contestId
int64 0
1.01k
| index
stringclasses 57
values | name
stringlengths 2
58
| type
stringclasses 2
values | rating
int64 0
3.5k
| tags
listlengths 0
11
| title
stringclasses 522
values | time-limit
stringclasses 8
values | memory-limit
stringclasses 8
values | problem-description
stringlengths 0
7.15k
| input-specification
stringlengths 0
2.05k
| output-specification
stringlengths 0
1.5k
| demo-input
listlengths 0
7
| demo-output
listlengths 0
7
| note
stringlengths 0
5.24k
| points
float64 0
425k
| test_cases
listlengths 0
402
| creationTimeSeconds
int64 1.37B
1.7B
| relativeTimeSeconds
int64 8
2.15B
| programmingLanguage
stringclasses 3
values | verdict
stringclasses 14
values | testset
stringclasses 12
values | passedTestCount
int64 0
1k
| timeConsumedMillis
int64 0
15k
| memoryConsumedBytes
int64 0
805M
| code
stringlengths 3
65.5k
| prompt
stringlengths 262
8.2k
| response
stringlengths 17
65.5k
| score
float64 -1
3.99
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
992
|
A
|
Nastya and an Array
|
PROGRAMMING
| 800
|
[
"implementation",
"sortings"
] | null | null |
Nastya owns too many arrays now, so she wants to delete the least important of them. However, she discovered that this array is magic! Nastya now knows that the array has the following properties:
- In one second we can add an arbitrary (possibly negative) integer to all elements of the array that are not equal to zero. - When all elements of the array become equal to zero, the array explodes.
Nastya is always busy, so she wants to explode the array as fast as possible. Compute the minimum time in which the array can be exploded.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105) — the size of the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=105<=≤<=*a**i*<=≤<=105) — the elements of the array.
|
Print a single integer — the minimum number of seconds needed to make all elements of the array equal to zero.
|
[
"5\n1 1 1 1 1\n",
"3\n2 0 -1\n",
"4\n5 -6 -5 1\n"
] |
[
"1\n",
"2\n",
"4\n"
] |
In the first example you can add - 1 to all non-zero elements in one second and make them equal to zero.
In the second example you can add - 2 on the first second, then the array becomes equal to [0, 0, - 3]. On the second second you can add 3 to the third (the only non-zero) element.
| 500
|
[
{
"input": "5\n1 1 1 1 1",
"output": "1"
},
{
"input": "3\n2 0 -1",
"output": "2"
},
{
"input": "4\n5 -6 -5 1",
"output": "4"
},
{
"input": "1\n0",
"output": "0"
},
{
"input": "2\n21794 -79194",
"output": "2"
},
{
"input": "3\n-63526 95085 -5239",
"output": "3"
},
{
"input": "3\n0 53372 -20572",
"output": "2"
},
{
"input": "13\n-2075 -32242 27034 -37618 -96962 82203 64846 48249 -71761 28908 -21222 -61370 46899",
"output": "13"
},
{
"input": "5\n806 0 1308 1954 683",
"output": "4"
},
{
"input": "8\n-26 0 -249 -289 -126 -206 288 -11",
"output": "7"
},
{
"input": "10\n2 2 2 1 2 -1 0 2 -1 1",
"output": "3"
},
{
"input": "1\n8",
"output": "1"
},
{
"input": "3\n0 0 0",
"output": "0"
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10",
"output": "10"
},
{
"input": "5\n2 0 -1 0 0",
"output": "2"
},
{
"input": "2\n0 0",
"output": "0"
},
{
"input": "5\n0 0 0 0 0",
"output": "0"
},
{
"input": "2\n1 0",
"output": "1"
},
{
"input": "2\n-1 0",
"output": "1"
},
{
"input": "4\n0 0 0 0",
"output": "0"
},
{
"input": "8\n10 9 -1 0 0 3 2 3",
"output": "5"
},
{
"input": "5\n5 0 1 2 3",
"output": "4"
},
{
"input": "3\n1 1 0",
"output": "1"
},
{
"input": "1\n-1",
"output": "1"
},
{
"input": "5\n1 2 0 0 0",
"output": "2"
},
{
"input": "5\n1 0 0 0 0",
"output": "1"
},
{
"input": "5\n4 5 6 0 0",
"output": "3"
},
{
"input": "4\n-1 0 0 1",
"output": "2"
},
{
"input": "5\n3 0 0 4 5",
"output": "3"
},
{
"input": "3\n0 0 2",
"output": "1"
},
{
"input": "3\n1 0 0",
"output": "1"
},
{
"input": "4\n0 0 0 4",
"output": "1"
},
{
"input": "5\n-1 0 0 0 0",
"output": "1"
},
{
"input": "2\n0 1",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n5",
"output": "1"
},
{
"input": "10\n0 0 0 0 0 1 2 3 0 0",
"output": "3"
},
{
"input": "4\n0 1 2 3",
"output": "3"
},
{
"input": "3\n0 1 2",
"output": "2"
},
{
"input": "4\n2 0 0 -1",
"output": "2"
}
] | 1,543,041,767
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 109
| 0
|
x1,x2,x3 = map(int,input().split(" "))
if x1 == x2 == x3:
print(0)
elif x1 > x2 and x2 < x3 and x1 != x3 and x1 != x2:
print(round((x1-x3 )+(x3 - x2)))
elif x1 > x2 and x2 > x3 and x1 != x3 and x1 != x2:
print(round((x1 - x2)+(x2-x3)))
elif x1 < x2 and x2 < x3 and x1 != x2 and x1 != x3:
print(round((x2 - x1)+(x3-x2)))
elif x1 == x2 and x3 > x2:
print(round((x3-x2)+(x3-x1)))
elif x3 == x2 and x1 > x3 or x1 > x2:
print(round((x1 - x3)+(x1-x2)))
elif x2 == x3 and x2 > x1 or x3 >x1:
print(round(x2 - x1))
|
Title: Nastya and an Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Nastya owns too many arrays now, so she wants to delete the least important of them. However, she discovered that this array is magic! Nastya now knows that the array has the following properties:
- In one second we can add an arbitrary (possibly negative) integer to all elements of the array that are not equal to zero. - When all elements of the array become equal to zero, the array explodes.
Nastya is always busy, so she wants to explode the array as fast as possible. Compute the minimum time in which the array can be exploded.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105) — the size of the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=105<=≤<=*a**i*<=≤<=105) — the elements of the array.
Output Specification:
Print a single integer — the minimum number of seconds needed to make all elements of the array equal to zero.
Demo Input:
['5\n1 1 1 1 1\n', '3\n2 0 -1\n', '4\n5 -6 -5 1\n']
Demo Output:
['1\n', '2\n', '4\n']
Note:
In the first example you can add - 1 to all non-zero elements in one second and make them equal to zero.
In the second example you can add - 2 on the first second, then the array becomes equal to [0, 0, - 3]. On the second second you can add 3 to the third (the only non-zero) element.
|
```python
x1,x2,x3 = map(int,input().split(" "))
if x1 == x2 == x3:
print(0)
elif x1 > x2 and x2 < x3 and x1 != x3 and x1 != x2:
print(round((x1-x3 )+(x3 - x2)))
elif x1 > x2 and x2 > x3 and x1 != x3 and x1 != x2:
print(round((x1 - x2)+(x2-x3)))
elif x1 < x2 and x2 < x3 and x1 != x2 and x1 != x3:
print(round((x2 - x1)+(x3-x2)))
elif x1 == x2 and x3 > x2:
print(round((x3-x2)+(x3-x1)))
elif x3 == x2 and x1 > x3 or x1 > x2:
print(round((x1 - x3)+(x1-x2)))
elif x2 == x3 and x2 > x1 or x3 >x1:
print(round(x2 - x1))
```
| -1
|
|
799
|
A
|
Carrot Cakes
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] | null | null |
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
|
The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
|
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
|
[
"8 6 4 5\n",
"8 6 4 6\n",
"10 3 11 4\n",
"4 2 1 4\n"
] |
[
"YES\n",
"NO\n",
"NO\n",
"YES\n"
] |
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
| 500
|
[
{
"input": "8 6 4 5",
"output": "YES"
},
{
"input": "8 6 4 6",
"output": "NO"
},
{
"input": "10 3 11 4",
"output": "NO"
},
{
"input": "4 2 1 4",
"output": "YES"
},
{
"input": "28 17 16 26",
"output": "NO"
},
{
"input": "60 69 9 438",
"output": "NO"
},
{
"input": "599 97 54 992",
"output": "YES"
},
{
"input": "11 22 18 17",
"output": "NO"
},
{
"input": "1 13 22 11",
"output": "NO"
},
{
"input": "1 1 1 1",
"output": "NO"
},
{
"input": "3 1 1 1",
"output": "YES"
},
{
"input": "1000 1000 1000 1000",
"output": "NO"
},
{
"input": "1000 1000 1 1",
"output": "YES"
},
{
"input": "1000 1000 1 400",
"output": "YES"
},
{
"input": "1000 1000 1 1000",
"output": "YES"
},
{
"input": "1000 1000 1 999",
"output": "YES"
},
{
"input": "53 11 3 166",
"output": "YES"
},
{
"input": "313 2 3 385",
"output": "NO"
},
{
"input": "214 9 9 412",
"output": "NO"
},
{
"input": "349 9 5 268",
"output": "YES"
},
{
"input": "611 16 8 153",
"output": "YES"
},
{
"input": "877 13 3 191",
"output": "YES"
},
{
"input": "340 9 9 10",
"output": "YES"
},
{
"input": "31 8 2 205",
"output": "NO"
},
{
"input": "519 3 2 148",
"output": "YES"
},
{
"input": "882 2 21 219",
"output": "NO"
},
{
"input": "982 13 5 198",
"output": "YES"
},
{
"input": "428 13 6 272",
"output": "YES"
},
{
"input": "436 16 14 26",
"output": "YES"
},
{
"input": "628 10 9 386",
"output": "YES"
},
{
"input": "77 33 18 31",
"output": "YES"
},
{
"input": "527 36 4 8",
"output": "YES"
},
{
"input": "128 18 2 169",
"output": "YES"
},
{
"input": "904 4 2 288",
"output": "YES"
},
{
"input": "986 4 3 25",
"output": "YES"
},
{
"input": "134 8 22 162",
"output": "NO"
},
{
"input": "942 42 3 69",
"output": "YES"
},
{
"input": "894 4 9 4",
"output": "YES"
},
{
"input": "953 8 10 312",
"output": "YES"
},
{
"input": "43 8 1 121",
"output": "YES"
},
{
"input": "12 13 19 273",
"output": "NO"
},
{
"input": "204 45 10 871",
"output": "YES"
},
{
"input": "342 69 50 425",
"output": "NO"
},
{
"input": "982 93 99 875",
"output": "NO"
},
{
"input": "283 21 39 132",
"output": "YES"
},
{
"input": "1000 45 83 686",
"output": "NO"
},
{
"input": "246 69 36 432",
"output": "NO"
},
{
"input": "607 93 76 689",
"output": "NO"
},
{
"input": "503 21 24 435",
"output": "NO"
},
{
"input": "1000 45 65 989",
"output": "NO"
},
{
"input": "30 21 2 250",
"output": "YES"
},
{
"input": "1000 49 50 995",
"output": "NO"
},
{
"input": "383 69 95 253",
"output": "YES"
},
{
"input": "393 98 35 999",
"output": "YES"
},
{
"input": "1000 22 79 552",
"output": "NO"
},
{
"input": "268 294 268 154",
"output": "NO"
},
{
"input": "963 465 706 146",
"output": "YES"
},
{
"input": "304 635 304 257",
"output": "NO"
},
{
"input": "4 2 1 6",
"output": "NO"
},
{
"input": "1 51 10 50",
"output": "NO"
},
{
"input": "5 5 4 4",
"output": "YES"
},
{
"input": "3 2 1 1",
"output": "YES"
},
{
"input": "3 4 3 3",
"output": "NO"
},
{
"input": "7 3 4 1",
"output": "YES"
},
{
"input": "101 10 1 1000",
"output": "NO"
},
{
"input": "5 1 1 1",
"output": "YES"
},
{
"input": "5 10 5 5",
"output": "NO"
},
{
"input": "19 1 7 1",
"output": "YES"
},
{
"input": "763 572 745 262",
"output": "YES"
},
{
"input": "1 2 1 1",
"output": "NO"
},
{
"input": "5 1 1 3",
"output": "YES"
},
{
"input": "170 725 479 359",
"output": "NO"
},
{
"input": "6 2 1 7",
"output": "YES"
},
{
"input": "6 2 5 1",
"output": "YES"
},
{
"input": "1 2 2 1",
"output": "NO"
},
{
"input": "24 2 8 3",
"output": "YES"
},
{
"input": "7 3 3 3",
"output": "YES"
},
{
"input": "5 2 2 2",
"output": "YES"
},
{
"input": "3 2 1 2",
"output": "YES"
},
{
"input": "1000 2 200 8",
"output": "NO"
},
{
"input": "3 100 2 100",
"output": "NO"
},
{
"input": "2 999 1 1000",
"output": "NO"
},
{
"input": "2 1 1 1",
"output": "NO"
},
{
"input": "2 3 5 1",
"output": "NO"
},
{
"input": "100 1 5 1",
"output": "YES"
},
{
"input": "7 2 3 3",
"output": "YES"
},
{
"input": "4 1 1 3",
"output": "NO"
},
{
"input": "3 2 2 1",
"output": "YES"
},
{
"input": "1 1 1 2",
"output": "NO"
},
{
"input": "91 8 7 13",
"output": "YES"
},
{
"input": "3 1 2 1",
"output": "NO"
},
{
"input": "5 3 2 3",
"output": "YES"
},
{
"input": "9 6 6 3",
"output": "YES"
}
] | 1,677,433,180
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 93
| 46
| 0
|
n,t,k,d=map(int,input().split())
u=0--n//k
u-=d//t+1
print('YNEOS'[u<=0::2])
|
Title: Carrot Cakes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
Input Specification:
The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
Output Specification:
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
Demo Input:
['8 6 4 5\n', '8 6 4 6\n', '10 3 11 4\n', '4 2 1 4\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n', 'YES\n']
Note:
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
|
```python
n,t,k,d=map(int,input().split())
u=0--n//k
u-=d//t+1
print('YNEOS'[u<=0::2])
```
| 3
|
|
365
|
A
|
Good Number
|
PROGRAMMING
| 1,100
|
[
"implementation"
] | null | null |
Let's call a number *k*-good if it contains all digits not exceeding *k* (0,<=...,<=*k*). You've got a number *k* and an array *a* containing *n* numbers. Find out how many *k*-good numbers are in *a* (count each number every time it occurs in array *a*).
|
The first line contains integers *n* and *k* (1<=≤<=*n*<=≤<=100, 0<=≤<=*k*<=≤<=9). The *i*-th of the following *n* lines contains integer *a**i* without leading zeroes (1<=≤<=*a**i*<=≤<=109).
|
Print a single integer — the number of *k*-good numbers in *a*.
|
[
"10 6\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n",
"2 1\n1\n10\n"
] |
[
"10\n",
"1\n"
] |
none
| 500
|
[
{
"input": "10 6\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560",
"output": "10"
},
{
"input": "2 1\n1\n10",
"output": "1"
},
{
"input": "1 0\n1000000000",
"output": "1"
},
{
"input": "1 1\n1000000000",
"output": "1"
},
{
"input": "6 0\n10\n102\n120\n1032\n1212103\n1999999",
"output": "5"
},
{
"input": "1 3\n1000000000",
"output": "0"
},
{
"input": "1 9\n1000000000",
"output": "0"
},
{
"input": "1 0\n1",
"output": "0"
},
{
"input": "1 1\n1",
"output": "0"
},
{
"input": "1 3\n1",
"output": "0"
},
{
"input": "1 9\n1",
"output": "0"
},
{
"input": "2 8\n123456780\n123",
"output": "1"
},
{
"input": "2 8\n12345678\n1230",
"output": "0"
},
{
"input": "6 1\n10\n102\n120\n1032\n1212103\n1999999",
"output": "5"
},
{
"input": "6 2\n10\n102\n120\n1032\n1212103\n1999999",
"output": "4"
},
{
"input": "6 3\n10\n102\n120\n1032\n1212103\n1999999",
"output": "2"
},
{
"input": "6 9\n10\n102\n120\n1032\n1212103\n1999999",
"output": "0"
},
{
"input": "1 2\n2220",
"output": "0"
}
] | 1,689,676,259
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 30
| 0
|
def main():
input_str = input()
n, k = map(int, input_str.split())
counter=0
for i in range(n):
strlist=input()
my_list = [int(num) for num in strlist]
my_list.sort()
counterperlist=0
c=0
for j in range(len(my_list)):
if j==c:
counterperlist+=1
c+=1
if(len(my_list)==k+1and counterperlist-1==k):
counter+=1
print(counter)
if __name__ == "__main__":
main()
|
Title: Good Number
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let's call a number *k*-good if it contains all digits not exceeding *k* (0,<=...,<=*k*). You've got a number *k* and an array *a* containing *n* numbers. Find out how many *k*-good numbers are in *a* (count each number every time it occurs in array *a*).
Input Specification:
The first line contains integers *n* and *k* (1<=≤<=*n*<=≤<=100, 0<=≤<=*k*<=≤<=9). The *i*-th of the following *n* lines contains integer *a**i* without leading zeroes (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print a single integer — the number of *k*-good numbers in *a*.
Demo Input:
['10 6\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n', '2 1\n1\n10\n']
Demo Output:
['10\n', '1\n']
Note:
none
|
```python
def main():
input_str = input()
n, k = map(int, input_str.split())
counter=0
for i in range(n):
strlist=input()
my_list = [int(num) for num in strlist]
my_list.sort()
counterperlist=0
c=0
for j in range(len(my_list)):
if j==c:
counterperlist+=1
c+=1
if(len(my_list)==k+1and counterperlist-1==k):
counter+=1
print(counter)
if __name__ == "__main__":
main()
```
| 0
|
|
792
|
A
|
New Bus Route
|
PROGRAMMING
| 1,100
|
[
"implementation",
"sortings"
] | null | null |
There are *n* cities situated along the main road of Berland. Cities are represented by their coordinates — integer numbers *a*1,<=*a*2,<=...,<=*a**n*. All coordinates are pairwise distinct.
It is possible to get from one city to another only by bus. But all buses and roads are very old, so the Minister of Transport decided to build a new bus route. The Minister doesn't want to spend large amounts of money — he wants to choose two cities in such a way that the distance between them is minimal possible. The distance between two cities is equal to the absolute value of the difference between their coordinates.
It is possible that there are multiple pairs of cities with minimal possible distance, so the Minister wants to know the quantity of such pairs.
Your task is to write a program that will calculate the minimal possible distance between two pairs of cities and the quantity of pairs which have this distance.
|
The first line contains one integer number *n* (2<=≤<=*n*<=≤<=2·105).
The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=109<=≤<=*a**i*<=≤<=109). All numbers *a**i* are pairwise distinct.
|
Print two integer numbers — the minimal distance and the quantity of pairs with this distance.
|
[
"4\n6 -3 0 4\n",
"3\n-2 0 2\n"
] |
[
"2 1\n",
"2 2\n"
] |
In the first example the distance between the first city and the fourth city is |4 - 6| = 2, and it is the only pair with this distance.
| 0
|
[
{
"input": "4\n6 -3 0 4",
"output": "2 1"
},
{
"input": "3\n-2 0 2",
"output": "2 2"
},
{
"input": "2\n1 2",
"output": "1 1"
},
{
"input": "2\n1000000000 -1000000000",
"output": "2000000000 1"
},
{
"input": "5\n-979619606 -979619602 -979619604 -979619605 -979619603",
"output": "1 4"
},
{
"input": "5\n-799147771 -799147773 -799147764 -799147774 -799147770",
"output": "1 2"
},
{
"input": "20\n553280626 553280623 553280627 553280624 553280625 553280618 553280620 553280629 553280637 553280631 553280628 553280636 553280635 553280632 553280634 553280622 553280633 553280621 553280630 553280619",
"output": "1 19"
},
{
"input": "20\n105619866 106083760 106090730 105809555 106115212 105155938 105979518 106075627 106145216 105637844 105925719 105498536 105927000 106155938 106134226 106125969 106130588 105464813 106145509 106114971",
"output": "241 1"
},
{
"input": "10\n570685866 570685854 570685858 570685850 570685856 570685864 570685860 570685852 570685862 570685868",
"output": "2 9"
},
{
"input": "2\n1 1000000000",
"output": "999999999 1"
},
{
"input": "6\n1 2 3 4 5 6",
"output": "1 5"
},
{
"input": "3\n7 10 12",
"output": "2 1"
},
{
"input": "5\n-7 -5 -4 -3 -1",
"output": "1 2"
},
{
"input": "4\n-6 -4 -2 1",
"output": "2 2"
},
{
"input": "4\n3 5 7 8",
"output": "1 1"
},
{
"input": "9\n-9 -8 -7 -6 -5 -4 -3 -2 -1",
"output": "1 8"
},
{
"input": "2\n15 13",
"output": "2 1"
},
{
"input": "2\n14 13",
"output": "1 1"
},
{
"input": "2\n12 13",
"output": "1 1"
},
{
"input": "2\n-1000000000 13265920",
"output": "1013265920 1"
},
{
"input": "2\n8 10",
"output": "2 1"
}
] | 1,490,626,543
| 1,243
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 46
| 4,505,600
|
n = input()
str = input()
a = str.split()
ai = []
s = []
for aa in a:
ai.append(int(aa))
ai.sort()
for i in range(0,len(ai) - 1):
s.append(abs(int(a[i])- int(a[i+1])))
s.sort()
sm = min(s)
sc = 0
for ss in s:
if ss == sm:
sc += 1
else:
break
print('%d %d' % (sm, sc))
|
Title: New Bus Route
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* cities situated along the main road of Berland. Cities are represented by their coordinates — integer numbers *a*1,<=*a*2,<=...,<=*a**n*. All coordinates are pairwise distinct.
It is possible to get from one city to another only by bus. But all buses and roads are very old, so the Minister of Transport decided to build a new bus route. The Minister doesn't want to spend large amounts of money — he wants to choose two cities in such a way that the distance between them is minimal possible. The distance between two cities is equal to the absolute value of the difference between their coordinates.
It is possible that there are multiple pairs of cities with minimal possible distance, so the Minister wants to know the quantity of such pairs.
Your task is to write a program that will calculate the minimal possible distance between two pairs of cities and the quantity of pairs which have this distance.
Input Specification:
The first line contains one integer number *n* (2<=≤<=*n*<=≤<=2·105).
The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=109<=≤<=*a**i*<=≤<=109). All numbers *a**i* are pairwise distinct.
Output Specification:
Print two integer numbers — the minimal distance and the quantity of pairs with this distance.
Demo Input:
['4\n6 -3 0 4\n', '3\n-2 0 2\n']
Demo Output:
['2 1\n', '2 2\n']
Note:
In the first example the distance between the first city and the fourth city is |4 - 6| = 2, and it is the only pair with this distance.
|
```python
n = input()
str = input()
a = str.split()
ai = []
s = []
for aa in a:
ai.append(int(aa))
ai.sort()
for i in range(0,len(ai) - 1):
s.append(abs(int(a[i])- int(a[i+1])))
s.sort()
sm = min(s)
sc = 0
for ss in s:
if ss == sm:
sc += 1
else:
break
print('%d %d' % (sm, sc))
```
| 0
|
|
689
|
C
|
Mike and Chocolate Thieves
|
PROGRAMMING
| 1,700
|
[
"binary search",
"combinatorics",
"math"
] | null | null |
Bad news came to Mike's village, some thieves stole a bunch of chocolates from the local factory! Horrible!
Aside from loving sweet things, thieves from this area are known to be very greedy. So after a thief takes his number of chocolates for himself, the next thief will take exactly *k* times more than the previous one. The value of *k* (*k*<=><=1) is a secret integer known only to them. It is also known that each thief's bag can carry at most *n* chocolates (if they intend to take more, the deal is cancelled) and that there were exactly four thieves involved.
Sadly, only the thieves know the value of *n*, but rumours say that the numbers of ways they could have taken the chocolates (for a fixed *n*, but not fixed *k*) is *m*. Two ways are considered different if one of the thieves (they should be numbered in the order they take chocolates) took different number of chocolates in them.
Mike want to track the thieves down, so he wants to know what their bags are and value of *n* will help him in that. Please find the smallest possible value of *n* or tell him that the rumors are false and there is no such *n*.
|
The single line of input contains the integer *m* (1<=≤<=*m*<=≤<=1015) — the number of ways the thieves might steal the chocolates, as rumours say.
|
Print the only integer *n* — the maximum amount of chocolates that thieves' bags can carry. If there are more than one *n* satisfying the rumors, print the smallest one.
If there is no such *n* for a false-rumoured *m*, print <=-<=1.
|
[
"1\n",
"8\n",
"10\n"
] |
[
"8\n",
"54\n",
"-1\n"
] |
In the first sample case the smallest *n* that leads to exactly one way of stealing chocolates is *n* = 8, whereas the amounts of stealed chocolates are (1, 2, 4, 8) (the number of chocolates stolen by each of the thieves).
In the second sample case the smallest *n* that leads to exactly 8 ways is *n* = 54 with the possibilities: (1, 2, 4, 8), (1, 3, 9, 27), (2, 4, 8, 16), (2, 6, 18, 54), (3, 6, 12, 24), (4, 8, 16, 32), (5, 10, 20, 40), (6, 12, 24, 48).
There is no *n* leading to exactly 10 ways of stealing chocolates in the third sample case.
| 1,500
|
[
{
"input": "1",
"output": "8"
},
{
"input": "8",
"output": "54"
},
{
"input": "10",
"output": "-1"
},
{
"input": "27",
"output": "152"
},
{
"input": "28206",
"output": "139840"
},
{
"input": "32",
"output": "184"
},
{
"input": "115",
"output": "608"
},
{
"input": "81258",
"output": "402496"
},
{
"input": "116003",
"output": "574506"
},
{
"input": "149344197",
"output": "739123875"
},
{
"input": "57857854",
"output": "286347520"
},
{
"input": "999999999999999",
"output": "-1"
},
{
"input": "181023403153",
"output": "895903132760"
},
{
"input": "196071196742",
"output": "970376182648"
},
{
"input": "49729446417673",
"output": "246116048009288"
},
{
"input": "14821870173923",
"output": "73354931125416"
},
{
"input": "29031595887308",
"output": "143680297402952"
},
{
"input": "195980601490039",
"output": "969927770453672"
},
{
"input": "181076658641313",
"output": "896166653569800"
},
{
"input": "166173583620704",
"output": "822409831653228"
},
{
"input": "151269640772354",
"output": "748648714769352"
},
{
"input": "136366565751970",
"output": "674891892852776"
},
{
"input": "121463490731834",
"output": "601135070936200"
},
{
"input": "106559547884220",
"output": "527373954052328"
},
{
"input": "91656472864718",
"output": "453617132135750"
},
{
"input": "184061307002930",
"output": "910937979445720"
},
{
"input": "57857853",
"output": "-1"
},
{
"input": "1000000000000000",
"output": "4949100894494448"
},
{
"input": "375402146575334",
"output": "-1"
},
{
"input": "550368702711851",
"output": "-1"
},
{
"input": "645093839227897",
"output": "-1"
},
{
"input": "431",
"output": "-1"
},
{
"input": "99999",
"output": "-1"
},
{
"input": "2",
"output": "16"
},
{
"input": "3",
"output": "24"
},
{
"input": "4",
"output": "27"
},
{
"input": "5",
"output": "32"
},
{
"input": "6",
"output": "40"
},
{
"input": "7",
"output": "48"
},
{
"input": "13",
"output": "80"
},
{
"input": "999999999999998",
"output": "-1"
},
{
"input": "999999999999997",
"output": "4949100894494440"
},
{
"input": "999999999999996",
"output": "4949100894494432"
},
{
"input": "999999999999995",
"output": "4949100894494424"
},
{
"input": "999999999999993",
"output": "4949100894494416"
},
{
"input": "999999999999991",
"output": "4949100894494400"
},
{
"input": "999999999999992",
"output": "4949100894494408"
},
{
"input": "999999999999994",
"output": "4949100894494421"
},
{
"input": "4235246",
"output": "-1"
},
{
"input": "34",
"output": "-1"
},
{
"input": "998749999999991",
"output": "4942914518376840"
},
{
"input": "999999874999991",
"output": "4949100275856792"
},
{
"input": "987654129875642",
"output": "4887999937625136"
},
{
"input": "237648237648000",
"output": "1176145105832192"
}
] | 1,539,473,433
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 27
| 1,013
| 8,294,400
|
R = lambda: map(int, input().split())
t = int(input())
tab = [x**3 for x in range(2, 10**5)]
l, r = 1, 10**15
while l < r:
n = (l + r) // 2
s = sum(n // x for x in tab)
if s < t:
l = n + 1
elif s > t:
r = n - 1
else:
r = n
s = sum(l // x for x in tab)
if s != t:
print(-1)
else:
print(l)
|
Title: Mike and Chocolate Thieves
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bad news came to Mike's village, some thieves stole a bunch of chocolates from the local factory! Horrible!
Aside from loving sweet things, thieves from this area are known to be very greedy. So after a thief takes his number of chocolates for himself, the next thief will take exactly *k* times more than the previous one. The value of *k* (*k*<=><=1) is a secret integer known only to them. It is also known that each thief's bag can carry at most *n* chocolates (if they intend to take more, the deal is cancelled) and that there were exactly four thieves involved.
Sadly, only the thieves know the value of *n*, but rumours say that the numbers of ways they could have taken the chocolates (for a fixed *n*, but not fixed *k*) is *m*. Two ways are considered different if one of the thieves (they should be numbered in the order they take chocolates) took different number of chocolates in them.
Mike want to track the thieves down, so he wants to know what their bags are and value of *n* will help him in that. Please find the smallest possible value of *n* or tell him that the rumors are false and there is no such *n*.
Input Specification:
The single line of input contains the integer *m* (1<=≤<=*m*<=≤<=1015) — the number of ways the thieves might steal the chocolates, as rumours say.
Output Specification:
Print the only integer *n* — the maximum amount of chocolates that thieves' bags can carry. If there are more than one *n* satisfying the rumors, print the smallest one.
If there is no such *n* for a false-rumoured *m*, print <=-<=1.
Demo Input:
['1\n', '8\n', '10\n']
Demo Output:
['8\n', '54\n', '-1\n']
Note:
In the first sample case the smallest *n* that leads to exactly one way of stealing chocolates is *n* = 8, whereas the amounts of stealed chocolates are (1, 2, 4, 8) (the number of chocolates stolen by each of the thieves).
In the second sample case the smallest *n* that leads to exactly 8 ways is *n* = 54 with the possibilities: (1, 2, 4, 8), (1, 3, 9, 27), (2, 4, 8, 16), (2, 6, 18, 54), (3, 6, 12, 24), (4, 8, 16, 32), (5, 10, 20, 40), (6, 12, 24, 48).
There is no *n* leading to exactly 10 ways of stealing chocolates in the third sample case.
|
```python
R = lambda: map(int, input().split())
t = int(input())
tab = [x**3 for x in range(2, 10**5)]
l, r = 1, 10**15
while l < r:
n = (l + r) // 2
s = sum(n // x for x in tab)
if s < t:
l = n + 1
elif s > t:
r = n - 1
else:
r = n
s = sum(l // x for x in tab)
if s != t:
print(-1)
else:
print(l)
```
| 0
|
|
61
|
A
|
Ultra-Fast Mathematician
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Ultra-Fast Mathematician
|
2
|
256
|
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
|
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
|
Write one line — the corresponding answer. Do not omit the leading 0s.
|
[
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] |
[
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] |
none
| 500
|
[
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "10\n01",
"output": "11"
},
{
"input": "00111111\n11011101",
"output": "11100010"
},
{
"input": "011001100\n101001010",
"output": "110000110"
},
{
"input": "1100100001\n0110101100",
"output": "1010001101"
},
{
"input": "00011101010\n10010100101",
"output": "10001001111"
},
{
"input": "100000101101\n111010100011",
"output": "011010001110"
},
{
"input": "1000001111010\n1101100110001",
"output": "0101101001011"
},
{
"input": "01011111010111\n10001110111010",
"output": "11010001101101"
},
{
"input": "110010000111100\n001100101011010",
"output": "111110101100110"
},
{
"input": "0010010111110000\n0000000011010110",
"output": "0010010100100110"
},
{
"input": "00111110111110000\n01111100001100000",
"output": "01000010110010000"
},
{
"input": "101010101111010001\n001001111101111101",
"output": "100011010010101100"
},
{
"input": "0110010101111100000\n0011000101000000110",
"output": "0101010000111100110"
},
{
"input": "11110100011101010111\n00001000011011000000",
"output": "11111100000110010111"
},
{
"input": "101010101111101101001\n111010010010000011111",
"output": "010000111101101110110"
},
{
"input": "0000111111100011000010\n1110110110110000001010",
"output": "1110001001010011001000"
},
{
"input": "10010010101000110111000\n00101110100110111000111",
"output": "10111100001110001111111"
},
{
"input": "010010010010111100000111\n100100111111100011001110",
"output": "110110101101011111001001"
},
{
"input": "0101110100100111011010010\n0101100011010111001010001",
"output": "0000010111110000010000011"
},
{
"input": "10010010100011110111111011\n10000110101100000001000100",
"output": "00010100001111110110111111"
},
{
"input": "000001111000000100001000000\n011100111101111001110110001",
"output": "011101000101111101111110001"
},
{
"input": "0011110010001001011001011100\n0000101101000011101011001010",
"output": "0011011111001010110010010110"
},
{
"input": "11111000000000010011001101111\n11101110011001010100010000000",
"output": "00010110011001000111011101111"
},
{
"input": "011001110000110100001100101100\n001010000011110000001000101001",
"output": "010011110011000100000100000101"
},
{
"input": "1011111010001100011010110101111\n1011001110010000000101100010101",
"output": "0000110100011100011111010111010"
},
{
"input": "10111000100001000001010110000001\n10111000001100101011011001011000",
"output": "00000000101101101010001111011001"
},
{
"input": "000001010000100001000000011011100\n111111111001010100100001100000111",
"output": "111110101001110101100001111011011"
},
{
"input": "1101000000000010011011101100000110\n1110000001100010011010000011011110",
"output": "0011000001100000000001101111011000"
},
{
"input": "01011011000010100001100100011110001\n01011010111000001010010100001110000",
"output": "00000001111010101011110000010000001"
},
{
"input": "000011111000011001000110111100000100\n011011000110000111101011100111000111",
"output": "011000111110011110101101011011000011"
},
{
"input": "1001000010101110001000000011111110010\n0010001011010111000011101001010110000",
"output": "1011001001111001001011101010101000010"
},
{
"input": "00011101011001100101111111000000010101\n10010011011011001011111000000011101011",
"output": "10001110000010101110000111000011111110"
},
{
"input": "111011100110001001101111110010111001010\n111111101101111001110010000101101000100",
"output": "000100001011110000011101110111010001110"
},
{
"input": "1111001001101000001000000010010101001010\n0010111100111110001011000010111110111001",
"output": "1101110101010110000011000000101011110011"
},
{
"input": "00100101111000000101011111110010100011010\n11101110001010010101001000111110101010100",
"output": "11001011110010010000010111001100001001110"
},
{
"input": "101011001110110100101001000111010101101111\n100111100110101011010100111100111111010110",
"output": "001100101000011111111101111011101010111001"
},
{
"input": "1111100001100101000111101001001010011100001\n1000110011000011110010001011001110001000001",
"output": "0111010010100110110101100010000100010100000"
},
{
"input": "01100111011111010101000001101110000001110101\n10011001011111110000000101011001001101101100",
"output": "11111110000000100101000100110111001100011001"
},
{
"input": "110010100111000100100101100000011100000011001\n011001111011100110000110111001110110100111011",
"output": "101011011100100010100011011001101010100100010"
},
{
"input": "0001100111111011010110100100111000000111000110\n1100101011000000000001010010010111001100110001",
"output": "1101001100111011010111110110101111001011110111"
},
{
"input": "00000101110110110001110010100001110100000100000\n10010000110011110001101000111111101010011010001",
"output": "10010101000101000000011010011110011110011110001"
},
{
"input": "110000100101011100100011001111110011111110010001\n101011111001011100110110111101110011010110101100",
"output": "011011011100000000010101110010000000101000111101"
},
{
"input": "0101111101011111010101011101000011101100000000111\n0000101010110110001110101011011110111001010100100",
"output": "0101010111101001011011110110011101010101010100011"
},
{
"input": "11000100010101110011101000011111001010110111111100\n00001111000111001011111110000010101110111001000011",
"output": "11001011010010111000010110011101100100001110111111"
},
{
"input": "101000001101111101101111111000001110110010101101010\n010011100111100001100000010001100101000000111011011",
"output": "111011101010011100001111101001101011110010010110001"
},
{
"input": "0011111110010001010100010110111000110011001101010100\n0111000000100010101010000100101000000100101000111001",
"output": "0100111110110011111110010010010000110111100101101101"
},
{
"input": "11101010000110000011011010000001111101000111011111100\n10110011110001010100010110010010101001010111100100100",
"output": "01011001110111010111001100010011010100010000111011000"
},
{
"input": "011000100001000001101000010110100110011110100111111011\n111011001000001001110011001111011110111110110011011111",
"output": "100011101001001000011011011001111000100000010100100100"
},
{
"input": "0111010110010100000110111011010110100000000111110110000\n1011100100010001101100000100111111101001110010000100110",
"output": "1100110010000101101010111111101001001001110101110010110"
},
{
"input": "10101000100111000111010001011011011011110100110101100011\n11101111000000001100100011111000100100000110011001101110",
"output": "01000111100111001011110010100011111111110010101100001101"
},
{
"input": "000000111001010001000000110001001011100010011101010011011\n110001101000010010000101000100001111101001100100001010010",
"output": "110001010001000011000101110101000100001011111001011001001"
},
{
"input": "0101011100111010000111110010101101111111000000111100011100\n1011111110000010101110111001000011100000100111111111000111",
"output": "1110100010111000101001001011101110011111100111000011011011"
},
{
"input": "11001000001100100111100111100100101011000101001111001001101\n10111110100010000011010100110100100011101001100000001110110",
"output": "01110110101110100100110011010000001000101100101111000111011"
},
{
"input": "010111011011101000000110000110100110001110100001110110111011\n101011110011101011101101011111010100100001100111100100111011",
"output": "111100101000000011101011011001110010101111000110010010000000"
},
{
"input": "1001011110110110000100011001010110000100011010010111010101110\n1101111100001000010111110011010101111010010100000001000010111",
"output": "0100100010111110010011101010000011111110001110010110010111001"
},
{
"input": "10000010101111100111110101111000010100110111101101111111111010\n10110110101100101010011001011010100110111011101100011001100111",
"output": "00110100000011001101101100100010110010001100000001100110011101"
},
{
"input": "011111010011111000001010101001101001000010100010111110010100001\n011111001011000011111001000001111001010110001010111101000010011",
"output": "000000011000111011110011101000010000010100101000000011010110010"
},
{
"input": "1111000000110001011101000100100100001111011100001111001100011111\n1101100110000101100001100000001001011011111011010101000101001010",
"output": "0010100110110100111100100100101101010100100111011010001001010101"
},
{
"input": "01100000101010010011001110100110110010000110010011011001100100011\n10110110010110111100100111000111000110010000000101101110000010111",
"output": "11010110111100101111101001100001110100010110010110110111100110100"
},
{
"input": "001111111010000100001100001010011001111110011110010111110001100111\n110000101001011000100010101100100110000111100000001101001110010111",
"output": "111111010011011100101110100110111111111001111110011010111111110000"
},
{
"input": "1011101011101101011110101101011101011000010011100101010101000100110\n0001000001001111010111100100111101100000000001110001000110000000110",
"output": "1010101010100010001001001001100000111000010010010100010011000100000"
},
{
"input": "01000001011001010011011100010000100100110101111011011011110000001110\n01011110000110011011000000000011000111100001010000000011111001110000",
"output": "00011111011111001000011100010011100011010100101011011000001001111110"
},
{
"input": "110101010100110101000001111110110100010010000100111110010100110011100\n111010010111111011100110101011001011001110110111110100000110110100111",
"output": "001111000011001110100111010101111111011100110011001010010010000111011"
},
{
"input": "1001101011000001011111100110010010000011010001001111011100010100110001\n1111100111110101001111010001010000011001001001010110001111000000100101",
"output": "0110001100110100010000110111000010011010011000011001010011010100010100"
},
{
"input": "00000111110010110001110110001010010101000111011001111111100110011110010\n00010111110100000100110101000010010001100001100011100000001100010100010",
"output": "00010000000110110101000011001000000100100110111010011111101010001010000"
},
{
"input": "100101011100101101000011010001011001101110101110001100010001010111001110\n100001111100101011011111110000001111000111001011111110000010101110111001",
"output": "000100100000000110011100100001010110101001100101110010010011111001110111"
},
{
"input": "1101100001000111001101001011101000111000011110000001001101101001111011010\n0101011101010100011011010110101000010010110010011110101100000110110001000",
"output": "1000111100010011010110011101000000101010101100011111100001101111001010010"
},
{
"input": "01101101010011110101100001110101111011100010000010001101111000011110111111\n00101111001101001100111010000101110000100101101111100111101110010100011011",
"output": "01000010011110111001011011110000001011000111101101101010010110001010100100"
},
{
"input": "101100101100011001101111110110110010100110110010100001110010110011001101011\n000001011010101011110011111101001110000111000010001101000010010000010001101",
"output": "101101110110110010011100001011111100100001110000101100110000100011011100110"
},
{
"input": "0010001011001010001100000010010011110110011000100000000100110000101111001110\n1100110100111000110100001110111001011101001100001010100001010011100110110001",
"output": "1110111111110010111000001100101010101011010100101010100101100011001001111111"
},
{
"input": "00101101010000000101011001101011001100010001100000101011101110000001111001000\n10010110010111000000101101000011101011001010000011011101101011010000000011111",
"output": "10111011000111000101110100101000100111011011100011110110000101010001111010111"
},
{
"input": "111100000100100000101001100001001111001010001000001000000111010000010101101011\n001000100010100101111011111011010110101100001111011000010011011011100010010110",
"output": "110100100110000101010010011010011001100110000111010000010100001011110111111101"
},
{
"input": "0110001101100100001111110101101000100101010010101010011001101001001101110000000\n0111011000000010010111011110010000000001000110001000011001101000000001110100111",
"output": "0001010101100110011000101011111000100100010100100010000000000001001100000100111"
},
{
"input": "10001111111001000101001011110101111010100001011010101100111001010001010010001000\n10000111010010011110111000111010101100000011110001101111001000111010100000000001",
"output": "00001000101011011011110011001111010110100010101011000011110001101011110010001001"
},
{
"input": "100110001110110000100101001110000011110110000110000000100011110100110110011001101\n110001110101110000000100101001101011111100100100001001000110000001111100011110110",
"output": "010111111011000000100001100111101000001010100010001001100101110101001010000111011"
},
{
"input": "0000010100100000010110111100011111111010011101000000100000011001001101101100111010\n0100111110011101010110101011110110010111001111000110101100101110111100101000111111",
"output": "0100101010111101000000010111101001101101010010000110001100110111110001000100000101"
},
{
"input": "11000111001010100001110000001001011010010010110000001110100101000001010101100110111\n11001100100100100001101010110100000111100011101110011010110100001001000011011011010",
"output": "00001011101110000000011010111101011101110001011110010100010001001000010110111101101"
},
{
"input": "010110100010001000100010101001101010011010111110100001000100101000111011100010100001\n110000011111101101010011111000101010111010100001001100001001100101000000111000000000",
"output": "100110111101100101110001010001000000100000011111101101001101001101111011011010100001"
},
{
"input": "0000011110101110010101110110110101100001011001101010101001000010000010000000101001101\n1100111111011100000110000111101110011111100111110001011001000010011111100001001100011",
"output": "1100100001110010010011110001011011111110111110011011110000000000011101100001100101110"
},
{
"input": "10100000101101110001100010010010100101100011010010101000110011100000101010110010000000\n10001110011011010010111011011101101111000111110000111000011010010101001100000001010011",
"output": "00101110110110100011011001001111001010100100100010010000101001110101100110110011010011"
},
{
"input": "001110000011111101101010011111000101010111010100001001100001001100101000000111000000000\n111010000000000000101001110011001000111011001100101010011001000011101001001011110000011",
"output": "110100000011111101000011101100001101101100011000100011111000001111000001001100110000011"
},
{
"input": "1110111100111011010101011011001110001010010010110011110010011111000010011111010101100001\n1001010101011001001010100010101100000110111101011000100010101111111010111100001110010010",
"output": "0111101001100010011111111001100010001100101111101011010000110000111000100011011011110011"
},
{
"input": "11100010001100010011001100001100010011010001101110011110100101110010101101011101000111111\n01110000000110111010110100001010000101011110100101010011000110101110101101110111011110001",
"output": "10010010001010101001111000000110010110001111001011001101100011011100000000101010011001110"
},
{
"input": "001101011001100101101100110000111000101011001001100100000100101000100000110100010111111101\n101001111110000010111101111110001001111001111101111010000110111000100100110010010001011111",
"output": "100100100111100111010001001110110001010010110100011110000010010000000100000110000110100010"
},
{
"input": "1010110110010101000110010010110101011101010100011001101011000110000000100011100100011000000\n0011011111100010001111101101000111001011101110100000110111100100101111010110101111011100011",
"output": "1001101001110111001001111111110010010110111010111001011100100010101111110101001011000100011"
},
{
"input": "10010010000111010111011111110010100101100000001100011100111011100010000010010001011100001100\n00111010100010110010000100010111010001111110100100100011101000101111111111001101101100100100",
"output": "10101000100101100101011011100101110100011110101000111111010011001101111101011100110000101000"
},
{
"input": "010101110001010101100000010111010000000111110011001101100011001000000011001111110000000010100\n010010111011100101010101111110110000000111000100001101101001001000001100101110001010000100001",
"output": "000111001010110000110101101001100000000000110111000000001010000000001111100001111010000110101"
},
{
"input": "1100111110011001000111101001001011000110011010111111100010111111001100111111011101100111101011\n1100000011001000110100110111000001011001010111101000010010100011000001100100111101101000010110",
"output": "0000111101010001110011011110001010011111001101010111110000011100001101011011100000001111111101"
},
{
"input": "00011000100100110111100101100100000000010011110111110010101110110011100001010111010011110100101\n00011011111011111011100101100111100101001110010111000010000111000100100100000001110101111011011",
"output": "00000011011111001100000000000011100101011101100000110000101001110111000101010110100110001111110"
},
{
"input": "000101011001001100000111100010110101111011110101111101000110001101011010111110110011100100000001\n011000101010011111011000111000100000000011011000000001111110001000001111101010110000011100001111",
"output": "011101110011010011011111011010010101111000101101111100111000000101010101010100000011111000001110"
},
{
"input": "1000101001011010000100100100010010011101011001110101111011101111111110010101001101010001010101001\n0110110010011100011111011111110111000000010001110100001010111110101011010011111011111110000110000",
"output": "1110011011000110011011111011100101011101001000000001110001010001010101000110110110101111010011001"
},
{
"input": "01111010010101100111110111111011011010100001011101010000111100101101101110111011001100101011100111\n00001100110110100001111011000010001001001100000010111101000001111011100000010111010010000011000010",
"output": "01110110100011000110001100111001010011101101011111101101111101010110001110101100011110101000100101"
},
{
"input": "111101011101111000001011001101111010110111001101110100100011111011011101001101010101011010111000110\n101111100101101101001100110011000001111010011101110111110110101110011011110011111100001001110101101",
"output": "010010111000010101000111111110111011001101010000000011010101010101000110111110101001010011001101011"
},
{
"input": "1010000011010110011101001101110001110010000111011101110010110110111111001001110100101100010101010001\n0111101000111100101100000101111010100100001000011101010100110011100011010011010101000100101011100011",
"output": "1101101011101010110001001000001011010110001111000000100110000101011100011010100001101000111110110010"
},
{
"input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001\n1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111010",
"output": "1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111011"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "0\n1",
"output": "1"
}
] | 1,612,329,908
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 102
| 77
| 0
|
n1=input()
n2=input()
res=''
for i in range(len(n2)):
if n1[i]=='1' and n2[i]=='1':
res=res+'0'
elif n1[i]=='0' and n2[i]=='0':
res=res+'0'
else:
res=res+'1'
print(res)
|
Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
Input Specification:
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
Output Specification:
Write one line — the corresponding answer. Do not omit the leading 0s.
Demo Input:
['1010100\n0100101\n', '000\n111\n', '1110\n1010\n', '01110\n01100\n']
Demo Output:
['1110001\n', '111\n', '0100\n', '00010\n']
Note:
none
|
```python
n1=input()
n2=input()
res=''
for i in range(len(n2)):
if n1[i]=='1' and n2[i]=='1':
res=res+'0'
elif n1[i]=='0' and n2[i]=='0':
res=res+'0'
else:
res=res+'1'
print(res)
```
| 3.98075
|
727
|
A
|
Transformation: from A to B
|
PROGRAMMING
| 1,000
|
[
"brute force",
"dfs and similar",
"math"
] | null | null |
Vasily has a number *a*, which he wants to turn into a number *b*. For this purpose, he can do two types of operations:
- multiply the current number by 2 (that is, replace the number *x* by 2·*x*); - append the digit 1 to the right of current number (that is, replace the number *x* by 10·*x*<=+<=1).
You need to help Vasily to transform the number *a* into the number *b* using only the operations described above, or find that it is impossible.
Note that in this task you are not required to minimize the number of operations. It suffices to find any way to transform *a* into *b*.
|
The first line contains two positive integers *a* and *b* (1<=≤<=*a*<=<<=*b*<=≤<=109) — the number which Vasily has and the number he wants to have.
|
If there is no way to get *b* from *a*, print "NO" (without quotes).
Otherwise print three lines. On the first line print "YES" (without quotes). The second line should contain single integer *k* — the length of the transformation sequence. On the third line print the sequence of transformations *x*1,<=*x*2,<=...,<=*x**k*, where:
- *x*1 should be equal to *a*, - *x**k* should be equal to *b*, - *x**i* should be obtained from *x**i*<=-<=1 using any of two described operations (1<=<<=*i*<=≤<=*k*).
If there are multiple answers, print any of them.
|
[
"2 162\n",
"4 42\n",
"100 40021\n"
] |
[
"YES\n5\n2 4 8 81 162 \n",
"NO\n",
"YES\n5\n100 200 2001 4002 40021 \n"
] |
none
| 1,000
|
[
{
"input": "2 162",
"output": "YES\n5\n2 4 8 81 162 "
},
{
"input": "4 42",
"output": "NO"
},
{
"input": "100 40021",
"output": "YES\n5\n100 200 2001 4002 40021 "
},
{
"input": "1 111111111",
"output": "YES\n9\n1 11 111 1111 11111 111111 1111111 11111111 111111111 "
},
{
"input": "1 1000000000",
"output": "NO"
},
{
"input": "999999999 1000000000",
"output": "NO"
},
{
"input": "1 2",
"output": "YES\n2\n1 2 "
},
{
"input": "1 536870912",
"output": "YES\n30\n1 2 4 8 16 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 131072 262144 524288 1048576 2097152 4194304 8388608 16777216 33554432 67108864 134217728 268435456 536870912 "
},
{
"input": "11111 11111111",
"output": "YES\n4\n11111 111111 1111111 11111111 "
},
{
"input": "59139 946224",
"output": "YES\n5\n59139 118278 236556 473112 946224 "
},
{
"input": "9859 19718",
"output": "YES\n2\n9859 19718 "
},
{
"input": "25987 51974222",
"output": "YES\n5\n25987 259871 2598711 25987111 51974222 "
},
{
"input": "9411 188222222",
"output": "YES\n6\n9411 94111 941111 9411111 94111111 188222222 "
},
{
"input": "25539 510782222",
"output": "YES\n6\n25539 255391 2553911 25539111 255391111 510782222 "
},
{
"input": "76259 610072",
"output": "YES\n4\n76259 152518 305036 610072 "
},
{
"input": "92387 184774",
"output": "YES\n2\n92387 184774 "
},
{
"input": "8515 85151111",
"output": "YES\n5\n8515 85151 851511 8515111 85151111 "
},
{
"input": "91939 9193911",
"output": "YES\n3\n91939 919391 9193911 "
},
{
"input": "30518 610361",
"output": "YES\n3\n30518 61036 610361 "
},
{
"input": "46646 373168844",
"output": "YES\n7\n46646 466461 932922 9329221 93292211 186584422 373168844 "
},
{
"input": "30070 300701",
"output": "YES\n2\n30070 300701 "
},
{
"input": "13494 1079528",
"output": "YES\n5\n13494 134941 269882 539764 1079528 "
},
{
"input": "96918 775344422",
"output": "YES\n7\n96918 193836 1938361 3876722 38767221 387672211 775344422 "
},
{
"input": "13046 260921",
"output": "YES\n3\n13046 26092 260921 "
},
{
"input": "29174 5834811",
"output": "YES\n4\n29174 58348 583481 5834811 "
},
{
"input": "79894 319576421",
"output": "YES\n6\n79894 798941 1597882 15978821 31957642 319576421 "
},
{
"input": "96022 1920442",
"output": "YES\n3\n96022 960221 1920442 "
},
{
"input": "79446 6355681",
"output": "YES\n5\n79446 158892 317784 635568 6355681 "
},
{
"input": "5440 27853056",
"output": "YES\n11\n5440 10880 108801 217602 435204 870408 1740816 3481632 6963264 13926528 27853056 "
},
{
"input": "250000000 705032705",
"output": "NO"
},
{
"input": "17 35",
"output": "NO"
},
{
"input": "1 3",
"output": "NO"
},
{
"input": "2 11",
"output": "NO"
}
] | 1,675,760,295
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 46
| 0
|
a,b=map(int,input().split())
lst=[b]
flag=0
while(b!=a):
if (b<a):
flag=5
break
elif b%2==0:
b=int(b/2)
lst.append(b)
else:
b=int(b//10)
lst.append(b)
lst.sort()
if flag==5:
print("NO")
else:
print("YES")
print(len(lst))
for i in range (len(lst)):
print(int(lst[i]),end=" ")
|
Title: Transformation: from A to B
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasily has a number *a*, which he wants to turn into a number *b*. For this purpose, he can do two types of operations:
- multiply the current number by 2 (that is, replace the number *x* by 2·*x*); - append the digit 1 to the right of current number (that is, replace the number *x* by 10·*x*<=+<=1).
