in length and provide everything you need to live on the road.
How many square feet is the average RV?
Class A Motorhomes have length 30 foot and the width of it is 9 foot. Hence, Class A RV square feet in 30 foot is 270 square ft. this is the large size of RV, but it is the normal size in the class A RVs. If the width of the class A RV is 8 ft, then its length is 30 ft then the length of that RV is 240 square feet.
What is the longest RV ever made?
This one is the longest by far, so far. Doug Tolbert, Idaho, built this Powerhouse Coach a few years ago. It’s a 52-foot-long, quad-slide motorhome with the muscle of a semi truck, towing a 38,000-lb.
What is the tallest a travel trailer can be?
State laws vary somewhat concerning height limits, but generally, camper trailers cannot be more than 13 feet, 6 inches tall. Each different type of camper has a different height average, ranging from 4-foot tall teardrop trailers to 13-foot tall fifth wheels.
Can you walk around an RV while driving?
It’s illegal to sleep, walk around or even be inside an RV like a travel trailer, fifth wheel or any kind of pull-behind camperswhile it’s moving. However, you can sit inside a Class A, B, and C motorhome that has seat belts, and you can legally use some of the facilities inside while driving.
How many square feet is a 53 trailer?
Full Truckload Shipping: Are You Maximizing Your Trailer Space?
|48 Foot||53 Foot|
|Interior Dimensions:||47’4” L x 8’6” W x 9’2” H||53′ L x 8’6” W|
|Door Dimensions:||8’2” W x 9’2” H||– – –|
|Floor Space:||389.81 sq. ft.||45.50 sq. ft.|
How much does Will Smith RV cost?
A motor home as large and luxurious as Smith’s costs a fortune that only Hollywood’s top stars can afford. The price of the motor home is a whopping $2.5 million, complete with the crazy amenities mentioned above. | <urn:uuid:a2555319-73c1-4d70-9a27-ad9e38d08793> | CC-MAIN-2022-33 | https://fulltimeroadwarrior.com/recreational-vehicle/what-rv-has-the-most-square-feet.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571097.39/warc/CC-MAIN-20220810010059-20220810040059-00265.warc.gz | en | 0.904404 | 561 | 1.703125 | 2 |
Changing Pedagogy: The Introduction of Experiential, Cooperative Learning and Interactive Multimedia into the Statics Learning Environment.
Bavaro, M. Tina
MetadataShow full item record
Teacher change is about moving from thought, feelings and an understanding of teaching and learning into action and practice (Fullan, 1982). This naturalistic case study describes the initial phases of the teacher change process resulting from the implementation of a restructured undergraduate statics engineering course. The investigation focused on the broad research question of what happens when an educator undertakes the teacher change process to allow himself to move away from what is familiar and known (i.e., the traditional pedagogy) into an unknown, new pedagogy. More specifically, the three research questions investigated by this study were : (a) what were the teacher's intentions for changing his pedagogy? (b) what were the actual teaching events over the course of the semester? (c) what were the participant's (i.e., the instructor, students, undergraduate teaching assistant and researchers) perceptions of the pedagogical change? The collection and analysis of the data occurred simultaneously throughout the Fall semester of 1995, and continued into April 1996. Data were collected from transcribed audio recordings of interviews with the instructor, selected students and the undergraduate teaching assistant,written field notes from observations, questionnaires, electronic mail exchanges, student minute papers, and other documents. The data were summarized and coded according to recurring words, phrases, sentences and paragraphs about the instructor's intent for his change in pedagogy, then organized into categories of three change foci : (a) experiential learning, (b) cooperative learning, and (c) interactive multimedia in order to correspond with his intent for the new statics learning environment. Data were displayed in charts and tables to determine issues related to change. The results of this study are presented in terms of a descriptive analysis of the initial teacher change process portrayed through the "multiple realities" of the participants who experienced the pedagogical change. Three issues were evident : (a) the problem of the simultaneous introduction of three new innovations (experiential, cooperative learning and the interactive multimedia), (b) the frustrations of the teacher change process, and (c) difficulties of a paradigm shift in pedagogy when the instructor commences to relinquish control in the new learning environment. Articulation of these issues helps to increase our understanding of the teacher change process and the need to enact change over time. Moreover, lessons learned from this study can serve as guidelines for future researchers in their efforts to study the change process. This study increases our understanding of the teacher change process particularly when one undertakes a paradigm shift in pedagogy.
- Doctoral Dissertations | <urn:uuid:2ab2e16a-1591-4ee3-98a1-31b10751093b> | CC-MAIN-2017-04 | https://vtechworks.lib.vt.edu/handle/10919/30530 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00469-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.9424 | 562 | 2.703125 | 3 |
Source/Published: Wilshire's Magazine, Justice, November 1905, pp 4 & 20
Translated by: Henry Bergen of Munich
Online Version: August Bebel Internet Archive, November 2004
Transcription: Ted Crawford
HTML Markup: Mike B.
Proofread: Nik McDonald (September 2005)
The Sixteenth Annual Congress of the German Social Democratic Party was opened on Monday morning, September 18th, 1905, and continued until the evening of Saturday, September 23rd. The chief questions discussed were the organization of the party, the First of May holiday, and the political general strike. Inasmuch as the revision of the organization statutes and the First of May controversy are mainly of local interest, little need be said of them here, beyond that the tendency of the party organization is toward greater centralization, and that the revised statutes were accepted by the majority vote of the delegates. From the very first, the interest of the Congress centred on the question of the political general strike, and since this question, together with that of the trade unions, is one of great importance to the international Socialist movement, we cannot do better than confine our attention to Bebel's resolution and speech, and this all the more so for the reason that the speech was not only one of the most eloquent and effective that has ever been delivered at a Social Democratic congress, but presents us with a vivid picture of contemporary German politics in its relations to Social Democracy.
The resolution in regard to the political general strike brought forward by Bebel was as follows:
"I. In view of the endeavor of the ruling classes and authorities to deprive the working class of the exercise of its legitimate influence on the regulation of public affairs, and to rob the workers of such political rights as they are already able to exercise through their parliamentary representatives, and thus to render them destitute of all political and economic influence.
"The Congress holds it to be necessary to proclaim that the imperative duty of the united working class is to oppose, with every means at its disposal, all invasions of its prerogatives as men and citizens, and ceaselessly to demand full equality of rights.
"In special, it has been shown by experience that the ruling classes, down to the most extreme bourgeois radicals, are opponents of universal, equal and direct suffrage and the secret ballot, that although universal suffrage is tolerated by them, the moment they have reason to believe that their supremacy is endangered by universal suffrage, they immediately endeavor either to abolish or deprive it of all practical value. Consequently they oppose the extension of universal, equal and direct suffrage and the secret ballot in various of the federated states (Prussia and others), and, for fear that the working class may obtain the smallest influence in the parliamentary representative bodies, even go so far as to render the antiquated suffrage laws that are already in existence still more reactionary.
"Examples are the disenfranchisement of the working class by a tyrannical and boundlessly cowardly bourgeoisie and a bigoted lower middle class in Saxony and the so-called republics of Hamburg and Lubeck, and the restrictions placed upon the municipal suffrage in various of the German states (Baden, Saxony, Saxon-Meiningen) and cities (Kiel, Dresden, Fürth, Chemnitz, etc.) by the representatives of the different bourgeois parties.
"In view, however, of the fact that especially universal, equal and direct suffrage and the secret ballot are the preliminary condition for the normal political development of the State, in the same manner that the unrestricted right of coalition is the prerequisite of the economic progress of the working class.
"And further, in view of the fact that because of its steadily increasing numbers, its intelligence, and its labor for the economic and social life of the entire nation, and also by reason of the material and physical sacrifices which it must make for the military defence of the country, the working class is the main factor in modern society, it must demand not only the preservation but the extension of universal, equal and direct suffrage and the secret ballot for all representative bodies, as is laid down in the Social Democratic programme, and also the guarantee of the unrestricted right of coalition.
"Therefore, the Congress declares that particularly in case of a conspiracy against universal suffrage, or the right of coalition, it is the duty of the united working class to employ with the utmost energy every means of defense that may prove expedient. The Congress considers that in case of an emergency, one of the most effective means of defending the working class against the political crime of disenfranchisement, or of conquering an important fundamental right for its emancipation, is the employment on the most extensive scale of the general strike.
"In order, however, that the use of this means of carrying on the struggle may be rendered practicable and of the greatest effect, the widest possible extension of the political organization of the working class and the trade unions, together with the uninterrupted education and enlightenment of the masses through the labor press and oral and written propaganda, are imperative necessities.
"This propaganda must explain the importance and necessity of the political rights of the working class, especially universal, equal and direct suffrage and the unrestricted right of coalition, in view of the class-character of the State and society and the daily wrong to which the ruling classes and authorities subject the working class as a result of their exclusive possession of political power.
"It is the duty of every comrade, in case the members of his particular trade are organized, or the possibility of forming such an organization are presented, to join that organization and to support the aims and endeavors of the trade unions. It is likewise the duty of every class-conscious member of a trade union to join the political organization of his class: the Social Democratic Party - and to co-operate toward extending the circulation of the Social Democratic press.
"The Congress commissions the national committee to issue a pamphlet in which the reasons for the demands embodied in the above resolution shall be fully explained. Arrangements are also to be made for the wholesale circulation of this pamphlet among the German working class."
Then followed Bebel's address on the general strike:
"It is beyond doubt our unanimous opinion that this question is a most important one, no less for the present Congress than for the entire Party. It has been discussed in detail for months, and the majority of our comrades have already formed their opinions in regard to it. How does it happen that we are now compelled to face this issue? What is the present attitude of the Social Democratic Party toward the ruling powers? In order to answer these questions it will be necessary for us once more to make a thorough survey of German political conditions; for only then can we be in a position to decide whether the means of defense already at our disposal, and of which we have hitherto made use, will prove a sufficient safeguard against fresh invasions of the rights of the workers.
"Since 1903, a great transformation in German political conditions has certainly taken place. Although the increase in the Social Democratic vote awakened the enthusiasm of our own comrades, it aroused the very opposite feeling in our opponents. The first question we had then to answer was, what are we to do? The question of tactics long busied us in Dresden, and many comrades were of the opinion that such discussions had only an injurious effect both within and without the Party. But what was it that we accomplished in Dresden? The Dresden Congress settled once and for all, and with the greatest clearness, both for friend and foe, our future policy. This was its great historical action. And the Dresden Congress also demonstrated that in case a resolution was passed against his wishes, no comrade thought otherwise than of forgetting all differences and joining hands with the majority. Prince Bülow, the Chancellor of the Empire, was naturally disappointed to find that his hope that a portion of the Party might swing over to Liberalism and separate from the majority was not realized. His attitude toward us has been different ever since. In his vexation he loses no opportunity of referring to us as a party of the past; but, however absurd this may be, there is no reason why we should cherish any illusions as to our influence in the Reichstag. It is true, 80 seats is a large number; but the balance of power still lies in the hands of the Centrum (Catholic Party). As for the Liberals, ask Naumann, Barth and von Gerlach what they now think of the 'Great Liberal Party'! Their answer will be that there is nothing whatever to hope from it. The class contradictions have become so acute since 1903, that in case of necessity the Liberals are invariably ready to unite with the Conservatives against us. Another characteristic of the bourgeois parties is their endeavor to win the votes of the working class. Never before have so many acts relating to labor and social questions come up before the Reichstag. The Centrum is even willing to coquette with modern science and the emancipation of women. But what it most desires, is to get a firm grasp on the souls of the younger generation. For this reason it has the sympathy of the ruling classes. Even the highest officer of the State talks as if he were inclined to turn Catholic. Should bayonets fail, the Church at any rate will remain a bulwark of defense.
"But the antagonisms in the Reichstag itself have become more acute. In former days the floor of the Reichstag was smoother even than the parquetry at court. At that time we were constantly obliged to guard against the loss of our good old revolutionary tactics. Today the wind in the Reichstag blows from a different direction. Since the struggle over the tariff all personal relations between us and our opponents in the Reichstag have come to an end. The disinclination of the government toward the work of social and political reform is steadily increasing. The economic contradiction has also become greater. One need only call to mind the attitude of the Prussian legislature toward the suffrage for the Reichstag and the right of coalition, the growth of employers' associations, the increase of lockouts. The class-consciousness of the capitalists often shows itself to be more penetrating and more deeply seated than that of the working class. The development of capitalism is hastening with giant strides towards its culminating point. It is only the stupidity and gross ignorance inculcated in school, church, press and state, and by which too many of the workers are still dominated, that prevents them from showing their true power. And the power of the enlightened working class would be far greater than the entire material force of the bourgeoisie. The tremendous strength of the workers is not sufficiently done justice to; our work of propaganda is still frequently misdirected. Situations are approaching which must of physical necessity lead to catastrophes, unless the working class develops so rapidly in power, number, culture and insight that the bourgeoisie loses its desire for catastrophes. We are not seeking for a catastrophe - of what use would it be to us? Catastrophes are brought about by the ruling classes. Perhaps an attempt may be made to suppress us by means of special legislation. But I know many a comrade in our ranks who is longing for the day when a new discriminative law is passed and catastrophes arrive; for then they will be able to show what stuff they are made of. And I hope I will be with you when the struggle breaks out afresh.
The capitalist class cannot imagine their fate - the fate of the `noblest and the best' - can be placed in the hands the great boorish masses. Yet in the West, these `noblest and best' squander, as in the days of the declining Roman Empire, thirty, forty, fifty marks on a single dinner. They buy ministers and high officials of state, and, together with the Krupps and Baltins(1), have more influence at court than families of the nobility of six or eight centuries standing. When I once said in the Reichstag that the government was a mere committee of administration, `quite true,' was the answer of von Bötticher, the Secretary of State. And although there may be no reason why the policy in the interest of the ruling classes need be so stupid and irresponsible as it now is, agrarian and capitalistic it must remain so long as they are at the helm. It is for this reason that universal suffrage is a thorn in the side of the bourgeoisie. Hence their continual complaints and attacks on it and the Reichstag.
"Once, it is true, the Liberal Party stood up for universal suffrage for the various local houses of representatives as well as for the Reichstag. But ever since that time it has gladly assisted in restricting the franchise, and has welcomed every invasion of the suffrage of the working class in the very strongholds of the Social Democratic movement. As for the Centrum, it has no political principles. In Bavaria and Baden it is for, in Würtemberg and Prussia against, universal suffrage. And now the Roman Catholic Cologne Volkszeitung declares that if Social Democracy should threaten to clog the wheels of the machine of state, care must be taken to be ready in time with preventive measures. But, in the meanwhile, the proletariat is becoming more and more numerous and more and more the foundation of our national wealth and powers of defence. And if our opponents now begin to attack this foundation of the state pyramid, the result will be such a violent wrench as to cause the pyramid to collapse altogether. We may shudder at the prospect, but it is there, to be viewed clearly - there is little use in trying to conceal facts or to put on the brakes.
"Consider the strange alliances that our opponents are obliged to enter into in order to defeat us, and the imperial association for combating Social Democracy - that political praetorian horde to which all parties contribute. No one has reason to undervalue the influence of our party - the `Social Democratic danger,' as the bourgeoisie put it. In the Reichstag they did not dare to deceive the victorious miners, and so the government turned to the corrupt Prussian legislature with its projected law. That was owing to the pressure of universal suffrage. And yet some comrades say that, considering the injustice we receive at the hands of the State, it would be better to dispense entirely with parliamentary activity. And they say this at the very moment when our comrades in Russia are fighting as the proletariat has never fought before. And for what? - For a modern parliamentary State! You do not know how nervous recent events in Russia have made our ruling classes. They fear that the fire may leap across to us. They say that in Russia the workers are unorganized; in Germany they are firmly united. They are aware that here we have entire regiments of Socialists, and that if the reserves and territorial troops were called out, the whole army would be Social Democratic. One of our Major Generals has declared that a war against the will of Social Democracy would be an impossibility. The entire foreign policy of the nation must be adjusted with regard to us.
"Yet, in spite of all, in political life we are more on the defensive than on the offensive; in spite of all, our means of agitation for security against invasions of the rights of the people are not sufficient. For this reason we must not ignore the discussion of the political general strike, especially considering that such strikes are constantly increasing in extent. The trade union congress at Cologne has, unfortunately, only succeeded in obscuring the question by its excess of caution. It almost looked as if the trade unions desired to forbid the general strike entirely. Von Elm is right in saying that it would have been better had the trade union congress spoken up energetically to the effect that the unions will exert their entire economic power in order to repel a criminal invasion of the right of universal suffrage. For in case the universal suffrage is lost, the trade unions, too, will lose their rights of coalition and association.
"Ever since 1889, the International Socialist Congresses have been continually busied with the general strike, and their attitude has by no means always been one of opposition. They have invariably admitted the possibility of a political general strike in case a strong enough organization is behind it. Wolfgang Heine has described to us the dangers of the general strike. Every great strike contains within itself the same elements of danger; and if the coal miners succeeded in avoiding them, we will be able to do the same. Above all, there are times when one does not stop to inquire into possible dangers. 'Contemptible the nation that does not risk all for its honor,' and miserable the class that allows itself to be treated infamously without resisting to the last breath!
"Since the first general strike in Belgium, in 1893, such strikes have been constant, especially within the last three years. It is true that we consider sympathetic and demonstrative strikes to be impossible. We have never recommended unprepared and unorganized general strikes. And we must consider well before we enter a severe struggle that may lead to results of the most serious nature. We must agitate and organize, and make it clear to the workers that when a vital issue is at stake - an issue which is to decide their fate as men, as fathers of families, and as citizens - they must be ready to risk all. We have no desire to rush blindly into a general strike; it is not our intention to egg on the unorganized masses. But the necessary organization can and must be created; and if the press, not only of the party, but also of the trade unions, does its duty in enlightening the working class, all this can be accomplished.
"Some people have objected, in regard to the general strike, that we must not permit the knowledge of our plan of campaign to leak out. A party numbering millions cannot form its ranks of battle in secret. We are not fighting for utopias or demands of the `Future State,' but for actual rights, which are the very life-nerve of the working class if it expects to have a voice in political affairs. And in case of a decisive struggle, a portion of the bourgeoisie will come over to our side. Besides, it is easier to defend than to conquer rights; for in the former case our enemies appear only as brutal opponents of justice, and their actions cannot but awaken the indignation of the masses.
"Is it not an unheard-of scandal that the strongest political party in Prussia has not one single representative of all the 432 members of the legislature? It is for us to consider if we are permanently to bow down before feudal lord, capitalist and priest. Perhaps it will not be until they attempt some coup d'etat and arouse the anger of the entire nation, that we will make use of this weapon. The Prussian bourgeoisie of before 1848 stood up more energetically for their rights than we do. We receive one blow after another from the Prussian government, and always in silence, silence.
"We must work harder for enlightenment in regard to the theory of Socialism and for the education of the members of the party. Although the trade unions must seek to enlarge their membership rolls, they cannot afford to neglect the politics of the working class. And in case our party press gives us still greater assistance than heretofore towards the work of organization, we will be able to double the number of members of the Social Democratic local branches, increase the number of trade union members by 25 per cent, and the readers of our organs 50 per cent. In that event we will have the means at our disposal and such good preliminary work for the coming struggles accomplished, that better could not be wished for. It is from this standpoint that I ask you to vote for my resolution. And it is from this standpoint that we will fight our way onwards and labor until the victory is wholly ours."
A scene of great enthusiasm followed, many of the delegates rushing forward to congratulate the speaker. Nineteen comrades took part in the debate; and, on being put to the vote, the resolution was passed by the overwhelming majority of 288 to 14.
The revival of the idea of the general strike means that a new phase has arrived in German political conditions. The Social Democratic Party has not altered its tactics; it is merely endeavoring to adapt itself to new circumstances. Four or five years ago there was a hope that something might be accomplished in legislation by the aid of the bourgeois Radicals and the more advanced Liberals. This was the expectation of many of the Revisionists. But matters have turned out differently. Since the increase of the Socialist vote to over three millions in 1903, the Liberals have cast away the last vestige of democracy, and their whole endeavor is now to save themselves from what they are pleased to term the Socialist peril. Nor is this anything else than one would be led to expect from the representatives of the capitalist bourgeoisie. In the Reichstag, the Clericals (Centrum) have the largest number of seats and hold the balance of power. Their policy is that of the Roman Catholic Church. Occasionally they vote for some insignificant social reform, in order not to fall into discredit with their working-class supporters; but this is all. They are shrewd politicians with an eye exclusively to their own welfare. The Conservatives and other agrarian-feudal parties are still more embittered in their opposition to the progress of the working class, and are only waiting for a pretext to continue the work of disenfranchisement.
This being the case, and considering that, in spite of the three million votes, only 80 of the 379 deputies in the Reichstag are Socialists, it is evident that the workers have a comparatively small influence in shaping the domestic policy of the empire. It is no wonder that the party is exercised over the helplessness of its parliamentary group. No wonder that profound dissatisfaction should be felt in Saxony, where all but one of the Reichstag members elected in 1903 by universal suffrage are Social Democrats, but where, owing to the three-class system of voting for the legislature, not one of the members of the latter is a Socialist! In Prussia the 2,000,000 votes of the Social Democratic Party were insufficient to elect a single member of the lower house of 432 deputies. And this again was due to the indirect suffrage and class system of voting. Still, it would be a mistake to say that Social Democracy is wholly without influence in the German parliaments. The moral pressure of the working class is alone sufficient to cause many a change of policy by the government; nevertheless, the direct influence in legislation of Social Democracy is entirely out of proportion to the number of Socialist votes. And this calls for a remedy.
First Democracy, and then Socialism. The German Empire, although nominally a constitutional monarchy, is to all intents and purposes an autocracy. Consequently, it is along the lines of universal suffrage that the battle must be fought. Where there is no equality of voters, it must be won, and where equality does exist, it must be defended. Hence, the present discussion of the political general strike as a possible weapon in the struggle.
The general strike of the German Socialists is not the ordinary sympathetic strike for economic improvement, such as is of frequent occurrence in all capitalistic countries, nor is it the unorganized universal strike in all branches of industry and all employments dreamed of by the Anarchists, as a preface to the final catastrophe. It is an organized strike for political as distinguished from economic ends, in which the organized workers of as many trades as may prove expedient will take part; the larger the mass of organized workers, the more far-reaching its effects. It presupposes a highly developed trade-union movement, a powerful Socialist Party, and, what is of still greater importance, harmony between the two and the consciousness of a common aim. These elements are not lacking in Germany, and every effort is being made to strengthen the feeling of solidarity between the unions and the Social Democratic Party, as well as to increase the membership of each by means of effective propaganda.
The influence of men like Samuel Gompers, which serves to demoralize rather than to further the cause of the working class, or of men like John Mitchell, who have apparently not yet grasped the fact that in neglecting class-conscious political action the workers are deliberately throwing away their most powerful weapon in the struggle for their emancipation, is less in Germany than in America. The members of the independent trade unions are Socialists, and no Socialist Democrat fails to join the organization (so long as it is free from bourgeois influence) of his fellow workers. That differences of opinion occasionally arise is but natural, considering that the duty of the trade union is, primarily, to guard the immediate economic interests of the workers and of Social Democracy to perform the additional labor of political action and organization. But by strengthening the economic influence of the working class, the trade unions indirectly contribute toward the realization of the Socialist programme, and by rendering it possible for the workers to become a powerful factor in political life, Socialism secures to the trade union a firm foundation on which to stand in its struggle against the capitalist class. For the latter, in Germany as in America, although willing to recognize the right of coalition is strenuously endeavoring, by fair means or foul, to prevent the workers from putting that right into effective use. It is only through political organization and solidarity that the workers can hope successfully to resist these encroachments upon their rights.
The Social Democratic Party has no desire to rush blindly into the general strike; its object is energetically to push on the work of organization and enlightenment to the end that when the time comes for action, a new and effective weapon will be ready to the hand of the working class in its struggle against an autocratic and corrupt plutocracy.
Munich, Sept. 27, 1905.
1. President of the Hamburg-American Steam-ship Company. | <urn:uuid:ad42292b-bd70-493e-a585-af6400cc0759> | CC-MAIN-2017-04 | https://www.marxists.org/archive/bebel/1905/11/x01.htm | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280128.70/warc/CC-MAIN-20170116095120-00394-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.964826 | 5,335 | 2.078125 | 2 |
Evolution is a change in organisms over time. Evolution happens as a result of natural selection. Natural selection was first described by Charles Darwin
- There is variation between organisms of a species
- Variation can be caused by a mutation
- The organisms best suited to their environment are more likely to survive to breed
- The genes which caused the successful variation are passed on to the next variation
This theory can be applied to different situations in a question.
Before the industrial revolution most peppered moths were… | <urn:uuid:df991627-30bc-4a3a-9063-ef93bfcde0da> | CC-MAIN-2017-04 | https://getrevising.co.uk/revision-notes/evolution_13 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280128.70/warc/CC-MAIN-20170116095120-00390-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.954942 | 104 | 3.328125 | 3 |
The Old Library Trinity Collage, Dublin, Ireland
Travel tips > Europe > Ireland > Dublin > The Old Library Trinity Collage
- History & Culture travel tip
- City center
You can barely imagine the amount of books there and the atmosphere of gratitude that captures you when you step in. Besides the walk among the thousands of books the Old Library offers exhibitions as well. The most famous is the Book of Kells exhibition. The Book of Kells is a world famous 9th century manuscript of the four gospels that was written on calfskin. Other old manuscripts are also exhibited besides this one.
The so called Long Room of the library gives place to more than 200,000 of the oldest books of the library. It's wonderful. I think I could move in there. :)
Trinity Collage Dublin
Adults 9 Euro
Students and seniors 8 Euro
Free for children under 12
Monday-Saturday: 09:30 - 17:00
Sunday (May-September): 09:30 - 16:30
Sunday (October-April): 12:00 - 16:30
How to get there:
It is in the center of Dublin. You can get there by the DART rail line, the nearest stations are Pearse Street and Connolly Station.
Recent travel tips for Dublin
- Christchurch CathedralThe Cathedral is about one thousand years old. It's amazing and magnificent! It is huge and beautiful, a little bit like a castle. The inside of the cathedral is wonderful, so huge and beautifully decorated. There are pointed arches all [...]D: 0.5mi00
- Guinness StorehouseGuinness Storehouse is like the origin of all beers and a little piece of Irish history and culture. You can follow the brewing process, you will meet the different types of the Guinness and even meet Arthur Guinness, the father of this [...]D: 1.1mi10
- The GravediggersThe Gravediggers is one of the greatest pubs in the world. The place got it's name from the gravediggers who often attended the pub after a long day of hard work. This because The Gravediggers is located right next to the Glasnevin Cemetery [...]D: 1.8mi00
- Dublin Writers MuseumIf you like literature, Writers Museum is something you should definitely see. Here you can have a taste of the immense literary past the city has. No matter how well you think you know one writer or another, you may always ind here [...]D: 0.7mi00
- Lodging and food in DublinLodging: Harding Hotel, Jury's Inn Christ Church Food: Queen of Tarts on Cows Lane for excellent breakfast or lunch [...]D: n/a00
Things about Dublin you may be interested in
More travel tips you might be interested in
If you are holidaying on a budget but don’t want to compromise on quality, our Sydney hotel deal for tonight is perfect for you. Our hotels in...
