source
stringlengths 31
227
| text
stringlengths 9
2k
|
|---|---|
https://en.wikipedia.org/wiki/Maneb
|
Maneb is a fungicide and a polymeric complex of manganese with the ethylene bis(dithiocarbamate) anionic ligand.
Applications
It can be also used to create a toxin-based animal model of Parkinson's disease, usually in primates.
Regulation
It was included in a pesticide ban proposed by the Swedish Chemicals Agency and approved by the European Parliament on January 13, 2009.
See also
Metam sodium - A related dithiocarbamate salt which is also used as a fungicide.
Zineb - ethylene bis(dithiocarbamate) with zinc instead of manganese.
Mancozeb - A common fungicide containing Zineb and Maneb.
|
https://en.wikipedia.org/wiki/Continuous%20symmetry
|
In mathematics, continuous symmetry is an intuitive idea corresponding to the concept of viewing some symmetries as motions, as opposed to discrete symmetry, e.g. reflection symmetry, which is invariant under a kind of flip from one state to another. However, a discrete symmetry can always be reinterpreted as a subset of some higher-dimensional continuous symmetry, e.g. reflection of a 2 dimensional object in 3 dimensional space can be achieved by continuously rotating that object 180 degrees across a non-parallel plane.
Formalization
The notion of continuous symmetry has largely and successfully been formalised in the mathematical notions of topological group, Lie group and group action. For most practical purposes continuous symmetry is modelled by a group action of a topological group that preserves some structure. Particularly, let be a function, and G is a group that acts on X then a subgroup is a symmetry of f if for all .
One-parameter subgroups
The simplest motions follow a one-parameter subgroup of a Lie group, such as the Euclidean group of three-dimensional space. For example translation parallel to the x-axis by u units, as u varies, is a one-parameter group of motions. Rotation around the z-axis is also a one-parameter group.
Noether's theorem
Continuous symmetry has a basic role in Noether's theorem in theoretical physics, in the derivation of conservation laws from symmetry principles, specifically for continuous symmetries. The search for continuous symmetries only intensified with the further developments of quantum field theory.
See also
Goldstone's theorem
Infinitesimal transformation
Noether's theorem
Sophus Lie
Motion (geometry)
Circular symmetry
|
https://en.wikipedia.org/wiki/Daptomycin
|
Daptomycin, sold under the brand name Cubicin among others, is a lipopeptide antibiotic used in the treatment of systemic and life-threatening infections caused by Gram-positive organisms.
Daptomycin was removed from the World Health Organization's List of Essential Medicines in 2019. The World Health Organization classifies daptomycin as critically important for human medicine.
Medical uses
In the United States, daptomycin is indicated for use in adults for skin and skin structure infections caused by Gram-positive infections, S. aureus bacteraemia, and right-sided S. aureus endocarditis. It binds avidly to pulmonary surfactant, so cannot be used in the treatment of pneumonia. There seems to be a difference in working daptomycin on hematogenous pneumonia.
Adverse effects
Common adverse drug reactions associated with daptomycin therapy include:
Cardiovascular: low blood pressure, high blood pressure, swelling
Central nervous system: insomnia
Dermatological: rash
Gastrointestinal: diarrhea, abdominal pain
Hematological: eosinophilia
Respiratory: dyspnea
Other: injection site reactions, fever, hypersensitivity
Less common, but serious adverse events reported in the literature include
Hepatotoxicity: elevated transaminases
Nephrotoxicity: acute kidney injury from rhabdomyolysis
Also, myopathy and rhabdomyolysis have been reported in patients simultaneously taking statins, but whether this is due entirely to the statin or whether daptomycin potentiates this effect is unknown. Due to the limited data available, the manufacturer recommends that statins be temporarily discontinued while the patient is receiving daptomycin therapy. Creatine kinase levels are usually checked regularly while individuals undergo daptomycin therapy.
In July 2010, the FDA issued a warning that daptomycin could cause life-threatening eosinophilic pneumonia. The FDA said it had identified seven confirmed cases of eosinophilic pneumonia between 2004 and 2010 and an additional 36 p
|
https://en.wikipedia.org/wiki/Metalink
|
Metalink is an extensible metadata file format that describes one or more computer files available for download. It specifies files appropriate for the user's language and operating system; facilitates file verification and recovery from data corruption; and lists alternate download sources (mirror URIs).
The metadata is encoded in HTTP header fields and/or in an XML file with extension or . The duplicate download locations provide reliability in case one method fails. Some clients also achieve faster download speeds by allowing different chunks/segments of each file to be downloaded from multiple resources at the same time (segmented downloading).
Metalink supports listing multiple partial and full file hashes along with PGP signatures. Most clients only support verifying MD5, SHA-1, and SHA-256, however. Besides FTP and HTTP mirror locations and rsync, it also supports listing the P2P methods BitTorrent, ed2k, magnet link or any other that uses a URI.
Development history
Metalink 3.0 was publicly released in 2005. It was designed to aid in downloading Linux ISO images and other large files on release day, when servers would be overloaded (each server would have to be tried manually) and to repair large downloads by replacing only the parts with errors instead of fully re-downloading them. It was initially adopted by download managers, and was used by open source projects such as OpenOffice.org and Linux distributions. A community developed around it, more download programs supported it (including proprietary ones) and it saw commercial adoption. In 2008, the community took their work to the Internet Engineering Task Force which resulted in Metalink 4.0 in 2010, described in a Standards Track RFC. Metalink 3.0 (with the extension ) and Metalink 4.0 (with the extension ) are incompatible because they have a slightly different format. In 2011, another Standards Track RFC described Metalink in HTTP header fields.
Client programs
Client libraries
libmetalink (
|
https://en.wikipedia.org/wiki/Multiplicative%20inverse
|
In mathematics, a multiplicative inverse or reciprocal for a number x, denoted by 1/x or x−1, is a number which when multiplied by x yields the multiplicative identity, 1. The multiplicative inverse of a fraction a/b is b/a. For the multiplicative inverse of a real number, divide 1 by the number. For example, the reciprocal of 5 is one fifth (1/5 or 0.2), and the reciprocal of 0.25 is 1 divided by 0.25, or 4. The reciprocal function, the function f(x) that maps x to 1/x, is one of the simplest examples of a function which is its own inverse (an involution).
Multiplying by a number is the same as dividing by its reciprocal and vice versa. For example, multiplication by 4/5 (or 0.8) will give the same result as division by 5/4 (or 1.25). Therefore, multiplication by a number followed by multiplication by its reciprocal yields the original number (since the product of the number and its reciprocal is 1).
The term reciprocal was in common use at least as far back as the third edition of Encyclopædia Britannica (1797) to describe two numbers whose product is 1; geometrical quantities in inverse proportion are described as in a 1570 translation of Euclid's Elements.
In the phrase multiplicative inverse, the qualifier multiplicative is often omitted and then tacitly understood (in contrast to the additive inverse). Multiplicative inverses can be defined over many mathematical domains as well as numbers. In these cases it can happen that ; then "inverse" typically implies that an element is both a left and right inverse.
The notation f −1 is sometimes also used for the inverse function of the function f, which is for most functions not equal to the multiplicative inverse. For example, the multiplicative inverse is the cosecant of x, and not the inverse sine of x denoted by or . The terminology difference reciprocal versus inverse is not sufficient to make this distinction, since many authors prefer the opposite naming convention, probably for historical reasons (for
|
https://en.wikipedia.org/wiki/Dirty%20kitchen
|
A dirty kitchen is an outdoor kitchen in the Philippines, Kuwait, Bahrain and many other West Asian countries either separate from or adjoining the main house, with the reasons for its isolation or separation including fire safety, keeping the smoke and fuel smell out, and keeping charcoal dust and oil grime out.
Rural versions of the dirty kitchen have firewood-run stoves on kitchen tables literally made of dirt.
|
https://en.wikipedia.org/wiki/Stefan%20Mazurkiewicz
|
Stefan Mazurkiewicz (25 September 1888 – 19 June 1945) was a Polish mathematician who worked in mathematical analysis, topology, and probability. He was a student of Wacław Sierpiński and a member of the Polish Academy of Learning (PAU). His students included Karol Borsuk, Bronisław Knaster, Kazimierz Kuratowski, Stanisław Saks, and Antoni Zygmund. For a time Mazurkiewicz was a professor at the University of Paris; however, he spent most of his career as a professor at the University of Warsaw.
The Hahn–Mazurkiewicz theorem, a basic result on curves prompted by the phenomenon of space-filling curves, is named for Mazurkiewicz and Hans Hahn. His 1935 paper Sur l'existence des continus indécomposables is generally considered the most elegant piece of work in point-set topology.
During the Polish–Soviet War (1919–21), Mazurkiewicz as early as 1919 broke the most common Russian cipher for the Polish General Staff's cryptological agency. Thanks to this, orders issued by Soviet commander Mikhail Tukhachevsky's staff were known to Polish Army leaders. This contributed substantially, perhaps decisively, to Polish victory at the critical Battle of Warsaw and possibly to Poland's survival as an independent country.
See also
Biuro Szyfrów
List of Polish mathematicians
External links
1888 births
1945 deaths
Warsaw School of Mathematics
People from Warsaw Governorate
Polish cryptographers
Topologists
Academic staff of the University of Paris
Academic staff of the University of Warsaw
Mathematical analysts
Cipher Bureau (Poland)
University of Warsaw alumni
|
https://en.wikipedia.org/wiki/RSSOwl
|
RSSOwl is a news aggregator for RSS and Atom news feeds. It is written in Java and built on the Eclipse Rich Client Platform which uses SWT as a widget toolkit to allow it to fit in with the look and feel of different operating systems while remaining cross-platform. Released under the EPL-1.0 license, RSSOwl is free software.
In addition to its full text searches, saved searches, notifications and filters, RSSOwl v2.1 synchronized with the now discontinued Google Reader.
History
RSSOwl began as small project on SourceForge at the end of July 2003. The first public version was 0.3a.
Version 1.0
RSSOwl 1.0 was released on December 19, 2001. It was released with support for RSS and Atom news feeds. The initial release also supported exporting feeds to PDF, RTF, and HTML. This release was available for Windows, Mac, Linux, and Solaris.
RSSOwl 1.1 added support for toolbars and quick search in news feeds. Version 1.2 improved toolbar customization and added support for Atom 1.0 News feeds. Versions 1.2.1 and 1.2.2 added universal binary support for mac as well as drag and drop for tabs and a built-in feed validator. RSSOwl was the SourceForge Project of the Month for January 2005.
Version 2.0
RSSOwl 2.0 was announced on March 7, 2007, at EclipseCon 2007. Version 2.0 was rebuilt on the Eclipse Rich Client Platform and used db4o for database storage and Lucene for text searching. Several milestone versions were released before the final 2.0 version that added labeling of news feeds, pop-up notification of new feeds and storage of news articles in news bins. The final 2.0 version was released as milestone 9 and added support for secure password and credential storage, news filters, support for embedding Firefox 3.0 XULRunner to render news feeds, and proxy support for Windows. Version 2.1, released July 15, 2011, added Google Reader synchronization support and new layouts.
Forks
RSSOwl is no longer maintained by its original developer. However, a maintained fork of i
|
https://en.wikipedia.org/wiki/Flat-field%20correction
|
Flat-field correction (FFC) is a digital imaging technique to mitigate the image detector pixel-to-pixel sensitivity and distortions in the optical path. It is a standard calibration procedure in everything from personal digital cameras to large telescopes.
Overview
Flat fielding refers to the process of compensating for different gains and dark currents in a detector. Once a detector has been appropriately flat-fielded, a uniform signal will create a uniform output (hence flat-field). This then means any further signal is due to the phenomenon being detected and not a systematic error.
A flat-field image is acquired by imaging a uniformly-illuminated screen, thus producing an image of uniform color and brightness across the frame. For handheld cameras, the screen could be a piece of paper at arm's length, but a telescope will frequently image a clear patch of sky at twilight, when the illumination is uniform and there are few, if any, stars visible. Once the images are acquired, processing can begin.
A flat-field consists of two numbers for each pixel, the pixel's gain and its dark current (or dark frame). The pixel's gain is how the amount of signal given by the detector varies as a function of the amount of light (or equivalent). The gain is almost always a linear variable, as such the gain is given simply as the ratio of the input and output signals. The dark-current is the amount of signal given out by the detector when there is no incident light (hence dark frame). In many detectors this can also be a function of time, for example in astronomical telescopes it is common to take a dark-frame of the same time as the planned light exposure. The gain and dark-frame for optical systems can also be established by using a series of neutral density filters to give input/output signal information and applying a least squares fit to obtain the values for the dark current and gain.
where:
C = corrected image
R = raw image
F = flat field image
D = dark field or da
|
https://en.wikipedia.org/wiki/Border%20states%20%28Eastern%20Europe%29
|
Border states, or European buffer states, were the European nations that won their independence from the Russian Empire after the Bolshevik Revolution of 1917, the Treaty of Brest-Litovsk and ultimately the defeat of the German Empire and Austria-Hungary in World War I. During the interwar period, the nations of Western Europe implemented a border states policy, which aimed at uniting them in protection against the Soviet Union and communist expansionism. The border states were interchangeably Finland, Estonia, Latvia, Lithuania, Poland, Romania and, until their annexation into the Soviet Union, short-lived Belarus and Ukraine.
The policy tended to see the border states as a cordon sanitaire, or buffer states, separating Western Europe from the newly formed Soviet Union. The policy was very successful. At the time, Soviet foreign policy was driven by the Trotskyist idea of permanent revolution, the end goal of which was to spread communism worldwide through perpetual warfare. However, the Soviet advance to the west was halted by Poland, which managed to defeat the Red Army during the Polish–Soviet War. After the war, Polish leader Józef Piłsudski made attempts to unify the border states under a federation called Intermarium, but disputes and different allegiances between and within the group of states prevented such a thing from happening, leaving them more susceptible to possible incursions by their more powerful neighbors. The matter was further complicated by the rise of the expansionist Nazi Germany to the west. In 1939, Germany and the Soviet Union signed the Molotov–Ribbentrop Pact, which included a secret clause that sanctioned the partitioning of several border states between the two regimes in the event of war. Only nine days after the pact was signed, Nazi Germany invaded Poland, and the Soviets followed suit shortly after, beginning World War II in Europe. After the end of the war, all border states except for Finland were transferred to Soviet occupatio
|
https://en.wikipedia.org/wiki/Pyrodictiaceae
|
The Pyrodictiaceae are a family of disc-shaped anaerobic microorganisms belonging to the order Desulfurococcales, in the domain Archaea. Members of this family are distinguished from the other family (Desulfurococcaceae) in the order Desulfurococcales by having an optimal growth temperature above 100 °C, rather than below 100 °C.
Phylogeny
The currently accepted taxonomy is based on the List of Prokaryotic names with Standing in Nomenclature (LPSN) and National Center for Biotechnology Information (NCBI).
See also
List of Archaea genera
|
https://en.wikipedia.org/wiki/Internet%20of%20Military%20Things
|
The Internet of Military Things (IoMT) is a class of Internet of things for combat operations and warfare. It is a complex network of interconnected entities, or "things", in the military domain that continually communicate with each other to coordinate, learn, and interact with the physical environment to accomplish a broad range of activities in a more efficient and informed manner. The concept of IoMT is largely driven by the idea that future military battles will be dominated by machine intelligence and cyber warfare and will likely take place in urban environments. By creating a miniature ecosystem of smart technology capable of distilling sensory information and autonomously governing multiple tasks at once, the IoMT is conceptually designed to offload much of the physical and mental burden that warfighters encounter in a combat setting.
Over time, several different terms have been introduced to describe the use of IoT technology for reconnaissance, environment surveillance, unmanned warfare and other combat purposes. These terms include the Military Internet of Things (MIoT), the Internet of Battle Things, and the Internet of Battlefield Things (IoBT).
Overview
The Internet of Military Things encompasses a large range of devices that possess intelligent physical sensing, learning, and actuation capabilities through virtual or cyber interfaces that are integrated into systems. These devices include items such as sensors, vehicles, robots, UAVs, human-wearable devices, biometrics, munitions, armor, weapons, and other smart technology. In general, IoMT devices can generally be classified into one of four categories (but the devices are meant to be ubiquitous enough to form a data fabric):
Data-carrying device: A device attached to a physical thing that indirectly connects it to the larger communication network.
Data-capturing device: A reader/writer device capable of interacting with physical things.
Sensing and actuating device: A device that can detect
|
https://en.wikipedia.org/wiki/Vicnet
|
Vicnet (Victoria's Network) was a business unit of the State Library of Victoria, Australia operating between 1994 and 2014. It was an early Australian internet service provider that provided website space and training. It was Australia's largest web host for community organisations and projects such as Skills.Net and Libraries Online. The State Library of Victoria closed Vicnet on 31 January 2014.
History
The State Library of Victoria and the Royal Melbourne Institute of Technology (RMIT) established a joint project to build a web-based publishing service and internet access provider for community organisations in 1993.