You need to help Vasily to transform the number *a* into the number *b* using only the operations described above, or find that it is impossible.
Note that in this task you are not required to minimize the number of operations. It suffices to find any way to transform *a* into *b*.
Input Specification:
The first line contains two positive integers *a* and *b* (1<=≤<=*a*<=<<=*b*<=≤<=109) — the number which Vasily has and the number he wants to have.
Output Specification:
If there is no way to get *b* from *a*, print "NO" (without quotes).
Otherwise print three lines. On the first line print "YES" (without quotes). The second line should contain single integer *k* — the length of the transformation sequence. On the third line print the sequence of transformations *x*1,<=*x*2,<=...,<=*x**k*, where:
- *x*1 should be equal to *a*, - *x**k* should be equal to *b*, - *x**i* should be obtained from *x**i*<=-<=1 using any of two described operations (1<=<<=*i*<=≤<=*k*).
If there are multiple answers, print any of them.
Demo Input:
['2 162\n', '4 42\n', '100 40021\n']
Demo Output:
['YES\n5\n2 4 8 81 162 \n', 'NO\n', 'YES\n5\n100 200 2001 4002 40021 \n']
Note:
none
|
```python
a,b=map(int,input().split())
lst=[b]
flag=0
while(b!=a):
if (b<a):
flag=5
break
elif b%2==0:
b=int(b/2)
lst.append(b)
else:
b=int(b//10)
lst.append(b)
lst.sort()
if flag==5:
print("NO")
else:
print("YES")
print(len(lst))
for i in range (len(lst)):
print(int(lst[i]),end=" ")
```
| 0
|
|
673
|
A
|
Bear and Game
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game.
|
The first line of the input contains one integer *n* (1<=≤<=*n*<=≤<=90) — the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t*1<=<<=*t*2<=<<=... *t**n*<=≤<=90), given in the increasing order.
|
Print the number of minutes Limak will watch the game.
|
[
"3\n7 20 88\n",
"9\n16 20 30 40 50 60 70 80 90\n",
"9\n15 20 30 40 50 60 70 80 90\n"
] |
[
"35\n",
"15\n",
"90\n"
] |
In the first sample, minutes 21, 22, ..., 35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game.
| 500
|
[
{
"input": "3\n7 20 88",
"output": "35"
},
{
"input": "9\n16 20 30 40 50 60 70 80 90",
"output": "15"
},
{
"input": "9\n15 20 30 40 50 60 70 80 90",
"output": "90"
},
{
"input": "30\n6 11 12 15 22 24 30 31 32 33 34 35 40 42 44 45 47 50 53 54 57 58 63 67 75 77 79 81 83 88",
"output": "90"
},
{
"input": "60\n1 2 4 5 6 7 11 14 16 18 20 21 22 23 24 25 26 33 34 35 36 37 38 39 41 42 43 44 46 47 48 49 52 55 56 57 58 59 60 61 63 64 65 67 68 70 71 72 73 74 75 77 78 80 82 83 84 85 86 88",
"output": "90"
},
{
"input": "90\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n1",
"output": "16"
},
{
"input": "5\n15 30 45 60 75",
"output": "90"
},
{
"input": "6\n14 29 43 59 70 74",
"output": "58"
},
{
"input": "1\n15",
"output": "30"
},
{
"input": "1\n16",
"output": "15"
},
{
"input": "14\n14 22 27 31 35 44 46 61 62 69 74 79 88 89",
"output": "90"
},
{
"input": "76\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n90",
"output": "15"
},
{
"input": "6\n13 17 32 47 60 66",
"output": "81"
},
{
"input": "84\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84",
"output": "90"
},
{
"input": "9\n6 20 27 28 40 53 59 70 85",
"output": "90"
},
{
"input": "12\n14 22 27 31 35 44 62 69 74 79 88 89",
"output": "59"
},
{
"input": "5\n15 30 45 60 74",
"output": "89"
},
{
"input": "72\n3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89",
"output": "54"
},
{
"input": "8\n1 16 30 31 32 33 34 50",
"output": "49"
},
{
"input": "12\n1 3 6 10 15 21 28 36 45 55 66 78",
"output": "90"
},
{
"input": "25\n1 2 3 4 5 6 7 8 9 10 11 23 36 50 65 81 82 83 84 85 86 87 88 89 90",
"output": "80"
},
{
"input": "8\n5 17 20 35 42 53 67 76",
"output": "90"
},
{
"input": "9\n15 28 39 48 55 60 63 64 74",
"output": "89"
},
{
"input": "10\n15 28 39 48 55 60 63 64 74 82",
"output": "90"
},
{
"input": "2\n1 18",
"output": "16"
},
{
"input": "9\n10 20 30 40 50 60 70 80 84",
"output": "90"
},
{
"input": "2\n16 50",
"output": "15"
},
{
"input": "6\n15 30 45 60 75 84",
"output": "90"
},
{
"input": "8\n15 20 30 40 50 60 73 83",
"output": "90"
},
{
"input": "8\n10 20 30 40 50 60 70 80",
"output": "90"
},
{
"input": "3\n1 20 90",
"output": "16"
},
{
"input": "6\n15 30 45 60 74 89",
"output": "90"
}
] | 1,556,799,013
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 108
| 0
|
def main():
input()
t = [int(_) for _ in input().split()] + [90]
end = 0
still_interesting = True
next_interesting = 0
while end < 90 and still_interesting:
end = min(end + 15, 90)
if end >= t[next_interesting]:
end = t[next_interesting]
next_interesting += 1
else:
still_interesting = False
print(end)
if __name__ == '__main__':
main()
|
Title: Bear and Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game.
Input Specification:
The first line of the input contains one integer *n* (1<=≤<=*n*<=≤<=90) — the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t*1<=<<=*t*2<=<<=... *t**n*<=≤<=90), given in the increasing order.
Output Specification:
Print the number of minutes Limak will watch the game.
Demo Input:
['3\n7 20 88\n', '9\n16 20 30 40 50 60 70 80 90\n', '9\n15 20 30 40 50 60 70 80 90\n']
Demo Output:
['35\n', '15\n', '90\n']
Note:
In the first sample, minutes 21, 22, ..., 35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game.
|
```python
def main():
input()
t = [int(_) for _ in input().split()] + [90]
end = 0
still_interesting = True
next_interesting = 0
while end < 90 and still_interesting:
end = min(end + 15, 90)
if end >= t[next_interesting]:
end = t[next_interesting]
next_interesting += 1
else:
still_interesting = False
print(end)
if __name__ == '__main__':
main()
```
| 3
|
|
672
|
B
|
Different is Good
|
PROGRAMMING
| 1,000
|
[
"constructive algorithms",
"implementation",
"strings"
] | null | null |
A wise man told Kerem "Different is good" once, so Kerem wants all things in his life to be different.
Kerem recently got a string *s* consisting of lowercase English letters. Since Kerem likes it when things are different, he wants all substrings of his string *s* to be distinct. Substring is a string formed by some number of consecutive characters of the string. For example, string "aba" has substrings "" (empty substring), "a", "b", "a", "ab", "ba", "aba".
If string *s* has at least two equal substrings then Kerem will change characters at some positions to some other lowercase English letters. Changing characters is a very tiring job, so Kerem want to perform as few changes as possible.
Your task is to find the minimum number of changes needed to make all the substrings of the given string distinct, or determine that it is impossible.
|
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100<=000) — the length of the string *s*.
The second line contains the string *s* of length *n* consisting of only lowercase English letters.
|
If it's impossible to change the string *s* such that all its substring are distinct print -1. Otherwise print the minimum required number of changes.
|
[
"2\naa\n",
"4\nkoko\n",
"5\nmurat\n"
] |
[
"1\n",
"2\n",
"0\n"
] |
In the first sample one of the possible solutions is to change the first character to 'b'.
In the second sample, one may change the first character to 'a' and second character to 'b', so the string becomes "abko".
| 1,000
|
[
{
"input": "2\naa",
"output": "1"
},
{
"input": "4\nkoko",
"output": "2"
},
{
"input": "5\nmurat",
"output": "0"
},
{
"input": "6\nacbead",
"output": "1"
},
{
"input": "7\ncdaadad",
"output": "4"
},
{
"input": "25\npeoaicnbisdocqofsqdpgobpn",
"output": "12"
},
{
"input": "25\ntcqpchnqskqjacruoaqilgebu",
"output": "7"
},
{
"input": "13\naebaecedabbee",
"output": "8"
},
{
"input": "27\naaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "-1"
},
{
"input": "10\nbababbdaee",
"output": "6"
},
{
"input": "11\ndbadcdbdbca",
"output": "7"
},
{
"input": "12\nacceaabddaaa",
"output": "7"
},
{
"input": "13\nabddfbfaeecfa",
"output": "7"
},
{
"input": "14\neeceecacdbcbbb",
"output": "9"
},
{
"input": "15\ndcbceaaggabaheb",
"output": "8"
},
{
"input": "16\nhgiegfbadgcicbhd",
"output": "7"
},
{
"input": "17\nabhfibbdddfghgfdi",
"output": "10"
},
{
"input": "26\nbbbbbabbaababaaabaaababbaa",
"output": "24"
},
{
"input": "26\nahnxdnbfbcrirerssyzydihuee",
"output": "11"
},
{
"input": "26\nhwqeqhkpxwulbsiwmnlfyhgknc",
"output": "8"
},
{
"input": "26\nrvxmulriorilidecqwmfaemifj",
"output": "10"
},
{
"input": "26\naowpmreooavnmamogdoopuisge",
"output": "12"
},
{
"input": "26\ninimevtuefhvuefirdehmmfudh",
"output": "15"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "25"
},
{
"input": "27\nqdcfjtblgglnilgassirrjekcjt",
"output": "-1"
},
{
"input": "27\nabcdefghijklmnopqrstuvwxyza",
"output": "-1"
},
{
"input": "26\nqwertyuiopasdfghjklzxcvbnm",
"output": "0"
},
{
"input": "5\nzzzzz",
"output": "4"
},
{
"input": "27\naaaaaaaaaaaaaaaaabaaaaaaaaa",
"output": "-1"
},
{
"input": "1\nq",
"output": "0"
},
{
"input": "27\nqwertyuioplkjhgfdsazxcvbnmm",
"output": "-1"
},
{
"input": "9\nxxxyyyzzz",
"output": "6"
},
{
"input": "45\naaabbbcccdddeeefffgghhiijjkkkkkkkkkkkkkkkkkkk",
"output": "-1"
},
{
"input": "27\nqwertyuiopasdfghjklzxcvbnmm",
"output": "-1"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxyz",
"output": "0"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxya",
"output": "1"
},
{
"input": "27\nabcdefghijklmnopqrstuvwxyzz",
"output": "-1"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "25"
},
{
"input": "26\nqwertyuioplkjhgfdsazxcvbnm",
"output": "0"
},
{
"input": "10\nzzzzzzzzzz",
"output": "9"
},
{
"input": "1\na",
"output": "0"
},
{
"input": "30\nabcdefghtyabcdefghtyabcdefghty",
"output": "-1"
}
] | 1,616,284,191
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 47
| 108
| 0
|
n = int(input())
if n <= 26:
print(n-len(set(input())))
else:
print("-1")
|
Title: Different is Good
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A wise man told Kerem "Different is good" once, so Kerem wants all things in his life to be different.
Kerem recently got a string *s* consisting of lowercase English letters. Since Kerem likes it when things are different, he wants all substrings of his string *s* to be distinct. Substring is a string formed by some number of consecutive characters of the string. For example, string "aba" has substrings "" (empty substring), "a", "b", "a", "ab", "ba", "aba".
If string *s* has at least two equal substrings then Kerem will change characters at some positions to some other lowercase English letters. Changing characters is a very tiring job, so Kerem want to perform as few changes as possible.
Your task is to find the minimum number of changes needed to make all the substrings of the given string distinct, or determine that it is impossible.
Input Specification:
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100<=000) — the length of the string *s*.
The second line contains the string *s* of length *n* consisting of only lowercase English letters.
Output Specification:
If it's impossible to change the string *s* such that all its substring are distinct print -1. Otherwise print the minimum required number of changes.
Demo Input:
['2\naa\n', '4\nkoko\n', '5\nmurat\n']
Demo Output:
['1\n', '2\n', '0\n']
Note:
In the first sample one of the possible solutions is to change the first character to 'b'.
In the second sample, one may change the first character to 'a' and second character to 'b', so the string becomes "abko".
|
```python
n = int(input())
if n <= 26:
print(n-len(set(input())))
else:
print("-1")
```
| 3
|
|
950
|
A
|
Left-handers, Right-handers and Ambidexters
|
PROGRAMMING
| 800
|
[
"implementation",
"math"
] | null | null |
You are at a water bowling training. There are *l* people who play with their left hand, *r* people, who play with their right hand, and *a* ambidexters, who can play with left or right hand.
The coach decided to form a team of even number of players, exactly half of the players should play with their right hand, and exactly half of the players should play with their left hand. One player should use only on of his hands.
Ambidexters play as well with their right hand as with their left hand. In the team, an ambidexter can play with their left hand, or with their right hand.
Please find the maximum possible size of the team, where equal number of players use their left and right hands, respectively.
|
The only line contains three integers *l*, *r* and *a* (0<=≤<=*l*,<=*r*,<=*a*<=≤<=100) — the number of left-handers, the number of right-handers and the number of ambidexters at the training.
|
Print a single even integer — the maximum number of players in the team. It is possible that the team can only have zero number of players.
|
[
"1 4 2\n",
"5 5 5\n",
"0 2 0\n"
] |
[
"6\n",
"14\n",
"0\n"
] |
In the first example you can form a team of 6 players. You should take the only left-hander and two ambidexters to play with left hand, and three right-handers to play with right hand. The only person left can't be taken into the team.
In the second example you can form a team of 14 people. You have to take all five left-handers, all five right-handers, two ambidexters to play with left hand and two ambidexters to play with right hand.
| 500
|
[
{
"input": "1 4 2",
"output": "6"
},
{
"input": "5 5 5",
"output": "14"
},
{
"input": "0 2 0",
"output": "0"
},
{
"input": "30 70 34",
"output": "128"
},
{
"input": "89 32 24",
"output": "112"
},
{
"input": "89 44 77",
"output": "210"
},
{
"input": "0 0 0",
"output": "0"
},
{
"input": "100 100 100",
"output": "300"
},
{
"input": "1 1 1",
"output": "2"
},
{
"input": "30 70 35",
"output": "130"
},
{
"input": "89 44 76",
"output": "208"
},
{
"input": "0 100 100",
"output": "200"
},
{
"input": "100 0 100",
"output": "200"
},
{
"input": "100 1 100",
"output": "200"
},
{
"input": "1 100 100",
"output": "200"
},
{
"input": "100 100 0",
"output": "200"
},
{
"input": "100 100 1",
"output": "200"
},
{
"input": "1 2 1",
"output": "4"
},
{
"input": "0 0 100",
"output": "100"
},
{
"input": "0 100 0",
"output": "0"
},
{
"input": "100 0 0",
"output": "0"
},
{
"input": "10 8 7",
"output": "24"
},
{
"input": "45 47 16",
"output": "108"
},
{
"input": "59 43 100",
"output": "202"
},
{
"input": "34 1 30",
"output": "62"
},
{
"input": "14 81 1",
"output": "30"
},
{
"input": "53 96 94",
"output": "242"
},
{
"input": "62 81 75",
"output": "218"
},
{
"input": "21 71 97",
"output": "188"
},
{
"input": "49 82 73",
"output": "204"
},
{
"input": "88 19 29",
"output": "96"
},
{
"input": "89 4 62",
"output": "132"
},
{
"input": "58 3 65",
"output": "126"
},
{
"input": "27 86 11",
"output": "76"
},
{
"input": "35 19 80",
"output": "134"
},
{
"input": "4 86 74",
"output": "156"
},
{
"input": "32 61 89",
"output": "182"
},
{
"input": "68 60 98",
"output": "226"
},
{
"input": "37 89 34",
"output": "142"
},
{
"input": "92 9 28",
"output": "74"
},
{
"input": "79 58 98",
"output": "234"
},
{
"input": "35 44 88",
"output": "166"
},
{
"input": "16 24 19",
"output": "58"
},
{
"input": "74 71 75",
"output": "220"
},
{
"input": "83 86 99",
"output": "268"
},
{
"input": "97 73 15",
"output": "176"
},
{
"input": "77 76 73",
"output": "226"
},
{
"input": "48 85 55",
"output": "188"
},
{
"input": "1 2 2",
"output": "4"
},
{
"input": "2 2 2",
"output": "6"
},
{
"input": "2 1 2",
"output": "4"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "3 2 1",
"output": "6"
},
{
"input": "1 2 3",
"output": "6"
},
{
"input": "1 3 2",
"output": "6"
},
{
"input": "2 1 3",
"output": "6"
},
{
"input": "2 3 1",
"output": "6"
},
{
"input": "3 1 2",
"output": "6"
},
{
"input": "99 99 99",
"output": "296"
},
{
"input": "99 99 100",
"output": "298"
},
{
"input": "99 100 99",
"output": "298"
},
{
"input": "99 100 100",
"output": "298"
},
{
"input": "100 99 99",
"output": "298"
},
{
"input": "100 99 100",
"output": "298"
},
{
"input": "100 100 99",
"output": "298"
},
{
"input": "89 32 23",
"output": "110"
},
{
"input": "4 5 0",
"output": "8"
},
{
"input": "3 0 3",
"output": "6"
},
{
"input": "0 0 2",
"output": "2"
},
{
"input": "97 97 0",
"output": "194"
},
{
"input": "1 4 0",
"output": "2"
},
{
"input": "5 2 0",
"output": "4"
},
{
"input": "0 5 10",
"output": "14"
},
{
"input": "0 1 2",
"output": "2"
},
{
"input": "5 2 3",
"output": "10"
},
{
"input": "5 5 0",
"output": "10"
},
{
"input": "0 0 10",
"output": "10"
},
{
"input": "0 1 1",
"output": "2"
},
{
"input": "0 0 1",
"output": "0"
}
] | 1,579,257,569
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 79
| 109
| 307,200
|
def solve(l, r, a):
x = abs(l - r)
y = min(x, a)
x = min(l, r) + y
return (x + (a - y)//2)*2
def main():
l, r, a = list(map(int, input().split()))
print(solve(l, r, a))
main()
|
Title: Left-handers, Right-handers and Ambidexters
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are at a water bowling training. There are *l* people who play with their left hand, *r* people, who play with their right hand, and *a* ambidexters, who can play with left or right hand.
The coach decided to form a team of even number of players, exactly half of the players should play with their right hand, and exactly half of the players should play with their left hand. One player should use only on of his hands.
Ambidexters play as well with their right hand as with their left hand. In the team, an ambidexter can play with their left hand, or with their right hand.
Please find the maximum possible size of the team, where equal number of players use their left and right hands, respectively.
Input Specification:
The only line contains three integers *l*, *r* and *a* (0<=≤<=*l*,<=*r*,<=*a*<=≤<=100) — the number of left-handers, the number of right-handers and the number of ambidexters at the training.
Output Specification:
Print a single even integer — the maximum number of players in the team. It is possible that the team can only have zero number of players.
Demo Input:
['1 4 2\n', '5 5 5\n', '0 2 0\n']
Demo Output:
['6\n', '14\n', '0\n']
Note:
In the first example you can form a team of 6 players. You should take the only left-hander and two ambidexters to play with left hand, and three right-handers to play with right hand. The only person left can't be taken into the team.
In the second example you can form a team of 14 people. You have to take all five left-handers, all five right-handers, two ambidexters to play with left hand and two ambidexters to play with right hand.
|
```python
def solve(l, r, a):
x = abs(l - r)
y = min(x, a)
x = min(l, r) + y
return (x + (a - y)//2)*2
def main():
l, r, a = list(map(int, input().split()))
print(solve(l, r, a))
main()
```
| 3
|
|
873
|
A
|
Chores
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Luba has to do *n* chores today. *i*-th chore takes *a**i* units of time to complete. It is guaranteed that for every the condition *a**i*<=≥<=*a**i*<=-<=1 is met, so the sequence is sorted.
Also Luba can work really hard on some chores. She can choose not more than *k* any chores and do each of them in *x* units of time instead of *a**i* ().
Luba is very responsible, so she has to do all *n* chores, and now she wants to know the minimum time she needs to do everything. Luba cannot do two chores simultaneously.
|
The first line contains three integers *n*,<=*k*,<=*x* (1<=≤<=*k*<=≤<=*n*<=≤<=100,<=1<=≤<=*x*<=≤<=99) — the number of chores Luba has to do, the number of chores she can do in *x* units of time, and the number *x* itself.
The second line contains *n* integer numbers *a**i* (2<=≤<=*a**i*<=≤<=100) — the time Luba has to spend to do *i*-th chore.
It is guaranteed that , and for each *a**i*<=≥<=*a**i*<=-<=1.
|
Print one number — minimum time Luba needs to do all *n* chores.
|
[
"4 2 2\n3 6 7 10\n",
"5 2 1\n100 100 100 100 100\n"
] |
[
"13\n",
"302\n"
] |
In the first example the best option would be to do the third and the fourth chore, spending *x* = 2 time on each instead of *a*<sub class="lower-index">3</sub> and *a*<sub class="lower-index">4</sub>, respectively. Then the answer is 3 + 6 + 2 + 2 = 13.
In the second example Luba can choose any two chores to spend *x* time on them instead of *a*<sub class="lower-index">*i*</sub>. So the answer is 100·3 + 2·1 = 302.
| 0
|
[
{
"input": "4 2 2\n3 6 7 10",
"output": "13"
},
{
"input": "5 2 1\n100 100 100 100 100",
"output": "302"
},
{
"input": "1 1 1\n100",
"output": "1"
},
{
"input": "100 1 99\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100",
"output": "9999"
},
{
"input": "100 100 1\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100",
"output": "100"
},
{
"input": "100 50 50\n51 51 52 53 55 55 55 55 56 56 56 57 57 58 58 59 59 59 60 60 61 61 62 62 63 64 64 64 64 65 65 65 65 66 66 66 67 68 68 68 69 69 70 70 70 70 71 71 71 71 71 71 72 72 76 76 76 76 77 79 79 81 81 81 81 82 82 82 82 83 84 85 86 87 87 88 88 88 89 89 89 90 90 90 91 91 91 92 92 93 95 95 96 96 96 97 97 98 99 100",
"output": "5618"
},
{
"input": "100 100 1\n2 4 4 4 5 5 5 6 10 10 11 11 12 12 13 13 13 14 17 18 20 20 21 21 22 22 23 24 24 25 26 29 29 32 32 34 34 35 38 39 39 40 40 42 42 43 45 47 48 49 51 52 52 54 57 59 59 60 61 61 62 63 63 64 65 65 68 70 70 72 74 75 75 76 76 77 77 78 78 78 79 80 81 82 82 83 83 83 84 89 90 92 92 93 94 96 96 97 98 99",
"output": "100"
},
{
"input": "100 1 1\n3 3 5 7 8 8 8 9 9 9 11 13 14 15 18 18 19 20 21 22 22 25 27 27 29 31 32 33 33 34 36 37 37 38 40 42 44 44 46 47 47 48 48 48 50 50 51 51 54 54 54 55 55 56 56 56 60 61 62 62 63 64 65 65 68 70 70 71 71 71 71 75 75 76 76 79 79 79 79 81 81 82 82 86 86 86 86 88 90 90 92 96 97 97 98 98 98 98 100 100",
"output": "5202"
},
{
"input": "100 50 49\n50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51",
"output": "4950"
},
{
"input": "100 50 1\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3",
"output": "151"
},
{
"input": "100 1 1\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2",
"output": "199"
}
] | 1,508,499,844
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 46
| 5,529,600
|
n, k , x = map(int, input().split())
ar = list(map(int, input().split()))
print(ar[:k])
print (k*x + sum(ar[:-k]))
|
Title: Chores
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Luba has to do *n* chores today. *i*-th chore takes *a**i* units of time to complete. It is guaranteed that for every the condition *a**i*<=≥<=*a**i*<=-<=1 is met, so the sequence is sorted.
Also Luba can work really hard on some chores. She can choose not more than *k* any chores and do each of them in *x* units of time instead of *a**i* ().
Luba is very responsible, so she has to do all *n* chores, and now she wants to know the minimum time she needs to do everything. Luba cannot do two chores simultaneously.
Input Specification:
The first line contains three integers *n*,<=*k*,<=*x* (1<=≤<=*k*<=≤<=*n*<=≤<=100,<=1<=≤<=*x*<=≤<=99) — the number of chores Luba has to do, the number of chores she can do in *x* units of time, and the number *x* itself.
The second line contains *n* integer numbers *a**i* (2<=≤<=*a**i*<=≤<=100) — the time Luba has to spend to do *i*-th chore.
It is guaranteed that , and for each *a**i*<=≥<=*a**i*<=-<=1.
Output Specification:
Print one number — minimum time Luba needs to do all *n* chores.
Demo Input:
['4 2 2\n3 6 7 10\n', '5 2 1\n100 100 100 100 100\n']
Demo Output:
['13\n', '302\n']
Note:
In the first example the best option would be to do the third and the fourth chore, spending *x* = 2 time on each instead of *a*<sub class="lower-index">3</sub> and *a*<sub class="lower-index">4</sub>, respectively. Then the answer is 3 + 6 + 2 + 2 = 13.
In the second example Luba can choose any two chores to spend *x* time on them instead of *a*<sub class="lower-index">*i*</sub>. So the answer is 100·3 + 2·1 = 302.
|
```python
n, k , x = map(int, input().split())
ar = list(map(int, input().split()))
print(ar[:k])
print (k*x + sum(ar[:-k]))
```
| 0
|
|
712
|
A
|
Memory and Crow
|
PROGRAMMING
| 800
|
[
"implementation",
"math"
] | null | null |
There are *n* integers *b*1,<=*b*2,<=...,<=*b**n* written in a row. For all *i* from 1 to *n*, values *a**i* are defined by the crows performing the following procedure:
- The crow sets *a**i* initially 0. - The crow then adds *b**i* to *a**i*, subtracts *b**i*<=+<=1, adds the *b**i*<=+<=2 number, and so on until the *n*'th number. Thus, *a**i*<==<=*b**i*<=-<=*b**i*<=+<=1<=+<=*b**i*<=+<=2<=-<=*b**i*<=+<=3....
Memory gives you the values *a*1,<=*a*2,<=...,<=*a**n*, and he now wants you to find the initial numbers *b*1,<=*b*2,<=...,<=*b**n* written in the row? Can you do it?
|
The first line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=100<=000) — the number of integers written in the row.
The next line contains *n*, the *i*'th of which is *a**i* (<=-<=109<=≤<=*a**i*<=≤<=109) — the value of the *i*'th number.
|
Print *n* integers corresponding to the sequence *b*1,<=*b*2,<=...,<=*b**n*. It's guaranteed that the answer is unique and fits in 32-bit integer type.
|
[
"5\n6 -4 8 -2 3\n",
"5\n3 -2 -1 5 6\n"
] |
[
"2 4 6 1 3 \n",
"1 -3 4 11 6 \n"
] |
In the first sample test, the crows report the numbers 6, - 4, 8, - 2, and 3 when he starts at indices 1, 2, 3, 4 and 5 respectively. It is easy to check that the sequence 2 4 6 1 3 satisfies the reports. For example, 6 = 2 - 4 + 6 - 1 + 3, and - 4 = 4 - 6 + 1 - 3.
In the second sample test, the sequence 1, - 3, 4, 11, 6 satisfies the reports. For example, 5 = 11 - 6 and 6 = 6.
| 500
|
[
{
"input": "5\n6 -4 8 -2 3",
"output": "2 4 6 1 3 "
},
{
"input": "5\n3 -2 -1 5 6",
"output": "1 -3 4 11 6 "
},
{
"input": "10\n13 -2 532 -63 -23 -63 -64 -23 12 10",
"output": "11 530 469 -86 -86 -127 -87 -11 22 10 "
},
{
"input": "10\n0 0 0 0 0 0 0 0 0 0",
"output": "0 0 0 0 0 0 0 0 0 0 "
},
{
"input": "10\n1 -1 1 -1 1 -1 1 -1 1 -1",
"output": "0 0 0 0 0 0 0 0 0 -1 "
},
{
"input": "10\n-1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000",
"output": "0 0 0 0 0 0 0 0 0 1000000000 "
},
{
"input": "10\n124 532 -642 6482 -124 952 -235 7594 34 -12",
"output": "656 -110 5840 6358 828 717 7359 7628 22 -12 "
},
{
"input": "10\n1294 35852 32749 537295 12048 53729 29357 58320 64739 1240",
"output": "37146 68601 570044 549343 65777 83086 87677 123059 65979 1240 "
}
] | 1,581,078,355
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 93
| 0
|
a=int(input());b=list(map(int,input().split()));print([b[i]+b[i+1] for i in range(a-1)]+[b[-1]])
|
Title: Memory and Crow
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* integers *b*1,<=*b*2,<=...,<=*b**n* written in a row. For all *i* from 1 to *n*, values *a**i* are defined by the crows performing the following procedure:
- The crow sets *a**i* initially 0. - The crow then adds *b**i* to *a**i*, subtracts *b**i*<=+<=1, adds the *b**i*<=+<=2 number, and so on until the *n*'th number. Thus, *a**i*<==<=*b**i*<=-<=*b**i*<=+<=1<=+<=*b**i*<=+<=2<=-<=*b**i*<=+<=3....
Memory gives you the values *a*1,<=*a*2,<=...,<=*a**n*, and he now wants you to find the initial numbers *b*1,<=*b*2,<=...,<=*b**n* written in the row? Can you do it?
Input Specification:
The first line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=100<=000) — the number of integers written in the row.
The next line contains *n*, the *i*'th of which is *a**i* (<=-<=109<=≤<=*a**i*<=≤<=109) — the value of the *i*'th number.
Output Specification:
Print *n* integers corresponding to the sequence *b*1,<=*b*2,<=...,<=*b**n*. It's guaranteed that the answer is unique and fits in 32-bit integer type.
Demo Input:
['5\n6 -4 8 -2 3\n', '5\n3 -2 -1 5 6\n']
Demo Output:
['2 4 6 1 3 \n', '1 -3 4 11 6 \n']
Note:
In the first sample test, the crows report the numbers 6, - 4, 8, - 2, and 3 when he starts at indices 1, 2, 3, 4 and 5 respectively. It is easy to check that the sequence 2 4 6 1 3 satisfies the reports. For example, 6 = 2 - 4 + 6 - 1 + 3, and - 4 = 4 - 6 + 1 - 3.
In the second sample test, the sequence 1, - 3, 4, 11, 6 satisfies the reports. For example, 5 = 11 - 6 and 6 = 6.
|
```python
a=int(input());b=list(map(int,input().split()));print([b[i]+b[i+1] for i in range(a-1)]+[b[-1]])
```
| 0
|
|
558
|
B
|
Amr and The Large Array
|
PROGRAMMING
| 1,300
|
[
"implementation"
] | null | null |
Amr has got a large array of size *n*. Amr doesn't like large arrays so he intends to make it smaller.
Amr doesn't care about anything in the array except the beauty of it. The beauty of the array is defined to be the maximum number of times that some number occurs in this array. He wants to choose the smallest subsegment of this array such that the beauty of it will be the same as the original array.
Help Amr by choosing the smallest subsegment possible.
|
The first line contains one number *n* (1<=≤<=*n*<=≤<=105), the size of the array.
The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=106), representing elements of the array.
|
Output two integers *l*,<=*r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*), the beginning and the end of the subsegment chosen respectively.
If there are several possible answers you may output any of them.
|
[
"5\n1 1 2 2 1\n",
"5\n1 2 2 3 1\n",
"6\n1 2 2 1 1 2\n"
] |
[
"1 5",
"2 3",
"1 5"
] |
A subsegment *B* of an array *A* from *l* to *r* is an array of size *r* - *l* + 1 where *B*<sub class="lower-index">*i*</sub> = *A*<sub class="lower-index">*l* + *i* - 1</sub> for all 1 ≤ *i* ≤ *r* - *l* + 1
| 1,000
|
[
{
"input": "5\n1 1 2 2 1",
"output": "1 5"
},
{
"input": "5\n1 2 2 3 1",
"output": "2 3"
},
{
"input": "6\n1 2 2 1 1 2",
"output": "1 5"
},
{
"input": "10\n1 1000000 2 1000000 3 2 1000000 1 2 1",
"output": "2 7"
},
{
"input": "10\n1 2 3 4 5 5 1 2 3 4",
"output": "5 6"
},
{
"input": "10\n1 1 2 1 1 2 2 1 2 3",
"output": "1 8"
},
{
"input": "10\n5 4 3 2 1 1 2 3 4 5",
"output": "5 6"
},
{
"input": "10\n1 10 100 1000 10000 1 10 100 1000 10000",
"output": "1 6"
},
{
"input": "10\n9 9 9 9 8 9 8 8 8 8",
"output": "1 6"
},
{
"input": "10\n1 11 111 1111 1 11 11 1 1111 1111",
"output": "2 7"
}
] | 1,472,482,038
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 31
| 1,000
| 9,523,200
|
import sys
n = int(input())
an = list(map(int, sys.stdin.readline().split()))
count = [0] * 1000001
m = 0
for i in range(n):
count[an[i]] += 1
if count[an[i]] > m:
m = count[an[i]]
ax = []
for i in range(1000001):
if count[i] == m:
ax.append(i)
ans = [0, n-1]
for x in ax:
l = an.index(x)
r = len(an) - 1
while r > l and an[r] != x:
r -= 1
if r - l < ans[1] - ans[0]:
ans[0] = l
ans[1] = r
print(1+ans[0], 1+ans[1])
|
Title: Amr and The Large Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Amr has got a large array of size *n*. Amr doesn't like large arrays so he intends to make it smaller.
Amr doesn't care about anything in the array except the beauty of it. The beauty of the array is defined to be the maximum number of times that some number occurs in this array. He wants to choose the smallest subsegment of this array such that the beauty of it will be the same as the original array.
Help Amr by choosing the smallest subsegment possible.
Input Specification:
The first line contains one number *n* (1<=≤<=*n*<=≤<=105), the size of the array.
The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=106), representing elements of the array.
Output Specification:
Output two integers *l*,<=*r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*), the beginning and the end of the subsegment chosen respectively.
If there are several possible answers you may output any of them.
Demo Input:
['5\n1 1 2 2 1\n', '5\n1 2 2 3 1\n', '6\n1 2 2 1 1 2\n']
Demo Output:
['1 5', '2 3', '1 5']
Note:
A subsegment *B* of an array *A* from *l* to *r* is an array of size *r* - *l* + 1 where *B*<sub class="lower-index">*i*</sub> = *A*<sub class="lower-index">*l* + *i* - 1</sub> for all 1 ≤ *i* ≤ *r* - *l* + 1
|
```python
import sys
n = int(input())
an = list(map(int, sys.stdin.readline().split()))
count = [0] * 1000001
m = 0
for i in range(n):
count[an[i]] += 1
if count[an[i]] > m:
m = count[an[i]]
ax = []
for i in range(1000001):
if count[i] == m:
ax.append(i)
ans = [0, n-1]
for x in ax:
l = an.index(x)
r = len(an) - 1
while r > l and an[r] != x:
r -= 1
if r - l < ans[1] - ans[0]:
ans[0] = l
ans[1] = r
print(1+ans[0], 1+ans[1])
```
| 0
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
You are given an array *a*1,<=*a*2,<=...,<=*a**n* consisting of *n* integers, and an integer *k*. You have to split the array into exactly *k* non-empty subsegments. You'll then compute the minimum integer on each subsegment, and take the maximum integer over the *k* obtained minimums. What is the maximum possible integer you can get?
Definitions of subsegment and array splitting are given in notes.
|
The first line contains two integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=<=105) — the size of the array *a* and the number of subsegments you have to split the array to.
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (<=-<=109<=<=≤<=<=*a**i*<=≤<=<=109).
|
Print single integer — the maximum possible integer you can get if you split the array into *k* non-empty subsegments and take maximum of minimums on the subsegments.
|
[
"5 2\n1 2 3 4 5\n",
"5 1\n-4 -5 -3 -2 -1\n"
] |
[
"5\n",
"-5\n"
] |
A subsegment [*l*, *r*] (*l* ≤ *r*) of array *a* is the sequence *a*<sub class="lower-index">*l*</sub>, *a*<sub class="lower-index">*l* + 1</sub>, ..., *a*<sub class="lower-index">*r*</sub>.
Splitting of array *a* of *n* elements into *k* subsegments [*l*<sub class="lower-index">1</sub>, *r*<sub class="lower-index">1</sub>], [*l*<sub class="lower-index">2</sub>, *r*<sub class="lower-index">2</sub>], ..., [*l*<sub class="lower-index">*k*</sub>, *r*<sub class="lower-index">*k*</sub>] (*l*<sub class="lower-index">1</sub> = 1, *r*<sub class="lower-index">*k*</sub> = *n*, *l*<sub class="lower-index">*i*</sub> = *r*<sub class="lower-index">*i* - 1</sub> + 1 for all *i* > 1) is *k* sequences (*a*<sub class="lower-index">*l*<sub class="lower-index">1</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">1</sub></sub>), ..., (*a*<sub class="lower-index">*l*<sub class="lower-index">*k*</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">*k*</sub></sub>).
In the first example you should split the array into subsegments [1, 4] and [5, 5] that results in sequences (1, 2, 3, 4) and (5). The minimums are *min*(1, 2, 3, 4) = 1 and *min*(5) = 5. The resulting maximum is *max*(1, 5) = 5. It is obvious that you can't reach greater result.
In the second example the only option you have is to split the array into one subsegment [1, 5], that results in one sequence ( - 4, - 5, - 3, - 2, - 1). The only minimum is *min*( - 4, - 5, - 3, - 2, - 1) = - 5. The resulting maximum is - 5.
| 0
|
[
{
"input": "5 2\n1 2 3 4 5",
"output": "5"
},
{
"input": "5 1\n-4 -5 -3 -2 -1",
"output": "-5"
},
{
"input": "10 2\n10 9 1 -9 -7 -9 3 8 -10 5",
"output": "10"
},
{
"input": "10 4\n-8 -1 2 -3 9 -8 4 -3 5 9",
"output": "9"
},
{
"input": "1 1\n504262064",
"output": "504262064"
},
{
"input": "3 3\n-54481850 -878017339 -486296116",
"output": "-54481850"
},
{
"input": "2 2\n-333653905 224013643",
"output": "224013643"
},
{
"input": "14 2\n-14 84 44 46 -75 -75 77 -49 44 -82 -74 -51 -9 -50",
"output": "-14"
},
{
"input": "88 71\n-497 -488 182 104 40 183 201 282 -384 44 -29 494 224 -80 -491 -197 157 130 -52 233 -426 252 -61 -51 203 -50 195 -442 -38 385 232 -243 -49 163 340 -200 406 -254 -29 227 -194 193 487 -325 230 146 421 158 20 447 -97 479 493 -130 164 -471 -198 -330 -152 359 -554 319 544 -444 235 281 -467 337 -385 227 -366 -210 266 69 -261 525 526 -234 -355 177 109 275 -301 7 -41 553 -284 540",
"output": "553"
},
{
"input": "39 1\n676941771 -923780377 -163050076 -230110947 -208029500 329620771 13954060 158950156 -252501602 926390671 -678745080 -921892226 -100127643 610420285 602175224 -839193819 471391946 910035173 777969600 -736144413 -489685522 60986249 830784148 278642552 -375298304 197973611 -354482364 187294011 636628282 25350767 636184407 -550869740 53830680 -42049274 -451383278 900048257 93225803 877923341 -279506435",
"output": "-923780377"
},
{
"input": "3 2\n1 5 3",
"output": "3"
},
{
"input": "5 2\n1 2 5 4 3",
"output": "3"
},
{
"input": "3 2\n1 3 2",
"output": "2"
},
{
"input": "3 2\n1 3 1",
"output": "1"
},
{
"input": "5 3\n-2 -2 -2 -2 -2",
"output": "-2"
},
{
"input": "5 2\n1 2 3 5 4",
"output": "4"
},
{
"input": "5 2\n1 1 11 1 1",
"output": "1"
},
{
"input": "3 3\n3 8 4",
"output": "8"
},
{
"input": "6 3\n4 3 1 5 6 2",
"output": "6"
},
{
"input": "2 1\n1 2",
"output": "1"
},
{
"input": "5 2\n2 5 4 3 1",
"output": "2"
},
{
"input": "5 2\n-1 1 5 4 3",
"output": "3"
},
{
"input": "5 2\n5 2 1 9 3",
"output": "5"
},
{
"input": "2 1\n1000000000 1000000000",
"output": "1000000000"
},
{
"input": "1 1\n1000000000",
"output": "1000000000"
},
{
"input": "5 2\n1 5 3 4 1",
"output": "1"
},
{
"input": "3 2\n-1000000000 -1000000000 -1000000000",
"output": "-1000000000"
},
{
"input": "2 2\n5 2",
"output": "5"
},
{
"input": "7 3\n1 1 1 10 1 1 1",
"output": "10"
},
{
"input": "9 3\n1 2 1 1 5 1 1 1 2",
"output": "5"
},
{
"input": "9 3\n2 2 2 2 9 2 2 2 2",
"output": "9"
},
{
"input": "3 3\n-1000000000 -1000000000 -1000000000",
"output": "-1000000000"
}
] | 1,678,913,455
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 9
| 77
| 11,161,600
|
# ----------- FastIO ----------- #
import atexit, os
from sys import stdin
from io import BytesIO
output_pipe = BytesIO()
readline = stdin.readline
_write = output_pipe.write
output_pipe.write = lambda *args: (_write(b' '.join(map(lambda s: str(s).encode(), args))), _write(b'\n'))
print = output_pipe.write
input = lambda: readline().rstrip('\r\n')
atexit.register(lambda: os.write(1, output_pipe.getvalue()))
# ------------------------------ #
# from bisect import bisect_left
# from collections import deque
# from string import ascii_lowercase
# from heapq import heappush, heappop, heapify
read = lambda: input()
read_int = lambda: int(input())
read_ints = lambda: [int(_) for _ in input().split()]
def solve():
n, k = read_ints()
nums = read_ints()
if k == 1:
return min(nums)
return max(nums)
print(solve())
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an array *a*1,<=*a*2,<=...,<=*a**n* consisting of *n* integers, and an integer *k*. You have to split the array into exactly *k* non-empty subsegments. You'll then compute the minimum integer on each subsegment, and take the maximum integer over the *k* obtained minimums. What is the maximum possible integer you can get?
Definitions of subsegment and array splitting are given in notes.
Input Specification:
The first line contains two integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=<=105) — the size of the array *a* and the number of subsegments you have to split the array to.
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (<=-<=109<=<=≤<=<=*a**i*<=≤<=<=109).
Output Specification:
Print single integer — the maximum possible integer you can get if you split the array into *k* non-empty subsegments and take maximum of minimums on the subsegments.
Demo Input:
['5 2\n1 2 3 4 5\n', '5 1\n-4 -5 -3 -2 -1\n']
Demo Output:
['5\n', '-5\n']
Note:
A subsegment [*l*, *r*] (*l* ≤ *r*) of array *a* is the sequence *a*<sub class="lower-index">*l*</sub>, *a*<sub class="lower-index">*l* + 1</sub>, ..., *a*<sub class="lower-index">*r*</sub>.
Splitting of array *a* of *n* elements into *k* subsegments [*l*<sub class="lower-index">1</sub>, *r*<sub class="lower-index">1</sub>], [*l*<sub class="lower-index">2</sub>, *r*<sub class="lower-index">2</sub>], ..., [*l*<sub class="lower-index">*k*</sub>, *r*<sub class="lower-index">*k*</sub>] (*l*<sub class="lower-index">1</sub> = 1, *r*<sub class="lower-index">*k*</sub> = *n*, *l*<sub class="lower-index">*i*</sub> = *r*<sub class="lower-index">*i* - 1</sub> + 1 for all *i* > 1) is *k* sequences (*a*<sub class="lower-index">*l*<sub class="lower-index">1</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">1</sub></sub>), ..., (*a*<sub class="lower-index">*l*<sub class="lower-index">*k*</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">*k*</sub></sub>).
In the first example you should split the array into subsegments [1, 4] and [5, 5] that results in sequences (1, 2, 3, 4) and (5). The minimums are *min*(1, 2, 3, 4) = 1 and *min*(5) = 5. The resulting maximum is *max*(1, 5) = 5. It is obvious that you can't reach greater result.
In the second example the only option you have is to split the array into one subsegment [1, 5], that results in one sequence ( - 4, - 5, - 3, - 2, - 1). The only minimum is *min*( - 4, - 5, - 3, - 2, - 1) = - 5. The resulting maximum is - 5.
|
```python
# ----------- FastIO ----------- #
import atexit, os
from sys import stdin
from io import BytesIO
output_pipe = BytesIO()
readline = stdin.readline
_write = output_pipe.write
output_pipe.write = lambda *args: (_write(b' '.join(map(lambda s: str(s).encode(), args))), _write(b'\n'))
print = output_pipe.write
input = lambda: readline().rstrip('\r\n')
atexit.register(lambda: os.write(1, output_pipe.getvalue()))
# ------------------------------ #
# from bisect import bisect_left
# from collections import deque
# from string import ascii_lowercase
# from heapq import heappush, heappop, heapify
read = lambda: input()
read_int = lambda: int(input())
read_ints = lambda: [int(_) for _ in input().split()]
def solve():
n, k = read_ints()
nums = read_ints()
if k == 1:
return min(nums)
return max(nums)
print(solve())
```
| 0
|
|
994
|
A
|
Fingerprints
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
You are locked in a room with a door that has a keypad with 10 keys corresponding to digits from 0 to 9. To escape from the room, you need to enter a correct code. You also have a sequence of digits.
Some keys on the keypad have fingerprints. You believe the correct code is the longest not necessarily contiguous subsequence of the sequence you have that only contains digits with fingerprints on the corresponding keys. Find such code.
|
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 10$) representing the number of digits in the sequence you have and the number of keys on the keypad that have fingerprints.
The next line contains $n$ distinct space-separated integers $x_1, x_2, \ldots, x_n$ ($0 \le x_i \le 9$) representing the sequence.
The next line contains $m$ distinct space-separated integers $y_1, y_2, \ldots, y_m$ ($0 \le y_i \le 9$) — the keys with fingerprints.
|
In a single line print a space-separated sequence of integers representing the code. If the resulting sequence is empty, both printing nothing and printing a single line break is acceptable.
|
[
"7 3\n3 5 7 1 6 2 8\n1 2 7\n",
"4 4\n3 4 1 0\n0 1 7 9\n"
] |
[
"7 1 2\n",
"1 0\n"
] |
In the first example, the only digits with fingerprints are $1$, $2$ and $7$. All three of them appear in the sequence you know, $7$ first, then $1$ and then $2$. Therefore the output is 7 1 2. Note that the order is important, and shall be the same as the order in the original sequence.
In the second example digits $0$, $1$, $7$ and $9$ have fingerprints, however only $0$ and $1$ appear in the original sequence. $1$ appears earlier, so the output is 1 0. Again, the order is important.
| 500
|
[
{
"input": "7 3\n3 5 7 1 6 2 8\n1 2 7",
"output": "7 1 2"
},
{
"input": "4 4\n3 4 1 0\n0 1 7 9",
"output": "1 0"
},
{
"input": "9 4\n9 8 7 6 5 4 3 2 1\n2 4 6 8",
"output": "8 6 4 2"
},
{
"input": "10 5\n3 7 1 2 4 6 9 0 5 8\n4 3 0 7 9",
"output": "3 7 4 9 0"
},
{
"input": "10 10\n1 2 3 4 5 6 7 8 9 0\n4 5 6 7 1 2 3 0 9 8",
"output": "1 2 3 4 5 6 7 8 9 0"
},
{
"input": "1 1\n4\n4",
"output": "4"
},
{
"input": "3 7\n6 3 4\n4 9 0 1 7 8 6",
"output": "6 4"
},
{
"input": "10 1\n9 0 8 1 7 4 6 5 2 3\n0",
"output": "0"
},
{
"input": "5 10\n6 0 3 8 1\n3 1 0 5 4 7 2 8 9 6",
"output": "6 0 3 8 1"
},
{
"input": "8 2\n7 2 9 6 1 0 3 4\n6 3",
"output": "6 3"
},
{
"input": "5 4\n7 0 1 4 9\n0 9 5 3",
"output": "0 9"
},
{
"input": "10 1\n9 6 2 0 1 8 3 4 7 5\n6",
"output": "6"
},
{
"input": "10 2\n7 1 0 2 4 6 5 9 3 8\n3 2",
"output": "2 3"
},
{
"input": "5 9\n3 7 9 2 4\n3 8 4 5 9 6 1 0 2",
"output": "3 9 2 4"
},
{
"input": "10 6\n7 1 2 3 8 0 6 4 5 9\n1 5 8 2 3 6",
"output": "1 2 3 8 6 5"
},
{
"input": "8 2\n7 4 8 9 2 5 6 1\n6 4",
"output": "4 6"
},
{
"input": "10 2\n1 0 3 5 8 9 4 7 6 2\n0 3",
"output": "0 3"
},
{
"input": "7 6\n9 2 8 6 1 3 7\n4 2 0 3 1 8",
"output": "2 8 1 3"
},
{
"input": "1 6\n3\n6 8 2 4 5 3",
"output": "3"
},
{
"input": "1 8\n0\n9 2 4 8 1 5 0 7",
"output": "0"
},
{
"input": "6 9\n7 3 9 4 1 0\n9 1 5 8 0 6 2 7 4",
"output": "7 9 4 1 0"
},
{
"input": "10 2\n4 9 6 8 3 0 1 5 7 2\n0 1",
"output": "0 1"
},
{
"input": "10 5\n5 2 8 0 9 7 6 1 4 3\n9 6 4 1 2",
"output": "2 9 6 1 4"
},
{
"input": "6 3\n8 3 9 2 7 6\n5 4 3",
"output": "3"
},
{
"input": "4 10\n8 3 9 6\n4 9 6 2 7 0 8 1 3 5",
"output": "8 3 9 6"
},
{
"input": "1 2\n1\n1 0",
"output": "1"
},
{
"input": "3 6\n1 2 3\n4 5 6 1 2 3",
"output": "1 2 3"
},
{
"input": "1 2\n2\n1 2",
"output": "2"
},
{
"input": "1 10\n9\n0 1 2 3 4 5 6 7 8 9",
"output": "9"
}
] | 1,573,106,381
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 109
| 0
|
n,m=[int(x) for x in input().split()]
l=[int(x) for x in input().split()]
a=[int(x) for x in input().split()]
res=[]
for i in l:
if i in a:
res.append(i)
print(*res,sep=' ')
|
Title: Fingerprints
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are locked in a room with a door that has a keypad with 10 keys corresponding to digits from 0 to 9. To escape from the room, you need to enter a correct code. You also have a sequence of digits.