General: Sydney Hotel Deals for Tonight
This is Heaven from time immemorial. Welcome to Hangzhou China.
History & Culture: Living in Hangzhou China
Manchester, United Kingdom
Take a romantic walk among the bridges and boats of Castlefield. The canals are amazing, especially in the evening, after a good dinner in a nearby...
Sightseeing: Take a romantic walk
If you are interested in history and you like old castles, don't miss the Castle of Eger. It is very well maintained, it has a museum, a torture...
History & Culture: The Castle of Eger
It was a trip to the Entertainment Capital of the World; excitement was at its heights. It was not a bachelor party, neither a hush-hush...
Family & Fun: Reveling at Vegas – Getting Attracted to Distractions
Visit the museum of ancient roman relicts and the roman baths in the city center.
General: The museum of ancient roman relicts
If you plan to go to Capri, take a look at the schedule of the ferries. Normally they go there at a certain time, but not every five minutes.
General: Check the schedule of the ferries
You should really take yourself time for at least one day or better a whole weekend.
General: Visiting the ancient roman city
El Paso, Texas
I would say this restaurant is one of the best in whole El Paso. The Crave Kitchen and Bar has not only great service but excellent food too. If I...
Food: Crave Kitchen and Bar
Nice place in th winter, if you want to go skiing, without paying so much money like at Ischgl.
Outdoors Activities: Skiing in Schruns | <urn:uuid:5066eb6a-3a4a-4d62-b6fc-458aacb17264> | CC-MAIN-2017-04 | http://www.travelgrove.com/travel-tips/Dublin-travel-tips-Ireland-856462/The-Old-Library-Trinity-Collage-619.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280718.7/warc/CC-MAIN-20170116095120-00405-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.922294 | 980 | 1.875 | 2 |
In geology an erratic is a "boulder or rock formation transported some distance from its original source, as by a glacier." In award-winning novelist Mark Frutkin's case, his movement from his native Cleveland. Ohio, was instigated by his wish to protest and resist the U.S. military draft during the Vietnam War, and his destination was Canada.
An estimated 50,000 to 100,000 American Vietnam War draft resisters sought sanctuary in Canada. Many of these men stayed, became Canadian citizens, and have made significant contributions to the country, including writers such as William Gibson, George Fetherling, Keith Maillard, and Jay Scott; musicians Jesse Winchester and Jim Byrnes; children's performer Eric Nagler; and radio personality Andy Barrie.
Although this first nonfiction work by Mark Frutkin looks back at the circumstances and culture of the late 1960s and early 1970s that prompted the author to relocate to Canada, Erratic North is about many other things. It's also a lyrical meditation about "returning to nature" in the bush country of Quebec and an account of the crucible that forged one writer. Tying everything together, though, is the overarching theme of the book: A contemplation of humanity's embrace of war and violence and the countervailing impulse to resist that embrace, specifically as seen in the experience of Frutkin himself; his grandfather Simon, who escaped Tsarist Russia and its military in the 1890s; and Louis Drouin, the Quebec farmer Frutkin bought his original farm from and who resisted conscription in World War II.
©2008 Mark Frutkin (P)2013 Audible, Inc.
Report Inappropriate Content
If you find this review inappropriate and think it should be removed from our site, let us know. This report will be reviewed by Audible and we will take appropriate action. | <urn:uuid:01cbe0c5-d879-4245-9e29-c967c11fc780> | CC-MAIN-2017-04 | http://www.audible.com/pd/History/Erratic-North-Audiobook/B00H2UA1SW | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283689.98/warc/CC-MAIN-20170116095123-00346-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.971674 | 384 | 2.328125 | 2 |
Alarm calls are typically high frequency sounds because these calls are hard to localized by predators. On the other hand, low frequency sounds are easier to localized by predators. Calls that are hard to localized by predators are selected for because conspecific can pick up on the warning but predators cannot identify the location of the caller. If an individual successfully alert its social group of approaching predator yet does not reveal its location, it will significantly decrease the chance of the caller to be detected and increase the chance of its social group to avoid predation.
Vervet monkeys. Photo from Wikipedia.
Here, I will focus on the study of predatory alarm calls in vervet monkey (Chlorocebus pygerythrus) by Seyfarth et al. (1980) in the Amboseli National Park, Kenya. Vervet monkeys are Old World monkeys that range between Eastern and Southern Africa. These monkeys are diurnal and live in closely-knit social groups. They are quadrupedal and are both terrestrial and arboreal. Like all Old World monkeys, vervet monkeys have the characteristic cheek pouches that enables them to forage and store food to be eaten later. Male vervet monkeys have blue scrotal area and a red penis. Males and females are sexually dimorphic, with males slightly larger than females.
Male vervet monkey with blue scrotal area and red penis. Photo from Something Up Her Sleeve.
Vervet monkeys are known to elicit predator-specific alarm calls. Three well-documented vervet monkey alarm calls are those for leopard, martial eagle and python. Leopard alarm calls are short tonal calls produced in a series of inhalations and exhalations. Eagle alarm calls are low pitched grunt while python alarm calls are high pitched "chutters". Different alarm calls seem to evoke different responses to individuals that heard the alarm calls. However, the first reaction of a vervet monkey upon hearing an alarm call is to look at the direction of the caller. Looking at the direction of the caller gives them clues as to why the alarm calls were made and also where the caller is facing reveals the direction of the approaching predator. You can listen to these different alarm calls on this site.
As we said before, different alarm calls evoke different responses. Leopard alarm calls would make the monkeys run up into the tree to avoid being ambushed by the leopard. Also, these monkeys would sit on the branches further away from the tree because, even though leopards can climb trees, the branches could not support the leopard's weight. When an eagle alarm call is given, vervet monkeys would make them look up, run for the nearest bush or both to avoid an approaching aerial attack. Python alarm calls would the monkeys stand bipedally and look down on the ground.
A martial eagle. Photo by Jacques S G from Flickr.
Adult vervet monkeys are more discriminatory when eliciting alarm calls. Infants and juveniles calls however, are less discriminating as they attribute most terrestrial mammals with leopard calls, flying birds with eagle calls and stick-like figures with snake calls (although, compared to infants, juveniles are more discriminant when making alarm calls). In spite of that, adult vervet monkeys seem to elicit eagle alarm calls to different species of raptors and non-raptors (see illustration below). We can infer that adult vervet monkeys attribute eagle alarm calls to birds with the same silhouette as martial eagles. As vervet monkeys get older, they seem to have a better association between predator species and types of alarm calls. Vervet monkeys generally pay more attention to adult alarm calls than those of juveniles or infants.
Alarm calls made by infant, juvenile and adult vervet monkeys in response to sightings of birds of prey (raptors) and non-raptors. The number of calls cited for each age group refers to the total number of calls that were analysed (Gould & Gould, 1999). Click on illustration for larger view of the image.
The study of vervet monkey alarm calls by Seyfarth et al. (1980) laid an important ground work to better understand the complexity of animal communications. By showing that vervet monkeys make different alarm calls to different predatory species, we can posit that vervet monkeys have the ability to categorize different species. The ability to discriminate between terrestrial mammal, flying birds and snake-like objects starts during infancy in vervet monkeys. As they get older, they are better at associating predators with specific alarm calls.
An infant vervet monkey with its mother. Photo by Lip Kee from Flickr.
The ability to over generalize during infancy is evident in both vervet monkeys and humans. For example, upon learning the word "dog", human infants would refer to quadruped mammals they see as "dog". As the infant grows, so does the ability to associate the semantic meaning of words they learned. However, the acquisition of alarm calls in vervet monkeys is different than the acquisition of speech (language) in humans. Alarm calls in vervet monkeys are instinctual and not learned. Humans, however, have to learn their language. Failing to do so during the "critical period" generally will result in the inability to learn language in later years. Feral child are examples of human infants that lack linguistic input during their critical period of language acquisition.
Most of us interpret animal alarm calls as an uncontrollable auditory response to fear or pain, akin to humans yelping if we had our finger caught in a door. While this is not entirely false, some animal calls actually convey information from the caller to the listener. Seyfarth et al. (1980) posit that vervet monkey alarm calls are actually basic semantic signals or symbolic signals because each alarm calls seem to mean something to these vervet monkeys. While we don't know if these alarm calls actually mean "leopard" or "run up to the tree", we do know that it conveys specific information to their conspecific about approaching predators.
I will be blogging Part II of this post later this week, where I will explain in details the experiments done by Seyfarth and Cheney on vervet monkey alarm calls.
Cawthon Lang KA. 2006 January 3. Primate Factsheets: Vervet (Chlorocebus) Taxonomy, Morphology, & Ecology. http://pin.primate.wisc.edu/factsheets/entry/vervet. Accessed 2011 March 9.
Fichtel, C. Perry, S. Gros-Louis, J. 2005. Alarm calls of white-faced capuchin monkeys: an acoustic analysis. Animal Behaviour 70(1): 165-176. doi: 10.1016/j.anbehav.2004.09.020.
Gould, JL. Gould, CG. 1999. The Animal Mind. Scientific American Library.
Ouattara, K. Lemasson, A. Zuberbühler, K. 2009. Campbell's Monkeys Use Affixation to Alter Call Meaning. PLoS ONE 4(11). doi:10.1371/journal.pone.0007808.
Seyfarth, RM. Cheney, DL. Marler, P. 1980. Monkey responses to Three Different Alarm Calls: Evidence of Predator Classification and Semantic Communication. Science 210(4471): 801-803.
Zuberbühler, K. Jenny, D. Bshary, R. 1999. The Predator Deterrence Function of Primate Alarm Calls. Ethology 105: 477–490. doi: 10.1046/j.1439-0310.1999.00396.x.
Zuberbuhler, K. 2000. Referential labelling in Diana monkeys. Animal Behaviour 59(5): 917-927. doi: 10.1006/anbe.1999.1317. | <urn:uuid:1f575104-787a-4431-be0d-ad9a2767e235> | CC-MAIN-2017-04 | http://theprancingpapio.blogspot.com/2011/03/semantics-of-vervet-monkey-alarm-calls.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279410.32/warc/CC-MAIN-20170116095119-00165-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.900739 | 1,631 | 3.234375 | 3 |
Only Rare Cold Will Keep 2012 From Being Hottest Year
By Climate Central
With a month and a half to go before 2013 begins, it’s still technically possible that 2012 won’t end up as the warmest year on record for the continental U.S. It’s possible, but it’s not likely and won’t be easy.
The graphic below shows just how cold the next six weeks would have to be to keep 2012 out of the record books.
The graphic, based on data from NOAA's National Climatic Data Center, shows that 1998 (white line) was the warmest year on record for the continental U.S. (each triangle marks the average temperature to date for a given month, so the October triangle, for example, represents the year’s average through October).
So far 2012 (red line) is way above the 1998 average. If temperatures stay well above normal for the rest of the year (orange line), we’ll beat 1998 easily. If temperatures are about normal, we’ll still set a record.
Only if temperatures plunge to well below normal for November and December would we have a shot at sneaking in under the 1998 average.
Is it possible? Definitely. But with every passing day, it’s looking less and less likely.
October Ties for 5th Warmest on Record
How Global Warming Made Hurricane Sandy Worse
Statistics Show Sandy's Extraordinary Intensity
Hurricane Sandy Paralyzes New York, New Jersey
Ongoing Coverage of Historic Hurricane Sandy
Despite Cool October, 2012 On Track to Be Hottest U.S. Year
Forecasts Call for Weak to Non-Existent El Nino This Year | <urn:uuid:3f26a161-8c46-48ca-9bac-6c9f7dfac174> | CC-MAIN-2017-04 | http://www.climatecentral.org/blogs/only-rare-cold-will-keep-2012-from-being-warmest-on-record-15264 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282926.64/warc/CC-MAIN-20170116095122-00396-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.880858 | 357 | 2.875 | 3 |
طراحی کنترل کننده های بهینه واقعی به شدت مثبت با استفاده از بهینه سازی های عددی برای کنترل سیستم های رباتیک انعطاف پذیر
|کد مقاله||سال انتشار||مقاله انگلیسی||ترجمه فارسی||تعداد کلمات|
|10448||2011||25 صفحه PDF||سفارش دهید||محاسبه نشده|
Publisher : Elsevier - Science Direct (الزویر - ساینس دایرکت)
Journal : Journal of the Franklin Institute, Volume 348, Issue 8, October 2011, Pages 2191–2215
The design of optimal strictly positive real (SPR) controllers using numerical optimization is considered. We focus on how to parameterize the SPR controllers being optimized and the effect of parameterization. Minimization of the closed-loop H2-norm is the optimization objective function. Various single-input single-output and multi-input multi-output controller parameterizations using transfer functions/matrices and state–space equations are considered. Depending on the controller form, constraints are enforced (i) using simple inequalities guaranteeing SPRness, (ii) in the frequency domain or, (iii) by implementing the Kalman–Yakubovich–Popov Lemma. None of the parameterizations we consider foster an observer-based controller structure. Simulated control of a single-link and a two-link flexible manipulators demonstrates the effectiveness of our proposed controller optimization formulations.
The passivity theorem is one of the most celebrated results in input–output systems theory. In general, a passive system is one that does not generate energy and a very strictly passive system is one that dissipates energy. The passivity theorem states that a passive system and a very strictly passive system connected in a negative-feedback loop are input–output stable . This is an extremely powerful statement in the context of nonlinear control; stability of a nonlinear yet passive plant is guaranteed via control in the form of a very strictly passive operator. In the context of passive mechanical systems, inputs are forces and outputs are rates such as velocity. Flexible structures possess a large number of vibration modes, and in robotics applications have dynamics that are nonlinear. Flexible robotic manipulators are known to be passive via collocation of the joint torques and the angular velocity sensors, that is when the input–output map is between the joint torques and joint angular velocities. The passivity property for these collocated systems is independent of the system mass, stiffness, and modeled vibration modes. The noncollocated map between joint torques and end-tip velocity of a manipulator is not passive, but the map between a modified set of joint torques and a modified output, known as the μ-tip rate, has been shown to be passive, thus facilitating passivity-based control of the μ-tip rate . Passive and very strictly passive systems that are linear and time-invariant (LTI) are closely related to positive real (PR) and strictly positive real (SPR) transfer functions or matrices . The robust stability of nonlinear flexible robotic manipulators is assured via the passivity theorem when the controllers employed are SPR. In particular, spillover instabilities are avoided. In light of this important stability result, many authors have attempted to formulate rate controllers such that they are SPR. Benhabib et al. suggested the use of SPR rate controllers to control large space structures where the controllers considered were not observer-based. Similarly, McLaren and Slater investigated implementing positive real LQG controllers for the control of large space structures. Lozano-Leal and Joshi investigated the design of LQG controllers, constraining the LQG weight matrices such that the resultant optimal controllers remain SPR. Haddad et al. extend the work of Lozano-Leal and Joshi to include an H∞ performance bound on the closed-loop, again by constraining the appropriate weighting matrices. The use of numerical optimization algorithms to find optimal SPR controllers has been considered in various papers. In Germoel and Gapsik the design of observer-based SPR compensators using convex numerical optimization was considered. Using linear matrix inequality (LMI) constraints, the H2-optimal control problem was retooled to yield SPR controllers. The controllers were full order, meaning that the controllers and the plant model to be controlled have the same number of system states. Shimomura and Pullen extended the work of Germoel and Gapsik , considering the use of iterative algorithms that overcome bilinear matrix inequality issues within the optimal SPR optimization formulation. Again, the resultant controllers were observer-based and full order. In both Germoel and Gapsik and Shimomura and Pullen the observer gains were those found via the solution to the unconstrained H2-optimal control problem. In Damaren , the optimization of single-input single-output SPR controllers of varying order was considered. The SPR controllers were not full order, nor observer-based compensators. Simple inequality constraints in the frequency domain via a transformation from the s-domain to the z-domain guaranteed SPRness. In Damaren et al. , optimal SPR controllers that approximate a given observer-based, full order controller were found by solving a quadratic programming problem with linear inequality constraints. In Henrion a method using LMIs is presented whereby a transfer function can be designed to be robustly rendered SPR given a Hurwitz denominator polynomial. Other than the work of Benhabib et al. and Damaren , the existing SPR design schemes (that is, optimal design schemes) yield controllers that are observer-based, and thus have the same order as the plant. It remains an open question as to whether or not the optimal SPR controller that solves the H2 control problem is observer-based, or even should be the same order as the plant being controlled. Because unconstrained H2-optimal controllers are observer-based, it does not mean that optimal SPR controllers must be observer-based. Also, if the dimension of the plant is large (as is the case with flexible robotic manipulators and structures), having a controller that is lower order yet still optimal is desirable. With this in mind, we will explore various controller parameterizations of various orders that are not observer-based, constrain the controllers to be SPR (in different ways, depending on the parameterization at hand), and optimize the controllers numerically by minimizing the closed-loop H2-norm of the system. One of the questions we hope to shed light on is that of controller order. Additionally, the existing literature often considers the control of a pinned–pinned Euler–Bernoulli beam , , and . In our work, we consider the tip control of single- and two-link flexible robotic manipulators. Recall that the SPR controllers we parameterize and optimize will be rate (velocity) controllers. To realize position control, the manipulators must also be compensated by position (i.e., proportional) control. We will include the proportional control gain as a design variable, which is equivalent to optimally designing the rigid-body mode of the plant in conjunction with the rate controller. The outline of the paper is as follows: in the next section we will briefly review the conditions which ensure that a system is SPR. We then consider flexible manipulator modeling and tip-based control. Both two- and single-link flexible manipulator models will be considered. In Section 4 we will state our numerical optimization objective function. Although we will consider various controller parameterizations and constraint methods in this paper, we will always be minimizing the closed-loop H2-norm of the system. We then move onto the main contributions of the paper. In Section 5 we consider three different SISO controller parameterizations, as well as ways to constrain the controllers based on the parameterizations. In Section 6 we then modify the parameterizations (and constraints) for MIMO controller design. Simulated control of the single- and two-link flexible manipulators is included. We close with a discussion and final remarks.
نتیجه گیری انگلیسی
The objective function was minimized to a value of J2=80.9141. The convergence tolerance was set to 1 ×10−8. The frequency response of the controller G(s) created via the state–space parameterization and optimization is shown in Fig. 13. Shown in Fig. 14 is the system response of the two-link manipulator.The frequency response of the full-order SPR controller is quite interesting. Notice that the gain is high, but not as high as, for example, the variable-order SPR controller gain in Fig. 11. Also, note that the full-order SPR controller begins to roll off above 104 rad/s, unlike both the diagonal-decoupled (Section 6.1) and variable-order SPR controllers. The performance of the closed-loop system as controlled by the full-order SPR controller is quite good. There is only a moderate amount of overshoot at the end of the manipulator maneuver, with no residual vibration. The full-order SPR controller outperforms the diagonal-decoupled SPR controller significantly. However, the performance of the variable-order and full-order SPR controller is essentially the same. Recall that each controller parameterization is used within an optimization scheme that minimized the closed-loop H2-norm given a particular set of weights (i.e., the B1, C1, D12, D21 matrices). Interestingly, the present parameterization is able to attain a smaller closed-loop H2-norm as compared to the diagonal-decoupled and variable-order parameterizations. This is due to the fact that the full-order parameterization allows for controllers that are of greater order (compared to the other parameterizations). | <urn:uuid:60bea02a-85a7-423e-a403-1cca04fd1dd2> | CC-MAIN-2017-04 | http://isiarticles.com/article/10448 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280791.35/warc/CC-MAIN-20170116095120-00359-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.893193 | 2,241 | 1.890625 | 2 |
Answers 1Add Yours
Answered by Aslan
At the time of the story the town of Sighet was under Hungarian control. Naturally, if Jews were to be deported, it would be non-Hungarian residence first. In the end it really didn't matter so much; all Jews were eventually targeted by the Nazis. | <urn:uuid:d49b420b-9b18-472a-b5ea-ffc942833581> | CC-MAIN-2017-04 | http://www.gradesaver.com/night/q-and-a/why-were-non-hungarian-jews-deported-first-48673 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282935.68/warc/CC-MAIN-20170116095122-00241-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.987671 | 69 | 1.75 | 2 |
Pastoral Prayer 1-10-21
It has been a week. Together we bear witness to historic events in the life of our nation. On Wednesday the first African American from Georgia was elected to the Senate, a pastor who serves the same congregation Martin Luther King, Jr. once did. Dr. King gave his life for a Biblical vision of beloved community. This week we saw evidence that Dr. King’s vision continues to bear the fruit of love and justice in our nation.
That same day, Wednesday Jan. 6, we witnessed an armed attack on our nation’s Capitol. Four people lost their lives. Our nation’s leaders were forced to shelter in place. On Jan. 6 a mob incited by our President was able to do what all the armies of the Confederacy failed to do 150 years ago. They paraded the Confederate battle flag–a symbol of slavery, racism, and hate–through the halls of congress. It was a chiling reminder that the evil of racism and white supremacy continues to eat away at the soul of our country. Like Dr. King’s dream our nation is resilient but fragile. We pray that you will send your spirit to heal our land.
Also on Wednesday we gathered in the evening to record the professions of faith of three Confirmands. We celebrate with joy their honesty, their curiosity, their love, and their commitment to the way of Jesus. We ask that you bless and protect them. We ask that you make all of us instruments of your peace in this time of unrest. We ask that as a congregation you give us the courage to find a way toward your future. Give us a heart for future generations so that they, too, can learn of Dr. King’s dream and find new ways to embody it.
In this time of conflict and mass delusion, we may at times feel helpless to heal the divides of our nation. Give us a baptism of your Spirit that we may all be one. Renew our commitment to the way of Jesus, who received a baptism of the Spirit in order to bring justice and peace among all people.
Bless by your Holy Spirit, gracious God, this water that by it we may be reminded of our baptism into Jesus Christ and that by the power of your Holy Spirit we may fulfill what we have promised.
[Explanation: For over 20 years my spiritual practice has been Zen meditation. I am currently a member of Boundless Way Temple, Worcester, MA. I study koans under the instruction of David Rynick, Roshi. “Koan” comes from the ancient Chinese practice of law and simply means “case,” as in the record of a legal proceeding that points to the truth of the matter at hand. Koans are statements of proceedings usually in a monastery context, that point to truth. Another one of David’s students and I have taken up the practice of writing verses in response to some of the koans we study. My dharma name is “Setsusho.” Below is the koan. The koan translation from the original Chinese is by poet David Hinton. Rather than transliterate the character names (in the example below, “Quingrang”), Hinton uses a literal translation of the Chinese characters, so Quingrang becomes “Light-Inception Peak.” Confusing, but perhaps opening up more nuance of meaning. Following the koan is “Setsusho’s” response!]
A monk asked Master Light-Inception Peak: “The Buddha of Vast Insight and Surpassing Wisdom sat in meditation for ten kalpas on Buddha-Way Terrace, but the Buddha-dharma never took shape for him. How is it, in all that time, he never wholly became Buddha-Way’s turning seasons?”
“A question to the point exactly,” replied Light-Inception.
But the monk persisted: “After all that meditation on Buddha-Way Terrace, how is it he never wholly became the Buddha-Way?”
“Because he never became a Buddha.”
Deaf monk sits beneath a dead branch
Half moon hangs in the sky
In Kenosha, Jacob Blake
Lies in hospital, spine severed
Holy God, you call us to make disciples, but how can we invite others to follow when we ourselves have such a tendency to stray from your way of love? Tune our hearts to your call to return to the boundless embrace of your never changing love. Amen.
Invitation to the Table
Jesus said: “I am the bread of life; anyone who comes to me shall not hunger; anyone who believes in me shall never thirst.” Nevertheless, we hunger; nevertheless we thirst. We hunger for justice on behalf of Black lives lost and Black bodies broken under the crushing weight of systemic racism. We thirst for righteousness that is necessary for all to live in peace.
This table is open to all who hunger and thirst for God. Come to this sacred table not because you must but because you may. Come not because you are fulfilled but because in your emptiness you stand in need of God’s mercy and assurance. Come not to express an opinion, but to seek a presence and to pray for a Spirit.
Come to this table, sisters and brothers, as you are. Partake and share. It is spread for you and me that we might again know that God has come to us, shared our common lot, and invited us to step past the bonds of hatred and fear into God’s boundless embrace.
The Great Thanksgiving
Holy God, we praise and bless you for creation and the gift of life and for your abiding love which brings us close to you, the source of all blessing. We thank you for revealing your will for us in the giving of the law and in the preaching of the prophets.
The prophet Amos called on the ancient Israelites to “let justice roll down like waters and righteousness like a mighty stream.” Centuries later your prophet Dr. Martin Luther King, Jr. called on the people of America to do the same.
We thank you for the prophets of this moment who call us to once again examine our hearts, to shake free of our complacency, to open our ears to the cries of those suffocating in the grip of racial hatred. We thank you for calling us to be the healing hands and passionate heart of Jesus to our world.
With the faithful in every place and time, we praise with joy your holy name:
Holy, holy, holy God of love and majesty, the whole universe speaks of your glory, O God Most High. Amen. | <urn:uuid:c5badef9-d878-4d03-9192-1a97e8fa8fbc> | CC-MAIN-2022-33 | https://todd-grant-yonkman.net/tag/racial-justice/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570767.11/warc/CC-MAIN-20220808061828-20220808091828-00476.warc.gz | en | 0.940986 | 1,414 | 1.679688 | 2 |
We want to make it easy for you to know what to do if you’re facing anti-social behaviour (ASB) or other difficult behaviour.
If someone is in immediate danger, or you believe a crime is in progress you should call 999 now.
If ASB is in progress, you can call Leicestershire Police on 101. ASB can also be reported to Leicestershire Police at via the Leicestershire Police website.
If you / the victim / or the person who is causing ASB lives in a housing association home, you should contact the housing association.
Before you click on the links below, it is worth reading our 'what is anti-social behaviour' webpage so see what behaviours are not likely to be ASB, and which actions should be reported to the police rather than the council.
Further information can be found below:
Last updated: Mon 27th June, 2022 @ 14:05 | <urn:uuid:a37471be-b62f-48f5-b47d-6f2dd2c4dd39> | CC-MAIN-2022-33 | https://www.charnwood.gov.uk/pages/asb_guide | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572212.96/warc/CC-MAIN-20220815205848-20220815235848-00473.warc.gz | en | 0.946638 | 195 | 1.6875 | 2 |
The title of this week's article is One of the world’s most endangered forests originally planted by ancient South Americans, discover archaeologists.