Vicnet worked with the State and federal government, private providers, the Victorian public library network and community based organisations across Victoria to address Digital Divide issues. Through a range of ICT programs Vicnet drove the roll out of public access internet points across Victoria and in the process connected every library in Victoria to the Internet for public access. To facilitate access, Vicnet staff delivered extensive training/community development programs across Victoria through government funded programs such as the Skills.net program (a program that was responsible for training more than 100,000 Victorians).
Additionally Vicnet developed an online publication platform and an extensive web directory for community and other organizations, as well as for members of the general population. Among many hundreds, Vicnet published and trained in the editing for the first web sites for the Melbourne International Comedy Festival, the Melbourne Formula One Grand Prix, the Indigenous Flora and Fauna Society, the Council on the Ageing (Victoria), The Age newspaper, and the Victorian Department of Premier and Cabinet.
With government assistance from Multimedia Victoria, Vicnet provided internet access to regional Victorian communities then out of the reach of any internet service, such as Mallacoota and Apollo Bay. With other ear
|
https://en.wikipedia.org/wiki/Activating%20protein%202
|
Activating Protein 2 (AP-2) is a family of closely related transcription factors which plays a critical role in regulating gene expression during early development.
|
https://en.wikipedia.org/wiki/Lyapunov%20function
|
In the theory of ordinary differential equations (ODEs), Lyapunov functions, named after Aleksandr Lyapunov, are scalar functions that may be used to prove the stability of an equilibrium of an ODE. Lyapunov functions (also called Lyapunov’s second method for stability) are important to stability theory of dynamical systems and control theory. A similar concept appears in the theory of general state space Markov chains, usually under the name Foster–Lyapunov functions.
For certain classes of ODEs, the existence of Lyapunov functions is a necessary and sufficient condition for stability. There is no general technique for constructing Lyapunov functions for ODEs, however, depending on formulation type, a systematic method to construct Lyapunov functions for ordinary differential equations using their most general form in autonomous cases was given by Prof. Cem Civelek. Though, in many specific cases the construction of Lyapunov functions is known. For instance, according to a lot of applied mathematicians, for a dissipative gyroscopic system a Lyapunov function could not be constructed. However, using the method expressed in the publication above, even for such a system a Lyapunov function could be constructed as per related article by C. Civelek and Ö. Cihanbegendi. In addition, quadratic functions suffice for systems with one state; the solution of a particular linear matrix inequality provides Lyapunov functions for linear systems, and conservation laws can often be used to construct Lyapunov functions for physical systems.
Definition
A Lyapunov function for an autonomous dynamical system
with an equilibrium point at is a scalar function that is continuous, has continuous first derivatives, is strictly positive for , and for which the time derivative is non positive (these conditions are required on some region containing the origin). The (stronger) condition that is strictly positive for is sometimes stated as is locally positive definite, or is locall
|
https://en.wikipedia.org/wiki/Webcam%20model
|
A webcam model (colloquially, camgirl, camboy, or cammodel) is a video performer who streams on the Internet with a live webcam broadcast. A webcam model often performs erotic acts online, such as stripping, masturbation, or sex acts in exchange for money, goods, or attention. They may also sell videos of their performances. Once viewed as a small niche in the world of adult entertainment, camming became "the engine of the porn industry," according to Alec Helmy, the publisher of XBIZ, a sex-trade industry journal.
As many webcam models operate in the comfort of their own homes, they are free to choose the amount of sexual content for their broadcasts. While most display nudity and sexually provocative behavior, some choose to remain mostly clothed and merely talk about various topics, while still soliciting payment as tips from their fans. Webcam models are predominantly women, and also include noted performers of all genders and sexualities.
Background
The conceptual artist Jenny Ringley is considered the first camgirl. In 1996, as a student at Dickinson College, Ringley created a website called "JenniCam". Her webcam was located in her dorm room and automatically photographed her every few minutes. Ringley viewed her site as a straightforward document of her life. She did not wish to filter the events that were shown on her camera, so sometimes she was shown nude or engaging in sexual behavior, including sexual intercourse and masturbation. These images were then broadcast live over the Internet. Two years later, in 1998, she divided her website's access between free and paying.
Also in 1998, a commercial site called AmandaCam was launched. Amanda's site, like Ringley's, had multiple cameras around her house, which allowed people to look in on her. However, Amanda made an important early discovery that would influence the camming industry for decades to come – that a website's popularity could be greatly increased by enabling viewers to chat with a performer
|
https://en.wikipedia.org/wiki/Mosaic%20%28film%29
|
Mosaic is a 2007 American animated superhero film about a new character created by Stan Lee. It features the voice of Anna Paquin as Maggie Nelson and with supporting roles done by Kirby Morrow, Cam Clarke, Garry Chalk, Ron Halder, and Nicole Oliver. It was released under the Stan Lee Presents banner, which is a series of direct-to-DVD animated films distributed by POW! Entertainment with Anchor Bay Entertainment. The story was by Stan Lee, with the script by former X-Men writer Scott Lobdell.
Mosaic was released on DVD on January 9, 2007, and had its television premiere on March 10, 2007, on Cartoon Network.
Plot
Aspiring young actress Maggie Nelson (Anna Paquin), who lives in New York City with her father, an Interpol agent, gains chameleon-like powers one night after she gets unknowingly caught between a severe electrical storm and a magic rune her father had brought home to study after it was found at the scene of a murder at a New York City museum. Her powers are from a secret and ancient race known as the Chameliel, who are able to hide in plain sight due to their shape shifting abilities, and she is told all about the Chameliel after meeting a young Chameliel named Mosaic (Kirby Morrow). The murder victim at the museum was a Chameliel who was killed by another Chameliel named Maniken, who is stealing some of the powerful Chameliel stones hidden around the world to use them to gain the alchemical powers of his dead wife Facade, and ruling the world. After Maniken kidnaps her father, Maggie becomes determined to help Mosaic to fight Maniken.
The two go from New York City, to the catacombs of Rome, to a large radio dish at the north magnetic pole, trying to stop Maniken, as he plans to sacrifice Maggie's father as part of a ceremony to use the Chameliel stones to transfer to Maniken the powers of his wife from her body and rule the Earth like a god. As Maniken prepares to begin the ceremony on the radio dish, Maggie uses her shape-shifting abilities with her
|
https://en.wikipedia.org/wiki/DATANET-30
|
The DATANET-30, or DN-30 for short, was a computer manufactured by General Electric designed in 1961-1963 to be used as a communications computer. It was later used as a front-end processor for data communications. It became the first front end communications computer. The names on the patent were Don Birmingham, Bob McKenzie, Bud Pine, and Bill Hill.
The first freestanding installations beginning in 1963 were Chrysler Corporation message switching systems, replacing Teletype punched tape systems. In 1964, acting as a front end processor along with an interface to the GE-225 computer, a professor at Dartmouth College developed the BASIC programming language. Multiple teletype units were attached to be the first time-sharing system.
The DATANET-30 used magnetic-core memory with a cycle time of 6.94 μs. The word size was 18 bits and memory was available in sizes of 4K, 8K, or 16K words. The system could attach up to 128 asynchronous terminals, nominally at speeds of up to "3000 bits per second" (bps), but usually limited to the 300 bps supported by standard common-carrier facilities of the time, such as Bell 103 modem.
The DATANET-30 could also operate in synchronous mode at speeds up to 2400 bps.
A Computer Interface Unit allowed the DATANET-30 to communicate with a GE-200 series computer using direct memory access (DMA). It could also attach to the I/O channel of a GE-400 series, or GE-600 series system.
An optional attachment allowed the DATANET-30 to attach GE-200 series peripherals such as disk storage, magnetic tape, or a line printer.
The system was also a general purpose computer, with a number of special-purpose hardware registers. The instruction set contained 78 instructions.
Assemblers were provided for the DATANET-30, one of which could run on the DATANET itself and one on the GE-225.
|
https://en.wikipedia.org/wiki/Balancing%20of%20rotating%20masses
|
The balancing of rotating bodies is important to avoid vibration. In heavy industrial machines such as gas turbines and electric generators, vibration can cause catastrophic failure, as well as noise and discomfort. In the case of a narrow wheel, balancing simply involves moving the center of gravity to the centre of rotation. For a system to be in complete balance both force and couple polygons should be close in order to prevent the effect of centrifugal force. It is important to design the machine parts wisely so that the unbalance is reduced up to the minimum possible level or eliminated completely.
Static balance
Static balance occurs when the centre of gravity of an object is on the axis of rotation. The object can therefore remain stationary, with the axis horizontal, without the application of any braking force. It has no tendency to rotate due to the force of gravity. This is seen in bike wheels where the reflective plate is placed opposite the valve to distribute the centre of mass to the centre of the wheel. Other examples are grindstones, discs or car wheels. Verifying static balance requires the freedom for the object to rotate with as little friction as possible.
This may be provided with sharp, hardened knife edges, adjusted to be both horizontal and parallel. Alternatively, a pair of free-running ball bearing races is substituted for each knife edge, which relaxed the horizontal and parallel requirement. The object is either axially symmetrical like a wheel or must be provided with an axle. It is slowly spun, and when it comes to rest, it will stop at a random position if statically balanced. If not, an adhesive or clip on weight is securely attached to achieve balance.
Dynamic balance
A rotating system of mass is in dynamic balance when the rotation does not produce any resultant centrifugal force or couple. The system rotates without requiring the application of any external force or couple, other than that required to support its
|
https://en.wikipedia.org/wiki/List%20of%20gig%20economy%20companies
|
The following is a list of gig economy companies. The list includes only companies that have been noted by sources as being former or current gig economy companies.
Background
The Congressional Research Service defines the "gig economy" as: the collection of markets that match providers to consumers on a gig (or job) basis in support of on-demand commerce. In the basic model, gig workers enter into formal agreements with on-demand companies to provide services to company's clients. Prospective clients request services through an Internet-based technological platform or smartphone application that allows them to search for providers or to specify jobs. Providers (gig workers) engaged by the on-demand company provide the requested service and are compensated for the jobs.
In 2019, Queensland University of Technology published a report stating 7% of Australians participate in the gig economy. 10% of the American workforce participated in the gig economy in 2018. According to a 2019 Bank of Canada report, 18% of Canadians worked in the gig economy for non-recreational reasons. Around 2018, 15% of China's workforce, representing over 110 million people, was involved in the gig economy. In 2019, the World Bank estimated that globally, fewer than 0.5% of people in the "active labor force" take part in the gig economy.
List of gig economy companies
Accommodation
Caregiving
Delivery
Grocery
Food
Education
Knowledge Work (Freelancing platforms)
Business and technical services
Creative services
Home services
Health services
Legal services
Retail
Transportation and parking
Notes
See also
Business model
Peer-to-peer
Sharing economy
Temporary work
Crowdsourcing
|
https://en.wikipedia.org/wiki/Sales%20outsourcing
|
Sales outsourcing refers to indirect sales process through which the seller sells products or services to buyers while making some profits.
Purpose of indirect sales
The sole purpose of a contract sales organization is to provide sales resource to its clients, without taking title to their products. Sales outsourcing providers include manufacturers' representatives, contract sales organizations, sales agents or SO outsourcing consultants. One way of organising the sales effort, especially when product delivery is erratic, is to replace or supplement internal resources with functionality and expertise brought in from contract sales organisations.
SO outsourcing is quite different from large-scale service outsourcing, which has its advantages but also requires pro-active contract and relationship management. In addition to full sales outsourcing, many partial models are observed, particularly in large firms.
Advantages
SO is expected to be cheaper than the fully loaded cost of employing salespeople, but calculating the cost comparison over time is far from straightforward. Nevertheless, replacing fixed costs with variable costs is attractive to budget-holders. However, unlike many forms of outsourcing, the advantages of sales outsourcing does not often come from saving costs but rather increasing revenue or providing speed of response or flexibility.
The business case for sales outsourcing should also include consideration of the cost of controlling the contract. Difficulty in measuring the link between sales activity and sales performance leads to a preference for employed salespeople. However, the issues internally are often the same and the internal hire has many other corporate "distractions" that do not occur with external resources.
Companies may also choose sales outsourcing as a means of accessing the best sales skills. Although the pejorative term “rent-a-rep” is still used, there is some evidence that contractors are perceived as good performers a
|
https://en.wikipedia.org/wiki/Charge%20controller
|
A charge controller, charge regulator or battery regulator limits the rate at which electric current is added to or drawn from electric batteries to protect against electrical overload, overcharging, and may protect against overvoltage. This prevents conditions that reduce battery performance or lifespan and may pose a safety risk. It may also prevent completely draining ("deep discharging") a battery, or perform controlled discharges, depending on the battery technology, to protect battery life.
The terms "charge controller" or "charge regulator" may refer to either a stand-alone device, or to control circuitry integrated within a battery pack, battery-powered device, and/or battery charger.
Stand-alone charge controllers
Charge controllers are sold to consumers as separate devices, often in conjunction with solar or wind power generators, for uses such as RV, boat, and off-the-grid home battery storage systems.
In solar applications, charge controllers may also be called solar regulators or solar charge controllers. Some charge controllers / solar regulators have additional features, such as a low voltage disconnect (LVD), a separate circuit which powers down the load when the batteries become overly discharged (some battery chemistries are such that over-discharge can ruin the battery).
A series charge controller or series regulator disables further current flow into batteries when they are full. A shunt charge controller or shunt regulator diverts excess electricity to an auxiliary or "shunt" load, such as an electric water heater, when batteries are full.
Simple charge controllers stop charging a battery when they exceed a set high voltage level, and re-enable charging when battery voltage drops back below that level. Pulse-width modulation (PWM) and maximum power point tracker (MPPT) technologies are more electronically sophisticated, adjusting charging rates depending on the battery's level, to allow charging closer to its maximum capacity.
A charge con
|
https://en.wikipedia.org/wiki/List%20of%20Saint%20Patrick%27s%20crosses
|
A variety of crosses, both designs and physical objects, have been associated with Saint Patrick, the patron saint of Ireland. Traditionally, the cross pattée has been associated with him, but in more recent times, the Saint Patrick's Saltire has also been linked to him.
Some authors have stated, however, that Patrick is not entitled to have a cross as a symbol since he was not a martyr, unlike Saints George and Andrew.
Celtic Cross
It is popularly believed that St. Patrick introduced the Celtic Cross in Ireland, during his conversion of the provincial kings from paganism to Christianity. St Patrick is said to have taken the symbol of the sun and extended one of the lengths to form a melding of the Christian Cross and the sun.
Saltire
Saint Patrick's Saltire is a red saltire on a white field. It is used in the insignia of the Order of Saint Patrick, established in 1783, and after the Acts of Union 1800 it was combined with the Saint George's Cross of England and the Saint Andrew's Cross of Scotland to form the Union Flag of the United Kingdom of Great Britain and Ireland. A saltire was intermittently used as a symbol of Ireland from the seventeenth century, but without reference to Saint Patrick.
The Pepys Library's collection of broadside ballads includes one from called "Teague and Sawney: or The Unfortunate Success of a Dear-Joys Devotion by St. Patrick's Cross. Being Transform'd into the Deel's Whirlegig." It describes an Irishman (Teague) and Scot (Sawney), both stereotypically blockheaded, encountering a windmill for the first time and arguing over whether it is Saint Andrew's Cross or Saint Patrick's Cross.
Cross pattée
Some of the Order of St Patrick's symbols were borrowed from the pre-existing Friendly Brothers of St Patrick, including the motto Quis separabit?; however, the "Saint Patrick's Cross" used in the Friendly Brothers' badge was not a saltire. A 1783 letter to a Dublin newspaper criticising the Order's use of a saltire, asserted that "Th
|
https://en.wikipedia.org/wiki/2020%20United%20Kingdom%20school%20exam%20grading%20controversy
|
Due to the COVID-19 pandemic in the United Kingdom, all secondary education examinations due to be held in 2020 were cancelled. As a result, an alternative method had to be designed and implemented at short notice to determine the qualification grades to be awarded to students for that year. A standardisation algorithm was produced in June 2020 by the regulator Ofqual in England, Qualifications Wales in Wales, Scottish Qualifications Authority in Scotland, and CCEA in Northern Ireland. The algorithm was designed to combat grade inflation, and was to be used to moderate the existing but unpublished centre-assessed grades for A-Level and GCSE students. After the A-Level grades were issued, and after criticism, Ofqual, with the support of HM Government, withdrew these grades. It issued all students the Centre Assessed Grades (CAGs), which had been produced by teachers as part of the process. The same ruling was applied to the awarding of GCSE grades, just a few days before they were issued: CAG-based grades were the ones released on results day.
A similar controversy erupted in Scotland, after the Scottish Qualifications Authority marked down as many as 75,000 predicted grades to "maintain credibility", and later agreed to upgrade the results and issue new exam certificates. The Scottish Government apologised for the controversy, with Nicola Sturgeon, the First Minister of Scotland saying of the situation that the Scottish Government "did not get it right".
Background
In England, Wales and Northern Ireland, students sit General Certificate of Secondary Education (GCSE) and A-Level exams, typically at ages 16 and 18 respectively. Similar but equivalent international versions of these qualifications are offered by UK exam boards.