Some keys on the keypad have fingerprints. You believe the correct code is the longest not necessarily contiguous subsequence of the sequence you have that only contains digits with fingerprints on the corresponding keys. Find such code.
Input Specification:
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 10$) representing the number of digits in the sequence you have and the number of keys on the keypad that have fingerprints.
The next line contains $n$ distinct space-separated integers $x_1, x_2, \ldots, x_n$ ($0 \le x_i \le 9$) representing the sequence.
The next line contains $m$ distinct space-separated integers $y_1, y_2, \ldots, y_m$ ($0 \le y_i \le 9$) — the keys with fingerprints.
Output Specification:
In a single line print a space-separated sequence of integers representing the code. If the resulting sequence is empty, both printing nothing and printing a single line break is acceptable.
Demo Input:
['7 3\n3 5 7 1 6 2 8\n1 2 7\n', '4 4\n3 4 1 0\n0 1 7 9\n']
Demo Output:
['7 1 2\n', '1 0\n']
Note:
In the first example, the only digits with fingerprints are $1$, $2$ and $7$. All three of them appear in the sequence you know, $7$ first, then $1$ and then $2$. Therefore the output is 7 1 2. Note that the order is important, and shall be the same as the order in the original sequence.
In the second example digits $0$, $1$, $7$ and $9$ have fingerprints, however only $0$ and $1$ appear in the original sequence. $1$ appears earlier, so the output is 1 0. Again, the order is important.
|
```python
n,m=[int(x) for x in input().split()]
l=[int(x) for x in input().split()]
a=[int(x) for x in input().split()]
res=[]
for i in l:
if i in a:
res.append(i)
print(*res,sep=' ')
```
| 3
|
|
858
|
C
|
Did you mean...
|
PROGRAMMING
| 1,500
|
[
"dp",
"greedy",
"implementation"
] | null | null |
Beroffice text editor has a wide range of features that help working with text. One of the features is an automatic search for typos and suggestions of how to fix them.
Beroffice works only with small English letters (i.e. with 26 letters from a to z). Beroffice thinks that a word is typed with a typo if there are three or more consonants in a row in the word. The only exception is that if the block of consonants has all letters the same, then this block (even if its length is greater than three) is not considered a typo. Formally, a word is typed with a typo if there is a block of not less that three consonants in a row, and there are at least two different letters in this block.
For example:
- the following words have typos: "hellno", "hackcerrs" and "backtothefutttture"; - the following words don't have typos: "helllllooooo", "tobeornottobe" and "oooooo".
When Beroffice editor finds a word with a typo, it inserts as little as possible number of spaces in this word (dividing it into several words) in such a way that each of the resulting words is typed without any typos.
Implement this feature of Beroffice editor. Consider the following letters as the only vowels: 'a', 'e', 'i', 'o' and 'u'. All the other letters are consonants in this problem.
|
The only line contains a non-empty word consisting of small English letters. The length of the word is between 1 and 3000 letters.
|
Print the given word without any changes if there are no typos.
If there is at least one typo in the word, insert the minimum number of spaces into the word so that each of the resulting words doesn't have any typos. If there are multiple solutions, print any of them.
|
[
"hellno\n",
"abacaba\n",
"asdfasdf\n"
] |
[
"hell no \n",
"abacaba \n",
"asd fasd f \n"
] |
none
| 1,500
|
[
{
"input": "hellno",
"output": "hell no "
},
{
"input": "abacaba",
"output": "abacaba "
},
{
"input": "asdfasdf",
"output": "asd fasd f "
},
{
"input": "ooo",
"output": "ooo "
},
{
"input": "moyaoborona",
"output": "moyaoborona "
},
{
"input": "jxegxxx",
"output": "jxegx xx "
},
{
"input": "orfyaenanabckumulsboloyhljhacdgcmnooxvxrtuhcslxgslfpnfnyejbxqisxjyoyvcvuddboxkqgbogkfz",
"output": "orf yaenanabc kumuls boloyh lj hacd gc mnooxv xr tuhc sl xg sl fp nf nyejb xqisx jyoyv cvudd boxk qg bogk fz "
},
{
"input": "zxdgmhsjotvajkwshjpvzcuwehpeyfhakhtlvuoftkgdmvpafmxcliqvrztloocziqdkexhzcbdgxaoyvte",
"output": "zx dg mh sjotvajk ws hj pv zcuwehpeyf hakh tl vuoft kg dm vpafm xc liqv rz tloocziqd kexh zc bd gxaoyv te "
},
{
"input": "niblehmwtycadhbfuginpyafszjbucaszihijndzjtuyuaxkrovotshtsajmdcflnfdmahzbvpymiczqqleedpofcnvhieknlz",
"output": "niblehm wt ycadh bfuginp yafs zj bucaszihijn dz jtuyuaxk rovots ht sajm dc fl nf dmahz bv py micz qq leedpofc nv hiekn lz "
},
{
"input": "pqvtgtctpkgjgxnposjqedofficoyznxlerxyqypyzpoehejtjvyafjxjppywwgeakf",
"output": "pq vt gt ct pk gj gx nposj qedofficoyz nx lerx yq yp yz poehejt jv yafj xj pp yw wgeakf "
},
{
"input": "mvjajoyeg",
"output": "mv jajoyeg "
},
{
"input": "dipxocwjosvdaillxolmthjhzhsxskzqslebpixpuhpgeesrkedhohisdsjsrkiktbjzlhectrfcathvewzficirqbdvzq",
"output": "dipxocw josv daill xolm th jh zh sx sk zq slebpixpuhp geesr kedhohisd sj sr kikt bj zl hect rf cath vewz ficirq bd vz q "
},
{
"input": "ibbtvelwjirxqermucqrgmoauonisgmarjxxybllktccdykvef",
"output": "ibb tvelw jirx qermucq rg moauonisg marj xx yb ll kt cc dy kvef "
},
{
"input": "jxevkmrwlomaaahaubvjzqtyfqhqbhpqhomxqpiuersltohinvfyeykmlooujymldjqhgqjkvqknlyj",
"output": "jxevk mr wlomaaahaubv jz qt yf qh qb hp qhomx qpiuers ltohinv fyeyk mlooujy ml dj qh gq jk vq kn ly j "
},
{
"input": "hzxkuwqxonsulnndlhygvmallghjerwp",
"output": "hz xkuwq xonsuln nd lh yg vmall gh jerw p "
},
{
"input": "jbvcsjdyzlzmxwcvmixunfzxidzvwzaqqdhguvelwbdosbd",
"output": "jb vc sj dy zl zm xw cv mixunf zxidz vw zaqq dh guvelw bdosb d "
},
{
"input": "uyrsxaqmtibbxpfabprvnvbinjoxubupvfyjlqnfrfdeptipketwghr",
"output": "uyr sxaqm tibb xp fabp rv nv binjoxubupv fy jl qn fr fdeptipketw gh r "
},
{
"input": "xfcftysljytybkkzkpqdzralahgvbkxdtheqrhfxpecdjqofnyiahggnkiuusalu",
"output": "xf cf ty sl jy ty bk kz kp qd zralahg vb kx dt heqr hf xpecd jqofn yiahg gn kiuusalu "
},
{
"input": "a",
"output": "a "
},
{
"input": "b",
"output": "b "
},
{
"input": "aa",
"output": "aa "
},
{
"input": "ab",
"output": "ab "
},
{
"input": "ba",
"output": "ba "
},
{
"input": "bb",
"output": "bb "
},
{
"input": "aaa",
"output": "aaa "
},
{
"input": "aab",
"output": "aab "
},
{
"input": "aba",
"output": "aba "
},
{
"input": "abb",
"output": "abb "
},
{
"input": "baa",
"output": "baa "
},
{
"input": "bab",
"output": "bab "
},
{
"input": "bba",
"output": "bba "
},
{
"input": "bbb",
"output": "bbb "
},
{
"input": "bbc",
"output": "bb c "
},
{
"input": "bcb",
"output": "bc b "
},
{
"input": "cbb",
"output": "cb b "
},
{
"input": "bababcdfabbcabcdfacbbabcdfacacabcdfacbcabcdfaccbabcdfacaaabcdfabacabcdfabcbabcdfacbaabcdfabaaabcdfabbaabcdfacababcdfabbbabcdfabcaabcdfaaababcdfabccabcdfacccabcdfaacbabcdfaabaabcdfaabcabcdfaaacabcdfaccaabcdfaabbabcdfaaaaabcdfaacaabcdfaacc",
"output": "bababc dfabb cabc dfacb babc dfacacabc dfacb cabc dfacc babc dfacaaabc dfabacabc dfabc babc dfacbaabc dfabaaabc dfabbaabc dfacababc dfabbbabc dfabcaabc dfaaababc dfabc cabc dfacccabc dfaacbabc dfaabaabc dfaabcabc dfaaacabc dfaccaabc dfaabbabc dfaaaaabc dfaacaabc dfaacc "
},
{
"input": "bddabcdfaccdabcdfadddabcdfabbdabcdfacddabcdfacdbabcdfacbbabcdfacbcabcdfacbdabcdfadbbabcdfabdbabcdfabdcabcdfabbcabcdfabccabcdfabbbabcdfaddcabcdfaccbabcdfadbdabcdfacccabcdfadcdabcdfadcbabcdfabcbabcdfadbcabcdfacdcabcdfabcdabcdfadccabcdfaddb",
"output": "bd dabc dfacc dabc dfadddabc dfabb dabc dfacd dabc dfacd babc dfacb babc dfacb cabc dfacb dabc dfadb babc dfabd babc dfabd cabc dfabb cabc dfabc cabc dfabbbabc dfadd cabc dfacc babc dfadb dabc dfacccabc dfadc dabc dfadc babc dfabc babc dfadb cabc dfacd cabc dfabc dabc dfadc cabc dfadd b "
},
{
"input": "helllllooooo",
"output": "helllllooooo "
},
{
"input": "bbbzxxx",
"output": "bbb zx xx "
},
{
"input": "ffff",
"output": "ffff "
},
{
"input": "cdddddddddddddddddd",
"output": "cd ddddddddddddddddd "
},
{
"input": "bbbc",
"output": "bbb c "
},
{
"input": "lll",
"output": "lll "
},
{
"input": "bbbbb",
"output": "bbbbb "
},
{
"input": "llll",
"output": "llll "
},
{
"input": "bbbbbbccc",
"output": "bbbbbb ccc "
},
{
"input": "lllllb",
"output": "lllll b "
},
{
"input": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzz "
},
{
"input": "lllll",
"output": "lllll "
},
{
"input": "bbbbbbbbbc",
"output": "bbbbbbbbb c "
},
{
"input": "helllllno",
"output": "helllll no "
},
{
"input": "nnnnnnnnnnnn",
"output": "nnnnnnnnnnnn "
},
{
"input": "bbbbbccc",
"output": "bbbbb ccc "
},
{
"input": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzz "
},
{
"input": "nnnnnnnnnnnnnnnnnn",
"output": "nnnnnnnnnnnnnnnnnn "
},
{
"input": "zzzzzzzzzzzzzzzzzzzzzzz",
"output": "zzzzzzzzzzzzzzzzzzzzzzz "
},
{
"input": "hhhh",
"output": "hhhh "
},
{
"input": "nnnnnnnnnnnnnnnnnnnnnnnnn",
"output": "nnnnnnnnnnnnnnnnnnnnnnnnn "
},
{
"input": "zzzzzzzzzz",
"output": "zzzzzzzzzz "
},
{
"input": "dddd",
"output": "dddd "
},
{
"input": "heffffffgggggghhhhhh",
"output": "heffffff gggggg hhhhhh "
},
{
"input": "bcddd",
"output": "bc ddd "
},
{
"input": "x",
"output": "x "
},
{
"input": "nnn",
"output": "nnn "
},
{
"input": "xxxxxxxx",
"output": "xxxxxxxx "
},
{
"input": "cclcc",
"output": "cc lc c "
},
{
"input": "tttttttttttttt",
"output": "tttttttttttttt "
},
{
"input": "xxxxxxx",
"output": "xxxxxxx "
},
{
"input": "ccccb",
"output": "cccc b "
},
{
"input": "bcecccc",
"output": "bcecccc "
},
{
"input": "jjja",
"output": "jjja "
},
{
"input": "zzz",
"output": "zzz "
},
{
"input": "xxxxxxxxxzzzzzzzzzzzz",
"output": "xxxxxxxxx zzzzzzzzzzzz "
},
{
"input": "alllewww",
"output": "alllewww "
},
{
"input": "bbbbbbbbb",
"output": "bbbbbbbbb "
},
{
"input": "jjj",
"output": "jjj "
},
{
"input": "bbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "bbbbbbbbbbbbbbbbbbbbbbbbb "
},
{
"input": "kkkkkkkkkklllllllllllllll",
"output": "kkkkkkkkkk lllllllllllllll "
},
{
"input": "helllllllllllo",
"output": "helllllllllllo "
},
{
"input": "ttttsttttt",
"output": "tttt st tttt "
},
{
"input": "tttttttsssssss",
"output": "ttttttt sssssss "
},
{
"input": "assstttttatsfatsfdjfdhtsjdsaatttssssststsss",
"output": "asss tttttats fats fd jf dh ts jd saattt sssss ts ts ss "
},
{
"input": "xxxxx",
"output": "xxxxx "
},
{
"input": "bbbhbbb",
"output": "bbb hb bb "
},
{
"input": "bbbbbbbb",
"output": "bbbbbbbb "
}
] | 1,505,656,401
| 2,901
|
Python 3
|
WRONG_ANSWER
|
PRETESTS
| 6
| 62
| 0
|
s = input().strip()
def is_valid(c):
return c not in 'aeiou'
ans = ''
i = 0
while i < len(s):
if is_valid(s[i]):
j = 1
is_uniq = True
while (i + j) < len(s) and is_valid(s[i + j]):
is_uniq = is_uniq and s[i + j] == s[i]
j += 1
if j >= 3 and not is_uniq:
for k in range(j // 2 + j % 2):
n = int(2 + k * 2 <= j)
ans += s[i + 2 * k: i + 2 * k + 1 + n] + (' ' if n else '')
else:
ans += s[i: i + j]
i += j
else:
ans += s[i]
i += 1
print(ans)
|
Title: Did you mean...
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Beroffice text editor has a wide range of features that help working with text. One of the features is an automatic search for typos and suggestions of how to fix them.
Beroffice works only with small English letters (i.e. with 26 letters from a to z). Beroffice thinks that a word is typed with a typo if there are three or more consonants in a row in the word. The only exception is that if the block of consonants has all letters the same, then this block (even if its length is greater than three) is not considered a typo. Formally, a word is typed with a typo if there is a block of not less that three consonants in a row, and there are at least two different letters in this block.
For example:
- the following words have typos: "hellno", "hackcerrs" and "backtothefutttture"; - the following words don't have typos: "helllllooooo", "tobeornottobe" and "oooooo".
When Beroffice editor finds a word with a typo, it inserts as little as possible number of spaces in this word (dividing it into several words) in such a way that each of the resulting words is typed without any typos.
Implement this feature of Beroffice editor. Consider the following letters as the only vowels: 'a', 'e', 'i', 'o' and 'u'. All the other letters are consonants in this problem.
Input Specification:
The only line contains a non-empty word consisting of small English letters. The length of the word is between 1 and 3000 letters.
Output Specification:
Print the given word without any changes if there are no typos.
If there is at least one typo in the word, insert the minimum number of spaces into the word so that each of the resulting words doesn't have any typos. If there are multiple solutions, print any of them.
Demo Input:
['hellno\n', 'abacaba\n', 'asdfasdf\n']
Demo Output:
['hell no \n', 'abacaba \n', 'asd fasd f \n']
Note:
none
|
```python
s = input().strip()
def is_valid(c):
return c not in 'aeiou'
ans = ''
i = 0
while i < len(s):
if is_valid(s[i]):
j = 1
is_uniq = True
while (i + j) < len(s) and is_valid(s[i + j]):
is_uniq = is_uniq and s[i + j] == s[i]
j += 1
if j >= 3 and not is_uniq:
for k in range(j // 2 + j % 2):
n = int(2 + k * 2 <= j)
ans += s[i + 2 * k: i + 2 * k + 1 + n] + (' ' if n else '')
else:
ans += s[i: i + j]
i += j
else:
ans += s[i]
i += 1
print(ans)
```
| 0
|
|
287
|
B
|
Pipeline
|
PROGRAMMING
| 1,700
|
[
"binary search",
"math"
] | null | null |
Vova, the Ultimate Thule new shaman, wants to build a pipeline. As there are exactly *n* houses in Ultimate Thule, Vova wants the city to have exactly *n* pipes, each such pipe should be connected to the water supply. A pipe can be connected to the water supply if there's water flowing out of it. Initially Vova has only one pipe with flowing water. Besides, Vova has several splitters.
A splitter is a construction that consists of one input (it can be connected to a water pipe) and *x* output pipes. When a splitter is connected to a water pipe, water flows from each output pipe. You can assume that the output pipes are ordinary pipes. For example, you can connect water supply to such pipe if there's water flowing out from it. At most one splitter can be connected to any water pipe.
Vova has one splitter of each kind: with 2, 3, 4, ..., *k* outputs. Help Vova use the minimum number of splitters to build the required pipeline or otherwise state that it's impossible.
Vova needs the pipeline to have exactly *n* pipes with flowing out water. Note that some of those pipes can be the output pipes of the splitters.
|
The first line contains two space-separated integers *n* and *k* (1<=≤<=*n*<=≤<=1018, 2<=≤<=*k*<=≤<=109).
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
|
Print a single integer — the minimum number of splitters needed to build the pipeline. If it is impossible to build a pipeline with the given splitters, print -1.
|
[
"4 3\n",
"5 5\n",
"8 4\n"
] |
[
"2\n",
"1\n",
"-1\n"
] |
none
| 1,500
|
[
{
"input": "4 3",
"output": "2"
},
{
"input": "5 5",
"output": "1"
},
{
"input": "8 4",
"output": "-1"
},
{
"input": "1000000000000000000 1000000000",
"output": "-1"
},
{
"input": "499999998500000001 1000000000",
"output": "999955279"
},
{
"input": "499999998500000000 1000000000",
"output": "999955279"
},
{
"input": "499999999500000000 1000000000",
"output": "999999998"
},
{
"input": "499999999500000001 1000000000",
"output": "999999999"
},
{
"input": "525 34",
"output": "25"
},
{
"input": "223265034477 726990",
"output": "440662"
},
{
"input": "15597035789572051 185473109",
"output": "128849771"
},
{
"input": "499999999500000002 1000000000",
"output": "-1"
},
{
"input": "1 1000000000",
"output": "0"
},
{
"input": "1000000000 2",
"output": "-1"
},
{
"input": "462498979 204468265",
"output": "3"
},
{
"input": "2107921 542531",
"output": "4"
},
{
"input": "131 49",
"output": "3"
},
{
"input": "20171878992939541 200857557",
"output": "200853401"
},
{
"input": "399812655947 894219",
"output": "893030"
},
{
"input": "93 17",
"output": "8"
},
{
"input": "1000000000 999999999",
"output": "2"
},
{
"input": "100000000000000000 1000000000",
"output": "105572810"
}
] | 1,610,960,663
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 12
| 93
| 0
|
#!/usr/bin/env python3
from sys import stdin
def solve(tc):
n, k = map(int, stdin.readline().split())
if n <= k:
print(1)
return
if k == 2:
print(-1)
return
lo, hi = 0, k-1
while lo < hi:
mid = lo + (hi-lo+1)//2
cum = (k-2+mid-1)*(k-mid)//2
if cum < n-k:
hi = mid - 1
else:
lo = mid
if lo == 0:
print(-1)
return
print(k-lo+1)
tcs = 1
for tc in range(tcs):
solve(tc)
|
Title: Pipeline
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vova, the Ultimate Thule new shaman, wants to build a pipeline. As there are exactly *n* houses in Ultimate Thule, Vova wants the city to have exactly *n* pipes, each such pipe should be connected to the water supply. A pipe can be connected to the water supply if there's water flowing out of it. Initially Vova has only one pipe with flowing water. Besides, Vova has several splitters.
A splitter is a construction that consists of one input (it can be connected to a water pipe) and *x* output pipes. When a splitter is connected to a water pipe, water flows from each output pipe. You can assume that the output pipes are ordinary pipes. For example, you can connect water supply to such pipe if there's water flowing out from it. At most one splitter can be connected to any water pipe.
Vova has one splitter of each kind: with 2, 3, 4, ..., *k* outputs. Help Vova use the minimum number of splitters to build the required pipeline or otherwise state that it's impossible.
Vova needs the pipeline to have exactly *n* pipes with flowing out water. Note that some of those pipes can be the output pipes of the splitters.
Input Specification:
The first line contains two space-separated integers *n* and *k* (1<=≤<=*n*<=≤<=1018, 2<=≤<=*k*<=≤<=109).
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
Output Specification:
Print a single integer — the minimum number of splitters needed to build the pipeline. If it is impossible to build a pipeline with the given splitters, print -1.
Demo Input:
['4 3\n', '5 5\n', '8 4\n']
Demo Output:
['2\n', '1\n', '-1\n']
Note:
none
|
```python
#!/usr/bin/env python3
from sys import stdin
def solve(tc):
n, k = map(int, stdin.readline().split())
if n <= k:
print(1)
return
if k == 2:
print(-1)
return
lo, hi = 0, k-1
while lo < hi:
mid = lo + (hi-lo+1)//2
cum = (k-2+mid-1)*(k-mid)//2
if cum < n-k:
hi = mid - 1
else:
lo = mid
if lo == 0:
print(-1)
return
print(k-lo+1)
tcs = 1
for tc in range(tcs):
solve(tc)
```
| 0
|
|
709
|
A
|
Juicer
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Kolya is going to make fresh orange juice. He has *n* oranges of sizes *a*1,<=*a*2,<=...,<=*a**n*. Kolya will put them in the juicer in the fixed order, starting with orange of size *a*1, then orange of size *a*2 and so on. To be put in the juicer the orange must have size not exceeding *b*, so if Kolya sees an orange that is strictly greater he throws it away and continues with the next one.
The juicer has a special section to collect waste. It overflows if Kolya squeezes oranges of the total size strictly greater than *d*. When it happens Kolya empties the waste section (even if there are no more oranges) and continues to squeeze the juice. How many times will he have to empty the waste section?
|
The first line of the input contains three integers *n*, *b* and *d* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*b*<=≤<=*d*<=≤<=1<=000<=000) — the number of oranges, the maximum size of the orange that fits in the juicer and the value *d*, which determines the condition when the waste section should be emptied.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1<=000<=000) — sizes of the oranges listed in the order Kolya is going to try to put them in the juicer.
|
Print one integer — the number of times Kolya will have to empty the waste section.
|
[
"2 7 10\n5 6\n",
"1 5 10\n7\n",
"3 10 10\n5 7 7\n",
"1 1 1\n1\n"
] |
[
"1\n",
"0\n",
"1\n",
"0\n"
] |
In the first sample, Kolya will squeeze the juice from two oranges and empty the waste section afterwards.
In the second sample, the orange won't fit in the juicer so Kolya will have no juice at all.
| 500
|
[
{
"input": "2 7 10\n5 6",
"output": "1"
},
{
"input": "1 5 10\n7",
"output": "0"
},
{
"input": "3 10 10\n5 7 7",
"output": "1"
},
{
"input": "1 1 1\n1",
"output": "0"
},
{
"input": "2 951637 951638\n44069 951637",
"output": "1"
},
{
"input": "50 100 129\n55 130 91 19 116 3 63 52 104 76 75 27 151 99 149 147 39 148 84 9 132 49 40 112 124 141 144 93 36 32 146 74 48 38 150 55 94 32 107 69 77 81 33 57 62 98 78 127 154 126",
"output": "12"
},
{
"input": "100 1000 1083\n992 616 818 359 609 783 263 989 501 929 362 394 919 1081 870 830 1097 975 62 346 531 367 323 457 707 360 949 334 867 116 478 417 961 963 1029 114 867 1008 988 916 983 1077 959 942 572 961 579 318 721 337 488 717 111 70 416 685 987 130 353 107 61 191 827 849 106 815 211 953 111 398 889 860 801 71 375 320 395 1059 116 222 931 444 582 74 677 655 88 173 686 491 661 186 114 832 615 814 791 464 517 850",
"output": "36"
},
{
"input": "2 6 8\n2 1",
"output": "0"
},
{
"input": "5 15 16\n7 11 5 12 8",
"output": "2"
},
{
"input": "15 759966 759967\n890397 182209 878577 548548 759966 812923 759966 860479 200595 381358 299175 339368 759966 907668 69574",
"output": "4"
},
{
"input": "5 234613 716125\n642626 494941 234613 234613 234613",
"output": "0"
},
{
"input": "50 48547 567054\n529808 597004 242355 559114 78865 537318 631455 733020 655072 645093 309010 855034 306058 625046 524574 834944 27330 664392 443637 821584 338013 490702 289520 675471 885846 258814 134220 571301 84875 94132 200425 928833 375166 521232 317961 175315 947093 89971 322071 174033 48547 998535 954205 704114 943163 438900 48547 538422 48547 48547",
"output": "0"
},
{
"input": "5 10 20\n10 10 10 10 1",
"output": "1"
},
{
"input": "5 10 11\n10 10 10 10 1",
"output": "2"
},
{
"input": "3 10 10\n4 3 3",
"output": "0"
},
{
"input": "3 5 5\n5 5 5",
"output": "1"
},
{
"input": "3 4 14\n5 5 5",
"output": "0"
},
{
"input": "2 7 10\n1234 1234",
"output": "0"
},
{
"input": "1 5 6\n10",
"output": "0"
},
{
"input": "3 4 6\n1 2 3",
"output": "0"
},
{
"input": "5 10 12\n13 13 13 13 13",
"output": "0"
},
{
"input": "3 4 5\n5 7 9",
"output": "0"
},
{
"input": "3 10 100\n5 5 5",
"output": "0"
},
{
"input": "5 1 2\n2 2 2 2 2",
"output": "0"
},
{
"input": "5 5 5\n5 5 5 5 5",
"output": "2"
},
{
"input": "2 2 5\n5 5",
"output": "0"
},
{
"input": "3 1 4\n2 2 2",
"output": "0"
}
] | 1,678,872,696
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 77
| 6,963,200
|
line1 = list(map(int, input().split()))
line2 = list(map(int, input().split()))
num = line1[2]
counter = 0
i = 0
while i < line1[0]-1:
if line2[i] + line2[i+1] > num or i+1 % 2 == 1:
counter += 1
i += 2
print(counter)
|
Title: Juicer
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kolya is going to make fresh orange juice. He has *n* oranges of sizes *a*1,<=*a*2,<=...,<=*a**n*. Kolya will put them in the juicer in the fixed order, starting with orange of size *a*1, then orange of size *a*2 and so on. To be put in the juicer the orange must have size not exceeding *b*, so if Kolya sees an orange that is strictly greater he throws it away and continues with the next one.
The juicer has a special section to collect waste. It overflows if Kolya squeezes oranges of the total size strictly greater than *d*. When it happens Kolya empties the waste section (even if there are no more oranges) and continues to squeeze the juice. How many times will he have to empty the waste section?
Input Specification:
The first line of the input contains three integers *n*, *b* and *d* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*b*<=≤<=*d*<=≤<=1<=000<=000) — the number of oranges, the maximum size of the orange that fits in the juicer and the value *d*, which determines the condition when the waste section should be emptied.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1<=000<=000) — sizes of the oranges listed in the order Kolya is going to try to put them in the juicer.
Output Specification:
Print one integer — the number of times Kolya will have to empty the waste section.
Demo Input:
['2 7 10\n5 6\n', '1 5 10\n7\n', '3 10 10\n5 7 7\n', '1 1 1\n1\n']
Demo Output:
['1\n', '0\n', '1\n', '0\n']
Note:
In the first sample, Kolya will squeeze the juice from two oranges and empty the waste section afterwards.
In the second sample, the orange won't fit in the juicer so Kolya will have no juice at all.
|
```python
line1 = list(map(int, input().split()))
line2 = list(map(int, input().split()))
num = line1[2]
counter = 0
i = 0
while i < line1[0]-1:
if line2[i] + line2[i+1] > num or i+1 % 2 == 1:
counter += 1
i += 2
print(counter)
```
| 0
|
|
11
|
A
|
Increasing Sequence
|
PROGRAMMING
| 900
|
[
"constructive algorithms",
"implementation",
"math"
] |
A. Increasing Sequence
|
1
|
64
|
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
|
The first line of the input contains two integer numbers *n* and *d* (2<=≤<=*n*<=≤<=2000,<=1<=≤<=*d*<=≤<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=≤<=*b**i*<=≤<=106).
|
Output the minimal number of moves needed to make the sequence increasing.
|
[
"4 2\n1 3 3 2\n"
] |
[
"3\n"
] |
none
| 0
|
[
{
"input": "4 2\n1 3 3 2",
"output": "3"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 1\n2 5",
"output": "0"
},
{
"input": "2 1\n1 2",
"output": "0"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 7\n10 20",
"output": "0"
},
{
"input": "2 7\n1 1",
"output": "1"
},
{
"input": "3 3\n18 1 9",
"output": "10"
},
{
"input": "3 3\n15 17 9",
"output": "3"
},
{
"input": "3 3\n10 9 12",
"output": "2"
},
{
"input": "10 3\n2 1 17 10 5 16 8 4 15 17",
"output": "31"
},
{
"input": "10 3\n6 11 4 12 22 15 23 26 24 26",
"output": "13"
},
{
"input": "10 3\n10 24 13 15 18 14 15 26 33 35",
"output": "29"
},
{
"input": "100 3\n529 178 280 403 326 531 671 427 188 866 669 646 421 804 494 609 53 1012 211 243 887 833 900 543 226 42 859 718 454 372 971 692 846 770 511 395 499 479 641 756 115 269 206 45 1039 727 400 779 859 614 146 214 196 919 702 959 380 830 535 878 859 784 316 305 782 924 536 243 236 978 564 150 291 877 808 983 537 839 490 120 168 838 267 650 900 170 211 504 326 771 895 984 994 483 776 100 471 1078 317 580",
"output": "15717"
},
{
"input": "100 3\n329 226 331 909 962 112 837 1005 194 818 506 416 125 648 367 459 400 582 989 547 329 438 234 121 272 226 821 376 834 427 718 164 834 113 654 177 737 212 169 696 744 180 89 944 233 147 667 990 809 1072 1085 1093 814 265 1067 312 833 572 303 901 1032 504 185 817 389 158 613 723 239 269 911 352 769 404 225 822 897 606 947 323 913 804 923 1084 552 901 486 249 209 898 847 610 728 1122 986 669 1116 1076 367 327",
"output": "16133"
}
] | 1,598,711,889
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 25
| 310
| 1,843,200
|
n,d = map(int,input().split())
bi = list(map(int,input().split()))
maxn = bi[0]
ans = 0
for i in range(1,n):
maxn = max(maxn+1,bi[i])
n = (maxn - bi[i])//d + int((maxn - bi[i])% d != 0)
maxn = bi[i] + n * d
ans += n
print(ans)
|
Title: Increasing Sequence
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
Input Specification:
The first line of the input contains two integer numbers *n* and *d* (2<=≤<=*n*<=≤<=2000,<=1<=≤<=*d*<=≤<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=≤<=*b**i*<=≤<=106).
Output Specification:
Output the minimal number of moves needed to make the sequence increasing.
Demo Input:
['4 2\n1 3 3 2\n']
Demo Output:
['3\n']
Note:
none
|
```python
n,d = map(int,input().split())
bi = list(map(int,input().split()))
maxn = bi[0]
ans = 0
for i in range(1,n):
maxn = max(maxn+1,bi[i])
n = (maxn - bi[i])//d + int((maxn - bi[i])% d != 0)
maxn = bi[i] + n * d
ans += n
print(ans)
```
| 3.831267
|
320
|
A
|
Magic Numbers
|
PROGRAMMING
| 900
|
[
"brute force",
"greedy"
] | null | null |
A magic number is a number formed by concatenation of numbers 1, 14 and 144. We can use each of these numbers any number of times. Therefore 14144, 141414 and 1411 are magic numbers but 1444, 514 and 414 are not.
You're given a number. Determine if it is a magic number or not.
|
The first line of input contains an integer *n*, (1<=≤<=*n*<=≤<=109). This number doesn't contain leading zeros.
|
Print "YES" if *n* is a magic number or print "NO" if it's not.
|
[
"114114\n",
"1111\n",
"441231\n"
] |
[
"YES\n",
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "114114",
"output": "YES"
},
{
"input": "1111",
"output": "YES"
},
{
"input": "441231",
"output": "NO"
},
{
"input": "1",
"output": "YES"
},
{
"input": "14",
"output": "YES"
},
{
"input": "114",
"output": "YES"
},
{
"input": "9",
"output": "NO"
},
{
"input": "414",
"output": "NO"
},
{
"input": "1000000000",
"output": "NO"
},
{
"input": "144144144",
"output": "YES"
},
{
"input": "1444",
"output": "NO"
},
{
"input": "11",
"output": "YES"
},
{
"input": "141414141",
"output": "YES"
},
{
"input": "11110111",
"output": "NO"
},
{
"input": "114114144",
"output": "YES"
},
{
"input": "444",
"output": "NO"
},
{
"input": "9999",
"output": "NO"
},
{
"input": "111444",
"output": "NO"
},
{
"input": "11114",
"output": "YES"
},
{
"input": "41111",
"output": "NO"
},
{
"input": "114414441",
"output": "NO"
},
{
"input": "144414441",
"output": "NO"
},
{
"input": "144244144",
"output": "NO"
},
{
"input": "111111111",
"output": "YES"
},
{
"input": "144444444",
"output": "NO"
},
{
"input": "444444444",
"output": "NO"
},
{
"input": "141441441",
"output": "YES"
},
{
"input": "441",
"output": "NO"
},
{
"input": "15",
"output": "NO"
},
{
"input": "14444",
"output": "NO"
},
{
"input": "11444",
"output": "NO"
},
{
"input": "144",
"output": "YES"
},
{
"input": "1414414",
"output": "YES"
},
{
"input": "141444",
"output": "NO"
},
{
"input": "14144",
"output": "YES"
},
{
"input": "4",
"output": "NO"
},
{
"input": "1144",
"output": "YES"
},
{
"input": "141111444",
"output": "NO"
},
{
"input": "14414414",
"output": "YES"
},
{
"input": "141414144",
"output": "YES"
},
{
"input": "1414",
"output": "YES"
},
{
"input": "1441",
"output": "YES"
},
{
"input": "12",
"output": "NO"
},
{
"input": "144144141",
"output": "YES"
},
{
"input": "144144",
"output": "YES"
},
{
"input": "14414411",
"output": "YES"
},
{
"input": "14414",
"output": "YES"
}
] | 1,645,529,775
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 7
| 92
| 0
|
x = input().split("1")
for i in x:
if i != "" and i != "4" and i != "44":
print("NO")
break
else:
print("YES")
|
Title: Magic Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A magic number is a number formed by concatenation of numbers 1, 14 and 144. We can use each of these numbers any number of times. Therefore 14144, 141414 and 1411 are magic numbers but 1444, 514 and 414 are not.
You're given a number. Determine if it is a magic number or not.
Input Specification:
The first line of input contains an integer *n*, (1<=≤<=*n*<=≤<=109). This number doesn't contain leading zeros.
Output Specification:
Print "YES" if *n* is a magic number or print "NO" if it's not.
Demo Input:
['114114\n', '1111\n', '441231\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n']
Note:
none
|
```python
x = input().split("1")
for i in x:
if i != "" and i != "4" and i != "44":
print("NO")
break
else:
print("YES")
```
| 0
|
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,633,865,238
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 2
| 62
| 0
|
s = input()
t = {'h': 1, 'e': 1, 'l': 2, 'o': 1}
v = "YES"
try:
i = s.index('h')
j = 0
while i < len(s):
if j < 4 and s[i] == list(t.keys())[j]:
n = 0
while i < len(s) and s[i] == list(t.keys())[j]:
n += 1
i += 1
if n < t[list(t.keys())[j]]:
raise('Wayeeh')
j += 1
elif j == 4:
break
else:
raise('Wayeeh')
print(v)
except:
print("NO")
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
s = input()
t = {'h': 1, 'e': 1, 'l': 2, 'o': 1}
v = "YES"
try:
i = s.index('h')
j = 0
while i < len(s):
if j < 4 and s[i] == list(t.keys())[j]:
n = 0
while i < len(s) and s[i] == list(t.keys())[j]:
n += 1
i += 1
if n < t[list(t.keys())[j]]:
raise('Wayeeh')
j += 1
elif j == 4:
break
else:
raise('Wayeeh')
print(v)
except:
print("NO")
```
| 0
|
621
|
A
|
Wet Shark and Odd and Even
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Today, Wet Shark is given *n* integers. Using any of these integers no more than once, Wet Shark wants to get maximum possible even (divisible by 2) sum. Please, calculate this value for Wet Shark.
Note, that if Wet Shark uses no integers from the *n* integers, the sum is an even integer 0.
|
The first line of the input contains one integer, *n* (1<=≤<=*n*<=≤<=100<=000). The next line contains *n* space separated integers given to Wet Shark. Each of these integers is in range from 1 to 109, inclusive.
|
Print the maximum possible even sum that can be obtained if we use some of the given integers.
|
[
"3\n1 2 3\n",
"5\n999999999 999999999 999999999 999999999 999999999\n"
] |
[
"6",
"3999999996"
] |
In the first sample, we can simply take all three integers for a total sum of 6.
In the second sample Wet Shark should take any four out of five integers 999 999 999.
| 500
|
[
{
"input": "3\n1 2 3",
"output": "6"
},
{
"input": "5\n999999999 999999999 999999999 999999999 999999999",
"output": "3999999996"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "15\n39 52 88 78 46 95 84 98 55 3 68 42 6 18 98",
"output": "870"
},
{
"input": "15\n59 96 34 48 8 72 67 90 15 85 7 90 97 47 25",
"output": "840"
},
{
"input": "15\n87 37 91 29 58 45 51 74 70 71 47 38 91 89 44",
"output": "922"
},
{
"input": "15\n11 81 49 7 11 14 30 67 29 50 90 81 77 18 59",
"output": "674"
},
{
"input": "15\n39 21 95 89 73 90 9 55 85 32 30 21 68 59 82",
"output": "848"
},
{
"input": "15\n59 70 48 54 26 67 84 39 40 18 77 69 70 88 93",
"output": "902"
},
{
"input": "15\n87 22 98 32 88 36 72 31 100 97 17 16 60 22 20",
"output": "798"
},
{
"input": "15\n15 63 51 13 37 9 43 19 55 79 57 60 50 59 31",
"output": "632"
},
{
"input": "1\n4",
"output": "4"
},
{
"input": "2\n1 4",
"output": "4"
},
{
"input": "3\n1 2 4",
"output": "6"
},
{
"input": "2\n9 3",
"output": "12"
},
{
"input": "2\n1000000000 1001",
"output": "1000000000"
},
{
"input": "3\n1 8 4",
"output": "12"
},
{
"input": "3\n7 4 4",
"output": "8"
},
{
"input": "5\n2 3 4 5 3",
"output": "14"
},
{
"input": "2\n4 5",
"output": "4"
},
{
"input": "3\n2 4 5",
"output": "6"
},
{
"input": "3\n2 2 3",
"output": "4"
},
{
"input": "2\n2 3",
"output": "2"
},
{
"input": "4\n2 3 7 7",
"output": "16"
},
{
"input": "2\n999999999 2",
"output": "2"
},
{
"input": "2\n2 5",
"output": "2"
},
{
"input": "3\n5 3 1",
"output": "8"
},
{
"input": "4\n3 2 5 7",
"output": "14"
}
] | 1,559,292,244
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 8
| 155
| 8,499,200
|
n = int(input())
a = list(map(int, input().split()))
Max, Sum, b = 0, 0, []
for i in range(n):
Sum += a[i]
if Sum % 2 == 0:
Max = max(Max, Sum)
print(Max)
|
Title: Wet Shark and Odd and Even
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Today, Wet Shark is given *n* integers. Using any of these integers no more than once, Wet Shark wants to get maximum possible even (divisible by 2) sum. Please, calculate this value for Wet Shark.
Note, that if Wet Shark uses no integers from the *n* integers, the sum is an even integer 0.
Input Specification:
The first line of the input contains one integer, *n* (1<=≤<=*n*<=≤<=100<=000). The next line contains *n* space separated integers given to Wet Shark. Each of these integers is in range from 1 to 109, inclusive.
Output Specification:
Print the maximum possible even sum that can be obtained if we use some of the given integers.
Demo Input:
['3\n1 2 3\n', '5\n999999999 999999999 999999999 999999999 999999999\n']
Demo Output:
['6', '3999999996']
Note:
In the first sample, we can simply take all three integers for a total sum of 6.
In the second sample Wet Shark should take any four out of five integers 999 999 999.
|
```python
n = int(input())
a = list(map(int, input().split()))
Max, Sum, b = 0, 0, []
for i in range(n):
Sum += a[i]
if Sum % 2 == 0:
Max = max(Max, Sum)
print(Max)
```
| 0
|
|
80
|
A
|
Panoramix's Prediction
|
PROGRAMMING
| 800
|
[
"brute force"
] |
A. Panoramix's Prediction
|
2
|
256
|
A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater than *x*. For example, the next prime number after 2 is 3, and the next prime number after 3 is 5. Note that there is exactly one next prime number after each number. So 5 is not the next prime number for 2.
One cold April morning Panoramix predicted that soon Kakofonix will break free from his straitjacket, and this will be a black day for the residents of the Gallic countryside.
Panoramix's prophecy tells that if some day Asterix and Obelix beat exactly *x* Roman soldiers, where *x* is a prime number, and next day they beat exactly *y* Roman soldiers, where *y* is the next prime number after *x*, then it's time to wait for Armageddon, for nothing can shut Kakofonix up while he sings his infernal song.
Yesterday the Gauls beat *n* Roman soldiers and it turned out that the number *n* was prime! Today their victims were a troop of *m* Romans (*m*<=><=*n*). Determine whether the Gauls should wait for the black day after today's victory of Asterix and Obelix?
|
The first and only input line contains two positive integers — *n* and *m* (2<=≤<=*n*<=<<=*m*<=≤<=50). It is guaranteed that *n* is prime.
Pretests contain all the cases with restrictions 2<=≤<=*n*<=<<=*m*<=≤<=4.
|
Print YES, if *m* is the next prime number after *n*, or NO otherwise.
|
[
"3 5\n",
"7 11\n",
"7 9\n"
] |
[
"YES",
"YES",
"NO"
] |
none
| 500
|
[
{
"input": "3 5",
"output": "YES"
},
{
"input": "7 11",
"output": "YES"
},
{
"input": "7 9",
"output": "NO"
},
{
"input": "2 3",
"output": "YES"
},
{
"input": "2 4",
"output": "NO"
},
{
"input": "3 4",
"output": "NO"
},
{
"input": "3 5",
"output": "YES"
},
{
"input": "5 7",
"output": "YES"
},
{
"input": "7 11",
"output": "YES"
},
{
"input": "11 13",
"output": "YES"
},
{
"input": "13 17",
"output": "YES"
},
{
"input": "17 19",
"output": "YES"
},
{
"input": "19 23",
"output": "YES"
},
{
"input": "23 29",
"output": "YES"
},
{
"input": "29 31",
"output": "YES"
},
{
"input": "31 37",
"output": "YES"
},
{
"input": "37 41",
"output": "YES"
},
{
"input": "41 43",
"output": "YES"
},
{
"input": "43 47",
"output": "YES"
},
{
"input": "2 5",
"output": "NO"
},
{
"input": "2 7",
"output": "NO"
},
{
"input": "2 6",
"output": "NO"
},
{
"input": "2 11",
"output": "NO"
},
{
"input": "3 6",
"output": "NO"
},
{
"input": "3 7",
"output": "NO"
},
{
"input": "3 9",
"output": "NO"
},
{
"input": "5 6",
"output": "NO"
},
{
"input": "5 9",
"output": "NO"
},
{
"input": "5 11",
"output": "NO"
},
{
"input": "5 13",
"output": "NO"
},
{
"input": "5 15",
"output": "NO"
},
{
"input": "7 8",
"output": "NO"
},
{
"input": "7 13",
"output": "NO"
},
{
"input": "13 15",
"output": "NO"
},
{
"input": "13 17",
"output": "YES"
},
{
"input": "19 21",
"output": "NO"
},
{
"input": "13 20",
"output": "NO"
},
{
"input": "41 49",
"output": "NO"
},
{
"input": "43 49",
"output": "NO"
},
{
"input": "47 50",
"output": "NO"
},
{
"input": "47 49",
"output": "NO"
},
{
"input": "47 48",
"output": "NO"
},
{
"input": "23 25",
"output": "NO"
},
{
"input": "2 50",
"output": "NO"
},
{
"input": "31 33",
"output": "NO"
}
] | 1,652,515,834
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 45
| 124
| 0
|
ls = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
if m == n:
print('NO')
elif m < n:
print('NO')
else:
if n in ls and m in ls:
x = ls.index(n)
y = ls.index(m)
if y - x == 1:
print('YES')
else:
print('NO')
else:
print('NO')
|
Title: Panoramix's Prediction
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater than *x*. For example, the next prime number after 2 is 3, and the next prime number after 3 is 5. Note that there is exactly one next prime number after each number. So 5 is not the next prime number for 2.
One cold April morning Panoramix predicted that soon Kakofonix will break free from his straitjacket, and this will be a black day for the residents of the Gallic countryside.
Panoramix's prophecy tells that if some day Asterix and Obelix beat exactly *x* Roman soldiers, where *x* is a prime number, and next day they beat exactly *y* Roman soldiers, where *y* is the next prime number after *x*, then it's time to wait for Armageddon, for nothing can shut Kakofonix up while he sings his infernal song.
Yesterday the Gauls beat *n* Roman soldiers and it turned out that the number *n* was prime! Today their victims were a troop of *m* Romans (*m*<=><=*n*). Determine whether the Gauls should wait for the black day after today's victory of Asterix and Obelix?
Input Specification:
The first and only input line contains two positive integers — *n* and *m* (2<=≤<=*n*<=<<=*m*<=≤<=50). It is guaranteed that *n* is prime.
Pretests contain all the cases with restrictions 2<=≤<=*n*<=<<=*m*<=≤<=4.
Output Specification:
Print YES, if *m* is the next prime number after *n*, or NO otherwise.
Demo Input:
['3 5\n', '7 11\n', '7 9\n']
Demo Output:
['YES', 'YES', 'NO']
Note:
none
|
```python
ls = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
if m == n:
print('NO')
elif m < n:
print('NO')
else:
if n in ls and m in ls:
x = ls.index(n)
y = ls.index(m)
if y - x == 1:
print('YES')
else:
print('NO')
else:
print('NO')
```
| 3.969
|
199
|
A
|
Hexadecimal's theorem
|
PROGRAMMING
| 900
|
[
"brute force",
"constructive algorithms",
"implementation",
"number theory"
] | null | null |
Recently, a chaotic virus Hexadecimal advanced a new theorem which will shake the Universe. She thinks that each Fibonacci number can be represented as sum of three not necessary different Fibonacci numbers.
Let's remember how Fibonacci numbers can be calculated. *F*0<==<=0, *F*1<==<=1, and all the next numbers are *F**i*<==<=*F**i*<=-<=2<=+<=*F**i*<=-<=1.
So, Fibonacci numbers make a sequence of numbers: 0, 1, 1, 2, 3, 5, 8, 13, ...
If you haven't run away from the PC in fear, you have to help the virus. Your task is to divide given Fibonacci number *n* by three not necessary different Fibonacci numbers or say that it is impossible.
|
The input contains of a single integer *n* (0<=≤<=*n*<=<<=109) — the number that should be represented by the rules described above. It is guaranteed that *n* is a Fibonacci number.
|
Output three required numbers: *a*, *b* and *c*. If there is no answer for the test you have to print "I'm too stupid to solve this problem" without the quotes.
If there are multiple answers, print any of them.
|
[
"3\n",
"13\n"
] |
[
"1 1 1\n",
"2 3 8\n"
] |
none
| 500
|
[
{
"input": "3",
"output": "1 1 1"
},
{
"input": "13",
"output": "2 3 8"
},
{
"input": "0",
"output": "0 0 0"
},
{
"input": "1",
"output": "1 0 0"
},
{
"input": "2",
"output": "1 1 0"
},
{
"input": "1597",
"output": "233 377 987"
},
{
"input": "0",
"output": "0 0 0"
},
{
"input": "1",
"output": "1 0 0"
},
{
"input": "1",
"output": "1 0 0"
},
{
"input": "2",
"output": "1 1 0"
},
{
"input": "3",
"output": "1 1 1"
},
{
"input": "5",
"output": "1 1 3"
},
{
"input": "8",
"output": "1 2 5"
},
{
"input": "13",
"output": "2 3 8"
},
{
"input": "21",
"output": "3 5 13"
},
{
"input": "34",
"output": "5 8 21"
},
{
"input": "55",
"output": "8 13 34"
},
{
"input": "89",
"output": "13 21 55"
},
{
"input": "144",
"output": "21 34 89"
},
{
"input": "233",
"output": "34 55 144"
},
{
"input": "377",
"output": "55 89 233"
},
{
"input": "610",
"output": "89 144 377"
},
{
"input": "987",
"output": "144 233 610"
},
{
"input": "1597",
"output": "233 377 987"
},
{
"input": "2584",
"output": "377 610 1597"
},
{
"input": "4181",
"output": "610 987 2584"
},
{
"input": "6765",
"output": "987 1597 4181"
},
{
"input": "10946",
"output": "1597 2584 6765"
},
{
"input": "17711",
"output": "2584 4181 10946"
},
{
"input": "28657",
"output": "4181 6765 17711"
},
{
"input": "46368",
"output": "6765 10946 28657"
},
{
"input": "75025",
"output": "10946 17711 46368"
},
{
"input": "121393",
"output": "17711 28657 75025"
},
{
"input": "196418",
"output": "28657 46368 121393"
},
{
"input": "317811",
"output": "46368 75025 196418"
},
{
"input": "514229",
"output": "75025 121393 317811"
},
{
"input": "832040",
"output": "121393 196418 514229"
},
{
"input": "1346269",
"output": "196418 317811 832040"
},
{
"input": "2178309",
"output": "317811 514229 1346269"
},
{
"input": "3524578",
"output": "514229 832040 2178309"
},
{
"input": "5702887",
"output": "832040 1346269 3524578"
},
{
"input": "9227465",
"output": "1346269 2178309 5702887"
},
{
"input": "14930352",
"output": "2178309 3524578 9227465"
},
{
"input": "24157817",
"output": "3524578 5702887 14930352"
},
{
"input": "39088169",
"output": "5702887 9227465 24157817"
},
{
"input": "63245986",
"output": "9227465 14930352 39088169"
},
{
"input": "102334155",
"output": "14930352 24157817 63245986"
},
{
"input": "165580141",
"output": "24157817 39088169 102334155"
},
{
"input": "267914296",
"output": "39088169 63245986 165580141"
},
{
"input": "433494437",
"output": "63245986 102334155 267914296"
},
{
"input": "701408733",
"output": "102334155 165580141 433494437"
},
{
"input": "701408733",
"output": "102334155 165580141 433494437"
},
{
"input": "102334155",
"output": "14930352 24157817 63245986"
},
{
"input": "63245986",
"output": "9227465 14930352 39088169"
}
] | 1,595,053,279
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 2
| 280
| 20,172,800
|
n = int(input())
fibo = [0,1]
while(fibo[-1]<n):
fibo.append(fibo[-1]+fibo[-2])
t = fibo.index(fibo[-1])
if n>2:
print(fibo[t-4],fibo[t-3],fibo[t-1])
else:
print("I'm too stupid to solve this problem")
|
Title: Hexadecimal's theorem
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently, a chaotic virus Hexadecimal advanced a new theorem which will shake the Universe. She thinks that each Fibonacci number can be represented as sum of three not necessary different Fibonacci numbers.
Let's remember how Fibonacci numbers can be calculated. *F*0<==<=0, *F*1<==<=1, and all the next numbers are *F**i*<==<=*F**i*<=-<=2<=+<=*F**i*<=-<=1.