In this weeks article is about the as the title suggest is about one of the worlds oldest Forests and more importantly a specific tree that is in most of these forests that are the Monkey Puzzle tree for which there are 19 species of this type of tree and 5 of them are on the endangered species list while 2 of them on on the critically endangered species list. This forest of these Monkey Puzzle trees are found in parts of Chile, Brazil, and Argentina, where a researcher has asked the question of how did these special trees get to South America?
Well, he found that they had not been just spread around these parts of South America normally by natural processes but more by a bit of human intervention from the Southern Je indigenous people that began to take the trees into different parts of Chile, Brazil, and Argentina the reason for this is they had been using the trees for timber, fuel, food, and resin. But unfortunately, where the indigenous people try to plant the trees were not geography or the most suitable places for these old trees, this was found when the trees would only grow on the Southside of most of the places they were planted because of Climate and the geography that they were placed on as well as they would not grow as tall. | <urn:uuid:a5f503cb-9471-4547-9adc-5f425615402b> | CC-MAIN-2022-33 | https://geogf101.community.uaf.edu/2020/03/08/blog-post-south-america-one-of-the-worlds-most-endangered-forests/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00275.warc.gz | en | 0.977501 | 371 | 3.375 | 3 |
Muskego residents formed a book club to read the book rejected by the school board
Muskego resident and book-lover Kellie Nimphius worked for the Milwaukee Public Library system for a dozen years before she began working for the Milwaukee County Federated Library System. That’s why it only made sense for her to help facilitate the new Muskego Community Book Club.
The club was formed after the Muskego-Norway School Board removed “When the Emperor Was Divine” by Julie Otsuka from a high school English class’s reading list.
Denying any book, she fears, could lead to more blocks to educational resources.
“I don't want to be part of a community that endorses banning one person's experience over another because it's an uncomfortable part of history or it makes people sad,” Nimphius said.
Otsuka’s novel, which details Japanese-American internment camps during World War II, is the first the club will read.
Muskego parent Ann Zielke has organized support for the book. As co-chair of the new club, she hopes she can continue to rally residents who care about diversity and inclusion.
When Zielke reached out to the Wisconsin Public Education Network for help, the nonprofit organization awarded her a $500 mini grant.
“Through that mini grant, we purchased 25 copies of ("When the Emperor Was Divine") that we have since given out,” Zielke said.
Zielke recently started a Facebook group for those interested in joining the club. There are already more than 70 members, a “fantastic” number, she said, and much higher than she expected.
One of those members is Carri Sussman, a two-year resident of Muskego. Knowing she’s not alone in her support of the novel gives her hope, she said.
“If you don't learn about history, you're damned to repeat it,” Sussman said.
The group’s first meeting will be held virtually via the Facebook page on Aug. 17. Anyone from any location can join. | <urn:uuid:8ec12c65-d61a-4545-83ce-31a7d2fba66e> | CC-MAIN-2022-33 | https://www.jsonline.com/story/communities/waukesha/2022/07/26/over-70-community-members-join-muskego-book-club-support-rejected-novel/10124595002/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573623.4/warc/CC-MAIN-20220819035957-20220819065957-00674.warc.gz | en | 0.952101 | 454 | 1.953125 | 2 |
- Word Combinations (noun), Word History, Word Explorer
|part of speech:
||a type of visual art work in which diverse and often seemingly incongruous materials, such as photographs, buttons, hair, and the like, are pasted upon a surface, often with added marks or writing.
is a French word that means "gluing." When French artists such as Picasso began making the first "collages" around 1912, the word entered English as a name for this type of artwork. | <urn:uuid:1459ad93-eef1-4f74-a5fb-6f2f6d02fb6e> | CC-MAIN-2017-04 | http://www.wordsmyth.net/?rid=8073&as_level=3 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281226.52/warc/CC-MAIN-20170116095121-00379-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.93439 | 108 | 2.859375 | 3 |
Fursdon House Gardens and Tearoom, Devon
Fursdon House is surrounded by 4 acres of hillside gardens that have been extensively restored and replanted over the last 40 years, with stunning views
Home of the Fursdon family since 1259, historic Fursdon House is surrounded by 4 acres of hillside gardens that have been extensively restored and replanted over the last 40 years, with stunning views looking over grassy parkland to the Exe Valley, Dartmoor and beyond.
Rising behind the house is the ancient cob-walled garden, known mysteriously as the ‘Fox Garden’, where a mix of formal and naturalistic planting can be enjoyed from the Vine Pavilion and thatched Round House. A display of tulips and alliums appear here in Spring. Scented shrub roses throughout have been trained on hazel supports to encourage maximum flowering, and are surrounded by a haze of herbaceous planting in soft blues, purples, and pinks.
In early Autumn, a mass of crimson Dahlias appears in Grace’s Border (named after a Fursdon matriarch) – quite a spectacle! The Library Terrace bank planting has been developed to provide a nectar rich feast for bees and butterflies - recently added Salvias, Asters and Nepeta mingle with drifts of marjoram and other perennials in front of a wall clad with roses and clematis.
The Meadow Garden, originally planted nearly 200 years ago, in memory of Harriet Fursdon, is now a woodland walk leading to a pond and grassy areas where the family is trying to establish wild flowers from existing meadows on the estate.
At the Coach Hall tea-room, large planters in the cobbled courtyard start with tulips and wallflowers in the spring, and are replanted for the summer months with a different colour scheme each season - again focusing on nectar rich planting - inspiration whilst visitors enjoy their teas!
Fursdon House Gardens Opening Times 2022 - Check website before visiting.
The garden is open from Easter Monday until the end of September on Bank Holidays and Wednesday and Thursday afternoons, 2-5pm.
During the months of June, July and August, visitors can combine their garden visit with a guided tour around the historic manor house with family costumes and artefacts from Fursdon’s long history on display in the museum.
- Telephone: 01392 860860
- Street: Fursdon House
- Postcode: EX5 5JS
- City: Cadbury
- County: Devon
HOTELS AND PLACES TO STAY NEAR TO GARDEN
If you want to take a break, why not stay in one of our recommended hotels. Each hotel has genuine guest reviews enabling you to book from anywhere in the world in total confidence. Not only do we feature hotels near the garden, we also feature hotels worldwide and at all major airports. Special prices up to 70% off standard rates as well as hundreds of exclusive deals. Look now - click here. | <urn:uuid:6b019656-cc4d-4496-83fa-48bedff59480> | CC-MAIN-2022-33 | https://greatbritishgardens.co.uk/devon/item/fursdon-house-gardens.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00470.warc.gz | en | 0.938855 | 666 | 1.617188 | 2 |
Sunday nights will soon see a new source of information and public debate with the debut of a TV programme that will focus on what is happening at the National Assembly of Guyana and what the political parties are seeking to do on behalf of the Guyanese people, a release from the US Embassy said today.
“This Week in Parliament” is made possible through USAID’s Leadership and Democracy (LEAD) Program. It will air on TVG-Channel 28 on Sunday nights from 19:15 hrs to 20:15 hrs, beginning on April 13, 2014. The LEAD programme has been a source of controversy between Guyana and the US.
In addition to providing viewers with information on current legislation and matters being debated in the National Assembly and its committees, the programme will offer viewers a moderated “Discussion Panel” comprised of invited MPs from all major political parties in the Assembly, the release said.
The release said viewers will be invited to submit questions to the panel relating to the selected topics of debate. Each programme will also highlight a youth group operating in Guyana and offer a segment where the members of the public will be able to express their views on issues that matter to them and which they want the National Assembly to address.
The programme is produced by the International Republican Institute, the release noted. | <urn:uuid:0ec97248-8168-4d5e-a763-c30badb5a137> | CC-MAIN-2016-44 | http://www.stabroeknews.com/2014/news/stories/04/10/lead-tv-programme-to-focus-on-parliament-matters/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720238.63/warc/CC-MAIN-20161020183840-00189-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.96014 | 271 | 1.84375 | 2 |
ESCI 1/72 F-100D Super Sabre
|PRICE:||$5.00 from a vendor's table many years ago|
|REVIEWER:||Scott Van Aken|
"The North American Aviation F-100 Super Sabre was a sleek, swept-back-wing fighter that gave the United States a supersonic Air Force. Although the first version was produced prior to 1950, various improved versions served as trainers and as active military craft at many U.S. and foreign bases.
Since May 1953, when the first prototype model, the YF-100, bettered the speed of sound on its first flight, the versatile fighter set numerous records for speed, endurance, range and maintenance.
Late production models of the F-100D and F-100F had the capability of being launched from remote areas in the manner of manned missiles. An F-100D Super Sabre became the first supersonic aircraft to be "boosted" airborne without use of a runway in successful Zero Length Launch (ZEL) tests at Edwards Air Force Base, Calif., in 1958.
In addition to its nuclear bomb armament and four 20 mm cannons, the Super Sabre could be equipped to fire rockets and missiles, including the heat-seeking GAR-8 Sidewinder.
While the later models of the F-100 had a speed in excess of 1,000 mph, two earlier models of the "A" and "C" established the world's first low level supersonic speed records. Colonel F.K. (Pete) Everest reached 755.149 mph in October 1953, and Colonel Horace Hanes topped 822 mph in August 1955.
To demonstrate the ability of its pilot and aircraft, the Air Force chose F-100 Super Sabres to perform throughout the world in aerial precision demonstration flights. The famed "Thunderbirds," a four-man aircraft team, were viewed by over 19 million people as the storied pilots performed intricate precision maneuvers at low altitude. In Europe the "Skyblazers" flew similar demonstrations.
The jet fighter was originally powered by a Pratt & Whitney J57-P-7 axial-flow engine. Later models of the F-100 were powered by a Pratt & Whitney J57-P-21A engine. Both were two-stage turbojet engines with afterburner, rated in the 10,000-pound thrust class.
The F-100 had a service ceiling above 50,000 feet and a range of more than 1,000 statute miles.
In addition to the thin, highly swept wing and tail, the F-100 design incorporated other features that reflect an answer to the problem of supersonic flight. Heat-resisting titanium was used extensively throughout the plane. A low-drag, ultra-streamlined fuselage and canopy with but one thin-lipped air intake duct helped make supersonic speed possible. The canopy line matched the rear fuselage in a smoothly curving line so that from the side, the Super Sabre appeared to be slightly arched. Other features included automatic leading-edge slats and a low-positioned one-piece horizontal stabilizer. The F-100 was the first USAF airplane to utilize the low tail.
The plane had an automatically regulated air conditioning and pressurizing system and automatic fuel system.
Particular attention was given to placement of all controls, equipment and instruments in the cockpit for ease of operation.
Most of you know that ESCI went out of business in the late 1980s and was purchased by AMT/ERTL, then Racing Champions and now Italeri. ESCI was very much doing aircraft kits and lots of other types as well. One of their better kits was the 1/72 F-100D kit that was produced in at least a half dozen different boxings. Even now, many consider it to be the best F-100D in this scale, even though there has been another kit released by Revell AG and I believe either Trumpeter or Hobby Boss has done one in this scale. This same kit was the basis for the AMT 1/72 F-100F, using all the same sprues except for the fuselage, canopy, and additional interior bits.
Molded in a tan plastic, the kit is very nicely molded with crisp engraved panel lines. There is no flash nor sink areas. However, ejector pin marks can be found on the inside of gear doors, on gear legs, missile bodies, pylons and a few other places. Some will be difficult to remove. The cockpit is relatively barren with but a control stick, seat and instrument panel. Instruments and side consoles are decals. A gun sight sits atop the instrument coaming.
The intake is quite shallow as is the exhaust, going back no farther than the nose and afterburner sections. Both type of afterburner can are provided as ANG planes used the less complex F-102 burner can. There are three pylons for each wing with the center one being used for the drop tank. Inner pylon is for the Bullpup or Sidewinder missiles. The Sidewinder missile rails are incorrect as it should look like an inverted Y but is like an inverted T instead. The outer racks have no weapons, so it is up to your spares box to find something. The kit also supplies only the curved refueling probe so if doing an early plane, you'll have to make the straight one. The kit's canopy is a single piece and will need to be cut to show any interior detail. However, since there is little, perhaps it should remain closed.
Instructions are quite well done with good drawings and color information in both generic and FS 595 colors where that is applicable. Markings are for four aircraft. One is a silver painted plane from the 481 TFS in Vietnam named 'Pretty Penny' as shown on the box art. An Arkansas ANG 184 TFS aircraft in SEA camo is next. In a similar scheme is a French EC 4/11 aircraft with a huge sharkmouth. Finally, in overall green drab is a Danish 730 Esk aircraft. The ESCI decals are nicely printed though the French roundels are a tad off register. My experience with ESCI decals have been mixed with some working fine and others breaking apart when they hit the water. They do not respond well to setting solutions and are quite matte.
First thing I did was ignore the kit recommendations on the interior (they suggest light blue) and used dark gull grey for this job. I then applied the decals to the instrument panel and side consoles. After fitting the control stick, the interior was installed into one fuselage half. I then added probably more weight than what was needed and closed the halves. Meanwhile the wing halves were joined after opening up the holes for the center pylon, which will carry the fuel tanks. I have seen many photos of this plane with no inner and outer pylons so that will be how this one will be built. Both the wings and fuselage seams were filled and sanded down.
Back at the fuselage, the lower gun panel piece was installed. It is a VERY tight fit and perhaps should be installed when assembling the fuselage halves. The nose piece was next. I then installed the wings. Fit is also quite tight and the rear join never did properly line up. From the way it seems, the next time I'll install the lower wing section to the fuselage first then add the upper wing halves for it seems the upper wings were causing the mis-alignment. Nothing filler and sandpaper cannot fix, but I'd rather have not had this issue.
With the wings in place, I masked and temporarily attached the canopy. I say temporarily as I've been looking for a metal replacement seat that I know I have but cannot find. I then headed for the paint shop.
|COLORS & MARKINGS|
This particular aircraft would be an overall painted aluminum. I had been told that Tamiya TS-17 Gloss Aluminum in a spray can does the best painted aluminum surface so decided to give it a try. Like all spray cans, I first sat the can in hot water for about ten minutes to warm the paint. I then sprayed the airframe and sprues with this color. I have to say that I'm not jazzed about the lack of control in terms of the amount of paint that comes out of the can, but I do say that the paint looks to be painted aluminum so perhaps I'll try it again later. I blithely ignored instructions to paint the gear and speed brake wells with Interior Green, leaving them in painted aluminum.
At this time, I attached the landing gear, gear doors, speed brake, tail hook and refueling probe. As I'd done some sanding/scraping on these items to remove mold seams, I decided to spray on more of the Tamiya Aluminum. Meanwhile, the wheels were painted using Floqui's Weathered Black. Once dry, they were installed on the axles.
I then went to work on the rear fuselage. This area was often heavily burnt from the heat of the engine and so with a combination of metallics and pastels, I tried to make it look as if the paint had burned off this area. Not so sure how successful I was, but it is convincing enough for me.
Seemed like a good time to consider markings. I have several old Superscale sheets with wing commander's planes, but I wanted something a bit more subdued for this one. Wolfpak decals has a nice sheet (72-030) that contains a pair of aluminum painted F-100s based in the UK with the 20th and the 48th TFW. I picked the one from the 20th TFW as it had a nice badge on the fin.
The decals went on without any issues. I did have to use a few markings from the kit sheet as there were no wing walk markings in with the Wolfpak sheet.
There really is not all that much left. I did some painting of the formation lights and cut a decal to use for the nose radome section and the upper fuselage. I also installed the pitot and the wing fences. The drop tanks were next along with their support pylons. Eventually I located the Aeroclub F-100 seat that I had in my stash, painted it up and installed it. A few more decals were needed for the drop tanks. I noticed from the profile on the sheet that the flashes on the wing tanks were reverse of the ones on the fin and had the red as the upper color instead of the blue. It also appears the tanks in the profile are fatter and shorter. With all the markings in place, I sprayed on some Metallizer Sealer to help protect the decals. This is quite thin and does not dull the aluminum as much as other methods. I then pulled off the canopy and installed the metal Aeroclub F-100 seat I eventually located. The canopy was glued back on, though it really doesn't fit all that great, especially on the right side. Masking removed, detail stuff done and that was it.
This is the second single seat 1/72 ESCI F-100D I've done and if you include the AMT two seat version, it makes three. The kit is quite a nice build and while perhaps eclipsed by newer versions, is well worth seeking out when you run across it as shows and other venues.
Historical section courtesy of www.boeing.com
Thanks to me for the kit and Wolfpak Decals for the markings.
If you would like your product reviewed fairly and fairly quickly, please contact the editor or see other details in the Note to Contributors.
Back to the Main Page
Back to the Review Index Page | <urn:uuid:8bbc6103-cf6f-4b7f-ab1b-e603510b644b> | CC-MAIN-2022-33 | http://modelingmadness.com/scott/korean/us/usaf/f100d.htm | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00277.warc.gz | en | 0.972388 | 2,509 | 2.421875 | 2 |
Amazing photograph series by Los Angeles based artist Brice Bischoff, specialize in photo-based work. This series was realized in Los Angeles, the Bronson Caves are famous for their use in cinema as a stage set to countless movies and television shows, mainly from the western and science fiction genres. In the series of photographs titled Bronson Caves, the caves served as a stage set yet again. Bischoff performed actions for the camera with massive sheets of colored paper. Since a long-exposure photograph was produced rather than a motion picture, the papers were recorded as voluminous, glowing colors. The materiality of the rainbowed forms, emerging from the mouth of the cave, dancing about the canyon, and bubbling up from the ground, are based solely in the photographic process, and can only be experienced when viewing the final photographic prints. See more;
If a visitor to the caves were to accidently stumble upon my performance they would only see a mass of crumbled colored paper draped awkwardly over a man moving/dancing to a camera positioned on a tripod. The goal of these performances was to create sculptural, photographic objects that interacted with the history and architecture of the caves.
The colored paper used during the production of the cave photographs was transformed, weathered, stained, and torn after months of constant use. Deciding to isolate the medium, the props of the action, a studio setting with a pedestal was used to photograph the various scraps of paper. The format of these photographs mimics the traditional way of documenting art objects. However, a photographic technique similar to that explored at the caves was used, exposing the paper into a blurred mass, a pure photographic object. The final phase of the series involved setting the paper ablaze, letting the objects pass in transience but allowing them to persist in photographs. - Brice Bischoff.
via | Look in Art | <urn:uuid:43845d11-e158-4ffc-9e72-809e35ee7282> | CC-MAIN-2017-04 | http://www.triangulation.jp/2011/05/bronson-caves-by-brice-bischoff.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281574.78/warc/CC-MAIN-20170116095121-00021-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.968363 | 387 | 2.5 | 2 |
Bruce Caldwell offers a refresher course on Hayekian economics to the economists gathered at the Institute for New Economic Thinking conference at Cambridge:
Let me begin by clearing up a misconception. Hayek is sometimes wrongly portrayed as thinking that market systems always work just fine. Now this is a man whose first book was titled Monetary Theory and the Trade Cycle. Suffice it to say that Hayek was no Dr. Pangloss when it came to the workings of a market economy. Hayek thought that a trade cycle was an unavoidable concomitant of a credit using
market economy. Hayek’s description of the unfolding of a typical cycle actually maps pretty well with at least a part of what happened in the latest meltdown, especially in terms of the Fed’s interest rate policy and its effects on the American housing sector.
In Hayek’s theory, problems start when the market rate of interest is held too low for too long. This always politically popular policy leads to malinvestment – too many investment projects get started that cannot ultimately be sustained. When people realize what has happened, investment spending collapses and a recession begins. In Hayek’s theory, recessions are the painful but necessary adjustment that returns the system back to equilibrium. His policy advice at the time, simply to let the system adjust, was as popular then as it is today. His great fear was that attempts to combat the recession with expansionary policy would perpetuate the malinvestment, delay the necessary and painful process of adjustment, and set up the prospects of future inflation. This too perhaps sounds familiar.
Perhaps of more interest than his cycle theory are Hayek’s views on regulation and on the limitations of economics as a discipline. Regarding regulation, two things should be noted at the outset. First, Hayek was not opposed to all regulation; more forcefully, he frequently criticized the concept of laissez faire. Second, he was no policy wonk. All of his observations were made at a very general level. This was in partstrategic: when he established the Mont Pelerin Society he found himself trying to keep together a coalition that ranged from Ludwig von Mises to Chicago School economists like Friedman and Stigler to ordo-liberals like Walter Eucken to people like Michael Polanyi and Karl Popper who, in this group anyway, might well be considered social democrats. He was not always successful: Mises walked out of one of the sessions at that first meeting muttering that everyone there was a damn socialist. In any event, given that we are trying in this conference to consider foundational issues about economics, a discussion of general principles may not be entirely out of place … | <urn:uuid:826557aa-6c97-4ca6-bf43-b292392cd576> | CC-MAIN-2017-04 | http://hayekcenter.org/?p=2229 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283008.19/warc/CC-MAIN-20170116095123-00080-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.972442 | 549 | 2.03125 | 2 |
No problem – no startup. Every successful startup solves a problem. Without a problem, there is no solution and therefore no business. If you want to succeed on Startup Weekend, you’ll have to quickly validate that your idea solves a real problem in order to have enough time to build the right prototype and prepare the business case. 95% of teams that I mentored during four or five Startup Weekends used the wrong approach to validating the problem and their ideas. Therefore, they had to double (or even triple) their effort if they wanted to fix it and still get a chance to succeed. I am going to quickly explain you what is the mistake and how to avoid it to validate whether your idea solves a real problem.
You validate whether your idea solves a real problem by doing customer interviews and asking them questions. If you only assume that everyone would like what you are doing because you like it, you can stop doing it right now.
“Assumption is a mother of all screw ups.”
If you aren’t Steve Jobs or Henry Ford, validating whether your idea solves a real problem is much safer way to start working on your startup. So let’s imagine that it’s 1999 and you just had an idea of a small music device that could store hundreds of songs – iPod. What would you ask the potential customers during the customer interviews? The teams that make the mistake and use wrong question would ask something like the following:
“Hey, would you mind answering a quick question? I’ve got this idea and would like to know, if you’d like having your music stored in a digital format instead of a CD and thus being able to listen to many more songs than you usually are?”
The answer to such question would almost always be similar to “That sounds like a great idea!”. The reason is that people would like to have many things. Flying cars for example. But that doesn’t mean that they need them and are going to pay for them at this time.
It happened because the idea was pitched as a part of the problem validation. Pitching the idea will very likely bias or influence the answer. In this very early stage, you don’t need to validate whether the potential customers like your idea. Instead, you need identify whether the problem that you want to resolve is big enough for them. Therefore, validate the problem, not the idea. I believe that the best way to do so is to use the three magic questions that I’ve seen introduced by Lean Startup Machine. There are some variations of them of course, but the logic behind stays the same.
1. What’s your biggest problem when doing the ABCXYZ?
This tells you what the people really think about it and what they consider a problem.
2. How often do you experience the problem and what do you do when it happens?
This shows you how big the problem is as well as what is the current solution. Do they experience it every day or only a few times a year? Of course, don’t ask this question when the person doesn’t have any problem.
3. If you had a magic wand, how would you resolve it?
This is a real magic. You will even learn what you need to do to resolve the problem.
That’s it, simple as it goes. Use these three magic questions, talk to real users and not only friends. You will not need more than an hour to validate whether your idea solves a real problem and keep working towards winning Startup Weekend.
Founder & CEO at Mentegram and entrepreneur innovating healthcare and mental health. | <urn:uuid:d7769bd4-682f-45f8-87dc-1a491137e098> | CC-MAIN-2017-04 | http://www.techstars.com/content/community/right-approach-validate-idea-startup-weekend/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280730.27/warc/CC-MAIN-20170116095120-00254-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.967537 | 764 | 1.8125 | 2 |
The Mark I Batmobile was the Batman's original Batmobile. The Mark I was an all-black armored transport with heavy artillery weapons, much like the original Batwing. At first Batman often simply referred to this Batmobile as "the car".
This armored car was among the many inventions Bruce engineered in his Batcave. Originally it was only referred to as "the car."
Batman's first known use of the car was during the rescue of Vicki Vale from Joker. Wayne parked it outside of the Flugelheim, which he infiltrated through the skylight. The pair then escaped the building via zip-line and entered a wild car chase with Joker Goon Cars and GCPD cruisers. A grappling hook line was fired out of the side of the car to allow to turn a sharp corner at high speed, causing some of the pursuing vehicles to crash at an intersection. At one point massive construction vehicle blocked the street, and they were forced to abandon the car and continue to flee on foot. Batman pulled a small remote from his belt, activating heavy layers of shielding around the car with a voice command.
After a grueling street fight, Batman called the car with the communicator and when it arrived dramatically told it to "stop" directly in front of him, where it stopped on a dime. Wayne drove her to the outskirts of the city, through an off-road wooded area. Vicki screamed in horror as they sped toward a rock wall, which is revealed to be an entrance to a Batcave tunnel. They appeared to pass through it, though when Vicki looked back she noticed something lowering over the opening where the wall was.
Destroying Axis plant
After being called out by Napier in a disingenuous video message to Gothamites, Wayne responded with an all out assault on Joker's lair which he had been narrowing down on a map in the Batcave. Standing safely outside the Axis Chemicals plant, he sent the Batmbobile crashing through the outer gates.
Afterwards Batman met back up with the car outside the exploding facility. Joker suddenly appeared overhead in a helicopter mocking him with a lyric about going into the air, revealing that him and most his men had escape before the chain reaction had finished destroying the plant. Batman returned to the Batcave and took to the skies himself in the Batwing aerial vehicle to go "mano e mano" with the Joker at the 200th Anniversary Festival.
Dispersing the Red Triangle Gang
Batman used this Batmobile to fast travel to Gotham Plaza, where the Red Triangle gang launched a terrorist attack on the Lighting of the Tree Ceremony. He launched newly installed riot control weaponry, called Bat-Discs at their dirt bikers and clowns firing guns. He also used blunt metal extensions on both sides of the car to knock pyro jugglers off their stilts, who had been setting innocents on fire. Two clowns with submachine guns jumped onto the hood of the car from a bridge, started futilely firing point blank into windshield visor of the car. Visibly agitated by this, Batman sped forward, slamming on the brakes launching the pair of the car through the window of a vandalized gift shop. Coming upon a firebreather gangmember who had just set to the merchandise in the gift shop on fire, he used a hydraulic jack built into the bottom of the Batmobile to lift the car and turn it 360 degrees. Putting the firebreather directly in the path of the jet turbine exhaust, which Batman used to set him on fire. Afterward he emerged from the cockpit to personally rescue Selina Kyle from a clown with a taser.
Hijacked by the Penguin
Penguin commissioned blueprints from his engineers in the circus on how to tamper with it and weaponize it. A device was created by the gang that could hack the frequency and deactivated the shield mode on the vehicle. They were able get access through the armor panel seams and exposed areas around the vehicle, pulling out the hi-tech turbine the Sword Swallower began doing hotwire work. The Thin Clown installed receiver device on the bottom of the car that would allow Penguin to take control of the vehicle from his trailer.