On 18 March 2020, the government decided to cancel all examinations in England due to the COVID-19 pandemic, although the regulator, Ofqual, had advised that holding exams in a socially distanced manner was the best option. The same cancel
|
https://en.wikipedia.org/wiki/Lunar%20effect
|
The lunar effect is a purported correlation between specific stages of the roughly 29.5-day lunar cycle and behavior and physiological changes in living beings on Earth, including humans. A considerable number of studies have examined the effect on humans. By the late 1980s, there were at least 40 published studies on the purported lunar-lunacy connection, and at least 20 published studies on the purported lunar-birthrate connection. Literature reviews and metanalyses have found no correlation between the lunar cycle and human biology or behavior. In cases such as the approximately monthly cycle of menstruation in humans (but not other mammals), the coincidence in timing reflects no known lunar influence. The widespread and persistent beliefs about the influence of the Moon may depend on illusory correlation – the perception of an association that does not in fact exist.
In a number of marine animals, there is stronger evidence for the effects of lunar cycles. Observed effects relating to reproductive synchrony may depend on external cues relating to the presence or amount of moonlight. Corals contain light-sensitive cryptochromes, proteins that are sensitive to different levels of light. Coral species such as Dipsastraea speciosa tend to synchronize spawning in the evening or night, around the last quarter moon of the lunar cycle. In Dipsastraea speciosa, a period of darkness between sunset and moonrise appears to be a trigger for synchronized spawning. Another marine animal, the bristle worm Platynereis dumerilii, spawns a few days after a full moon. It contains a protein with light-absorbing flavin structures that differentially detect moonlight and sunlight. It is used as a model for studying the biological mechanisms of marine lunar cycles.
Contexts
Claims of a lunar connection have appeared in the following contexts:
Fertility
It is widely believed that the Moon has a relationship with fertility due to the corresponding human menstrual cycle, which
|
https://en.wikipedia.org/wiki/Continuous%20obsolescence
|
Continuous obsolescence or perpetual revolution is a phenomenon where industry trends, or other items that do not immediately correspond to technical needs, mandate a continual readaptation of a system. Such work does not increase the usefulness of the system, but is required for the system to continue fulfilling its functions.
Unintentional reasons
Continuous obsolescence may be unintentional. One type of largely unintentional case of continuous obsolescence occurs when the rising demand for graphics- and experience-intensive video games collides with a long development time for a new title. While a game may promise to be acceptable or even revolutionary if released on schedule, a delay exposes it to the risk of being unable to compete with better games released during the delay (e.g. Daikatana), or of being continually rewritten to take advantage of better technologies as they become available (e.g. Duke Nukem Forever). This last behavior is an example of a software development anti-pattern.
Intentional reasons
Continuous obsolescence may also be intentional, for example when an application tries to include compatibility for the output of another widely used application. In this case, the software house responsible for the latter may vary its output format repeatedly, forcing the developer of the former to continuously expend resources to keep its compatibility up-to-date, rather than using those resources to expand features or otherwise make the product more competitive. Many accuse Microsoft of doing exactly this with the file formats used by its Office application suite.
See also
Planned obsolescence
|
https://en.wikipedia.org/wiki/Mariette%20Yvinec
|
Mariette Yvinec is a French researcher in computational geometry at the French Institute for Research in Computer Science and Automation (INRIA) in Sophia Antipolis. She is one of the developers of CGAL, a software library of computational geometry algorithms.
Yvinec is the co-author of two books in computational geometry:
Géometrie Algorithmique (with Jean-Daniel Boissonnat, Edusciences 1995), translated as Algorithmic Geometry (Hervé Brönnimann, trans., Cambridge University Press, 1998)
Geometric and Topological Inference (with Jean-Daniel Boissonnat and Frédéric Chazal, Cambridge Texts in Applied Mathematics, 2018)
|
https://en.wikipedia.org/wiki/Vascular%20lacuna
|
The vascular lacuna (Latin: lacuna vasorum (retroinguinalis)) is the medial compartment beneath the inguinal ligament. It is separated from the lateral muscular lacuna by the iliopectineal arch. It gives passage to the femoral vessels, lymph vessels and lymph nodes.
The lacunar ligament can be a site of entrapment for femoral hernias.
Anatomy
Its boundaries are the iliopectineal arch, the inguinal ligament, the lacunar ligament, and the superior border of the pubis.
Contents
The structures found in the vascular lacuna, from medial to lateral, are:
Cloquet's node;
Femoral vein;
Femoral artery; and
Femoral branch of the genitofemoral nerve
|
https://en.wikipedia.org/wiki/Okayama%20Planet%20Search%20Program
|
The Okayama Planet Search Program (OPSP) was started in 2001 with the goal of spectroscopically searching for planetary systems around stars. It reported on the detection of 3 new extrasolar planets: (18 Delphini b, xi Aql b, and 41 Lyncis b), around intermediate-mass G and K giants 18 Delphini, Xi Aquilae, and HD 81688. Also, it updated the orbital parameters of HD 104985 b, the first planet discovered around the G giants from the survey, by using the data collected during the past six years. Since 2001, it has been conducting a precise Doppler survey of about 300 G and K giants using a 1.88m telescope, the High Dispersion Echelle Spectrograph (HIDES), and an iodine absorption cell I2 cell at the Okayama Astrophysical Observatory (OAO).
Discoveries
Observatory
Okayama Astrophysical Observatory, Kurashiki in Japan
|
https://en.wikipedia.org/wiki/Coda%20%28music%29
|
In music, a coda (; ; plural ) is a passage that brings a piece (or a movement) to an end. It may be as simple as a few measures, or as complex as an entire section.
In classical music
The presence of a coda as a structural element in a movement is especially clear in works written in particular musical forms. Codas were commonly used in both sonata form and variation movements during the Classical era. In a sonata form movement, the recapitulation section will, in general, follow the exposition in its thematic content, while adhering to the home key. The recapitulation often ends with a passage that sounds like a termination, paralleling the music that ended the exposition; thus, any music coming after this termination will be perceived as extra material, i.e., as a coda. In works in variation form, the coda occurs following the last variation and will be very noticeable as the first music not based on the theme.
One of the ways that Beethoven extended and intensified Classical practice was to expand the coda sections, producing a final section sometimes of equal musical weight to the foregoing exposition, development, and recapitulation sections and completing the musical argument. For one famous example, see the finale of Symphony No. 8 (Beethoven).
Musical purpose
Charles Burkhart suggests that the reason codas are common, even necessary, is that, in the climax of the main body of a piece, a "particularly effortful passage", often an expanded phrase, is often created by "working an idea through to its structural conclusions" and that, after all this momentum is created, a coda is required to "look back" on the main body, allow listeners to "take it all in", and "create a sense of balance."
Codetta
Codetta (Italian for "little tail", the diminutive form) has a similar purpose to the coda, but on a smaller scale, concluding a section of a work instead of the work as a whole. A typical codetta concludes the exposition and recapitulation sections of a work
|
https://en.wikipedia.org/wiki/Platform%20Environment%20Control%20Interface
|
Platform Environment Control Interface, abbreviated as PECI, is an Intel proprietary single wire serial interface that provides a communication channel between Intel processors and chipset components to external system management logic and thermal monitoring devices. Also, PECI provides an interface for external devices to read processor temperature, perform processor manageability functions, and manage processor interface tuning and diagnostics. Typically in server platforms, CPUs are the PECI slaves and PCH is the PECI master, meanwhile in client segment, CPU is usually the PECI slave and EC/BMC is the PECI master. PECI was introduced in 2006 with the Intel Core 2 Duo microprocessors.
Support for PECI was added to the Linux kernel version 5.18 in 2022.
Thermal monitoring details
While previous thermal management technologies have made use of thermal diodes, PECI instead uses on-die digital thermal sensors (DTS). These sensors, after being calibrated at the factory, are able to provide digital data concerning processor temperature information. The PECI bus, allowing access to this data from chipset components, is a proprietary single-wire interface with a variable data transfer speed (from 2 kbit/s to 2 Mbit/s).
From a control standpoint, the main difference between PECI and the previously used thermal monitoring methods is that PECI reports a negative value expressing the difference between the current temperature and the thermal throttle point (at which the CPU reduces speed or shuts down to prevent damage due to overheating) instead of the absolute temperature. For example, for a CPU with maximal temperature of 85 °C and a current temperature reading of 35 °C, the value reported by PECI would be −50 °C.
Advantages
Since the value reported by PECI takes into account internal processor information about safe operating temperatures, it alleviates the need for the BIOS or operating system to make potentially incorrect assumptions about this limit. Furthermore
|
https://en.wikipedia.org/wiki/Lobe%20%28anatomy%29
|
In anatomy, a lobe is a clear anatomical division or extension of an organ (as seen for example in the brain, lung, liver, or kidney) that can be determined without the use of a microscope at the gross anatomy level. This is in contrast to the much smaller lobule, which is a clear division only visible under the microscope.
Interlobar ducts connect lobes and interlobular ducts connect lobules.
Examples of lobes
The four main lobes of the brain
the frontal lobe
the parietal lobe
the occipital lobe
the temporal lobe
The three lobes of the human cerebellum
the flocculonodular lobe
the anterior lobe
the posterior lobe
The two lobes of the thymus
The two and three lobes of the lungs
Left lung: superior and inferior
Right lung: superior, middle, and inferior
The four lobes of the liver
Left lobe of liver
Right lobe of liver
Quadrate lobe of liver
Caudate lobe of liver
The renal lobes of the kidney
Earlobes
Examples of lobules
the cortical lobules of the kidney
the testicular lobules of the testis
the lobules of the mammary gland
the pulmonary lobules of the lung
the lobules of the thymus
|
https://en.wikipedia.org/wiki/Remineralisation
|
In biogeochemistry, remineralisation (or remineralization) refers to the breakdown or transformation of organic matter (those molecules derived from a biological source) into its simplest inorganic forms. These transformations form a crucial link within ecosystems as they are responsible for liberating the energy stored in organic molecules and recycling matter within the system to be reused as nutrients by other organisms.
Remineralisation is normally viewed as it relates to the cycling of the major biologically important elements such as carbon, nitrogen and phosphorus. While crucial to all ecosystems, the process receives special consideration in aquatic settings, where it forms a significant link in the biogeochemical dynamics and cycling of aquatic ecosystems.
Role in biogeochemistry
The term "remineralization" is used in several contexts across different disciplines. The term is most commonly used in the medicinal and physiological fields, where it describes the development or redevelopment of mineralized structures in organisms such as teeth or bone. In the field of biogeochemistry, however, remineralization is used to describe a link in the chain of elemental cycling within a specific ecosystem. In particular, remineralization represents the point where organic material constructed by living organisms is broken down into basal inorganic components that are not obviously identifiable as having come from an organic source. This differs from the process of decomposition which is a more general descriptor of larger structures degrading to smaller structures.
Biogeochemists study this process across all ecosystems for a variety of reasons. This is done primarily to investigate the flow of material and energy in a given system, which is key to understanding the productivity of that ecosystem along with how it recycles material versus how much is entering the system. Understanding the rates and dynamics of organic matter remineralization in a given system can
|
https://en.wikipedia.org/wiki/Google%20Glass
|
Google Glass, or simply Glass, is a brand of smart glasses developed and sold by Google. It was developed by X (previously Google X), with the mission of producing a ubiquitous computer. Google Glass displays information to the wearer using a head-up display. Wearers communicate with the Internet via natural language voice commands.
Google started selling a prototype of Google Glass to qualified "Glass Explorers" in the US on April 15, 2013, for a limited period for $1,500, before it became available to the public on May 15, 2014. It had an integral 5 megapixel still/720p video camera. The headset received a great deal of criticism amid concerns that its use could violate existing privacy laws.
On January 15, 2015, Google announced that it would stop producing the Google Glass prototype. The prototype was succeeded by two Enterprise Editions, whose sales were suspended on March 15, 2023.
Development
Google Glass was developed by Google X, the facility within Google devoted to technological advancements such as driverless cars.
The Google Glass prototype resembled standard eyeglasses with the lens replaced by a head-up display. In mid-2011, Google engineered a prototype that weighed ; by 2013 they were lighter than the average pair of sunglasses.
In April 2013, the Explorer Edition was made available to Google I/O developers in the United States for $1,500.
The product was publicly announced in April 2012. Sergey Brin wore a prototype of the Glass to an April 5, 2012, Foundation Fighting Blindness event in San Francisco. In May 2012, Google demonstrated for the first time how Google Glass could be used to shoot videos.
Google provided four prescription frame choices for $225 and free with the purchase of any new Glass unit. Google entered in a partnership with the Italian eyewear company Luxottica, owners of the Ray-Ban, Oakley, and other brands, to offer additional frame designs.
In June 2014, Nepal government adopted Google Glass for tackling poachers of wi
|
https://en.wikipedia.org/wiki/Mediator%20%28coactivator%29
|
Mediator is a multiprotein complex that functions as a transcriptional coactivator in all eukaryotes. It was discovered in 1990 in the lab of Roger D. Kornberg, recipient of the 2006 Nobel Prize in Chemistry. Mediator complexes interact with transcription factors and RNA polymerase II. The main function of mediator complexes is to transmit signals from the transcription factors to the polymerase.
Mediator complexes are variable at the evolutionary, compositional and conformational levels. The first image shows only one "snapshot" of what a particular mediator complex might be composed of, but it certainly does not accurately depict the conformation of the complex in vivo. During evolution, mediator has become more complex. The yeast Saccharomyces cerevisiae (a simple eukaryote) is thought to have up to 21 subunits in the core mediator (exclusive of the CDK module), while mammals have up to 26.
Individual subunits can be absent or replaced by other subunits under different conditions. Also, there are many intrinsically disordered regions in mediator proteins, which may contribute to the conformational flexibility seen both with and without other bound proteins or protein complexes. A more realistic model of a mediator complex without the CDK module is shown in the second figure.
The mediator complex is required for the successful transcription by RNA polymerase II. Mediator has been shown to make contacts with the polymerase in the transcription preinitiation complex. A recent model showing the association of the polymerase with mediator in the absence of DNA is shown in the figure to the left. In addition to RNA polymerase II, mediator must also associate with transcription factors and DNA. A model of such interactions is shown in the figure to the right. Note that the different morphologies of mediator do not necessarily mean that one of the models is correct; rather those differences may reflect the flexibility of mediator as it interacts with other molecules.
|
https://en.wikipedia.org/wiki/Aoriopsis
|
Aoriopsis is an extinct genus of leaf beetles in the subfamily Eumolpinae. It contains only one species, Aoriopsis eocenicus, and is known only from lowermost Eocene amber collected from Le Quesnoy, Oise Department, France.
The species is known only from one fossil, the holotype, specimen number "PA 2437". It is an almost complete female beetle included in a small piece of amber. The specimen is currently deposited at the Muséum national d'histoire naturelle in Paris, France. Aoriopsis was first studied by Alexey G. Moseyko and Alexander G. Kirejtshuk of the Zoological Institute of the Russian Academy of Sciences and Andre Nel of the Muséum national d'histoire naturelle. Their type description of the genus was published in the journal Annales de la Société Entomologique de France in 2010.
The generic name, Aoriopsis, is a combination of the generic name Aoria and the Greek root (appearance, countenance, face). The specific name, eocenicus, is derived from "Eocene", the geological epoch the genus lived in.
|
https://en.wikipedia.org/wiki/Pesticide%20degradation
|
Pesticide degradation is the process by which a pesticide is transformed into a benign substance that is environmentally compatible with the site to which it was applied. Globally, an estimated 1 to 2.5 million tons of active pesticide ingredients are used each year, mainly in agriculture. Forty percent are herbicides, followed by insecticides and fungicides. Since their initial development in the 1940s, multiple chemical pesticides with different uses and modes of action have been employed. Pesticides are applied over large areas in agriculture and urban settings. Pesticide use, therefore, represents an important source of diffuse chemical environmental inputs.
Persistence
In principle, pesticides are registered for use only after they are demonstrated not to persist in the environment considerably beyond their intended period of use. Typically, documented soil half-lives are in the range of days to weeks. However, pesticide residues are found ubiquitously in the environment in ng/liter to low μg/liter concentrations. For instance, surveys of groundwater and not-yet-treated potable water in industrialized countries typically detect 10 to 20 substances in recurrent findings above the maximum accepted drinking water concentration for pesticides in many countries. About half of the detected substances are no longer in use and another 10 to 20% are stable transformation products.
Pesticide residues have been found in other realms. Transport from groundwater may lead to a low-level presence in surface waters. Pesticides have been detected in high-altitude regions, demonstrating sufficient persistence to survive transport across hundreds of kilometers in the atmosphere.
Degradation involves both biotic and abiotic transformation processes. Biotic transformation is mediated by microorganisms, while abiotic transformation involves processes such as chemical and photochemical reactions. The specific degradation processes for a given pesticide are determined by its str
|
https://en.wikipedia.org/wiki/Marston%20Conder
|
Marston Donald Edward Conder (born 9 September 1955) is a New Zealand mathematician, a Distinguished Professor of Mathematics at Auckland University, and the former co-director of the New Zealand Institute of Mathematics and its Applications. His main research interests are in combinatorial group theory, graph theory, and their connections with each other.