So, Fibonacci numbers make a sequence of numbers: 0, 1, 1, 2, 3, 5, 8, 13, ...
If you haven't run away from the PC in fear, you have to help the virus. Your task is to divide given Fibonacci number *n* by three not necessary different Fibonacci numbers or say that it is impossible.
Input Specification:
The input contains of a single integer *n* (0<=≤<=*n*<=<<=109) — the number that should be represented by the rules described above. It is guaranteed that *n* is a Fibonacci number.
Output Specification:
Output three required numbers: *a*, *b* and *c*. If there is no answer for the test you have to print "I'm too stupid to solve this problem" without the quotes.
If there are multiple answers, print any of them.
Demo Input:
['3\n', '13\n']
Demo Output:
['1 1 1\n', '2 3 8\n']
Note:
none
|
```python
n = int(input())
fibo = [0,1]
while(fibo[-1]<n):
fibo.append(fibo[-1]+fibo[-2])
t = fibo.index(fibo[-1])
if n>2:
print(fibo[t-4],fibo[t-3],fibo[t-1])
else:
print("I'm too stupid to solve this problem")
```
| 0
|
|
466
|
C
|
Number of Ways
|
PROGRAMMING
| 1,700
|
[
"binary search",
"brute force",
"data structures",
"dp",
"two pointers"
] | null | null |
You've got array *a*[1],<=*a*[2],<=...,<=*a*[*n*], consisting of *n* integers. Count the number of ways to split all the elements of the array into three contiguous parts so that the sum of elements in each part is the same.
More formally, you need to find the number of such pairs of indices *i*,<=*j* (2<=≤<=*i*<=≤<=*j*<=≤<=*n*<=-<=1), that .
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=5·105), showing how many numbers are in the array. The second line contains *n* integers *a*[1], *a*[2], ..., *a*[*n*] (|*a*[*i*]|<=≤<=<=109) — the elements of array *a*.
|
Print a single integer — the number of ways to split the array into three parts with the same sum.
|
[
"5\n1 2 3 0 3\n",
"4\n0 1 -1 0\n",
"2\n4 1\n"
] |
[
"2\n",
"1\n",
"0\n"
] |
none
| 1,500
|
[
{
"input": "5\n1 2 3 0 3",
"output": "2"
},
{
"input": "4\n0 1 -1 0",
"output": "1"
},
{
"input": "2\n4 1",
"output": "0"
},
{
"input": "9\n0 0 0 0 0 0 0 0 0",
"output": "28"
},
{
"input": "10\n2 5 -2 2 -3 -2 3 5 -5 -2",
"output": "0"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "3\n1 2 3",
"output": "0"
},
{
"input": "100\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1",
"output": "2030"
},
{
"input": "6\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "10\n1 0 0 0 1 1 1 0 1 1",
"output": "2"
},
{
"input": "10\n-2 2 -2 0 -2 -1 1 -1 2 0",
"output": "0"
},
{
"input": "4\n0 2 -1 2",
"output": "0"
},
{
"input": "5\n3 3 -3 3 3",
"output": "3"
},
{
"input": "5\n1 1 1 1 1",
"output": "0"
},
{
"input": "8\n-1 -1 -1 -1 -1 -1 -1 -1",
"output": "0"
},
{
"input": "2\n0 0",
"output": "0"
},
{
"input": "4\n1 -1 0 0",
"output": "1"
},
{
"input": "3\n6 -3 6",
"output": "0"
}
] | 1,699,580,934
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 358
| 62,361,600
|
N=int(input())
arr=list(map(int,input().split()))
s=sum(arr)
if s%3!=0:
print('0')
else:
s=s//3
L=count=0
tot=arr[0]
for i in arr[1:]:
if tot == s*2:
count+=L
if tot == s:
L+=1
tot+=i
print(count)
|
Title: Number of Ways
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got array *a*[1],<=*a*[2],<=...,<=*a*[*n*], consisting of *n* integers. Count the number of ways to split all the elements of the array into three contiguous parts so that the sum of elements in each part is the same.
More formally, you need to find the number of such pairs of indices *i*,<=*j* (2<=≤<=*i*<=≤<=*j*<=≤<=*n*<=-<=1), that .
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=5·105), showing how many numbers are in the array. The second line contains *n* integers *a*[1], *a*[2], ..., *a*[*n*] (|*a*[*i*]|<=≤<=<=109) — the elements of array *a*.
Output Specification:
Print a single integer — the number of ways to split the array into three parts with the same sum.
Demo Input:
['5\n1 2 3 0 3\n', '4\n0 1 -1 0\n', '2\n4 1\n']
Demo Output:
['2\n', '1\n', '0\n']
Note:
none
|
```python
N=int(input())
arr=list(map(int,input().split()))
s=sum(arr)
if s%3!=0:
print('0')
else:
s=s//3
L=count=0
tot=arr[0]
for i in arr[1:]:
if tot == s*2:
count+=L
if tot == s:
L+=1
tot+=i
print(count)
```
| 3
|
|
387
|
B
|
George and Round
|
PROGRAMMING
| 1,200
|
[
"brute force",
"greedy",
"two pointers"
] | null | null |
George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
To make the round good, he needs to put at least *n* problems there. Besides, he needs to have at least one problem with complexity exactly *a*1, at least one with complexity exactly *a*2, ..., and at least one with complexity exactly *a**n*. Of course, the round can also have problems with other complexities.
George has a poor imagination. It's easier for him to make some already prepared problem simpler than to come up with a new one and prepare it. George is magnificent at simplifying problems. He can simplify any already prepared problem with complexity *c* to any positive integer complexity *d* (*c*<=≥<=*d*), by changing limits on the input data.
However, nothing is so simple. George understood that even if he simplifies some problems, he can run out of problems for a good round. That's why he decided to find out the minimum number of problems he needs to come up with in addition to the *m* he's prepared in order to make a good round. Note that George can come up with a new problem of any complexity.
|
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=3000) — the minimal number of problems in a good round and the number of problems George's prepared. The second line contains space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*<=≤<=106) — the requirements for the complexity of the problems in a good round. The third line contains space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b*1<=≤<=*b*2...<=≤<=*b**m*<=≤<=106) — the complexities of the problems prepared by George.
|
Print a single integer — the answer to the problem.
|
[
"3 5\n1 2 3\n1 2 2 3 3\n",
"3 5\n1 2 3\n1 1 1 1 1\n",
"3 1\n2 3 4\n1\n"
] |
[
"0\n",
"2\n",
"3\n"
] |
In the first sample the set of the prepared problems meets the requirements for a good round.
In the second sample, it is enough to come up with and prepare two problems with complexities 2 and 3 to get a good round.
In the third sample it is very easy to get a good round if come up with and prepare extra problems with complexities: 2, 3, 4.
| 1,000
|
[
{
"input": "3 5\n1 2 3\n1 2 2 3 3",
"output": "0"
},
{
"input": "3 5\n1 2 3\n1 1 1 1 1",
"output": "2"
},
{
"input": "3 1\n2 3 4\n1",
"output": "3"
},
{
"input": "29 100\n20 32 41 67 72 155 331 382 399 412 465 470 484 511 515 529 616 637 679 715 733 763 826 843 862 903 925 979 989\n15 15 15 17 18 19 19 20 21 21 22 24 25 26 26 27 28 31 32 32 37 38 38 39 39 40 41 42 43 43 45 45 46 47 49 49 50 50 50 51 52 53 53 55 56 57 59 59 59 60 60 62 62 63 63 64 64 64 66 67 69 69 70 70 72 72 73 74 75 76 77 78 80 80 81 81 83 83 83 84 86 86 86 86 87 88 89 91 91 91 92 93 94 94 96 97 97 97 98 98",
"output": "24"
}
] | 1,606,040,105
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 41
| 109
| 614,400
|
[n, m] = list(map(int, input().split()))
a = list(map(int, input().split()))[:n]
b = list(map(int, input().split()))[:m]
result = 0
j = 0
for i in range(n):
while(j < m):
if(a[i] <= b[j]):
result = result + 1
j = j + 1
break
j = j + 1
print(n - result)
|
Title: George and Round
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
To make the round good, he needs to put at least *n* problems there. Besides, he needs to have at least one problem with complexity exactly *a*1, at least one with complexity exactly *a*2, ..., and at least one with complexity exactly *a**n*. Of course, the round can also have problems with other complexities.
George has a poor imagination. It's easier for him to make some already prepared problem simpler than to come up with a new one and prepare it. George is magnificent at simplifying problems. He can simplify any already prepared problem with complexity *c* to any positive integer complexity *d* (*c*<=≥<=*d*), by changing limits on the input data.
However, nothing is so simple. George understood that even if he simplifies some problems, he can run out of problems for a good round. That's why he decided to find out the minimum number of problems he needs to come up with in addition to the *m* he's prepared in order to make a good round. Note that George can come up with a new problem of any complexity.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=3000) — the minimal number of problems in a good round and the number of problems George's prepared. The second line contains space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*<=≤<=106) — the requirements for the complexity of the problems in a good round. The third line contains space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=≤<=*b*1<=≤<=*b*2...<=≤<=*b**m*<=≤<=106) — the complexities of the problems prepared by George.
Output Specification:
Print a single integer — the answer to the problem.
Demo Input:
['3 5\n1 2 3\n1 2 2 3 3\n', '3 5\n1 2 3\n1 1 1 1 1\n', '3 1\n2 3 4\n1\n']
Demo Output:
['0\n', '2\n', '3\n']
Note:
In the first sample the set of the prepared problems meets the requirements for a good round.
In the second sample, it is enough to come up with and prepare two problems with complexities 2 and 3 to get a good round.
In the third sample it is very easy to get a good round if come up with and prepare extra problems with complexities: 2, 3, 4.
|
```python
[n, m] = list(map(int, input().split()))
a = list(map(int, input().split()))[:n]
b = list(map(int, input().split()))[:m]
result = 0
j = 0
for i in range(n):
while(j < m):
if(a[i] <= b[j]):
result = result + 1
j = j + 1
break
j = j + 1
print(n - result)
```
| 3
|
|
107
|
A
|
Dorm Water Supply
|
PROGRAMMING
| 1,400
|
[
"dfs and similar",
"graphs"
] |
A. Dorm Water Supply
|
1
|
256
|
The German University in Cairo (GUC) dorm houses are numbered from 1 to *n*. Underground water pipes connect these houses together. Each pipe has certain direction (water can flow only in this direction and not vice versa), and diameter (which characterizes the maximal amount of water it can handle).
For each house, there is at most one pipe going into it and at most one pipe going out of it. With the new semester starting, GUC student and dorm resident, Lulu, wants to install tanks and taps at the dorms. For every house with an outgoing water pipe and without an incoming water pipe, Lulu should install a water tank at that house. For every house with an incoming water pipe and without an outgoing water pipe, Lulu should install a water tap at that house. Each tank house will convey water to all houses that have a sequence of pipes from the tank to it. Accordingly, each tap house will receive water originating from some tank house.
In order to avoid pipes from bursting one week later (like what happened last semester), Lulu also has to consider the diameter of the pipes. The amount of water each tank conveys should not exceed the diameter of the pipes connecting a tank to its corresponding tap. Lulu wants to find the maximal amount of water that can be safely conveyed from each tank to its corresponding tap.
|
The first line contains two space-separated integers *n* and *p* (1<=≤<=*n*<=≤<=1000,<=0<=≤<=*p*<=≤<=*n*) — the number of houses and the number of pipes correspondingly.
Then *p* lines follow — the description of *p* pipes. The *i*-th line contains three integers *a**i* *b**i* *d**i*, indicating a pipe of diameter *d**i* going from house *a**i* to house *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*,<=*a**i*<=≠<=*b**i*,<=1<=≤<=*d**i*<=≤<=106).
It is guaranteed that for each house there is at most one pipe going into it and at most one pipe going out of it.
|
Print integer *t* in the first line — the number of tank-tap pairs of houses.
For the next *t* lines, print 3 integers per line, separated by spaces: *tank**i*, *tap**i*, and *diameter**i*, where *tank**i*<=≠<=*tap**i* (1<=≤<=*i*<=≤<=*t*). Here *tank**i* and *tap**i* are indexes of tank and tap houses respectively, and *diameter**i* is the maximum amount of water that can be conveyed. All the *t* lines should be ordered (increasingly) by *tank**i*.
|
[
"3 2\n1 2 10\n2 3 20\n",
"3 3\n1 2 20\n2 3 10\n3 1 5\n",
"4 2\n1 2 60\n3 4 50\n"
] |
[
"1\n1 3 10\n",
"0\n",
"2\n1 2 60\n3 4 50\n"
] |
none
| 500
|
[
{
"input": "3 2\n1 2 10\n2 3 20",
"output": "1\n1 3 10"
},
{
"input": "3 3\n1 2 20\n2 3 10\n3 1 5",
"output": "0"
},
{
"input": "4 2\n1 2 60\n3 4 50",
"output": "2\n1 2 60\n3 4 50"
},
{
"input": "10 10\n10 3 70\n1 9 98\n9 10 67\n5 2 78\n8 6 71\n4 8 95\n7 1 10\n2 5 73\n6 7 94\n3 4 23",
"output": "0"
},
{
"input": "7 5\n3 2 26\n4 6 84\n6 3 82\n5 1 57\n1 7 34",
"output": "2\n4 2 26\n5 7 34"
},
{
"input": "9 6\n7 4 98\n5 9 72\n4 6 10\n2 8 22\n9 7 17\n3 1 66",
"output": "3\n2 8 22\n3 1 66\n5 6 10"
},
{
"input": "8 6\n1 3 84\n8 4 34\n7 2 10\n6 8 8\n3 5 39\n2 7 8",
"output": "2\n1 5 39\n6 4 8"
},
{
"input": "10 8\n2 3 49\n4 8 26\n5 2 76\n3 5 94\n1 7 16\n10 9 77\n6 4 24\n7 1 7",
"output": "2\n6 8 24\n10 9 77"
},
{
"input": "6 5\n2 6 47\n3 4 27\n5 2 47\n4 1 62\n1 5 61",
"output": "1\n3 6 27"
},
{
"input": "5 4\n5 2 9\n4 1 94\n3 5 82\n2 3 58",
"output": "1\n4 1 94"
},
{
"input": "1000 0",
"output": "0"
},
{
"input": "2 2\n1 2 1\n2 1 1",
"output": "0"
},
{
"input": "44 42\n4 37 166\n34 25 47\n28 19 367\n20 14 811\n8 3 878\n39 1 925\n35 9 206\n32 18 841\n16 44 503\n5 20 426\n22 34 896\n44 43 471\n17 33 577\n40 22 317\n24 31 818\n37 11 292\n21 39 888\n6 8 983\n43 36 170\n11 21 662\n36 17 942\n18 7 356\n2 32 220\n12 5 774\n19 27 193\n13 40 63\n15 10 510\n30 35 869\n41 24 736\n42 4 180\n23 41 261\n9 28 501\n29 15 983\n10 30 638\n7 13 402\n26 12 754\n25 6 597\n27 29 57\n1 16 933\n31 42 135\n33 38 718\n14 23 361",
"output": "2\n2 3 47\n26 38 135"
},
{
"input": "35 33\n22 7 978\n5 6 566\n20 10 198\n6 17 170\n7 27 627\n24 19 659\n31 30 130\n34 8 365\n23 12 716\n4 29 217\n8 20 156\n26 35 142\n3 2 419\n15 1 448\n17 24 91\n18 33 962\n30 22 822\n9 16 847\n2 9 470\n10 25 981\n16 31 359\n19 28 283\n28 34 199\n11 5 660\n25 23 176\n29 18 235\n12 14 765\n14 11 81\n27 21 61\n21 13 651\n35 3 583\n1 32 767\n13 4 256",
"output": "2\n15 32 448\n26 33 61"
},
{
"input": "33 28\n12 15 574\n11 13 714\n13 33 62\n9 28 391\n22 19 235\n6 20 655\n23 9 25\n8 29 994\n21 30 133\n17 18 170\n32 7 470\n14 21 418\n7 31 431\n3 1 185\n1 14 538\n33 12 250\n31 22 694\n2 27 945\n16 26 584\n19 32 317\n27 2 904\n15 25 748\n29 3 754\n24 4 287\n18 10 775\n30 11 401\n10 8 653\n28 5 70",
"output": "5\n6 20 655\n16 26 584\n17 25 62\n23 5 25\n24 4 287"
},
{
"input": "3 1\n1 2 10",
"output": "1\n1 2 10"
},
{
"input": "1 0",
"output": "0"
},
{
"input": "2 0",
"output": "0"
},
{
"input": "3 0",
"output": "0"
}
] | 1,652,040,438
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 10
| 62
| 2,252,800
|
def dfs(g, s, mn):
if g.get(s, -1) == -1:
return s, mn
if sizes[s] < mn or mn == -1:
mn = sizes[s]
return dfs(g, g[s], mn)
n, p = map(int, input().split())
in_links = dict()
links = dict()
sizes = dict()
for i in range(n):
in_links[i + 1] = -1
for i in range(p):
a, b, d = map(int, input().split())
in_links[b] = a
links[a] = b
if a not in sizes or d < sizes[a]:
sizes[a] = d
if b not in sizes or d < sizes[b]:
sizes[b] = d
res = []
for k, v in in_links.items():
if v == -1:
a, b = dfs(links, k, -1)
res.append((k, a, b, ))
print(len(res))
print('\n'.join([' '.join(map(str, tup)) for tup in res]))
|
Title: Dorm Water Supply
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
The German University in Cairo (GUC) dorm houses are numbered from 1 to *n*. Underground water pipes connect these houses together. Each pipe has certain direction (water can flow only in this direction and not vice versa), and diameter (which characterizes the maximal amount of water it can handle).
For each house, there is at most one pipe going into it and at most one pipe going out of it. With the new semester starting, GUC student and dorm resident, Lulu, wants to install tanks and taps at the dorms. For every house with an outgoing water pipe and without an incoming water pipe, Lulu should install a water tank at that house. For every house with an incoming water pipe and without an outgoing water pipe, Lulu should install a water tap at that house. Each tank house will convey water to all houses that have a sequence of pipes from the tank to it. Accordingly, each tap house will receive water originating from some tank house.
In order to avoid pipes from bursting one week later (like what happened last semester), Lulu also has to consider the diameter of the pipes. The amount of water each tank conveys should not exceed the diameter of the pipes connecting a tank to its corresponding tap. Lulu wants to find the maximal amount of water that can be safely conveyed from each tank to its corresponding tap.
Input Specification:
The first line contains two space-separated integers *n* and *p* (1<=≤<=*n*<=≤<=1000,<=0<=≤<=*p*<=≤<=*n*) — the number of houses and the number of pipes correspondingly.
Then *p* lines follow — the description of *p* pipes. The *i*-th line contains three integers *a**i* *b**i* *d**i*, indicating a pipe of diameter *d**i* going from house *a**i* to house *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*,<=*a**i*<=≠<=*b**i*,<=1<=≤<=*d**i*<=≤<=106).
It is guaranteed that for each house there is at most one pipe going into it and at most one pipe going out of it.
Output Specification:
Print integer *t* in the first line — the number of tank-tap pairs of houses.
For the next *t* lines, print 3 integers per line, separated by spaces: *tank**i*, *tap**i*, and *diameter**i*, where *tank**i*<=≠<=*tap**i* (1<=≤<=*i*<=≤<=*t*). Here *tank**i* and *tap**i* are indexes of tank and tap houses respectively, and *diameter**i* is the maximum amount of water that can be conveyed. All the *t* lines should be ordered (increasingly) by *tank**i*.
Demo Input:
['3 2\n1 2 10\n2 3 20\n', '3 3\n1 2 20\n2 3 10\n3 1 5\n', '4 2\n1 2 60\n3 4 50\n']
Demo Output:
['1\n1 3 10\n', '0\n', '2\n1 2 60\n3 4 50\n']
Note:
none
|
```python
def dfs(g, s, mn):
if g.get(s, -1) == -1:
return s, mn
if sizes[s] < mn or mn == -1:
mn = sizes[s]
return dfs(g, g[s], mn)
n, p = map(int, input().split())
in_links = dict()
links = dict()
sizes = dict()
for i in range(n):
in_links[i + 1] = -1
for i in range(p):
a, b, d = map(int, input().split())
in_links[b] = a
links[a] = b
if a not in sizes or d < sizes[a]:
sizes[a] = d
if b not in sizes or d < sizes[b]:
sizes[b] = d
res = []
for k, v in in_links.items():
if v == -1:
a, b = dfs(links, k, -1)
res.append((k, a, b, ))
print(len(res))
print('\n'.join([' '.join(map(str, tup)) for tup in res]))
```
| 0
|
219
|
A
|
k-String
|
PROGRAMMING
| 1,000
|
[
"implementation",
"strings"
] | null | null |
A string is called a *k*-string if it can be represented as *k* concatenated copies of some string. For example, the string "aabaabaabaab" is at the same time a 1-string, a 2-string and a 4-string, but it is not a 3-string, a 5-string, or a 6-string and so on. Obviously any string is a 1-string.
You are given a string *s*, consisting of lowercase English letters and a positive integer *k*. Your task is to reorder the letters in the string *s* in such a way that the resulting string is a *k*-string.
|
The first input line contains integer *k* (1<=≤<=*k*<=≤<=1000). The second line contains *s*, all characters in *s* are lowercase English letters. The string length *s* satisfies the inequality 1<=≤<=|*s*|<=≤<=1000, where |*s*| is the length of string *s*.
|
Rearrange the letters in string *s* in such a way that the result is a *k*-string. Print the result on a single output line. If there are multiple solutions, print any of them.
If the solution doesn't exist, print "-1" (without quotes).
|
[
"2\naazz\n",
"3\nabcabcabz\n"
] |
[
"azaz\n",
"-1\n"
] |
none
| 500
|
[
{
"input": "2\naazz",
"output": "azaz"
},
{
"input": "3\nabcabcabz",
"output": "-1"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "2\nabba",
"output": "abab"
},
{
"input": "2\naaab",
"output": "-1"
},
{
"input": "7\nabacaba",
"output": "-1"
},
{
"input": "5\naaaaa",
"output": "aaaaa"
},
{
"input": "3\naabaaaaabb",
"output": "-1"
},
{
"input": "2\naaab",
"output": "-1"
},
{
"input": "2\nbabac",
"output": "-1"
},
{
"input": "3\nbbbccc",
"output": "bcbcbc"
},
{
"input": "2\naa",
"output": "aa"
},
{
"input": "250\ncececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececece",
"output": "cececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececececece"
},
{
"input": "15\nabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaaabaabbbcababaaa",
"output": "aaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbcaaaaaaaabbbbbbc"
},
{
"input": "1\naaa",
"output": "aaa"
},
{
"input": "1\naabaab",
"output": "aaaabb"
},
{
"input": "2\naabbbbccccccdddddddd",
"output": "abbcccddddabbcccdddd"
},
{
"input": "3\naaaaaaaaacccdddddd",
"output": "aaacddaaacddaaacdd"
},
{
"input": "3\naaaaaaaaacccbbbbbb",
"output": "aaabbcaaabbcaaabbc"
},
{
"input": "2\naazzzz",
"output": "azzazz"
},
{
"input": "2\naaaa",
"output": "aaaa"
},
{
"input": "2\naaaazz",
"output": "aazaaz"
},
{
"input": "2\naaaabb",
"output": "aabaab"
},
{
"input": "2\naabbbb",
"output": "abbabb"
},
{
"input": "2\naaaazzzz",
"output": "aazzaazz"
},
{
"input": "2\naaazz",
"output": "-1"
},
{
"input": "2\nbbbbaa",
"output": "abbabb"
},
{
"input": "2\naaaaaabbbb",
"output": "aaabbaaabb"
},
{
"input": "2\naaaaaazz",
"output": "aaazaaaz"
},
{
"input": "2\naaaabbbb",
"output": "aabbaabb"
},
{
"input": "2\naabaab",
"output": "aabaab"
},
{
"input": "1\naaaaa",
"output": "aaaaa"
},
{
"input": "2\nbbaaaa",
"output": "aabaab"
},
{
"input": "2\nacaccc",
"output": "accacc"
}
] | 1,668,081,012
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 1
| 62
| 0
|
k = int(input())
a = input()
b=""
l = len(a)
h=l//k
j=0
if(l%k!=0):
print(-1)
else:
while(j<k):
for i in range(0,h):
if(k*i > l):
break
else:
# print(b)
b=b+ a[k*i]
j=j+1
print(b)
|
Title: k-String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A string is called a *k*-string if it can be represented as *k* concatenated copies of some string. For example, the string "aabaabaabaab" is at the same time a 1-string, a 2-string and a 4-string, but it is not a 3-string, a 5-string, or a 6-string and so on. Obviously any string is a 1-string.
You are given a string *s*, consisting of lowercase English letters and a positive integer *k*. Your task is to reorder the letters in the string *s* in such a way that the resulting string is a *k*-string.
Input Specification:
The first input line contains integer *k* (1<=≤<=*k*<=≤<=1000). The second line contains *s*, all characters in *s* are lowercase English letters. The string length *s* satisfies the inequality 1<=≤<=|*s*|<=≤<=1000, where |*s*| is the length of string *s*.
Output Specification:
Rearrange the letters in string *s* in such a way that the result is a *k*-string. Print the result on a single output line. If there are multiple solutions, print any of them.
If the solution doesn't exist, print "-1" (without quotes).
Demo Input:
['2\naazz\n', '3\nabcabcabz\n']
Demo Output:
['azaz\n', '-1\n']
Note:
none
|
```python
k = int(input())
a = input()
b=""
l = len(a)
h=l//k
j=0
if(l%k!=0):
print(-1)
else:
while(j<k):
for i in range(0,h):
if(k*i > l):
break
else:
# print(b)
b=b+ a[k*i]
j=j+1
print(b)
```
| 0
|
|
584
|
A
|
Olesya and Rodion
|
PROGRAMMING
| 1,000
|
[
"math"
] | null | null |
Olesya loves numbers consisting of *n* digits, and Rodion only likes numbers that are divisible by *t*. Find some number that satisfies both of them.
Your task is: given the *n* and *t* print an integer strictly larger than zero consisting of *n* digits that is divisible by *t*. If such number doesn't exist, print <=-<=1.
|
The single line contains two numbers, *n* and *t* (1<=≤<=*n*<=≤<=100, 2<=≤<=*t*<=≤<=10) — the length of the number and the number it should be divisible by.
|
Print one such positive number without leading zeroes, — the answer to the problem, or <=-<=1, if such number doesn't exist. If there are multiple possible answers, you are allowed to print any of them.
|
[
"3 2\n"
] |
[
"712"
] |
none
| 500
|
[
{
"input": "3 2",
"output": "222"
},
{
"input": "2 2",
"output": "22"
},
{
"input": "4 3",
"output": "3333"
},
{
"input": "5 3",
"output": "33333"
},
{
"input": "10 7",
"output": "7777777777"
},
{
"input": "2 9",
"output": "99"
},
{
"input": "18 8",
"output": "888888888888888888"
},
{
"input": "1 5",
"output": "5"
},
{
"input": "1 10",
"output": "-1"
},
{
"input": "100 5",
"output": "5555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555"
},
{
"input": "10 2",
"output": "2222222222"
},
{
"input": "18 10",
"output": "111111111111111110"
},
{
"input": "1 9",
"output": "9"
},
{
"input": "7 6",
"output": "6666666"
},
{
"input": "4 4",
"output": "4444"
},
{
"input": "14 7",
"output": "77777777777777"
},
{
"input": "3 8",
"output": "888"
},
{
"input": "1 3",
"output": "3"
},
{
"input": "2 8",
"output": "88"
},
{
"input": "3 8",
"output": "888"
},
{
"input": "4 3",
"output": "3333"
},
{
"input": "5 9",
"output": "99999"
},
{
"input": "4 8",
"output": "8888"
},
{
"input": "3 4",
"output": "444"
},
{
"input": "9 4",
"output": "444444444"
},
{
"input": "8 10",
"output": "11111110"
},
{
"input": "1 6",
"output": "6"
},
{
"input": "20 3",
"output": "33333333333333333333"
},
{
"input": "15 10",
"output": "111111111111110"
},
{
"input": "31 4",
"output": "4444444444444444444444444444444"
},
{
"input": "18 9",
"output": "999999999999999999"
},
{
"input": "72 4",
"output": "444444444444444444444444444444444444444444444444444444444444444444444444"
},
{
"input": "76 8",
"output": "8888888888888888888888888888888888888888888888888888888888888888888888888888"
},
{
"input": "12 5",
"output": "555555555555"
},
{
"input": "54 5",
"output": "555555555555555555555555555555555555555555555555555555"
},
{
"input": "96 10",
"output": "111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "15 9",
"output": "999999999999999"
},
{
"input": "100 2",
"output": "2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222"
},
{
"input": "99 3",
"output": "333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333"
},
{
"input": "98 4",
"output": "44444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444"
},
{
"input": "97 5",
"output": "5555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555"
},
{
"input": "100 6",
"output": "6666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666"
},
{
"input": "99 7",
"output": "777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777"
},
{
"input": "98 8",
"output": "88888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888"
},
{
"input": "97 9",
"output": "9999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999"
},
{
"input": "100 10",
"output": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "3 10",
"output": "110"
},
{
"input": "2 4",
"output": "44"
},
{
"input": "2 10",
"output": "10"
},
{
"input": "10 10",
"output": "1111111110"
},
{
"input": "4 10",
"output": "1110"
},
{
"input": "25 10",
"output": "1111111111111111111111110"
},
{
"input": "50 10",
"output": "11111111111111111111111111111111111111111111111110"
},
{
"input": "5 10",
"output": "11110"
},
{
"input": "99 10",
"output": "111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "100 10",
"output": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "1 2",
"output": "2"
},
{
"input": "20 10",
"output": "11111111111111111110"
},
{
"input": "99 7",
"output": "777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777"
},
{
"input": "89 5",
"output": "55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555"
},
{
"input": "6 10",
"output": "111110"
},
{
"input": "3 8",
"output": "888"
},
{
"input": "1 9",
"output": "9"
},
{
"input": "1 4",
"output": "4"
},
{
"input": "100 7",
"output": "7777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777"
}
] | 1,672,936,792
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 11
| 62
| 0
|
a,b=map(int,input().split())
if len(str(a))<len(str(b)): print(-1)
else: print(str(b)+('0'*(a-1)))
|
Title: Olesya and Rodion
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Olesya loves numbers consisting of *n* digits, and Rodion only likes numbers that are divisible by *t*. Find some number that satisfies both of them.
Your task is: given the *n* and *t* print an integer strictly larger than zero consisting of *n* digits that is divisible by *t*. If such number doesn't exist, print <=-<=1.
Input Specification:
The single line contains two numbers, *n* and *t* (1<=≤<=*n*<=≤<=100, 2<=≤<=*t*<=≤<=10) — the length of the number and the number it should be divisible by.
Output Specification:
Print one such positive number without leading zeroes, — the answer to the problem, or <=-<=1, if such number doesn't exist. If there are multiple possible answers, you are allowed to print any of them.
Demo Input:
['3 2\n']
Demo Output:
['712']
Note:
none
|
```python
a,b=map(int,input().split())
if len(str(a))<len(str(b)): print(-1)
else: print(str(b)+('0'*(a-1)))
```
| 0
|
|
260
|
C
|
Balls and Boxes
|
PROGRAMMING
| 1,700
|
[
"constructive algorithms",
"greedy",
"implementation"
] | null | null |
Little Vasya had *n* boxes with balls in the room. The boxes stood in a row and were numbered with numbers from 1 to *n* from left to right.
Once Vasya chose one of the boxes, let's assume that its number is *i*, took all balls out from it (it is guaranteed that this box originally had at least one ball), and began putting balls (one at a time) to the boxes with numbers *i*<=+<=1, *i*<=+<=2, *i*<=+<=3 and so on. If Vasya puts a ball into the box number *n*, then the next ball goes to box 1, the next one goes to box 2 and so on. He did it until he had no balls left in his hands. It is possible that Vasya puts multiple balls to the same box, and it is also possible that one or more balls will go to the box number *i*. If *i*<==<=*n*, Vasya puts the first ball into the box number 1, then the next ball goes to box 2 and so on.
For example, let's suppose that initially Vasya had four boxes, and the first box had 3 balls, the second one had 2, the third one had 5 and the fourth one had 4 balls. Then, if *i*<==<=3, then Vasya will take all five balls out of the third box and put them in the boxes with numbers: 4,<=1,<=2,<=3,<=4. After all Vasya's actions the balls will lie in the boxes as follows: in the first box there are 4 balls, 3 in the second one, 1 in the third one and 6 in the fourth one.
At this point Vasya has completely forgotten the original arrangement of the balls in the boxes, but he knows how they are arranged now, and the number *x* — the number of the box, where he put the last of the taken out balls.
He asks you to help to find the initial arrangement of the balls in the boxes.
|
The first line of the input contains two integers *n* and *x* (2<=≤<=*n*<=≤<=105, 1<=≤<=*x*<=≤<=*n*), that represent the number of the boxes and the index of the box that got the last ball from Vasya, correspondingly. The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n*, where integer *a**i* (0<=≤<=*a**i*<=≤<=109, *a**x*<=≠<=0) represents the number of balls in the box with index *i* after Vasya completes all the actions.
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
|
Print *n* integers, where the *i*-th one represents the number of balls in the box number *i* before Vasya starts acting. Separate the numbers in the output by spaces. If there are multiple correct solutions, you are allowed to print any of them.
|
[
"4 4\n4 3 1 6\n",
"5 2\n3 2 0 2 7\n",
"3 3\n2 3 1\n"
] |
[
"3 2 5 4 ",
"2 1 4 1 6 ",
"1 2 3 "
] |
none
| 1,500
|
[
{
"input": "4 4\n4 3 1 6",
"output": "3 2 5 4 "
},
{
"input": "5 2\n3 2 0 2 7",
"output": "2 1 4 1 6 "
},
{
"input": "3 3\n2 3 1",
"output": "1 2 3 "
},
{
"input": "10 3\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000",
"output": "0 0 10000000000 0 0 0 0 0 0 0 "
},
{
"input": "5 4\n0 554459682 978416312 784688178 954779973",
"output": "3 554459681 978416311 784688177 954779973 "
},
{
"input": "5 2\n1 554459683 978416312 784688178 954779974",
"output": "6 554459681 978416311 784688177 954779973 "
},
{
"input": "10 8\n994538714 617271264 168716105 915909382 338220996 533154890 507276501 323171960 121635370 33140162",
"output": "961398551 584131101 135575942 882769219 305080833 500014727 474136338 290031797 88495208 331401628 "
},
{
"input": "10 5\n994538715 617271265 168716106 915909383 338220997 533154890 507276501 323171960 121635371 33140163",
"output": "961398551 584131101 135575942 882769219 305080833 500014727 474136338 290031797 88495208 331401635 "
},
{
"input": "15 12\n256121252 531930087 157210108 921323934 786210452 0 962820592 824495629 642702951 556399489 660627699 454443499 406577817 234814732 387536495",
"output": "256121252 531930087 157210108 921323934 786210452 6 962820591 824495628 642702950 556399488 660627698 454443498 406577817 234814732 387536495 "
},
{
"input": "15 8\n256121253 531930088 157210109 921323935 786210453 1 962820593 824495630 642702951 556399489 660627699 454443499 406577818 234814733 387536496",
"output": "256121252 531930087 157210108 921323934 786210452 17 962820591 824495628 642702950 556399488 660627698 454443498 406577817 234814732 387536495 "
},
{
"input": "48 34\n227460647 746912226 53993109 682685525 621533698 666833117 492590398 167395931 678377836 66509684 638633255 713194369 386921920 34175132 704550051 220688091 499436760 495071385 102952101 137372655 0 720974146 209203457 946682102 237312198 943872065 957150897 357568282 367006748 0 730509325 68523190 726721460 85037180 620964625 219537305 396613042 39840356 91947418 566463810 791505982 87036026 446282153 912204581 895882687 284561729 35994526 423462628",
"output": "227460647 746912226 53993109 682685525 621533698 666833117 492590398 167395931 678377836 66509684 638633255 713194369 386921920 34175132 704550051 220688091 499436760 495071385 102952101 137372655 0 720974146 209203457 946682102 237312198 943872065 957150897 357568282 367006748 4 730509324 68523189 726721459 85037179 620964625 219537305 396613042 39840356 91947418 566463810 791505982 87036026 446282153 912204581 895882687 284561729 35994526 423462628 "
},
{
"input": "48 19\n227460648 746912227 53993110 682685526 621533699 666833118 492590399 167395932 678377837 66509685 638633256 713194370 386921921 34175133 704550052 220688092 499436761 495071386 102952102 137372655 0 720974146 209203457 946682102 237312198 943872065 957150897 357568282 367006748 0 730509325 68523190 726721460 85037180 620964626 219537306 396613043 39840357 91947419 566463811 791505983 87036027 446282154 912204582 895882688 284561730 35994527 423462629",
"output": "227460647 746912226 53993109 682685525 621533698 666833117 492590398 167395931 678377836 66509684 638633255 713194369 386921920 34175132 704550051 220688091 499436760 495071385 102952101 137372655 0 720974146 209203457 946682102 237312198 943872065 957150897 357568282 367006748 37 730509324 68523189 726721459 85037179 620964625 219537305 396613042 39840356 91947418 566463810 791505982 87036026 446282153 912204581 895882687 284561729 35994526 423462628 "
},
{
"input": "10 5\n3 3 3 3 4 3 3 3 3 3",
"output": "0 0 0 31 0 0 0 0 0 0 "
},
{
"input": "5 4\n3 1 3 1 3",
"output": "2 0 2 5 2 "
}
] | 1,595,149,953
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 0
| 124
| 20,172,800
|
import sys
input = sys.stdin.readline
def read_int():
return int(input().strip())
def read_ints():
return list(map(int, input().strip().split(' ')))
def solve():
"""
4 4
4 3 1 6
3 2 4 5
3 2 5 4
"""
n, x = read_ints()
a = read_ints()
last_min_j = x%n
for j in range(x, x+n):
if a[j%n] <= a[last_min_j]:
last_min_j = j%n
temp = a[last_min_j]
a[last_min_j] += n*temp
a = [a0-temp for a0 in a]
j = last_min_j
while j%n != x-1:
a[j%n] -= 1
j += 1
a[last_min_j] += 1
print(*a)
if __name__ == '__main__':
solve()
|
Title: Balls and Boxes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Vasya had *n* boxes with balls in the room. The boxes stood in a row and were numbered with numbers from 1 to *n* from left to right.
Once Vasya chose one of the boxes, let's assume that its number is *i*, took all balls out from it (it is guaranteed that this box originally had at least one ball), and began putting balls (one at a time) to the boxes with numbers *i*<=+<=1, *i*<=+<=2, *i*<=+<=3 and so on. If Vasya puts a ball into the box number *n*, then the next ball goes to box 1, the next one goes to box 2 and so on. He did it until he had no balls left in his hands. It is possible that Vasya puts multiple balls to the same box, and it is also possible that one or more balls will go to the box number *i*. If *i*<==<=*n*, Vasya puts the first ball into the box number 1, then the next ball goes to box 2 and so on.
For example, let's suppose that initially Vasya had four boxes, and the first box had 3 balls, the second one had 2, the third one had 5 and the fourth one had 4 balls. Then, if *i*<==<=3, then Vasya will take all five balls out of the third box and put them in the boxes with numbers: 4,<=1,<=2,<=3,<=4. After all Vasya's actions the balls will lie in the boxes as follows: in the first box there are 4 balls, 3 in the second one, 1 in the third one and 6 in the fourth one.
At this point Vasya has completely forgotten the original arrangement of the balls in the boxes, but he knows how they are arranged now, and the number *x* — the number of the box, where he put the last of the taken out balls.
He asks you to help to find the initial arrangement of the balls in the boxes.
Input Specification:
The first line of the input contains two integers *n* and *x* (2<=≤<=*n*<=≤<=105, 1<=≤<=*x*<=≤<=*n*), that represent the number of the boxes and the index of the box that got the last ball from Vasya, correspondingly. The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n*, where integer *a**i* (0<=≤<=*a**i*<=≤<=109, *a**x*<=≠<=0) represents the number of balls in the box with index *i* after Vasya completes all the actions.
Please, do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
Output Specification:
Print *n* integers, where the *i*-th one represents the number of balls in the box number *i* before Vasya starts acting. Separate the numbers in the output by spaces. If there are multiple correct solutions, you are allowed to print any of them.
Demo Input:
['4 4\n4 3 1 6\n', '5 2\n3 2 0 2 7\n', '3 3\n2 3 1\n']
Demo Output:
['3 2 5 4 ', '2 1 4 1 6 ', '1 2 3 ']
Note:
none
|
```python
import sys
input = sys.stdin.readline
def read_int():
return int(input().strip())
def read_ints():
return list(map(int, input().strip().split(' ')))
def solve():
"""
4 4
4 3 1 6
3 2 4 5
3 2 5 4
"""
n, x = read_ints()
a = read_ints()
last_min_j = x%n
for j in range(x, x+n):
if a[j%n] <= a[last_min_j]:
last_min_j = j%n
temp = a[last_min_j]
a[last_min_j] += n*temp
a = [a0-temp for a0 in a]
j = last_min_j
while j%n != x-1:
a[j%n] -= 1
j += 1
a[last_min_j] += 1
print(*a)
if __name__ == '__main__':
solve()
```
| 0
|
|
408
|
A
|
Line to Cashier
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Little Vasya went to the supermarket to get some groceries. He walked about the supermarket for a long time and got a basket full of products. Now he needs to choose the cashier to pay for the products.
There are *n* cashiers at the exit from the supermarket. At the moment the queue for the *i*-th cashier already has *k**i* people. The *j*-th person standing in the queue to the *i*-th cashier has *m**i*,<=*j* items in the basket. Vasya knows that:
- the cashier needs 5 seconds to scan one item; - after the cashier scans each item of some customer, he needs 15 seconds to take the customer's money and give him the change.
Of course, Vasya wants to select a queue so that he can leave the supermarket as soon as possible. Help him write a program that displays the minimum number of seconds after which Vasya can get to one of the cashiers.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of cashes in the shop. The second line contains *n* space-separated integers: *k*1,<=*k*2,<=...,<=*k**n* (1<=≤<=*k**i*<=≤<=100), where *k**i* is the number of people in the queue to the *i*-th cashier.
The *i*-th of the next *n* lines contains *k**i* space-separated integers: *m**i*,<=1,<=*m**i*,<=2,<=...,<=*m**i*,<=*k**i* (1<=≤<=*m**i*,<=*j*<=≤<=100) — the number of products the *j*-th person in the queue for the *i*-th cash has.
|
Print a single integer — the minimum number of seconds Vasya needs to get to the cashier.
|
[
"1\n1\n1\n",
"4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8\n"
] |
[
"20\n",
"100\n"
] |
In the second test sample, if Vasya goes to the first queue, he gets to the cashier in 100·5 + 15 = 515 seconds. But if he chooses the second queue, he will need 1·5 + 2·5 + 2·5 + 3·5 + 4·15 = 100 seconds. He will need 1·5 + 9·5 + 1·5 + 3·15 = 100 seconds for the third one and 7·5 + 8·5 + 2·15 = 105 seconds for the fourth one. Thus, Vasya gets to the cashier quicker if he chooses the second or the third queue.
| 500
|
[
{
"input": "1\n1\n1",
"output": "20"
},
{
"input": "4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8",
"output": "100"
},
{
"input": "4\n5 4 5 5\n3 1 3 1 2\n3 1 1 3\n1 1 1 2 2\n2 2 1 1 3",
"output": "100"
},
{
"input": "5\n5 3 6 6 4\n7 5 3 3 9\n6 8 2\n1 10 8 5 9 2\n9 7 8 5 9 10\n9 8 3 3",
"output": "125"
},
{
"input": "5\n10 10 10 10 10\n6 7 8 6 8 5 9 8 10 5\n9 6 9 8 7 8 8 10 8 5\n8 7 7 8 7 5 6 8 9 5\n6 5 10 5 5 10 7 8 5 5\n10 9 8 7 6 9 7 9 6 5",
"output": "480"
},
{
"input": "10\n9 10 10 10 9 5 9 7 8 7\n11 6 10 4 4 15 7 15 5\n3 9 11 12 11 1 13 13 1 5\n6 15 9 12 3 2 8 12 11 10\n7 1 1 6 10 2 6 1 14 2\n8 14 2 3 6 1 14 1 12\n6 10 9 3 5\n13 12 12 7 13 4 4 8 10\n5 6 4 3 14 9 13\n8 12 1 5 7 4 13 1\n1 9 5 3 5 1 4",
"output": "240"
},
{
"input": "10\n5 5 5 5 5 5 5 5 5 5\n5 5 4 5 4\n6 5 7 7 6\n5 4 4 5 5\n4 4 5 5 5\n7 6 4 5 7\n4 6 5 4 5\n6 6 7 6 6\n4 5 4 4 7\n7 5 4 4 5\n6 6 7 4 4",
"output": "190"
},
{
"input": "1\n1\n100",
"output": "515"
},
{
"input": "1\n90\n90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90",
"output": "41850"
}
] | 1,539,191,683
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 20
| 124
| 0
|
n=int(input())
a= list(map(int, input().split()))
b=[]
for i in range(n):
c= list(map(int, input().split()))
temp=sum(c)*5+a[i]*15
b.append(temp)
print(min(b))
|
Title: Line to Cashier
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Vasya went to the supermarket to get some groceries. He walked about the supermarket for a long time and got a basket full of products. Now he needs to choose the cashier to pay for the products.
There are *n* cashiers at the exit from the supermarket. At the moment the queue for the *i*-th cashier already has *k**i* people. The *j*-th person standing in the queue to the *i*-th cashier has *m**i*,<=*j* items in the basket. Vasya knows that:
- the cashier needs 5 seconds to scan one item; - after the cashier scans each item of some customer, he needs 15 seconds to take the customer's money and give him the change.
Of course, Vasya wants to select a queue so that he can leave the supermarket as soon as possible. Help him write a program that displays the minimum number of seconds after which Vasya can get to one of the cashiers.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of cashes in the shop. The second line contains *n* space-separated integers: *k*1,<=*k*2,<=...,<=*k**n* (1<=≤<=*k**i*<=≤<=100), where *k**i* is the number of people in the queue to the *i*-th cashier.
The *i*-th of the next *n* lines contains *k**i* space-separated integers: *m**i*,<=1,<=*m**i*,<=2,<=...,<=*m**i*,<=*k**i* (1<=≤<=*m**i*,<=*j*<=≤<=100) — the number of products the *j*-th person in the queue for the *i*-th cash has.
Output Specification:
Print a single integer — the minimum number of seconds Vasya needs to get to the cashier.
Demo Input:
['1\n1\n1\n', '4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8\n']
Demo Output:
['20\n', '100\n']
Note:
In the second test sample, if Vasya goes to the first queue, he gets to the cashier in 100·5 + 15 = 515 seconds. But if he chooses the second queue, he will need 1·5 + 2·5 + 2·5 + 3·5 + 4·15 = 100 seconds. He will need 1·5 + 9·5 + 1·5 + 3·15 = 100 seconds for the third one and 7·5 + 8·5 + 2·15 = 105 seconds for the fourth one. Thus, Vasya gets to the cashier quicker if he chooses the second or the third queue.
|
```python
n=int(input())
a= list(map(int, input().split()))
b=[]
for i in range(n):
c= list(map(int, input().split()))
temp=sum(c)*5+a[i]*15
b.append(temp)
print(min(b))
```
| 3
|
|
41
|
A
|
Translation
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Translation
|
2
|
256
|
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
|
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
|
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
|
[
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,632,757,071
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 62
| 0
|
s = raw_input()
y = raw_input()
if s[::-1] == y:
print(YES)
else:
print(NO)
|
Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
s = raw_input()
y = raw_input()
if s[::-1] == y:
print(YES)
else:
print(NO)
```
| -1
|
570
|
B
|
Simple Game
|
PROGRAMMING
| 1,300
|
[
"constructive algorithms",
"games",
"greedy",
"implementation",
"math"
] | null | null |
One day Misha and Andrew were playing a very simple game. First, each player chooses an integer in the range from 1 to *n*. Let's assume that Misha chose number *m*, and Andrew chose number *a*.
Then, by using a random generator they choose a random integer *c* in the range between 1 and *n* (any integer from 1 to *n* is chosen with the same probability), after which the winner is the player, whose number was closer to *c*. The boys agreed that if *m* and *a* are located on the same distance from *c*, Misha wins.
Andrew wants to win very much, so he asks you to help him. You know the number selected by Misha, and number *n*. You need to determine which value of *a* Andrew must choose, so that the probability of his victory is the highest possible.
More formally, you need to find such integer *a* (1<=≤<=*a*<=≤<=*n*), that the probability that is maximal, where *c* is the equiprobably chosen integer from 1 to *n* (inclusive).
|
The first line contains two integers *n* and *m* (1<=≤<=*m*<=≤<=*n*<=≤<=109) — the range of numbers in the game, and the number selected by Misha respectively.
|
Print a single number — such value *a*, that probability that Andrew wins is the highest. If there are multiple such values, print the minimum of them.
|
[
"3 1\n",
"4 3\n"
] |
[
"2",
"2"
] |
In the first sample test: Andrew wins if *c* is equal to 2 or 3. The probability that Andrew wins is 2 / 3. If Andrew chooses *a* = 3, the probability of winning will be 1 / 3. If *a* = 1, the probability of winning is 0.
In the second sample test: Andrew wins if *c* is equal to 1 and 2. The probability that Andrew wins is 1 / 2. For other choices of *a* the probability of winning is less.
| 1,000
|
[
{
"input": "3 1",
"output": "2"
},
{
"input": "4 3",
"output": "2"
},
{
"input": "5 5",
"output": "4"
},
{
"input": "10 5",
"output": "6"
},
{
"input": "20 13",
"output": "12"
},
{
"input": "51 1",
"output": "2"
},
{
"input": "100 50",
"output": "51"
},
{
"input": "100 51",
"output": "50"
},
{
"input": "100 49",
"output": "50"
},
{
"input": "1000000000 1000000000",
"output": "999999999"
},
{
"input": "1000000000 1",
"output": "2"
},
{
"input": "1000000000 100000000",
"output": "100000001"
},
{
"input": "1000000000 500000000",
"output": "500000001"
},
{
"input": "1000000000 123124",
"output": "123125"
},
{
"input": "12412523 125123",
"output": "125124"
},
{
"input": "54645723 432423",
"output": "432424"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "262833325 131416663",
"output": "131416662"
},
{
"input": "477667530 238833766",
"output": "238833765"
},
{
"input": "692501734 346250868",
"output": "346250867"
},
{
"input": "907335939 453667970",
"output": "453667969"
},
{
"input": "746085224 373042613",
"output": "373042612"
},
{
"input": "189520699 94760350",
"output": "94760349"
},
{
"input": "404354904 202177453",
"output": "202177452"
},
{
"input": "619189108 309594555",
"output": "309594554"
},
{
"input": "81813292 40906647",
"output": "40906646"
},
{
"input": "296647497 148323750",
"output": "148323749"
},
{
"input": "511481701 255740851",
"output": "255740850"
},
{
"input": "726315905 363157953",
"output": "363157952"
},
{
"input": "496110970 201868357",
"output": "201868358"
},
{
"input": "710945175 173165570",
"output": "173165571"
},
{
"input": "925779379 720443954",
"output": "720443953"
},
{
"input": "140613583 93171580",
"output": "93171579"
},
{
"input": "355447788 85890184",
"output": "85890185"
},
{
"input": "570281992 291648263",
"output": "291648262"
},
{
"input": "541904957 459371829",
"output": "459371828"
},
{
"input": "756739161 125332525",
"output": "125332526"
},
{
"input": "971573366 216791157",
"output": "216791158"
},
{
"input": "186407570 160453970",
"output": "160453969"
},
{
"input": "401241775 170032078",
"output": "170032079"
},
{
"input": "616075979 207073797",
"output": "207073798"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "2 1",
"output": "2"
},
{
"input": "2 2",
"output": "1"
},
{
"input": "3 1",
"output": "2"
},
{
"input": "3 2",
"output": "1"
},
{
"input": "3 3",
"output": "2"
},
{
"input": "4 1",
"output": "2"
},
{
"input": "4 2",
"output": "3"
},
{
"input": "4 3",
"output": "2"
},
{
"input": "4 4",
"output": "3"
},
{
"input": "5 1",
"output": "2"
},
{
"input": "5 2",
"output": "3"
},
{
"input": "5 3",
"output": "2"
},
{
"input": "5 4",
"output": "3"
},
{
"input": "5 5",
"output": "4"
},
{
"input": "3 2",
"output": "1"
},
{
"input": "7 4",
"output": "3"
},
{
"input": "2 2",
"output": "1"
},
{
"input": "7 3",
"output": "4"
}
] | 1,593,542,187
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 93
| 0
|
m,n=map(int,input().split())
if(n==1):
print('2')
else:
print(n-1)
|
Title: Simple Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Misha and Andrew were playing a very simple game. First, each player chooses an integer in the range from 1 to *n*. Let's assume that Misha chose number *m*, and Andrew chose number *a*.