Bruce later used a vehicle called the Batskiboat to traverse the sewers and find Cobblepot's lair.
Although Bruce Wayne later repaired and restored the Batmobile, he would eventually quit actively using this Batmobile and go on to use at least two different models, starting around the time Harvey Dent was scarred by Sal Moroni. | <urn:uuid:0e116291-31ae-4a1c-b936-a405ac1df61e> | CC-MAIN-2022-33 | https://batmananthology.fandom.com/wiki/Batmobile_Mk_I | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.37/warc/CC-MAIN-20220809003642-20220809033642-00674.warc.gz | en | 0.973403 | 946 | 2.28125 | 2 |
When Warren Buffett speaks, the investment world tends to listen, and for good reason. Likewise, when Buffett's second in command, Berkshire Hathaway (NYSE:BRK-A) Vice Chairman Charlie Munger, expresses an opinion, you should take note. Nearly a year ago, Munger told CNBC that he thinks that "civilized people don't buy gold," instead preferring a collection of well-run business, much like those in Berkshire's portfolio. While his advice was sound a year ago, it truly resonates this year as analysts across the street slash price expectations and, in some cases, recommend being short gold. Given the turmoil and increasingly negative outlook settling over the gold market, 2013 may be a good year to sit out in pursuit of more prim and proper pursuits.
We just have a wonderful portfolio in business, if you average them out. By and large they're doing productive, useful work. It's not outsmarting the computer systems in the trading markets.
Even though the comment is self-serving, and arguably stale, it highlights an important concept when thinking about the gold market, namely that gold doesn't really do anything. Unlike silver, which has a myriad of industrial uses, as do Molycorp's (NYSE: MCP) rare earths, gold is mostly coveted as a safe-haven investment or inflation hedge.
"I think civilized people don't buy gold," Munger said; "they invest in productive businesses." Where the rare earth materials produced by Molycorp and others are used in health care, technology, water treatment, and defense applications, gold is used for very little beyond jewelry. He may not have had other materials companies in mind, but this distinction for gold is an important one and should not be lost.
The analysts are circling
Both Goldman Sachs and Deutsche Bank recently cut their respective outlooks for gold for the rest of 2013 and beyond. Deutsche focused on the strength of the U.S. dollar, the shift into stocks, and its view on improving U.S. growth as all being negative for gold over the medium and longer terms. It trimmed its 2013 outlook by nearly 12% and, while it dropped its 2014 projection by 4.7%, it still sees gold climbing to $1,810 next year.
Goldman's view is much grimmer, leading the investment bank to recommend that clients go short gold ahead of continued weakness. In its second cut of the year, Goldman dropped its 2013 price target to $1,545 and its 2014 target to $1,350, well below the estimate of many peers. Some of the reasons cited include the muted response gold prices have had to economic weakness and the potential for accelerated selling pressure as speculative investments are wound down.
Ultimately, I believe reality lies somewhere in between the views of the two investment houses, with the real possibility that another debt hiccup in Europe could serve as a catalyst to redraw the landscape. At current levels, gold remains speculative and better options exist. Even if you prefer not to liquidate your exposure completely, some trimming is indicated here.
Fool contributor Doug Ehrman has no position in any stocks mentioned. The Motley Fool recommends Goldman Sachs. Try any of our Foolish newsletter services free for 30 days. We Fools don't all hold the same opinions, but we all believe that considering a diverse range of insights makes us better investors. The Motley Fool has a disclosure policy. | <urn:uuid:15d34651-c560-4bb6-aad8-564b6a4e5a3e> | CC-MAIN-2017-04 | http://www.fool.com/investing/general/2013/04/13/be-civilized-and-dont-buy-gold-in.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280410.21/warc/CC-MAIN-20170116095120-00455-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.965095 | 702 | 1.539063 | 2 |
A banner that greeted President Obama on his 2010 visit to California solar energy start-up Solyndra was to be a memento of the presidential push which helped get the company off the ground.
Now it’s up for auction, part of a trove of Solyndra assets for sale after the company filed for bankruptcy, all relics of a federal loan program gone awry.
A website for the auction company Heritage Global Partners lists the banner among dozens of computers, pieces of office furniture, robots, even electron microscopes worth $500,000 or more.
The seven-foot-by-30-foot banner featuring an American flag and heralding Solyndra and “Made in the USA,” a backdrop for Obama’s tour, has yet to receive any bids, according to the auction website.
More than 1,000 potential buyers have already signed up to view the Solyndra property, auction house partner Kirk Dove told San Francisco ABC television affiliate KGO.
“It could be solar panel manufacturers looking for extra capacity and need manufacturing equipment, it could be wholesalers of finished good products because we’re selling finished good panels. It can also be buyers of household items, of office furnishings, personal computers,” Dove said. “There’s biopharma equipment. There’s electronic test equipment.”
The federal government awarded $500 million in grants to help the solar panel maker get started. But now, little if any of that money is expected to be recovered for taxpayers. More than 1,000 workers also lost their jobs at the company when it abruptly shut down in August.
Obama has defended the Solyndra loan, which had been the poster child of the administration’s green jobs push, telling ABC News last month that “hindsight is always 20/20.”
“It went through the regular review process, and people felt like this was a good bet,” he said.
The White House has since ordered a review of the entire Energy Department loan program. House Republicans are conducting a separate investigation into the Solyndra affair. | <urn:uuid:9714d80b-4677-4357-8b09-5c3df615e86e> | CC-MAIN-2016-44 | http://abcnews.go.com/blogs/politics/2011/11/for-sale-banner-that-greeted-obama-at-solyndra/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988718866.34/warc/CC-MAIN-20161020183838-00003-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.95513 | 444 | 1.59375 | 2 |
Fresh from his stint at AU, Interaction Designer, Ian Hooper, filed this report on Project Newport.
Architecture has always had a role in storytelling, from the library that hold the books to the created space for drama, sports, commerce, and community. Theme parks go beyond providing the setting for the creation of stories and consciously builds upon well known stories or genre traditions, allowing visitors to enter physically into spaces they have visited many times before in their imagination. In more traditional architecture, spatial and social narrative are fundamental to the ways in which buildings are shaped, used and perceived. Building these evocative spaces is one thing, but selling the idea and communicating the story before it is built is a challenge architects face.
image source: http://www.flickr.com/photos/dgphilli/51563395/sizes/m/
There are many ways to build a story, but first let's take a look at what a story is. A story is a narrative which describes a sequence of events. This is different from a historical account where the goal is to provide the best possible interpretation of past events given the available evidence. A story willfully tries to create a particular vision or perspective from which to understand the meaning of the tale. Storytelling is the act of performing a structured narrative for a live audience with (one of) the goals being to share and create a common experience.
When architects present their design, they are looking to express the story of how the building will be built, lived in, and talked about. They are trying to share their design intent by creating a common experience. Another way to say this is that they are walking the client through their thought process; however, both in traditional contexts and in modern digital incarnations, storytelling is often very interactive. The storyteller must react and temper the tale based on the reactions and feedback from the audience. In the same way, an architect can gauge the mood of the client and make on-the-fly adjustments to the presentation.
image source: http://www.flickr.com/photos/bhikku/41659000/sizes/m/
Today’s architecture demands going beyond reading the mood of the audience. Looking ahead, we are seeing the end of the passive consumer. Increasingly we live in a participatory culture where we see ourselves as active creators. Whether that is in the form of editing family photos, making a video for YouTube, or designing a dream kitchen on a retailer’s web site, the effect is the same: the creative act is no longer the exclusive domain of master artisans. The lay person may not necessarily produce quality results, but it changes the nature of the interaction between the designer and their clients.
Clients want and expect to have more input in design decisions. In this context, a static presentation board is inadequate at facilitating a rich two-way dialog. Now the storyteller must adapt the narration in real-time to the inquiries and inspirations of their audience. It is the difference between reading the text of a book to someone who quietly listens and telling someone a story as they interject with questions and clarifications.
As much as clients are getting more engaged in designing, they do not really want to stand over the shoulder of the architect as they work out the design details in Revit, and the architects most certainly don’t want that. So what is needed is a tool that allows for the right amount of interaction. Again, to draw upon the storytelling metaphor, an audience member might ask the storyteller to tell them more about the dragon that has just entered the tale. The storyteller may even improvise and make some adjustments to the story to lengthen the role of the dragon; however, the overall story arc and central plot remains the same. The storyteller is not engaged in a story writing workshop. They are not looking to the audience to help them come up with a good ending. The narrative is known, even if the details are worked out in real time.
We have designed Project Newport to give architects the modern tools they need to present an appropriate amount of interaction with their designs. Presentations can be tightly controlled and scripted slideshows or a free-ranging exploration of materials, spaces and lighting. Through rich storybuilding tools Project Newport provides the means to react and engage with a more participatory audience in the creation of evocative, meaningful architecture.
Thanks Ian. Project Newport is alive in the lab. You can sign up to be notified when Project Newport is available on Autodesk Labs at:
Thanks for your interest in Project Newport. | <urn:uuid:cdcfa139-f5eb-4c29-996e-82427395a52c> | CC-MAIN-2022-33 | https://labs.blogs.com/its_alive_in_the_lab/2008/12/storytelling-for-architects.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573533.87/warc/CC-MAIN-20220818215509-20220819005509-00265.warc.gz | en | 0.959299 | 947 | 2.765625 | 3 |
It’s midnight, and you have to wake up at 5 a.m. for an early meeting. Even though you’ve had a long day, you still can’t seem to fall asleep. You watch the alarm clock, cringing at every minute that passes and dreading how you’ll feel the next day.
Sleep is crucial to our survival and well-being. So why is it so elusive at times when our body needs it most? There’s some bad news and some good news. The bad news is that we are, subconsciously, doing this to ourselves. The good news is that we can develop mastery over our sleeping habits, just like any other self-regulatory process, such as eating, as long as we have access to knowledge about that process and proper techniques that grant ourselves control.
According to psychological research, insomnia is a common problem when we’re under a high cognitive load, such as daytime stress. Researchers claim that two processes interfere with our ability to fall asleep. The first is pre-sleep worry. Because our lives are often so busy, we leave all of our anxiety to the end of the day, when we feel that we’ll be more able to direct our attention solely to our thoughts. Little do we realize how damaging this can be to our sleep regulation. Worrying about our current situation, the past, or the future can lead to cognitive and bodily arousal, telling your body it’s not time to sleep yet. Thus, night worries can easily keep you up all night. Another process that interrupts our sleeping patterns is our cognitive distortions, or dysfunctional beliefs about sleep. These include thoughts such as, “If I can’t fall asleep, I should stay in bed and try harder” or “If I don’t fall asleep now, my entire week will be affected.” These types of thoughts are dysfunctional because not only are they untrue, but they also produce worry and anxiety about sleep itself, leaving you restless.
If you’re curious, the best thing to do if you cannot sleep after 20 minutes is to get out of bed and do something else before trying again (for example, reading a book). This helps you to avoid those anxious thoughts and expectations. Also, one bad night’s sleep will not carry over through the entire week. Your body is wired to make up for loss of sleep the next night by falling into deeper (and better quality) sleep faster.
What can we do to have more control over our sleep? The answer is simple: do nothing! The premise of mindfulness tells us to be aware of and accept internal and external experiences as they occur to and within us. This is exactly what helps sleep come on faster. If we’re able to stop holding on to our thoughts and feelings and let them float on as we observe instead, our arousal level will diminish, telling our bodies that it is time to rest. So don’t worry about a racing mind at bedtime. Embrace it, and ride the wave! | <urn:uuid:1dffb887-5737-4bb9-9e67-650742bec153> | CC-MAIN-2017-04 | http://www.themindfulword.org/2012/mindful-sleep-insomnia/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281069.89/warc/CC-MAIN-20170116095121-00266-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.950906 | 633 | 2.8125 | 3 |
Size of this preview: 800 × 600 pixels
Full resolution (2,592 × 1,944 pixel, file size: 732 KB, MIME type: image/jpeg)
A 1/2 inch diameter conical magnet attached to a 2 inch long cylindrical magnet mounted onto a microscope slide with a three pronged clamp.
Click on a date/time to view the file as it appeared at that time.
|current||10:45, 22 June 2010||2,592×1,944 (732 KB)||Brian P. Josey (Talk | contribs)||(A 1/2 inch diameter conical magnet attached to a 2 inch long cylindrical magnet mounted onto a microscope slide with a three pronged clamp.)|
- Search for duplicate files
- Edit this file using an external application
See the setup instructions for more information.
This file contains additional information, probably added from the digital camera or scanner used to create or digitize it. If the file has been modified from its original state, some details may not fully reflect the modified file.
|Camera model||Canon PowerShot SD430 WIRELESS|
|Exposure time||1/1 sec (1)|
|Date and time of data generation||09:29, 22 June 2010|
|Lens focal length||12.12 mm|
|Horizontal resolution||180 dpi|
|Vertical resolution||180 dpi|
|File change date and time||09:29, 22 June 2010|
|Y and C positioning||1|
|Date and time of digitizing||09:29, 22 June 2010|
|Image compression mode||3|
|Maximum land aperture||4|
|Focal plane X resolution||11520|
|Focal plane Y resolution||11571.428571429|
|Focal plane resolution unit||inches|
|Sensing method||One-chip color area sensor|
|Custom image processing||Normal process|
|Exposure mode||Auto exposure|
|White Balance||Auto white balance|
|Digital zoom ratio||1|
|Scene capture type||Standard| | <urn:uuid:174b1d50-c2b7-4748-b279-c55cb2ef4075> | CC-MAIN-2017-04 | http://www.openwetware.org/wiki/Image:Magnetic_Mount.JPG | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280763.38/warc/CC-MAIN-20170116095120-00517-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.748921 | 458 | 1.765625 | 2 |
When Ancient Greek speaks
Many books exist written in the Ancient Greek language that are worth of reading today. Ancient Greek should be so taught as to develop power to read those books in original language. This task, however, is often complicated by the necessity of learning a formidable grammatical nomenclature, and the beginner is often called upon to deal with situations outside his own experience. The research that linguists, psychologists, and language teachers have conducted over the past three decades stress the importance of integrating all four skills – listening, reading, speaking, and writing – in the Greek classroom. This program is designed to suggest ideas on how to use the inductive-contextual method (or Nature Method) which is based on the frequency vocabulary and the principle that new words should be introduced in a setting that makes possible their interpretation by reading alone. This program is chiefly based on the Italian edition of Athènaze, by M. Balme, G. Lawall, L. Miraglia and T. F. Bórri (vool I and II). Moreover, the Athènaze course offers the chance to use technology to full, especially surfing the internet.
- Improving teaching and learning according to the Nature Method.
- Developing pedagogical methodologies for teaching Ancient Greek in a more effective way.
- Supporting teachers to encourage the cooperative learning.
- Discovering how writing and speaking in Ancient Greek may help overcoming certain difficulties of grammar and syntax.
- Organizing lessons using the Nature Method.
- Introductory meeting, explanation of practical arrangements, presentation of the timetable, information about the course venue.
- Introducing the course.
- Explaining the working principles of the Nature Method.
- The number one issue: Motivation.
- Reading Greek as Greek: Athènaze I.
- Using orally, listening to, and writing Greek as a part of the language process.
- Doing English into Ancient Greek.
- Using Greek as an exercise of comprehension.
- Reading Plato, Herodotus, Thucydides, and Aristophanes in original language: Athènaze II.
- Recognizing and using elements of the Greek language to increase the knowledge of one’s own language.
- Working on projects.
- Reading authors not included in the two volumes of the method.
- Finalizing work on projects.
- Projects presentations.
- Course evaluation.
Lectures, exercises, discussion, teamwork, role-playing.
Teachers of Ancient Greek in secondary schools.
Pontifical Lateran University, Rome
President of Europa Latina cultural Association
Rate & review
Reviews only come from verified course participants via the European Commission's Mobility Tool+. If you participated in this course, use the Mobility Tool+ to submit a review. If the course is not listed in the Mobility Tool+ yet, please provide to your project coordinator the following course ID: 111475.
There are no reviews for this course. | <urn:uuid:ed9fadc1-c12d-4c02-b136-70eb4f51c946> | CC-MAIN-2022-33 | https://www.schooleducationgateway.eu/en/pub/teacher_academy/catalogue/detail.cfm?id=111475 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00679.warc.gz | en | 0.901332 | 669 | 3.390625 | 3 |
MATEC Web Conf.
Volume 252, 2019III International Conference of Computational Methods in Engineering Science (CMES’18)
|Number of page(s)||5|
|Section||Finite Element Method (FEM)|
|Published online||14 January 2019|
Numerical analysis of behaviour of compressed thin-walled Z-profiles weakened by holes
Faculty of Mechanical Engineering, Department of Machine Design and Mechatronics, Nadbystrzycka 36, 20-618 Lublin, Poland
* Corresponding author: email@example.com
This paper presents the results of numerical analysis conducted to investigate compressed thin-walled Z-profile weakened by holes with variable geometrical parameters. The specimens made of constructional steel were articulately supported on the edges of the cross-section in the upper and lower parts. The FEM analysis examined the nonlinear stability of these structures in the post-buckling state, where the mode of buckling was forced to ensure their stable behaviour. The numerical computations were performed within the geometrically nonlinear range until the yield point was reached. The investigation involved determining the effect of holes sizes on allowable operational loads. Numerical analysis was conducted with the Abaqus commercial FEM software package.
© The Authors, published by EDP Sciences, 2019
This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while. | <urn:uuid:f55baa8b-2b65-489b-954f-30ff0d64818f> | CC-MAIN-2022-33 | https://www.matec-conferences.org/articles/matecconf/abs/2019/01/matecconf_cmes2018_07010/matecconf_cmes2018_07010.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572833.78/warc/CC-MAIN-20220817001643-20220817031643-00275.warc.gz | en | 0.879076 | 468 | 1.734375 | 2 |
In one of her essays collected in Café Europa (1996), the Croatian author and journalist Slavenka Drakulic writes about the crimes her country committed as a fascist puppet state during the Second World War, and her generation's inability to learn from history. "Perhaps," she goes on, "this is the reason why we are now, with this recent war, sentenced to live in the past."
That recent war provides the backdrop to Sara Novic's powerful debut novel, Girl at War. The book's protagonist, Ana, is 10 when the Croatian War of Independence breaks out and 20 when she returns to her homeland after having embarked on a new life in America.
Too young to be condemned to “live in the past”, Ana is instead deeply scarred by it. Her story is an important and profoundly moving reading experience.
“The war in Zagreb began over a pack of cigarettes.”
From her arresting and somewhat cryptic opening line, Novic sets the scene and builds the tension. Ana is a tomboy who enjoys long summer days outdoors with best friend Luka in the Croatian capital. But Serb soldiers are advancing on the city, rumours abound about concentration camps, and Slobodan Miloševic is on TV looking like “a dejected bulldog” and ranting angrily about “cleansing the land”. When the presidential palace is bombed, Ana, her parents and ailing baby sister Rahela find themselves under siege.
Just when we think the novel will be a tale of one family fighting for survival, Novic changes direction, topples our expectations and then floors us. After a trip to Sarajevo to put Rahela on a flight to America for urgent medical care, Ana and her parents are halted by a roadblock and a gang of drunk, AK-47-toting Chetniks. Hauled out of the car and bound with barbed-wire cuffs, they are herded into a group of other prisoners and led in a procession into a dark forest towards the mouth of a large pit.
Girl at War is being marketed as the lead fiction title of 2015 for Random House US and Little, Brown UK. It is too early to debate whether it is the standout debut novel of the year but it will be interesting to see if another novelist, particularly a first-time novelist, can match Novic's bravura, gut-punching opening section.
Once we get our breath back we discover that in the next section Novic has fast-forwarded a decade. Ana is now a student in New York and reunited with Rahela. She tells the story of her ordeal during the Croat-Bosniak war to the UN; to her friends and to boyfriend Brian she lives in denial, claiming to be New Jersey- born and bred.
But over time that stage-managed deception, along with a genuine yearning to reconnect, becomes too great, forcing Ana to make a much-postponed return pilgrimage to Croatia to come to terms with her own personal tragedy and learn the fates of the loved ones she left behind.
Novic has lived in America and Croatia, and writes with authority about both. However, her Croatia sections are far and away the strongest in the book.
Her American interlude creaks with the usual Old World versus New World clichés, and is hampered further by attempts to convey Ana’s crippling trauma through overdone referencing of W G Sebald and desultory treatment of 9/11.
Swapping the land of opportunity for a decidedly straitened Croatia, Novic does two interesting things with Ana for the remainder of the novel: she has her tour post-war Croatia, culture shocked by her own culture and overcome by alternate waves of nostalgia and torment; and in an extended flashback that comprises the grittiest, grimiest section of the book, she shows Ana as a child-soldier battling to stay alive.
As we accompany Ana on her journey we travel through a range of emotions. There are the twitchy, nail-biting initial scenes of air raids, shelters and sniper fire, all of which serve as prologue to the terrifying round-up in the forest. There is poignancy in Ana’s unanswered letters to Luka, excitement as she is smuggled out of the country by UN peacekeepers, and horror at what she is made to endure and later live with.
“[D]o you think it makes sense to open old wounds?” Brian asks her. “Open them?” Ana replies.
“History did not get buried here,” Ana tells us at one point. “It was still being unearthed.”
Girl at War is a superb exploration of conflict and its aftermath, and a stark reminder that while ceasefires and peace treaties may end the fighting, they don't always end the suffering.
Malcolm Forbes is a freelance essayist and reviewer. | <urn:uuid:62b0624a-6fe0-45c1-93ac-0d74d88a4241> | CC-MAIN-2022-33 | https://www.thenationalnews.com/arts-culture/book-review-girl-at-war-1.113641 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573163.7/warc/CC-MAIN-20220818033705-20220818063705-00077.warc.gz | en | 0.959795 | 1,028 | 1.851563 | 2 |
Intrigued by Wednesday's announcement of Trappist-1, a star system only 39 light-years away that hosts at least seven Earth-like planets?
You might enjoy getting lost in a short science fiction story on it. Yep, one already exists.
"The Terminator," by Swiss science fiction novelist Laurence Suhner, takes place four centuries in the future on Trappist-1e, renamed Nuwa by colonists from Earth who still await peaceful contact with the natives of the Trappist-1 system.
The journal Nature quietly shared the story on Wednesday, the same day it published a much-cited paper on the newly discovered, potentially habitable planets in the intriguing Trappist-1 system. Astronomers call them our best bet to find life beyond the pull of our sun.
Here's a quick taste:
"I stand on the deck a moment, fascinated by the ocean that darkens before me as it disappears into the night. Myriad stars riddle the waves: bioluminescence. Nuwa's ocean abounds with life forms that constantly move between the two hemispheres, following the currents and the movement of the violent winds generated by the contrast in the temperatures near the surface. These winds, along with the moderating power of the ocean, guarantee the existence of habitable regions on either side of the terminator, cooling the exposed side of Nuwa and heating the dark one."
While it's a little unusual for a top scientific journal to publish a work of science fiction, Nature is no stranger to the practice. The journal has regularly published a science fiction column since 2007, and the Trappist-1 planets really beg for the sci-fi treatment. The seven planets tightly circling a dim, ultracool dwarf star are much closer to each other than the planets in our solar system, and at least three of them might be just as habitable as Earth.
"The Trappist-1 system, with its short interplanetary distances, makes space opera possible," writes Suhner, who read the research paper before penning her story. "Traveling from Nuwa to Pangu takes a week. A lilliputian system where worlds are like neighboring countries."
Suhner said collaborating with scientists is essential to her work.
"Integrating advanced research into my texts allows me to talk about science while keeping the sense of wonder and awe intact," she wrote in a Nature blog post about the short story. "This is one of the main advantages of science fiction."
Here's to more sci-fi set around Trappist-1, because while 39 light-years is close on the cosmic scale, it's still out of reach today. If we're ever going to get there, it's going take lots of ingenuity, imagination and inspiration. Science fiction seems like a good place to start cultivating all three.
Crowd Control: A crowdsourced science fiction novel written by CNET readers.
Solving for XX: The industry seeks to overcome outdated ideas about "women in tech." | <urn:uuid:54b4c1b6-dad9-483a-8dcc-58ed92c3b7d0> | CC-MAIN-2022-33 | https://www.cnet.com/culture/nature-science-fiction-trappist-1-nasa-planets-laurence-suhner/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570871.10/warc/CC-MAIN-20220808183040-20220808213040-00274.warc.gz | en | 0.950186 | 624 | 2.796875 | 3 |
I am an extensive believer in Rheumatoid Arthritis hott Treatment options. These types of choices aimed at addressing the underlying dysfunction within your body and not just alleviating the Symptoms. This in which real way to true as well as helping your disease. RA one amongst the most common autoimmune disease around the world affecting approximately 1% of the individuals. Women are three times more likely to suffer than men. It is sad that makes use of finding Rheumatoid Arthritis natural Treatment options very difficult.
Generally Rheumatoid Arthritis nature's Treatment choices aren't even unwrapped instead of medicines in relation to mainstream medicine. The reality that individuals are not really provided a substitute for medicines and medicine is already unfair. Frequently many people will undoubtedly be not aware that your own special Rheumatoid Arthritis natural Treatment is. This information will talk over some of the things situations put into action directly into your lifestyle to begin healing human body and restoring your yourself and. It may be thought about a two step system. Getting rid of poor food items plus exchanging them indefinitely food items.
The utilization of medications and drugs in the relief RA is absolutely missing the big picture. Drugs will be in dedicated to symptomatic therapy. And even though alleviating the Symptoms is to crucial it genuinely misses the wonderful picture. Symptomatic relief exist by covering up to your Symptoms with drugs, manual true main cause could very well be present in the entire body. Drug Treatments do nothing is to end the true actual trigger of autoimmune diseases. Rheumatoid Arthritis natural Treatment struggling to merely provide symptomatic reduction but also address the true underlying reason your complaint.
Eating modifications are among the several things that will offer Rheumatoid Arthritis natural Treatment. Losing certain known foods how your trigger inflammation and help over activity from immune system really are a excellent starting place. Should you dismiss the particular food items, it's possible that every day your body activating your immune system and making more signs and Symptoms with your. There's a selection of food items which can be recognized as contributors, however an excellent starting place could be losing wheat along with dairy food. I understand these are generally large food groups and also at to begin many people believe that needed to be impossible. The truth will it be will take some understanding to understand suggestions include the dietary marketing strategy change. Getting rid of meals is only one facet of Rheumatoid Arthritis laxative Treatment.