Education and career
Conder was born in Hamilton, New Zealand, and studied at Matamata College. He earned a master's degree in social science from Waikato University in 1977, and a doctorate from Oxford University in 1980 under the supervision of Graham Higman. He served as president of the New Zealand Mathematical Society from 1993 to 1995, and as president of the Academy of the Royal Society of New Zealand from 2006 to 2008. In 2011 he was selected as the inaugural Maclaurin Lecturer, as part of a reciprocal exchange between the New Zealand Mathematical Society and the American Mathematical Society.
Recognition
Conder is a fellow of the New Zealand Mathematical Society and of the Royal Society Te Apārangi, and in 2012 became a fellow of the American Mathematical Society. He was named as a Distinguished Alumnus of Waikato University for 2013. In 2011 he was awarded a James Cook Research Fellowship for research on symmetry of discrete structures.
In March 2021 it was announced that Conder has been awarded the 2020 Euler Medal by the Institute of Combinatorics and its Applications for his "many distinguished contributions to combinatorics over the last 40 years."
In 2014 the Royal Society Te Apārangi awarded Conder the Hector Medal, and in 2018 the Jones Medal, named after Vaughan Jones, "for his internationally renowned research on symmetry and chirality in discrete structures, and his exemplary leadership and service in the New Zealand mathematical sciences community".
In the 2020 Birthday Honours, he was appointed an Officer of the New Zealand Order of Merit (ONZM) for services to mathematics.
|
https://en.wikipedia.org/wiki/Trade%20facilitation
|
Trade facilitation looks at how procedures and controls governing the movement of goods across national borders can be improved to reduce associated cost burdens and maximise efficiency while safeguarding legitimate regulatory objectives. Business costs may be a direct function of collecting information and submitting declarations or an indirect consequence of border checks in the form of delays and associated time penalties, forgone business opportunities and reduced competitiveness.
Understanding and use of the term “trade facilitation” varies in the literature and amongst practitioners. "Trade facilitation" is largely used by institutions which seek to improve the regulatory interface between government bodies and traders at national borders. The WTO, in an online training package, has defined trade facilitation as “the simplification and harmonisation of international trade procedures”, where trade procedures are the “activities, practices and formalities involved in collecting, presenting, communicating and processing data required for the movement of goods in international trade”.
In defining the term, many trade facilitation proponents will also make reference to trade finance and the procedures applicable for making payments (e.g. via a commercial banks). For example, UN/CEFACT defines trade facilitation as "the simplification, standardization and harmonisation of procedures and associated information flows required to move goods from seller to buyer and to make payment".
Occasionally, the term trade facilitation is extended to address a wider agenda in economic development and trade to include: the improvement of transport infrastructure, the removal of government corruption, the modernization of customs administration, the removal of other non-tariff trade barriers, as well as export marketing and promotion.
The World Trade Report 2015 provides an overview of the various trade facilitation definitions from academia as well as various international orga
|
https://en.wikipedia.org/wiki/Butterfly%20net
|
A butterfly net (sometimes called an aerial insect net) is one of several kinds of nets used to collect insects. The entire bag of the net is generally constructed from a lightweight mesh to minimize damage to delicate butterfly wings. Other types of nets used in insect collecting include beat nets, aquatic nets, and sweep nets.
Nets for catching different insects have different mesh sizes. Aquatic nets usually have bigger, more 'open' mesh. Catching small aquatic creatures usually requires an insect net. The mesh is smaller and can capture more.
|
https://en.wikipedia.org/wiki/Sequences%20%28book%29
|
Sequences is a mathematical monograph on integer sequences. It was written by Heini Halberstam and Klaus Roth, published in 1966 by the Clarendon Press, and republished in 1983 with minor corrections by Springer-Verlag. Although planned to be part of a two-volume set, the second volume was never published.
Topics
The book has five chapters, each largely self-contained and loosely organized around different techniques used to solve problems in this area, with an appendix on the background material in number theory needed for reading the book. Rather than being concerned with specific sequences such as the prime numbers or square numbers, its topic is the mathematical theory of sequences in general.
The first chapter considers the natural density of sequences, and related concepts such as the Schnirelmann density. It proves theorems on the density of sumsets of sequences, including Mann's theorem that the Schnirelmann density of a sumset is at least the sum of the Schnirelmann densities and Kneser's theorem on the structure of sequences whose lower asymptotic density is subadditive. It studies essential components, sequences that when added to another sequence of Schnirelmann density between zero and one, increase their density, proves that additive bases are essential components, and gives examples of essential components that are not additive bases.
The second chapter concerns the number of representations of the integers as sums of a given number of elements from a given sequence, and includes the Erdős–Fuchs theorem according to which this number of representations cannot be close to a linear function. The third chapter continues the study of numbers of representations, using the probabilistic method; it includes the theorem that there exists an additive basis of order two whose number of representations is logarithmic, later strengthened to all orders in the Erdős–Tetali theorem.
After a chapter on sieve theory and the large sieve (unfortunately missing signi
|
https://en.wikipedia.org/wiki/Second%20source
|
In the electronics industry, a second source is a company that is licensed to manufacture and sell components originally designed by another company (the first source).
It is common for engineers and purchasers to avoid components that are only available from a single source, to avoid the risk that a problem with the supplier would prevent a popular and profitable product from being manufactured. For simple components such as resistors and transistors, this is not usually an issue, but for complex integrated circuits, vendors often react by licensing one or more other companies to manufacture and sell the same parts as second sources. While the details of such licenses are usually confidential, they often involve cross-licensing, so that each company also obtains the right to manufacture and sell parts designed by the other.
Examples
MOS Technology licensed Rockwell and Synertek to second-source the 6502 microprocessor and its support components.
Intel licensed AMD to second-source Intel microprocessors such as the 8086 and its related support components. This second-source agreement is particularly famous for leading to much litigation between the two parties. The agreement gave AMD the rights to second-source later Intel parts, but Intel refused to provide the masks for the 386 to AMD. AMD reverse-engineered the 386, and Intel then claimed that AMD's license to the 386 microcode only allowed AMD to "use" the microcode but not to sell products incorporating it. The courts eventually decided in favor of AMD.
|
https://en.wikipedia.org/wiki/Rata%20Die
|
Rata Die (R.D.) is a system for assigning numbers to calendar days (optionally with time of day), independent of any calendar, for the purposes of calendrical calculations. It was named (after the Latin ablative feminine singular for "from a fixed date") by Howard Jacobson.
Rata Die is somewhat similar to Julian Dates (JD), in that the values are plain real numbers that increase by 1 each day. The systems differ principally in that JD takes on a particular value at a particular absolute time, and is the same in all contexts, whereas R.D. values may be relative to time zone, depending on the implementation. This makes R.D. more suitable for work on calendar dates, whereas JD is more suitable for work on time per se. The systems also differ trivially by having different epochs: R.D. is 1 at midnight (00:00) local time on January 1, AD 1 in the proleptic Gregorian calendar, JD is 0 at noon (12:00) Universal Time on January 1, 4713 BC in the proleptic Julian calendar.
Forms
There are three distinct forms of R.D., heretofore defined using Julian Dates.
Dershowitz and Reingold do not explicitly distinguish between these three forms, using the abbreviation "R.D." for all of them.
Dershowitz and Reingold do not say that the RD is based on Greenwich time, but page 10 state that an R.D. with a decimal fraction is called a moment, with the function moment-from-jd taking the floating point R.D. as an argument and returns the argument -1721424.5. Consequently, there is no requirement or opportunity to supply a time zone offset.
Fractional days
The first form of R.D. is a continuously-increasing fractional number, taking integer values at midnight local time. It is defined as:
RD = JD − 1,721,424.5
Midnight local time on December 31, year 0 (1 BC) in the proleptic Gregorian calendar corresponds to Julian Date 1,721,424.5 and hence RD 0.
Day Number
In the second form, R.D. is an integer that labels an entire day, from midnight to midnight local time. This is the result
|
https://en.wikipedia.org/wiki/Stomoxyn
|
Stomoxyn is an insect antimicrobial peptide localised in the gut epithelium, which functions in killing a range of microorganisms, parasites and some viruses. In water, stomoxyn has a flexible random coil in structure, while in trifluoroethanol it adopts a stable helical structure. Structural similarities to the antimicrobial peptide cecropin A from Hyalophora cecropia suggest that it may function in a similar manner by disrupting the bacterial membrane.
|
https://en.wikipedia.org/wiki/Limiting%20parallel
|
In neutral or absolute geometry, and in hyperbolic geometry, there may be many lines parallel to a given line through a point not on line ; however, in the plane, two parallels may be closer to than all others (one in each direction of ).
Thus it is useful to make a new definition concerning parallels in neutral geometry. If there are closest parallels to a given line they are known as the limiting parallel, asymptotic parallel or horoparallel (horo from — border).
For rays, the relation of limiting parallel is an equivalence relation, which includes the equivalence relation of being coterminal.
If, in a hyperbolic triangle, the pairs of sides are limiting parallel, then the triangle is an ideal triangle.
Definition
A ray is a limiting parallel to a ray if they are coterminal or if they lie on distinct lines not equal to the line , they do not meet, and every ray in the interior of the angle meets the ray .
Properties
Distinct lines carrying limiting parallel rays do not meet.
Proof
Suppose that the lines carrying distinct parallel rays met. By definition they cannot meet on the side of which either is on. Then they must meet on the side of opposite to , call this point . Thus . Contradiction.
See also
horocycle, In Hyperbolic geometry a curve whose normals are limiting parallels
angle of parallelism
|
https://en.wikipedia.org/wiki/Shower-curtain%20effect
|
The shower-curtain effect in physics describes the phenomenon of a shower curtain being blown inward when a shower is running. The problem of identifying the cause of this effect has been featured in Scientific American magazine, with several theories given to explain the phenomenon but no definite conclusion.
The shower-curtain effect may also be used to describe the observation how nearby phase front distortions of an optical wave are more severe than remote distortions of the same amplitude.
Hypotheses
Buoyancy hypothesis
Also called Chimney effect or Stack effect, observes that warm air (from the hot shower) rises out over the shower curtain as cooler air (near the floor) pushes in under the curtain to replace the rising air. By pushing the curtain in towards the shower, the (short range) vortex and Coandă effects become more significant. However, the shower-curtain effect persists when cold water is used, implying that this cannot be the only mechanism at work.
Bernoulli effect hypothesis
The most popular explanation given for the shower-curtain effect is Bernoulli's principle. Bernoulli's principle states that an increase in velocity results in a decrease in pressure. This theory presumes that the water flowing out of a shower head causes the air through which the water moves to start flowing in the same direction as the water. This movement would be parallel to the plane of the shower curtain. If air is moving across the inside surface of the shower curtain, Bernoulli's principle says the air pressure there will drop. This would result in a pressure differential between the inside and outside, causing the curtain to move inward. It would be strongest when the gap between the bather and the curtain is smallest, resulting in the curtain attaching to the bather.
Horizontal vortex hypothesis
A computer simulation of a typical bathroom found that none of the above theories pan out in their analysis, but instead found that the spray from the shower-
|
https://en.wikipedia.org/wiki/Smart%20Display
|
In computing, Smart Display (originally codenamed Mira) was a Microsoft initiative to use a portable touchscreen LCD monitor as a thin client for PCs, connecting via Wi-Fi.
Smart Display was announced in early 2002, released in early 2003 and discontinued in December 2003, having never achieved more than negligible market penetration.
Technology
The Smart Display was a battery-powered 10" or 15" LCD monitor with a touchscreen (similar in size and shape to a Tablet PC), connecting to a PC over an 802.11b WiFi network, with input via Transcriber (similar to Graffiti) or a pop-up soft-keyboard for text entry, and built-in speakers. Some models had a docking unit with wired PC, keyboard and mouse connectors.
The display ran Smart Display OS or Microsoft Windows CE for Smart Displays, based on Windows CE and .NET. The remote technology was based on Windows Terminal Server. Smart Display OS 1.0 would only connect to a Windows XP Professional host system, although some reported that any version of Windows could be remote-controlled using NetMeeting.
ViewSonic was the first manufacturer to bring Smart Display to the market, with the airpanel V150 in early 2003. This included a 15" 1024×768 LCD, a 400 MHz Intel XScale processor, 32MB ROM, 64MB RAM and 802.11b wireless, and a USB wireless hub for the host PC.
Problems
Analysts flagged the problems with the Mira initiative very early on, as soon as it reached their notice in early 2002.
In Smart Display OS 1.0, the display would lock the host PC to it while in use. Microsoft variously attributed this to licensing issues (that Windows XP Professional was licensed for one user per running copy ) and resource management problems. The requirements of licensing — not to allow the devices to work standalone, not to allow the device to connect to the host PC while the PC's main screen was active and not to allow multiple Smart Displays to control one PC — were widely derided in the press.
Only one Smart Display could connec
|
https://en.wikipedia.org/wiki/Token%20economy
|
A token economy is a system of contingency management based on the systematic reinforcement of target behavior. The reinforcers are symbols or tokens that can be exchanged for other reinforcers. A token economy is based on the principles of operant conditioning and behavioral economics and can be situated within applied behavior analysis. In applied settings token economies are used with children and adults; however, they have been successfully modeled with pigeons in lab settings.
Basic requirements
Three requirements are basic for a token economy: tokens, back-up reinforcers, and specified target behaviours.
Tokens
Tokens must be used as reinforcers to be effective. A token is an object or symbol that can be exchanged for material reinforcers, services, or privileges (back-up reinforcers). In applied settings, a wide range of tokens have been used: coins, checkmarks, images of small suns or stars, points on a counter, and checkmarks on a poster. These symbols and objects are comparably worthless outside of the patient-clinician or teacher-student relationship, but their value lies in the fact that they can be exchanged for other things. Technically speaking, tokens are not primary reinforcers, but secondary or learned reinforcers. Much research has been conducted on token reinforcement, including animal studies.
Back-up reinforcers
Tokens have no intrinsic value, but can be exchanged for other valued reinforcing events: back-up reinforcers, which act as rewards. Most token economies offer a choice of differing back-up reinforcers that can be virtually anything. Some possible reinforcers might be:
Material reinforcers: candy, cigarettes, journals, money
Services: breakfast in bed, room cleaned, enjoyable activities
Privileges and other extras: passes for leaving a building or area, permission to stay in bed, phone calls, having one's name or picture on a wall.
Back-up reinforcers are chosen in function of the individual or group for which the token econ
|
https://en.wikipedia.org/wiki/Toyota%20Electronic%20Modulated%20Suspension
|
TEMS (Toyota Electronic Modulated Suspension) is a shock absorber that is electronically controlled (Continuous Damping Control) based on multiple factors, and was built and exclusively used by Toyota for selected products during the 1980s and 1990s (first introduced on the Toyota Soarer in 1983). The semi-active suspension system was widely used on luxury and top sport trim packages on most of Toyota's products sold internationally. Its popularity fell after the “bubble economy” as it was seen as an unnecessary expense to purchase and maintain, and remained in use on luxury or high performance sports cars.
Summary
TEMS consisted of four shock absorbers mounted at all four wheels, and could be used in either an automatic or driver selected mode based on the installation of the system used. The technology was installed on top-level Toyota products with four wheel independent suspension, labeled PEGASUS (Precision Engineered Geometrically Advanced SUSpension). Because of the nature of the technology, TEMS was installed on vehicles with front and rear independent suspensions. Although there were TEMS equipped cars with the rear dependent suspension too – the minibuses or minivans like Toyota TownAce/MasterAce, Toyota HiAce at the top package.
Based on road conditions, the system would increase or decrease ride damping force for particular situations. The TEMS system was easily installed to suit ride comfort, and road handling stability on small suspensions, adding a level of ride modification found on larger, more expensive luxury vehicles. The technology was originally developed and calibrated for Japanese driving conditions due to Japanese speed limits, but was adapted for international driving conditions with later revisions.
As the Japanese recession of the early 1990s began to take effect, the system was seen as an unnecessary expense as buyers were less inclined to purchase products and services seen as “luxury” and more focused on basic needs. TEMS installati
|
https://en.wikipedia.org/wiki/Color%E2%80%93color%20diagram
|
A color–color diagram is a means of comparing the colors of an astronomical object at different wavelengths. Astronomers typically observe at narrow bands around certain wavelengths, and objects observed will have different brightnesses in each band. The difference in brightness between two bands is referred to as color. On color–color diagrams, the color defined by two wavelength bands is plotted on the horizontal axis, and the color defined by another brightness difference will be plotted on the vertical axis.
Background
Although stars are not perfect blackbodies, to first order the spectra of light emitted by stars conforms closely to a black-body radiation curve, also referred to sometimes as a thermal radiation curve. The overall shape of a black-body curve is uniquely determined by its temperature, and the wavelength of peak intensity is inversely proportional to temperature, a relation known as Wien's Displacement Law. Thus, observation of a stellar spectrum allows determination of its effective temperature. Obtaining complete spectra for stars through spectrometry is much more involved than simple photometry in a few bands. Thus by comparing the magnitude of the star in multiple different color indices, the effective temperature of the star can still be determined, as magnitude differences between each color will be unique for that temperature. As such, color-color diagrams can be used as a means of representing the stellar population, much like a Hertzsprung–Russell diagram, and stars of different spectral classes will inhabit different parts of the diagram. This feature leads to applications within various wavelength bands.