Then, by using a random generator they choose a random integer *c* in the range between 1 and *n* (any integer from 1 to *n* is chosen with the same probability), after which the winner is the player, whose number was closer to *c*. The boys agreed that if *m* and *a* are located on the same distance from *c*, Misha wins.
Andrew wants to win very much, so he asks you to help him. You know the number selected by Misha, and number *n*. You need to determine which value of *a* Andrew must choose, so that the probability of his victory is the highest possible.
More formally, you need to find such integer *a* (1<=≤<=*a*<=≤<=*n*), that the probability that is maximal, where *c* is the equiprobably chosen integer from 1 to *n* (inclusive).
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*m*<=≤<=*n*<=≤<=109) — the range of numbers in the game, and the number selected by Misha respectively.
Output Specification:
Print a single number — such value *a*, that probability that Andrew wins is the highest. If there are multiple such values, print the minimum of them.
Demo Input:
['3 1\n', '4 3\n']
Demo Output:
['2', '2']
Note:
In the first sample test: Andrew wins if *c* is equal to 2 or 3. The probability that Andrew wins is 2 / 3. If Andrew chooses *a* = 3, the probability of winning will be 1 / 3. If *a* = 1, the probability of winning is 0.
In the second sample test: Andrew wins if *c* is equal to 1 and 2. The probability that Andrew wins is 1 / 2. For other choices of *a* the probability of winning is less.
|
```python
m,n=map(int,input().split())
if(n==1):
print('2')
else:
print(n-1)
```
| 0
|
|
266
|
B
|
Queue at the School
|
PROGRAMMING
| 800
|
[
"constructive algorithms",
"graph matchings",
"implementation",
"shortest paths"
] | null | null |
During the break the schoolchildren, boys and girls, formed a queue of *n* people in the canteen. Initially the children stood in the order they entered the canteen. However, after a while the boys started feeling awkward for standing in front of the girls in the queue and they started letting the girls move forward each second.
Let's describe the process more precisely. Let's say that the positions in the queue are sequentially numbered by integers from 1 to *n*, at that the person in the position number 1 is served first. Then, if at time *x* a boy stands on the *i*-th position and a girl stands on the (*i*<=+<=1)-th position, then at time *x*<=+<=1 the *i*-th position will have a girl and the (*i*<=+<=1)-th position will have a boy. The time is given in seconds.
You've got the initial position of the children, at the initial moment of time. Determine the way the queue is going to look after *t* seconds.
|
The first line contains two integers *n* and *t* (1<=≤<=*n*,<=*t*<=≤<=50), which represent the number of children in the queue and the time after which the queue will transform into the arrangement you need to find.
The next line contains string *s*, which represents the schoolchildren's initial arrangement. If the *i*-th position in the queue contains a boy, then the *i*-th character of string *s* equals "B", otherwise the *i*-th character equals "G".
|
Print string *a*, which describes the arrangement after *t* seconds. If the *i*-th position has a boy after the needed time, then the *i*-th character *a* must equal "B", otherwise it must equal "G".
|
[
"5 1\nBGGBG\n",
"5 2\nBGGBG\n",
"4 1\nGGGB\n"
] |
[
"GBGGB\n",
"GGBGB\n",
"GGGB\n"
] |
none
| 500
|
[
{
"input": "5 1\nBGGBG",
"output": "GBGGB"
},
{
"input": "5 2\nBGGBG",
"output": "GGBGB"
},
{
"input": "4 1\nGGGB",
"output": "GGGB"
},
{
"input": "2 1\nBB",
"output": "BB"
},
{
"input": "2 1\nBG",
"output": "GB"
},
{
"input": "6 2\nBBGBBG",
"output": "GBBGBB"
},
{
"input": "8 3\nBBGBGBGB",
"output": "GGBGBBBB"
},
{
"input": "10 3\nBBGBBBBBBG",
"output": "GBBBBBGBBB"
},
{
"input": "22 7\nGBGGBGGGGGBBBGGBGBGBBB",
"output": "GGGGGGGGBGGBGGBBBBBBBB"
},
{
"input": "50 4\nGBBGBBBGGGGGBBGGBBBBGGGBBBGBBBGGBGGBGBBBGGBGGBGGBG",
"output": "GGBGBGBGBGBGGGBBGBGBGBGBBBGBGBGBGBGBGBGBGBGBGGBGBB"
},
{
"input": "50 8\nGGGGBGGBGGGBGBBBGGGGGGGGBBGBGBGBBGGBGGBGGGGGGGGBBG",
"output": "GGGGGGGGGGGGBGGBGBGBGBGBGGGGGGBGBGBGBGBGBGGBGGBGBB"
},
{
"input": "50 30\nBGGGGGGBGGBGBGGGGBGBBGBBBGGBBBGBGBGGGGGBGBBGBGBGGG",
"output": "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "20 20\nBBGGBGGGGBBBGBBGGGBB",
"output": "GGGGGGGGGGBBBBBBBBBB"
},
{
"input": "27 6\nGBGBGBGGGGGGBGGBGGBBGBBBGBB",
"output": "GGGGGGGBGBGBGGGGGBGBBBBBBBB"
},
{
"input": "46 11\nBGGGGGBGBGGBGGGBBGBBGBBGGBBGBBGBGGGGGGGBGBGBGB",
"output": "GGGGGGGGGGGBGGGGGBBGBGBGBGBGBGBGBGBGBGBGBBBBBB"
},
{
"input": "50 6\nBGGBBBBGGBBBBBBGGBGBGBBBBGBBBBBBGBBBBBBBBBBBBBBBBB",
"output": "GGGGBBBBBGBGBGBGBBBGBBBBBBGBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "50 10\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "50 8\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"
},
{
"input": "50 10\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBGB",
"output": "BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBGBBBBBBBBBBB"
},
{
"input": "50 13\nGGGBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "GGGGGGGGGGGGGGGGBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"
},
{
"input": "1 1\nB",
"output": "B"
},
{
"input": "1 1\nG",
"output": "G"
},
{
"input": "1 50\nB",
"output": "B"
},
{
"input": "1 50\nG",
"output": "G"
},
{
"input": "50 50\nBBBBBBBBGGBBBBBBGBBBBBBBBBBBGBBBBBBBBBBBBBBGBBBBBB",
"output": "GGGGGBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "50 50\nGGBBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBBGGGGGGBG",
"output": "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBBBBB"
},
{
"input": "6 3\nGGBBBG",
"output": "GGGBBB"
},
{
"input": "26 3\nGBBGBBBBBGGGBGBGGGBGBGGBBG",
"output": "GGBBBBGBGBGBGGGBGBGGGBGBBB"
},
{
"input": "46 3\nGGBBGGGGBBGBGBBBBBGGGBGGGBBGGGBBBGGBGGBBBGBGBB",
"output": "GGGGBGBGGGBBBBBGBGBGBGGGBGGBGBGBGBGBGBGBGBBBBB"
},
{
"input": "44 8\nBGBBBBBBBBBGGBBGBGBGGBBBBBGBBGBBBBBBBBBGBBGB",
"output": "GBBGBGBGBGBGBGBBBBGBBGBBBBBBBBBGBBGBBBBBBBBB"
},
{
"input": "20 20\nBBGGBGGGGBBBGBBGGGBB",
"output": "GGGGGGGGGGBBBBBBBBBB"
},
{
"input": "30 25\nBGGBBGBGGBGBGBBGBGGGGBGBGGBBBB",
"output": "GGGGGGGGGGGGGGGBBBBBBBBBBBBBBB"
},
{
"input": "17 42\nBBGBGBGGGGGGBBGGG",
"output": "GGGGGGGGGGGBBBBBB"
},
{
"input": "30 50\nBGGBBGGGGGGGGBBGGGBBGGBBBGBBGG",
"output": "GGGGGGGGGGGGGGGGGGBBBBBBBBBBBB"
},
{
"input": "31 33\nBBGGBBGGBGBBBBGGBGBBBGBGGBBGBBB",
"output": "GGGGGGGGGGGGBBBBBBBBBBBBBBBBBBB"
},
{
"input": "2 2\nBG",
"output": "GB"
},
{
"input": "8 8\nGGGBGGBB",
"output": "GGGGGBBB"
},
{
"input": "34 34\nBGGBBBBGGBBGBGGGGGGBBGGGGGBGGBGGGB",
"output": "GGGGGGGGGGGGGGGGGGGGGBBBBBBBBBBBBB"
},
{
"input": "34 20\nBBBBGBGGGBGGGBGBGGBBBBGGBBGGGBGBBG",
"output": "GGGGGGGGGGGGGGGGGBBBBBBBBBBBBBBBBB"
},
{
"input": "50 50\nBBGBBBBBBBBBBBBGBBBGBBBBBBBGBBBBBBGBBBGBBGBBGBBBGG",
"output": "GGGGGGGGGGBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "10 10\nGGGGGGGGGG",
"output": "GGGGGGGGGG"
},
{
"input": "10 10\nBBBBBBBBBB",
"output": "BBBBBBBBBB"
},
{
"input": "10 10\nBGBGBGBGBG",
"output": "GGGGGBBBBB"
},
{
"input": "1 1\nB",
"output": "B"
}
] | 1,698,147,002
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 44
| 124
| 0
|
a,b = map(int,input().split())
c = list(input())
for i in range(b):
j = 1
while j<a:
if c[-j] == 'G' and c[-j-1] == 'B':
c[-j],c[-j-1] = c[-j-1],c[-j]
j += 2
else:
j += 1
print(''.join(c))
|
Title: Queue at the School
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
During the break the schoolchildren, boys and girls, formed a queue of *n* people in the canteen. Initially the children stood in the order they entered the canteen. However, after a while the boys started feeling awkward for standing in front of the girls in the queue and they started letting the girls move forward each second.
Let's describe the process more precisely. Let's say that the positions in the queue are sequentially numbered by integers from 1 to *n*, at that the person in the position number 1 is served first. Then, if at time *x* a boy stands on the *i*-th position and a girl stands on the (*i*<=+<=1)-th position, then at time *x*<=+<=1 the *i*-th position will have a girl and the (*i*<=+<=1)-th position will have a boy. The time is given in seconds.
You've got the initial position of the children, at the initial moment of time. Determine the way the queue is going to look after *t* seconds.
Input Specification:
The first line contains two integers *n* and *t* (1<=≤<=*n*,<=*t*<=≤<=50), which represent the number of children in the queue and the time after which the queue will transform into the arrangement you need to find.
The next line contains string *s*, which represents the schoolchildren's initial arrangement. If the *i*-th position in the queue contains a boy, then the *i*-th character of string *s* equals "B", otherwise the *i*-th character equals "G".
Output Specification:
Print string *a*, which describes the arrangement after *t* seconds. If the *i*-th position has a boy after the needed time, then the *i*-th character *a* must equal "B", otherwise it must equal "G".
Demo Input:
['5 1\nBGGBG\n', '5 2\nBGGBG\n', '4 1\nGGGB\n']
Demo Output:
['GBGGB\n', 'GGBGB\n', 'GGGB\n']
Note:
none
|
```python
a,b = map(int,input().split())
c = list(input())
for i in range(b):
j = 1
while j<a:
if c[-j] == 'G' and c[-j-1] == 'B':
c[-j],c[-j-1] = c[-j-1],c[-j]
j += 2
else:
j += 1
print(''.join(c))
```
| 3
|
|
1,008
|
A
|
Romaji
|
PROGRAMMING
| 900
|
[
"implementation",
"strings"
] | null | null |
Vitya has just started learning Berlanese language. It is known that Berlanese uses the Latin alphabet. Vowel letters are "a", "o", "u", "i", and "e". Other letters are consonant.
In Berlanese, there has to be a vowel after every consonant, but there can be any letter after any vowel. The only exception is a consonant "n"; after this letter, there can be any letter (not only a vowel) or there can be no letter at all. For example, the words "harakiri", "yupie", "man", and "nbo" are Berlanese while the words "horse", "king", "my", and "nz" are not.
Help Vitya find out if a word $s$ is Berlanese.
|
The first line of the input contains the string $s$ consisting of $|s|$ ($1\leq |s|\leq 100$) lowercase Latin letters.
|
Print "YES" (without quotes) if there is a vowel after every consonant except "n", otherwise print "NO".
You can print each letter in any case (upper or lower).
|
[
"sumimasen\n",
"ninja\n",
"codeforces\n"
] |
[
"YES\n",
"YES\n",
"NO\n"
] |
In the first and second samples, a vowel goes after each consonant except "n", so the word is Berlanese.
In the third sample, the consonant "c" goes after the consonant "r", and the consonant "s" stands on the end, so the word is not Berlanese.
| 500
|
[
{
"input": "sumimasen",
"output": "YES"
},
{
"input": "ninja",
"output": "YES"
},
{
"input": "codeforces",
"output": "NO"
},
{
"input": "auuaoonntanonnuewannnnpuuinniwoonennyolonnnvienonpoujinndinunnenannmuveoiuuhikucuziuhunnnmunzancenen",
"output": "YES"
},
{
"input": "n",
"output": "YES"
},
{
"input": "necnei",
"output": "NO"
},
{
"input": "nternn",
"output": "NO"
},
{
"input": "aucunuohja",
"output": "NO"
},
{
"input": "a",
"output": "YES"
},
{
"input": "b",
"output": "NO"
},
{
"input": "nn",
"output": "YES"
},
{
"input": "nnnzaaa",
"output": "YES"
},
{
"input": "zn",
"output": "NO"
},
{
"input": "ab",
"output": "NO"
},
{
"input": "aaaaaaaaaa",
"output": "YES"
},
{
"input": "aaaaaaaaab",
"output": "NO"
},
{
"input": "aaaaaaaaan",
"output": "YES"
},
{
"input": "baaaaaaaaa",
"output": "YES"
},
{
"input": "naaaaaaaaa",
"output": "YES"
},
{
"input": "nbaaaaaaaa",
"output": "YES"
},
{
"input": "bbaaaaaaaa",
"output": "NO"
},
{
"input": "bnaaaaaaaa",
"output": "NO"
},
{
"input": "eonwonojannonnufimiiniewuqaienokacevecinfuqihatenhunliquuyebayiaenifuexuanenuaounnboancaeowonu",
"output": "YES"
},
{
"input": "uixinnepnlinqaingieianndeakuniooudidonnnqeaituioeneiroionxuowudiooonayenfeonuino",
"output": "NO"
},
{
"input": "nnnnnyigaveteononnnnxaalenxuiiwannntoxonyoqonlejuoxuoconnnentoinnul",
"output": "NO"
},
{
"input": "ndonneasoiunhomuunnhuitonnntunntoanerekonoupunanuauenu",
"output": "YES"
},
{
"input": "anujemogawautiedoneobninnibonuunaoennnyoorufonxionntinimiboonununnnnnleenqunminzayoutanlalo",
"output": "NO"
},
{
"input": "y",
"output": "NO"
},
{
"input": "by",
"output": "NO"
},
{
"input": "yy",
"output": "NO"
},
{
"input": "nbn",
"output": "NO"
},
{
"input": "nz",
"output": "NO"
},
{
"input": "king",
"output": "NO"
},
{
"input": "g",
"output": "NO"
},
{
"input": "az",
"output": "NO"
},
{
"input": "x",
"output": "NO"
},
{
"input": "z",
"output": "NO"
},
{
"input": "yn",
"output": "NO"
},
{
"input": "aeo",
"output": "YES"
},
{
"input": "nb",
"output": "NO"
},
{
"input": "npn",
"output": "NO"
},
{
"input": "kini",
"output": "YES"
},
{
"input": "pya",
"output": "NO"
},
{
"input": "m",
"output": "NO"
},
{
"input": "p",
"output": "NO"
},
{
"input": "aaaaaaaak",
"output": "NO"
},
{
"input": "aab",
"output": "NO"
},
{
"input": "d",
"output": "NO"
},
{
"input": "at",
"output": "NO"
},
{
"input": "aaaaaak",
"output": "NO"
},
{
"input": "aaz",
"output": "NO"
},
{
"input": "aaab",
"output": "NO"
},
{
"input": "s",
"output": "NO"
},
{
"input": "nzzen",
"output": "NO"
},
{
"input": "aeionnhhhn",
"output": "NO"
},
{
"input": "h",
"output": "NO"
},
{
"input": "ny",
"output": "NO"
}
] | 1,637,563,539
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
l=int()
v=["a","e","i","o","u"]
n=o
k=2
for i in l:
if n==1:
if i in v:
n=0
k=0
else:
break
elif: i not in v and i !="n":
n=1
k=1
if k==1:
print("NO")
else:
print("YES")
|
Title: Romaji
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vitya has just started learning Berlanese language. It is known that Berlanese uses the Latin alphabet. Vowel letters are "a", "o", "u", "i", and "e". Other letters are consonant.
In Berlanese, there has to be a vowel after every consonant, but there can be any letter after any vowel. The only exception is a consonant "n"; after this letter, there can be any letter (not only a vowel) or there can be no letter at all. For example, the words "harakiri", "yupie", "man", and "nbo" are Berlanese while the words "horse", "king", "my", and "nz" are not.
Help Vitya find out if a word $s$ is Berlanese.
Input Specification:
The first line of the input contains the string $s$ consisting of $|s|$ ($1\leq |s|\leq 100$) lowercase Latin letters.
Output Specification:
Print "YES" (without quotes) if there is a vowel after every consonant except "n", otherwise print "NO".
You can print each letter in any case (upper or lower).
Demo Input:
['sumimasen\n', 'ninja\n', 'codeforces\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n']
Note:
In the first and second samples, a vowel goes after each consonant except "n", so the word is Berlanese.
In the third sample, the consonant "c" goes after the consonant "r", and the consonant "s" stands on the end, so the word is not Berlanese.
|
```python
l=int()
v=["a","e","i","o","u"]
n=o
k=2
for i in l:
if n==1:
if i in v:
n=0
k=0
else:
break
elif: i not in v and i !="n":
n=1
k=1
if k==1:
print("NO")
else:
print("YES")
```
| -1
|
|
112
|
A
|
Petya and Strings
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Petya and Strings
|
2
|
256
|
Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison.
|
Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters.
|
If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared.
|
[
"aaaa\naaaA\n",
"abs\nAbz\n",
"abcdefg\nAbCdEfF\n"
] |
[
"0\n",
"-1\n",
"1\n"
] |
If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site:
- http://en.wikipedia.org/wiki/Lexicographical_order
| 500
|
[
{
"input": "aaaa\naaaA",
"output": "0"
},
{
"input": "abs\nAbz",
"output": "-1"
},
{
"input": "abcdefg\nAbCdEfF",
"output": "1"
},
{
"input": "asadasdasd\nasdwasdawd",
"output": "-1"
},
{
"input": "aslkjlkasdd\nasdlkjdajwi",
"output": "1"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "0"
},
{
"input": "aAaaaAAaAaaAzZsssSsdDfeEaeqZlpP\nAaaaAaaAaaAaZzSSSSsDdFeeAeQZLpp",
"output": "0"
},
{
"input": "bwuEhEveouaTECagLZiqmUdxEmhRSOzMauJRWLQMppZOumxhAmwuGeDIkvkBLvMXwUoFmpAfDprBcFtEwOULcZWRQhcTbTbX\nHhoDWbcxwiMnCNexOsKsujLiSGcLllXOkRSbnOzThAjnnliLYFFmsYkOfpTxRNEfBsoUHfoLTiqAINRPxWRqrTJhgfkKcDOH",
"output": "-1"
},
{
"input": "kGWUuguKzcvxqKTNpxeDWXpXkrXDvGMFGoXKDfPBZvWSDUyIYBynbKOUonHvmZaKeirUhfmVRKtGhAdBfKMWXDUoqvbfpfHYcg\ncvOULleuIIiYVVxcLZmHVpNGXuEpzcWZZWyMOwIwbpkKPwCfkVbKkUuosvxYCKjqfVmHfJKbdrsAcatPYgrCABaFcoBuOmMfFt",
"output": "1"
},
{
"input": "nCeNVIzHqPceNhjHeHvJvgBsNFiXBATRrjSTXJzhLMDMxiJztphxBRlDlqwDFImWeEPkggZCXSRwelOdpNrYnTepiOqpvkr\nHJbjJFtlvNxIbkKlxQUwmZHJFVNMwPAPDRslIoXISBYHHfymyIaQHLgECPxAmqnOCizwXnIUBRmpYUBVPenoUKhCobKdOjL",
"output": "1"
},
{
"input": "ttXjenUAlfixytHEOrPkgXmkKTSGYuyVXGIHYmWWYGlBYpHkujueqBSgjLguSgiMGJWATIGEUjjAjKXdMiVbHozZUmqQtFrT\nJziDBFBDmDJCcGqFsQwDFBYdOidLxxhBCtScznnDgnsiStlWFnEXQrJxqTXKPxZyIGfLIToETKWZBPUIBmLeImrlSBWCkTNo",
"output": "1"
},
{
"input": "AjQhPqSVhwQQjcgCycjKorWBgFCRuQBwgdVuAPSMJAvTyxGVuFHjfJzkKfsmfhFbKqFrFIohSZBbpjgEHebezmVlGLTPSCTMf\nXhxWuSnMmKFrCUOwkTUmvKAfbTbHWzzOTzxJatLLCdlGnHVaBUnxDlsqpvjLHMThOPAFBggVKDyKBrZAmjnjrhHlrnSkyzBja",
"output": "-1"
},
{
"input": "HCIgYtnqcMyjVngziNflxKHtdTmcRJhzMAjFAsNdWXFJYEhiTzsQUtFNkAbdrFBRmvLirkuirqTDvIpEfyiIqkrwsjvpPWTEdI\nErqiiWKsmIjyZuzgTlTqxYZwlrpvRyaVhRTOYUqtPMVGGtWOkDCOOQRKrkkRzPftyQCkYkzKkzTPqqXmeZhvvEEiEhkdOmoMvy",
"output": "1"
},
{
"input": "mtBeJYILXcECGyEVSyzLFdQJbiVnnfkbsYYsdUJSIRmyzLfTTtFwIBmRLVnwcewIqcuydkcLpflHAFyDaToLiFMgeHvQorTVbI\nClLvyejznjbRfCDcrCzkLvqQaGzTjwmWONBdCctJAPJBcQrcYvHaSLQgPIJbmkFBhFzuQLBiRzAdNHulCjIAkBvZxxlkdzUWLR",
"output": "1"
},
{
"input": "tjucSbGESVmVridTBjTmpVBCwwdWKBPeBvmgdxgIVLwQxveETnSdxkTVJpXoperWSgdpPMKNmwDiGeHfxnuqaDissgXPlMuNZIr\nHfjOOJhomqNIKHvqSgfySjlsWJQBuWYwhLQhlZYlpZwboMpoLoluGsBmhhlYgeIouwdkPfiaAIrkYRlxtiFazOPOllPsNZHcIZd",
"output": "1"
},
{
"input": "AanbDfbZNlUodtBQlvPMyomStKNhgvSGhSbTdabxGFGGXCdpsJDimsAykKjfBDPMulkhBMsqLmVKLDoesHZsRAEEdEzqigueXInY\ncwfyjoppiJNrjrOLNZkqcGimrpTsiyFBVgMWEPXsMrxLJDDbtYzerXiFGuLBcQYitLdqhGHBpdjRnkUegmnwhGHAKXGyFtscWDSI",
"output": "-1"
},
{
"input": "HRfxniwuJCaHOcaOVgjOGHXKrwxrDQxJpppeGDXnTAowyKbCsCQPbchCKeTWOcKbySSYnoaTJDnmRcyGPbfXJyZoPcARHBu\nxkLXvwkvGIWSQaFTznLOctUXNuzzBBOlqvzmVfTSejekTAlwidRrsxkbZTsGGeEWxCXHzqWVuLGoCyrGjKkQoHqduXwYQKC",
"output": "-1"
},
{
"input": "OjYwwNuPESIazoyLFREpObIaMKhCaKAMWMfRGgucEuyNYRantwdwQkmflzfqbcFRaXBnZoIUGsFqXZHGKwlaBUXABBcQEWWPvkjW\nRxLqGcTTpBwHrHltCOllnTpRKLDofBUqqHxnOtVWPgvGaeHIevgUSOeeDOJubfqonFpVNGVbHFcAhjnyFvrrqnRgKhkYqQZmRfUl",
"output": "-1"
},
{
"input": "tatuhQPIzjptlzzJpCAPXSRTKZRlwgfoCIsFjJquRoIDyZZYRSPdFUTjjUPhLBBfeEIfLQpygKXRcyQFiQsEtRtLnZErBqW\ntkHUjllbafLUWhVCnvblKjgYIEoHhsjVmrDBmAWbvtkHxDbRFvsXAjHIrujaDbYwOZmacknhZPeCcorbRgHjjgAgoJdjvLo",
"output": "-1"
},
{
"input": "cymCPGqdXKUdADEWDdUaLEEMHiXHsdAZuDnJDMUvxvrLRBrPSDpXPAgMRoGplLtniFRTomDTAHXWAdgUveTxaqKVSvnOyhOwiRN\nuhmyEWzapiRNPFDisvHTbenXMfeZaHqOFlKjrfQjUBwdFktNpeiRoDWuBftZLcCZZAVfioOihZVNqiNCNDIsUdIhvbcaxpTRWoV",
"output": "-1"
},
{
"input": "sSvpcITJAwghVfJaLKBmyjOkhltTGjYJVLWCYMFUomiJaKQYhXTajvZVHIMHbyckYROGQZzjWyWCcnmDmrkvTKfHSSzCIhsXgEZa\nvhCXkCwAmErGVBPBAnkSYEYvseFKbWSktoqaHYXUmYkHfOkRwuEyBRoGoBrOXBKVxXycjZGStuvDarnXMbZLWrbjrisDoJBdSvWJ",
"output": "-1"
},
{
"input": "hJDANKUNBisOOINDsTixJmYgHNogtpwswwcvVMptfGwIjvqgwTYFcqTdyAqaqlnhOCMtsnWXQqtjFwQlEcBtMFAtSqnqthVb\nrNquIcjNWESjpPVWmzUJFrelpUZeGDmSvCurCqVmKHKVAAPkaHksniOlzjiKYIJtvbuQWZRufMebpTFPqyxIWWjfPaWYiNlK",
"output": "-1"
},
{
"input": "ycLoapxsfsDTHMSfAAPIUpiEhQKUIXUcXEiopMBuuZLHtfPpLmCHwNMNQUwsEXxCEmKHTBSnKhtQhGWUvppUFZUgSpbeChX\ndCZhgVXofkGousCzObxZSJwXcHIaqUDSCPKzXntcVmPxtNcXmVcjsetZYxedmgQzXTZHMvzjoaXCMKsncGciSDqQWIIRlys",
"output": "1"
},
{
"input": "nvUbnrywIePXcoukIhwTfUVcHUEgXcsMyNQhmMlTltZiCooyZiIKRIGVHMCnTKgzXXIuvoNDEZswKoACOBGSyVNqTNQqMhAG\nplxuGSsyyJjdvpddrSebOARSAYcZKEaKjqbCwvjhNykuaECoQVHTVFMKXwvrQXRaqXsHsBaGVhCxGRxNyGUbMlxOarMZNXxy",
"output": "-1"
},
{
"input": "EncmXtAblQzcVRzMQqdDqXfAhXbtJKQwZVWyHoWUckohnZqfoCmNJDzexFgFJYrwNHGgzCJTzQQFnxGlhmvQTpicTkEeVICKac\nNIUNZoMLFMyAjVgQLITELJSodIXcGSDWfhFypRoGYuogJpnqGTotWxVqpvBHjFOWcDRDtARsaHarHaOkeNWEHGTaGOFCOFEwvK",
"output": "-1"
},
{
"input": "UG\nak",
"output": "1"
},
{
"input": "JZR\nVae",
"output": "-1"
},
{
"input": "a\nZ",
"output": "-1"
},
{
"input": "rk\nkv",
"output": "1"
},
{
"input": "RvuT\nbJzE",
"output": "1"
},
{
"input": "PPS\nydq",
"output": "-1"
},
{
"input": "q\nq",
"output": "0"
},
{
"input": "peOw\nIgSJ",
"output": "1"
},
{
"input": "PyK\noKN",
"output": "1"
},
{
"input": "O\ni",
"output": "1"
},
{
"input": "NmGY\npDlP",
"output": "-1"
},
{
"input": "nG\nZf",
"output": "-1"
},
{
"input": "m\na",
"output": "1"
},
{
"input": "MWyB\nWZEV",
"output": "-1"
},
{
"input": "Gre\nfxc",
"output": "1"
},
{
"input": "Ooq\nwap",
"output": "-1"
},
{
"input": "XId\nlbB",
"output": "1"
},
{
"input": "lfFpECEqUMEOJhipvkZjDPcpDNJedOVXiSMgBvBZbtfzIKekcvpWPCazKAhJyHircRtgcBIJwwstpHaLAgxFOngAWUZRgCef\nLfFPEcequmeojHIpVkzjDPcpdNJEDOVXiSmGBVBZBtfZikEKcvPwpCAzKAHJyHIrCRTgCbIJWwSTphALagXfOnGAwUzRGcEF",
"output": "0"
},
{
"input": "DQBdtSEDtFGiNRUeJNbOIfDZnsryUlzJHGTXGFXnwsVyxNtLgmklmFvRCzYETBVdmkpJJIvIOkMDgCFHZOTODiYrkwXd\nDQbDtsEdTFginRUEJNBOIfdZnsryulZJHGtxGFxnwSvYxnTLgmKlmFVRCzyEtBVdmKpJjiVioKMDgCFhzoTODiYrKwXD",
"output": "0"
},
{
"input": "tYWRijFQSzHBpCjUzqBtNvBKyzZRnIdWEuyqnORBQTLyOQglIGfYJIRjuxnbLvkqZakNqPiGDvgpWYkfxYNXsdoKXZtRkSasfa\nTYwRiJfqsZHBPcJuZQBTnVbkyZZRnidwEuYQnorbQTLYOqGligFyjirJUxnblVKqZaknQpigDVGPwyKfxyNXSDoKxztRKSaSFA",
"output": "0"
},
{
"input": "KhScXYiErQIUtmVhNTCXSLAviefIeHIIdiGhsYnPkSBaDTvMkyanfMLBOvDWgRybLtDqvXVdVjccNunDyijhhZEAKBrdz\nkHsCXyiErqIuTMVHNTCxSLaViEFIEhIIDiGHsYNpKsBAdTvMKyANFMLBovdwGRYbLtdQVxvDVJCcNUndYiJHhzeakBrdZ",
"output": "0"
},
{
"input": "cpPQMpjRQJKQVXjWDYECXbagSmNcVfOuBWNZxihdERraVuiOpSVDCPgTGuSQALNoVjySceHcKXwOEpSzXrEqWwwrYeppNiWhDVg\nCPPqmPjRqJkQvxJwdyECXBAGsMNcVfOuBWNzxIhderRavUiOpSvDCpGTgusqAlNovjyScEhCKXwoePSZxrEQwWwryEPPniWHDvG",
"output": "0"
},
{
"input": "SajcCGMepaLjZIWLRBGFcrZRCRvvoCsIyKsQerbrwsIamxxpRmQSZSalasJLVFbCHCuXJlubciQAvLxXYBazLsMKLHLdDQ\nsaJcCgmEpaLJziWlrBgFcRzrCrVVOcSIykSQerBrwSIamxxPrMqSzSalASjLVFbChCUxjLUbCIQAVlxxybAZLsmkLhLDdQ",
"output": "0"
},
{
"input": "kigPrWNTOUNDBskAfefjhHYZNYdnfZWuXWzHiBxFQryBbAkPtenFwWvCSTYGpzOntUNzNUhxRWjKmicTwLwJAnbAxj\nkigpRWntOUNdBsKaFEFjhhYZnYDNfzWuXwZhibxFQRybbakPteNfwwvcStyGPzoNTunznuHXrWjKMIctWLWJANBAxJ",
"output": "0"
},
{
"input": "nTomZZuTTRTAAPoUsySVFGElrpQRNLjqvFmcYytiheQnjUhPLnqNBiYtQkljbcvmjuNAVKbvQOWpqqFlQhAhULIhquoCnjUI\nntOmzZuttrtAAPOUSySVFgeLRPQrNLjQvfmCyYTiHEQnjuHPlNQNbIYtqKLJBCVmjunavkbvQOWPQQFlqHaHULIHQuOcnJUi",
"output": "0"
},
{
"input": "abac\nadaa",
"output": "-1"
},
{
"input": "Bbc\nabc",
"output": "1"
},
{
"input": "aaaba\naaaab",
"output": "1"
}
] | 1,699,207,616
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 53
| 92
| 0
|
n1 = input()
n2 = input()
if n1.lower() < n2.lower():
print(-1)
elif n1.lower() > n2.lower():
print(1)
else:
print(0)
|
Title: Petya and Strings
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison.
Input Specification:
Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters.
Output Specification:
If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared.
Demo Input:
['aaaa\naaaA\n', 'abs\nAbz\n', 'abcdefg\nAbCdEfF\n']
Demo Output:
['0\n', '-1\n', '1\n']
Note:
If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site:
- http://en.wikipedia.org/wiki/Lexicographical_order
|
```python
n1 = input()
n2 = input()
if n1.lower() < n2.lower():
print(-1)
elif n1.lower() > n2.lower():
print(1)
else:
print(0)
```
| 3.977
|
335
|
A
|
Banana
|
PROGRAMMING
| 1,400
|
[
"binary search",
"constructive algorithms",
"greedy"
] | null | null |
Piegirl is buying stickers for a project. Stickers come on sheets, and each sheet of stickers contains exactly *n* stickers. Each sticker has exactly one character printed on it, so a sheet of stickers can be described by a string of length *n*. Piegirl wants to create a string *s* using stickers. She may buy as many sheets of stickers as she wants, and may specify any string of length *n* for the sheets, but all the sheets must be identical, so the string is the same for all sheets. Once she attains the sheets of stickers, she will take some of the stickers from the sheets and arrange (in any order) them to form *s*. Determine the minimum number of sheets she has to buy, and provide a string describing a possible sheet of stickers she should buy.
|
The first line contains string *s* (1<=≤<=|*s*|<=≤<=1000), consisting of lowercase English characters only. The second line contains an integer *n* (1<=≤<=*n*<=≤<=1000).
|
On the first line, print the minimum number of sheets Piegirl has to buy. On the second line, print a string consisting of *n* lower case English characters. This string should describe a sheet of stickers that Piegirl can buy in order to minimize the number of sheets. If Piegirl cannot possibly form the string *s*, print instead a single line with the number -1.
|
[
"banana\n4\n",
"banana\n3\n",
"banana\n2\n"
] |
[
"2\nbaan\n",
"3\nnab\n",
"-1\n"
] |
In the second example, Piegirl can order 3 sheets of stickers with the characters "nab". She can take characters "nab" from the first sheet, "na" from the second, and "a" from the third, and arrange them to from "banana".
| 500
|
[
{
"input": "banana\n4",
"output": "2\nbaan"
},
{
"input": "banana\n3",
"output": "3\nnab"
},
{
"input": "banana\n2",
"output": "-1"
},
{
"input": "p\n1000",
"output": "1\npaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa..."
},
{
"input": "b\n1",
"output": "1\nb"
},
{
"input": "aba\n2",
"output": "2\nab"
},
{
"input": "aaa\n2",
"output": "2\naa"
},
{
"input": "aa\n3",
"output": "1\naaa"
},
{
"input": "aaaaaaaabbbbbccccccccccccccccccccccccccccccc\n7",
"output": "8\nabcccca"
},
{
"input": "aaaaa\n10",
"output": "1\naaaaaaaaaa"
},
{
"input": "baba\n3",
"output": "2\naba"
},
{
"input": "a\n1000",
"output": "1\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa..."
},
{
"input": "aan\n5",
"output": "1\naanaa"
},
{
"input": "banana\n5",
"output": "2\naabna"
},
{
"input": "a\n5",
"output": "1\naaaaa"
},
{
"input": "aaaaaaa\n5",
"output": "2\naaaaa"
},
{
"input": "abc\n100",
"output": "1\nabcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "zzz\n4",
"output": "1\nzzza"
},
{
"input": "aaabbb\n3",
"output": "3\naba"
},
{
"input": "abc\n5",
"output": "1\nabcaa"
},
{
"input": "abc\n10",
"output": "1\nabcaaaaaaa"
},
{
"input": "aaaaa\n100",
"output": "1\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa"
},
{
"input": "abc\n1000",
"output": "1\nabcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa..."
},
{
"input": "a\n10",
"output": "1\naaaaaaaaaa"
},
{
"input": "bbbbb\n6",
"output": "1\nbbbbba"
},
{
"input": "bnana\n4",
"output": "2\nabna"
},
{
"input": "aaaaaaabbbbbbb\n3",
"output": "7\naba"
},
{
"input": "aabbbcccc\n7",
"output": "2\nabbccaa"
},
{
"input": "aaa\n9",
"output": "1\naaaaaaaaa"
},
{
"input": "a\n2",
"output": "1\naa"
},
{
"input": "cccbba\n10",
"output": "1\nabbcccaaaa"
},
{
"input": "a\n4",
"output": "1\naaaa"
}
] | 1,588,345,807
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 6
| 186
| 307,200
|
import math
def get_max_key(d, keys):
max_key = keys[0]
for key in keys:
if d[max_key] < d[key]:
max_key = key
return max_key
s = input()
n = int(input())
d = dict()
for x in s:
if x in d:
d[x] += 1
else:
d[x] = 1
keys = list(d.keys())
l = len(keys)
if l > n:
print(-1)
else:
sheets_per_char = d
curr_sheets = dict()
for key in keys:
curr_sheets[key] = 1
for _ in range(n-l):
max_key = get_max_key(sheets_per_char, keys)
curr_sheets[max_key] += 1
sheets_per_char[max_key] = math.ceil(d[max_key] / curr_sheets[max_key])
n_sheets = sheets_per_char[get_max_key(sheets_per_char, keys)]
print(n_sheets)
for key in keys:
for _ in range(curr_sheets[key]):
print(key, end="")
|
Title: Banana
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Piegirl is buying stickers for a project. Stickers come on sheets, and each sheet of stickers contains exactly *n* stickers. Each sticker has exactly one character printed on it, so a sheet of stickers can be described by a string of length *n*. Piegirl wants to create a string *s* using stickers. She may buy as many sheets of stickers as she wants, and may specify any string of length *n* for the sheets, but all the sheets must be identical, so the string is the same for all sheets. Once she attains the sheets of stickers, she will take some of the stickers from the sheets and arrange (in any order) them to form *s*. Determine the minimum number of sheets she has to buy, and provide a string describing a possible sheet of stickers she should buy.
Input Specification:
The first line contains string *s* (1<=≤<=|*s*|<=≤<=1000), consisting of lowercase English characters only. The second line contains an integer *n* (1<=≤<=*n*<=≤<=1000).
Output Specification:
On the first line, print the minimum number of sheets Piegirl has to buy. On the second line, print a string consisting of *n* lower case English characters. This string should describe a sheet of stickers that Piegirl can buy in order to minimize the number of sheets. If Piegirl cannot possibly form the string *s*, print instead a single line with the number -1.
Demo Input:
['banana\n4\n', 'banana\n3\n', 'banana\n2\n']
Demo Output:
['2\nbaan\n', '3\nnab\n', '-1\n']
Note:
In the second example, Piegirl can order 3 sheets of stickers with the characters "nab". She can take characters "nab" from the first sheet, "na" from the second, and "a" from the third, and arrange them to from "banana".
|
```python
import math
def get_max_key(d, keys):
max_key = keys[0]
for key in keys:
if d[max_key] < d[key]:
max_key = key
return max_key
s = input()
n = int(input())
d = dict()
for x in s:
if x in d:
d[x] += 1
else:
d[x] = 1
keys = list(d.keys())
l = len(keys)
if l > n:
print(-1)
else:
sheets_per_char = d
curr_sheets = dict()
for key in keys:
curr_sheets[key] = 1
for _ in range(n-l):
max_key = get_max_key(sheets_per_char, keys)
curr_sheets[max_key] += 1
sheets_per_char[max_key] = math.ceil(d[max_key] / curr_sheets[max_key])
n_sheets = sheets_per_char[get_max_key(sheets_per_char, keys)]
print(n_sheets)
for key in keys:
for _ in range(curr_sheets[key]):
print(key, end="")
```
| 0
|
|
609
|
A
|
USB Flash Drives
|
PROGRAMMING
| 800
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives.
|
The first line contains positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of USB flash drives.
The second line contains positive integer *m* (1<=≤<=*m*<=≤<=105) — the size of Sean's file.
Each of the next *n* lines contains positive integer *a**i* (1<=≤<=*a**i*<=≤<=1000) — the sizes of USB flash drives in megabytes.
It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*.
|
Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives.
|
[
"3\n5\n2\n1\n3\n",
"3\n6\n2\n3\n2\n",
"2\n5\n5\n10\n"
] |
[
"2\n",
"3\n",
"1\n"
] |
In the first example Sean needs only two USB flash drives — the first and the third.
In the second example Sean needs all three USB flash drives.
In the third example Sean needs only one USB flash drive and he can use any available USB flash drive — the first or the second.
| 0
|
[
{
"input": "3\n5\n2\n1\n3",
"output": "2"
},
{
"input": "3\n6\n2\n3\n2",
"output": "3"
},
{
"input": "2\n5\n5\n10",
"output": "1"
},
{
"input": "5\n16\n8\n1\n3\n4\n9",
"output": "2"
},
{
"input": "10\n121\n10\n37\n74\n56\n42\n39\n6\n68\n8\n100",
"output": "2"
},
{
"input": "12\n4773\n325\n377\n192\n780\n881\n816\n839\n223\n215\n125\n952\n8",
"output": "7"
},
{
"input": "15\n7758\n182\n272\n763\n910\n24\n359\n583\n890\n735\n819\n66\n992\n440\n496\n227",
"output": "15"
},
{
"input": "30\n70\n6\n2\n10\n4\n7\n10\n5\n1\n8\n10\n4\n3\n5\n9\n3\n6\n6\n4\n2\n6\n5\n10\n1\n9\n7\n2\n1\n10\n7\n5",
"output": "8"
},
{
"input": "40\n15705\n702\n722\n105\n873\n417\n477\n794\n300\n869\n496\n572\n232\n456\n298\n473\n584\n486\n713\n934\n121\n303\n956\n934\n840\n358\n201\n861\n497\n131\n312\n957\n96\n914\n509\n60\n300\n722\n658\n820\n103",
"output": "21"
},
{
"input": "50\n18239\n300\n151\n770\n9\n200\n52\n247\n753\n523\n263\n744\n463\n540\n244\n608\n569\n771\n32\n425\n777\n624\n761\n628\n124\n405\n396\n726\n626\n679\n237\n229\n49\n512\n18\n671\n290\n768\n632\n739\n18\n136\n413\n117\n83\n413\n452\n767\n664\n203\n404",
"output": "31"
},
{
"input": "70\n149\n5\n3\n3\n4\n6\n1\n2\n9\n8\n3\n1\n8\n4\n4\n3\n6\n10\n7\n1\n10\n8\n4\n9\n3\n8\n3\n2\n5\n1\n8\n6\n9\n10\n4\n8\n6\n9\n9\n9\n3\n4\n2\n2\n5\n8\n9\n1\n10\n3\n4\n3\n1\n9\n3\n5\n1\n3\n7\n6\n9\n8\n9\n1\n7\n4\n4\n2\n3\n5\n7",
"output": "17"
},
{
"input": "70\n2731\n26\n75\n86\n94\n37\n25\n32\n35\n92\n1\n51\n73\n53\n66\n16\n80\n15\n81\n100\n87\n55\n48\n30\n71\n39\n87\n77\n25\n70\n22\n75\n23\n97\n16\n75\n95\n61\n61\n28\n10\n78\n54\n80\n51\n25\n24\n90\n58\n4\n77\n40\n54\n53\n47\n62\n30\n38\n71\n97\n71\n60\n58\n1\n21\n15\n55\n99\n34\n88\n99",
"output": "35"
},
{
"input": "70\n28625\n34\n132\n181\n232\n593\n413\n862\n887\n808\n18\n35\n89\n356\n640\n339\n280\n975\n82\n345\n398\n948\n372\n91\n755\n75\n153\n948\n603\n35\n694\n722\n293\n363\n884\n264\n813\n175\n169\n646\n138\n449\n488\n828\n417\n134\n84\n763\n288\n845\n801\n556\n972\n332\n564\n934\n699\n842\n942\n644\n203\n406\n140\n37\n9\n423\n546\n675\n491\n113\n587",
"output": "45"
},
{
"input": "80\n248\n3\n9\n4\n5\n10\n7\n2\n6\n2\n2\n8\n2\n1\n3\n7\n9\n2\n8\n4\n4\n8\n5\n4\n4\n10\n2\n1\n4\n8\n4\n10\n1\n2\n10\n2\n3\n3\n1\n1\n8\n9\n5\n10\n2\n8\n10\n5\n3\n6\n1\n7\n8\n9\n10\n5\n10\n10\n2\n10\n1\n2\n4\n1\n9\n4\n7\n10\n8\n5\n8\n1\n4\n2\n2\n3\n9\n9\n9\n10\n6",
"output": "27"
},
{
"input": "80\n2993\n18\n14\n73\n38\n14\n73\n77\n18\n81\n6\n96\n65\n77\n86\n76\n8\n16\n81\n83\n83\n34\n69\n58\n15\n19\n1\n16\n57\n95\n35\n5\n49\n8\n15\n47\n84\n99\n94\n93\n55\n43\n47\n51\n61\n57\n13\n7\n92\n14\n4\n83\n100\n60\n75\n41\n95\n74\n40\n1\n4\n95\n68\n59\n65\n15\n15\n75\n85\n46\n77\n26\n30\n51\n64\n75\n40\n22\n88\n68\n24",
"output": "38"
},
{
"input": "80\n37947\n117\n569\n702\n272\n573\n629\n90\n337\n673\n589\n576\n205\n11\n284\n645\n719\n777\n271\n567\n466\n251\n402\n3\n97\n288\n699\n208\n173\n530\n782\n266\n395\n957\n159\n463\n43\n316\n603\n197\n386\n132\n799\n778\n905\n784\n71\n851\n963\n883\n705\n454\n275\n425\n727\n223\n4\n870\n833\n431\n463\n85\n505\n800\n41\n954\n981\n242\n578\n336\n48\n858\n702\n349\n929\n646\n528\n993\n506\n274\n227",
"output": "70"
},
{
"input": "90\n413\n5\n8\n10\n7\n5\n7\n5\n7\n1\n7\n8\n4\n3\n9\n4\n1\n10\n3\n1\n10\n9\n3\n1\n8\n4\n7\n5\n2\n9\n3\n10\n10\n3\n6\n3\n3\n10\n7\n5\n1\n1\n2\n4\n8\n2\n5\n5\n3\n9\n5\n5\n3\n10\n2\n3\n8\n5\n9\n1\n3\n6\n5\n9\n2\n3\n7\n10\n3\n4\n4\n1\n5\n9\n2\n6\n9\n1\n1\n9\n9\n7\n7\n7\n8\n4\n5\n3\n4\n6\n9",
"output": "59"
},
{
"input": "90\n4226\n33\n43\n83\n46\n75\n14\n88\n36\n8\n25\n47\n4\n96\n19\n33\n49\n65\n17\n59\n72\n1\n55\n94\n92\n27\n33\n39\n14\n62\n79\n12\n89\n22\n86\n13\n19\n77\n53\n96\n74\n24\n25\n17\n64\n71\n81\n87\n52\n72\n55\n49\n74\n36\n65\n86\n91\n33\n61\n97\n38\n87\n61\n14\n73\n95\n43\n67\n42\n67\n22\n12\n62\n32\n96\n24\n49\n82\n46\n89\n36\n75\n91\n11\n10\n9\n33\n86\n28\n75\n39",
"output": "64"
},
{
"input": "90\n40579\n448\n977\n607\n745\n268\n826\n479\n59\n330\n609\n43\n301\n970\n726\n172\n632\n600\n181\n712\n195\n491\n312\n849\n722\n679\n682\n780\n131\n404\n293\n387\n567\n660\n54\n339\n111\n833\n612\n911\n869\n356\n884\n635\n126\n639\n712\n473\n663\n773\n435\n32\n973\n484\n662\n464\n699\n274\n919\n95\n904\n253\n589\n543\n454\n250\n349\n237\n829\n511\n536\n36\n45\n152\n626\n384\n199\n877\n941\n84\n781\n115\n20\n52\n726\n751\n920\n291\n571\n6\n199",
"output": "64"
},
{
"input": "100\n66\n7\n9\n10\n5\n2\n8\n6\n5\n4\n10\n10\n6\n5\n2\n2\n1\n1\n5\n8\n7\n8\n10\n5\n6\n6\n5\n9\n9\n6\n3\n8\n7\n10\n5\n9\n6\n7\n3\n5\n8\n6\n8\n9\n1\n1\n1\n2\n4\n5\n5\n1\n1\n2\n6\n7\n1\n5\n8\n7\n2\n1\n7\n10\n9\n10\n2\n4\n10\n4\n10\n10\n5\n3\n9\n1\n2\n1\n10\n5\n1\n7\n4\n4\n5\n7\n6\n10\n4\n7\n3\n4\n3\n6\n2\n5\n2\n4\n9\n5\n3",
"output": "7"
},
{
"input": "100\n4862\n20\n47\n85\n47\n76\n38\n48\n93\n91\n81\n31\n51\n23\n60\n59\n3\n73\n72\n57\n67\n54\n9\n42\n5\n32\n46\n72\n79\n95\n61\n79\n88\n33\n52\n97\n10\n3\n20\n79\n82\n93\n90\n38\n80\n18\n21\n43\n60\n73\n34\n75\n65\n10\n84\n100\n29\n94\n56\n22\n59\n95\n46\n22\n57\n69\n67\n90\n11\n10\n61\n27\n2\n48\n69\n86\n91\n69\n76\n36\n71\n18\n54\n90\n74\n69\n50\n46\n8\n5\n41\n96\n5\n14\n55\n85\n39\n6\n79\n75\n87",
"output": "70"
},
{
"input": "100\n45570\n14\n881\n678\n687\n993\n413\n760\n451\n426\n787\n503\n343\n234\n530\n294\n725\n941\n524\n574\n441\n798\n399\n360\n609\n376\n525\n229\n995\n478\n347\n47\n23\n468\n525\n749\n601\n235\n89\n995\n489\n1\n239\n415\n122\n671\n128\n357\n886\n401\n964\n212\n968\n210\n130\n871\n360\n661\n844\n414\n187\n21\n824\n266\n713\n126\n496\n916\n37\n193\n755\n894\n641\n300\n170\n176\n383\n488\n627\n61\n897\n33\n242\n419\n881\n698\n107\n391\n418\n774\n905\n87\n5\n896\n835\n318\n373\n916\n393\n91\n460",
"output": "78"
},
{
"input": "100\n522\n1\n5\n2\n4\n2\n6\n3\n4\n2\n10\n10\n6\n7\n9\n7\n1\n7\n2\n5\n3\n1\n5\n2\n3\n5\n1\n7\n10\n10\n4\n4\n10\n9\n10\n6\n2\n8\n2\n6\n10\n9\n2\n7\n5\n9\n4\n6\n10\n7\n3\n1\n1\n9\n5\n10\n9\n2\n8\n3\n7\n5\n4\n7\n5\n9\n10\n6\n2\n9\n2\n5\n10\n1\n7\n7\n10\n5\n6\n2\n9\n4\n7\n10\n10\n8\n3\n4\n9\n3\n6\n9\n10\n2\n9\n9\n3\n4\n1\n10\n2",
"output": "74"
},
{
"input": "100\n32294\n414\n116\n131\n649\n130\n476\n630\n605\n213\n117\n757\n42\n109\n85\n127\n635\n629\n994\n410\n764\n204\n161\n231\n577\n116\n936\n537\n565\n571\n317\n722\n819\n229\n284\n487\n649\n304\n628\n727\n816\n854\n91\n111\n549\n87\n374\n417\n3\n868\n882\n168\n743\n77\n534\n781\n75\n956\n910\n734\n507\n568\n802\n946\n891\n659\n116\n678\n375\n380\n430\n627\n873\n350\n930\n285\n6\n183\n96\n517\n81\n794\n235\n360\n551\n6\n28\n799\n226\n996\n894\n981\n551\n60\n40\n460\n479\n161\n318\n952\n433",
"output": "42"
},
{
"input": "100\n178\n71\n23\n84\n98\n8\n14\n4\n42\n56\n83\n87\n28\n22\n32\n50\n5\n96\n90\n1\n59\n74\n56\n96\n77\n88\n71\n38\n62\n36\n85\n1\n97\n98\n98\n32\n99\n42\n6\n81\n20\n49\n57\n71\n66\n9\n45\n41\n29\n28\n32\n68\n38\n29\n35\n29\n19\n27\n76\n85\n68\n68\n41\n32\n78\n72\n38\n19\n55\n83\n83\n25\n46\n62\n48\n26\n53\n14\n39\n31\n94\n84\n22\n39\n34\n96\n63\n37\n42\n6\n78\n76\n64\n16\n26\n6\n79\n53\n24\n29\n63",
"output": "2"
},
{
"input": "100\n885\n226\n266\n321\n72\n719\n29\n121\n533\n85\n672\n225\n830\n783\n822\n30\n791\n618\n166\n487\n922\n434\n814\n473\n5\n741\n947\n910\n305\n998\n49\n945\n588\n868\n809\n803\n168\n280\n614\n434\n634\n538\n591\n437\n540\n445\n313\n177\n171\n799\n778\n55\n617\n554\n583\n611\n12\n94\n599\n182\n765\n556\n965\n542\n35\n460\n177\n313\n485\n744\n384\n21\n52\n879\n792\n411\n614\n811\n565\n695\n428\n587\n631\n794\n461\n258\n193\n696\n936\n646\n756\n267\n55\n690\n730\n742\n734\n988\n235\n762\n440",
"output": "1"
},
{
"input": "100\n29\n9\n2\n10\n8\n6\n7\n7\n3\n3\n10\n4\n5\n2\n5\n1\n6\n3\n2\n5\n10\n10\n9\n1\n4\n5\n2\n2\n3\n1\n2\n2\n9\n6\n9\n7\n8\n8\n1\n5\n5\n3\n1\n5\n6\n1\n9\n2\n3\n8\n10\n8\n3\n2\n7\n1\n2\n1\n2\n8\n10\n5\n2\n3\n1\n10\n7\n1\n7\n4\n9\n6\n6\n4\n7\n1\n2\n7\n7\n9\n9\n7\n10\n4\n10\n8\n2\n1\n5\n5\n10\n5\n8\n1\n5\n6\n5\n1\n5\n6\n8",
"output": "3"
},
{
"input": "100\n644\n94\n69\n43\n36\n54\n93\n30\n74\n56\n95\n70\n49\n11\n36\n57\n30\n59\n3\n52\n59\n90\n82\n39\n67\n32\n8\n80\n64\n8\n65\n51\n48\n89\n90\n35\n4\n54\n66\n96\n68\n90\n30\n4\n13\n97\n41\n90\n85\n17\n45\n94\n31\n58\n4\n39\n76\n95\n92\n59\n67\n46\n96\n55\n82\n64\n20\n20\n83\n46\n37\n15\n60\n37\n79\n45\n47\n63\n73\n76\n31\n52\n36\n32\n49\n26\n61\n91\n31\n25\n62\n90\n65\n65\n5\n94\n7\n15\n97\n88\n68",
"output": "7"
},
{
"input": "100\n1756\n98\n229\n158\n281\n16\n169\n149\n239\n235\n182\n147\n215\n49\n270\n194\n242\n295\n289\n249\n19\n12\n144\n157\n92\n270\n122\n212\n97\n152\n14\n42\n12\n198\n98\n295\n154\n229\n191\n294\n5\n156\n43\n185\n184\n20\n125\n23\n10\n257\n244\n264\n79\n46\n277\n13\n22\n97\n212\n77\n293\n20\n51\n17\n109\n37\n68\n117\n51\n248\n10\n149\n179\n192\n239\n161\n13\n173\n297\n73\n43\n109\n288\n198\n81\n70\n254\n187\n277\n1\n295\n113\n95\n291\n293\n119\n205\n191\n37\n34\n116",
"output": "6"
},
{
"input": "100\n20562\n721\n452\n11\n703\n376\n183\n197\n203\n406\n642\n346\n446\n256\n760\n201\n360\n702\n707\n388\n779\n653\n610\n497\n768\n670\n134\n780\n306\n661\n180\n259\n256\n362\n6\n121\n415\n747\n170\n67\n439\n728\n193\n622\n481\n38\n225\n343\n303\n253\n436\n305\n68\n794\n247\n291\n600\n750\n188\n199\n757\n28\n776\n749\n253\n351\n53\n629\n129\n578\n209\n89\n651\n262\n638\n353\n469\n31\n144\n460\n176\n535\n562\n366\n639\n234\n577\n364\n761\n617\n303\n450\n778\n311\n289\n221\n274\n239\n626\n194\n36",
"output": "30"
},
{
"input": "100\n32630\n548\n21\n756\n138\n56\n719\n97\n86\n599\n531\n464\n137\n737\n239\n626\n179\n170\n271\n335\n178\n298\n597\n616\n104\n190\n216\n333\n606\n621\n310\n70\n286\n593\n655\n472\n556\n77\n625\n744\n395\n487\n762\n316\n469\n258\n475\n596\n651\n180\n737\n101\n511\n708\n163\n713\n475\n557\n649\n705\n583\n97\n447\n119\n91\n372\n194\n394\n667\n384\n635\n611\n746\n758\n613\n54\n508\n405\n188\n570\n254\n28\n599\n767\n115\n737\n194\n148\n686\n705\n236\n762\n613\n770\n633\n401\n773\n448\n274\n141\n718",
"output": "52"
},
{
"input": "1\n1\n1",
"output": "1"
}
] | 1,561,177,689
| 189
|
Python 3
|
OK
|
TESTS
| 34
| 124
| 0
|
n = input(); n =int(n) # n usbs
m = input(); m = int(m) # file size
caps = [] # capacities
for i in range(int(n)):
cap = input(); cap = int(cap)
caps.append(cap)
caps.sort(reverse=True)
count = 0
value = 0
for cap in caps:
count += 1
value = value + cap
if value >= m:
break
print(count)
|
Title: USB Flash Drives
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives.