When we have taken out the harmful meals from the diet, we can easily exchange these for wholesome past beneficial foods. In exactly the same way you can find certain foods that increase inflammation, you can find food products that capacity lower inflammation. Cold water fish is shown to lower inflammation. Additionally, you'll find plenty handy food supplements which will help with inflammation and given that promoting joint health. Even though eating habits does play a vital role in Rheumatoid Arthritis inbreed Treatment, additionally, there are other factors that will gain too. Psychological and mental stress is yet another part of health that will impact our well being. An all-natural method the idea addresses both these factors is a reasonable Rheumatoid Arthritis natural Treatment.. | <urn:uuid:8c09f949-a41b-40e8-be3c-11a7328a2d97> | CC-MAIN-2017-04 | http://arthritismi.blogspot.com/2013/05/rheumatoid-arthritis-well-balanced.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281419.3/warc/CC-MAIN-20170116095121-00494-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.943033 | 647 | 1.515625 | 2 |
San Antonio Virtual Reality Nonprofit Brings Relaxation And Wellness To Its Users
A San Antonio nonprofit organization named Studio Bahia wants to make virtual reality therapy accessible to local residents, with plans to expand through Texas and the nation. Originally founded as a response to help Syrian and European refugees — specifically children with trauma — Studio Bahia wanted to identify how to reach them with language and culture barriers in the way.
"The reason we decided to do this (VR therapies) is because other language-based approaches had failed. Approaches such as a psychologist coming and talking to a refugee. A refugee does not have the tradition of opening up to a stranger," said Allen Olson-Urtecho, one of the founders.
They noticed how easy it was to access VR through mobile devices the parents carry. Studio Bahia has taken the lead in designing therapeutic landscapes available on mobile devices. This made VR accessible for the refugees and now the company wants to make it available to anyone who has a smart phone.
This nonprofit operates out of San Antonio, and includes collaborations across Texas and worldwide. The team of five is made up of virtual reality designers Christina Chrysanthopoulou and Renia Papathanasiou, clinical psychologist Dr. Cindy Dominique, Ivy Georgieva and Allen Olson-Urtecho, with PhDs. in VR therapies.
Olson-Urtecho first touched on the idea when he saw how language and culture barriers could be a challenge. To work around this, the team designed sets and narratives in the storyboard and takes the time to produce and document designs that are non culture specific and offer relaxation and healing.
"We had to innovate and try something totally different. So all our therapies don't have language. And it works really well because virtual reality is so powerful, it's such a powerful tool," Olson-Urtecho said.
The organization provides virtual reality therapy for an embodied learning experience and contributes to a person's wellness through distraction therapy, prenatal and postpartum instruction, and even CPR practice.
Studio Bahia offers a multitude of landscapes; Purple VR — used to reduce anxiety, Aqua VR — a therapy for people with Alzheimer's Disease, Pink VR — a therapy for chronic pain.
The company's VR designs also include distraction therapy, a scenic walkthrough that aims to relieve pain during difficult experiences such as medical procedures.
In November 2020, Studio Bahia won the"10 Most Promising Companies" award at the Texas Life Science Forum, for their innovative, low cost model and outreach to large vulnerable populations.
Now, the company is producing what it calls user-friendly, accessible, and affordable headsets for phones to attach to, and downloadable VR wellness walkthroughs for mobile devices. For every VR headset sold to a hospital, Studio Bahia donates to nurse's unions, veterans, and other vulnerable populations in Texas.
"Creating an atmosphere and a feeling, we're able to offer certain situations that bring about psychological benefits to people," added Olson-Urtecho.
When asked what VR wellness will look like in ten years, Olson-Urtecho speaks of a more personalized experience for every person, one embodying more senses and adding to the healing journey, training, or just relaxation — available to any person.
TPR was founded by and is supported by our community. If you value our commitment to the highest standards of responsible journalism and are able to do so, please consider making your gift of support today. | <urn:uuid:425e595f-9d42-4f2e-96d7-4e57c273336a> | CC-MAIN-2022-33 | https://www.tpr.org/technology-entrepreneurship/2021-08-10/san-antonio-virtual-reality-nonprofit-brings-relaxation-and-wellness-to-its-users | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573667.83/warc/CC-MAIN-20220819100644-20220819130644-00070.warc.gz | en | 0.947172 | 710 | 1.828125 | 2 |
Wireless sensor networks and, particularly wireless body area networks (WBANs) are the key building blocks of upcoming generation networks. Modern health care system is one of the most popular WBAN application and a hot area of research in subject to present work.In recent years, research has focused on channel modeling, energy conservation and design of efficient medium access control (MAC) schemes. Less attention has been paid to the path-loss performance analysis. In this work, we propose LAEEBA (Link-aware and Energy Efficient scheme for Body Area Networks) which is a reliable, path-loss efficient and high throughput routing protocol for WBANs. The characteristics of single-hop and multi-hop communication schemes have been utilized to reduce path-loss effects and increase network lifetime. A cost function is proposed to select the forwarder node on the basis of has high residual energy and minimum distance to sink. Residual energy parameter balances the energy consumption among the sensor nodes while distance parameter ensures successful packet delivery to sink. Simulation results show that LAEEBA protocol maximizes the network stability period and nodes stay alive for longer time; which contributes to sufficient decrease in the path-losses occurring in the links connecting sensors on a human body and hence transferring of data with much less losses.Results show better performance of our proposed protocol as compared to its given variants. | <urn:uuid:be0e7c98-af88-4194-91a1-bdb822b9f191> | CC-MAIN-2022-33 | https://www.researchgate.net/publication/260287632_LAEEBA_Link_aware_and_energy_efficient_scheme_for_body_area_networks | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00669.warc.gz | en | 0.916835 | 273 | 1.960938 | 2 |
Gongol.com Archives: September 2014
PBR is being sold to the Russians
Pabst, once an iconic Milwaukee beer, hasn't even been headquartered there since 2010. It's now being sold to Oasis Beverages, out of Russia, in partnership with an investment company. A few observations: First, brands and brand perceptions are always going to matter when it comes to things like food and drink, since people care most about the things they put inside their bodies. Second, hearkening back to the sale of Anheuser-Busch to the Brazilians and Belgians back in 2008, if people don't want to lose control of companies, they have choices available to them -- like buying and retaining control. Choose not to do that? Fine. But control comes via ownership. Third, as long as debt remains cheap and the United States remains the world's most stable free market, we shouldn't be surprised in the least to find that foreign owners take a liking to American assets. They're highly attractive because America is highly attractive. The more uncertain the rest of the world appears, the more certain investments in America will look.
Mother of Omaha jewelry-store killer says he was "hanging out with the wrong crowd"
Anything that makes it harder for young people -- especially young men -- to find something productive to do makes it easier for them to fall in with the "wrong crowd." Consider that when people tell you that a $15 minimum wage is some grand solution to all of the world's problems. Everyone remains individually responsible for their own behavior -- but we as a society shouldn't be blind to the conditions we ourselves create and the unintended consequences thereof. Youth unemployment is a deeply serious problem, and we shouldn't knowingly make it worse. And if it becomes a chronic condition, then we may end up paying the costs for decades.
The Tampa Bay Times is on borrowed time
Reports have it that the paper is a matter of weeks from a possible financial collapse.
Scotland votes to stay in the UK
But the BBC might've overstated things in saying the 55% to 45% vote was a "decisive rejection" -- that's only a 5-point swing
An appalling number of Americans don't know how the government works
A third don't even know the name of a single branch of government | <urn:uuid:5ff23810-e5eb-4be4-a3bc-b55645d057b4> | CC-MAIN-2022-33 | http://www.gongol.com/fft/2014/09/19/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572043.2/warc/CC-MAIN-20220814143522-20220814173522-00478.warc.gz | en | 0.969746 | 474 | 1.539063 | 2 |
Pay to write business content
It works like this: You write your list (10 items per list minimum), you send it in,. You can …. The mills (i.e., pay to write business content the companies) are often in short top annotated bibliography ghostwriters sites usa supply of writers because they pay below the going rate. help writing philosophy argumentative essay You can find the writing guidelines there, too Oct 04, 2017 · Providing business, product, or service information to pay to write business content a client. many of which pay as well. We’ve selected some quality, high-paying magazines for you. We do it because we are motivated, and every writer in our team envisions how a perfect custom writing service should look like This can vary depending on the marketplace. Basic Business Plan Guidelines Writing a Business Plan will probably take a lot of time. You can write department columns of 500-700 words, or feature articles of 1000-2500 words. The type of activity doesn’t always have to be the same — it should be appropriate to the type of writing project and the personal preferences of the writer Aug 18, 2016 · Trade magazines typically pay less than consumer magazines — think 10 – 50 cents per word, though many pay higher — but on decapitation thesis new france the “pro” side, they’re easier to write for than the big guys, they tend to pay quickly, and they become loyal clients that will come back to you again and again An effective credit policy should align your corporate goals with business procedures and help your company reduce bad debt and write-offs. Jul 11, 2014 · Divide your hourly rate by the number of pages you complete per hour.
You can write a business plan yourself to save money and sap sd fresher resume model write a business plan for just what your time is worth. Find the names of editors, study back copies, read the guidelines and then pitch Jan 10, 2020 · Again, business proposals are reflective of your company. If yes, this list of 30 websites and blogs that pay writers is exactly what you need. All articles are “rented,” so you still own the content. It can also hurt a writer's reputation with legitimate media companies to have their pay to write business content name associated. So here is the deal: We will pay you $100 for your efforts. Freelance writing is the ultimate side hustle. The Project Definition. custom university phd essay samples Decide what type of business plan your company needs in order to help determine the cost of the plan. The minimum word count is 500. Early American Life. Use the proper greeting with a client, depending on your existing relationship Write My Paper for Me - We Care About the Quality We promote ourselves as a college paper writing service that has earned its global popularity by providing superior quality articles, reviews, and papers. You can pay to write business content find the writing guidelines there, too Sep 06, 2019 · Many content writers starting out in their careers are not sure how much they should be paid per word. Yes, Ms.
Mar 20, 2019 · How to ask for a raise in writing. But it also allows you to write reviews of various products and make money from it. You don’t need to be an expert—you just need to have English equal to that of a native speaker, a sense of humor, and a love for things unusual or interesting. High quality, cheap, fast and 'on-topic' articles. This profession was my golden ticket to bigger and better opportunities Writing a business contract that protects your interests while balancing your business objectives is critical to your business' success. The idea is simple. Get familiar with the content by checking out the company’s Facebook page. They accept articles about coding, design, content strategy, user experience and basically internet industry/business. Hire quality writers to write articles and other content for your website. 1. We specialize in professional business plans written by accomplished MBA writers, and our mission is to provide these customized business plans at …. Writing for a magazine can net you anywhere for $0.10-$2 per word. Responding to client questions pay to write business content and queries. Submit a pitch by e-mail and the editors will work with you on your article. They pay between $50 and $200, depending on the nature of the writing.
The business niche is thriving. Pippin is selling something (and she’s very aggressively building an email list) but that doesn’t mean you can’t get paid for writing Aug 23, 2019 · The first is revenue-sharing, where the website pays you a certain amount for every view or ad click from your post. The Finance Section. While there are probably tens of thousands of magazines that pay writers, a much smaller number compensate writers really well. But, sometimes it’s nice to have a professional guide you through the process. How to Write a Newsletter in 4 Simple Steps. We also share some email best practices and provide an effective reminder email sample you can work from Jan 17, 2020 · When you own a business, you will likely need to write letters to your customers. One high-paying writing niche that’s a little tougher to break into is magazine writing. The trick is finding someone to pay it who believes it is a fair price. Send emails of your portfolio or samples to firstname.lastname@example.org (Subject: Freelance Writer). I am a content writer myself and few points mentioned here are sure to be helpful in my future work 8 Essential Steps to Writing a Business Letter in English. For example, if you borrow money and use 70% of it for business and the pay to write business content other 30% for a family vacation, you can deduct 70% of the interest as a business expense. Fiverr connects businesses with freelancers offering digital services in 250+ categories Extensive research has shown that writing projects of any kind tend to be successful when writers use the process approach and engage in some type of activity from all these three phases. The membership fee enables us to find, recruit, vet, train and manage the best freelance writers in the world. Providing confirmations and follow ups. Jul 26, 2019 · Freelance Writing Jobs for Beginners If this list is helpful, you’ll get even more out of The Write Life’s ebook: 71 Ways to Earn as a Freelance Writer . Mar 12, 2018 · They pay $200.00 each for poems. In other words, you get paid when you contribute content to the following websites and blogs People per hour is another great site for freelance writers to find writing jobs online. Decide what type of letter you need to write. Payment by page is more often used in long projects, such as books or manuals, or editing What happens to your business when that single content mill you write for goes belly up, as so many do? Business plan consulting: We’re here to give you the tools to write your business plan on your own. Content Runner– Similar to Constant Content where you can write about whatever you want, set your own rates, and pay them a percentage of your sales. Refer to chapter 4 …. | <urn:uuid:159653f5-544a-435a-a3ae-8a50d87413ef> | CC-MAIN-2022-33 | http://www.helloartdept.com/2020/02/13/pay-to-write-business-content | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571911.5/warc/CC-MAIN-20220813081639-20220813111639-00466.warc.gz | en | 0.941665 | 1,484 | 1.554688 | 2 |
Coudenberg (Former Palace of Brussels)
Built in the 12th century, the Coudenberg developed into one of Europe’s most important royal palaces, eventually becoming the main residence of Holy Roman Emperor Charles V in the 16th century. Soon after its destruction by fire in 1731, the palace was razed to make room for a new city layout, and, later, the current Royal Palace.
Visitors can explore the Coudenberg on self-guided tours independently or aided by audio guide or free mobile app. Along the way, roam subterranean rooms that served as kitchens and cellars; walk along the former Rue Isabelle; and see recovered artifacts at a small museum. The Coudenberg is also a stop-off on some Brussel tours—including select bike excursions and private tours that look beyond the city’s most obvious tourist sights. The Brussels Card grants access to the ruins.
Things to know before you go
- The Coudenberg is great for history and archaeology fans.
- The site is partially wheelchair-accessible, and the museum almost fully accessible.
- Entry is via the BELvue Museum on Brussels’ Place de Palais.
- The Coudenberg offers restrooms, while the BELvue has a café-restaurant and gift shop.
How to get there
The Coudenberg is situated on the Place de Palais and best reached by public transit. Visitors can take trains to Brussels Central Station and make the short walk from there; catch a #92 or #93 tram to the Palais or Royale (Koning) stops; or take a #27, #38, #71, or #95 bus to the Royale. Both stops are a 5-minute stroll from the BELvue entrance.
When to get there
The Coudenberg is open daily, excluding Mondays and key public holidays. As one of Brussels’ lower-profile sights, it’s rarely busy, so there are no good or bad times to visit. Allow about 90 minutes to explore and a little more time to visit the BELvue shop and café-restaurant.
The Coudenberg for Kids
If you’re visiting the Coudenberg with kids, consider booking one of the in-house treasure hunt tours to bring the palace and its story to life. Aimed at 5- to 8-year-olds, the tour tasks them with locating Charles V’s hidden treasure chest using a map, torch, and clues—and rewards them with a gift when they find it.
- Things to do in Zaventem
- Things to do in Bruges
- Things to do in Lille
- Things to do in Dordrecht
- Things to do in Rotterdam
- Things to do in Amsterdam
- Things to do in Luxembourg City
- Things to do in Marne-la-Vallée
- Things to do in Paris
- Things to do in Leeuwarden
- Things to do in Stansted Mountfitchet
- Things to do in Horley
- Things to do in Flanders
- Things to do in South Holland
- Things to do in Nord-Pas de Calais
- BELvue Museum
- Magritte Museum (Musée Magritte)
- Musical Instruments Museum
- Brussels Royal Palace (Palais Royal de Bruxelles)
- Museum of the Turn of the Century (Musée Fin-de-Siècle)
- Sablon District
- Royal Museums of Fine Arts of Belgium
- Grand Sablon Square (Place du Grand Sablon)
- MOOF Museum
- St. Michael and St. Gudula Cathedral
- Hard Rock Cafe Brussels
- Royal Galleries of Saint Hubert (Les Galeries St-Hubert)
- Grand-Place (Grote Markt)
- Brussels City Museum (Musée de la Ville de Bruxelles)
- Brussels Town Hall (Hotel de Ville) | <urn:uuid:e6bb46a7-fb59-4550-b890-0bb34997ed15> | CC-MAIN-2022-33 | https://18196.partner.viator.com/Brussels-attractions/Coudenberg-Former-Palace-of-Brussels/overview/d458-a12664 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570921.9/warc/CC-MAIN-20220809094531-20220809124531-00271.warc.gz | en | 0.863706 | 848 | 2.140625 | 2 |
Video: Competing currency being accepted in Michigan
from connect mid-michigan: New types of money are popping up across Mid-Michigan and supporters say, it's not counterfeit, but rather a competing currency. Right now, you can buy a meal or visit a chiropractor without using actual U.S. legal tender. They sound like real money and look like real money. But you can't take them to the bank because they're not made at a government mint. They're made at private mints. "I sell three or four every single day and then I get one or two back a week," said Dave Gillie, owner of Gillies Coney Island Restaurant in Genesee Township. Gillie also accepts silver, gold, copper and other precious metals to pay for food. He says, if he wanted to, he could accept marbles. "Do people have to accept dollars or money? No, they don't," Gillie said. "They can accept anything they want or they can refuse to accept anything." He's absolutely right. The U.S. Treasury Department says the Coinage Act of 1965 says "private businesses are free to develop their own policies on whether or not to accept cash, unless there is a state law which says otherwise."
Markets dive as Bernanke speaks
from of goats and men: This is the S&P chart. The red dive down occurs during Bernanke's testimony today. (the chart is from the UK so times are different) Go here for live viewing of Bernanke as he talks about depression, bad outcomes, etc...
Obama signs 'sweeping financial overhaul' into law
from ap: Reveling over a new milestone in his presidency, a triumphant Barack Obama on Wednesday signed into law the most sweeping overhaul of lending and high-finance rules since the Great Depression, adding safeguards for millions of consumers and aiming to restrain Wall Street excesses that could set off a new recession... The new rules, however, are only at a midpoint. Banking and market regulators will have up to two years to write many of the new regulations required by the law, extending uncertainty and ushering in a new phase of lobbying by financial firms. "Regulators will have to be vigilant," Obama said. The president sought to quell public anger over the $700 billion bank rescue fund the government created at the height of the crisis to reassure the markets. While the infusion is credited with providing stability, the public recoiled at the idea of taxpayer money being used to help prop up huge banks. The law gives regulators new authority to liquidate large, interconnected financial firms that are failing. "Because of this law, the American people will never be asked again to foot the bill for Wall Street's mistakes," Obama said. "There will be no more tax-funded bailouts, period."
The scariest unemployment graph I've seen yet
US financial bailout figure hits $3.7t*
Prominent hedge fund manager's Idaho ranch:
"It would be a place you could hole up in"*
'Darth Vader' robs NY bank* | <urn:uuid:da249e63-9b57-4f74-8a97-97b3ed4595a0> | CC-MAIN-2022-33 | https://mediamonarchy.com/econocrash-updates-competing-currencies-scary-graphs/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00074.warc.gz | en | 0.965977 | 636 | 1.609375 | 2 |
Definitions of college
n. - A collection, body, or society of persons engaged in common pursuits, or having common duties and interests, and sometimes, by charter, peculiar rights and privileges; as, a college of heralds; a college of electors; a college of bishops. 2
n. - A society of scholars or friends of learning, incorporated for study or instruction, esp. in the higher branches of knowledge; as, the colleges of Oxford and Cambridge Universities, and many American colleges. 2
n. - A building, or number of buildings, used by a college. 2
n. - Fig.: A community. 2
The word "college" uses 7 letters: C E E G L L O.
No direct anagrams for college found in this word list.
List shorter words within college, sorted by length
All words formed from college by changing one letter
Browse words starting with college by next letter | <urn:uuid:2614295b-c887-42c9-9dd6-82b1654fad55> | CC-MAIN-2017-04 | http://www.morewords.com/word/college/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00475-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.927118 | 193 | 1.945313 | 2 |
Last updated: May 2018
What are cookies?
Cookies are small data files that are placed on your computer or mobile device when you visit a website. Cookies are widely used by website owners in order to make their websites work, or to work more efficiently, as well as to provide reporting information.
Cookies set by the website owner, in this case TAINA, are called "first party cookies". Cookies set by parties other than the website owner are called "third party cookies". Third party cookies enable third party features or functionality to be provided on or through the website (e.g. like interactive content and analytics). The parties that set these third party cookies can recognise your computer both when it visits the website in question and also when it visits certain other websites.
What cookies do you use and why do you use them?
We use both first party and third party cookies on our website.
The type of cookies used on our website can be put into one of the following four cookie categories: Strictly Necessary, Performance, Functionality and Analytics.
Strictly Necessary cookies - These cookies are essential in order to enable you to navigate our website and to use some of its features. These cookies don’t gather information about you for profiling or targeted marketing purposes.
Performance cookies - These cookies collect anonymous information about how visitors use our website, for instance which pages visitors go to most often, and if they get error messages. These cookies don’t collect personally identifiable information; the information collected is anonymous and is only used to improve the performance of our website but are non-essential to its use.
Functionality Cookies – These cookies allow our websites to provide services such as watching a video or commenting on a blog. The information these cookies collect is anonymous and cannot be used to track your browsing activity on other websites.
Analytics and customisation cookies - These cookies collect information that is used either in aggregate form to help us understand how our websites are being used or to help us customise our website for you.
What about other tracking technologies, like web beacons, Flash cookies or Local Shared Objects?
We do not currently use other technologies, like web beacons (sometimes called "tracking pixels" or "clear gifs") or "Flash Cookies" (also known as Local Shared Objects or "LSOs") to recognise, collect or store information about your use of our website.
Do you serve targeted advertising?
Third parties may serve cookies on your computer or mobile device to serve advertising through our website. These companies may use information about your visits to this and other websites in order to provide relevant advertisements about goods and services that you may be interested in. They may also employ technology that is used to measure the effectiveness of advertisements. This can be accomplished by them using cookies or web beacons to collect information about your visits to this and other sites in order to provide relevant advertisements about goods and services of potential interest to you. The information collected through this process does not enable us or them to identify your name, contact details or other personally identifying details unless you choose to provide these.
How can I control cookies?
You have the right to decide whether to accept or reject cookies.
In addition, most advertising networks offer you a way to opt out of targeted advertising. If you would like to find out more information, please visit http://www.aboutads.info/choices/ or http://www.youronlinechoices.com.
How often will you update this Cookie Notice?
The date at the top of this Cookie Notice indicates when it was last updated.
Where can I get further information?
- For more generic information please visit the below listed websites:
- Information about cookies - All About Cookies
- Internet Advertising Bureau - Guide to online advertising and privacy
- International Chamber of Commerce United Kingdom - ICC UK cookie guide | <urn:uuid:1f2109d1-1780-4f1f-b2ba-383abf3afbd9> | CC-MAIN-2022-33 | https://www.taina.tech/cookie-notice | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571234.82/warc/CC-MAIN-20220811042804-20220811072804-00078.warc.gz | en | 0.916879 | 1,130 | 2.046875 | 2 |
They’re made with graphite (a form of carbon), and they have been for at least 200 years or so. So, you don’t need to worry about your dog suffering from lead poisoning after he eats a pencil.
What will happen if a dog eats a pencil?
The made health risk if your dog eats pencil comes from the wood around the graphite or charcoal. … The major problem with wood is that it can splinter off into pieces, and these sharp bits can cause damage to your dog’s digestive tract, intestines, and stomach. Internal bleeding is a potential risk.
Can eating a pencil kill a dog?
Are pencils toxic to dogs? Take a breath and find some peace in this: pencils are not toxic to dogs. While pencils used a hundred years ago may have been dangerous if they were eaten, thanks to lead and chemical use in paint, today’s pencils are very much evolved into harmless versions!
Are colored pencils toxic if eaten?
These pigments are chemicals that are generally considered non-toxic in pencil amounts. Colored pencils might stain the mouth or skin, but that is harmless and will wear off by itself.
Should I be worried if my dog ate a stick?
First of all, it is dangerous because some sticks are poisonous if eaten in large amounts, such as oak, chestnut, apple, locust, and buckeye. Second, eating sticks of any kind can cause choking, blockage in the intestine, or the sharp edges can actually perforate the mouth, esophagus, or digestive tract.
What are the symptoms of a blockage in a dog?
Symptoms of a Bowel Obstruction
- Vomiting, especially when repetitive.
- Loss of appetite.
- Dehydration due to inability to hold any water down.
- Abdominal pain.
- Hunching or whining.
Is pencil lead toxic?
“Lead” pencils don’t contain lead and aren’t dangerous. Lead poisoning occurs when children or adults get lead into their body. Lead gets into the body by eating it or breathing it. According to the EPA, lead poisoning was once a major environmental health hazard.
Is graphite non toxic?
Graphite and other components of a pencil are minimally toxic when swallowed or drawn onto the skin.
Can crayons kill a dog?
Probably not! Commercially-available crayons, including those made by Crayola, are non-toxic. … Crayons are made of paraffin wax and pigment. These ingredients should not upset your dog’s digestive system, though a large amount may cause intestinal discomfort and loose stool.
How much graphite is lethal?
For graphite, the 4-hr lethal concentration for 50% of the test animals (LC50) was found to be 428/µg/mL higher than the LC50 for titanium dioxide, carbon, aluminum, or slate aluminum (from 115 to 285/µg/mL).
Why does my child eat pencils?
If you have a child who is constantly sucking on their shirts or clothing, chews on their pencils at school, enjoys extreme flavors of foods, or is constantly chewing on their toys, it could be a sign that their sensory receptors are in need of that tactile sensation in their mouth and are using it as a defense …
Why does my 2 year old eat crayons?
Teething. Depending on how young your child is, they might just want to bite down on something to relieve the uncomfortable sensation in their gums. Be observant and see if they aren’t just reaching for the crayon. Kids often chew or eat colored pencils, erasers and markers.
Can a dog poop out a Popsicle stick?
Dogs do eat wood, and often pass it without problem. You will need to monitor his feces and his behavior. The stick should pass within 24-48 hours. If he starts vomiting, having diarrhea, stops eating, or becomes very lethargic, then it is likely that the stick is stuck, and he will need to see a vet right away.
Why do dogs eat bark?
Tree bark is tasty.
The first reason your dog likes to chew sticks is because he simply likes the way it tastes and feels in his mouth. Tree bark contains cellulose, which is a type of fiber. Some dog food manufacturers even add cellulose to their products, as fiber facilitates good digestion and colon health.
Why do dogs lick you?