In the stellar locus, stars tend to align in a more or less straight feature. If stars were perfect black bodies, the stellar locus would be a pure straight line indeed. The divergences with the straight line are due to the absorptions and emission lines in the stellar spectra. These divergences can be more or less evident depending
|
https://en.wikipedia.org/wiki/Global%20Index%20Medicus
|
The World Health Organization maintains the Global Index Medicus (GIM). The GIM database draws into one reference source several WHO regional databases that cover bio-medicine and social welfare issues. Among these are: The African Index Medicus – AIM (maintained by AFRO/WHO); the Scientific and Technical Literature of Latin America and the Caribbean – LILACS (maintained by AMRO-PAHO/WHO through its specialized center BIREME); Index Medicus for Eastern Mediterranean Region – IMEMR (EMRO/WHO); Index Medicus for South-East Asia Region – IMSEAR (SEARO/WHO); and the Western Pacific Region Index Medicus – WPRIM (WPRO/WHO).
The Global Index Medicus began consolidating the contents of the above listed databases in 2012.
|
https://en.wikipedia.org/wiki/Structure%20factor
|
In condensed matter physics and crystallography, the static structure factor (or structure factor for short) is a mathematical description of how a material scatters incident radiation. The structure factor is a critical tool in the interpretation of scattering patterns (interference patterns) obtained in X-ray, electron and neutron diffraction experiments.
Confusingly, there are two different mathematical expressions in use, both called 'structure factor'. One is usually written ; it is more generally valid, and relates the observed diffracted intensity per atom to that produced by a single scattering unit. The other is usually written or and is only valid for systems with long-range positional order — crystals. This expression relates the amplitude and phase of the beam diffracted by the planes of the crystal ( are the Miller indices of the planes) to that produced by a single scattering unit at the vertices of the primitive unit cell. is not a special case of ; gives the scattering intensity, but gives the amplitude. It is the modulus squared that gives the scattering intensity. is defined for a perfect crystal, and is used in crystallography, while is most useful for disordered systems. For partially ordered systems such as crystalline polymers there is obviously overlap, and experts will switch from one expression to the other as needed.
The static structure factor is measured without resolving the energy of scattered photons/electrons/neutrons. Energy-resolved measurements yield the dynamic structure factor.
Derivation of
Consider the scattering of a beam of wavelength by an assembly of particles or atoms stationary at positions . Assume that the scattering is weak, so that the amplitude of the incident beam is constant throughout the sample volume (Born approximation), and absorption, refraction and multiple scattering can be neglected (kinematic diffraction). The direction of any scattered wave is defined by its scattering vector . ,
|
https://en.wikipedia.org/wiki/Ren%27Py
|
The Ren'Py Visual Novel Engine (or RenPy for short) is a free software game engine which facilitates the creation of visual novels. Ren'Py is a portmanteau of , the Japanese word for 'romantic love', a common element of games made using Ren'Py; and Python, the programming language that Ren'Py runs on.
Features
Ren'Py includes the ability to create branching stories, save file systems, rollback to previous points in the story, a variety of scene transitions, DLC, and so on. The engine also allows for movie playback for both full-screen movies and animated sprites, in-engine animation (using the built in "Animation and Translation Language", or ATL), and full animation and customization of UI elements via "Screen Language". Ren'Py scripts have a screenplay-like syntax, and can also include blocks of Python code to allow advanced users to add new features of their own. In addition, tools are included in the engine distribution to obfuscate scripts and archive game assets to mitigate copyright infringement.
Ren'Py is built on pygame, which is built with Python on SDL. The Ren'Py SDK is officially supported on Windows, recent versions of macOS, and Linux; and can be installed via the package managers of the Arch Linux, Ubuntu, Debian, and Gentoo (in experimental overlay) Linux distributions. Ren'Py can build games for Windows, macOS, Linux, Android, OpenBSD, iOS, and HTML5 with WebAssembly.
Reception
Ren'Py has been recommended as a video game creation engine by several outlets, including Indie Games Plus, MakeUseOf, PC Gamer, and The Guardian. It has been used in classes at Carnegie Mellon School of Art, Faculty of Art at University Tunku Abdul Rahman, Kampar, Perak, Malaysia, and as a tool for information literacy.
Notable games
See also
List of visual novel engines
|
https://en.wikipedia.org/wiki/Amoeba%20%28operating%20system%29
|
Amoeba is a distributed operating system developed by Andrew S. Tanenbaum and others at the Vrije Universiteit Amsterdam. The aim of the Amoeba project was to build a timesharing system that makes an entire network of computers appear to the user as a single machine. Development at the Vrije Universiteit was stopped: the source code of the latest version (5.3) was last modified on 30 July 1996.
The Python programming language was originally developed for this platform.
Overview
The goal of the Amoeba project was to construct an operating system for networks of computers that would present the network to the user as if it were a single machine. An Amoeba network consists of a number of workstations connected to a "pool" of processors, and executing a program from a terminal causes it to run on any of the available processors, with the operating system providing load balancing. Unlike the contemporary Sprite, Amoeba does not support process migration.
The workstations would typically function as networked terminals only. Aside from workstations and processors, additional machines operate as servers for files, directory services, TCP/IP communications etc.
Amoeba is a microkernel-based operating system. It offers multithreaded programs and a remote procedure call (RPC) mechanism for communication between threads, potentially across the network; even kernel-threads use this RPC mechanism for communication. Each thread is assigned a 48-bit number called its "port", which serves as its unique, network-wide "address" for communication.
The user interface and APIs of Amoeba were modeled after Unix and compliance with the POSIX standard was partially implemented; some of the Unix emulation code consists of utilities ported over from Tanenbaum's other operating system, MINIX. Early versions used a "homebrew" window system, which the Amoeba authors considered "faster ... in our view, cleaner ... smaller and much easier to understand", but version 4.0 uses the X Window Sys
|
https://en.wikipedia.org/wiki/Enonic%20XP
|
Enonic XP is a free and open-source web application platform and content management system (CMS) in one based on Java and Elasticsearch. Developed by the Norwegian software company Enonic, the microservice web platform can be used to build progressive web applications, Next.js websites, or web-based APIs. Enonic XP uses an application framework for coding server logic with JavaScript, and has no need for SQL as it ships with an integrated content repository. The CMS is fully decoupled, meaning developers can create traditional websites and landing pages, or use XP in headless mode, that is without the presentation layer, for loading editorial content onto any device or client. Enonic is used by major organizations in Norway, including the national postal service Norway Post, the insurance company Gjensidige, the national lottery Norsk Tipping, the Norwegian Labour and Welfare Administration, and all the top football clubs in the national football league for men, Eliteserien.
Overview
Enonic XP has embedded web content management, blending applications and websites into one experience. The content management system (CMS) functionality includes a visual drag and drop editor, a landing page editor, support for multi-site and multi-language, media and structured content, advanced image editing, responsive user interface, permissions and roles management, revision and version control, and bulk publishing. Content and website(s) are managed through the "Content Studio," while integrations and applications can be directly installed via the "Applications" section in XP, where the platform finds apps approved in the official Enonic Market.
There are no third-party databases in Enonic XP. Instead, the developers have built a distributed storage repository on top of the search engine Elasticsearch, avoiding the need to index content. The system brings together capabilities from Filesystem, NoSQL, document stores, and search in the storage technology, which automatically ind
|
https://en.wikipedia.org/wiki/Cycloheximide%20chase
|
Cycloheximide chase assays are an experimental technique used in molecular and cellular biology to measure steady state protein stability. Cycloheximide is a drug that inhibits the elongation step in eukaryotic protein translation, thereby preventing protein synthesis. The addition of cycloheximide to cultured cells followed by protein lysis at multiple timepoints is conducted to observe protein degradation over time and can be used to determine a protein's half-life. These assays are often followed by western blotting to assess protein abundance and can be analyzed using quantitative tools such as ImageJ.
Implementation
Cycloheximide chase assays have been conducted using a variety of cell types such as yeast and mammalian cell lines. Depending on the cell system used for analysis, the assay may vary in application and time course. For example, yeast cells expressing a protein substrate of interest typically require cycloheximide chases lasting up to 90 minutes to allow protein turnover to occur. In contrast, proteins that are expressed in mammalian cell lines tend to me more stable at steady state and may require a chase lasting 3 to 8 hours. Depending on the complexity of the protein and whether it is overexpressed or endogenous to the model system, the required length of the chase may vary. To ensure that protein synthesis is inhibited during the entire chase, cycloheximide is often spiked into the sample every few hours.
In yeast, deletion strains are frequently used to assess protein stability over time with cycloheximide chases. For example, yeast strains lacking critical degradation machinery such as chaperones, E3 ligases, and vacuolar proteins are often used to determine the mechanism of degradation for a protein substrate of interest. Drug treatments (such as MG132) are also used to inhibit steps of degradation, followed by a cycloheximide chase to observe how the stability of a protein of interest is affected. These experiments may be conducted in mam
|
https://en.wikipedia.org/wiki/Foundry%20Networks
|
Foundry Networks, Inc. was a networking hardware vendor selling high-end Ethernet switches and routers. The company was acquired by Brocade Communications Systems on December 18, 2008.
History
The company was founded in 1996 by Bobby R. Johnson, Jr. and was headquartered in Santa Clara, California, United States. In its first year the company operated under the names Perennium Networks and StarRidge Networks, but by January 1997 the name Foundry Networks was adopted. Foundry Networks had their initial public offering in 1999, during the Internet bubble, with the company reaching a valuation of $9 billion on its first day of trading on NASDAQ with the symbol FDRY.
Foundry Networks designed, manufactured and sold high-end enterprise and service provider switches and routers, as well as wireless, security, and traffic management solutions. It was best known for its Layer 2 & 3 Ethernet switches. Foundry Networks was the first company to build and ship a gigabit Ethernet switch in 1997; to build a Layer 3 switch, also in 1997; to build the first Layer 4-7 switch in 1998 and to include 10 Gigabit Ethernet single connectors in its boxes (since 2001).
Foundry Networks early product lines consisted of the Workgroup, Backbone, and ServerIron products. The TurboIron all GigE switch and then router models were later introduced. Foundry Networks' later product lines consisted of the BigIron, EdgeIron, FastIron, IronPoint, NetIron, SecureIron, and ServerIron. After the early BigIron modular chassis, the Mucho Grande (MG) series chassis were introduced. Later the RX series in 4, 8, 16, and 32 slot versions. The largest and final product, the XMR was a full rack sized switch/router. Their software products included IronView and ServerIron TrafficWorks.
According to a Dell’Oro report published in 1Q2006, Foundry Networks ranked number 4 in a total market share of over US$3,659 million, and its ServerIron application switch ranked first for total port shipments.
Acquisition
O
|
https://en.wikipedia.org/wiki/Statistical%20Applications%20in%20Genetics%20and%20Molecular%20Biology
|
Statistical Applications in Genetics and Molecular Biology is a bimonthly peer-reviewed scientific journal covering the application of statistics to problems in computational biology. It was established in 2002 and is published by de Gruyter. The editor-in-chief is Guido Sanguinetti. According to the Journal Citation Reports, the journal has a 2012 impact factor of 1.717.
Abstracting and indexing
The journal is abstracted and indexed in:
Current Index to Statistics
MEDLINE
Science Citation Index Expanded
Zentralblatt MATH
|
https://en.wikipedia.org/wiki/Efficient%20coding%20hypothesis
|
The efficient coding hypothesis was proposed by Horace Barlow in 1961 as a theoretical model of sensory coding in the brain. Within the brain, neurons communicate with one another by sending electrical impulses referred to as action potentials or spikes. One goal of sensory neuroscience is to decipher the meaning of these spikes in order to understand how the brain represents and processes information about the outside world. Barlow hypothesized that the spikes in the sensory system formed a neural code for efficiently representing sensory information. By efficient Barlow meant that the code minimized the number of spikes needed to transmit a given signal. This is somewhat analogous to transmitting information across the internet, where different file formats can be used to transmit a given image. Different file formats require different number of bits for representing the same image at given distortion level, and some are better suited for representing certain classes of images than others. According to this model, the brain is thought to use a code which is suited for representing visual and audio information representative of an organism's natural environment .
Efficient coding and information theory
The development of the Barlow's hypothesis was influenced by information theory introduced by Claude Shannon only a decade before. Information theory provides the mathematical framework for analyzing communication systems. It formally defines concepts such as information, channel capacity, and redundancy. Barlow's model treats the sensory pathway as a communication channel where neuronal spiking is an efficient code for representing sensory signals. The spiking code aims to maximize available channel capacity by minimizing the redundancy between representational units. H. Barlow was not the very first one to introduce the idea: it already appears in a 1954 article written by F. Attneave.
A key prediction of the efficient coding hypothesis is that sensory
|
https://en.wikipedia.org/wiki/Ripeness%20in%20viticulture
|
In viticulture, ripeness is the completion of the ripening process of wine grapes on the vine which signals the beginning of harvest. What exactly constitutes ripeness will vary depending on what style of wine is being produced (sparkling, still, fortified, rosé, dessert wine, etc.) and what the winemaker and viticulturist personally believe constitutes ripeness. Once the grapes are harvested, the physical and chemical components of the grape which will influence a wine's quality are essentially set so determining the optimal moment of ripeness for harvest may be considered the most crucial decision in winemaking.
There are several factors that contribute to the ripeness of the grape. As the grapes go through veraison, sugars in the grapes will continue to rise as acid levels fall. The balance between sugar (as well as the potential alcohol level) and acids is considered one of the most critical aspects of producing quality wine so both the must weight and "total acidity", as well as the pH of the grapes, are evaluated to determine ripeness. Towards the end of the 20th century, winemakers and viticulturists began focusing on the concept of achieving "physiological" ripeness in the grapes-described as a more complete ripeness of tannins and other phenolic compounds in the grapes that contribute to the color, flavor and aroma of wine.
What happens to a grape as it ripens
If ripening is broadly defined as the development of wine grapes, then it could be said that ripening is happening throughout the continuous annual cycle of the grapevine. More narrowly defined, ripening begins at the inception of veraison. At this point (which is normally 40–60 days after fruit set though it may be longer in cooler climates), the grapes are hard and green with low sugar levels and very high levels of mostly malic acids. During veraison, which may last from 30–70 days depending on the climate and other factors, the grapes go through several changes which impact their sugar, acid, t
|
https://en.wikipedia.org/wiki/United%20Nations%20Permanent%20Forum%20on%20Indigenous%20Issues
|
The United Nations Permanent Forum on Indigenous Issues (UNPFII or PFII) is the UN's central coordinating body for matters relating to the concerns and rights of the world's indigenous peoples. There are more than 370 million indigenous people (also known as native, original, aboriginal and first peoples) in some 70 countries worldwide.
The forum was created in 2000 as an outcome of the UN's International Year for the World's Indigenous People in 1993, within the first International Decade of the World's Indigenous People (1995–2004). It is an advisory body within the framework of the United Nations System that reports to the UN's Economic and Social Council (ECOSOC).
History
Resolution 45/164 of the United Nations General Assembly was adopted on 18 December 1990, proclaiming that 1993 would be the International Year for the World's Indigenous People, "with a view to strengthening international cooperation for the solution of problems faced by indigenous communities in areas such as human rights, the environment, development, education and health". The year was launched in Australia by Prime Minister Paul Keating's memorable Redfern speech on 10 December 1992, in which he addressed Indigenous Australians' disadvantage.
The creation of the permanent forum was discussed at the 1993 World Conference on Human Rights in Vienna, Austria. The Vienna Declaration and Programme of Action recommended that such a forum should be established within the first United Nations International Decade of the World's Indigenous Peoples.
A working group was formed and various other meetings took place that led to the establishment of the permanent forum by Economic and Social Council Resolution 2000/22 on 28 July 2000.
Functions and operation
It submits recommendations to the Council on issues related to indigenous peoples. It holds a two-week session each year which takes place at the United Nations Headquarters in New York City but it could also take place in Geneva or any other p
|
https://en.wikipedia.org/wiki/Use-case%20analysis
|
Use case analysis is a technique used to identify the requirements of a system (normally associated with software/process design) and the information used to both define processes used and classes (which are a collection of actors and processes) which will be used both in the use case diagram and the overall use case in the development or redesign of a software system or program. The use case analysis is the foundation upon which the system will be built.
Background
A use case analysis is the primary form for gathering usage requirements for a new software program or task to be completed. The primary goals of a use case analysis are: designing a system from the user's perspective, communicating system behavior in the user's terms, and specifying all externally visible behaviors. Another set of goals for a use case analysis is to clearly communicate: system requirements, how the system is to be used, the roles the user plays in the system, what the system does in response to the user stimulus, what the user receives from the system, and what value the customer or user will receive from the system.
Process
There are several steps involved in a use-case analysis.
Realization
A Use-case realization describes how a particular use case was realized within the design model, in terms of collaborating objects.
The Realization step sets up the framework within which an emerging system is analysis. This is where the first, most general, outline of what is required by the system is documented. This entails rough breakdown of the processes, actors, and data required for the system. These are what comprise the classes of the analysis.