Input Specification:
The first line contains positive integer *n* (1<=≤<=*n*<=≤<=100) — the number of USB flash drives.
The second line contains positive integer *m* (1<=≤<=*m*<=≤<=105) — the size of Sean's file.
Each of the next *n* lines contains positive integer *a**i* (1<=≤<=*a**i*<=≤<=1000) — the sizes of USB flash drives in megabytes.
It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*.
Output Specification:
Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives.
Demo Input:
['3\n5\n2\n1\n3\n', '3\n6\n2\n3\n2\n', '2\n5\n5\n10\n']
Demo Output:
['2\n', '3\n', '1\n']
Note:
In the first example Sean needs only two USB flash drives — the first and the third.
In the second example Sean needs all three USB flash drives.
In the third example Sean needs only one USB flash drive and he can use any available USB flash drive — the first or the second.
|
```python
n = input(); n =int(n) # n usbs
m = input(); m = int(m) # file size
caps = [] # capacities
for i in range(int(n)):
cap = input(); cap = int(cap)
caps.append(cap)
caps.sort(reverse=True)
count = 0
value = 0
for cap in caps:
count += 1
value = value + cap
if value >= m:
break
print(count)
```
| 3
|
|
217
|
A
|
Ice Skating
|
PROGRAMMING
| 1,200
|
[
"brute force",
"dfs and similar",
"dsu",
"graphs"
] | null | null |
Bajtek is learning to skate on ice. He's a beginner, so his only mode of transportation is pushing off from a snow drift to the north, east, south or west and sliding until he lands in another snow drift. He has noticed that in this way it's impossible to get from some snow drifts to some other by any sequence of moves. He now wants to heap up some additional snow drifts, so that he can get from any snow drift to any other one. He asked you to find the minimal number of snow drifts that need to be created.
We assume that Bajtek can only heap up snow drifts at integer coordinates.
|
The first line of input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of snow drifts. Each of the following *n* lines contains two integers *x**i* and *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=1000) — the coordinates of the *i*-th snow drift.
Note that the north direction coinсides with the direction of *Oy* axis, so the east direction coinсides with the direction of the *Ox* axis. All snow drift's locations are distinct.
|
Output the minimal number of snow drifts that need to be created in order for Bajtek to be able to reach any snow drift from any other one.
|
[
"2\n2 1\n1 2\n",
"2\n2 1\n4 1\n"
] |
[
"1\n",
"0\n"
] |
none
| 500
|
[
{
"input": "2\n2 1\n1 2",
"output": "1"
},
{
"input": "2\n2 1\n4 1",
"output": "0"
},
{
"input": "24\n171 35\n261 20\n4 206\n501 446\n961 912\n581 748\n946 978\n463 514\n841 889\n341 466\n842 967\n54 102\n235 261\n925 889\n682 672\n623 636\n268 94\n635 710\n474 510\n697 794\n586 663\n182 184\n806 663\n468 459",
"output": "21"
},
{
"input": "17\n660 646\n440 442\n689 618\n441 415\n922 865\n950 972\n312 366\n203 229\n873 860\n219 199\n344 308\n169 176\n961 992\n153 84\n201 230\n987 938\n834 815",
"output": "16"
},
{
"input": "11\n798 845\n722 911\n374 270\n629 537\n748 856\n831 885\n486 641\n751 829\n609 492\n98 27\n654 663",
"output": "10"
},
{
"input": "1\n321 88",
"output": "0"
},
{
"input": "9\n811 859\n656 676\n76 141\n945 951\n497 455\n18 55\n335 294\n267 275\n656 689",
"output": "7"
},
{
"input": "7\n948 946\n130 130\n761 758\n941 938\n971 971\n387 385\n509 510",
"output": "6"
},
{
"input": "6\n535 699\n217 337\n508 780\n180 292\n393 112\n732 888",
"output": "5"
},
{
"input": "14\n25 23\n499 406\n193 266\n823 751\n219 227\n101 138\n978 992\n43 74\n997 932\n237 189\n634 538\n774 740\n842 767\n742 802",
"output": "13"
},
{
"input": "12\n548 506\n151 198\n370 380\n655 694\n654 690\n407 370\n518 497\n819 827\n765 751\n802 771\n741 752\n653 662",
"output": "11"
},
{
"input": "40\n685 711\n433 403\n703 710\n491 485\n616 619\n288 282\n884 871\n367 352\n500 511\n977 982\n51 31\n576 564\n508 519\n755 762\n22 20\n368 353\n232 225\n953 955\n452 436\n311 330\n967 988\n369 364\n791 803\n150 149\n651 661\n118 93\n398 387\n748 766\n852 852\n230 228\n555 545\n515 519\n667 678\n867 862\n134 146\n859 863\n96 99\n486 469\n303 296\n780 786",
"output": "38"
},
{
"input": "3\n175 201\n907 909\n388 360",
"output": "2"
},
{
"input": "7\n312 298\n86 78\n73 97\n619 594\n403 451\n538 528\n71 86",
"output": "6"
},
{
"input": "19\n802 820\n368 248\n758 794\n455 378\n876 888\n771 814\n245 177\n586 555\n844 842\n364 360\n820 856\n731 624\n982 975\n825 856\n122 121\n862 896\n42 4\n792 841\n828 820",
"output": "16"
},
{
"input": "32\n643 877\n842 614\n387 176\n99 338\n894 798\n652 728\n611 648\n622 694\n579 781\n243 46\n322 305\n198 438\n708 579\n246 325\n536 459\n874 593\n120 277\n989 907\n223 110\n35 130\n761 692\n690 661\n518 766\n226 93\n678 597\n725 617\n661 574\n775 496\n56 416\n14 189\n358 359\n898 901",
"output": "31"
},
{
"input": "32\n325 327\n20 22\n72 74\n935 933\n664 663\n726 729\n785 784\n170 171\n315 314\n577 580\n984 987\n313 317\n434 435\n962 961\n55 54\n46 44\n743 742\n434 433\n617 612\n332 332\n883 886\n940 936\n793 792\n645 644\n611 607\n418 418\n465 465\n219 218\n167 164\n56 54\n403 405\n210 210",
"output": "29"
},
{
"input": "32\n652 712\n260 241\n27 154\n188 16\n521 351\n518 356\n452 540\n790 827\n339 396\n336 551\n897 930\n828 627\n27 168\n180 113\n134 67\n794 671\n812 711\n100 241\n686 813\n138 289\n384 506\n884 932\n913 959\n470 508\n730 734\n373 478\n788 862\n392 426\n148 68\n113 49\n713 852\n924 894",
"output": "29"
},
{
"input": "14\n685 808\n542 677\n712 747\n832 852\n187 410\n399 338\n626 556\n530 635\n267 145\n215 209\n559 684\n944 949\n753 596\n601 823",
"output": "13"
},
{
"input": "5\n175 158\n16 2\n397 381\n668 686\n957 945",
"output": "4"
},
{
"input": "5\n312 284\n490 509\n730 747\n504 497\n782 793",
"output": "4"
},
{
"input": "2\n802 903\n476 348",
"output": "1"
},
{
"input": "4\n325 343\n425 442\n785 798\n275 270",
"output": "3"
},
{
"input": "28\n462 483\n411 401\n118 94\n111 127\n5 6\n70 52\n893 910\n73 63\n818 818\n182 201\n642 633\n900 886\n893 886\n684 700\n157 173\n953 953\n671 660\n224 225\n832 801\n152 157\n601 585\n115 101\n739 722\n611 606\n659 642\n461 469\n702 689\n649 653",
"output": "25"
},
{
"input": "36\n952 981\n885 900\n803 790\n107 129\n670 654\n143 132\n66 58\n813 819\n849 837\n165 198\n247 228\n15 39\n619 618\n105 138\n868 855\n965 957\n293 298\n613 599\n227 212\n745 754\n723 704\n877 858\n503 487\n678 697\n592 595\n155 135\n962 982\n93 89\n660 673\n225 212\n967 987\n690 680\n804 813\n489 518\n240 221\n111 124",
"output": "34"
},
{
"input": "30\n89 3\n167 156\n784 849\n943 937\n144 95\n24 159\n80 120\n657 683\n585 596\n43 147\n909 964\n131 84\n345 389\n333 321\n91 126\n274 325\n859 723\n866 922\n622 595\n690 752\n902 944\n127 170\n426 383\n905 925\n172 284\n793 810\n414 510\n890 884\n123 24\n267 255",
"output": "29"
},
{
"input": "5\n664 666\n951 941\n739 742\n844 842\n2 2",
"output": "4"
},
{
"input": "3\n939 867\n411 427\n757 708",
"output": "2"
},
{
"input": "36\n429 424\n885 972\n442 386\n512 511\n751 759\n4 115\n461 497\n496 408\n8 23\n542 562\n296 331\n448 492\n412 395\n109 166\n622 640\n379 355\n251 262\n564 586\n66 115\n275 291\n666 611\n629 534\n510 567\n635 666\n738 803\n420 369\n92 17\n101 144\n141 92\n258 258\n184 235\n492 456\n311 210\n394 357\n531 512\n634 636",
"output": "34"
},
{
"input": "29\n462 519\n871 825\n127 335\n156 93\n576 612\n885 830\n634 779\n340 105\n744 795\n716 474\n93 139\n563 805\n137 276\n177 101\n333 14\n391 437\n873 588\n817 518\n460 597\n572 670\n140 303\n392 441\n273 120\n862 578\n670 639\n410 161\n544 577\n193 116\n252 195",
"output": "28"
},
{
"input": "23\n952 907\n345 356\n812 807\n344 328\n242 268\n254 280\n1000 990\n80 78\n424 396\n595 608\n755 813\n383 380\n55 56\n598 633\n203 211\n508 476\n600 593\n206 192\n855 882\n517 462\n967 994\n642 657\n493 488",
"output": "22"
},
{
"input": "10\n579 816\n806 590\n830 787\n120 278\n677 800\n16 67\n188 251\n559 560\n87 67\n104 235",
"output": "8"
},
{
"input": "23\n420 424\n280 303\n515 511\n956 948\n799 803\n441 455\n362 369\n299 289\n823 813\n982 967\n876 878\n185 157\n529 551\n964 989\n655 656\n1 21\n114 112\n45 56\n935 937\n1000 997\n934 942\n360 366\n648 621",
"output": "22"
},
{
"input": "23\n102 84\n562 608\n200 127\n952 999\n465 496\n322 367\n728 690\n143 147\n855 867\n861 866\n26 59\n300 273\n255 351\n192 246\n70 111\n365 277\n32 104\n298 319\n330 354\n241 141\n56 125\n315 298\n412 461",
"output": "22"
},
{
"input": "7\n429 506\n346 307\n99 171\n853 916\n322 263\n115 157\n906 924",
"output": "6"
},
{
"input": "3\n1 1\n2 1\n2 2",
"output": "0"
},
{
"input": "4\n1 1\n1 2\n2 1\n2 2",
"output": "0"
},
{
"input": "5\n1 1\n1 2\n2 2\n3 1\n3 3",
"output": "0"
},
{
"input": "6\n1 1\n1 2\n2 2\n3 1\n3 2\n3 3",
"output": "0"
},
{
"input": "20\n1 1\n2 2\n3 3\n3 9\n4 4\n5 2\n5 5\n5 7\n5 8\n6 2\n6 6\n6 9\n7 7\n8 8\n9 4\n9 7\n9 9\n10 2\n10 9\n10 10",
"output": "1"
},
{
"input": "21\n1 1\n1 9\n2 1\n2 2\n2 5\n2 6\n2 9\n3 3\n3 8\n4 1\n4 4\n5 5\n5 8\n6 6\n7 7\n8 8\n9 9\n10 4\n10 10\n11 5\n11 11",
"output": "1"
},
{
"input": "22\n1 1\n1 3\n1 4\n1 8\n1 9\n1 11\n2 2\n3 3\n4 4\n4 5\n5 5\n6 6\n6 8\n7 7\n8 3\n8 4\n8 8\n9 9\n10 10\n11 4\n11 9\n11 11",
"output": "3"
},
{
"input": "50\n1 1\n2 2\n2 9\n3 3\n4 4\n4 9\n4 16\n4 24\n5 5\n6 6\n7 7\n8 8\n8 9\n8 20\n9 9\n10 10\n11 11\n12 12\n13 13\n14 7\n14 14\n14 16\n14 25\n15 4\n15 6\n15 15\n15 22\n16 6\n16 16\n17 17\n18 18\n19 6\n19 19\n20 20\n21 21\n22 6\n22 22\n23 23\n24 6\n24 7\n24 8\n24 9\n24 24\n25 1\n25 3\n25 5\n25 7\n25 23\n25 24\n25 25",
"output": "7"
},
{
"input": "55\n1 1\n1 14\n2 2\n2 19\n3 1\n3 3\n3 8\n3 14\n3 23\n4 1\n4 4\n5 5\n5 8\n5 15\n6 2\n6 3\n6 4\n6 6\n7 7\n8 8\n8 21\n9 9\n10 1\n10 10\n11 9\n11 11\n12 12\n13 13\n14 14\n15 15\n15 24\n16 5\n16 16\n17 5\n17 10\n17 17\n17 18\n17 22\n17 27\n18 18\n19 19\n20 20\n21 20\n21 21\n22 22\n23 23\n24 14\n24 24\n25 25\n26 8\n26 11\n26 26\n27 3\n27 27\n28 28",
"output": "5"
},
{
"input": "3\n1 2\n2 1\n2 2",
"output": "0"
},
{
"input": "6\n4 4\n3 4\n5 4\n4 5\n4 3\n3 1",
"output": "0"
},
{
"input": "4\n1 1\n1 2\n2 1\n2 2",
"output": "0"
},
{
"input": "3\n1 1\n2 2\n1 2",
"output": "0"
},
{
"input": "8\n1 3\n1 1\n4 1\n2 2\n2 5\n5 9\n5 1\n5 4",
"output": "1"
},
{
"input": "10\n1 1\n1 2\n1 3\n1 4\n5 5\n6 6\n7 7\n8 8\n9 9\n100 100",
"output": "6"
},
{
"input": "7\n1 1\n2 2\n3 3\n4 4\n1 2\n2 3\n3 4",
"output": "0"
},
{
"input": "6\n1 1\n2 1\n2 2\n2 4\n4 3\n2 3",
"output": "0"
},
{
"input": "4\n3 1\n2 1\n2 2\n1 2",
"output": "0"
},
{
"input": "6\n1 1\n2 2\n2 1\n2 4\n4 3\n2 3",
"output": "0"
},
{
"input": "3\n1 2\n1 3\n1 4",
"output": "0"
},
{
"input": "4\n1 1\n2 2\n1 2\n2 1",
"output": "0"
},
{
"input": "4\n1 3\n2 1\n3 2\n3 1",
"output": "1"
},
{
"input": "7\n1 1\n1 2\n2 2\n3 3\n3 4\n4 4\n1 4",
"output": "0"
},
{
"input": "21\n12 12\n13 12\n12 11\n13 13\n10 10\n11 10\n11 11\n501 500\n501 501\n503 502\n500 500\n503 503\n502 501\n502 502\n700 700\n702 702\n703 702\n701 701\n702 701\n703 703\n701 700",
"output": "2"
},
{
"input": "6\n1 11\n6 8\n11 10\n1 10\n11 11\n6 9",
"output": "1"
},
{
"input": "4\n1 1\n2 2\n3 2\n3 1",
"output": "0"
},
{
"input": "3\n1 2\n3 4\n3 2",
"output": "0"
},
{
"input": "3\n1 1\n1 2\n2 2",
"output": "0"
},
{
"input": "4\n5 5\n5 4\n6 3\n6 4",
"output": "0"
},
{
"input": "3\n1 1\n2 2\n2 1",
"output": "0"
}
] | 1,632,621,992
| 2,147,483,647
|
PyPy 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
from collections import defaultdict
def dfs(x, y, visited_coords, s):
visited_coords[s]=True
for i in range(n):
if(not visited_coords[i] and (x[s]==x[i] or y[s]==y[i])):
dfs(x,y,visited_coords,i)
visited_coords=defaultdict(lambda:False,{})
x,y = [],[]
n = int(input())
for i in range(n):
x1, y1 = [int(m) for m in input().split()]
x.append(x1)
y.append(y1)
r=0
for i in range(n):
if(not visited_coords[i]):
dfs(x,y,visited_coords,i)
r+=1
print(r-1)
|
Title: Ice Skating
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bajtek is learning to skate on ice. He's a beginner, so his only mode of transportation is pushing off from a snow drift to the north, east, south or west and sliding until he lands in another snow drift. He has noticed that in this way it's impossible to get from some snow drifts to some other by any sequence of moves. He now wants to heap up some additional snow drifts, so that he can get from any snow drift to any other one. He asked you to find the minimal number of snow drifts that need to be created.
We assume that Bajtek can only heap up snow drifts at integer coordinates.
Input Specification:
The first line of input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of snow drifts. Each of the following *n* lines contains two integers *x**i* and *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=1000) — the coordinates of the *i*-th snow drift.
Note that the north direction coinсides with the direction of *Oy* axis, so the east direction coinсides with the direction of the *Ox* axis. All snow drift's locations are distinct.
Output Specification:
Output the minimal number of snow drifts that need to be created in order for Bajtek to be able to reach any snow drift from any other one.
Demo Input:
['2\n2 1\n1 2\n', '2\n2 1\n4 1\n']
Demo Output:
['1\n', '0\n']
Note:
none
|
```python
from collections import defaultdict
def dfs(x, y, visited_coords, s):
visited_coords[s]=True
for i in range(n):
if(not visited_coords[i] and (x[s]==x[i] or y[s]==y[i])):
dfs(x,y,visited_coords,i)
visited_coords=defaultdict(lambda:False,{})
x,y = [],[]
n = int(input())
for i in range(n):
x1, y1 = [int(m) for m in input().split()]
x.append(x1)
y.append(y1)
r=0
for i in range(n):
if(not visited_coords[i]):
dfs(x,y,visited_coords,i)
r+=1
print(r-1)
```
| -1
|
|
770
|
A
|
New Password
|
PROGRAMMING
| 800
|
[
"*special",
"implementation"
] | null | null |
Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help.
Innokentiy decides that new password should satisfy the following conditions:
- the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct.
Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions.
|
The first line contains two positive integers *n* and *k* (2<=≤<=*n*<=≤<=100, 2<=≤<=*k*<=≤<=*min*(*n*,<=26)) — the length of the password and the number of distinct symbols in it.
Pay attention that a desired new password always exists.
|
Print any password which satisfies all conditions given by Innokentiy.
|
[
"4 3\n",
"6 6\n",
"5 2\n"
] |
[
"java\n",
"python\n",
"phphp\n"
] |
In the first test there is one of the appropriate new passwords — java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it.
In the second test there is one of the appropriate new passwords — python, because its length is equal to 6 and it consists of 6 distinct lowercase letters.
In the third test there is one of the appropriate new passwords — phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it.
Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
| 500
|
[
{
"input": "4 3",
"output": "abca"
},
{
"input": "6 6",
"output": "abcdef"
},
{
"input": "5 2",
"output": "ababa"
},
{
"input": "3 2",
"output": "aba"
},
{
"input": "10 2",
"output": "ababababab"
},
{
"input": "26 13",
"output": "abcdefghijklmabcdefghijklm"
},
{
"input": "100 2",
"output": "abababababababababababababababababababababababababababababababababababababababababababababababababab"
},
{
"input": "100 10",
"output": "abcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij"
},
{
"input": "3 3",
"output": "abc"
},
{
"input": "6 3",
"output": "abcabc"
},
{
"input": "10 3",
"output": "abcabcabca"
},
{
"input": "50 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcab"
},
{
"input": "90 2",
"output": "ababababababababababababababababababababababababababababababababababababababababababababab"
},
{
"input": "6 2",
"output": "ababab"
},
{
"input": "99 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabc"
},
{
"input": "4 2",
"output": "abab"
},
{
"input": "100 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca"
},
{
"input": "40 22",
"output": "abcdefghijklmnopqrstuvabcdefghijklmnopqr"
},
{
"input": "13 8",
"output": "abcdefghabcde"
},
{
"input": "16 15",
"output": "abcdefghijklmnoa"
},
{
"input": "17 17",
"output": "abcdefghijklmnopq"
},
{
"input": "19 4",
"output": "abcdabcdabcdabcdabc"
},
{
"input": "100 26",
"output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv"
},
{
"input": "100 25",
"output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxy"
},
{
"input": "26 26",
"output": "abcdefghijklmnopqrstuvwxyz"
},
{
"input": "27 26",
"output": "abcdefghijklmnopqrstuvwxyza"
},
{
"input": "2 2",
"output": "ab"
},
{
"input": "26 25",
"output": "abcdefghijklmnopqrstuvwxya"
},
{
"input": "99 2",
"output": "abababababababababababababababababababababababababababababababababababababababababababababababababa"
},
{
"input": "99 26",
"output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstu"
},
{
"input": "4 4",
"output": "abcd"
},
{
"input": "5 3",
"output": "abcab"
},
{
"input": "5 4",
"output": "abcda"
},
{
"input": "5 5",
"output": "abcde"
},
{
"input": "24 22",
"output": "abcdefghijklmnopqrstuvab"
},
{
"input": "26 14",
"output": "abcdefghijklmnabcdefghijkl"
},
{
"input": "26 15",
"output": "abcdefghijklmnoabcdefghijk"
},
{
"input": "30 12",
"output": "abcdefghijklabcdefghijklabcdef"
},
{
"input": "35 4",
"output": "abcdabcdabcdabcdabcdabcdabcdabcdabc"
},
{
"input": "79 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca"
},
{
"input": "79 14",
"output": "abcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghi"
},
{
"input": "85 13",
"output": "abcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefg"
},
{
"input": "90 25",
"output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmno"
},
{
"input": "90 19",
"output": "abcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmn"
},
{
"input": "26 24",
"output": "abcdefghijklmnopqrstuvwxab"
},
{
"input": "100 17",
"output": "abcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmno"
},
{
"input": "26 2",
"output": "ababababababababababababab"
}
] | 1,621,407,882
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 47
| 77
| 0
|
import math
# test = int(input())
# for q in range(test):
x, y = map(int, input().split())
# n = int(input())
# s = input()
s = ""
i = 0
while i<x:
for j in range(min(y, x-i)):
s += chr(ord("a")+j)
i += j + 1
print(s)
|
Title: New Password
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help.
Innokentiy decides that new password should satisfy the following conditions:
- the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct.
Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions.
Input Specification:
The first line contains two positive integers *n* and *k* (2<=≤<=*n*<=≤<=100, 2<=≤<=*k*<=≤<=*min*(*n*,<=26)) — the length of the password and the number of distinct symbols in it.
Pay attention that a desired new password always exists.
Output Specification:
Print any password which satisfies all conditions given by Innokentiy.
Demo Input:
['4 3\n', '6 6\n', '5 2\n']
Demo Output:
['java\n', 'python\n', 'phphp\n']
Note:
In the first test there is one of the appropriate new passwords — java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it.
In the second test there is one of the appropriate new passwords — python, because its length is equal to 6 and it consists of 6 distinct lowercase letters.
In the third test there is one of the appropriate new passwords — phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it.
Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
|
```python
import math
# test = int(input())
# for q in range(test):
x, y = map(int, input().split())
# n = int(input())
# s = input()
s = ""
i = 0
while i<x:
for j in range(min(y, x-i)):
s += chr(ord("a")+j)
i += j + 1
print(s)
```
| 3
|
|
459
|
A
|
Pashmak and Garden
|
PROGRAMMING
| 1,200
|
[
"implementation"
] | null | null |
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones.
|
The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct.
|
If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=≤<=*x*3,<=*y*3,<=*x*4,<=*y*4<=≤<=1000).
|
[
"0 0 0 1\n",
"0 0 1 1\n",
"0 0 1 2\n"
] |
[
"1 0 1 1\n",
"0 1 1 0\n",
"-1\n"
] |
none
| 500
|
[
{
"input": "0 0 0 1",
"output": "1 0 1 1"
},
{
"input": "0 0 1 1",
"output": "0 1 1 0"
},
{
"input": "0 0 1 2",
"output": "-1"
},
{
"input": "-100 -100 100 100",
"output": "-100 100 100 -100"
},
{
"input": "-100 -100 99 100",
"output": "-1"
},
{
"input": "0 -100 0 100",
"output": "200 -100 200 100"
},
{
"input": "27 -74 27 74",
"output": "175 -74 175 74"
},
{
"input": "0 1 2 3",
"output": "0 3 2 1"
},
{
"input": "-100 100 100 -100",
"output": "-100 -100 100 100"
},
{
"input": "-100 -100 -100 100",
"output": "100 -100 100 100"
},
{
"input": "100 100 100 -100",
"output": "300 100 300 -100"
},
{
"input": "100 -100 -100 -100",
"output": "100 100 -100 100"
},
{
"input": "-100 100 100 100",
"output": "-100 300 100 300"
},
{
"input": "0 1 0 0",
"output": "1 1 1 0"
},
{
"input": "1 1 0 0",
"output": "1 0 0 1"
},
{
"input": "0 0 1 0",
"output": "0 1 1 1"
},
{
"input": "1 0 0 1",
"output": "1 1 0 0"
},
{
"input": "1 0 1 1",
"output": "2 0 2 1"
},
{
"input": "1 1 0 1",
"output": "1 2 0 2"
},
{
"input": "15 -9 80 -9",
"output": "15 56 80 56"
},
{
"input": "51 -36 18 83",
"output": "-1"
},
{
"input": "69 -22 60 16",
"output": "-1"
},
{
"input": "-68 -78 -45 -55",
"output": "-68 -55 -45 -78"
},
{
"input": "68 -92 8 -32",
"output": "68 -32 8 -92"
},
{
"input": "95 -83 -39 -6",
"output": "-1"
},
{
"input": "54 94 53 -65",
"output": "-1"
},
{
"input": "-92 15 84 15",
"output": "-92 191 84 191"
},
{
"input": "67 77 -11 -1",
"output": "67 -1 -11 77"
},
{
"input": "91 -40 30 21",
"output": "91 21 30 -40"
},
{
"input": "66 -64 -25 -64",
"output": "66 27 -25 27"
},
{
"input": "-42 84 -67 59",
"output": "-42 59 -67 84"
},
{
"input": "73 47 -5 -77",
"output": "-1"
},
{
"input": "6 85 -54 -84",
"output": "-1"
},
{
"input": "-58 -55 40 43",
"output": "-58 43 40 -55"
},
{
"input": "56 22 48 70",
"output": "-1"
},
{
"input": "-17 -32 76 -32",
"output": "-17 61 76 61"
},
{
"input": "0 2 2 0",
"output": "0 0 2 2"
},
{
"input": "0 0 -1 1",
"output": "0 1 -1 0"
},
{
"input": "0 2 1 1",
"output": "0 1 1 2"
},
{
"input": "0 0 1 -1",
"output": "0 -1 1 0"
},
{
"input": "-1 2 -2 3",
"output": "-1 3 -2 2"
},
{
"input": "0 1 1 0",
"output": "0 0 1 1"
},
{
"input": "1 2 2 1",
"output": "1 1 2 2"
},
{
"input": "4 1 2 1",
"output": "4 3 2 3"
},
{
"input": "70 0 0 10",
"output": "-1"
},
{
"input": "2 3 4 1",
"output": "2 1 4 3"
},
{
"input": "1 3 3 1",
"output": "1 1 3 3"
},
{
"input": "-3 3 0 0",
"output": "-3 0 0 3"
},
{
"input": "2 8 7 3",
"output": "2 3 7 8"
},
{
"input": "1 2 2 3",
"output": "1 3 2 2"
},
{
"input": "0 3 3 0",
"output": "0 0 3 3"
},
{
"input": "0 0 -3 3",
"output": "0 3 -3 0"
},
{
"input": "0 2 1 2",
"output": "0 3 1 3"
},
{
"input": "1 1 2 0",
"output": "1 0 2 1"
},
{
"input": "0 0 5 0",
"output": "0 5 5 5"
},
{
"input": "3 4 7 8",
"output": "3 8 7 4"
},
{
"input": "0 5 5 0",
"output": "0 0 5 5"
},
{
"input": "5 6 8 3",
"output": "5 3 8 6"
},
{
"input": "2 2 1 1",
"output": "2 1 1 2"
},
{
"input": "0 1 3 1",
"output": "0 4 3 4"
},
{
"input": "2 4 5 4",
"output": "2 7 5 7"
},
{
"input": "0 5 1 5",
"output": "0 6 1 6"
},
{
"input": "4 0 0 4",
"output": "4 4 0 0"
},
{
"input": "0 1 1 8",
"output": "-1"
},
{
"input": "2 3 3 4",
"output": "2 4 3 3"
},
{
"input": "1 0 2 1",
"output": "1 1 2 0"
},
{
"input": "0 0 2 14",
"output": "-1"
},
{
"input": "0 0 4 3",
"output": "-1"
},
{
"input": "3 5 5 3",
"output": "3 3 5 5"
},
{
"input": "-1 1 1 -1",
"output": "-1 -1 1 1"
},
{
"input": "0 0 2 0",
"output": "0 2 2 2"
},
{
"input": "0 0 1 7",
"output": "-1"
},
{
"input": "1 2 3 2",
"output": "1 4 3 4"
},
{
"input": "1 12 3 10",
"output": "1 10 3 12"
}
] | 1,690,579,822
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 74
| 62
| 0
|
import sys
input = sys.stdin.readline
x1,y1,x2,y2 = map(int,input().split())
if x1 == x2:
print(x1 + abs(y1-y2), y2, x1 + abs(y1-y2), y1)
elif y1 == y2:
print(x1, y1+abs(x2-x1), x2, y1 + abs(x2-x1))
else:
if abs(x1-x2) != abs(y1-y2):
print(-1)
else:
print(x1, y2, x2, y1)
|
Title: Pashmak and Garden
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones.
Input Specification:
The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct.
Output Specification:
If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=≤<=*x*3,<=*y*3,<=*x*4,<=*y*4<=≤<=1000).
Demo Input:
['0 0 0 1\n', '0 0 1 1\n', '0 0 1 2\n']
Demo Output:
['1 0 1 1\n', '0 1 1 0\n', '-1\n']
Note:
none
|
```python
import sys
input = sys.stdin.readline
x1,y1,x2,y2 = map(int,input().split())
if x1 == x2:
print(x1 + abs(y1-y2), y2, x1 + abs(y1-y2), y1)
elif y1 == y2:
print(x1, y1+abs(x2-x1), x2, y1 + abs(x2-x1))
else:
if abs(x1-x2) != abs(y1-y2):
print(-1)
else:
print(x1, y2, x2, y1)
```
| 3
|
|
805
|
A
|
Fake NP
|
PROGRAMMING
| 1,000
|
[
"greedy",
"math"
] | null | null |
Tavak and Seyyed are good friends. Seyyed is very funny and he told Tavak to solve the following problem instead of longest-path.
You are given *l* and *r*. For all integers from *l* to *r*, inclusive, we wrote down all of their integer divisors except 1. Find the integer that we wrote down the maximum number of times.
Solve the problem to show that it's not a NP problem.
|
The first line contains two integers *l* and *r* (2<=≤<=*l*<=≤<=*r*<=≤<=109).
|
Print single integer, the integer that appears maximum number of times in the divisors.
If there are multiple answers, print any of them.
|
[
"19 29\n",
"3 6\n"
] |
[
"2\n",
"3\n"
] |
Definition of a divisor: [https://www.mathsisfun.com/definitions/divisor-of-an-integer-.html](https://www.mathsisfun.com/definitions/divisor-of-an-integer-.html)
The first example: from 19 to 29 these numbers are divisible by 2: {20, 22, 24, 26, 28}.
The second example: from 3 to 6 these numbers are divisible by 3: {3, 6}.
| 500
|
[
{
"input": "19 29",
"output": "2"
},
{
"input": "3 6",
"output": "2"
},
{
"input": "39 91",
"output": "2"
},
{
"input": "76 134",
"output": "2"
},
{
"input": "93 95",
"output": "2"
},
{
"input": "17 35",
"output": "2"
},
{
"input": "94 95",
"output": "2"
},
{
"input": "51 52",
"output": "2"
},
{
"input": "47 52",
"output": "2"
},
{
"input": "38 98",
"output": "2"
},
{
"input": "30 37",
"output": "2"
},
{
"input": "56 92",
"output": "2"
},
{
"input": "900000000 1000000000",
"output": "2"
},
{
"input": "37622224 162971117",
"output": "2"
},
{
"input": "760632746 850720703",
"output": "2"
},
{
"input": "908580370 968054552",
"output": "2"
},
{
"input": "951594860 953554446",
"output": "2"
},
{
"input": "347877978 913527175",
"output": "2"
},
{
"input": "620769961 988145114",
"output": "2"
},
{
"input": "820844234 892579936",
"output": "2"
},
{
"input": "741254764 741254768",
"output": "2"
},
{
"input": "80270976 80270977",
"output": "2"
},
{
"input": "392602363 392602367",
"output": "2"
},
{
"input": "519002744 519002744",
"output": "519002744"
},
{
"input": "331900277 331900277",
"output": "331900277"
},
{
"input": "419873015 419873018",
"output": "2"
},
{
"input": "349533413 349533413",
"output": "349533413"
},
{
"input": "28829775 28829776",
"output": "2"
},
{
"input": "568814539 568814539",
"output": "568814539"
},
{
"input": "720270740 720270743",
"output": "2"
},
{
"input": "871232720 871232722",
"output": "2"
},
{
"input": "305693653 305693653",
"output": "305693653"
},
{
"input": "634097178 634097179",
"output": "2"
},
{
"input": "450868287 450868290",
"output": "2"
},
{
"input": "252662256 252662260",
"output": "2"
},
{
"input": "575062045 575062049",
"output": "2"
},
{
"input": "273072892 273072894",
"output": "2"
},
{
"input": "770439256 770439256",
"output": "770439256"
},
{
"input": "2 1000000000",
"output": "2"
},
{
"input": "6 8",
"output": "2"
},
{
"input": "2 879190747",
"output": "2"
},
{
"input": "5 5",
"output": "5"
},
{
"input": "999999937 999999937",
"output": "999999937"
},
{
"input": "3 3",
"output": "3"
},
{
"input": "5 100",
"output": "2"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "3 18",
"output": "2"
},
{
"input": "7 7",
"output": "7"
},
{
"input": "39916801 39916801",
"output": "39916801"
},
{
"input": "3 8",
"output": "2"
},
{
"input": "13 13",
"output": "13"
},
{
"input": "4 8",
"output": "2"
},
{
"input": "3 12",
"output": "2"
},
{
"input": "6 12",
"output": "2"
},
{
"input": "999999103 999999103",
"output": "999999103"
},
{
"input": "100000007 100000007",
"output": "100000007"
},
{
"input": "3 99",
"output": "2"
},
{
"input": "999999733 999999733",
"output": "999999733"
},
{
"input": "5 10",
"output": "2"
},
{
"input": "982451653 982451653",
"output": "982451653"
},
{
"input": "999900001 1000000000",
"output": "2"
},
{
"input": "999727999 999727999",
"output": "999727999"
},
{
"input": "2 999999999",
"output": "2"
},
{
"input": "242 244",
"output": "2"
},
{
"input": "3 10",
"output": "2"
},
{
"input": "15 27",
"output": "2"
},
{
"input": "998244353 998244353",
"output": "998244353"
},
{
"input": "5 15",
"output": "2"
},
{
"input": "999999797 999999797",
"output": "999999797"
},
{
"input": "2 3",
"output": "2"
},
{
"input": "999999929 999999929",
"output": "999999929"
},
{
"input": "3 111111",
"output": "2"
},
{
"input": "12 18",
"output": "2"
},
{
"input": "479001599 479001599",
"output": "479001599"
},
{
"input": "10000019 10000019",
"output": "10000019"
},
{
"input": "715827883 715827883",
"output": "715827883"
},
{
"input": "999992977 999992977",
"output": "999992977"
},
{
"input": "11 11",
"output": "11"
},
{
"input": "29 29",
"output": "29"
},
{
"input": "1000003 1000003",
"output": "1000003"
},
{
"input": "6 15",
"output": "2"
},
{
"input": "1200007 1200007",
"output": "1200007"
},
{
"input": "3 1000000000",
"output": "2"
},
{
"input": "990000023 990000023",
"output": "990000023"
},
{
"input": "1717 1717",
"output": "1717"
},
{
"input": "141650963 141650963",
"output": "141650963"
},
{
"input": "1002523 1002523",
"output": "1002523"
},
{
"input": "900000011 900000011",
"output": "900000011"
},
{
"input": "104729 104729",
"output": "104729"
},
{
"input": "4 12",
"output": "2"
},
{
"input": "100003 100003",
"output": "100003"
},
{
"input": "17 17",
"output": "17"
},
{
"input": "10 100",
"output": "2"
}
] | 1,620,051,870
| 2,147,483,647
|
PyPy 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
#include<bits/stdc++.h>
using namespace std;
int main()
{
int l,r;
cin>>l>>r;
if(l<r){
cout<<"2"<<endl;
}else cout<<l<<endl;
}
|
Title: Fake NP
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Tavak and Seyyed are good friends. Seyyed is very funny and he told Tavak to solve the following problem instead of longest-path.
You are given *l* and *r*. For all integers from *l* to *r*, inclusive, we wrote down all of their integer divisors except 1. Find the integer that we wrote down the maximum number of times.
Solve the problem to show that it's not a NP problem.
Input Specification:
The first line contains two integers *l* and *r* (2<=≤<=*l*<=≤<=*r*<=≤<=109).
Output Specification:
Print single integer, the integer that appears maximum number of times in the divisors.
If there are multiple answers, print any of them.
Demo Input:
['19 29\n', '3 6\n']
Demo Output:
['2\n', '3\n']
Note:
Definition of a divisor: [https://www.mathsisfun.com/definitions/divisor-of-an-integer-.html](https://www.mathsisfun.com/definitions/divisor-of-an-integer-.html)
The first example: from 19 to 29 these numbers are divisible by 2: {20, 22, 24, 26, 28}.
The second example: from 3 to 6 these numbers are divisible by 3: {3, 6}.
|
```python
#include<bits/stdc++.h>
using namespace std;
int main()
{
int l,r;
cin>>l>>r;
if(l<r){
cout<<"2"<<endl;
}else cout<<l<<endl;
}
```
| -1
|
|
378
|
A
|
Playing with Dice
|
PROGRAMMING
| 800
|
[
"brute force"
] | null | null |
Two players are playing a game. First each of them writes an integer from 1 to 6, and then a dice is thrown. The player whose written number got closer to the number on the dice wins. If both payers have the same difference, it's a draw.
The first player wrote number *a*, the second player wrote number *b*. How many ways to throw a dice are there, at which the first player wins, or there is a draw, or the second player wins?
|
The single line contains two integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=6) — the numbers written on the paper by the first and second player, correspondingly.
|
Print three integers: the number of ways to throw the dice at which the first player wins, the game ends with a draw or the second player wins, correspondingly.
|
[
"2 5\n",
"2 4\n"
] |
[
"3 0 3\n",
"2 1 3\n"
] |
The dice is a standard cube-shaped six-sided object with each side containing a number from 1 to 6, and where all numbers on all sides are distinct.
You can assume that number *a* is closer to number *x* than number *b*, if |*a* - *x*| < |*b* - *x*|.
| 500
|
[
{
"input": "2 5",
"output": "3 0 3"
},
{
"input": "2 4",
"output": "2 1 3"
},
{
"input": "5 3",
"output": "2 1 3"
},
{
"input": "1 6",
"output": "3 0 3"
},
{
"input": "5 1",
"output": "3 1 2"
},
{
"input": "6 3",
"output": "2 0 4"
},
{
"input": "2 3",
"output": "2 0 4"
},
{
"input": "5 6",
"output": "5 0 1"
},
{
"input": "4 4",
"output": "0 6 0"
},
{
"input": "1 1",
"output": "0 6 0"
},
{
"input": "6 4",
"output": "1 1 4"
},
{
"input": "1 4",
"output": "2 0 4"
},
{
"input": "5 5",
"output": "0 6 0"
},
{
"input": "4 5",
"output": "4 0 2"
},
{
"input": "4 3",
"output": "3 0 3"
},
{
"input": "1 5",
"output": "2 1 3"
},
{
"input": "6 5",
"output": "1 0 5"
},
{
"input": "2 2",
"output": "0 6 0"
},
{
"input": "1 3",
"output": "1 1 4"
},
{
"input": "3 6",
"output": "4 0 2"
},
{
"input": "3 1",
"output": "4 1 1"
},
{
"input": "3 2",
"output": "4 0 2"
},
{
"input": "3 5",
"output": "3 1 2"
},
{
"input": "3 3",
"output": "0 6 0"
},
{
"input": "6 2",
"output": "2 1 3"
},
{
"input": "4 1",
"output": "4 0 2"
},
{
"input": "5 2",
"output": "3 0 3"
},
{
"input": "4 2",
"output": "3 1 2"
},
{
"input": "2 1",
"output": "5 0 1"
},
{
"input": "6 1",
"output": "3 0 3"
},
{
"input": "4 6",
"output": "4 1 1"
},
{
"input": "2 6",
"output": "3 1 2"
},
{
"input": "3 4",
"output": "3 0 3"
},
{
"input": "1 2",
"output": "1 0 5"
},
{
"input": "6 6",
"output": "0 6 0"
},
{
"input": "5 4",
"output": "2 0 4"
},
{
"input": "3 3",
"output": "0 6 0"
},
{
"input": "1 1",
"output": "0 6 0"
}
] | 1,588,497,812
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 38
| 109
| 0
|
a,b = list(map(int,input().split()))
x=0;y=0;z=0
for i in range(1,7):
if abs(a-i)<abs(b-i):
x = x + 1
elif abs(a-i)==abs(b-i):
y = y + 1
else:
z = z + 1
print(x,y,z)
|
Title: Playing with Dice
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two players are playing a game. First each of them writes an integer from 1 to 6, and then a dice is thrown. The player whose written number got closer to the number on the dice wins. If both payers have the same difference, it's a draw.
The first player wrote number *a*, the second player wrote number *b*. How many ways to throw a dice are there, at which the first player wins, or there is a draw, or the second player wins?
Input Specification:
The single line contains two integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=6) — the numbers written on the paper by the first and second player, correspondingly.
Output Specification:
Print three integers: the number of ways to throw the dice at which the first player wins, the game ends with a draw or the second player wins, correspondingly.
Demo Input:
['2 5\n', '2 4\n']
Demo Output:
['3 0 3\n', '2 1 3\n']
Note:
The dice is a standard cube-shaped six-sided object with each side containing a number from 1 to 6, and where all numbers on all sides are distinct.
You can assume that number *a* is closer to number *x* than number *b*, if |*a* - *x*| < |*b* - *x*|.
|
```python
a,b = list(map(int,input().split()))
x=0;y=0;z=0
for i in range(1,7):
if abs(a-i)<abs(b-i):
x = x + 1
elif abs(a-i)==abs(b-i):
y = y + 1
else:
z = z + 1
print(x,y,z)
```
| 3
|
|
929
|
C
|
Красивая команда
|
PROGRAMMING
| 1,700
|
[
"*special",
"combinatorics",
"math"
] | null | null |
Завтра у хоккейной команды, которой руководит Евгений, важный матч. Евгению нужно выбрать шесть игроков, которые выйдут на лед в стартовом составе: один вратарь, два защитника и три нападающих.
Так как это стартовый состав, Евгения больше волнует, насколько красива будет команда на льду, чем способности игроков. А именно, Евгений хочет выбрать такой стартовый состав, чтобы номера любых двух игроков из стартового состава отличались не более, чем в два раза. Например, игроки с номерами 13, 14, 10, 18, 15 и 20 устроят Евгения, а если, например, на лед выйдут игроки с номерами 8 и 17, то это не устроит Евгения.
Про каждого из игроков вам известно, на какой позиции он играет (вратарь, защитник или нападающий), а также его номер. В хоккее номера игроков не обязательно идут подряд. Посчитайте число различных стартовых составов из одного вратаря, двух защитников и трех нападающих, которые может выбрать Евгений, чтобы выполнялось его условие красоты.
|
Первая строка содержит три целых числа *g*, *d* и *f* (1<=≤<=*g*<=≤<=1<=000, 1<=≤<=*d*<=≤<=1<=000, 1<=≤<=*f*<=≤<=1<=000) — число вратарей, защитников и нападающих в команде Евгения.
Вторая строка содержит *g* целых чисел, каждое в пределах от 1 до 100<=000 — номера вратарей.
Третья строка содержит *d* целых чисел, каждое в пределах от 1 до 100<=000 — номера защитников.
Четвертая строка содержит *f* целых чисел, каждое в пределах от 1 до 100<=000 — номера нападающих.
Гарантируется, что общее количество игроков не превосходит 1<=000, т. е. *g*<=+<=*d*<=+<=*f*<=≤<=1<=000. Все *g*<=+<=*d*<=+<=*f* номеров игроков различны.
|
Выведите одно целое число — количество возможных стартовых составов.
|
[
"1 2 3\n15\n10 19\n20 11 13\n",
"2 3 4\n16 40\n20 12 19\n13 21 11 10\n"
] |
[
"1\n",
"6\n"
] |
В первом примере всего один вариант для выбора состава, который удовлетворяет описанным условиям, поэтому ответ 1.