Affection: There’s a pretty good chance that your dog is licking you because it loves you. It’s why many people call them “kisses.” Dogs show affection by licking people and sometimes even other dogs. Licking is a natural action for dogs. … Dogs might lick your face if they can get to it. | <urn:uuid:eb1cbd2f-489f-47d9-9e19-86441214fc88> | CC-MAIN-2022-33 | https://midogguide.com/diseases/can-dogs-die-from-eating-a-pencil.html | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571056.58/warc/CC-MAIN-20220809155137-20220809185137-00674.warc.gz | en | 0.955791 | 1,048 | 2.421875 | 2 |
Regional Extension Centers (RECs) Health Information Technology
The HHS Office for the National Coordinator for Health Information Technology announced that more than 100,000 primary care providers are adopting certified Electronic Health Records (EHRs) to help improve their quality of care and ultimately lower health care costs. RECs serve the majority of primary care providers in small practices in rural areas. These figures include over half of the targeted 1,776 critical access and rural hospitals in 41 states and throughout Indian Country. A complete listing of REC grant recipients and additional information about Regional Extension Centers may be found at http://www.HealthIT.hhs.gov/REC/.
COREC is using SpectraMD’s Interactive Content Delivery and Analytics Platform to streamline the tracking for 1,000 priority primary care providers to achieve meaningful use of their EHRs, at the Telligen Health Information Technology Regional Extension Center, based in Iowa.
There has been a lot of activity in Florida recently. Here are the links to the RECs servicing Florida health centers – Florida providers, clinics, and hospitals.
- Florida – Rural and North Florida Regional Extension Center
- Florida – South Florida Regional Extension Center Collaborative
- Florida – University of Central Florida, Orlando
- Florida – University of South Florida, Tampa
The Washington & Idaho Regional Extension Center (WIREC), a division of Qualis Health, announced that it has met its enrollment goal of 2,369 healthcare providers in Washington and Idaho as part of the national effort to accelerate the adoption of electronic health records (EHRs). Practitioners across both states sought WIREC out for assistance with EHR implementation and utilization in order to attain “meaningful use” of their systems.
A valuable report and useful tool for regional extension centers is NEHC’s Secrets of HIE Success Revealed: Lessons from the Leaders, a report commissioned by NeHC in order to provide in-depth studies of successful and mature HIEs in diverse geographies and market types. The report captures the key dimensions of success for HIE leadership and sustainability, contributes to the development of a national roadmap for health information exchange, and provides insight and guidance for emerging HIEs. One of the organizations highlighted includes HealthBridge. They offer a wide variety of technology services, including a regional extension center (REC), quality improvement services such as a disease registry and workflow redesign, and health information exchange services. The HIE services include EHR integration, results delivery, order entry, e-prescribing, summary record exchange, public health reporting, syndromic surveillance and electronic claims check and eligibility verification. They recently announced that The Tri-State Regional Extension Center (REC) met its enrollment goal of 1,739 primary care providers in Ohio, Indiana and Kentucky.
See the PHIN Messaging Guide for Syndromic Surveillance: Emergency Department and Urgent Care Data has been approved and released. FAQs have been documented to assist you as well as the Comment Disposition worksheet . | <urn:uuid:5b1eab46-a76e-4bad-9da5-d994043dbc3d> | CC-MAIN-2017-04 | http://www.regionalextensioncenters.com/2011/11/23/regional-extension-centers-health-information-technology/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279189.36/warc/CC-MAIN-20170116095119-00056-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.926416 | 611 | 1.789063 | 2 |
Doctors in Victoria, Australia, Urged to Undergo Regular HIV and Hepatitis Testing
Doctors in Victoria, Australia, will soon be asked to undergo regular HIV and hepatitis testing to "further protect the community" from infection, the Australian Broadcasting Corporation reports. The testing is one of the recommendations to be included in the Medical Practitioners Board of Victoria's revised guidelines for reducing the risk of doctor-to-patient transmission of HIV or hepatitis (Australian Broadcasting Corporation, 7/18). The Herald-Sun reports that up to 10 doctors in Victoria are infected with HIV, hepatitis B or hepatitis C, and that as many as seven dentists infected with hepatitis work in public hospitals or clinics. But privacy laws state that doctors and dentists do not have to inform patients of their infection status, and equal opportunity laws bar discrimination against infected providers in the workplace, the Herald-Sun reports. MPBV President Joanna Flynn said that several providers have modified their practices in light of their infection status, adding that patients face "no significant risk" of infection if the doctors are "careful." Flynn said the decision to ask all doctors to undergo HIV and hepatitis testing stems from concerns that some doctors may be infected with the diseases and not know it (Dunn, Herald-Sun, 7/18).This is part of the KHN Morning Briefing, a summary of health policy coverage from major news organizations. Sign up for an email subscription. | <urn:uuid:883b8286-e8d1-4c24-b4a2-e93d4b404aac> | CC-MAIN-2022-33 | https://khn.org/morning-breakout/dr00012405/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00666.warc.gz | en | 0.939889 | 291 | 2.140625 | 2 |
My writing space at home has two pieces of Oriental carpet –sections of the rug Grandmother Edna Kearns had in her home over 100 years ago. The carpet feels sturdy under my feet. Though these remnants are now frayed and attract dog hair, I’d never expected this floor covering to have lasted so long. But it has, just like the suffrage stories Grandmother Edna passed down to me through my mother and of course, Edna’s own articles, stories and writings.
I can identify only a few things as having been touched by my grandmother. There’s the carpet, Edna’s tea tray, her silverware and letters, and suffrage archive. I walk on Edna’s carpet daily. Often I’m down on my knees tucking under frayed edges. When others mention how important it is to walk in other people’s shoes, I stand on Grandmother Edna’s carpet, listening to voices now faint (but growing louder) in this fast-moving world.
Suffrage stories are exciting. And they’re threatening. They’re a reminder of a time of grassroots organizing –people united in their determination to make change. We live in a time again of women rising, and at the same time, we are witnessing the last hurrah of a social system losing ground that no amount of legislation and other obstacles placed by backlash movements can change.
Grandmother Edna Kearns’ life has transformed me. The suffrage stories that have come down from her generation suggest the many ways in which it must have been a heady experience to have been involved in the suffrage movement. It represented a rush of sensation in a dead environment where education, marriage, political and personal power were limited, or for many, non existent. Women made many compromises, but the cat was out of the bag. Equality was on the horizon, and there was no turning back.
Women understood the value of working together, building constituencies, power and control through a nonviolent social revolution. As I walk on the carpet each day, I remember the legacy of our grandmothers and great grandmothers, as the power of their suffrage stories grow larger in spirit. The carpet’s surface is worn and beautiful in its strong threads.
Stay up to date with Marguerite’s Musings, plus news/views/stories of the suffrage movement at the suffrage “go to place,” Suffrage Wagon News Channel. | <urn:uuid:2c020bea-ee12-4467-8341-5984c0160222> | CC-MAIN-2022-33 | https://www.suffragewagon.org/i-walk-on-my-suffragist-grandmothers-carpet-marguerites-musings/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572215.27/warc/CC-MAIN-20220815235954-20220816025954-00672.warc.gz | en | 0.957435 | 521 | 2.203125 | 2 |
Dialogue partner | World Communion of Reformed Churches
In 1968, an ad hoc Lutheran-Reformed Evaluating Committee stated that Lutheran-Reformed dialogue should be encouraged and coordinated by LWF and the World Alliance of Reformed Churches (WARC).
This opinion was endorsed in 1970 by the Lutheran-Reformed Joint Committee that underscored the existence of a “special theological relationship between the Lutherans and the Reformed.”
The first round of international dialogue in 1988 suggested that all Lutheran and Reformed churches around the world should enter into church fellowship with one another. While this recommendation has not been received globally, many Reformed and Lutheran churches have declared themselves to be in full communion, e.g. the churches that have signed either the Leuenberg Agreement or the Formula of Agreement.
In 2010 WARC joined with the Reformed Ecumenical Council to form World Communion of Reformed Churches (WCRC).
Understanding of the church
International Dialogue Milestones
1989 | Toward Church Fellowship (Lutheran-Reformed Joint Commission)
2002 | Common statement Called to Communion and Common Witness (Lutheran-Reformed Joint Working Group)
2010 | Common statement Communion: On being the Church, Svätý Jur, Slovakia | <urn:uuid:db199d45-dd75-45f7-baf5-7c7c988eb74c> | CC-MAIN-2017-04 | https://www.lutheranworld.org/content/lutheran-reformed-dialogue | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280891.90/warc/CC-MAIN-20170116095120-00156-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.916402 | 261 | 1.875 | 2 |
Brilliant Microsoft Windows Vista for the Over 50s Paperback
by Joli Ballew
Brilliant Windows Vista for the over 50s is a visual, quick reference book that shows you how master all of the features of the new MS Vista OS. Specifically written for those who did not have significant contact with computers in their working lives, but who now have the time to explore the possibilities of the new technology.
Fully updated throughout to cover MS Vista SP1 it provides an easy-to-use guide to anyone wanting to get the most out of their computer. Summary Whether you have used an earlier variant of Windows on a computer before in, or have bought your first PC or laptop which uses Windows Vista as its operating system, gaining a good, solid grounding on how to use Windows Vista to your best advantage and discovering how to navigate around its various features to set up and use your computer exactly to your specification will make your life easier and more productive!
Brilliant windows Visat for the Over 50s has been written specifically for the older user who has not grown up with the Windows OS and covers everything that you will need to know to get up and running on your Visat PC in no time !Iit will give you a good grounding in the essentials, enabling you to tackle new activities with confidence. And it will do this through clear step-by-step guides, with expert tips and trouble-shooters to help you through the trickier parts.
Fully updated and rewritten for the release of MS Vista SP1 it covers all of the new features available to the user to enhance your use and experience of your PC.
- Format: Paperback
- Pages: 496 pages, col. Illustrations
- Publisher: Pearson Education Limited
- Publication Date: 18/12/2008
- Category: Windows Vista
- ISBN: 9780273720560 | <urn:uuid:a9fc74b1-8e10-4e70-a8a2-1b319f364932> | CC-MAIN-2017-04 | http://www.hive.co.uk/Product/Joli-Ballew/Brilliant-Microsoft-Windows-Vista-for-the-Over-50s/663110 | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280483.83/warc/CC-MAIN-20170116095120-00296-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.921104 | 386 | 1.742188 | 2 |
How to Teach Kids to Save Money
As a parent, teaching your child to manage and properly save his money is a skill that will deeply affect his ability to live as a productive, self-sufficient young adult. It can also be one of the more challenging tasks you face, as kids’ impulsive nature makes them want to spend every dollar they earn. Responsible spending and saving habits are among those that carry over for the rest of your child’s life, so instilling them early is one of the greatest gifts you can give your child.
Help Him Earn
It’s hard for your child to save money if he has no income, or to encourage him to save money that he receives as a birthday or holiday gift. In order for him to learn more about the concept of saving money, he needs to have a reliable method of earning it in the first place. Setting up a system of being paid in exchange for chores, or providing him with the opportunity to make money by completing extra tasks in addition to his daily chores are effective, but there are also a variety of ways that you can help him earn his own money. Finding the best system to suit the unique dynamic of your family may require a bit of creative thinking, but it’s the first step to helping him save and teaching him that money must be earned instead of being something that he’s simply awarded indiscriminately.
Match His Savings
Encouraging kids to save their money rather than spend it isn’t always easy. Unless your child’s personality is one that has a natural affinity for saving, he’ll probably want to rush out and make purchases with every dollar that he earns. Establishing a system of matching the money that he saves can act as an incentive, especially if it’s paired with a contingency fee for early spending. Think of it as the kids’ version of an interest-bearing certificate of deposit!
Let Him See His Money Growing
Kids may not care much for columns and rows of numbers, but they will be encouraged to save if they can literally watch their money grow. Keeping a transparent jar for kids to fill with money as they save it provides a visual incentive, and he can watch his efforts literally pay off. When the jar fills, depositing the money into his very own savings account can strip away the temptation to make frivolous purchases with all of the cash he’s accrued.
Rather than making big purchases for your kids, encourage them to save up to make those purchases themselves. Gifting an expensive video game console or an electronic gadget for holidays or birthdays might earn his excitement and effusive praise, but encouraging him to set a savings goal and helping him to reach it will help instill a sense of accomplishment and pride in his ability to provide for his own material wants, along with a lesson on the concept of saving.
Keep Your Own Piggy Bank
Maintaining your own saving habits in a way that’s visible to your child and explaining what you’re doing can be one of the most effective ways of passing along the skill of saving money. Kids aren’t known for always doing what their parents say, but they do observe the adults in their lives incessantly and often mimic the behavior they see. Modeling strong savings habits and limiting impulse purchases will not only help you to save money in the long run, but also to encourage those values in your child.
Let Him Make Mistakes
Though it may be your natural instinct to do whatever you can to protect your child from disappointment and to head him off from making a mistake, sometimes mistakes are the best lessons. Allowing your child to spend money that he was saving for a specific goal unwisely will disappoint him when he realizes the setback, but he will learn the natural consequences of overspending. Also, resist the temptation to replace the money for him so that he fully understands the nature of the lesson he’s learned. When he’s forced to rebuild his cache of money from the ground up, he’s more likely to think twice before spending irresponsibly in the future.
Remember that the process of teaching your child financial responsibility and the importance of saving is just that: a process. It may take years for him to understand the implications fully, but it will be well worth the effort for both of you. | <urn:uuid:1ad82391-e6c1-45e9-ba3b-8fa768319066> | CC-MAIN-2017-04 | http://www.liveinnanny.com/blog/how-to-teach-kids-to-save-money/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560282202.61/warc/CC-MAIN-20170116095122-00546-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.970871 | 896 | 2.96875 | 3 |
The YouTube debate was not the only exciting new program that aired on CNN this past week. In case you missed them, there were also two new documentaries. The first was part of the Broken Government series, Campbell Brown's Campaign Killers.
The program examines the impact of political attack ads in the election process.
Have you heard the term "swift voting" a campaign? It stems from the 2004 Presidential campaign, when an organization ran a negative campaign ad against John Kerry. The Kerry campaign chose not to address the claims made in the attack ad for over two weeks. The ad, their decision not to respond to it quickly, and the media's coverage of the claims made may have contributed to President Bush's victory.
The swift vote ad is only one of many featured in the program. The Urban Legend ad attacking Rudy Guiliani, the General Betray Us ad, and the Willie Horton ad attacking Michael Dukakis are just a few that are highlighted.
Campbell Brown interviewed Eli Pariser, the founder of MoveOn.org. He’s not exactly what you might expect when you think of someone who runs one of the most influential liberal political action committees of recent years. He's under 30 and runs the site out of his apartment. There are no MoveOn.org corporate offices.
The segment that really surprised me was about Mark McKinnon’s history of ads class. Mud slinging ads are not a product of TV. Thomas Jefferson used attack ads in the form of pamphlets in the 1800 campaign against President Adams. They worked then, too.
The internet has changed the rules a little bit. Now, anyone with a computer can create their own ads and post them on the internet. The 1984 style ad attacking Hillary Clinton was posted on the internet anonymously. Campaigns have no control over what might be created on their behalf by a well meaning individual.
Friday night, Christiane Amanpour’s Special Investigation Unit’s Czar Putin premiered. The program takes a critical look at Russian democracy.
Communism is history in Russia, but is democracy a reality? Fashion week in Russia gives the allusion of capitalism. Income levels have increased since the fall of communism and the government is elected. The program takes a critical look at current day Russia and suggests that Vladimir Putin’s party has total dominance over the political process and silences any opposition.
Here are few highlights from the program:
- 220 journalists have been killed since 1991.
- Garry Kasparov, grand chess master and a would be Presidential candidate of the Other Russia party, tries to run for President, but is unable to get his name on the ballot.
- NTV was a TV network that criticized Putin and has since been shut down.
- Alexander Litvinenko, a former spy, was critical of the government. The British authorities are still trying to get hold of the person responsible for his murder so that they can prosecute him.
OK, hands off the keyboard. Time is up! Did you enjoy this pop quiz of past Mystery Journalists? The correct journalists are listed below:
How did you do? Keep your eye out for future Mystery Journalists. | <urn:uuid:1f17d141-a497-4bf9-b7ce-9d79a8fb09de> | CC-MAIN-2017-04 | http://www.allthingscnn.com/2007/12/czar-campaign-killers-pop-quiz-answers.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281450.93/warc/CC-MAIN-20170116095121-00182-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.960434 | 649 | 2.015625 | 2 |
Hitting an equivalent ball many times in your game will exhaust it quickly. Factors like strike pressure, markings, dirt, etc. can push you to vary it a couple of times, which might be a problem after you are attempting to complete a game. Continuously having new balls handy is nice apply, however that’s not continuously the case particularly with amateurs and a few professionals. These days, lots of Printed Golf Balls use improved high-quality materials. This diminishes the frequency of fixing golf balls in virtually each spherical of your game. If you've got a high activity ball that's extremely resilient to scrapes and cuts caused by trees, rough surfaces, or skinny iron shots, then it's additionally possible that you just can use it once more on your next rounds. Therefore, you wish to understand the importance of cleansing your winning ball to maximize its performance on your every game. Imagine enjoying on it stunning inexperienced course, with all the mud, sand bunkers, fairways, and rough surfaces. You recognize its traditional for your ball to urge involved with lots of dirt, debris, etc. However, it all clings to the ball's dimples and can undoubtedly affect the means you play your game. The supplemental weight of the dirt and rubbish is harmful to the gap projection and speed of your golf balls. Once a ball is repeatedly used for a couple of times, it loses its color and becomes boring. Add altogether the dirt and markings the ball encounters; then, of course, it'll amendment over time.
The most obvious profit is that they’re cheaper. It very doesn’t get to any extent further advanced than that. If you’re still learning to play golf and haven’t got your handicap down nevertheless, then you most likely hit loads of balls into the wild. Meaning several of them will wander off. What’s the purpose in victimization new and dear balls once you’re losing loads of them anyway? You ought to continue second-hand ones and find additional bang for your buck. The sole drawback with used and used balls is that they could be dirty. That’s what this text goes to assist you with.
How to clean used Printed golf balls?
The simplest and most easy thanks to clean dirty laundry balls is to place them within the dishwasher. That’s true; it couldn’t be so simple than that. Some balls may get broken by the new water laundry method, however, that’s truly a decent issue because it helps you get obviate the poor quality used balls in your assortment. Most smart balls are going to be fine with it and can begin clean and new. However what if you haven’t got a dishwasher, or what if your balls area unit very dirty? You would possibly want a distinct choice. Some balls will have protects or different stubborn mess stuck to them which may not return off within the dishwasher anyway. With them, soak in a very bucket of the predicament that has acid in it. a choice is to use bleach or another similar product (do not try this if they’ve got acid or different cleansing product on them). | <urn:uuid:4c5ac9e3-b51f-41c2-bc68-1512198b55b7> | CC-MAIN-2022-33 | https://5e70bdb5eabd0.site123.me/blog/simple-method-to-clean-your-used-printed-golf-balls | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571758.42/warc/CC-MAIN-20220812200804-20220812230804-00674.warc.gz | en | 0.959725 | 649 | 1.59375 | 2 |
What Does the Prayer Really Say? Exaltation of the Cross (24th Sunday of Ordinary Time)
ORIGINALLY PRINTED IN The Wanderer in 2003
Again the ubiquitous Rome correspondent of the left-leaning National Catholic Reporter, Mr. John L. Allen, Jr., writes in his “The Word From Rome” column of 29 August 2003 that the Congregation for Divine Worship and Discipline of the Sacraments (CDW) “will host a meeting of the presidents of English-speaking bishops’ conferences on Oct. 21 to discuss liturgical translation. General issues are to include: The roles of the Vatican’s liturgy congregation and bishops’ conferences; more effective communication and consultation; and inculturation, in light of the third edition of the Roman Missal and a 1994 set of Vatican guidelines urging caution in integrating local customs into the liturgy.” We are seeing now put into action what I have for some time contended is the key to understanding the CDW’s 2001 document Liturgiam authenticam (LA), establishing norms for vernacular liturgical translations: inculturation. LA was the fifth instruction issued by the CDW for the proper implementation of the Second Vatican Council’s great Constitution on the Sacred Liturgy entitled Sacrosanctum Concilium. It followed the fourth instruction in 1994 called Varietates legitimae (VL) concerning a proper inculturation and permissible adaptations of the liturgy. Indeed LA and VL must be read in light each other. Inculturation, properly, understood will be the key principle at the foundation of the new English translations being prepared following upon the release of the third edition of the Missale Romanum in 2002.
There is more news on the liturgical front. The head of the Vatican’s hyper-dicastery, Secretary of State Angelo Card. Sodano recently spoke at a conference in Acireale Italy for National Liturgical Week. Forty years after the promulgation of Sacrosanctum Concilium His Eminence now states that, according the news account from Zenit.org, it is right to examine the way the pivotal Constitution was has been implemented in the last four decades, in order to “relaunch” it. Card. Sodano said, "Forty years later, it is right to ask what the liturgical reform itself has represented for the renewal of Christian communities, to what degree the liturgy, reformed according to the indications of the council, is able to mediate between faith and life, so that it forms believers able to offer consistent evangelical testimony”. He continued, “it is useful to ask oneself with clarity and sincerity if the reform has experienced some weak point and where, and, above all, how it can be relaunched for the good of the Christian people.” Resonating with what countless Catholics have been facing in the pews for decades now, His Eminence proposed that “perhaps some of the principles of the constitution have to be better understood and more faithfully applied.” In particular, he said, “it is useful to analyze some specific topics such as, for example, the relation between creativity and fidelity, between spiritual worship and life, between catechesis and celebration of the Mystery, between liturgical presidency and role of the assembly, between formation in the seminaries and the permanent formation of priests.”
Soon, hopefully, we will see a document about liturgical issues come forth from the CDW and we will hear tales of the meeting in October about translations, inculturation and the role of the bishops in their conferences in the process. Friends, pray for your bishop. His cares are many and the issue and duty of preparing translations is but one of his cares. While liturgy and its content is arguably “the source and summit” of our Catholic Christian lives, radiating its power into the farthest corners even of our moral lives, it will be a great temptation for the bishop, in the midst of many many administrative cares, law suits and funds to be raised, parish visits and unending committee meetings, to shuffle into the lap of some willing liturgist all the documentation and letters about translations he is being sent by the ream. If anything has been borne out over the years, liturgy and translations have received short shrift, at least insofar as they have required rectifying and the order of discipline.
But now hopes are raised. In the background many begin to think that words such as “discipline” and “reverence” have not been forgotten while from the podium and the press we hear words such as “relaunch” and “analyze” and, from such as the Cardinal Prefect of the CDW, “We want to respond to the spiritual hunger and sorrow so many of the faithful have expressed to us because of liturgical celebrations that seemed irreverent and unworthy of true adoration of God. You might sum up our document with words that echo the final words of the Mass: ‘The do-it-yourself Mass is ended. Go in peace.’”
We should encourage Cardinal Arinze:
Francis Card. Arinze
Prefect of the Congregation for Divine Worship
and Discipline of the Sacraments
00120 Vatican City
LATIN (2002 Missale Romanum – 24th Sunday):
Mentes nostras et corpora possideat,
quaesumus, Domine, doni caelestis operatio,
ut non noster sensus in nobis,
sed eius praeveniat semper effectus.
This was the Postcommunio of the 15th Sunday after Pentecost in the 1962MR with the slight change of the change of an adverb semper for iugiter : …sed iugiter eius praeveniat effectus.
Our Virgil leading us through the dark woods of Latin vocabulary, the Lewis & Short Dictionary explains that the verb possideo is “to have and hold, to be master of, to own, possess” and also “to take possession of, to occupy.” An operatio is “a working, work, labor, operation” and by extension it means “a religious performance, service, or solemnity, a bringing of offerings: operationes denicales, offerings”. In ancient Christian authors it means, “beneficence, charity” (cf. Lactantius 6, 12 and Prudentius Psychomachia 573). Sensus , Å«s, m. (from the verb sentio) means “the faculty or power of perceiving, perception, feeling, sensation, sense”. In a corporeal sense it applies to “perception, feeling, sensation” and in a mental sense, it is for “feeling, sentiment, emotion, affection; sense, understanding, capacity; humor, inclination, disposition, frame of mind”. By extension, among other things, it is “the common feelings of humanity, the moral sense, taste, discretion, tact in intercourse with men, often called in full sensus communis (sometimes with hominum)” Effectus, which dervies from efficio, still means what it meant back in the Post communion on the 15th Sunday of Ordinary Time, that is, “to make out, work out; hence, to bring to pass, to effect, execute, complete, accomplish, make, form” and as a substantive, effectus, “worked out, i. e., effected, completed”. Praevenio signifies, “to come before, precede, get the start of, to outstrip, anticipate, to prevent; to come or go beforehand (late Latin).” We looked at this word at length in the column on the Post communion of the feast of Epiphany with a digression about the theological distinction made when speaking of actual graces and gratia praeveniens or “prevenient grace” and sometimes even “preventing grace”.
May the religious work of bringing the offering of the heavenly gift,
we beseech, O Lord, possess our minds and bodies,
so that its effect and not our common inclination
have precedence within us.
The vocabulary of our prayer today is very dense, and so our English translation will suffer if we try to come up with one-to-one equivalents for the Latin elements. For example, the word sensus has great weight. It means more than simply “sense”. Even in a non-theological source such as the preferred Latin Dictionary of fame we find that sensus carries meaning beyond what we might perceive by the five physical senses of the body or by the perceiving powers of the mind. It points to that which is common to all human beings, “common sense”. This not the “common sense” which we might have (or lack) in, for example, not standing too close with our back to the lions’ cage when posing for a photo. This is also not the Kantian a priori principle of every judgment of taste, the Kantian term for the so-called subjective principle which determines only by feeling rather than concepts, though nonetheless with universal validity, what is liked or disliked by all people. It is not quite the ancient Greek idea of koine aisthesis according to the Aristotle (De anima – II,6, 418a17-20) which applies to our capacities of perceiving objects through more than one sense. Aristotle suggests a “common sense” power by which we perceive things. Medieval Aristotelians suggest that sensus communis is the root and origin of all sensing. Thus we are able to hear the roar, feel the bite and then see the shaggy mane and realize that it is the one and the same lion gnawing us as he drags our leg into the cage … when we lack the other sort of common sense. So, we might say that this is the power of uniting mentally the impressions conveyed by the five physical senses which constitutes ordinary understanding, without which one is foolish or insane and thus prone to lack common sense.
ICEL (1973 translation of the 1970MR):
may the eucharist you have given us
influence our thoughts and actions.
May your Spirit guide and direct us in your way.
Take careful note of how, in the Latin, we are asking that Christ in the Eucharist be Lord of our entire person, both body and soul. The priest prays for us that, by the graces we receive through a good Holy Communion, our mere human gifts of senses and perception, even our impulses and inclinations, both physical and psychological, wounded as they are and still reduced in this world through the unreconstructed effects of original sin, not be the only arbiter in what we accomplish in life in thought and action through our minds and bodies (mentes et corpora). We need those human impulses when they are good and proper and under the control of discipline through our will and the aid of grace. But we suffer terrible wounds to our will and intellect because of Original Sin. We resist graces sometimes. Our own wicked habits do terrible damage. Left to ourselves, what good would we be inclined to do? And when we are inclined, how great a struggle is it? By our baptism we are admitted to the source of such strength that we can live well and please our God, in whose image we are made. May the Eucharistic Lord truly possess us and be admitted into every aspect of our lives, physical and spiritual, so that what we think and do may be pleasing to Him.