Description
Once the general outline is completed, the next step is to describe the behavior of the system visible to the potential user of the system. While internal behaviors can be described as well, this is more related to designing a system rather than gathering requirements for it. The benefit of briefly describing internal behaviors woul
|
https://en.wikipedia.org/wiki/Agaric
|
An agaric () is a type of fungus fruiting body characterized by the presence of a pileus (cap) that is clearly differentiated from the stipe (stalk), with lamellae (gills) on the underside of the pileus. In the UK, agarics are called "mushrooms" or "toadstools". In North America they are typically called "gilled mushrooms". "Agaric" can also refer to a basidiomycete species characterized by an agaric-type fruiting body.
Archaically, agaric meant 'tree-fungus' (after Latin agaricum); however, that changed with the Linnaean interpretation in 1753 when Linnaeus used the generic name Agaricus for gilled mushrooms.
Most species of agaricus belong to the order Agaricales in the subphylum Agaricomycotina. The exceptions, where agarics have evolved independently, feature largely in the orders Russulales, Boletales, Hymenochaetales, and several other groups of basidiomycetes. Old systems of classification placed all agarics in the Agaricales and some (mostly older) sources use "agarics" as the colloquial collective noun for the Agaricales. Contemporary sources now tend to use the term euagarics to refer to all agaric members of the Agaricales. "Agaric" is also sometimes used as a common name for members of the genus Agaricus, as well as for members of other genera; for example, Amanita muscaria is known by its common name "fly agaric".
|
https://en.wikipedia.org/wiki/Condensation%20symbol
|
A condensation symbol is "a name, word, phrase, or maxim which stirs vivid impressions involving the listener's most basic values and readies the listener for action," as defined by political scientist Doris Graber. Short words or phrases such as "my country," "old glory" "American Dream," "family values," are all condensation symbols because they conjure a specific image within the listener and carry "intense emotional and effective power." Often used to further the meaning of a symbol or phrase, the condensation symbol has a semantic meaning, but through long-term use, it has acquired other connotations that further its symbolic meaning. Doris Graber identified three main characteristics of condensation symbols, as they:
Have the tendency to evoke rich and vivid images in an audience.
Possess the capacity to arouse emotions.
Supply instant categorizations and evaluations.
Considering the phrase "American Dream," the image that tends to come to mind is a successful, self-made American individual who has worked hard in order to obtain a life of financial security, with occasional luxury and minimal privilege, even if the sociological reality varies widely by region, class, place, and time. A closely related concept is the rhetorical concept of the ideograph.
Emergence of the term
With origins in psychology, sociology, and semiotic research, a condensation symbol is "a single symbol that represents multiple emotions, ideas, feelings, memories, or impulses”. Sigmund Freud first defined condensation in dreams as "fusing several different elements into one." When a listener hears a phrase that is meant to conjure a specific image, their mind should immediately turn to the image that is associated with the phrase, and feel the intended emotion the speaker wishes to present.
Edward Sapir later applied the term to linguistics along with his principle of linguistic relativity, which holds that "the structure of language affects the ways in which its speakers conceptua
|
https://en.wikipedia.org/wiki/Subsequence
|
In mathematics, a subsequence of a given sequence is a sequence that can be derived from the given sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence is a subsequence of obtained after removal of elements and The relation of one sequence being the subsequence of another is a preorder.
Subsequences can contain consecutive elements which were not consecutive in the original sequence. A subsequence which consists of a consecutive run of elements from the original sequence, such as from is a substring. The substring is a refinement of the subsequence.
The list of all subsequences for the word "apple" would be "a", "ap", "al", "ae", "app", "apl", "ape", "ale", "appl", "appe", "aple", "apple", "p", "pp", "pl", "pe", "ppl", "ppe", "ple", "pple", "l", "le", "e", "" (empty string).
Common subsequence
Given two sequences and a sequence is said to be a common subsequence of and if is a subsequence of both and For example, if
then is said to be a common subsequence of and
This would be the longest common subsequence, since only has length 3, and the common subsequence has length 4. The longest common subsequence of and is
Applications
Subsequences have applications to computer science, especially in the discipline of bioinformatics, where computers are used to compare, analyze, and store DNA, RNA, and protein sequences.
Take two sequences of DNA containing 37 elements, say:
SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
The longest common subsequence of sequences 1 and 2 is:
LCS(SEQ1,SEQ2) = CGTTCGGCTATGCTTCTACTTATTCTA
This can be illustrated by highlighting the 27 elements of the longest common subsequence into the initial sequences:
SEQ1 = AGGTGAGGAG
SEQ2 = CTAGTTAGTA
Another way to show this is to align the two sequences, that is, to position elements of the longest common subsequence in a same column (indicated by the vert
|
https://en.wikipedia.org/wiki/Transverse%20nasal%20crease
|
The transverse nasal crease or groove is a usually white line between the upper two-thirds and the lower third of the human nose (slightly above the cartilage tip between the bridge and nostrils). It can occur as the result of heredity, accident, or the constant rubbing or wiping of the nose, commonly referred to as the allergic salute.
Occurrence
In addition to cases caused by heredity, physical injury, the transverse nasal crease is common in children and adults with chronic nasal allergies. People with allergies often use their hands to remove mucus from a runny nose or rub an itchy nose. As the hand slides upward, the tip of the nose is pressed up, thus creating the crease.
Appearance
The appearance of the line depends on skin pigmentation. On lighter-skinned people, the transverse nasal crease is lighter in color than the surrounding skin, and may appear white. This is due to hypopigmentation resulting from the low level of melanin present in the damaged skin. In darker-skinned people, the line may appear darker than the surrounding skin.
|
https://en.wikipedia.org/wiki/Dynamic%20Data%20Exchange
|
In computing, Dynamic Data Exchange (DDE) is a technology for interprocess communication used in early versions of Microsoft Windows and OS/2. DDE allows programs to manipulate objects provided by other programs, and respond to user actions affecting those objects. DDE was partially superseded by Object Linking and Embedding (OLE), and is currently maintained in Windows systems only for the sake of backward compatibility.
History and architecture
Dynamic Data Exchange was first introduced in 1987 with the release of Windows 2.0 as a method of interprocess communication so that one program could communicate with or control another program, somewhat like Sun's RPC (Remote Procedure Call). At the time, the only method for communication between the operating system and client applications was the "Windows Messaging Layer." DDE extended this protocol to allow peer-to-peer communication among client applications, via message broadcasts.
Because DDE runs via message broadcasts, it is vulnerable to any window-management code that does not pump messages. This problem was not considered during the design of DDE, because DDE predates pre-emptive multitasking.
Moreover, any code managing a window handle can respond to a DDE broadcast; the initiator of DDE must distinguish between expected and unexpected responses. DDE interlocutors usually express what information they seek in terms of hierarchical string keys. For example, a cell in Microsoft Excel was known to DDE by its "application" name. Each application could further organize information by groups known as "topic" and each topic could serve up individual pieces of data as an "item". For example, if a user wanted to pull a value from Microsoft Excel which was contained in a spreadsheet called "Book1.xls" in the cell in the first row and first column, the application would be "Excel", the topic "Book1.xls" and the item "r1c1". Internal changes in the cell due to Excel actions would then be signaled (in reverse
|
https://en.wikipedia.org/wiki/World%20Reuse%2C%20Repair%20and%20Recycling%20Association
|
The World Reuse, Repair and Recycling Association (WR3A) is a business consortium dedicated to the reform of the trade of e-waste. The WR3A is inspired by fair trade organizations.
History
WR3A is a Fair Trade association (tradename Fair Trade Recycling reserved in 2013) established both to improve the export markets for surplus electronics and e-waste, and to defend them from biased reporting and racial profiling. WR3A was conceived in 2006 following a visit to China by a group including a USA electronics recycler (American Retroworks Inc.), a University of California Davis recycling program director, and a Seattle recycler with a zero-export policy.
The group was inspired by a visit to three of China's semi knock down factories. Those factories purchased USA computer monitors which still have functional CRTs. The CRTs are knocked down to the bare tube, which is inserted into a new TV or monitor case, complete with new tuner board, etc. WR3A founders observed that Western journalists reporting on the purchase and import of the used CRTs invariably described them as "primitive" wire burning operations, rather than re-manufacturers. These were often the same contract manufacturers who originally assembled brand new CRT monitors, and now rebuilt second-hand CRTs. The USA has its own CRT refurbishing factory, Video Display Corp of Tucker, Georgia.
WR3A proposed to form a coalition of USA companies to export only functional CRT monitors directly to the reuse factories, removing imploded, damaged, screen-burned, older, or non-compliant raster (e.g. Trinitron) CRTs from loads destined for CRT factories. The USA companies which remove and recycle the bad 1/3 of CRTs would benefit from higher prices, and the Chinese factories would bypass the sorting villages such as Guiyu. The WR3A was swamped by orders from Asian factories that year.
The Chinese government, which took over most of the new CRT manufacturing capacity worldwide in the 1990s, eventually opposed the
|
https://en.wikipedia.org/wiki/Telecommunications%20network
|
A telecommunications network is a group of nodes interconnected by telecommunications links that are used to exchange messages between the nodes. The links may use a variety of technologies based on the methodologies of circuit switching, message switching, or packet switching, to pass messages and signals.
Multiple nodes may cooperate to pass the message from an originating node to the destination node, via multiple network hops. For this routing function, each node in the network is assigned a network address for identification and locating it on the network. The collection of addresses in the network is called the address space of the network.
Examples of telecommunications networks include computer networks, the Internet, the public switched telephone network (PSTN), the global Telex network, the aeronautical ACARS network, and the wireless radio networks of cell phone telecommunication providers.
Network structure
In general, every telecommunications network conceptually consists of three parts, or planes (so-called because they can be thought of as being and often are, separate overlay networks):
The data plane (also user plane, bearer plane, or forwarding plane) carries the network's users' traffic, the actual payload.
The control plane carries control information (also known as signaling).
The management plane carries the operations, administration and management traffic required for network management. The management plane is sometimes considered a part of the control plane.
Data networks
Data networks are used extensively throughout the world for communication between individuals and organizations. Data networks can be connected to allow users seamless access to resources that are hosted outside of the particular provider they are connected to. The Internet is the best example of the internetworking of many data networks from different organizations.
Terminals attached to IP networks like the Internet are addressed using IP addresses. Protocols
|
https://en.wikipedia.org/wiki/Kohji%20Matsumoto
|
is a Japanese mathematician . He is professor of mathematics at Nagoya University in Nagoya, Japan.
Education and career
Matsumoto graduated from the University of Tokyo in 1981. He got a doctoral degree from Rikkyo University in 1986, advised by Akio Fujii. His thesis was titled Discrepancy estimates for the value-distribution of the Riemann zeta-function. He became a lecturer at Iwate University in 1987 and an associate professor there in 1990. He joined Nagoya University in 1995, becoming a full professor there in 2001.
Research
Matsumoto's specializations include number theory, zeta theory, and mathematical analysis. He is mostly recognized for the Matsumoto zeta function, a zeta function named after him. He co-edited Analytic Number Theory (2002), a book about prime numbers, divisor problems, Diophantine equations, and other topics related to analytic number theory, including Diophantine approximations, and the theory of zeta and L-functions. His other book, Algebraic And Analytic Aspects Of Zeta Functions And L-Functions, a compilation of lectures at the French-Japanese Winter School, was published in 2010.
Selected publications
|
https://en.wikipedia.org/wiki/ZoneAlarm
|
ZoneAlarm is an internet security software company that provides consumer antivirus and firewall products. ZoneAlarm was developed by Zone Labs, whose CEOs were Kevin Nickel, Mouad Abid and Shahin and the Company was acquired in March 2004 by Check Point. ZoneAlarm's firewall security products include an inbound intrusion detection system, as well as the ability to control which programs can open outbound connections.
Technical description
In ZoneAlarm, program access is controlled by way of "zones", into which all network connections are divided. The "trusted zone" which generally includes the user's local area network can share resources such as files and printers. The "Internet zone" includes everything without the trusted zone. The user can grant permissions (trusted zone client, trusted zone server, Internet zone client, Internet zone server) to programs before they attempt to access the Internet (e.g. before the first use) or ZoneAlarm will ask the user to grant permissions on the first access attempt.
"True Vector Internet Monitor", also known as "TrueVector Security Engine", is a Windows service that is the core of ZoneAlarm. In the processes list its Image Name is "vsmon.exe". This monitors internet traffic and generates alerts for disallowed access. "Operating System Firewall" (OSFirewall) monitors programs and generates alerts when they perform suspicious behaviors. The OSFirewall is useful in preventing rootkits and other spyware. "SmartDefense Advisor" is the name ZoneAlarm give to a service available in all versions that helps the user with certain types of alert, using a database of trusted program signatures to provide the user with advice on allowing or denying Internet access in response to program requests.
The current free version of Zonealarm has an ad for the paid version that pops up every time you turn on your computer after a short delay.
Awards and certifications
Both the free and Pro editions of ZoneAlarm Firewall were designated as
|
https://en.wikipedia.org/wiki/Calabi%E2%80%93Yau%20manifold
|
In algebraic geometry, a Calabi–Yau manifold, also known as a Calabi–Yau space, is a particular type of manifold which has properties, such as Ricci flatness, yielding applications in theoretical physics. Particularly in superstring theory, the extra dimensions of spacetime are sometimes conjectured to take the form of a 6-dimensional Calabi–Yau manifold, which led to the idea of mirror symmetry. Their name was coined by , after who first conjectured that such surfaces might exist, and who proved the Calabi conjecture.
Calabi–Yau manifolds are complex manifolds that are generalizations of K3 surfaces in any number of complex dimensions (i.e. any even number of real dimensions). They were originally defined as compact Kähler manifolds with a vanishing first Chern class and a Ricci-flat metric, though many other similar but inequivalent definitions are sometimes used.
Definitions
The motivational definition given by Shing-Tung Yau is of a compact Kähler manifold with a vanishing first Chern class, that is also Ricci flat.
There are many other definitions of a Calabi–Yau manifold used by different authors, some inequivalent. This section summarizes some of the more common definitions and the relations between them.
A Calabi–Yau -fold or Calabi–Yau manifold of (complex) dimension is sometimes defined as a compact -dimensional Kähler manifold satisfying one of the following equivalent conditions:
The canonical bundle of is trivial.
has a holomorphic -form that vanishes nowhere.
The structure group of the tangent bundle of can be reduced from to .
has a Kähler metric with global holonomy contained in .
These conditions imply that the first integral Chern class of vanishes. Nevertheless, the converse is not true. The simplest examples where this happens are hyperelliptic surfaces, finite quotients of a complex torus of complex dimension 2, which have vanishing first integral Chern class but non-trivial canonical bundle.
For a compact -dimensional Kä
|
https://en.wikipedia.org/wiki/Jack%20the%20Nipper
|
Jack the Nipper is a video game by Gremlin Graphics released in 1986 for ZX Spectrum, Commodore 64, Amstrad CPC, and MSX. It was followed by a sequel, Jack the Nipper II: In Coconut Capers.
Gameplay
Jack the Nipper is a side-view flip screen game with puzzle solving and platform elements. The graphics are rendered in 2D, but an illusion of depth is achieved by allowing characters to move forward and back within the playing area.
The player controls Jack, a naughty child who wants to break the record for naughtiness (recorded on the "naughtyometer"). He needs to carry out various wicked pranks on the unsuspecting inhabitants of his town, but if he comes into contact by angry adults he will be spanked. With each spanking his "nappy rash" meter increases, and if it grows too high Jack loses a life. Contact with the monsters and ghosts which inhabit the town will also increase the nappy rash.
Reception
The game went to number 1 in the ZX Spectrum charts, replacing Ghosts 'n Goblins, and reached number 2 in the overall charts behind Leader Board.
Sinclair User described it as having a "Wallyish style reminiscent of Pyjamarama, running wild through the village, searching houses, shops and gardens for objects you can use to create havoc elsewhere", in an environment populated by "Beano"-type characters. The review noted how it was "tempting when you come across a well-tended garden and you just happen to have a bottle of weed killer ... And then there's the tin of glue and the false teeth factory..."
ZX Computing praised the graphics. The Spectrum version was voted number 40 in the Your Sinclair Readers' Top 100 Games of All Time.
Legacy
Starting in April 1987, Your Sinclair magazine published a monthly comic strip based on the character.
|
https://en.wikipedia.org/wiki/LSMEM1
|
Leucine-Rich Single-Pass Membrane Protein 1 (LSMEM1) is a protein that, in humans, is encoded by the LSMEM1 gene.
Gene
In humans, LSMEM1 is located on chromosome 7q31.1. LSMEM1 neighbors the gene IFRD1 in humans. Aliases for LSMEM1 include C7orf53, chromosome 7 open reading frame 53, and FLJ39575. The human mRNA is 1686 base pairs long and the gene contains 5 exons. The human mRNA also has a 5' UTR and a 3' UTR. The 5' UTR goes from mRNA position 1 to 341, and the 3' UTR goes from mRNA position 738 to 1686.