Во втором примере подходят следующие игровые сочетания (в порядке вратарь-защитник-защитник-нападающий-нападающий-нападающий):
- 16 20 12 13 21 11 - 16 20 12 13 11 10 - 16 20 19 13 21 11 - 16 20 19 13 11 10 - 16 12 19 13 21 11 - 16 12 19 13 11 10
Таким образом, ответ на этот пример — 6.
| 1,750
|
[
{
"input": "1 2 3\n15\n10 19\n20 11 13",
"output": "1"
},
{
"input": "2 3 4\n16 40\n20 12 19\n13 21 11 10",
"output": "6"
},
{
"input": "4 4 5\n15 16 19 6\n8 11 9 18\n5 3 1 12 14",
"output": "0"
},
{
"input": "6 7 7\n32 35 26 33 16 23\n4 40 36 12 28 24 3\n39 11 31 37 1 25 6",
"output": "120"
},
{
"input": "9 10 7\n935 433 848 137 548 958 758 576 592\n780 129 631 991 575 421 245 944 487 771\n430 34 276 8 165 188 727",
"output": "0"
},
{
"input": "17 15 17\n598 1369 806 247 1570 361 1650 1250 1269 1744 1400 1074 947 115 863 1392 1044\n1252 1797 1574 1445 1274 246 1483 1814 231 804 543 1142 1425 125 1280\n1276 1724 512 1975 1215 1205 1415 1141 993 199 1318 855 389 376 1386 146 1297",
"output": "108025"
},
{
"input": "29 20 26\n250 44 142 149 3 84 85 267 191 144 100 164 66 125 278 37 244 288 124 50 47 16 141 93 9 242 78 238 59\n176 276 33 91 248 234 205 60 8 80 81 88 4 213 53 175 290 206 168 185\n10 56 225 193 73 209 246 296 152 146 221 294 275 83 42 192 23 24 82 226 70 222 189 20 210 265",
"output": "360518"
},
{
"input": "30 24 30\n61 189 108 126 2 180 15 141 75 67 115 107 144 196 4 135 38 106 146 136 31 114 14 49 158 54 173 69 91 98\n151 109 46 182 23 94 39 168 165 30 103 66 179 70 40 198 8 152 163 87 176 187 55 3\n65 140 21 142 80 185 125 19 190 157 73 186 58 188 105 93 83 1 7 79 52 82 113 13 10 164 174 119 96 78",
"output": "670920"
},
{
"input": "29 42 50\n605 254 369 842 889 103 937 235 135 698 482 883 738 467 848 70 1000 129 970 58 94 873 140 363 133 913 834 727 185\n17 676 703 245 149 296 800 106 153 111 285 382 12 704 830 664 30 533 604 380 469 155 216 466 36 347 270 170 10 349 86 5 164 599 517 593 373 461 908 34 569 573\n614 439 78 172 109 217 85 463 720 176 571 486 503 318 977 501 910 196 882 107 584 940 928 249 537 962 333 477 897 875 500 915 227 256 194 808 193 759 934 324 525 174 792 425 449 843 824 261 654 868",
"output": "7743753"
},
{
"input": "1 2 3\n1\n100 200\n300 400 500",
"output": "0"
},
{
"input": "40 40 40\n1 118 100 19 91 115 34 22 28 55 43 109 13 94 7 4 31 79 10 52 16 88 37 112 97 76 70 25 64 103 61 106 58 85 67 40 82 49 46 73\n59 80 23 113 35 56 95 116 107 44 65 26 38 98 47 14 86 11 50 89 29 119 41 5 17 71 92 110 2 32 20 104 83 8 53 77 62 101 74 68\n63 78 54 90 75 3 99 6 93 42 111 9 51 102 57 81 66 48 21 87 12 84 117 24 69 120 15 45 33 108 39 72 18 60 105 114 96 36 30 27",
"output": "9339317"
},
{
"input": "40 40 40\n100 73 109 115 40 88 58 76 22 31 34 7 97 61 70 16 10 64 103 94 79 106 67 13 118 43 85 46 19 112 1 55 4 91 28 49 37 82 52 25\n9 72 102 21 51 90 69 114 27 60 75 18 42 78 120 84 57 39 93 3 6 63 117 48 99 111 24 45 108 54 33 12 30 81 87 36 15 96 105 66\n119 98 113 23 116 71 83 56 68 65 44 50 29 107 26 38 5 35 14 101 86 77 62 80 89 92 104 2 59 20 11 74 53 47 17 32 95 41 8 110",
"output": "9166683"
},
{
"input": "40 40 40\n116 101 80 62 38 11 20 50 65 41 110 119 68 56 5 53 83 14 107 98 104 92 32 2 113 95 71 59 89 23 74 86 29 35 47 17 77 8 26 44\n67 97 22 37 4 55 46 100 40 16 64 79 43 19 82 109 34 10 52 7 88 85 1 13 73 94 25 106 91 115 58 31 61 28 70 112 76 49 118 103\n39 6 57 120 87 51 81 99 90 15 33 21 12 66 3 48 114 111 75 9 27 117 105 72 42 102 60 108 18 84 93 69 63 30 78 54 24 36 45 96",
"output": "9199268"
},
{
"input": "40 40 40\n86 41 89 2 32 29 11 107 20 101 35 8 59 47 104 74 56 50 95 92 53 119 68 113 14 77 71 23 38 5 62 44 65 83 110 98 116 80 17 26\n96 75 60 30 57 78 108 12 36 93 111 66 6 48 72 33 3 84 90 45 9 117 42 18 21 120 114 24 51 15 39 63 69 87 27 102 105 54 81 99\n94 10 1 112 22 103 109 46 82 25 40 34 61 79 19 85 13 70 106 28 31 118 97 67 76 16 91 115 58 4 88 49 73 52 55 7 100 64 43 37",
"output": "8979951"
},
{
"input": "40 40 40\n33 69 27 30 72 108 57 75 99 42 66 84 15 24 120 54 9 87 60 18 117 93 6 39 111 81 21 48 96 12 102 78 3 105 90 45 114 36 51 63\n61 40 4 7 34 55 94 46 112 19 85 97 28 100 115 79 103 82 67 109 73 91 64 16 106 22 70 1 25 49 37 76 88 43 13 118 31 52 10 58\n50 59 8 56 14 86 89 110 47 104 68 95 107 77 62 17 20 38 92 83 71 53 23 113 32 101 98 11 29 65 80 74 119 116 5 35 41 2 44 26",
"output": "9067332"
},
{
"input": "40 40 40\n93 90 27 120 108 21 12 114 66 45 48 57 9 81 18 75 111 39 6 102 117 15 30 3 51 96 99 33 72 24 78 54 36 87 105 69 42 63 84 60\n107 83 77 104 95 65 113 35 8 86 89 119 29 98 68 38 92 110 14 5 23 56 50 59 2 47 41 26 11 116 44 74 80 101 53 17 71 20 62 32\n22 7 43 40 85 49 79 31 46 61 118 82 115 67 112 34 28 13 88 91 73 16 25 4 19 70 37 1 103 10 55 76 97 94 58 64 52 106 100 109",
"output": "9020649"
},
{
"input": "2 1 3\n10 20\n15\n13 14 16",
"output": "0"
},
{
"input": "2 2 2\n10 11\n12 13\n14 15",
"output": "0"
},
{
"input": "1 2 1\n10\n11 12\n13",
"output": "0"
}
] | 1,520,029,610
| 24,710
|
Python 3
|
WRONG_ANSWER
|
PRETESTS
| 3
| 93
| 6,144,000
|
from math import factorial
import random
g, d, f = [int(w) for w in input().split()]
s = [(int(w), i) for i in range(3) for w in input().split()]
s.sort()
if g + d + f < 6:
print (0)
else :
count = 0
for i in range (g + d + f):
b = s[i][0] * 2
num = [0, 0, 0]
num[s[i][1]] += 1
for x in s[i+1:]:
if x[0] <= b:
num[x[1]] += 1
if num[0] < 1 or num[1] < 2 or num[2] < 3:
continue
else:
count += (num[0] * factorial(num[1]) * factorial(num[2]) // (6 * 2 * factorial(num[1] - 2) * factorial(num[2] - 3)))
print(count)
|
Title: Красивая команда
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Завтра у хоккейной команды, которой руководит Евгений, важный матч. Евгению нужно выбрать шесть игроков, которые выйдут на лед в стартовом составе: один вратарь, два защитника и три нападающих.
Так как это стартовый состав, Евгения больше волнует, насколько красива будет команда на льду, чем способности игроков. А именно, Евгений хочет выбрать такой стартовый состав, чтобы номера любых двух игроков из стартового состава отличались не более, чем в два раза. Например, игроки с номерами 13, 14, 10, 18, 15 и 20 устроят Евгения, а если, например, на лед выйдут игроки с номерами 8 и 17, то это не устроит Евгения.
Про каждого из игроков вам известно, на какой позиции он играет (вратарь, защитник или нападающий), а также его номер. В хоккее номера игроков не обязательно идут подряд. Посчитайте число различных стартовых составов из одного вратаря, двух защитников и трех нападающих, которые может выбрать Евгений, чтобы выполнялось его условие красоты.
Input Specification:
Первая строка содержит три целых числа *g*, *d* и *f* (1<=≤<=*g*<=≤<=1<=000, 1<=≤<=*d*<=≤<=1<=000, 1<=≤<=*f*<=≤<=1<=000) — число вратарей, защитников и нападающих в команде Евгения.
Вторая строка содержит *g* целых чисел, каждое в пределах от 1 до 100<=000 — номера вратарей.
Третья строка содержит *d* целых чисел, каждое в пределах от 1 до 100<=000 — номера защитников.
Четвертая строка содержит *f* целых чисел, каждое в пределах от 1 до 100<=000 — номера нападающих.
Гарантируется, что общее количество игроков не превосходит 1<=000, т. е. *g*<=+<=*d*<=+<=*f*<=≤<=1<=000. Все *g*<=+<=*d*<=+<=*f* номеров игроков различны.
Output Specification:
Выведите одно целое число — количество возможных стартовых составов.
Demo Input:
['1 2 3\n15\n10 19\n20 11 13\n', '2 3 4\n16 40\n20 12 19\n13 21 11 10\n']
Demo Output:
['1\n', '6\n']
Note:
В первом примере всего один вариант для выбора состава, который удовлетворяет описанным условиям, поэтому ответ 1.
Во втором примере подходят следующие игровые сочетания (в порядке вратарь-защитник-защитник-нападающий-нападающий-нападающий):
- 16 20 12 13 21 11 - 16 20 12 13 11 10 - 16 20 19 13 21 11 - 16 20 19 13 11 10 - 16 12 19 13 21 11 - 16 12 19 13 11 10
Таким образом, ответ на этот пример — 6.
|
```python
from math import factorial
import random
g, d, f = [int(w) for w in input().split()]
s = [(int(w), i) for i in range(3) for w in input().split()]
s.sort()
if g + d + f < 6:
print (0)
else :
count = 0
for i in range (g + d + f):
b = s[i][0] * 2
num = [0, 0, 0]
num[s[i][1]] += 1
for x in s[i+1:]:
if x[0] <= b:
num[x[1]] += 1
if num[0] < 1 or num[1] < 2 or num[2] < 3:
continue
else:
count += (num[0] * factorial(num[1]) * factorial(num[2]) // (6 * 2 * factorial(num[1] - 2) * factorial(num[2] - 3)))
print(count)
```
| 0
|
|
41
|
A
|
Translation
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Translation
|
2
|
256
|
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
|
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
|
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
|
[
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,647,351,381
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 30
| 0
|
print(input()[::-1])
print("YES")
|
Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
print(input()[::-1])
print("YES")
```
| 0
|
295
|
A
|
Greg and Array
|
PROGRAMMING
| 1,400
|
[
"data structures",
"implementation"
] | null | null |
Greg has an array *a*<==<=*a*1,<=*a*2,<=...,<=*a**n* and *m* operations. Each operation looks as: *l**i*, *r**i*, *d**i*, (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). To apply operation *i* to the array means to increase all array elements with numbers *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i* by value *d**i*.
Greg wrote down *k* queries on a piece of paper. Each query has the following form: *x**i*, *y**i*, (1<=≤<=*x**i*<=≤<=*y**i*<=≤<=*m*). That means that one should apply operations with numbers *x**i*,<=*x**i*<=+<=1,<=...,<=*y**i* to the array.
Now Greg is wondering, what the array *a* will be after all the queries are executed. Help Greg.
|
The first line contains integers *n*, *m*, *k* (1<=≤<=*n*,<=*m*,<=*k*<=≤<=105). The second line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=105) — the initial array.
Next *m* lines contain operations, the operation number *i* is written as three integers: *l**i*, *r**i*, *d**i*, (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*), (0<=≤<=*d**i*<=≤<=105).
Next *k* lines contain the queries, the query number *i* is written as two integers: *x**i*, *y**i*, (1<=≤<=*x**i*<=≤<=*y**i*<=≤<=*m*).
The numbers in the lines are separated by single spaces.
|
On a single line print *n* integers *a*1,<=*a*2,<=...,<=*a**n* — the array after executing all the queries. Separate the printed numbers by spaces.
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams of the %I64d specifier.
|
[
"3 3 3\n1 2 3\n1 2 1\n1 3 2\n2 3 4\n1 2\n1 3\n2 3\n",
"1 1 1\n1\n1 1 1\n1 1\n",
"4 3 6\n1 2 3 4\n1 2 1\n2 3 2\n3 4 4\n1 2\n1 3\n2 3\n1 2\n1 3\n2 3\n"
] |
[
"9 18 17\n",
"2\n",
"5 18 31 20\n"
] |
none
| 500
|
[
{
"input": "3 3 3\n1 2 3\n1 2 1\n1 3 2\n2 3 4\n1 2\n1 3\n2 3",
"output": "9 18 17"
},
{
"input": "1 1 1\n1\n1 1 1\n1 1",
"output": "2"
},
{
"input": "4 3 6\n1 2 3 4\n1 2 1\n2 3 2\n3 4 4\n1 2\n1 3\n2 3\n1 2\n1 3\n2 3",
"output": "5 18 31 20"
},
{
"input": "1 1 1\n0\n1 1 0\n1 1",
"output": "0"
}
] | 1,642,190,218
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 857
| 17,100,800
|
line = input().split(' ')
n, m, k = int(line[0]), int(line[1]), int(line[2])
# create arr
arr = input().split(' ')
for i in range(len(arr)):
arr[i] = int(arr[i])
arr = [0] + arr + [0]
# create operations
ops = [(0, 0, 0)]
for i in range(m):
line = input().split(' ')
l, r, d = int(line[0]), int(line[1]), int(line[2])
ops.append((l, r, d))
opsCount = [0] * (m + 2)
for i in range(k):
query = input().split(' ')
x, y = int(query[0]), int(query[1])
opsCount[x] += 1
opsCount[y + 1] -= 1
for i in range(1, len(opsCount)):
opsCount[i] += opsCount[i - 1]
dif = [0] * len(arr)
for i in range(1, m + 1):
l, r, d = ops[i]
dif[l] += opsCount[i] * d
dif[r + 1] -= opsCount[i] * d
for i in range(1, len(arr)):
dif[i] += dif[i - 1]
arr[i] += dif[i]
for i in range(1, len(arr) - 1):
print(str(arr[i]) + " ", end = '')
|
Title: Greg and Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Greg has an array *a*<==<=*a*1,<=*a*2,<=...,<=*a**n* and *m* operations. Each operation looks as: *l**i*, *r**i*, *d**i*, (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). To apply operation *i* to the array means to increase all array elements with numbers *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i* by value *d**i*.
Greg wrote down *k* queries on a piece of paper. Each query has the following form: *x**i*, *y**i*, (1<=≤<=*x**i*<=≤<=*y**i*<=≤<=*m*). That means that one should apply operations with numbers *x**i*,<=*x**i*<=+<=1,<=...,<=*y**i* to the array.
Now Greg is wondering, what the array *a* will be after all the queries are executed. Help Greg.
Input Specification:
The first line contains integers *n*, *m*, *k* (1<=≤<=*n*,<=*m*,<=*k*<=≤<=105). The second line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=105) — the initial array.
Next *m* lines contain operations, the operation number *i* is written as three integers: *l**i*, *r**i*, *d**i*, (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*), (0<=≤<=*d**i*<=≤<=105).
Next *k* lines contain the queries, the query number *i* is written as two integers: *x**i*, *y**i*, (1<=≤<=*x**i*<=≤<=*y**i*<=≤<=*m*).
The numbers in the lines are separated by single spaces.
Output Specification:
On a single line print *n* integers *a*1,<=*a*2,<=...,<=*a**n* — the array after executing all the queries. Separate the printed numbers by spaces.
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams of the %I64d specifier.
Demo Input:
['3 3 3\n1 2 3\n1 2 1\n1 3 2\n2 3 4\n1 2\n1 3\n2 3\n', '1 1 1\n1\n1 1 1\n1 1\n', '4 3 6\n1 2 3 4\n1 2 1\n2 3 2\n3 4 4\n1 2\n1 3\n2 3\n1 2\n1 3\n2 3\n']
Demo Output:
['9 18 17\n', '2\n', '5 18 31 20\n']
Note:
none
|
```python
line = input().split(' ')
n, m, k = int(line[0]), int(line[1]), int(line[2])
# create arr
arr = input().split(' ')
for i in range(len(arr)):
arr[i] = int(arr[i])
arr = [0] + arr + [0]
# create operations
ops = [(0, 0, 0)]
for i in range(m):
line = input().split(' ')
l, r, d = int(line[0]), int(line[1]), int(line[2])
ops.append((l, r, d))
opsCount = [0] * (m + 2)
for i in range(k):
query = input().split(' ')
x, y = int(query[0]), int(query[1])
opsCount[x] += 1
opsCount[y + 1] -= 1
for i in range(1, len(opsCount)):
opsCount[i] += opsCount[i - 1]
dif = [0] * len(arr)
for i in range(1, m + 1):
l, r, d = ops[i]
dif[l] += opsCount[i] * d
dif[r + 1] -= opsCount[i] * d
for i in range(1, len(arr)):
dif[i] += dif[i - 1]
arr[i] += dif[i]
for i in range(1, len(arr) - 1):
print(str(arr[i]) + " ", end = '')
```
| 3
|
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,646,251,667
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 40
| 62
| 0
|
b = "hello"
j = 0
pas = 0
a = input()
for i in range(len(a)):
if a[i] == b [j]:
j += 1
pas += 1
if pas == 5:
break
if pas == 5 :
print("YES")
else:
print("NO")
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
b = "hello"
j = 0
pas = 0
a = input()
for i in range(len(a)):
if a[i] == b [j]:
j += 1
pas += 1
if pas == 5:
break
if pas == 5 :
print("YES")
else:
print("NO")
```
| 3.969
|
287
|
A
|
IQ Test
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] | null | null |
In the city of Ultima Thule job applicants are often offered an IQ test.
The test is as follows: the person gets a piece of squared paper with a 4<=×<=4 square painted on it. Some of the square's cells are painted black and others are painted white. Your task is to repaint at most one cell the other color so that the picture has a 2<=×<=2 square, completely consisting of cells of the same color. If the initial picture already has such a square, the person should just say so and the test will be completed.
Your task is to write a program that determines whether it is possible to pass the test. You cannot pass the test if either repainting any cell or no action doesn't result in a 2<=×<=2 square, consisting of cells of the same color.
|
Four lines contain four characters each: the *j*-th character of the *i*-th line equals "." if the cell in the *i*-th row and the *j*-th column of the square is painted white, and "#", if the cell is black.
|
Print "YES" (without the quotes), if the test can be passed and "NO" (without the quotes) otherwise.
|
[
"####\n.#..\n####\n....\n",
"####\n....\n####\n....\n"
] |
[
"YES\n",
"NO\n"
] |
In the first test sample it is enough to repaint the first cell in the second row. After such repainting the required 2 × 2 square is on the intersection of the 1-st and 2-nd row with the 1-st and 2-nd column.
| 500
|
[
{
"input": "###.\n...#\n###.\n...#",
"output": "NO"
},
{
"input": ".##.\n#..#\n.##.\n#..#",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n.#.#\n#.#.",
"output": "NO"
},
{
"input": "##..\n..##\n##..\n..##",
"output": "NO"
},
{
"input": "#.#.\n#.#.\n.#.#\n.#.#",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n#.#.\n#.#.",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n#.#.\n.#.#",
"output": "NO"
},
{
"input": "#.#.\n#.#.\n#.#.\n#.#.",
"output": "NO"
},
{
"input": ".#.#\n.#.#\n.#.#\n.#.#",
"output": "NO"
},
{
"input": "#..#\n.##.\n####\n####",
"output": "YES"
},
{
"input": "#.#.\n.###\n#.#.\n.###",
"output": "YES"
},
{
"input": "#..#\n.##.\n.##.\n#..#",
"output": "YES"
},
{
"input": ".##.\n.#..\n##.#\n#..#",
"output": "YES"
},
{
"input": ".##.\n##..\n#..#\n..##",
"output": "YES"
},
{
"input": "##..\n##..\n..##\n..##",
"output": "YES"
},
{
"input": ".#..\n###.\n.#.#\n..#.",
"output": "YES"
},
{
"input": "###.\n###.\n...#\n...#",
"output": "YES"
},
{
"input": "#.##\n##.#\n#.##\n##.#",
"output": "YES"
},
{
"input": ".#.#\n#.#.\n.#.#\n#.##",
"output": "YES"
},
{
"input": "##..\n..##\n##..\n...#",
"output": "YES"
},
{
"input": ".#..\n..##\n##..\n..##",
"output": "YES"
},
{
"input": "##..\n...#\n##..\n...#",
"output": "YES"
},
{
"input": ".#..\n..#.\n.#..\n..#.",
"output": "YES"
},
{
"input": "....\n....\n....\n.#.#",
"output": "YES"
},
{
"input": "....\n....\n....\n...#",
"output": "YES"
}
] | 1,676,010,838
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 30
| 62
| 0
|
def f():
a1, a2, a3, a4 = input(), input(), input(), input()
li = []
li.append(a1[:2] + a2[:2])
li.append(a1[1:3] + a2[1:3])
li.append(a1[2:] + a2[2:])
li.append(a2[:2] + a3[:2])
li.append(a2[1:3] + a3[1:3])
li.append(a2[2:] + a3[2:])
li.append(a3[:2] + a4[:2])
li.append(a3[1:3] + a4[1:3])
li.append(a3[2:] + a4[2:])
p = 1
for i in range(9):
if li[i].count('#') == 2:
continue
else:
p = 0
break
if p:
print('NO')
else:
print('YES')
import sys
input = lambda: sys.stdin.readline().rstrip()
f()
|
Title: IQ Test
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In the city of Ultima Thule job applicants are often offered an IQ test.
The test is as follows: the person gets a piece of squared paper with a 4<=×<=4 square painted on it. Some of the square's cells are painted black and others are painted white. Your task is to repaint at most one cell the other color so that the picture has a 2<=×<=2 square, completely consisting of cells of the same color. If the initial picture already has such a square, the person should just say so and the test will be completed.
Your task is to write a program that determines whether it is possible to pass the test. You cannot pass the test if either repainting any cell or no action doesn't result in a 2<=×<=2 square, consisting of cells of the same color.
Input Specification:
Four lines contain four characters each: the *j*-th character of the *i*-th line equals "." if the cell in the *i*-th row and the *j*-th column of the square is painted white, and "#", if the cell is black.
Output Specification:
Print "YES" (without the quotes), if the test can be passed and "NO" (without the quotes) otherwise.
Demo Input:
['####\n.#..\n####\n....\n', '####\n....\n####\n....\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first test sample it is enough to repaint the first cell in the second row. After such repainting the required 2 × 2 square is on the intersection of the 1-st and 2-nd row with the 1-st and 2-nd column.
|
```python
def f():
a1, a2, a3, a4 = input(), input(), input(), input()
li = []
li.append(a1[:2] + a2[:2])
li.append(a1[1:3] + a2[1:3])
li.append(a1[2:] + a2[2:])
li.append(a2[:2] + a3[:2])
li.append(a2[1:3] + a3[1:3])
li.append(a2[2:] + a3[2:])
li.append(a3[:2] + a4[:2])
li.append(a3[1:3] + a4[1:3])
li.append(a3[2:] + a4[2:])
p = 1
for i in range(9):
if li[i].count('#') == 2:
continue
else:
p = 0
break
if p:
print('NO')
else:
print('YES')
import sys
input = lambda: sys.stdin.readline().rstrip()
f()
```
| 3
|
|
16
|
A
|
Flag
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Flag
|
2
|
64
|
According to a new ISO standard, a flag of every country should have a chequered field *n*<=×<=*m*, each square should be of one of 10 colours, and the flag should be «striped»: each horizontal row of the flag should contain squares of the same colour, and the colours of adjacent horizontal rows should be different. Berland's government asked you to find out whether their flag meets the new ISO standard.
|
The first line of the input contains numbers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100), *n* — the amount of rows, *m* — the amount of columns on the flag of Berland. Then there follows the description of the flag: each of the following *n* lines contain *m* characters. Each character is a digit between 0 and 9, and stands for the colour of the corresponding square.
|
Output YES, if the flag meets the new ISO standard, and NO otherwise.
|
[
"3 3\n000\n111\n222\n",
"3 3\n000\n000\n111\n",
"3 3\n000\n111\n002\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 0
|
[
{
"input": "3 3\n000\n111\n222",
"output": "YES"
},
{
"input": "3 3\n000\n000\n111",
"output": "NO"
},
{
"input": "3 3\n000\n111\n002",
"output": "NO"
},
{
"input": "10 10\n2222222222\n5555555555\n0000000000\n4444444444\n1111111111\n3333333393\n3333333333\n5555555555\n0000000000\n8888888888",
"output": "NO"
},
{
"input": "10 13\n4442444444444\n8888888888888\n6666666666666\n0000000000000\n3333333333333\n4444444444444\n7777777777777\n8388888888888\n1111111111111\n5555555555555",
"output": "NO"
},
{
"input": "10 8\n33333333\n44444444\n11111115\n81888888\n44444444\n11111111\n66666666\n33330333\n33333333\n33333333",
"output": "NO"
},
{
"input": "5 5\n88888\n44444\n66666\n55555\n88888",
"output": "YES"
},
{
"input": "20 19\n1111111111111111111\n5555555555555555555\n0000000000000000000\n3333333333333333333\n1111111111111111111\n2222222222222222222\n4444444444444444444\n5555555555555555555\n0000000000000000000\n4444444444444444444\n0000000000000000000\n5555555555555555555\n7777777777777777777\n9999999999999999999\n2222222222222222222\n4444444444444444444\n1111111111111111111\n6666666666666666666\n7777777777777777777\n2222222222222222222",
"output": "YES"
},
{
"input": "1 100\n8888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888",
"output": "YES"
},
{
"input": "100 1\n5\n7\n9\n4\n7\n2\n5\n1\n6\n7\n2\n7\n6\n8\n7\n4\n0\n2\n9\n8\n9\n1\n6\n4\n3\n4\n7\n1\n9\n3\n0\n8\n3\n1\n7\n5\n3\n9\n5\n1\n3\n5\n8\n1\n9\n3\n9\n0\n6\n0\n7\n6\n5\n2\n8\n3\n7\n6\n5\n1\n8\n3\n6\n9\n6\n0\n5\n8\n5\n2\n9\n1\n0\n1\n8\n3\n2\n1\n0\n3\n9\n0\n5\n1\n0\n4\n9\n3\n0\n4\n8\n4\n8\n6\n3\n0\n4\n6\n8\n4",
"output": "YES"
},
{
"input": "1 1\n2",
"output": "YES"
},
{
"input": "1 100\n1111111111111111111111111111111111111111111111111111111111111111111111111111181111111111111111111111",
"output": "NO"
},
{
"input": "100 1\n3\n6\n4\n3\n0\n2\n8\n7\n3\n2\n1\n7\n1\n3\n2\n3\n6\n9\n0\n8\n5\n9\n7\n9\n2\n1\n4\n5\n1\n9\n2\n5\n1\n4\n6\n4\n9\n1\n0\n2\n1\n4\n7\n1\n4\n8\n0\n9\n2\n1\n6\n2\n8\n6\n9\n5\n8\n6\n4\n5\n9\n2\n7\n4\n1\n5\n8\n0\n9\n5\n4\n6\n5\n0\n6\n3\n6\n9\n7\n2\n0\n9\n7\n3\n2\n4\n9\n4\n7\n1\n2\n3\n1\n7\n9\n1\n9\n0\n4\n0",
"output": "YES"
}
] | 1,686,000,158
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 62
| 0
|
n,m = input().split()
n = int(n)
m = int(m)
cols = []
Finished = False
for rows in range(n):
row = input().split()
if len(set(row)) == 1:
cols.append(row[0])
else:
print('NO')
Finished = True
break
if not Finished:
if len(set(cols)) == m:
print('YES')
else:
print('NO')
|
Title: Flag
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
According to a new ISO standard, a flag of every country should have a chequered field *n*<=×<=*m*, each square should be of one of 10 colours, and the flag should be «striped»: each horizontal row of the flag should contain squares of the same colour, and the colours of adjacent horizontal rows should be different. Berland's government asked you to find out whether their flag meets the new ISO standard.
Input Specification:
The first line of the input contains numbers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100), *n* — the amount of rows, *m* — the amount of columns on the flag of Berland. Then there follows the description of the flag: each of the following *n* lines contain *m* characters. Each character is a digit between 0 and 9, and stands for the colour of the corresponding square.
Output Specification:
Output YES, if the flag meets the new ISO standard, and NO otherwise.
Demo Input:
['3 3\n000\n111\n222\n', '3 3\n000\n000\n111\n', '3 3\n000\n111\n002\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
n,m = input().split()
n = int(n)
m = int(m)
cols = []
Finished = False
for rows in range(n):
row = input().split()
if len(set(row)) == 1:
cols.append(row[0])
else:
print('NO')
Finished = True
break
if not Finished:
if len(set(cols)) == m:
print('YES')
else:
print('NO')
```
| 0
|
4
|
A
|
Watermelon
|
PROGRAMMING
| 800
|
[
"brute force",
"math"
] |
A. Watermelon
|
1
|
64
|
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight.
|
The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys.
|
Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case.
|
[
"8\n"
] |
[
"YES\n"
] |
For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos).
| 0
|
[
{
"input": "8",
"output": "YES"
},
{
"input": "5",
"output": "NO"
},
{
"input": "4",
"output": "YES"
},
{
"input": "3",
"output": "NO"
},
{
"input": "2",
"output": "NO"
},
{
"input": "1",
"output": "NO"
},
{
"input": "7",
"output": "NO"
},
{
"input": "6",
"output": "YES"
},
{
"input": "10",
"output": "YES"
},
{
"input": "9",
"output": "NO"
},
{
"input": "53",
"output": "NO"
},
{
"input": "77",
"output": "NO"
},
{
"input": "32",
"output": "YES"
},
{
"input": "44",
"output": "YES"
},
{
"input": "98",
"output": "YES"
},
{
"input": "99",
"output": "NO"
},
{
"input": "90",
"output": "YES"
},
{
"input": "67",
"output": "NO"
},
{
"input": "100",
"output": "YES"
},
{
"input": "88",
"output": "YES"
}
] | 1,695,742,141
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 30
| 0
|
WatermelonWeight = eval(input("Enter the watermelon weight:"))
if WatermelonWeight % 2 == 0 :
print("yes")
else:
print("no")
|
Title: Watermelon
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight.
Input Specification:
The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys.
Output Specification:
Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case.
Demo Input:
['8\n']
Demo Output:
['YES\n']
Note:
For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos).
|
```python
WatermelonWeight = eval(input("Enter the watermelon weight:"))
if WatermelonWeight % 2 == 0 :
print("yes")
else:
print("no")
```
| 0
|
614
|
B
|
Gena's Code
|
PROGRAMMING
| 1,400
|
[
"implementation",
"math"
] | null | null |
It's the year 4527 and the tanks game that we all know and love still exists. There also exists Great Gena's code, written in 2016. The problem this code solves is: given the number of tanks that go into the battle from each country, find their product. If it is turns to be too large, then the servers might have not enough time to assign tanks into teams and the whole game will collapse!
There are exactly *n* distinct countries in the world and the *i*-th country added *a**i* tanks to the game. As the developers of the game are perfectionists, the number of tanks from each country is beautiful. A beautiful number, according to the developers, is such number that its decimal representation consists only of digits '1' and '0', moreover it contains at most one digit '1'. However, due to complaints from players, some number of tanks of one country was removed from the game, hence the number of tanks of this country may not remain beautiful.
Your task is to write the program that solves exactly the same problem in order to verify Gena's code correctness. Just in case.
|
The first line of the input contains the number of countries *n* (1<=≤<=*n*<=≤<=100<=000). The second line contains *n* non-negative integers *a**i* without leading zeroes — the number of tanks of the *i*-th country.
It is guaranteed that the second line contains at least *n*<=-<=1 beautiful numbers and the total length of all these number's representations doesn't exceed 100<=000.
|
Print a single number without leading zeroes — the product of the number of tanks presented by each country.
|
[
"3\n5 10 1\n",
"4\n1 1 10 11\n",
"5\n0 3 1 100 1\n"
] |
[
"50",
"110",
"0"
] |
In sample 1 numbers 10 and 1 are beautiful, number 5 is not not.
In sample 2 number 11 is not beautiful (contains two '1's), all others are beautiful.
In sample 3 number 3 is not beautiful, all others are beautiful.
| 1,000
|
[
{
"input": "3\n5 10 1",
"output": "50"
},
{
"input": "4\n1 1 10 11",
"output": "110"
},
{
"input": "5\n0 3 1 100 1",
"output": "0"
},
{
"input": "40\n10 100 10 1 10 10 100 10 10 100 10 100 100 10 1824868942 100 100 1 10 100 100 10 100 100 10 100 10 1 10 100 100 100 10 1 10 1 10 10 100 100",
"output": "1824868942000000000000000000000000000000000000000000000000000"
},
{
"input": "6\n1000000000000000000000000000000000000 6643573784 1000000000000000000000000000000000000 1000000000000000000000000000000000000 1000000000000000000000000000000000000 1000000000000000000000000000000000000",
"output": "6643573784000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000"
},
{
"input": "1\n0",
"output": "0"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "1\n9",
"output": "9"
},
{
"input": "2\n10 50",
"output": "500"
},
{
"input": "3\n500 1 10",
"output": "5000"
}
] | 1,640,768,541
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 9
| 500
| 716,800
|
n=int(input())
arr=list(map(int,input().split()))
ans=1
for a in arr:
ans*=a
print(ans)
|
Title: Gena's Code
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It's the year 4527 and the tanks game that we all know and love still exists. There also exists Great Gena's code, written in 2016. The problem this code solves is: given the number of tanks that go into the battle from each country, find their product. If it is turns to be too large, then the servers might have not enough time to assign tanks into teams and the whole game will collapse!
There are exactly *n* distinct countries in the world and the *i*-th country added *a**i* tanks to the game. As the developers of the game are perfectionists, the number of tanks from each country is beautiful. A beautiful number, according to the developers, is such number that its decimal representation consists only of digits '1' and '0', moreover it contains at most one digit '1'. However, due to complaints from players, some number of tanks of one country was removed from the game, hence the number of tanks of this country may not remain beautiful.
Your task is to write the program that solves exactly the same problem in order to verify Gena's code correctness. Just in case.
Input Specification:
The first line of the input contains the number of countries *n* (1<=≤<=*n*<=≤<=100<=000). The second line contains *n* non-negative integers *a**i* without leading zeroes — the number of tanks of the *i*-th country.
It is guaranteed that the second line contains at least *n*<=-<=1 beautiful numbers and the total length of all these number's representations doesn't exceed 100<=000.
Output Specification:
Print a single number without leading zeroes — the product of the number of tanks presented by each country.
Demo Input:
['3\n5 10 1\n', '4\n1 1 10 11\n', '5\n0 3 1 100 1\n']
Demo Output:
['50', '110', '0']
Note:
In sample 1 numbers 10 and 1 are beautiful, number 5 is not not.
In sample 2 number 11 is not beautiful (contains two '1's), all others are beautiful.
In sample 3 number 3 is not beautiful, all others are beautiful.
|
```python
n=int(input())
arr=list(map(int,input().split()))
ans=1
for a in arr:
ans*=a
print(ans)
```
| 0
|
|
526
|
A
|
King of Thieves
|
PROGRAMMING
| 1,300
|
[
"brute force",
"implementation"
] | null | null |
In this problem you will meet the simplified model of game King of Thieves.
In a new ZeptoLab game called "King of Thieves" your aim is to reach a chest with gold by controlling your character, avoiding traps and obstacles on your way.
An interesting feature of the game is that you can design your own levels that will be available to other players. Let's consider the following simple design of a level.
A dungeon consists of *n* segments located at a same vertical level, each segment is either a platform that character can stand on, or a pit with a trap that makes player lose if he falls into it. All segments have the same length, platforms on the scheme of the level are represented as '*' and pits are represented as '.'.
One of things that affects speedrun characteristics of the level is a possibility to perform a series of consecutive jumps of the same length. More formally, when the character is on the platform number *i*1, he can make a sequence of jumps through the platforms *i*1<=<<=*i*2<=<<=...<=<<=*i**k*, if *i*2<=-<=*i*1<==<=*i*3<=-<=*i*2<==<=...<==<=*i**k*<=-<=*i**k*<=-<=1. Of course, all segments *i*1,<=*i*2,<=... *i**k* should be exactly the platforms, not pits.
Let's call a level to be good if you can perform a sequence of four jumps of the same length or in the other words there must be a sequence *i*1,<=*i*2,<=...,<=*i*5, consisting of five platforms so that the intervals between consecutive platforms are of the same length. Given the scheme of the level, check if it is good.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of segments on the level.
Next line contains the scheme of the level represented as a string of *n* characters '*' and '.'.
|
If the level is good, print the word "yes" (without the quotes), otherwise print the word "no" (without the quotes).
|
[
"16\n.**.*..*.***.**.\n",
"11\n.*.*...*.*.\n"
] |
[
"yes",
"no"
] |
In the first sample test you may perform a sequence of jumps through platforms 2, 5, 8, 11, 14.
| 500
|
[
{
"input": "16\n.**.*..*.***.**.",
"output": "yes"
},
{
"input": "11\n.*.*...*.*.",
"output": "no"
},
{
"input": "53\n*.*.****.*.*......**....**.***.*.*.**.*.*.***...*..*.",
"output": "yes"
},
{
"input": "71\n**.**..*****.*.*.*.********.....*****.****.*..***...*.*.*.**.****.**.**",
"output": "yes"
},
{
"input": "56\n**.*..*...***.*.**.**..**.*.*.*.**...*.**.**....*...**..",
"output": "yes"
},
{
"input": "64\n***.*...*...*.***.....*.....**.*****.*.*...*..*.*..***..*...***.",
"output": "yes"
},
{
"input": "99\n.*..**..*..*..**...***.****.*...*....*****.....**..****.*..*....****..**..*****..*....**.*.**..**..",
"output": "yes"
},
{
"input": "89\n..**..**..*.********....*.*****.**.****...*......*******..*.**.*****..*..****....*...**..",
"output": "yes"
},
{
"input": "99\n..*.*..**.*.*.******.*.*.**.**.**.*..**.*.*****..*.*.****.*....**....*****.....***..**....***.*.*.*",
"output": "yes"
},
{
"input": "5\n*****",
"output": "yes"
},
{
"input": "10\n.*.*.*.*.*",
"output": "yes"
},
{
"input": "51\n....****....*........*.*..**........*....****....*.",
"output": "no"
},
{
"input": "98\n.**..**.*****..***...*.**..*..*....*******..**....*.****.**.*.....*.**..***.**..***.*******..****.",
"output": "yes"
},
{
"input": "45\n.***..******....***..**..*.*.*.**..**..*.**..",
"output": "yes"
},
{
"input": "67\n..**.*...*.....****.***.**.*....***..***.*..***.....*******.....*.*",
"output": "yes"
},
{
"input": "97\n...*..*...*******.*.**..**..******.*.*..*****.*...***.*.**.**.**..**.******.****.*.***.**..*...**",
"output": "yes"
},
{
"input": "87\n*..*..***.**.*...****...*....***....***......*..*.*.*****.**..*.***...*.****..**.*..***",
"output": "yes"
},
{
"input": "99\n***....*.....****.*.**.*.*.**.*.*.*..*...*..*...***..*.*...*.*...***.*.*...**.**.*******....**....*",
"output": "yes"
},
{
"input": "90\n**....****.***..***.*.*****...*.*.***..***.******.**...***..*...*****..*.**.**...*..**...*",
"output": "yes"
},
{
"input": "58\n**.*.*.**..******.**.*..*.**.*.*******.**.*.**.*..*****.*.",
"output": "yes"
},
{
"input": "75\n..*.**..*.*****.......*....*.*.*..**.*.***.*.***....******.****.*.....****.",
"output": "yes"
},
{
"input": "72\n.***.**.*.*...*****.*.*.*.*.**....**.*.**..*.*...**..***.**.**..*.**..**",
"output": "yes"
},
{
"input": "69\n.***...*.***.**...*....*.***.*..*....**.*...**....*.*..**....**..*.**",
"output": "yes"
},
{
"input": "42\n..*...*.*..**..*.*.*..**...**.***.*.******",
"output": "yes"
},
{
"input": "54\n...***.*...****.*..****....*..**..**..***.*..**...**..",
"output": "yes"
},
{
"input": "55\n...*..*.*.**..*.*....*.****..****....*..***.*****..*..*",
"output": "yes"
},
{
"input": "57\n**...*....**.**.*.******.**..**.*.....**.***..***...**..*",
"output": "yes"
},
{
"input": "97\n****.***.***.*..**.**.*.*.***.*............*..*......*.***.**.*.***.*.***.*..*.**.*.***.**.*****.",
"output": "yes"
},
{
"input": "42\n***.*..*.*.***...**..*..**....**..*..*...*",
"output": "yes"
},
{
"input": "99\n**...*.*.*..*....**.***..*...***..***.**.*.....*.*....*...*.**.**.****..**..*.*..*.***....**...**.*",
"output": "yes"
},
{
"input": "1\n.",
"output": "no"
},
{
"input": "1\n*",
"output": "no"
},
{
"input": "99\n.*.......................*.......................*.......................*.......................*.",
"output": "yes"
},
{
"input": "99\n.*.......................*...............................................*.......................*.",
"output": "no"
},
{
"input": "100\n****************************************************************************************************",
"output": "yes"
},
{
"input": "99\n***************************************************************************************************",
"output": "yes"
},
{
"input": "5\n.****",
"output": "no"
},
{
"input": "5\n*.***",
"output": "no"
},
{
"input": "5\n**.**",
"output": "no"
},
{
"input": "5\n***.*",
"output": "no"
},
{
"input": "5\n****.",
"output": "no"
},
{
"input": "100\n*...............................................................................................****",
"output": "no"
},
{
"input": "11\n.**.*..*.**",
"output": "no"
},
{
"input": "21\n*.*...*.*...*.*...*.*",
"output": "no"
},
{
"input": "6\n***.**",
"output": "no"
},
{
"input": "13\n*..*..*..*..*",
"output": "yes"
},
{
"input": "4\n****",
"output": "no"
},
{
"input": "17\n.*..*..*.....*..*",
"output": "no"
},
{
"input": "7\n***.***",
"output": "no"
},
{
"input": "20\n.*..*...*....*.....*",
"output": "no"
},
{
"input": "11\n*...**..*.*",
"output": "no"
},
{
"input": "10\n*****....*",
"output": "yes"
},
{
"input": "16\n*.**.**.**.*..*.",
"output": "yes"
},
{
"input": "10\n.*.*.*.*..",
"output": "no"
},
{
"input": "17\n*...*...*...*...*",
"output": "yes"
},
{
"input": "15\n..........*****",
"output": "yes"
}
] | 1,511,019,402
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 7
| 62
| 5,529,600
|
n = int(input().strip())
level = input().strip()
first = 0
for i in range(0, n):
if level[i] == '*':
first = i
break
def main():
for i in range(1, int(n / 4) + 1):
jumps = 0
j = first
while(i + j < n and level[j + i] == '*'):
jumps += 1
j += i
if jumps == 4:
print("yes")
return
jumps = 0
print("no")
if __name__ == "__main__":
main()
|
Title: King of Thieves
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In this problem you will meet the simplified model of game King of Thieves.
In a new ZeptoLab game called "King of Thieves" your aim is to reach a chest with gold by controlling your character, avoiding traps and obstacles on your way.
An interesting feature of the game is that you can design your own levels that will be available to other players. Let's consider the following simple design of a level.
A dungeon consists of *n* segments located at a same vertical level, each segment is either a platform that character can stand on, or a pit with a trap that makes player lose if he falls into it. All segments have the same length, platforms on the scheme of the level are represented as '*' and pits are represented as '.'.
One of things that affects speedrun characteristics of the level is a possibility to perform a series of consecutive jumps of the same length. More formally, when the character is on the platform number *i*1, he can make a sequence of jumps through the platforms *i*1<=<<=*i*2<=<<=...<=<<=*i**k*, if *i*2<=-<=*i*1<==<=*i*3<=-<=*i*2<==<=...<==<=*i**k*<=-<=*i**k*<=-<=1. Of course, all segments *i*1,<=*i*2,<=... *i**k* should be exactly the platforms, not pits.
Let's call a level to be good if you can perform a sequence of four jumps of the same length or in the other words there must be a sequence *i*1,<=*i*2,<=...,<=*i*5, consisting of five platforms so that the intervals between consecutive platforms are of the same length. Given the scheme of the level, check if it is good.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the number of segments on the level.
Next line contains the scheme of the level represented as a string of *n* characters '*' and '.'.
Output Specification:
If the level is good, print the word "yes" (without the quotes), otherwise print the word "no" (without the quotes).
Demo Input:
['16\n.**.*..*.***.**.\n', '11\n.*.*...*.*.\n']
Demo Output:
['yes', 'no']
Note:
In the first sample test you may perform a sequence of jumps through platforms 2, 5, 8, 11, 14.
|
```python
n = int(input().strip())
level = input().strip()
first = 0
for i in range(0, n):
if level[i] == '*':
first = i
break
def main():
for i in range(1, int(n / 4) + 1):
jumps = 0
j = first
while(i + j < n and level[j + i] == '*'):
jumps += 1
j += i
if jumps == 4:
print("yes")
return
jumps = 0
print("no")
if __name__ == "__main__":
main()
```
| 0
|
|
4
|
A
|
Watermelon
|
PROGRAMMING
| 800
|
[
"brute force",
"math"
] |
A. Watermelon
|
1
|
64
|
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight.
|
The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys.
|
Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case.
|
[
"8\n"
] |
[
"YES\n"
] |
For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos).
| 0
|
[
{
"input": "8",
"output": "YES"
},
{
"input": "5",
"output": "NO"
},
{
"input": "4",
"output": "YES"
},
{
"input": "3",
"output": "NO"
},
{
"input": "2",
"output": "NO"
},
{
"input": "1",
"output": "NO"
},
{
"input": "7",
"output": "NO"
},
{
"input": "6",
"output": "YES"
},
{
"input": "10",
"output": "YES"
},
{
"input": "9",
"output": "NO"
},
{
"input": "53",
"output": "NO"
},
{
"input": "77",
"output": "NO"
},
{
"input": "32",
"output": "YES"
},
{
"input": "44",
"output": "YES"
},
{
"input": "98",
"output": "YES"
},
{
"input": "99",
"output": "NO"
},
{
"input": "90",
"output": "YES"
},
{
"input": "67",
"output": "NO"
},
{
"input": "100",
"output": "YES"
},
{
"input": "88",
"output": "YES"
}
] | 1,688,928,607
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
if (w/2)%2==0:
return True
else:
return False
|
Title: Watermelon
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
One hot summer day Pete and his friend Billy decided to buy a watermelon. They chose the biggest and the ripest one, in their opinion. After that the watermelon was weighed, and the scales showed *w* kilos. They rushed home, dying of thirst, and decided to divide the berry, however they faced a hard problem.
Pete and Billy are great fans of even numbers, that's why they want to divide the watermelon in such a way that each of the two parts weighs even number of kilos, at the same time it is not obligatory that the parts are equal. The boys are extremely tired and want to start their meal as soon as possible, that's why you should help them and find out, if they can divide the watermelon in the way they want. For sure, each of them should get a part of positive weight.
Input Specification:
The first (and the only) input line contains integer number *w* (1<=≤<=*w*<=≤<=100) — the weight of the watermelon bought by the boys.
Output Specification:
Print YES, if the boys can divide the watermelon into two parts, each of them weighing even number of kilos; and NO in the opposite case.
Demo Input:
['8\n']
Demo Output:
['YES\n']
Note:
For example, the boys can divide the watermelon into two parts of 2 and 6 kilos respectively (another variant — two parts of 4 and 4 kilos).
|
```python
if (w/2)%2==0:
return True
else:
return False
```
| -1
|
95
|
A
|
Hockey
|
PROGRAMMING
| 1,600
|
[
"implementation",
"strings"
] |
A. Hockey
|
2
|
256
|
Petya loves hockey very much. One day, as he was watching a hockey match, he fell asleep. Petya dreamt of being appointed to change a hockey team's name. Thus, Petya was given the original team name *w* and the collection of forbidden substrings *s*1,<=*s*2,<=...,<=*s**n*. All those strings consist of uppercase and lowercase Latin letters. String *w* has the length of |*w*|, its characters are numbered from 1 to |*w*|.
First Petya should find all the occurrences of forbidden substrings in the *w* string. During the search of substrings the case of letter shouldn't be taken into consideration. That is, strings "aBC" and "ABc" are considered equal.
After that Petya should perform the replacement of all letters covered by the occurrences. More formally: a letter in the position *i* should be replaced by any other one if for position *i* in string *w* there exist pair of indices *l*,<=*r* (1<=≤<=*l*<=≤<=*i*<=≤<=*r*<=≤<=|*w*|) such that substring *w*[*l* ... *r*] is contained in the collection *s*1,<=*s*2,<=...,<=*s**n*, when using case insensitive comparison. During the replacement the letter's case should remain the same. Petya is not allowed to replace the letters that aren't covered by any forbidden substring.
Letter *letter* (uppercase or lowercase) is considered lucky for the hockey players. That's why Petya should perform the changes so that the *letter* occurred in the resulting string as many times as possible. Help Petya to find such resulting string. If there are several such strings, find the one that comes first lexicographically.
Note that the process of replacements is not repeated, it occurs only once. That is, if after Petya's replacements the string started to contain new occurrences of bad substrings, Petya pays no attention to them.
|
The first line contains the only integer *n* (1<=≤<=*n*<=≤<=100) — the number of forbidden substrings in the collection. Next *n* lines contain these substrings. The next line contains string *w*. All those *n*<=+<=1 lines are non-empty strings consisting of uppercase and lowercase Latin letters whose length does not exceed 100. The last line contains a lowercase letter *letter*.
|
Output the only line — Petya's resulting string with the maximum number of letters *letter*. If there are several answers then output the one that comes first lexicographically.