LATIN (2002 Missale Romanum – Exultation of the Holy Cross):
Refectione tua sancta enutriti,
Domine Iesu Christe, supplices deprecamur,
ut, quos per lignum crucis vivificae redemisti,
ad resurrectionis gloriam perducas.
Having been nourished upon your holy repast,
O Lord Jesus Christ, we supplicants earnestly pray,
that you may lead through to the glory of the resurrection
those whom you redeemed through the wood of the life-giving Cross.
ICEL (1973 translation of the 1970MR):
Lord Jesus Christ,
you are the holy bread of life.
Bring to the glory of the resurrection
the people you have redeemed by the wood of the Cross. | <urn:uuid:aa11d9ec-ef9c-49f1-ae60-83ae0435cac3> | CC-MAIN-2017-04 | http://wdtprs.com/blog/2006/09/24th-sunday-of-ordinary-time-post-communion-1/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00471-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.935787 | 2,631 | 1.703125 | 2 |
It’s a universe practically no one explores, a universe uncharitably defined and underestimated by those who cling to old political paradigms, a universe that Ann Marie Stock and her crew of William & Mary students are exposing to the world, one frame at a time.
Stock, associate professor of modern languages and literatures, first experienced Cuban cinema 20 years ago when she attended a film festival in Havana. Stunned by the passion, craftsmanship and accessibility of the filmmakers, she quickly began collecting material for her doctoral dissertation and, later, for her teaching at the College.
But there’s more to Stock’s story -- much more -- than mere intellectual immersion. Stock has centered her professional life around every aspect of film-making on the island. She has interviewed the filmmakers, written and published those interviews, written and published reviews of their films, written and published analyses of their films. She has written a book about these films, entitled “On Location in Cuba.”
Starting years ago with a film entitled “Madagascar” by Fernando Perez, Stock has taken their films, translated and subtitled them, made them marketable to the major film capitals of the world. She hasn’t done it alone; her students have been with her every step of the way.
“The students were jazzed by doing something that mattered, something that had a life beyond campus,” Stock recalled. “Something that wasn’t just a paper to be filed away that only their professor saw.
“I think it’s really important for students to think of themselves as cultural agents. By that I mean individuals who are capable of fostering the creativity of others, who are capable of helping circulate cultural expressions, be that film, poetry, video. It’s very empowering when students see themselves work with me in conducting an interview and the results of our interview are published and disseminated. To some extent -- maybe a tiny extent -- that matters for the career trajectory of artists of filmmakers.”
Cuban writer and filmmaker Karel Ducases disagrees with Stock. He would argue that there’s nothing “tiny” about the contribution she and William & Mary have made to the propagation of Cuban cinema.
“It’s very important to have a person like Ann Marie in the U.S., doing things for Latin American filmmakers and their works,” Ducases said via e-mail from Cuba. “I don’t know of any other person or American institution that has the kind of relationship with us that Ann Marie and William & Mary have.”
Last February, Stock transported Ducases’ film, “Zone of Silence” back to Williamsburg from Havana. She and her students then spent the spring semester creating subtitles for it. The students had lots of questions, most of which Stock could have answered. Instead, she encouraged them to go right to the source and contact Ducases, giving them an “eminently productive learning experience” with a director.
“(Their subtitling) was very important in the documentary being shown in other places, especially English-language countries,” Ducases wrote. “My work has now been seen by many people at festivals or exhibitions in Poland, the United States, the United Kingdom, Norway, Germany and Italy.
“This is great. My documentary runs 40 minutes and has five interviews and too many comments. That makes it impossible to understand the censorship history in Cuba -- and my personal message -- if you don’t understand a word of Spanish.”
Appreciation and support for her work were prime reasons Stock was awarded the first Reves Center Faculty Fellowship last spring, along with David Aday, professor of sociology and American studies.
The fellowships, Stock’s for International Student-Faculty Research, Aday’s for International Service Learning, run for two years. They include a $5,000 research fund or salary stipend each year and funding of $6,000 for student support last summer and in the summer of 2010.
“The Reves Fellow has really helped me grow this wonderful initiative that emphasizes independent inquiry,” Stock said. “Students really work towards goals they set for themselves with this research and with these documentary dissemination. It’s really helped me foster their undergraduate research skills.”
(Editor’s note: A profile and video of Professor Aday appeared here recently. See related links to view.)
In addition to manufacturing the subtitles for Zone of Silence, accomplishments aided by the Reves Fellowship stipend include: a documentary about Ducases and fellow Cuban filmmaker Alina Rodriguez; an exhibit devoted to the photos of Gustavo Perez and displayed in the Botentourt gallery of Swem Library.
Stock arranged to host filmmakers Gilberto Martinez Gomez and Miguel Coyula at a workshop in Williamsburg, during which Coyula filmed part of his next feature inside the Kimball Theatre. Workshop participants had the chance to position themselves behind the camera as interviewers and videographers and in front of the camera as extras. Footage from the interviews has been edited into “On Location in Cuba: Montage,” the trailer for a future documentary.
“Many filmmakers give thanks to her for her honest help,” Ducases wrote. “She is special for her contribution to events in Cuba like ‘Festival of Young Filmmakers’ or the ‘Latin America New Cinema Festival.’ I think Cuban filmmakers respect her, her comments and her ideas tremendously because she did an exhaustive and serious investigation in order to write her book.”
The value of Stock’s passion to W&M is incalculable. Their work is sent around the world and “when audiences are looking at this documentary,” Stock says, “at the end of credits they’re seeing, ‘Subtitles by’ and the students’ names as part of the W&M New Media workshop.”
In addition, two students employed footage that Stock and Troy Davis, media center director at Swem Library, shot of Ducases and Rodriguez and turned it into a documentary that Stock unveiled at the 2009 Havana Film festival of New York.
“It was a very concrete way for students to see the work they’re doing,” Stock said. “Their research disseminated important information not otherwise available. That’s particularly compelling in the case of Cuba because the relationship between our two countries has limited our knowledge of one another.”
There are many misconceptions Americans have of Cuba. Foremost among them is the amount of censorship the Castro government places on film.
“Often when I’m at a festival presenting work, the question is ‘How could a film that critical be made by the state-sponsored film institute?’ ” she said. “And I say, ‘There’s that one and seven more on the same subject.’ It says something about our expectations about expression in Cuba.”
Another misconception, one that irritates Cuban filmmakers, is that all of them want to defect from their country and come to the United States.
“I have invited filmmakers to come to U.S., hosted many at W&M, and Cubans are very interested in putting their work in front of international audiences,” she said. “No one has ever decided that this is where they want to stay. They tell me, ‘This is my country, the stories I want to tell are here. Why does everyone think we want to get out?’ ”
In 2010, Stock plans to bring her student even closer to the Cuban film community. She will use the Reves funding and money from a Mellon Grant to bring a “cadre” of students to New York for the Havana Film Festival. She wants them to experience presenting their work in person.
“I made as list of goals as part of the application process (for a Reves Fellow); activities, assessment milestones, that sort of thing,” Stock said. “I’m happy to say that I and my students are in good shape as far as reaching them.” | <urn:uuid:a21eee54-f9c1-416c-8abe-96c369d8fb76> | CC-MAIN-2017-04 | http://www.wm.edu/offices/revescenter/news/2010/stockcubanfilmmakers.php | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280872.69/warc/CC-MAIN-20170116095120-00314-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.967139 | 1,720 | 1.765625 | 2 |
Arabic Source and Roman Transliteration Arabic وَاسْتَعِينُوا بِالصَّبْرِ وَالصَّلَاةِ وَإِنَّهَا لَكَبِيرَةٌ إِلَّا عَلَى الْخَاشِعِينَ Transliteration Wa istaAAeenoo bi al ssabri wa al ssal ati wa-innah a lakabeeratun ill a AAal a alkh ashiAAeen a Literal (Word by Word) And seek help through patience and the prayer; and indeed, it (is) surely difficult except on the humble ones,
PLEASE Help keep us online. Donate today. Click here:
Generally Accepted Translations of the Meaning Muhammad Asad And seek aid in steadfast patience and prayer: and this, indeed, is a hard thing for all but the humble in spirit, M. M. Pickthall Seek help in patience and prayer; and truly it is hard save for the humble-minded, Shakir And seek assistance through patience and prayer, and most surely it is a hard thing except for the humble ones, Yusuf Ali (Saudi Rev. 1985) Nay, seek (Allah's) help with patient perseverance and prayer: It is indeed hard, except to those who bring a lowly spirit,- Yusuf Ali (Orig. 1938) Nay, seek (God's) help with patient perseverance and prayer: It is indeed hard, except to those who bring a lowly spirit,- Dr. Laleh Bakhtiar And pray for help with patience and formal prayer. And, truly, it is arduous, but for the ones who are humble, Wahiduddin Khan Seek help with patience and prayer; this is indeed an exacting discipline, but not to the humble, T.B.Irving Seek help through patience and prayer, since it is exacting except for the submissive Safi Kaskas Seek help in endurance and prayers. [Doing this] is a burden, except for the humble, [Al-Muntakhab] "Resort to patience to possess your souls and have recourse to prayer, for more things are wrought by prayer, than this world dreams of, albeit that the practice of praying to Allah is viewed by people as involving labour and effort and is hard to accomplish, but not by those who humble themselves to Allah with hearts impressed with the image of religious and spiritual virtues". [The Monotheist Group] (2011 Edition) And seek help through patience, and the contact-method. It is a difficult thing, but not so for the humble. Abdel Haleem Seek help with steadfastness and prayer- though this is hard indeed for anyone but the humble, Abdul Majid Daryabadi And seek help in patience and prayer and verily it is, hard except prayer unto the meek. Ahmed Ali Find strength in fortitude and prayer, which is heavy and exacting but for those who are humble and meek, Aisha Bewley Seek help in steadfastness and salat. But that is a very hard thing, except for the humble: Ali Ünal Seek help through patience (and fasting, which requires and enables great patience), and through the Prayer. Indeed the Prayer is burdensome, but not for those humbled by their reverence of God: Ali Quli Qara'i And take recourse in patience and prayer, and it is indeed hard except for the humble Hamid S. Aziz Seek aid with patience and prayer, though it is a hard thing save for the humble, Muhammad Mahmoud Ghali And seek help in patience and prayer; and surely it is indeed great (i.e., formidable, hard) except for the submissive. Muhammad Sarwar Help yourselves (in your affairs) with patience and prayer. It is a difficult task indeed, but not for the humble ones Muhammad Taqi Usmani Seek help through patience and prayer. It is indeed exacting, but not for those who are humble in their hearts, Shabbir Ahmed Rather, help yourselves with steadfast patience and establish the Divine System. This is a hard way, but it is made easy for those who are committed. (The System of equity and human equality strikes at the vested interests of the elite, and hence, it is hard for them to support it). Syed Vickar Ahamed But no! Seek (Allah’s) help with patient perseverance and prayer: It is truly difficult except for those who bring a humble spirit— Umm Muhammad (Sahih International) And seek help through patience and prayer, and indeed, it is difficult except for the humbly submissive [to Allah ] Farook Malik Seek Allah’s help with patience and Salah; it is indeed hard except for those who fear Allah, Dr. Munir Munshey Seek help and solace through prayers and patience. Of course it is hard, except for those who are humble of heart, Dr. Mohammad Tahir-ul-Qadri And seek (Allah’s) help through patience and Prayer. But this is no doubt hard except for the humble (whose hearts have been softened with the Love of Allah and gripped with His Fear). Dr. Kamal Omar And invoke assistance (of Allah) through perseverance and Salat, and indeed it is very hard except to those who are devoted — Talal A. Itani (new translation) And seek help through patience and prayer. But it is difficult, except for the devout. Bilal Muhammad (2013 Edition) No, seek help with patient-perseverance and prayer. It is indeed hard, except for those who bring a humble spirit, Maududi Seek help with the Salat and fortitude: no doubt, Salat is a hard task but not for those obedient servants, Ali Bakhtiari Nejad Get help from the patience (and perseverance) and the mandatory prayer, and it is definitely difficult except for those who are humble, [The Monotheist Group] (2013 Edition) And seek help through patience and through the contact prayer. It is a difficult thing, but not so for the humble. Mohammad Shafi And seek divine help with the patience and the proper prayer ! And this indeed is the hard thing except for those who dread -
Controversial, deprecated, or status undetermined works Bijan Moeinian God’s help and salvation is achieved through patience and worship. They are surely difficult tasks but not for those who respect God with an awe. Faridul Haque And seek help in patience and prayer; and truly it is hard except for those who prostrate before Me with sincerity. Hasan Al-Fatih Qaribullah And seek help in patience and prayer. For it is heavy, except to the humble, Maulana Muhammad Ali And seek assistance through patience and prayer, and this is hard except for the humble ones, Muhammad Ahmed - Samira And seek support with the patience and the prayers and that it truly is a great/burden (E) except on the humble . Sher Ali And seek help with patience and prayer, and this indeed is hard except for the humble in spirit, Rashad Khalifa You shall seek help through steadfastness and the Contact Prayers (Salat). This is difficult indeed, but not so for the reverent, Ahmed Raza Khan (Barelvi) And seek help in patience and prayer, and surely, the prayer is hard indeed save to those, who lean towards Me with their hearts. Amatul Rahman Omar Seek (God's) help through perfect perseverance and Prayer, and this is indeed a very hard thing except for those who are humble. Muhsin Khan & Muhammad al-Hilali And seek help in patience and As-Salat (the prayer) and truly it is extremely heavy and hard except for Al-Khashioon (i.e. the true believers in Allah - those who obey Allah with full submission, fear much from His Punishment, and believe in His Promise (Paradise, etc.) and in His Warnings (Hell, etc.)).
Non-Muslim and/or Orientalist works Arthur John Arberry Seek you help in patience and prayer, for grievous it is, save to the humble Edward Henry Palmer Seek aid with patience and prayer, though it is a hard thing save for the humble, George Sale Ask help with perseverance and prayer; this indeed is grievous, unless to the humble, John Medows Rodwell And seek help with patience and prayer: a hard duty indeed is this, but not to the humble, N J Dawood (draft) Fortify yourselves with patience and with prayer. This may indeed be an exacting discipline, but not to the devout,
New and/or Partial Translations, and works in progress Sayyid Qutb Seek strength in patient perseverance and in prayer, which is indeed a demanding task except for the devout. Ahmed Hulusi Be patient (by relying on the qualities of the Names in your essence); seek help by turning to these qualities through prayer (salat). Indeed, except for those who are in awe of Allah, this is difficult for the ego. Sayyed Abbas Sadr-Ameli And seek you help (from Allah) through patience and prayer; and most surely it is a hard thing, save upon the humble, Mir Aneesuddin And seek help through patience and worship (salat) and this is certainly difficult except for the humble ones.
Share this verse on Facebook... | <urn:uuid:630110d2-ed54-4b30-8f22-b8697cca0d6f> | CC-MAIN-2016-44 | http://www.islamawakened.com/Quran/2/45/default.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719079.39/warc/CC-MAIN-20161020183839-00035-ip-10-171-6-4.ec2.internal.warc.gz | en | 0.919891 | 1,994 | 2.4375 | 2 |
Clive Northwest Neighborhod Plan and Design Guidelines
The Northwest Neighborhood Master Plan and Design Guidelines was a collaborative planning process between the City of Clive, Iowa, and major landowners for 600 acres of land representing the community’s final new neighborhood. This process sought to accommodate market potential and economic realities wile achieving additional public objectives. Mr. Weber managed this project while with another firm.
The Creek Valley: The Little Walnut Creek valley would be preserved as public open space, floodplain and a multi-use path while land along five ravines would be designated as private open space.
Streets: All streets were designed to be appropriately narrow and have a sidewalk and street trees on both sides. Two roundabouts with plantings were included for traffic control and interest. “Parkway Connectors” would link the Greenbelt to the commercial-residential village in the southeast while adding form and drama to that neighborhood.
House Relationship to the Street: Houses would be encouraged to have a front porch in order to enliven the streetscape, bridge the transition from the public to the private space and promote social interaction. Similarly, builders would be encouraged to set garages no closer to the street than the rest of the front façade, if not farther back.
Attached Housing: Several types of attached housing are planned including an aged-restricted building. A few apartments could be located above retail shops.
Parks: Three public parks with athletic fields were planned along with two public squares and two private parks.
Mixed-Use Retail and Residential Village A walkable, diverse and relatively dense “village” was planned in the southeastern corner of the neighborhood. The shops, which would serve several nearby neighborhoods, would be located along a “Main Street,” have parking to the rear and on-street, and have doors and windows on both sides. There would be several types of attached housing that fronts onto the public streets and relates to the village public squares. Seniors’ housing and small offices are possible.
Costs: Means of apportioning improvement costs between the City and the land developers were included.
Design Guidelines: The neighborhood design guidelines booklet, generously illustrated with photos and graphics, addressed these and other subjects:
Single-Family Housing: Lot sizes and grading; house design, color palette and orientation; garage setbacks; porches.
Mid- and High-Density Housing: Context and character; orientation; façade materials and garage doors; outdoor private areas; parking.
Office Buildings: Facades; landscaping; sidewalks.
Local, Collector and Parkway Street Design: Width; sidewalks; landscaping and lighting; roundabouts.
Parks, Open Space and Path Design: Location, programming; plantings and materials; connections; surface water management; conservation easements; creek overlooks.
Neighborhood Commercial Area: Building facades, doors and windows, and relationship to the streets; signs; lighting; parking; landscaping.
- Arden Hills Downtown Master Plan and Urban Design Guidelines
- Astra Village Master Plan and Urban Design Guidelines
- Awards and Honors
- Clive, Iowa, Northwest Neighborhood Plan and Design Guidelines
- Eau Claire Comprehensive Plan 2005
- Eau Claire Comprehensive Plan 2015
- Eau Claire River Corridors Plan
- Economic Development Plan for Eau Claire
- Economic Impact of Mississippi River Lock Closing
- Edina Valley View at Wooddale Plan
- Expert Witness Testimony
- Loring Park Neighborhood Master Plan
- Metropolitan Area Comprehensive Plans
- New York East River Bikeway
- Northstar Corridor Station Neighborhood Planning
- Springfield, Missouri, Comprehensive and Fringe Growth Plans
- Taming the Garage in Northfield
- Traditional Zoning Ordinance
- Urban Photography
- Vadnais Heights Municipal Services
- Waconia Comprehensive Plan
- Waseca Zoning Ordinance
- West Riverside Neighborhood and Medical Campus Plan
- Wind Energy Assessment and Permitting | <urn:uuid:5e2253d6-62d5-4d4f-a4cc-6a97c5dcaf6f> | CC-MAIN-2017-04 | http://weberplanning.com/Projects/Clive_Northwest_Neighborhood.html | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285315.77/warc/CC-MAIN-20170116095125-00566-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.938301 | 816 | 1.914063 | 2 |
Episode One Hundred And Thirteen – On Critical Thinking, Alt Med And Science Communication – Michael McRae And Craig Cormick
A bonus for this episode! The start of the show is from Doubtful News, a ten-minute broadcast of some of the hit weird and wonderful stories that are in the media this month. Many thanks to Sharon Hill and check out the official site at http://doubtfulnews.com. Best of all, you’ll be able to see Sharon and many others in person at the forthcoming Amazing Meeting 2012 from July 12-15th!
Today’s episode features content from last month’s Australian Science Communicators’ National Conference held from 27-29th February in Sydney – a lecture by Michael McRae and an interview with Craig Cormick.
Michael McRae is the author of Tribal Science: Brains, Beliefs and Bad Ideas, which has been released in Australia by the University of Queensland Press; the forthcoming U.S. edition is from Prometheus Books. He has worked in science, education, as an artist and is currently employed as a writer-editor at Australia’s CSIRO. He is also the writer behind the critical thinking videos for TechNyou, which can be found in six parts on YouTube and are part of a series on The Logic of Critical Thinking. His presentation at the conference that features in this episode is called “A Vital Divide: The Future Of Alternative Medicine in a Scientific Society”.
Dr Craig Cormick is a former science journalist and editor, and is widely published on research into the causes of public concerns into new technologies. He has travelled to all seven continents as a science communicator, including presenting at APEC and OECD workshops. Dr Cormick has published several books and authored the reports What You Really Need To Know About What The Public Really Thinks About GM Foods (2005) and Cloning Goes To The Movies (2006). He also recently conducted an interview on Risk Science Unplugged: Why do smart people believe dumb things with Dr Di Bowman about the social values that govern much public perception of risk, and how they affect the decisions people make.
This show is available on Zune, mp3 via Libsyn or iTunes. Visit www.tokenskeptic.org – and I’d love to get your feedback at firstname.lastname@example.org. Theme songs are “P&P” by Derek K Miller of www.penmachine.com and “Leap Second” by Milton Mermikides, of www.miltonmermikides.com. Please considering supporting the show via visiting Tokenskeptic.org. | <urn:uuid:3eea834f-67de-4107-a584-e6d9f882d35e> | CC-MAIN-2017-04 | http://tokenskeptic.org/2012/03/20/episode-one-hundred-and-thirteen-on-critical-thinking-alt-med-and-science-communication-michael-mcrae-and-craig-cormick/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00466-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.940602 | 550 | 1.929688 | 2 |
4 Reasons for Investing in a Moissanite rather than Diamond Admin June 27, 2022 Accessories, Accessories How to, Lifestyle, Lifestyle How to, Weddings Most people immediately think of a diamond ring when they hear the words proposal, engagement ring, wedding or jewelry. Diamond rings are synonymous with engagement rings, and there is nothing against it – diamonds are brilliant, last forever, and are absolutely stunning and gorgeous in any form.But there is another gemstone that has all these qualities and costs just a fraction of a diamond. IF there was an option like this and most people knew about it – surely Moissanite would have been the most selling engagement ring.Moissanite solitaire rings are incredibly similar to diamonds, and there is so little difference between them that people will never recognize one from the other. Moissanite rings are extremely fashionable, and they are very economical and perhaps why most modern men and women are opting for moissanite over diamonds these days.Moissanite – IntroductionMoissanite is a crystal that was first discovered by a Geologist at the site of a meteor crater. The entire crater was white and shiny with this extra terrestrial material. Soon, moissanite was famed all over the world and people went gaga about this other worldly material. It was soon exhausted after mining all of the crater and the meteor.When the demand for moissanite rose, engineers and scientists tried to recreate this material in the lab and they were successfully able to make man-made moissanite in the laboratory. This made their value cheap and economical, but apart from this one reason, the moissanite crystals are far superior in quality, clarity, shine and the ability to make them into excellent jewelry.Moissanite has the same strength as that of Diamond on the Mohs Index for strength and durability. It is the only known element on earth that can compete with a diamond in its strength. The shine of Moissanite is unlike anything else – even diamond has less refraction than moissanite does, making it the shiniest crystal for jewellery.Moissanite is capable of being cut, polished and used in kinds of jewelry and in any form similar to that of diamonds. It can be cut into the same shapes of square, oval, emerald, princess, cushion etc as that of Diamond rings and pendants.Moissanite solitaire rings are known to be so similar and unrecognizable from diamond rings that most modern couples looking at economical options for a wedding ring are now looking at Moissanite instead of Diamond rings. Sure diamond has its own value, but having something that has all the qualities of diamond but at a fraction of its cost is truly invaluable for many people.Reasons to buy Moissanite Instead of DiamondBelow are the top 4 reasons to buy Moissanite rings instead of diamond rings in 2022:EconomicalThis is the top reason to buy moissanite without a doubt – they are so much cheaper than diamonds and offer most of the same qualities and appearance as diamonds.QualityMoissanite is made in specialized labs and is guaranteed to have excellent quality, provided they are purchased from verified authentic sellers.Everyday UseableThey are strong, durable and resistant to breakage, abrasion and chipping just like diamonds and therefore perfect for an everyday wear wedding ring.BrillianceThey have an incredible refractive index which makes them shinier even in low light and therefore excellent for fashion jewellery for women. Leave a Reply Cancel ReplyYour email address will not be published.CommentName* Email* Website Save my name, email, and website in this browser for the next time I comment. | <urn:uuid:2b8aaa59-e7ba-4767-afce-46b53514326a> | CC-MAIN-2022-33 | https://www.fashionfresta.com/4-reasons-for-investing-in-a-moissanite-rather-than-diamond/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571147.84/warc/CC-MAIN-20220810040253-20220810070253-00476.warc.gz | en | 0.961739 | 741 | 1.625 | 2 |
Complete Commentary on the Whole Bible, by Matthew Henry, , at sacred-texts.com
David was in distress when he penned this psalm, pursued, it is most likely, by Saul, that violent man. Is any distressed? Let him pray; David did so, and had the comfort of it. I. He prays for God's favourable acceptance (Psa 141:1, Psa 141:2). II. For his powerful assistance (Psa 141:3, Psa 141:4). III. That others might be instrumental of good to his soul, as he hoped to be to the souls of others (Psa 141:5, Psa 141:6). IV. That he and his friends being now brought to the last extremity God would graciously appear for their relief and rescue (Psa 141:7-10). The mercy and grace of God are as necessary to us as they were to him, and therefore we should be humbly earnest for them in singing this psalm.
A psalm of David.
Mercy to accept what we do well, and grace to keep us from doing ill, are the two things which we are here taught by David's example to pray to God for.
I. David loved prayer, and he begs of God that his prayers might be heard and answered, Psa 141:1, Psa 141:2. David cried unto God. His crying denotes fervency in prayer; he prayed as one in earnest. His crying to God denotes faith and fixedness in prayer. And what did he desire as the success of his prayer? 1. That God would take cognizance of it: "Give ear to my voice; let me have a gracious audience." Those that cry in prayer may hope to be heard in prayer, not for their loudness, but their liveliness. 2. That he would visit him upon it: Make haste unto me. Those that know how to value God's gracious presence will be importunate for it and humbly impatient of delays. He that believes does not make haste, but he that prays may be earnest with God to make haste. 3. That he would be well pleased with him in it, well pleased with his praying and the lifting up of his hands in prayer, which denotes both the elevation and enlargement of his desire and the out-goings of his hope and expectation, the lifting up of the hand signifying the lifting up of the heart, and being used instead of lifting up the sacrifices which were heaved and waved before the Lord. Prayer is a spiritual sacrifice; it is the offering up of the soul, and its best affections, to God. Now he prays that this may be set forth and directed before God as the incense which was daily burnt upon the golden altar, and as the evening sacrifice, which he mentions rather than the morning sacrifice, perhaps because this was an evening prayer, or with an eye to Christ, who, in the evening of the world and in the evening of the day, was to offer up himself a sacrifice of atonement, and establish the spiritual sacrifices of acknowledgement, having abolished all the carnal ordinances of the law. Those that pray in faith may expect it will please God better than an ox or bullock. David was now banished from God's court, and could not attend the sacrifice and incense, and therefore begs that his prayer might be instead of them. Note, Prayer is of a sweet-smelling savour to God, as incense, which yet has no savour without fire; nor has prayer without the fire of holy love and fervour.