Protein
The protein LSMEM1 encodes in humans is 131 amino acids long and has a molecular weight ranging from 14.2 to 14.5 kDal. Its isoelectric point in humans is about 5, making it slightly acidic. LSMEM1 is an integral membrane protein and a transmembrane protein Besides its transmembrane segment, it is mainly made up of coils and relatively few beta strands. As its name implies, LSMEM1 only has one transmembrane segment. The predicted post-translational modifications to the human LSMEM1 protein are glycation and phosphorylation. There is no predicted signal peptide for the human protein.
Homology/Evolution
There are no known paralogs in humans for LSMEM1. Orthologous proteins exist mainly in mammals, birds, and reptiles. There are also more distant orthologs in amphibians and sarcopterygii. LSMEM1 does not show up in invertebrates, fungi, or prokaryotes. LSMEM1 also contains a conserved domain of unknown function DUF4577. When the human protein encoded by LSMEM1 is compared to a known quickly evolving protein (fibrinopeptides) and a known slowly evolving protein (cytochrome c), LSMEM1 appears to be slowly evolving.
Expression
In humans, LSMEM1 is very highly expressed in skeletal muscle. In humans, LSMEM1 also shows high expression in nerve tissue, moderate expression in the uterus, testis, bone marrow, heart, and intestines, and low expression in the brain and pancreas. It also shows expression in both the fetal and adult stages of life in humans.
LSMEM
|
https://en.wikipedia.org/wiki/Algebraic%20definition
|
In mathematical logic, an algebraic definition is one that can be given using only equations between terms with free variables. Inequalities and quantifiers are specifically disallowed.
Saying that a definition is algebraic is a stronger condition than saying it is elementary.
Related
Algebraic sentence
Algebraic theory
Algebraic expression
Algebraic equation
|
https://en.wikipedia.org/wiki/Sun%20Is%20Shining%20%28Bob%20Marley%20and%20the%20Wailers%20song%29
|
"Sun Is Shining" is a song by Jamaican reggae band Bob Marley & the Wailers, first appearing on the Lee Perry-produced album Soul Revolution Part II in 1971, and then on African Herbsman in 1973. Marley later re-recorded the song for his 1978 album Kaya. In 1999, a remix by "Bob Marley vs. Funkstar De Luxe" reached number one on the US Hot Dance Music/Club Play chart and number three on the UK Singles Chart.
Although having become one of the most popular Marley songs, "Sun Is Shining" used to be a fairly unknown and seldom-performed number during Marley's lifetime. Up to date, only two live performances are documented; however, both took place under special circumstances. On 16 June 1978, Marley performed at The Music Inn in Lenox, Massachusetts, a concert having been rescheduled twice since 1976, and played an over 2-hour set. "Sun Is Shining" was the opening song, reportedly included spontaneously as it stopped to rain. On 23 July 1978, Marley performed an outdoor concert at the Santa Barbara Bowl that included "Sun Is Shining" as opening song; just before the song, Marley introduced the performance by referring to Haile Selassie's birthday on the same day.
Bob Marley vs. Funkstar De Luxe version
The song was remixed in 1999 by Danish house music producer Funkstar De Luxe. It was released on the Kontor Records-sub label Club Tools, credited to Bob Marley vs. Funkstar De Luxe. The producer was the first to receive clearance from the Marley estate to release official remixes of the late singer's music (although bootleg mixes of Marley tunes have circulated in the club world for years).
The song reached number one in Iceland and on the American and Canadian dance charts, and it debuted at number three on the UK Singles Chart—Marley's highest-charting single in that country. It also became a top-10 hit in Belgium, Finland, Ireland, Norway and Switzerland.
Track listing
"Sun Is Shining" (Radio De Luxe edit) – 3:59
"Sun Is Shining" (ATB airplay mix) – 3:48
"Sun
|
https://en.wikipedia.org/wiki/Coleoptera%20paleobiota%20of%20Burmese%20amber
|
Burmese amber is fossil resin dating to the early Late Cretaceous Cenomanian age recovered from deposits in the Hukawng Valley of northern Myanmar. It is known for being one of the most diverse Cretaceous age amber paleobiotas, containing rich arthropod fossils, along with uncommon vertebrate fossils and even rare marine inclusions. A mostly complete list of all taxa described up until 2018 can be found in Ross 2018; its supplement Ross 2019b covers most of 2019.
This article covers fossils classified as belonging to order Coleoptera, and its sub-orders Adephaga, Archostemata, Myxophaga, and Polyphaga.
Adephaga
Archostemata
Myxophaga
Polyphaga
Incertae sedis
|
https://en.wikipedia.org/wiki/Neurotechnology%20Industry%20Organization
|
The Neurotechnology Industry Organization (NIO) is a San Francisco, California based non-profit trade association that represents a broad spectrum of companies involved in neuroscience, brain research centers, and advocacy groups from around the globe. Operating as a coalition of organizations in the field of neurotechnology, the goal of NIO is to enhance awareness of brain and nervous system illnesses, as well as to promote and advocate for treatment and diagnostic options.
See also
Brain-computer interface
Brain implant
Neuroprosthetics
Neural Engineering
Transcranial magnetic stimulation
Enablement (disambiguation)
External links
NeurotechIndustry.org - Official website
Neurotechnology
Neural engineering
|
https://en.wikipedia.org/wiki/David%20Soudry
|
David Soudry (born 1956) is a professor of mathematics at Tel Aviv University working in number theory and automorphic forms.
Career
Soudry was born in 1956. He received his PhD in mathematics from Tel Aviv University in 1983 under the supervision of Ilya Piatetski-Shapiro. From 1983 to 1984, he was a member of the Institute for Advanced Study. He is a professor of mathematics at Tel Aviv University.
Research
Together with Stephen Rallis and David Ginzburg, Soudry wrote a series of papers about automorphic descent culminating in their book The descent map from automorphic representations of GL(n) to classical groups. Their automorphic descent method constructs an explicit inverse map to the (standard) Langlands functorial lift and has had major applications to the analysis of functoriality. Also, using the "Rallis tower property" from Rallis's 1984 paper on the Howe duality conjecture, they studied global exceptional correspondences and found new examples of functorial lifts.
Selected publications
|
https://en.wikipedia.org/wiki/DragonflyTV
|
DragonflyTV is an Emmy Award-winning science education television series produced by Twin Cities Public Television. The show aired on PBS Kids and PBS Kids Go! from January 19, 2002, to December 20, 2008. It was aimed at ages 9–12. Seasons 1–4 were co-hosted by Michael Brandon Battle and Mariko Nakasone. Seasons 5–7 were hosted by Eric Artell and were produced in partnership with science museums. DragonflyTV was created in collaboration with Project Dragonfly at Miami University, which founded Dragonfly magazine, the first national magazine to feature children's investigations, experiments, and discoveries. DragonflyTV pioneered a "real kids, real science" approach to children's science television and led to the development of the SciGirls television series. DragonflyTV and SciGirls were funded in part by the National Science Foundation to provide a national forum for children's scientific investigations. Reruns of DragonflyTV aired on select PBS stations until 2010, and later in off-network cable syndication to allow commercial stations to meet federal E/I mandates.
Episodes
Season 1 (2002)
Season 2 (2003)
Teams of DFTV's kid scientists demonstrate different approaches to investigations – experimental, engineering, and observational.
Season 3 (2004)
Season 4 (2005)
Season 5 (2006)
Season 6 (2007)
Season 7 (2008)
|
https://en.wikipedia.org/wiki/Folate-biopterin%20transporter%20family
|
The folate-biopterin transporter (FBT) family (TC# 2.A.71) is a distant family within the major facilitator superfamily, most closely related to drug resistance permeases. Proteins of the FBT family are reported to contain about 480 to 650 amino acyl residues. All probably have 12 transmembrane α-helical segments (TMSs). They may function by H+ symport.
Transport reaction
The probable transport reaction catalyzed by characterized FBT family members is:
[folate, biopterin, or AdoMet] (out) + H+ (out) → [folate, biopterin, or AdoMet] (in) + H+ (in)
Functionally characterized members
The FBT family includes functionally characterized members from protozoa, cyanobacteria and plants. Functionally characterized members of the family include FT1, the major folate transporter, and BT1, the biopterin/folate transporter and AdoMetT1, the major S-adenosylmethionine uptake porter. A related protein in Trypanosoma brucei, ESAGIO, shows weak folate/biopterin transport activity. There are at least 6 homologues of the FT1 transporter in Leishmania encoded by tandem genes.
|
https://en.wikipedia.org/wiki/Neuraminidase
|
Exo-α-sialidase (, sialidase, neuraminidase; systematic name acetylneuraminyl hydrolase) is a glycoside hydrolase that cleaves the glycosidic linkages of neuraminic acids:
Hydrolysis of α-(2→3)-, α-(2→6)-, α-(2→8)- glycosidic linkages of terminal sialic acid residues in oligosaccharides, glycoproteins, glycolipids, colominic acid and synthetic substrates
Neuraminidase enzymes are a large family, found in a range of organisms. The best-known neuraminidase is the viral neuraminidase, a drug target for the prevention of the spread of influenza infection. The viral neuraminidases are frequently used as antigenic determinants found on the surface of the influenza virus. Some variants of the influenza neuraminidase confer more virulence to the virus than others. Other homologues are found in mammalian cells, which have a range of functions. At least four mammalian sialidase homologues have been described in the human genome (see NEU1, NEU2, NEU3, NEU4).
Sialidases may act as pathogenic factors in microbial infections.
Reaction
There are two major classes of Neuraminidase that cleave exo or endo poly-sialic acids:
Exo hydrolysis of α-(2→3)-, α-(2→6)-, α-(2→8)-glycosidic linkages of terminal sialic acid residues
Endo hydrolysis of (2→8)-α-sialosyl linkages in oligo- or poly(sialic) acids (see endo-α-sialidase.)
Function
Sialidases, also called neuraminidases, catalyze the hydrolysis of terminal sialic acid residues from the newly formed virions and from the host cell receptors. Sialidase activities include assistance in the mobility of virus particles through the respiratory tract mucus and in the elution of virion progeny from the infected cell.
Subtypes
Swiss-Prot lists 137 types of neuraminidase from various species as of October 18, 2006. Nine subtypes of influenza neuraminidase are known; many occur only in various species of duck and chicken. Subtypes N1 and N2 have been positively linked to epidemics in humans, and strains with N3 or N7 subtypes have been
|
https://en.wikipedia.org/wiki/Diversity%20index
|
A diversity index is a quantitative measure that reflects how many different types (such as species) there are in a dataset (a community), and that can simultaneously take into account the phylogenetic relations among the individuals distributed among those types, such as richness, divergence or evenness. These indices are statistical representations of biodiversity in different aspects (richness, evenness, and dominance).
Effective number of species or Hill numbers
When diversity indices are used in ecology, the types of interest are usually species, but they can also be other categories, such as genera, families, functional types, or haplotypes. The entities of interest are usually individual plants or animals, and the measure of abundance can be, for example, number of individuals, biomass or coverage. In demography, the entities of interest can be people, and the types of interest various demographic groups. In information science, the entities can be characters and the types of the different letters of the alphabet. The most commonly used diversity indices are simple transformations of the effective number of types (also known as 'true diversity'), but each diversity index can also be interpreted in its own right as a measure corresponding to some real phenomenon (but a different one for each diversity index).
Many indices only account for categorical diversity between subjects or entities. Such indices, however do not account for the total variation (diversity) that can be held between subjects or entities which occurs only when both categorical and qualitative diversity are calculated.
True diversity, or the effective number of types, refers to the number of equally abundant types needed for the average proportional abundance of the types to equal that observed in the dataset of interest (where all types may not be equally abundant). The true diversity in a dataset is calculated by first taking the weighted generalized mean of the proportional abundance
|
https://en.wikipedia.org/wiki/Annals%20of%20Applied%20Probability
|
The Annals of Applied Probability is a leading peer-reviewed mathematics journal published by the Institute of Mathematical Statistics, which is the main international society for researchers in probability and
statistics. The journal was established in 1991 by founding editor J. Michael Steele and is indexed by Mathematical Reviews and Zentralblatt MATH. Its 2009 MCQ was 1.02. Its impact factor (measured by JCR/ISI-Thomson) evolved from 1.454 in 2014 to 1.786 in 2017.
The journal CiteScore is 3.2 and its SCImago Journal Rank is 1.878, both from 2020. It is currently ranked 9th in the field of Probability & Statistics with Applications according to Google Scholar.
|
https://en.wikipedia.org/wiki/BioSteel%20%28fiber%29
|
BioSteel was a trademark name for a high-strength fiber-based material made of the recombinant spider silk-like protein extracted from the milk of transgenic goats, made by defunct Montreal-based company Nexia Biotechnologies, and later by the Randy Lewis lab of the University of Wyoming and Utah State University. It is reportedly 7-10 times as strong as steel if compared for the same weight, and can stretch up to 20 times its unaltered size without losing its strength properties. It also has very high resistance to extreme temperatures, not losing any of its properties within .
The company had created lines of goats to produce recombinant versions of two spidroins from Nephila clavipes, the golden orb weaver, MaSp1 and MaSp2 When the female goats lactate, the milk, containing the recombinant DNA silk, was to be harvested and subjected to chromatographic techniques to purify the recombinant silk proteins.
The purified silk proteins could be dried, dissolved using solvents (DOPE formation) and transformed into microfibers using wet-spinning fiber production methods. The spun fibers were reported to have tenacities in the range of 2 - 3 grams/denier and elongation range of 25-45%. The "Biosteel biopolymer" had been transformed into nanofibers and nanomeshes using the electrospinning technique.
Nexia is the only company that has successfully produced fibers from spider silk expressed in goat's milk. The Lewis lab has produced fibers from recombinant spider silk protein and synthetic spider silk proteins and genetic chimeras produced in both recombinant E. coli and the milk of recombinant goats, however, no one has been able to produce the silk in commercial quantities thus far. The company was founded in 1993 by Dr. Jeffrey Turner and Paul Ballard and was sold in 2005 to Pharmathene.
In 2009, two transgenic goats were sold to the Canada Agriculture Museum after Nexia Biotechnologies went bankrupt.
Research has since continued with the help of Randy Lewis, a profes
|
https://en.wikipedia.org/wiki/Theory%20of%20Computing%20Systems
|
Theory of Computing Systems is a peer-reviewed scientific journal published by Springer Verlag.
Published since 1967 as Mathematical Systems Theory and since volume 30 in 1997 under its current title, it is devoted to publishing original research from all areas of theoretical computer science, such as computational complexity, algorithms and data structures, or parallel and distributed algorithms and architectures. It is published 8 times per year since 2018, although the frequency varied in the past.
|
https://en.wikipedia.org/wiki/Quasinormal%20operator
|
In operator theory, quasinormal operators is a class of bounded operators defined by weakening the requirements of a normal operator.
Every quasinormal operator is a subnormal operator. Every quasinormal operator on a finite-dimensional Hilbert space is normal.
Definition and some properties
Definition
Let A be a bounded operator on a Hilbert space H, then A is said to be quasinormal if A commutes with A*A, i.e.
Properties
A normal operator is necessarily quasinormal.
Let A = UP be the polar decomposition of A. If A is quasinormal, then UP = PU. To see this, notice that the positive factor P in the polar decomposition is of the form (A*A), the unique positive square root of A*A. Quasinormality means A commutes with A*A. As a consequence of the continuous functional calculus for self-adjoint operators, A commutes with P = (A*A) also, i.e.
So UP = PU on the range of P. On the other hand, if h ∈ H lies in kernel of P, clearly UP h = 0. But PU h = 0 as well. because U is a partial isometry whose initial space is closure of range P. Finally, the self-adjointness of P implies that H is the direct sum of its range and kernel. Thus the argument given proves UP = PU on all of H.
On the other hand, one can readily verify that if UP = PU, then A must be quasinormal. Thus the operator A is quasinormal if and only if UP = PU.
When H is finite dimensional, every quasinormal operator A is normal. This is because that in the finite dimensional case, the partial isometry U in the polar decomposition A = UP can be taken to be unitary. This then gives
In general, a partial isometry may not be extendable to a unitary operator and therefore a quasinormal operator need not be normal. For example, consider the unilateral shift T. T is quasinormal because T*T is the identity operator. But T is clearly not normal.
Quasinormal invariant subspaces
It is not known that, in general, whether a bounded operator A on a Hilbert space H has a nontrivial invariant subspace. However, whe
|
https://en.wikipedia.org/wiki/Cryogenic%20processor
|
A Cryogenic processor is a unit designed to cool an object to ultra-low temperatures (usually around −300°F / −150°C) at a moderated rate in order to prevent thermal shock to the components being treated. The first commercial unit was developed by Ed Busch in the late 1960s. The development of programmable microprocessor controls allowed the machines to follow temperature profiles that increased the effectiveness of the process. Some manufacturers make cryogenic processors with home computers to define the temperature profile.
Before programmable controls were added to control cryogenic processors, the "treatment" process of an object was done manually by immersing the object in liquid nitrogen. This normally caused thermal shock to occur within an object, resulting in cracks to the structure. Modern cryogenic processors measure changes in temperature and adjust the input of liquid nitrogen accordingly to ensure that only fractional changes in temperature occur over a long period of time. Their temperature measurements and adjustments are condensed into "profiles" that are used to repeat the process in a certain way when treating for similarly grouped objects.
The general processing cycle for modern cryogenic processors occurs within a three-day time window, with 24 hours to reach the optimal minimum temperature for a product, 24 hours to hold at the minimum temperature, and 24 hours to return to room temperature. Depending on the product, some items will be heated in an oven to higher temperatures. Some processors are capable of providing both the negative and positive extreme temperatures, although separate units (a cryogenic processor and a dedicated oven) can sometimes produce better results depending upon the application.
The optimal minimum temperatures for objects, as well as the hold times involved, are determined utilizing different research methods and are backed by analysis of the product to determine the optimum procedure for a particular product. As
|
https://en.wikipedia.org/wiki/Thiodictyon
|
Thiodictyon is a genus of gram-negative bacterium classified within purple sulfur bacteria (PSB).
T. elegans forms "netlike aggregates under certain culture conditions." It is obligately phototrophic and strictly anaerobic.
T. bacillosum does not form netlike aggregates, only clumps.
"Ca. T. syntrophicum" grows best under micro-oxic and low light conditions. There has only been one successful enrichment of "Ca. T. syntrophicum"; "Ca. T. syntrophicum" strain Cad16T.
"Ca. T. intracellulare" is reported in 2021 as a symbiont of Pseudoblepharisma tenue. It has lost a great portion of its genome including known genes for sulfur dissimilation, but the remaining sequence place it quite close to "Ca. T. syntrophicum".
Classification
Thiodictyon belongs to the family Chromatiaceae and class Gammaproteobacteria. "Ca. T. syntrophicum" is known to be related to the genera Lamprocystis, Thiocystis and Thiocapsa. Strain Cad16T was previously assigned to the genus Lamprocystis, but was recently reassigned to the genus Thiodictyon by Peduzzi et al. Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) was used to separate Cad16T from Lamprocystis due to differences in cell morphology/arrangement, caretenoid groups and chemolithotrophic growth; all of which are important factors used to consider Cad16T a member of the genus Thiodictyon rather than the genus Lamprocystis.
Genetics
The 16S rRNA from the type strains of the two recognized species have been sequenced. The two proposed Candidatus species have had their whole genomes sequenced. GTDB reports that several whole genomes from metagenomic samples, not yet named, are also available, clustering into three additional species-level groups.
Strain Cad16T
Cad16T is a novel strain of "Ca. T. syntrophicum", which was isolated from the chemocline of a crenogenic meromictic lake. 16S rRNA gene sequence data shows that Cad16T is closely related to Thiodictyon bacillosum DSM234T (99.2% sequ
|
https://en.wikipedia.org/wiki/Necrobiome
|
The necrobiome has been defined as the community of species associated with decaying corpse remains. The process of decomposition is complex. Microbes decompose cadavers, but other organisms including fungi, nematodes, insects, and larger scavenger animals also contribute. Once the immune system is no longer active, microbes colonizing the intestines and lungs decompose their respective tissues and then travel throughout the body via the blood and lymphatic systems to break down other tissue and bone. During this process, gases are released as a by-product and accumulate, causing bloating. Eventually, the gases seep through the body's wounds and natural openings, providing a way for some microbes to exit from the inside of the cadaver and inhabit the outside. The microbial communities colonizing the internal organs of a cadaver are referred to as the thanatomicrobiome. The region outside of the cadaver that is exposed to the external environment is referred to as the epinecrotic portion of the necrobiome, and is especially important when determining the time and location of death for an individual. Different microbes play specific roles during each stage of the decomposition process. The microbes that will colonize the cadaver and the rate of their activity are determined by the cadaver itself and the cadaver's surrounding environmental conditions.
History
There is textual evidence that human cadavers were first studied around the third century BC to gain an understanding of human anatomy. Many of the first human cadaver studies took place in Italy, where the earliest record of determining the cause of death from a human corpse dates back to 1286. However, understanding of the human body progressed slowly, in part because the spread of Christianity and other religious beliefs resulted in human dissection becoming illegal. Thus, non-human animals were solely dissected for anatomical understanding until the 13th century when officials realized human cadavers were ne
|
https://en.wikipedia.org/wiki/International%20Software%20Testing%20Qualifications%20Board
|
The International Software Testing Qualifications Board (ISTQB) is a software testing certification board that operates internationally. Founded in Edinburgh in November 2002, the ISTQB is a non-profit association legally registered in Belgium.
ISTQB Certified Tester is a standardized qualification for software testers and the certification is offered by the ISTQB. The qualifications are based on a syllabus, and there is a hierarchy of qualifications and guidelines for accreditation and examination. More than 1 million ISTQB exams have been delivered and over 721,000 certifications issued; the ISTQB consists of 67 member boards worldwide representing more than 100 countries as of April 2021.
Product portfolio
Current ISTQB product portfolio follows a matrix approach characterized by
Levels, that identify progressively increasing learning objectives
Foundation
Advanced
Expert
Streams, that identify clusters of certification modules:
Core
Agile
Specialist
ISTQB streams focus on:
Core – these modules correspond to the “historical” ISTQB certifications and so they:
Cover software testing topic in a breadth-first, broad, horizontal way,
Are valid for any technology/ methodology/ application domain
Allow for a common understanding
Agile – these modules address testing practices specifically for the Agile SDLC
Specialist – these modules are new in the ISTQB product portfolio and address specific topics in a vertical way:
They can address specific quality characteristics (e.g.: Usability; Security; Performance; etc.)
They can address technologies that involve specific test approaches (e.g.: model based testing; mobile testing; etc.)
They can also be related to specific test activities (e.g.: test automation; test metrics management; etc.)
Pre-conditions
Pre-conditions relate to certification exams and provide a natural progression through the ISTQB Scheme which helps people pick the right certificate and informs them about what they need to know.
The
|
https://en.wikipedia.org/wiki/Fully%20Buffered%20DIMM
|
Fully Buffered DIMM (or FB-DIMM) is a memory technology that can be used to increase reliability and density of memory systems. Unlike the parallel bus architecture of traditional DRAMs, an FB-DIMM has a serial interface between the memory controller and the advanced memory buffer (AMB). Conventionally, data lines from the memory controller have to be connected to data lines in every DRAM module, i.e. via multidrop buses. As the memory width increases together with the access speed, the signal degrades at the interface between the bus and the device. This limits the speed and memory density, so FB-DIMMs take a different approach to solve the problem.
240-pin DDR2 FB-DIMMs are neither mechanically nor electrically compatible with conventional 240-pin DDR2 DIMMs. As a result, those two DIMM types are notched differently to prevent using the wrong one.
As with nearly all RAM specifications, the FB-DIMM specification was published by JEDEC.
Technology
Fully buffered DIMM architecture introduces an advanced memory buffer (AMB) between the memory controller and the memory module. Unlike the parallel bus architecture of traditional DRAMs, an FB-DIMM has a serial interface between the memory controller and the AMB. This enables an increase to the width of the memory without increasing the pin count of the memory controller beyond a feasible level. With this architecture, the memory controller does not write to the memory module directly; rather it is done via the AMB. AMB can thus compensate for signal deterioration by buffering and resending the signal.
The AMB can also offer error correction, without imposing any additional overhead on the processor or the system's memory controller. It can also use the Bit Lane Failover Correction feature to identify bad data paths and remove them from operation, which dramatically reduces command/address errors. Also, since reads and writes are buffered, they can be done in parallel by the memory controller. This allows simpler i
|
https://en.wikipedia.org/wiki/Quantum%20speed%20limit
|
In quantum mechanics, a quantum speed limit (QSL) is a limitation on the minimum time for a quantum system to evolve between two distinguishable states. QSL are closely related to time-energy uncertainty relations. In 1945, Leonid Mandelstam and Igor Tamm derived a time-energy uncertainty relation that bounds the speed of evolution in terms of the energy dispersion. Over half a century later, Norman Margolus and Lev Levitin showed that the speed of evolution cannot exceed the mean energy, a result known as the Margolus–Levitin theorem. Realistic physical systems in contact with an environment are known as open quantum systems and their evolution is also subject to QSL. Quite remarkably it was shown that environmental effects, such as non-Markovian dynamics can speed up quantum processes, which was verified in a cavity QED experiment.
QSL have been used to explore the limits of computation and complexity. In 2017, QSLs were studied in a quantum oscillator at high temperature. In 2018, it was shown that QSL are not restricted to the quantum domain and that similar bounds hold in classical systems. In 2021, both the Mandelstam-Tamm and the Margolus-Levitin QSL bounds were concurrently tested in a single experiment which indicated there are "two different regimes: one where the Mandelstam-Tamm limit constrains the evolution at all times, and a second where a crossover to the Margolus-Levitin limit occurs at longer times."
Mandelstam-Tamm limit
Let be the Bures metric, defined byIf a quantum system is evolving under a time-dependent Hamiltonian , then its velocity according to Bures metric is upper bounded bywhere is the uncertainty in energy at time .
Two corollaries:
The time taken to evolve from to is , where is the time-averaged uncertainty in energy.
The time taken to evolve from one pure state to another pure state orthogonal to it is .
Applications
Computation machinery is constructed out of physical matter that follows quantum mechanics, and each
|
https://en.wikipedia.org/wiki/Stem%20Cell%20Network
|
The Stem Cell Network (SCN) is a Canadian non-profit that supports stem cell and regenerative medicine research, teaches the next generation of highly qualified personal, and delivers outreach activities across Canada. The Network has been supported by the Government of Canada, since inception in 2001. SCN has catalyzed 25 clinical trials, 21 start-up companies, incubated several international and Canadian research networks and organizations, and established the Till & McCulloch Meetings, Canada's foremost stem cell research event.
The organization is based in Ottawa, Ontario.
Activities
Annual Scientific Conference
Since 2001, SCN has hosted an annual scientific conference. This conference is open to SCN investigators and trainees, and provides a forum to share new research. The conference takes place in a different Canadian city each year. In 2012, the annual conference was re-branded as the Till & McCulloch Meetings. The establishment of the Meetings ensured that the country's stem cell and regenerative medicine research community would continue to have a venue for collaboration and the sharing of important research. The Till & McCulloch Meetings are Canada's largest stem cell and regenerative medicine conference.
Research Funding Programs
Training
The SCN training program includes studentships, fellowships, research grants and workshops. Since 2001, SCN has offered training opportunities to more than 5,000 trainees.
Organization
Member institutions
SCN and its membership engage in collaborative funding and research activities. Current members institutions include:
Partners
|
https://en.wikipedia.org/wiki/Adenosinergic
|
Adenosinergic means "working on adenosine".
An adenosinergic agent (or drug) is a chemical which functions to directly modulate the adenosine system in the body or brain. Examples include adenosine receptor agonists, adenosine receptor antagonists (such as caffeine), and adenosine reuptake inhibitors.
See also
Adrenergic
Cannabinoidergic
Cholinergic
Dopaminergic
GABAergic
Glycinergic
Histaminergic
Melatonergic
Monoaminergic
Opioidergic
Serotonergic
|
https://en.wikipedia.org/wiki/Earnshaw%27s%20theorem
|
Earnshaw's theorem states that a collection of point charges cannot be maintained in a stable stationary equilibrium configuration solely by the electrostatic interaction of the charges. This was first proven by British mathematician Samuel Earnshaw in 1842.
It is usually cited in reference to magnetic fields, but was first applied to electrostatic fields.
Earnshaw's theorem applies to classical inverse-square law forces (electric and gravitational) and also to the magnetic forces of permanent magnets, if the magnets are hard (the magnets do not vary in strength with external fields). Earnshaw's theorem forbids magnetic levitation in many common situations.
If the materials are not hard, Braunbeck's extension shows that materials with relative magnetic permeability greater than one (paramagnetism) are further destabilising, but materials with a permeability less than one (diamagnetic materials) permit stable configurations.
Explanation
Informally, the case of a point charge in an arbitrary static electric field is a simple consequence of Gauss's law. For a particle to be in a stable equilibrium, small perturbations ("pushes") on the particle in any direction should not break the equilibrium; the particle should "fall back" to its previous position. This means that the force field lines around the particle's equilibrium position should all point inward, toward that position. If all of the surrounding field lines point toward the equilibrium point, then the divergence of the field at that point must be negative (i.e. that point acts as a sink). However, Gauss's law says that the divergence of any possible electric force field is zero in free space. In mathematical notation, an electrical force deriving from a potential will always be divergenceless (satisfy Laplace's equation):
Therefore, there are no local minima or maxima of the field potential in free space, only saddle points. A stable equilibrium of the particle cannot exist and there must be an instabil
|
https://en.wikipedia.org/wiki/Asymmetric%20bacterium
|
Asymmetric bacteria are bacteria that undergo "non-symmetrical" life cycles. This especially includes those that differentiate temporally, such as prosthecate bacteria.
History
Cell division asymmetries have appeared alongside the evolution of complex developmental processes. While bacteria were historically considered symmetric simple cells, this idea has been overturned by novel technology and observation techniques. However, asymmetric bacteria remain difficult to detect. Asymmetrical growth aids in determining the age of bacteria, because it gives rise to an old pole, or region of inert cell wall material found at the ends of a rod-shaped bacterial cell. Following the "old pole" of the cell wall material allows an observer to create a bacterial lineage.
Types of asymmetry
Bacteria exhibit three different types of asymmetry: conditional asymmetry, reproductive asymmetry, and morphological asymmetry.
Conditional asymmetry is well defined in the case of endospore formation, which is triggered by stressful environmental conditions such as increased heat, pH change, and nutrient depletion. This type of asymmetry is usually seen in Bacilli and Clostridia.
Reproductive asymmetry is classically linked to bacterial budding, where a mother cell concentrates cell wall material to one area and a daughter cell begins to bud from that thickening. Cell growth which gives rise to reproductive asymmetry occurs in three phases: stalk elongation, daughter cell elongation, and septum formation.
Morphological asymmetry is classified by polar elongation. In this type of asymmetrical growth, the daughter cell receives most of the new cell wall material.
Examples
Bacillus subtilis
Caulobacter crescentus
|
https://en.wikipedia.org/wiki/List%20of%20Sri%20Lankan%20flags
|
This is a list of flags used in Sri Lanka.
National flag
Presidential flag (1972–2022)
This flag was personal to every President of Sri Lanka, and as such the design changed when a new president assumed office.
On 15 July 2022, the acting President Ranil Wickremesinghe abolished the presidential flag.
Civil ensigns
Military flags
Government flags
Provincial flags
Historical flags
Sinhala Kingdom flags
Tamil flags
Portuguese Ceylon flags
Dutch Ceylon flags
British Ceylon flags
Ensigns
Royal standards
Viceregal flags
Military flags
|
https://en.wikipedia.org/wiki/Eduard%20Heine
|
Heinrich Eduard Heine (16 March 1821 – 21 October 1881) was a German mathematician.
Heine became known for results on special functions and in real analysis. In particular, he authored an important treatise on spherical harmonics and Legendre functions (Handbuch der Kugelfunctionen). He also investigated basic hypergeometric series. He introduced the Mehler–Heine formula.
Biography
Heinrich Eduard Heine was born on 16 March 1821 in Berlin, as the eighth child of banker Karl Heine and his wife Henriette Märtens. Eduard was initially home schooled, then studied at the Friedrichswerdersche Gymnasium and Köllnische Gymnasium in Berlin. In 1838, after graduating from gymnasium, he enrolled at the University of Berlin, but transferred to the University of Göttingen to attend the mathematics lectures of Carl Friedrich Gauss and Moritz Stern. In 1840 Heine returned to Berlin, where he studied mathematics under Peter Gustav Lejeune Dirichlet, while also attending classes of Jakob Steiner and Johann Franz Encke. In 1842 he was awarded a PhD by the University of Berlin for a thesis on differential equations submitted with Enno Dirksen and Martin Ohm as advisors. Heine dedicated the doctoral thesis to his professor Gustav Dirichlet. Next he went to the University of Königsberg to participate in the mathematical seminar of Carl Gustav Jacobi, while also following mathematical physics classes of Franz Ernst Neumann. In Königsberg Heine got in contact with fellow students Gustav Kirchhoff and Philipp Ludwig von Seidel.
In 1844 Heine went for a teaching position at the University of Bonn, passing his habilitation and starting as a privatdozent. He continued his research in mathematics in Bonn and, in 1848, was promoted to extraordinary professor. In 1850 he married Sophie Wolff, the daughter of a Berlin merchant; the couple had five children, four daughters and one son. In 1856 Heine moved as a full professor to the University of Halle, where he remained for the rest of his life
|
https://en.wikipedia.org/wiki/ZHLS-GF
|
ZHLS-GF (Zone-Based Hierarchical Link State Routing Protocol with Gateway Flooding) is a hybrid routing protocol for computer networks that is based on ZHLS.
In ZHLS, all network nodes construct two routing tables — an intra-zone routing table and an inter-zone routing table — by flooding NodeLSPs within the zone and ZoneLSPs throughout the network. However, this incurs a large communication overhead in the network.
In ZHLS-GF, the flooding scheme floods ZoneLSPs only to the gateway nodes of zones, thus reducing the communication overhead significantly. Further, in ZHLS-GF only the gateway nodes store ZoneLSPs and constructs inter-zone routing tables, meaning that the total storage capacity required in the network is less than in ZHLS.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.