II. David was in fear of sin, and he begs of God that he might be kept from sin, knowing that his prayers would not be accepted unless he took care to watch against sin. We must be as earnest for God's grace in us as for his favour towards us. 1. He prays that he might not be surprised into any sinful words (Psa 141:3): "Set a watch, O Lord! before my mouth, and, nature having made my lips to be a door to my words, let grace keep that door, that no word may be suffered to go out which may in any way tend to the dishonour of God or the hurt of others." Good men know the evil of tongue-sins, and how prone they are to them (when enemies are provoking we are in danger of carrying our resentment too far, and of speaking unadvisedly, as Moses did, though the meekest of men), and therefore they are earnest with God to prevent their speaking amiss, as knowing that no watchfulness or resolution of their own is sufficient for the governing of their tongues, much less of their hearts, without the special grace of God. We must keep our mouths as with a bridle; but that will not serve: we must pray to God to keep them. Nehemiah prayed to the Lord when he set a watch, and so must we, for without him the watchman walketh but in vain. 2. That he might not be inclined to any sinful practices (Psa 141:4): "Incline not my heart to any evil thing; whatever inclination there is in me to sin, let it be not only restrained, but mortified, by divine grace." The example of those about us, and the provocations of those against us, are apt to stir up and draw out corrupt inclinations. We are ready to do as others do, and to think that if we have received injuries we may return them; and therefore we have need to pray that we may never be left to ourselves to practise any wicked work, either in confederacy with or in opposition to the men that work iniquity. While we live in such an evil world, and carry about with us such evil hearts, we have need to pray that we may neither be drawn in by any allurement nor driven on by any provocation to do any sinful thing. 3. That he might not be ensnared by any sinful pleasures: "Let me not eat of their dainties. Let me not join with them in their feasts and sports, lest thereby I be inveigled into their sins." Better is a dinner of herbs, out of the way of temptation, than a stalled ox in it. Sinners pretend to find dainties in sin. Stolen waters are sweet; forbidden fruit is pleasant to the eye. But those that consider how soon the dainties of sin will turn into wormwood and gall, how certainly it will, at last, bite like a serpent and sting like an adder, will dread those dainties, and pray to God by his providence to take them out of their sight, and by his grace to turn them against them. Good men will pray even against the sweets of sin.
Here, I. David desires to be told of his faults. His enemies reproached him with that which was false, which he could not but complain of; yet, at the same time, he desired his friends would reprove him for that which was really amiss in him, particularly if there was any thing that gave the least colour to those reproaches (Psa 141:5): let the righteous smite me; it shall be a kindness. The righteous God (so some); "I will welcome the rebukes of his providence, and be so far from quarrelling with them that I will receive them as tokens of love and improve them as means of grace, and will pray for those that are the instruments of my trouble." But it is commonly taken for the reproofs given by righteous men; and it best becomes those that are themselves righteous to reprove the unrighteousness of others, and from them reproof will be best taken. But if the reproof be just, though the reprover be not so, we must make a good use of it and learn obedience by it. We are here taught how to receive the reproofs of the righteous and wise. 1. We must desire to be reproved for whatever is amiss in us, or is done amiss by us: "Lord, put it into the heart of the righteous to smite me and reprove me. If my own heart does not smite me, as it ought, let my friend do it; let me never fall under that dreadful judgment of being let alone in sin." 2. We must account it a piece of friendship. We must not only bear it patiently, but take it as a kindness; for reproofs of instruction are the way of life (Pro 6:23), are means of good to us, to bring us to repentance for the sins we have committed, and to prevent relapses into sin. Though reproofs cut, it is in order to a cure, and therefore they are much more desirable than the kisses of an enemy (Pro 27:6) or the song of fools, Ecc 7:5. David blessed God for Abigail's seasonable admonition, Sa1 25:32. 3. We must reckon ourselves helped and healed by it: It shall be as an excellent oil to a wound, to mollify it and close it up; it shall not break my head, as some reckon it to do, who could as well bear to have their heads broken as to be told of their faults; but, says David, "I am not of that mind; it is my sin that has broken my head, that has broken my bones, Psa 51:8. The reproof is an excellent oil, to cure the bruises sin has given me. It shall not break my head, if it may but help to break my heart." 4. We must requite the kindness of those that deal thus faithfully, thus friendly with us, at least by our prayers for them in their calamities, and hereby we must show that we take it kindly. Dr. Hammond gives quite another reading of this verse: "Reproach will bruise me that am righteous, and rebuke me; but that poisonous oil shall not break my head (shall not destroy me, shall not do me the mischief intended), for yet my prayer shall be in their mischiefs, that God would preserve me from them, and my prayer shall not be in vain."
II. David hopes his persecutors will, some time or other, bear to be told of their faults, as he was willing to be told of his (Psa 141:6): "When their judges" (Saul and his officers who judged and condemned David, and would themselves be sole judges) "are overthrown in stony places, among the rocks in the wilderness, then they shall hear my words, for they are sweet." Some think this refers to the relentings that were in Saul's breast when he said, with tears, Is this thy voice, my son David? Sa1 24:16; Sa1 26:21. Or we may take it more generally: even judges, great as they are, may come to be overthrown. Those that make the greatest figure in this world do not always meet with level smooth ways through it. And those that slighted the word of God before will relish it, and be glad of it, when they are in affliction, for that opens the ear to instruction. When the world is bitter the word is sweet. Oppressed innocency cannot gain a hearing with those that live in pomp and pleasure, but when they come to be overthrown themselves they will have more compassionate thoughts of the afflicted.
III. David complains of the great extremity to which he and his friends were reduced (Psa 141:7): Our bones are scattered at the grave's mouth, out of which they are thrown up, so long have we been dead, or into which they are ready to be thrown, so near are we to the pit; and they are as little regarded as chips among the hewers of wood, which are thrown in neglected heaps: As one that cuts and cleaves the earth (so some read it), alluding to the ploughman who tears the earth in pieces with his plough-share, Psa 129:3. Can these dry bones live?
IV. David casts himself upon God, and depends upon him for deliverance: "But my eyes are unto thee (Psa 141:8); for, when the case is ever so deplorable, thou canst redress all the grievances. From thee I expect relief, bad as things are, and in thee is my trust." Those that have their eye towards God may have their hopes in him.
V. He prays that God would succour and relieve him as his necessity required. 1. That he would comfort him: "Leave not my soul desolate and destitute; still let me see where my help is." 2. That he would prevent the designs of his enemies against him (Psa 141:9): "Keep me from being taken in the snare they have laid for me; give me to discover it and to evade it." Be the gin placed with ever so much subtlety, God can and will secure his people from being taken in it. 3. That God would, in justice, turn the designs of his enemies upon themselves, and, in mercy, deliver him from being ruined by them (Psa 141:10): let the wicked fall into their own net, the net which, intentionally, they procured for me, but which, meritoriously, they prepared for themselves. Nec lex est justioir ulla quam necis artifices arte perire sua - No law can be more just than that the architects of destruction should perish by their own contrivances. All that are bound over to God's justice are held in the cords of their own iniquity. But let me at the same time obtain a discharge. The entangling and ensnaring of the wicked sometimes prove the escape and enlargement of the righteous. | <urn:uuid:b578b317-4894-4fb4-ab3e-764ae525b306> | CC-MAIN-2017-04 | http://sacred-texts.com/bib/cmt/henry/psa141.htm | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280587.1/warc/CC-MAIN-20170116095120-00563-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.979133 | 2,887 | 2.421875 | 2 |
If you are in a classroom that uses 1:1 mobile devices, I hope you have experienced an amazing transformation in the way that students and teachers are able to participate in learning. In my 15 years of teaching, nothing has changed my perspective and approach more than the moment when my students all received their own personal i-Pad. I have heard a lot of tech experts talk about how important it is to be a paperless classroom. While this is a novel and green idea, that’s not my goal. Don’t get me wrong. I have definitely printed fewer documents and I have mad love for the environment. But my daily goal is to harness the power of technology in order to enhance the way my students learn, share, and explore in my classroom. Whether your classroom has i-Pads, chrome books, or BYOD; the potential for a revolutionary change in learning exists!
With the help of the i-Pad, I am able to explore pathways of communication that were previously unavailable. One of my favorite relevant apps is edmodo. It is like Facebook for the classroom and it is definitely our home base. I use it to post directions, assignments, links, files, electronic quizzes, pictures, and videos. The difference maker, however, is that students are also able to make posts. With edmodo, I can ask a question to the class and everyone can answer at once. The important thing here is that everyone can answer. As the teacher, it is my job to find out what my students know. Asking a question and simply calling on a few students until I hear the answer I’m looking for is superficial and ineffective feedback. Providing a quick, efficient method for all students to participate provides me with a greater insight into what each student can do. It makes it possible for me to plan more effective lessons because I know where each student needs me to guide them.
Allowing students to post on edmodo also levels the playing field. As a former student, I know that in most classrooms it was easy to hide during lessons if I just kept quiet. My experience as a teacher has shown me that the shy student who never raises his hand to answer a question suddenly finds his voice on a mobile device. Since edmodo chats are electronic, I also have a record of students’ answers. This allows me to go back later and “review the tape” in order to analyze performance. Teachers worried about students simply copying an answer that has already been posted can adjust the setting s to moderate all posts. To be honest, I haven’t had that issue in my classroom, but I get that question a lot. What I’ve witnessed is that students feed off of each other and it leads to some magnificently engaging, electronic discussions. After all, I do not want my students to simply know the answer. I want them to demonstrate learning by being able to talk about it.
Mobile devices have enabled me to considerably change the way I assess my students. Using the socrative app, students can take quizzes and immediately receive feedback. I consider myself to be a quick grader by returning assignments and tests the next day. But I simply cannot compete with immediate results. Technology wins. I still give old-fashioned tests with paper and pencil. But by consistently embedding short socrative quizzes in my lessons, I am able to plan more effectively and better meet the needs of my learners. I can differentiate my teaching because I know the specific needs of my students in real time, before I continue. The icing on the cake is that my students usually think we are playing a game when using socrative. I obviously don’t mind. Socrative also stores results for each student which can be accessed at any time. In other words, pull them up at conference time or copy and paste them into your grade book for a minor assessment.
Edmodo is also great for assessment. My 3rd graders learn quickly how to access files, write comments, and post pictures and videos in edmodo. Students can post videos of themselves performing a task, reading for fluency, or explaining how they solved a math problem. Students can post pictures of science projects, completed word sorts, or multi-step math problems that require drawings. These methods lend themselves to being more authentic and revealing than a multiple choice or short response test. One such example occurred when my students were studying the properties of shapes. I wanted to see where they stood in their understanding of squares. My task was for them to find a square in the classroom, take a photo, and post it to edmodo with a description of what makes it a square.
Some students nailed it. Others were missing information about right angles. Others still forgot to mention 4 equal sides. Not only did I know who knew what, but I was able to pair up students who mentioned sides, but forgot angles with students who did the opposite. They compared pictures and words and there were a lot of “oh yeah, that’s right” kind of moments. Not only that, they were teaching each other. Win-win!
My favorite evidence of knowledge from that activity came from the girl who found a square, photographed it, and then said she really wasn’t sure. On a multiple choice test, she could have very easily gotten it correct. She knew what a square looked like, but her depth of knowledge ended there. Her picture and caption helped me understand exactly where she and I needed to go next in her learning journey.
I love collaboration and discussions in my classroom, especially when students are leading the way. So, during math lessons I often ask my students to work in groups to solve word problems or multi-step problems. I give them paper and markers because they still love these supplies. They talk it out, work out the problem, and show all their work. Since they’re using markers, they get into it with the drawings and explanations. Then one member of the group takes a picture of the finished product and posts it to the edmodo feed I began specifically for this task. As a class we are then able to view every groups’ response in my edmodo feed displayed on the SMART board. Right away. Together. Large! It is big enough for all to see it easily and we can also continue to write on it. The discussion continues about each one, and I can even leave a comment. For the paperless fans, I guess it helps me save on my chart paper. But the idea here is that we save time trying to stick it to the wall somewhere and we are able to view it even larger on the screen. There is also an added element of excitement due to the fact that students are taking a picture which shows up on the screen. It also saves the work to be viewed again later because it is in everyone’s edmodo feed.
The use of mobile technology has infiltrated the environment of my classroom and I love it. It’s not about adding an app to the end of a lesson or playing a game to review. It’s about changing the way things are done. My students are so familiar with mobile devices that they even make lunch choices electronically using the socrative app. My star students showcase their items and pictures with their own classflow lesson. Sometimes I even give directions without saying a word by merely holding up a little sign with the edmodo label on it. Paper still exists, but technology is alive and gaining momentum. Feedback is immediate. Communication is constant. Students are engaged and empowered! | <urn:uuid:5c4009d0-62c0-433f-9369-48a328d5c637> | CC-MAIN-2022-33 | https://positiverolemodel.wordpress.com/2015/08/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00673.warc.gz | en | 0.975163 | 1,561 | 2.421875 | 2 |
This collection of thought-provoking essays on death, dying, bereavement and legacy serve to remind us that each experience is different, yet we are not alone.
Real Life Stories about death, dying and bereavement began life as part of the huunuu virtual literary festival, held in February 2021.
Words can be helpful, they can help us to understand our part in events that can seem out of our control. Our aim by curating these real-life stories is to bring support to those reading them. We all have messy big emotions that can be hard to navigate. By sharing, we can begin to understand that we are in this thing called life (and death) together.
These stories and more will be curated into a collection later this year, which we hope to share with a wider audience.
If you'd like to contribute to our collection, please email: firstname.lastname@example.org with Real Life Stories in the subject header. We are ideally looking at a piece of 800 words long up to 2000. If you would like some further guidance before submitting, please ask us at the email address above.
If you've been affected by any of the existing stories and would like to access grief support, we can recommend:
We will be holding a beginners writing workshop to help you prepare your own story, with author and proud huunuuer Cherry Williams. May 18th at 10am Tickets available here: https://www.eventbrite.co.uk/e/real-life-stories-workshop-tickets-145278942227 | <urn:uuid:2e08435e-9639-4284-a6a2-4441693e7f03> | CC-MAIN-2022-33 | https://huunuu.com/blog/real-life-stories/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571090.80/warc/CC-MAIN-20220809215803-20220810005803-00069.warc.gz | en | 0.947944 | 323 | 1.757813 | 2 |
When a business has a higher level of management that make the executive decisions, sometimes it can be hard on them. They are the people that are the face of the business, who make the decisions and who it falls back on when something goes wrong. A management team is made up of executives that have the experience and knowledge within the industry, however this does not mean that they are invincible or that people will not turn to them if an incident occurs.
With the decisions that management needs to make, there can be times when the decision that they make does not turn out the way they planned. There may be people that are not happy with the decisions that they have made. Sometimes the decisions can be the wrong one and it can cause concerns for the business and the running of it. If the decisions made have a negative effect on the clients and customers, it can be stressful for the business and the growth of the business.
Management Liability insurance covers these decisions and any negative results that come from them.
Management liability insurance can assist and cover incidents that arise from the decisions that are made. A few of the things that it can cover include:
- Employment: If a decision is made about employment and the decision in turn has a negative effect on the business, you may be able to make a claim through your insurance. This can include incidents such as an employee making a complaint after feeling they were unfairly dismissed, a potential employee making a complaint that they did not receive the position due to personal judgement and having to cover the costs of employees if a decision in regards to the business goes wrong.
- Mismanagement: Mismanagement is something that may happen in a business where there is a management team and employees that work under them. If an employee feels that they have been mistreated and discriminated against, they might put in a complaint. Mismanagement can also extend to management making decisions for the business such as investing, changing directions, and choosing new suppliers. If these decisions have not been made with the utmost thought and knowledge it can have negative effects on the business and be considered mismanagement.
- Theft or damage: If theft to products, office equipment or machinery happens due to the decisions that are made by management, you may be able to make a claim through your insurance for the replacement of these items. This can also extend to equipment or machinery becoming damaged due to ill decisions being made, such as letting an untrained employee use the equipment.
- Financial loss: If the decisions made by management result in a large financial loss for the business you may be eligible for compensation through your insurance policy.
If the incident in question results in needing to conduct an audit or have a legal team hired, you may be able to claim the costs of this through your insurance, along with any compensation that may need to be paid to an employee or supplier. | <urn:uuid:ec067f82-9eeb-4cd3-aa0b-52b634cf4ff4> | CC-MAIN-2022-33 | https://www.phoenixriskservices.com.au/insurance/business/management-liability/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571982.99/warc/CC-MAIN-20220813172349-20220813202349-00071.warc.gz | en | 0.97469 | 574 | 2.0625 | 2 |
2013 September - The Leading Edge
IPCC AR5 WGI Released at the End of September
OSS will feature IPCC AR5 in the October issue of the Leading Edge. The graphics associated with the AR5 WGI report are expected to be released before the end of October.
Bjorn Lomborg continues to cherry pick the evidence base.
In a new article in the Washington Post called 'Don’t blame climate change for extreme weather' Bjorn continues to miss relevant points. One might say he has taken a psuedo-denialist position on climate change. Now that the government of Denmark has removed funding from his organization one wonders who is funding his skepticism these days or if he is now handling that based on his 'controversy value' achieved by placing his argument in areas where it is partially true based on a limited scope evaluation of the argument and incorrect or irrelevant context, based on either his ignorance or misunderstanding of relevant studies and evidence, or his inability to understand the reality of the evidence available.
Based on the evidence his opinions should not be trusted regarding climate change and the economy for public understanding.
In Bjorn's latest misconstruction of facts we see how he misses relevance and cherry picks statements to make his case using non sequitur arguments to support his misunderstanding.
Bjorn: "The total impact is likely to be less than 0.1 percent of global economic output."
R.J. Nicholls, of who is one of the author's of the paper Lomborg cites (out of context) gives context to the statements Lomborg is asserting:
"...just reporting the numbers is simplifying a complex message."
However, it is more important to note that Lomborg's cherry picking excludes too many factors to support his statements. This is similar to other scientists that have made claims that exceed the scope of the research. The Svensmark example comes to mind.
Beyond that Lomborg also has chosen a paper that examines a low impact scenario, whereas the best science available is for higher levels of sea level rise than considered in Lomborg's example.
It is easy to say not all the impacts from global warming will be bad. But without relevant context that statement is as misleading as any other misinformation that exists that is unsupportable by evidence or reason.
I could continue and take apart all his points, and maybe I will at some point, but in general facts out of context just are not intelligent. From that perspective one wonders why any one is still listening to Bjorn Lomborg?
Remarks from Nicholls:
"I think that this quote (from Lomborg) understates the impacts as our analysis reflects only coastal zones, considers quite small SLR scenarios, and as we state clearly in the discussion it is an incomplete analysis. It is also dependent As the quote is linked to a paragraph which also discusses drought -- this may also be misinterpreted that we talk about drought and sea level rise. My earlier email gave a lot more relevant information."
"Anthoff, David, Nicholls, Robert J. and Tol, Richard S.J. (2010) The economic impact of substantial sea-level rise.<http://eprints.soton.ac.uk/181657/> Mitigation and Adaptation Strategies for Global Change, 15, (4), 321-335. (doi:10.1007/s11027-010-9220-7<http://dx.doi.org/10.1007/s11027-010-9220-7>). This shows higher costs than the earlier paper -- not surprisingly -- and again includes a nuanced discussion which interprets the insights from the work and points a number of caveats and hence questions for further research. Hence just reporting the numbers is simplifying a complex message.
On the other hand, our results do suggest lower costs than are widely reported and emphasize the great potential benefits of adaptation and protection in particular in reducing costs (see for example the recent Hallegatte et al 2013 paper on flooding in coastal cities in Nature Climate Change ). The barriers to such adaptation and the factors that contribute to success or failure remains an important research question which we continue to investigate."
For context on this last statement one needs to understand that the SLR assessment also does not include a multitude of other impacts that will also be affecting various economies.
For example: With a more acidic ocean many extinctions are expected and the structure of the food web in the ocean will be significantly altered. On the positive side, if you can call it that, more jelly fish are expected along with more sharks as these animals may thrive in a more acidic ocean.
The more interesting issue are the impacts for crops. Agriculture is expected to suffer from the increasing number of days where crop thermal limits are exceed with will significantly impact yield production.
EMS/ECAM Meeting/Conference Reading, U.K.
The EMS/ECAM was held between Sept. 9th and 13th. The gathering is interesting because it brings together the weather and climate communities in sessions and discussion panels. Through this integration it is apparent that both communities are benefiting from the interchange by learning and growing in understanding of the weather/climate interface.
Adaptation/Mitigation on Sale Now!!!
One interesting message that was heard at the conference was that climate mitigation and adaptation are on sale now, however they will become increasingly more expensive in the future.
'Known Unknowns' and 'Unknown Knowns'
In honor of Donal Rumsfeld's famous 'unknown unknowns' speech a speaker (I think this was Gerald Fleming) discussed the consequences of known unknowns and unknown knowns giving context to the ability of important aspects of science that are accepted science that non scientists don't understand. The issue generally is that what scientists have in their foundational thought is largely unknown to an audience that one might be addressing. There was a lot more to the talk though and it was very interesting as exemplified by the packed room.
Summary & Images From Meeting:
The 2013 EMS/ECAM was yet another wonderful opportunity for scientists and professionals to come together and discuss difficult issues and share new understanding. It's amazing how useful the free flow of ideas and topical presentations can be to furthering our ability to learn and communicate the complexities involved in weather and climate science.
Photographer: Jon Bradley
Haleh Kootval, WMO; Tanja Cegnar, Slovenian Environment Agency
John Hirst, U.K. Met.
John Reisman, OSS Foundation
Gerald Fleming, Ireland Met.
Rasmus Benestad, Met. Norway
Alan Thorpe, ECMWF | <urn:uuid:923d661b-1a31-4ac0-a0e1-a81820b5d77e> | CC-MAIN-2017-04 | http://www.ossfoundation.us/projects/environment/global-warming/summary-docs/leading-edge/2013/sep-the-leading-edge | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281419.3/warc/CC-MAIN-20170116095121-00482-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.95251 | 1,363 | 2.1875 | 2 |
Thursday 6th October, 2011
9:00am to 10:00am
The Internet sits at the head of a long table of technologies that have revolutionised our world. Built on top of the base Internet stack, the World Wide Web has further democratised access to information, opened hitherto closed doors to human self-expression and communication, and laid the foundations of a semantically-rich and interconnected body of knowledge the likes of which have never been seen before.
So the Internet is a Big Thing™. And, both by association as well as by personal merit, so is the web.
And yet, on most devices, the web is currently a second-class citizen confined to life inside another application: the browser.
Furthermore, as pervasive and unstoppable as its progress may seem, the web can still be lost if we don’t temper ideological extremisms that preach ‘the one web’ above all else, including pragmatism and user experience.
In this (no doubt rather controversial) session, Aral Balkan will outline the essential role of user experience in our age and demonstrate how the web must embrace user experience if it is to compete with native. Flawed ‘native is laserdisc’ analogies will be shattered as Aral demonstrates how, in the Age of User Experience, the only possible future is a native one where focused, optimised, and expertly-crafted experiences empower, delight, and thrill users.
Sign in to add slides, notes or videos to this session | <urn:uuid:d8303ddc-6870-42a8-81fc-4ab2468ea21d> | CC-MAIN-2017-04 | http://lanyrd.com/2011/fronteers/shtrc/ | s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279189.36/warc/CC-MAIN-20170116095119-00062-ip-10-171-10-70.ec2.internal.warc.gz | en | 0.92875 | 310 | 1.921875 | 2 |
When I was struggling to write, in the mid-2000s, I found a writing coach. I could tell he would be able to help me where so many other people and approaches had failed.
There was just one problem: he charged A LOT more than I had ever spent.
The amount scared me. I didn’t think I could do it.
My boyfriend at the time wasn’t hearing it. “You have to do this,” he said. “You are going to work with this guy–even if you have to take out a home equity loan to do it.”
His words had a big effect on me. As a child of first-generation immigrants who scrimped and saved, it was foreign and scary to me to take out a loan out to pay for creativity. (“Borrowing against your home! How irresponsible!” the immigrant voices inside me shrilled.)
But my boyfriend said, “You’ll make it back. You’ll pay it off. You HAVE to work with this guy because you HAVE to break your block and write.”
He was so serious and so certain–it really got me. I recognized: he was right. I DID have to do this. My soul required it.
(I don’t mean ‘I was broken and this coach could fix me, so I had no choice.’ What I mean is, there are some things so important to us, so core to who we are, that we MUST fulfill them. Writing was that for me. Whatever it took to get me writing again, I would do.)
So I took a deep breath and chose: I would work with this coach.
As it turned out, I didn’t have to take out a home equity loan. Once I made the choice, I found it much easier to pay for than I had expected.
(Side note: In the intervening years, I’ve found this phenomenon to hold true again and again, for me and for clients: once you CHOOSE and COMMIT, the way opens.
Corollary truth: The way does NOT come from thinking, “I’ll save up and try to make more, and if I have the money, I’ll do it.”
Decision and commitment open your eyes to new opportunity (and sources of money). Excessive caution and hanging back focus your eyes on lack of money–and that perpetuates more of the same.)
This is key: The WILLINGNESS to do what it took opened the way. The willingness to do the scary thing I would never have considered before. The willingness to listen past the fear… to my soul’s imperative. And the willingness to make that bold commitment with my emotions and my money.
Yes, I DID break my writer’s block then. And what that did for my self-esteem is beyond words.
I was flying. Triumphant. Powerful.
Also, much more simply: I was capable. I believed in myself again.
And that is priceless.
P.S. As a side note, the results were priceless, AND there was money. 🙂 Within a few years, using the same power of commitment and choice, I also tripled my income–but that’s a topic for another post.
P.P.S. If you recognize the feeling of I MUST DO WHAT IT TAKES,” let’s talk. That is a message from your soul. Something in you is calling for you to break through your block–and to do it now.
I’m offering a new 1:1 program called TRUE CREATIVE SUCCESS. It’s designed specifically to help you break through what’s been holding you back for years, so you can do your TRUE creative work and take a DRAMATIC leap in your career and income. This is a program for talented, ambitious creative people who will do what it takes. Email me now to find out more. | <urn:uuid:3818fe70-00e4-4b67-ad84-fdecb6fc5c05> | CC-MAIN-2022-33 | https://creativewitchery.net/2018/08/my-story-how-i-did-what-it-took-to-break-my-writers-block/ | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572043.2/warc/CC-MAIN-20220814143522-20220814173522-00478.warc.gz | en | 0.980783 | 847 | 1.5625 | 2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.