The lexicographical comparison is performed by the standard < operator in modern programming languages. The line *a* is lexicographically smaller than the line *b*, if *a* is a prefix of *b*, or there exists such an *i* (1<=≤<=*i*<=≤<=|*a*|), that *a**i*<=<<=*b**i*, and for any *j* (1<=≤<=*j*<=<<=*i*) *a**j*<==<=*b**j*. |*a*| stands for the length of string *a*.
|
[
"3\nbers\nucky\nelu\nPetrLoveLuckyNumbers\nt\n",
"4\nhello\nparty\nabefglghjdhfgj\nIVan\npetrsmatchwin\na\n",
"2\naCa\ncba\nabAcaba\nc\n"
] |
[
"PetrLovtTttttNumtttt\n",
"petrsmatchwin\n",
"abCacba\n"
] |
none
| 500
|
[
{
"input": "3\nbers\nucky\nelu\nPetrLoveLuckyNumbers\nt",
"output": "PetrLovtTttttNumtttt"
},
{
"input": "4\nhello\nparty\nabefglghjdhfgj\nIVan\npetrsmatchwin\na",
"output": "petrsmatchwin"
},
{
"input": "2\naCa\ncba\nabAcaba\nc",
"output": "abCacba"
},
{
"input": "3\nlol\nhello\neho\nPetrUnited\nt",
"output": "PetrUnited"
},
{
"input": "2\ntrsd\ndream\nPetrsDreamOh\ny",
"output": "PeyyyYyyyyOh"
},
{
"input": "1\nPetrsDreamOh\nPetrsDreamOh\nh",
"output": "HhhhhHhhhhHa"
},
{
"input": "3\netr\ned\nied\nPetrUnited\nd",
"output": "PdddUnitda"
},
{
"input": "3\netr\ned\nied\nPetrUnited\nz",
"output": "PzzzUnitzz"
},
{
"input": "3\nab\nBa\naB\nABBA\na",
"output": "BAAB"
},
{
"input": "3\nab\nBa\naB\nABBAC\nb",
"output": "BAABC"
},
{
"input": "7\na\nb\ng\nk\ne\nt\nt\nA\na",
"output": "B"
},
{
"input": "4\nEfron\nKeyt\ncesho\ncool\nCodeForcesHockeyTeam\np",
"output": "CodeForpppPpcpppPeam"
},
{
"input": "4\nEfron\nKeyt\ncesho\ncool\nCodeForcesOldHockeyNewTeam\np",
"output": "CodeForcesOldHockeyNewTeam"
},
{
"input": "2\nA\nB\nabababBabaBBaBBBBAaaaAAAAA\na",
"output": "bababaAbabAAbAAAABbbbBBBBB"
},
{
"input": "7\nS\nT\ng\ni\nO\nr\nq\nkljpfP\nv",
"output": "kljpfP"
},
{
"input": "47\nV\nS\ng\nr\nC\nR\nB\nb\nl\nW\nJ\ni\nU\nn\nq\nq\nj\nL\nR\nu\nQ\nC\nf\nC\nU\nu\nx\nh\nq\nE\nY\nu\nK\nt\nM\nU\nA\nA\ns\ni\nV\nT\nj\nb\nk\nW\nN\nNlVwRlWzQQWoCI\nz",
"output": "ZzZzZzZzZZZoZZ"
},
{
"input": "47\njw\nL\nxIp\nW\nI\naI\nEp\nylG\nNe\nEglZ\noYkyo\nwDuZK\nDVh\nuoAoF\nGWj\nt\nP\nuNQz\nbPSg\neqru\nxvll\nO\nmb\nCM\nwnmvv\nYpFsq\nFYID\nc\nr\nrhbl\nYseyB\nRGcRj\nhDtz\nW\nQlQWB\nY\nftSl\nyPlAd\nLPgVw\nEIGOF\nTQ\nQrFcr\nspu\nK\nIJ\nfXUd\nGhpV\nDxUhKXELSLIiJMIOsbrpPQPXFwH\nw",
"output": "DxUhWXEWSWWwWMWWsbwwWQWXFaH"
},
{
"input": "74\nPjc\nZcOWk\nM\nyMyp\ncH\nTzmX\nA\nXgl\nKVB\nbljv\nIH\nu\nnu\nLdahF\nt\nO\nSv\nuzFT\nzfNd\nUM\nbXR\nUQbXk\nAA\ngVmH\nng\nF\nK\nHP\nIu\nwrH\nN\nPnTIQ\nkUY\nyabHN\nTA\nvrgl\nyxmsh\nTrQ\nX\nvIbrl\nMfu\nPfN\ni\nrH\nt\nHl\nUwst\nj\nB\nBiDCA\nJcE\nfd\nbXuI\nWWSU\nrd\nmj\nt\nIGrPe\nQl\nxfoSV\no\nWKdG\nTqeu\nE\nbZyg\nbVqR\nzY\nZD\nhHpdP\njHww\nlfU\ngVem\nt\nBD\nhUOfmkiMZhZxTuuiAyPuoutEQiPfZFSQVMMQxckAqtlRv\nx",
"output": "hXXxxxxXZhZaXxxxXyPxxxxXQxPxZXSQVXXQacxXqxlRv"
},
{
"input": "74\nULa\nn\nvq\nbybI\nfCX\nEEi\nSg\nxj\nIDz\nfsP\nM\nGGjx\nDpY\ngffu\nK\nMy\nqbtz\nk\nbLNb\nqET\nN\nBBY\nx\nKHUT\nUju\ntyXI\no\nChXY\neia\nR\nakHR\ng\nax\nKyY\nwpdl\nCZA\nsmFl\nLVDJ\nO\nxHF\nW\nTMZ\nvN\nqiT\ng\nI\nPsR\nsCJL\nN\naSCi\nJYD\nP\nA\nM\nT\nG\ngU\nk\nA\nloT\nEbP\nZ\nEoo\nQ\nGGY\nZcbG\ntvYl\nM\nczMR\nj\ne\nlLjf\nY\nzm\nqifNoaopvznANCLmPpfToShyelsYSFllyQLUDYbcQ\ng",
"output": "ggfGggggvggGGCLgGgfGgShgglsGSFllgGLUDGbcG"
},
{
"input": "74\nM\nLQ\nH\ncA\nqj\nD\nnj\nzD\njM\ns\nR\noC\nFh\nlO\nj\nc\nEn\nAB\nsw\nT\nz\nEb\nb\nu\nmj\nMI\nD\nj\nH\np\nzD\nV\nR\nvg\nH\nS\nBy\nu\nQP\nB\ndD\nrI\nJF\nnA\nsv\nz\na\nl\nI\nFJ\nK\nH\nT\nF\nl\ntC\ng\ns\nNl\nUj\nu\nA\nOO\nLd\nk\nk\nkM\nLY\nbn\nv\nfT\nC\nI\nc\naeBolOleYgGmSLkFCPJPbQZUeodomjS\nv",
"output": "vvVovVveYvVvVVvVVVVVvQVVeovovvV"
},
{
"input": "99\ns\nc\nN\nN\ni\ni\nW\nJ\nA\nW\nm\nB\nf\nO\nm\nk\nQ\nf\nx\np\nl\nH\nH\no\nn\nC\nK\nR\ns\nT\nJ\nv\nC\nZ\nd\nl\nr\no\nD\ng\na\nA\nE\nk\nN\nw\na\nb\no\nk\nv\nc\ni\nj\nE\nl\no\nf\nv\ns\nh\nx\nm\nE\nN\nt\nj\nk\ng\nk\nX\nW\ni\nX\nm\nw\nK\nL\nQ\nr\nj\nf\no\nw\nv\nS\no\nH\ne\nL\nL\nd\nP\nr\ng\nz\nz\nq\nd\nBBPVyRDLuNwdkeSYWimsIMiAPiOMQfuDQMcLEly\nq",
"output": "QQQQyQQQuQqqqqQYQqqqQQqQQqQQAquQAQqQQqy"
},
{
"input": "77\nGw\nZw\nqg\neO\nmx\nfE\nqD\nVv\nRs\nbd\nwA\nnh\nDm\nbR\nxV\nwe\nKH\nbl\nVy\naJ\nFr\nNP\nir\nxh\nFq\nDG\nNh\ndW\naG\nkm\nNS\nOm\nyC\nts\nZt\nEN\nFs\njA\nvf\nde\nDa\nAW\nBv\nmO\nDk\nYj\nfl\ndj\nJF\ndI\nhr\nzk\nam\nLT\nPJ\nAQ\nOW\nWN\nUG\nTL\nSZ\nBK\nLp\njW\nrY\nPB\nRj\nBw\ngl\nlK\nWj\nPl\nfx\nYO\nbX\nSN\nPt\nxPDCKNGWsNSlScKgBNEooOTnSuycVtvdToGmFoEfsUorvsSNcQIlaXRQqrfTZZoNvjutjhGpGXmNSQQWCzeHhMJAxclmiNnErpxH\nh",
"output": "xPDCKNHHhHHlScKgBNHhoOThHuhhVtvdToGmFoEhhUorvsHHcQIlaXRQqrfTZZoNvjutjhGpGXmHHQQWCzeHhMHHxclmiNnErphA"
},
{
"input": "100\nqn\nBE\nyN\nep\nPq\nXz\nLM\nEZ\ndb\nMn\nbn\nFe\nqA\nzc\nyq\npC\nyA\nWk\nYq\nrs\noD\nvD\nzW\nxZ\nbl\nur\nkf\ndf\nLS\nUW\nMy\nhR\nsh\nNh\nog\nCW\nor\nzo\nrO\nao\nXH\nDq\nKa\nlL\nYQ\nOh\nRZ\nAx\nta\nko\nDn\nNg\nNy\nDB\nYD\njO\nAp\nFT\noB\nNc\nwB\nHO\neW\nAc\nDr\nMt\nDf\nbF\nFP\nRa\nnF\nhF\nXC\nnG\nan\nZY\nuB\nHP\nOR\nKN\nUv\nLe\nIj\nlH\nVw\njb\nXn\nqu\nJo\nzL\nKW\nLS\naV\nLs\nBX\nMY\noK\nfh\ngP\nTB\npBWBEkqznLlZykhmPrfidzWbQMNDdBaDLykOfdvOZjKoUxCqKwJdGuhseuxaYcVyAGTSTwXYmKweRMUdbyfxssSNGLSAhckIknDj\nd",
"output": "pBDDDkqznDdDdkhmPrfiddDdQDDDaDaDLydDfdvOZjDdUdDqDdJdGuhseuxaYcVdDGTSTwXYmDdeRMUadyfxssSDDDDAhckIddDj"
},
{
"input": "3\na\nA\na\nA\na",
"output": "B"
},
{
"input": "3\na\nA\na\nA\nb",
"output": "B"
},
{
"input": "4\na\nA\ni\nA\nPetyaIsVeryCoolGuy\np",
"output": "PetypPsVeryCoolGuy"
},
{
"input": "3\njap\nthd\ndshipssinceW\nJapanisexperiencingitsgreatesthardshipssinceWorldWarIIthardshipssinceWorldWarIItesthardshixper\nc",
"output": "CccanisexperiencingitsgreatestharcccccccccacCorldWarIItharcccccccccacCorldWarIItesthardshixper"
},
{
"input": "3\njap\nthd\ndshipssinceW\nJapanisexperiencingitsgreatesthardshipssinceWorldWarIIthardshipssinceWorldWarIItesthardshixper\na",
"output": "AbaanisexperiencingitsgreatestharaaaaaaaaaaaAorldWarIItharaaaaaaaaaaaAorldWarIItesthardshixper"
},
{
"input": "7\na\nh\nu\np\nfgh\nwyz\ndefghijkl\nabcdefghijklmnopqrstuvwxyz\na",
"output": "bbcaaaaaaaaamnoaqrstavwxyz"
},
{
"input": "9\na\nh\nu\np\nz\nfgh\nwyz\ndefghijkl\nghijklmnopqrstu\nabcdefghijklmnopqrstuvwxyz\na",
"output": "bbcaaaaaaaaaaaaaaaaaavwxya"
},
{
"input": "3\nab\nBa\naB\nABBA\nl",
"output": "LLLL"
}
] | 1,699,127,011
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 49
| 248
| 1,331,200
|
s = [input().lower() for i in range(int(input()))]
u, x = input(), input()
y = 'ab'[x == 'a']
d = [(x, y), (x.upper(), y.upper())]
v = u.lower()
n = len(v)
k = [0] * (n + 1)
for q in s:
i = v.find(q)
while i != -1:
k[i] += 1
k[i + len(q)] -= 1
i = v.find(q, i + 1)
p = ''
for i in range(n):
k[i + 1] += k[i]
p += d[u[i] != v[i]][x == v[i]] if k[i] else u[i]
print(p)
|
Title: Hockey
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Petya loves hockey very much. One day, as he was watching a hockey match, he fell asleep. Petya dreamt of being appointed to change a hockey team's name. Thus, Petya was given the original team name *w* and the collection of forbidden substrings *s*1,<=*s*2,<=...,<=*s**n*. All those strings consist of uppercase and lowercase Latin letters. String *w* has the length of |*w*|, its characters are numbered from 1 to |*w*|.
First Petya should find all the occurrences of forbidden substrings in the *w* string. During the search of substrings the case of letter shouldn't be taken into consideration. That is, strings "aBC" and "ABc" are considered equal.
After that Petya should perform the replacement of all letters covered by the occurrences. More formally: a letter in the position *i* should be replaced by any other one if for position *i* in string *w* there exist pair of indices *l*,<=*r* (1<=≤<=*l*<=≤<=*i*<=≤<=*r*<=≤<=|*w*|) such that substring *w*[*l* ... *r*] is contained in the collection *s*1,<=*s*2,<=...,<=*s**n*, when using case insensitive comparison. During the replacement the letter's case should remain the same. Petya is not allowed to replace the letters that aren't covered by any forbidden substring.
Letter *letter* (uppercase or lowercase) is considered lucky for the hockey players. That's why Petya should perform the changes so that the *letter* occurred in the resulting string as many times as possible. Help Petya to find such resulting string. If there are several such strings, find the one that comes first lexicographically.
Note that the process of replacements is not repeated, it occurs only once. That is, if after Petya's replacements the string started to contain new occurrences of bad substrings, Petya pays no attention to them.
Input Specification:
The first line contains the only integer *n* (1<=≤<=*n*<=≤<=100) — the number of forbidden substrings in the collection. Next *n* lines contain these substrings. The next line contains string *w*. All those *n*<=+<=1 lines are non-empty strings consisting of uppercase and lowercase Latin letters whose length does not exceed 100. The last line contains a lowercase letter *letter*.
Output Specification:
Output the only line — Petya's resulting string with the maximum number of letters *letter*. If there are several answers then output the one that comes first lexicographically.
The lexicographical comparison is performed by the standard < operator in modern programming languages. The line *a* is lexicographically smaller than the line *b*, if *a* is a prefix of *b*, or there exists such an *i* (1<=≤<=*i*<=≤<=|*a*|), that *a**i*<=<<=*b**i*, and for any *j* (1<=≤<=*j*<=<<=*i*) *a**j*<==<=*b**j*. |*a*| stands for the length of string *a*.
Demo Input:
['3\nbers\nucky\nelu\nPetrLoveLuckyNumbers\nt\n', '4\nhello\nparty\nabefglghjdhfgj\nIVan\npetrsmatchwin\na\n', '2\naCa\ncba\nabAcaba\nc\n']
Demo Output:
['PetrLovtTttttNumtttt\n', 'petrsmatchwin\n', 'abCacba\n']
Note:
none
|
```python
s = [input().lower() for i in range(int(input()))]
u, x = input(), input()
y = 'ab'[x == 'a']
d = [(x, y), (x.upper(), y.upper())]
v = u.lower()
n = len(v)
k = [0] * (n + 1)
for q in s:
i = v.find(q)
while i != -1:
k[i] += 1
k[i + len(q)] -= 1
i = v.find(q, i + 1)
p = ''
for i in range(n):
k[i + 1] += k[i]
p += d[u[i] != v[i]][x == v[i]] if k[i] else u[i]
print(p)
```
| 3.93552
|
119
|
A
|
Epic Game
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take).
Your task is to determine by the given *a*, *b* and *n* who wins the game.
|
The only string contains space-separated integers *a*, *b* and *n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=100) — the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile.
|
If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes).
|
[
"3 5 9\n",
"1 1 100\n"
] |
[
"0",
"1"
] |
The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*, *b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*, 0) = *gcd*(0, *x*) = *x*.
In the first sample the game will go like that:
- Simon should take *gcd*(3, 9) = 3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5, 6) = 1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3, 5) = 1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5, 4) = 1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3, 3) = 3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5, 0) = 5 stones from the heap. As 0 < 5, it is impossible and Antisimon loses.
In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
| 500
|
[
{
"input": "3 5 9",
"output": "0"
},
{
"input": "1 1 100",
"output": "1"
},
{
"input": "23 12 16",
"output": "1"
},
{
"input": "95 26 29",
"output": "1"
},
{
"input": "73 32 99",
"output": "1"
},
{
"input": "1 1 1",
"output": "0"
},
{
"input": "41 12 65",
"output": "1"
},
{
"input": "13 61 100",
"output": "1"
},
{
"input": "100 100 10",
"output": "0"
},
{
"input": "12 24 26",
"output": "1"
},
{
"input": "73 21 96",
"output": "1"
},
{
"input": "17 22 81",
"output": "1"
},
{
"input": "14 88 97",
"output": "1"
},
{
"input": "42 81 17",
"output": "0"
},
{
"input": "34 36 19",
"output": "1"
},
{
"input": "21 87 12",
"output": "1"
},
{
"input": "97 92 98",
"output": "1"
},
{
"input": "49 25 62",
"output": "1"
},
{
"input": "29 17 44",
"output": "1"
},
{
"input": "10 1 10",
"output": "0"
},
{
"input": "99 98 100",
"output": "1"
},
{
"input": "100 100 1",
"output": "0"
},
{
"input": "11 99 55",
"output": "0"
},
{
"input": "8 13 21",
"output": "0"
},
{
"input": "34 55 89",
"output": "0"
},
{
"input": "21 34 55",
"output": "1"
},
{
"input": "13 21 34",
"output": "1"
},
{
"input": "34 21 55",
"output": "0"
},
{
"input": "10 20 84",
"output": "1"
},
{
"input": "4 2 5",
"output": "0"
},
{
"input": "3 2 3",
"output": "0"
},
{
"input": "31 23 1",
"output": "0"
},
{
"input": "100 100 100",
"output": "0"
},
{
"input": "100 1 100",
"output": "0"
},
{
"input": "1 100 100",
"output": "1"
},
{
"input": "1 1 100",
"output": "1"
},
{
"input": "17 23 100",
"output": "1"
},
{
"input": "99 98 100",
"output": "1"
},
{
"input": "1 1 2",
"output": "1"
},
{
"input": "2 1 1",
"output": "0"
},
{
"input": "1 2 1",
"output": "0"
},
{
"input": "2 1 2",
"output": "0"
},
{
"input": "10 10 3",
"output": "1"
},
{
"input": "2 2 1",
"output": "0"
},
{
"input": "9 5 1",
"output": "0"
}
] | 1,699,476,447
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 45
| 124
| 0
|
import math
a, b, c =map(int, input().split())
win=0
while True:
if win:
if math.gcd(c,b)<=c:
c-=math.gcd(c,b)
win=1-win
else:
break
else:
if math.gcd(c,a)<=c:
c-=math.gcd(c,a)
win=1-win
else:
break
print(1-win)
|
Title: Epic Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take).
Your task is to determine by the given *a*, *b* and *n* who wins the game.
Input Specification:
The only string contains space-separated integers *a*, *b* and *n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=100) — the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile.
Output Specification:
If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes).
Demo Input:
['3 5 9\n', '1 1 100\n']
Demo Output:
['0', '1']
Note:
The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*, *b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*, 0) = *gcd*(0, *x*) = *x*.
In the first sample the game will go like that:
- Simon should take *gcd*(3, 9) = 3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5, 6) = 1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3, 5) = 1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5, 4) = 1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3, 3) = 3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5, 0) = 5 stones from the heap. As 0 < 5, it is impossible and Antisimon loses.
In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
|
```python
import math
a, b, c =map(int, input().split())
win=0
while True:
if win:
if math.gcd(c,b)<=c:
c-=math.gcd(c,b)
win=1-win
else:
break
else:
if math.gcd(c,a)<=c:
c-=math.gcd(c,a)
win=1-win
else:
break
print(1-win)
```
| 3
|
|
510
|
A
|
Fox And Snake
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Fox Ciel starts to learn programming. The first task is drawing a fox! However, that turns out to be too hard for a beginner, so she decides to draw a snake instead.
A snake is a pattern on a *n* by *m* table. Denote *c*-th cell of *r*-th row as (*r*,<=*c*). The tail of the snake is located at (1,<=1), then it's body extends to (1,<=*m*), then goes down 2 rows to (3,<=*m*), then goes left to (3,<=1) and so on.
Your task is to draw this snake for Fox Ciel: the empty cells should be represented as dot characters ('.') and the snake cells should be filled with number signs ('#').
Consider sample tests in order to understand the snake pattern.
|
The only line contains two integers: *n* and *m* (3<=≤<=*n*,<=*m*<=≤<=50).
*n* is an odd number.
|
Output *n* lines. Each line should contain a string consisting of *m* characters. Do not output spaces.
|
[
"3 3\n",
"3 4\n",
"5 3\n",
"9 9\n"
] |
[
"###\n..#\n###\n",
"####\n...#\n####\n",
"###\n..#\n###\n#..\n###\n",
"#########\n........#\n#########\n#........\n#########\n........#\n#########\n#........\n#########\n"
] |
none
| 500
|
[
{
"input": "3 3",
"output": "###\n..#\n###"
},
{
"input": "3 4",
"output": "####\n...#\n####"
},
{
"input": "5 3",
"output": "###\n..#\n###\n#..\n###"
},
{
"input": "9 9",
"output": "#########\n........#\n#########\n#........\n#########\n........#\n#########\n#........\n#########"
},
{
"input": "3 5",
"output": "#####\n....#\n#####"
},
{
"input": "3 6",
"output": "######\n.....#\n######"
},
{
"input": "7 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###"
},
{
"input": "7 4",
"output": "####\n...#\n####\n#...\n####\n...#\n####"
},
{
"input": "49 50",
"output": "##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.............................................."
},
{
"input": "43 50",
"output": "##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.............................................."
},
{
"input": "43 27",
"output": "###########################\n..........................#\n###########################\n#..........................\n###########################\n..........................#\n###########################\n#..........................\n###########################\n..........................#\n###########################\n#..........................\n###########################\n..........................#\n###########################\n#..........................\n###########################\n....................."
},
{
"input": "11 15",
"output": "###############\n..............#\n###############\n#..............\n###############\n..............#\n###############\n#..............\n###############\n..............#\n###############"
},
{
"input": "11 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###"
},
{
"input": "19 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###"
},
{
"input": "23 50",
"output": "##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.............................................."
},
{
"input": "49 49",
"output": "#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#..."
},
{
"input": "33 43",
"output": "###########################################\n..........................................#\n###########################################\n#..........................................\n###########################################\n..........................................#\n###########################################\n#..........................................\n###########################################\n..........................................#\n###########################################\n#.................."
},
{
"input": "33 44",
"output": "############################################\n...........................................#\n############################################\n#...........................................\n############################################\n...........................................#\n############################################\n#...........................................\n############################################\n...........................................#\n############################################\n#......."
},
{
"input": "45 45",
"output": "#############################################\n............................................#\n#############################################\n#............................................\n#############################################\n............................................#\n#############################################\n#............................................\n#############################################\n............................................#\n#########################################..."
},
{
"input": "45 49",
"output": "#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#..."
},
{
"input": "45 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###"
},
{
"input": "45 4",
"output": "####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####"
},
{
"input": "5 4",
"output": "####\n...#\n####\n#...\n####"
},
{
"input": "5 5",
"output": "#####\n....#\n#####\n#....\n#####"
},
{
"input": "5 6",
"output": "######\n.....#\n######\n#.....\n######"
},
{
"input": "7 5",
"output": "#####\n....#\n#####\n#....\n#####\n....#\n#####"
},
{
"input": "7 6",
"output": "######\n.....#\n######\n#.....\n######\n.....#\n######"
},
{
"input": "7 7",
"output": "#######\n......#\n#######\n#......\n#######\n......#\n#######"
}
] | 1,683,208,438
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 28
| 46
| 0
|
column, row = map(int, input().split())
align = 1
for i in range(1, column + 1):
if i % 2 != 0:
print("#" * row)
elif align % 2 != 0:
print("." * (row - 1), end="")
print("#")
align += 1
elif align % 2 == 0:
print("#", end="")
print("." * (row - 1))
align += 1
|
Title: Fox And Snake
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fox Ciel starts to learn programming. The first task is drawing a fox! However, that turns out to be too hard for a beginner, so she decides to draw a snake instead.
A snake is a pattern on a *n* by *m* table. Denote *c*-th cell of *r*-th row as (*r*,<=*c*). The tail of the snake is located at (1,<=1), then it's body extends to (1,<=*m*), then goes down 2 rows to (3,<=*m*), then goes left to (3,<=1) and so on.
Your task is to draw this snake for Fox Ciel: the empty cells should be represented as dot characters ('.') and the snake cells should be filled with number signs ('#').
Consider sample tests in order to understand the snake pattern.
Input Specification:
The only line contains two integers: *n* and *m* (3<=≤<=*n*,<=*m*<=≤<=50).
*n* is an odd number.
Output Specification:
Output *n* lines. Each line should contain a string consisting of *m* characters. Do not output spaces.
Demo Input:
['3 3\n', '3 4\n', '5 3\n', '9 9\n']
Demo Output:
['###\n..#\n###\n', '####\n...#\n####\n', '###\n..#\n###\n#..\n###\n', '#########\n........#\n#########\n#........\n#########\n........#\n#########\n#........\n#########\n']
Note:
none
|
```python
column, row = map(int, input().split())
align = 1
for i in range(1, column + 1):
if i % 2 != 0:
print("#" * row)
elif align % 2 != 0:
print("." * (row - 1), end="")
print("#")
align += 1
elif align % 2 == 0:
print("#", end="")
print("." * (row - 1))
align += 1
```
| 3
|
|
460
|
A
|
Vasya and Socks
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation",
"math"
] | null | null |
Vasya has *n* pairs of socks. In the morning of each day Vasya has to put on a pair of socks before he goes to school. When he comes home in the evening, Vasya takes off the used socks and throws them away. Every *m*-th day (at days with numbers *m*,<=2*m*,<=3*m*,<=...) mom buys a pair of socks to Vasya. She does it late in the evening, so that Vasya cannot put on a new pair of socks before the next day. How many consecutive days pass until Vasya runs out of socks?
|
The single line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100; 2<=≤<=*m*<=≤<=100), separated by a space.
|
Print a single integer — the answer to the problem.
|
[
"2 2\n",
"9 3\n"
] |
[
"3\n",
"13\n"
] |
In the first sample Vasya spends the first two days wearing the socks that he had initially. Then on day three he puts on the socks that were bought on day two.
In the second sample Vasya spends the first nine days wearing the socks that he had initially. Then he spends three days wearing the socks that were bought on the third, sixth and ninth days. Than he spends another day wearing the socks that were bought on the twelfth day.
| 500
|
[
{
"input": "2 2",
"output": "3"
},
{
"input": "9 3",
"output": "13"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "2 3",
"output": "2"
},
{
"input": "1 99",
"output": "1"
},
{
"input": "4 4",
"output": "5"
},
{
"input": "10 2",
"output": "19"
},
{
"input": "10 9",
"output": "11"
},
{
"input": "100 100",
"output": "101"
},
{
"input": "2 27",
"output": "2"
},
{
"input": "99 100",
"output": "99"
},
{
"input": "99 2",
"output": "197"
},
{
"input": "100 3",
"output": "149"
},
{
"input": "98 3",
"output": "146"
},
{
"input": "4 4",
"output": "5"
},
{
"input": "100 2",
"output": "199"
},
{
"input": "62 4",
"output": "82"
},
{
"input": "99 10",
"output": "109"
},
{
"input": "100 5",
"output": "124"
},
{
"input": "80 80",
"output": "81"
},
{
"input": "95 16",
"output": "101"
},
{
"input": "75 16",
"output": "79"
},
{
"input": "99 74",
"output": "100"
},
{
"input": "20 21",
"output": "20"
},
{
"input": "52 96",
"output": "52"
},
{
"input": "24 5",
"output": "29"
}
] | 1,696,065,655
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 0
| 61
| 0
|
socks, day_bought = map(int, '93')
total_wear = socks
total_wear = total_wear + socks//day_bought
total_wear = total_wear + total_wear//socks
print(total_wear)
|
Title: Vasya and Socks
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has *n* pairs of socks. In the morning of each day Vasya has to put on a pair of socks before he goes to school. When he comes home in the evening, Vasya takes off the used socks and throws them away. Every *m*-th day (at days with numbers *m*,<=2*m*,<=3*m*,<=...) mom buys a pair of socks to Vasya. She does it late in the evening, so that Vasya cannot put on a new pair of socks before the next day. How many consecutive days pass until Vasya runs out of socks?
Input Specification:
The single line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100; 2<=≤<=*m*<=≤<=100), separated by a space.
Output Specification:
Print a single integer — the answer to the problem.
Demo Input:
['2 2\n', '9 3\n']
Demo Output:
['3\n', '13\n']
Note:
In the first sample Vasya spends the first two days wearing the socks that he had initially. Then on day three he puts on the socks that were bought on day two.
In the second sample Vasya spends the first nine days wearing the socks that he had initially. Then he spends three days wearing the socks that were bought on the third, sixth and ninth days. Than he spends another day wearing the socks that were bought on the twelfth day.
|
```python
socks, day_bought = map(int, '93')
total_wear = socks
total_wear = total_wear + socks//day_bought
total_wear = total_wear + total_wear//socks
print(total_wear)
```
| 0
|
|
702
|
A
|
Maximum Increase
|
PROGRAMMING
| 800
|
[
"dp",
"greedy",
"implementation"
] | null | null |
You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous.
|
The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109).
|
Print the maximum length of an increasing subarray of the given array.
|
[
"5\n1 7 2 11 15\n",
"6\n100 100 100 100 100 100\n",
"3\n1 2 3\n"
] |
[
"3\n",
"1\n",
"3\n"
] |
none
| 0
|
[
{
"input": "5\n1 7 2 11 15",
"output": "3"
},
{
"input": "6\n100 100 100 100 100 100",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n1000000000",
"output": "1"
},
{
"input": "10\n802030518 598196518 640274071 983359971 71550121 96204862 799843967 446173607 796619138 402690754",
"output": "3"
},
{
"input": "2\n2 1",
"output": "1"
},
{
"input": "5\n1 2 3 3 4",
"output": "3"
},
{
"input": "4\n1 2 2 3",
"output": "2"
},
{
"input": "3\n2 1 1",
"output": "1"
},
{
"input": "3\n1 2 1",
"output": "2"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n1 1 2",
"output": "2"
},
{
"input": "11\n1 2 3 1 2 3 2 1 2 3 4",
"output": "4"
},
{
"input": "9\n1 2 3 4 5 6 7 8 9",
"output": "9"
},
{
"input": "9\n1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "3\n3 2 1",
"output": "1"
},
{
"input": "7\n1 2 3 4 5 6 7",
"output": "7"
},
{
"input": "1\n1234394",
"output": "1"
}
] | 1,654,328,913
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 31
| 0
|
x = (int(input()))
g = list(map(int, input().split()))
c = -1000
k = 0
for i in range(x):
if g[i] > c:
k += 1
else:
k = 1
c = g[i]
print(k)
|
Title: Maximum Increase
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given array consisting of *n* integers. Your task is to find the maximum length of an increasing subarray of the given array.
A subarray is the sequence of consecutive elements of the array. Subarray is called increasing if each element of this subarray strictly greater than previous.
Input Specification:
The first line contains single positive integer *n* (1<=≤<=*n*<=≤<=105) — the number of integers.
The second line contains *n* positive integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print the maximum length of an increasing subarray of the given array.
Demo Input:
['5\n1 7 2 11 15\n', '6\n100 100 100 100 100 100\n', '3\n1 2 3\n']
Demo Output:
['3\n', '1\n', '3\n']
Note:
none
|
```python
x = (int(input()))
g = list(map(int, input().split()))
c = -1000
k = 0
for i in range(x):
if g[i] > c:
k += 1
else:
k = 1
c = g[i]
print(k)
```
| 0
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
You are given an undirected graph with *n* vertices. There are no edge-simple cycles with the even length in it. In other words, there are no cycles of even length that pass each edge at most once. Let's enumerate vertices from 1 to *n*.
You have to answer *q* queries. Each query is described by a segment of vertices [*l*;<=*r*], and you have to count the number of its subsegments [*x*;<=*y*] (*l*<=≤<=*x*<=≤<=*y*<=≤<=*r*), such that if we delete all vertices except the segment of vertices [*x*;<=*y*] (including *x* and *y*) and edges between them, the resulting graph is bipartite.
|
The first line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=3·105, 1<=≤<=*m*<=≤<=3·105) — the number of vertices and the number of edges in the graph.
The next *m* lines describe edges in the graph. The *i*-th of these lines contains two integers *a**i* and *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*; *a**i*<=≠<=*b**i*), denoting an edge between vertices *a**i* and *b**i*. It is guaranteed that this graph does not contain edge-simple cycles of even length.
The next line contains a single integer *q* (1<=≤<=*q*<=≤<=3·105) — the number of queries.
The next *q* lines contain queries. The *i*-th of these lines contains two integers *l**i* and *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the query parameters.
|
Print *q* numbers, each in new line: the *i*-th of them should be the number of subsegments [*x*;<=*y*] (*l**i*<=≤<=*x*<=≤<=*y*<=≤<=*r**i*), such that the graph that only includes vertices from segment [*x*;<=*y*] and edges between them is bipartite.
|
[
"6 6\n1 2\n2 3\n3 1\n4 5\n5 6\n6 4\n3\n1 3\n4 6\n1 6\n",
"8 9\n1 2\n2 3\n3 1\n4 5\n5 6\n6 7\n7 8\n8 4\n7 2\n3\n1 8\n1 4\n3 8\n"
] |
[
"5\n5\n14\n",
"27\n8\n19\n"
] |
The first example is shown on the picture below:
<img class="tex-graphics" src="https://espresso.codeforces.com/01e1d1999228f416613ff64b5d0e0cf984f150b1.png" style="max-width: 100.0%;max-height: 100.0%;"/>
For the first query, all subsegments of [1; 3], except this segment itself, are suitable.
For the first query, all subsegments of [4; 6], except this segment itself, are suitable.
For the third query, all subsegments of [1; 6] are suitable, except [1; 3], [1; 4], [1; 5], [1; 6], [2; 6], [3; 6], [4; 6].
The second example is shown on the picture below:
<img class="tex-graphics" src="https://espresso.codeforces.com/09b9227070585b8d5a7dff3cbc5f8535c260a595.png" style="max-width: 100.0%;max-height: 100.0%;"/>
| 0
|
[] | 1,513,704,884
| 7,184
|
PyPy 3
|
RUNTIME_ERROR
|
PRETESTS
| 0
| 77
| 23,142,400
|
from collections import defaultdict as di
n,m = [int(x) for x in input().split()]
coupl = [di(set),di(set),di(set)]
for i in range(m):
a,b = [int(x)-1 for x in input().split()]
coupl[-1][a].add(b)
coupl[-1][b].add(a)
colors = [-1]*n
def try_color(node):
if len(coupl[0][node])==0:
return 0
if len(coupl[1][node])==0:
return 1
return -1
reach = [-1]*n
next_to_color = 0
for ind in range(n):
if next_to_color<n:
pos_color = try_color(next_to_color)
print('try to color',pos_color)
while pos_color!=-1:
neig = []
for cop in coupl:
for nei in cop[next_to_color]:
neig.append(nei)
for nei in neig:
coupl[-1][nei].remove(next_to_color)
coupl[pos_color][nei].add(next_to_color)
colors[next_to_color] = pos_color
next_to_color += 1
if next_to_color>=n:
break
pos_color = try_color(next_to_color)
reach[ind] = next_to_color-1
neig = []
for cop in coupl:
for nei in cop[ind]:
neig.append(nei)
for nei in neig:
coupl[colors[ind]][nei].remove(ind)
colors[ind] = -1
print(reach)
cumsum = [0]*(n+1)
for i in range(n):
cumsum[i+1] = cumsum[i] + (reach[i]-i+1)
print(cumsum)
q = int(input())
for _ in range(q):
l,r = [int(x)-1 for x in input().split()]
if reach[l]>r:
N = r-l+1
print('allt funkar',l,r)
print(N*(N+1)//2)
break
a = l
b = n
while b-a>1:
m = (a+b)//2
if reach[m]<=r:
a=m
else:
b=m
print('Funkar fran',l,a+1,r)
summa = 0
summa += cumsum[a+1] - cumsum[l]
print('Från första får')
if a+1<=r:
N = r-(a+1)+1
print('Nst pekar ut',N)
summa += N*(N+1)//2
print(summa)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an undirected graph with *n* vertices. There are no edge-simple cycles with the even length in it. In other words, there are no cycles of even length that pass each edge at most once. Let's enumerate vertices from 1 to *n*.
You have to answer *q* queries. Each query is described by a segment of vertices [*l*;<=*r*], and you have to count the number of its subsegments [*x*;<=*y*] (*l*<=≤<=*x*<=≤<=*y*<=≤<=*r*), such that if we delete all vertices except the segment of vertices [*x*;<=*y*] (including *x* and *y*) and edges between them, the resulting graph is bipartite.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*<=≤<=3·105, 1<=≤<=*m*<=≤<=3·105) — the number of vertices and the number of edges in the graph.
The next *m* lines describe edges in the graph. The *i*-th of these lines contains two integers *a**i* and *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*; *a**i*<=≠<=*b**i*), denoting an edge between vertices *a**i* and *b**i*. It is guaranteed that this graph does not contain edge-simple cycles of even length.
The next line contains a single integer *q* (1<=≤<=*q*<=≤<=3·105) — the number of queries.
The next *q* lines contain queries. The *i*-th of these lines contains two integers *l**i* and *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the query parameters.
Output Specification:
Print *q* numbers, each in new line: the *i*-th of them should be the number of subsegments [*x*;<=*y*] (*l**i*<=≤<=*x*<=≤<=*y*<=≤<=*r**i*), such that the graph that only includes vertices from segment [*x*;<=*y*] and edges between them is bipartite.
Demo Input:
['6 6\n1 2\n2 3\n3 1\n4 5\n5 6\n6 4\n3\n1 3\n4 6\n1 6\n', '8 9\n1 2\n2 3\n3 1\n4 5\n5 6\n6 7\n7 8\n8 4\n7 2\n3\n1 8\n1 4\n3 8\n']
Demo Output:
['5\n5\n14\n', '27\n8\n19\n']
Note:
The first example is shown on the picture below:
<img class="tex-graphics" src="https://espresso.codeforces.com/01e1d1999228f416613ff64b5d0e0cf984f150b1.png" style="max-width: 100.0%;max-height: 100.0%;"/>
For the first query, all subsegments of [1; 3], except this segment itself, are suitable.
For the first query, all subsegments of [4; 6], except this segment itself, are suitable.
For the third query, all subsegments of [1; 6] are suitable, except [1; 3], [1; 4], [1; 5], [1; 6], [2; 6], [3; 6], [4; 6].
The second example is shown on the picture below:
<img class="tex-graphics" src="https://espresso.codeforces.com/09b9227070585b8d5a7dff3cbc5f8535c260a595.png" style="max-width: 100.0%;max-height: 100.0%;"/>
|
```python
from collections import defaultdict as di
n,m = [int(x) for x in input().split()]
coupl = [di(set),di(set),di(set)]
for i in range(m):
a,b = [int(x)-1 for x in input().split()]
coupl[-1][a].add(b)
coupl[-1][b].add(a)
colors = [-1]*n
def try_color(node):
if len(coupl[0][node])==0:
return 0
if len(coupl[1][node])==0:
return 1
return -1
reach = [-1]*n
next_to_color = 0
for ind in range(n):
if next_to_color<n:
pos_color = try_color(next_to_color)
print('try to color',pos_color)
while pos_color!=-1:
neig = []
for cop in coupl:
for nei in cop[next_to_color]:
neig.append(nei)
for nei in neig:
coupl[-1][nei].remove(next_to_color)
coupl[pos_color][nei].add(next_to_color)
colors[next_to_color] = pos_color
next_to_color += 1
if next_to_color>=n:
break
pos_color = try_color(next_to_color)
reach[ind] = next_to_color-1
neig = []
for cop in coupl:
for nei in cop[ind]:
neig.append(nei)
for nei in neig:
coupl[colors[ind]][nei].remove(ind)
colors[ind] = -1
print(reach)
cumsum = [0]*(n+1)
for i in range(n):
cumsum[i+1] = cumsum[i] + (reach[i]-i+1)
print(cumsum)
q = int(input())
for _ in range(q):
l,r = [int(x)-1 for x in input().split()]
if reach[l]>r:
N = r-l+1
print('allt funkar',l,r)
print(N*(N+1)//2)
break
a = l
b = n
while b-a>1:
m = (a+b)//2
if reach[m]<=r:
a=m
else:
b=m
print('Funkar fran',l,a+1,r)
summa = 0
summa += cumsum[a+1] - cumsum[l]
print('Från första får')
if a+1<=r:
N = r-(a+1)+1
print('Nst pekar ut',N)
summa += N*(N+1)//2
print(summa)
```
| -1
|
|
454
|
B
|
Little Pony and Sort by Shift
|
PROGRAMMING
| 1,200
|
[
"implementation"
] | null | null |
One day, Twilight Sparkle is interested in how to sort a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* in non-decreasing order. Being a young unicorn, the only operation she can perform is a unit shift. That is, she can move the last element of the sequence to its beginning:
Help Twilight Sparkle to calculate: what is the minimum number of operations that she needs to sort the sequence?
|
The first line contains an integer *n* (2<=≤<=*n*<=≤<=105). The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105).
|
If it's impossible to sort the sequence output -1. Otherwise output the minimum number of operations Twilight Sparkle needs to sort it.
|
[
"2\n2 1\n",
"3\n1 3 2\n",
"2\n1 2\n"
] |
[
"1\n",
"-1\n",
"0\n"
] |
none
| 1,000
|
[
{
"input": "2\n2 1",
"output": "1"
},
{
"input": "3\n1 3 2",
"output": "-1"
},
{
"input": "2\n1 2",
"output": "0"
},
{
"input": "6\n3 4 5 6 3 2",
"output": "-1"
},
{
"input": "3\n1 2 1",
"output": "1"
},
{
"input": "5\n1 1 2 1 1",
"output": "2"
},
{
"input": "4\n5 4 5 4",
"output": "-1"
},
{
"input": "7\n3 4 5 5 5 1 2",
"output": "2"
},
{
"input": "5\n2 2 1 2 2",
"output": "3"
},
{
"input": "5\n5 4 1 2 3",
"output": "-1"
},
{
"input": "4\n6 1 2 7",
"output": "-1"
},
{
"input": "5\n4 5 6 2 3",
"output": "2"
},
{
"input": "2\n1 1",
"output": "0"
},
{
"input": "4\n1 2 2 1",
"output": "1"
},
{
"input": "9\n4 5 6 7 1 2 3 4 10",
"output": "-1"
},
{
"input": "7\n2 3 4 1 2 3 4",
"output": "-1"
},
{
"input": "6\n1 2 1 2 1 2",
"output": "-1"
},
{
"input": "3\n3 2 1",
"output": "-1"
},
{
"input": "4\n1 4 4 1",
"output": "1"
},
{
"input": "5\n1 2 1 1 1",
"output": "3"
},
{
"input": "5\n4 6 7 3 5",
"output": "-1"
},
{
"input": "4\n2 3 1 4",
"output": "-1"
},
{
"input": "5\n5 4 3 2 1",
"output": "-1"
},
{
"input": "4\n2 4 1 4",
"output": "-1"
},
{
"input": "6\n4 5 6 1 2 7",
"output": "-1"
},
{
"input": "6\n1 2 3 1 1 1",
"output": "3"
},
{
"input": "5\n1 3 3 3 1",
"output": "1"
},
{
"input": "6\n5 6 7 5 5 5",
"output": "3"
},
{
"input": "5\n3 4 2 1 2",
"output": "-1"
},
{
"input": "3\n3 4 2",
"output": "1"
},
{
"input": "6\n1 1 2 2 1 1",
"output": "2"
},
{
"input": "4\n2 3 4 2",
"output": "1"
},
{
"input": "5\n3 5 7 7 3",
"output": "1"
},
{
"input": "4\n1 1 4 1",
"output": "1"
},
{
"input": "7\n1 5 6 1 1 1 1",
"output": "4"
},
{
"input": "5\n7 8 6 7 8",
"output": "-1"
},
{
"input": "4\n2 4 1 3",
"output": "-1"
}
] | 1,604,164,532
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 3
| 1,000
| 7,372,800
|
import collections
n = int(input())
li = list(map(int,input().split()))[:n]
l = len(li)
li2 = sorted(li)
count = 0
for i in range(l):
if li == li2:
break
else:
li = collections.deque(li)
li.rotate(1)
li = list(li)
count+=1
if count==l:
print(-1)
else:
print(count)
|
Title: Little Pony and Sort by Shift
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day, Twilight Sparkle is interested in how to sort a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* in non-decreasing order. Being a young unicorn, the only operation she can perform is a unit shift. That is, she can move the last element of the sequence to its beginning:
Help Twilight Sparkle to calculate: what is the minimum number of operations that she needs to sort the sequence?
Input Specification:
The first line contains an integer *n* (2<=≤<=*n*<=≤<=105). The second line contains *n* integer numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105).
Output Specification:
If it's impossible to sort the sequence output -1. Otherwise output the minimum number of operations Twilight Sparkle needs to sort it.
Demo Input:
['2\n2 1\n', '3\n1 3 2\n', '2\n1 2\n']
Demo Output:
['1\n', '-1\n', '0\n']
Note:
none
|
```python
import collections
n = int(input())
li = list(map(int,input().split()))[:n]
l = len(li)
li2 = sorted(li)
count = 0
for i in range(l):
if li == li2:
break
else:
li = collections.deque(li)
li.rotate(1)
li = list(li)
count+=1
if count==l:
print(-1)
else:
print(count)
```
| 0
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
Bike is interested in permutations. A permutation of length *n* is an integer sequence such that each integer from 0 to (*n*<=-<=1) appears exactly once in it. For example, [0,<=2,<=1] is a permutation of length 3 while both [0,<=2,<=2] and [1,<=2,<=3] is not.
A permutation triple of permutations of length *n* (*a*,<=*b*,<=*c*) is called a Lucky Permutation Triple if and only if . The sign *a**i* denotes the *i*-th element of permutation *a*. The modular equality described above denotes that the remainders after dividing *a**i*<=+<=*b**i* by *n* and dividing *c**i* by *n* are equal.
Now, he has an integer *n* and wants to find a Lucky Permutation Triple. Could you please help him?
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105).
|
If no Lucky Permutation Triple of length *n* exists print -1.
Otherwise, you need to print three lines. Each line contains *n* space-seperated integers. The first line must contain permutation *a*, the second line — permutation *b*, the third — permutation *c*.
If there are multiple solutions, print any of them.
|
[
"5\n",
"2\n"
] |
[
"1 4 3 2 0\n1 0 2 4 3\n2 4 0 1 3\n",
"-1\n"
] |
In Sample 1, the permutation triple ([1, 4, 3, 2, 0], [1, 0, 2, 4, 3], [2, 4, 0, 1, 3]) is Lucky Permutation Triple, as following holds:
- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a6bf1b9b57809dbec5021f65f89616f259587c07.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/48cc13134296b68f459f69d78e0240859aaec702.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/ac44412de7b46833e90348a6b3298f9796e3977c.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/3825b0bb758208dda2ead1c5224c05d89ad9ab55.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/0a72e2da40048a507839927a211267ac01c9bf89.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In Sample 2, you can easily notice that no lucky permutation triple exists.
| 0
|
[
{
"input": "5",
"output": "1 4 3 2 0\n1 0 2 4 3\n2 4 0 1 3"
},
{
"input": "2",
"output": "-1"
},
{
"input": "8",
"output": "-1"
},
{
"input": "9",
"output": "0 1 2 3 4 5 6 7 8 \n0 1 2 3 4 5 6 7 8 \n0 2 4 6 8 1 3 5 7 "
},
{
"input": "2",
"output": "-1"
},
{
"input": "77",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 \n0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 4..."
},
{
"input": "6",
"output": "-1"
},
{
"input": "87",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 \n0 2 4..."
},
{
"input": "72",
"output": "-1"
},
{
"input": "1",
"output": "0 \n0 \n0 "
},
{
"input": "23",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 2 4 6 8 10 12 14 16 18 20 22 1 3 5 7 9 11 13 15 17 19 21 "
},
{
"input": "52",
"output": "-1"
},
{
"input": "32",
"output": "-1"
},
{
"input": "25",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 \n0 2 4 6 8 10 12 14 16 18 20 22 24 1 3 5 7 9 11 13 15 17 19 21 23 "
},
{
"input": "54",
"output": "-1"
},
{
"input": "39",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 \n0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 "
},
{
"input": "20",
"output": "-1"
},
{
"input": "53",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 \n0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 "
},
{
"input": "34",
"output": "-1"
},
{
"input": "23",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 2 4 6 8 10 12 14 16 18 20 22 1 3 5 7 9 11 13 15 17 19 21 "
},
{
"input": "37123",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "41904",
"output": "-1"
},
{
"input": "46684",
"output": "-1"
},
{
"input": "67817",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "72598",
"output": "-1"
},
{
"input": "85891",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "74320",
"output": "-1"
},
{
"input": "11805",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "16586",
"output": "-1"
},
{
"input": "5014",
"output": "-1"
},
{
"input": "73268",
"output": "-1"
},
{
"input": "61697",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "99182",
"output": "-1"
},
{
"input": "79771",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "68199",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "5684",
"output": "-1"
},
{
"input": "10465",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "31598",
"output": "-1"
},
{
"input": "36379",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "16968",
"output": "-1"
},
{
"input": "93061",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "73650",
"output": "-1"
},
{
"input": "94783",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "99564",
"output": "-1"
},
{
"input": "37049",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "25478",
"output": "-1"
},
{
"input": "30259",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "43551",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "31980",
"output": "-1"
},
{
"input": "69465",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "1",
"output": "0 \n0 \n0 "
},
{
"input": "100000",
"output": "-1"
},
{
"input": "99999",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "99998",
"output": "-1"
}
] | 1,622,810,089
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 996
| 8,192,000
|
t=int(input())
if(t%2==0):
print(-1)
else:
arr=[]
brr=[]
crr=[]
for i in range(t-1,-1,-1):
arr.append(i)
for i in range(0,t,2):
brr.append(i)
for i in range(1,t-1,2):
brr.append(i)
for i in range(t):
x=arr[i]+brr[i]
y=int(x%t)
crr.append(y)
print(*arr,sep=" ")
print(*brr,sep=" ")
print(*crr,sep=" ")
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bike is interested in permutations. A permutation of length *n* is an integer sequence such that each integer from 0 to (*n*<=-<=1) appears exactly once in it. For example, [0,<=2,<=1] is a permutation of length 3 while both [0,<=2,<=2] and [1,<=2,<=3] is not.
A permutation triple of permutations of length *n* (*a*,<=*b*,<=*c*) is called a Lucky Permutation Triple if and only if . The sign *a**i* denotes the *i*-th element of permutation *a*. The modular equality described above denotes that the remainders after dividing *a**i*<=+<=*b**i* by *n* and dividing *c**i* by *n* are equal.
Now, he has an integer *n* and wants to find a Lucky Permutation Triple. Could you please help him?
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105).
Output Specification:
If no Lucky Permutation Triple of length *n* exists print -1.
Otherwise, you need to print three lines. Each line contains *n* space-seperated integers. The first line must contain permutation *a*, the second line — permutation *b*, the third — permutation *c*.
If there are multiple solutions, print any of them.
Demo Input:
['5\n', '2\n']
Demo Output:
['1 4 3 2 0\n1 0 2 4 3\n2 4 0 1 3\n', '-1\n']
Note:
In Sample 1, the permutation triple ([1, 4, 3, 2, 0], [1, 0, 2, 4, 3], [2, 4, 0, 1, 3]) is Lucky Permutation Triple, as following holds:
- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a6bf1b9b57809dbec5021f65f89616f259587c07.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/48cc13134296b68f459f69d78e0240859aaec702.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/ac44412de7b46833e90348a6b3298f9796e3977c.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/3825b0bb758208dda2ead1c5224c05d89ad9ab55.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/0a72e2da40048a507839927a211267ac01c9bf89.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In Sample 2, you can easily notice that no lucky permutation triple exists.
|
```python
t=int(input())
if(t%2==0):
print(-1)
else:
arr=[]
brr=[]
crr=[]
for i in range(t-1,-1,-1):
arr.append(i)
for i in range(0,t,2):
brr.append(i)
for i in range(1,t-1,2):
brr.append(i)
for i in range(t):
x=arr[i]+brr[i]
y=int(x%t)
crr.append(y)
print(*arr,sep=" ")
print(*brr,sep=" ")
print(*crr,sep=" ")
```
| 3
|
|
12
|
A
|
Super Agent
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Super Agent
|
2
|
256
|
There is a very secret base in Potatoland where potato mash is made according to a special recipe. The neighbours from Porridgia decided to seize this recipe and to sell it to Pilauland. For this mission they have been preparing special agent Pearlo for many years. When, finally, Pearlo learned all secrets of espionage, he penetrated into the Potatoland territory and reached the secret base.
Now he is standing at the entrance, but to get inside he need to pass combination lock. Minute ago one of the workers entered the password on the terminal and opened the door. The terminal is a square digital keyboard 3<=×<=3 with digits from 1 to 9.
Pearlo knows that the password consists from distinct digits and is probably symmetric with respect to the central button of the terminal. He has heat sensor which allowed him to detect the digits which the worker pressed. Now he wants to check whether the password entered by the worker is symmetric with respect to the central button of the terminal. This fact can Help Pearlo to reduce the number of different possible password combinations.
|
Input contains the matrix of three rows of three symbols each. Symbol «X» means that the corresponding button was pressed, and «.» means that is was not pressed. The matrix may contain no «X», also it may contain no «.».
|
Print YES if the password is symmetric with respect to the central button of the terminal and NO otherwise.
|
[
"XX.\n...\n.XX\n",
"X.X\nX..\n...\n"
] |
[
"YES\n",
"NO\n"
] |
If you are not familiar with the term «central symmetry», you may look into http://en.wikipedia.org/wiki/Central_symmetry
| 0
|
[
{
"input": "XX.\n...\n.XX",
"output": "YES"
},
{
"input": ".X.\n.X.\n.X.",
"output": "YES"
},
{
"input": "XXX\nXXX\nXXX",
"output": "YES"
},
{
"input": "XXX\nX.X\nXXX",
"output": "YES"
},
{
"input": "X..\n.X.\n..X",
"output": "YES"
},
{
"input": "...\nX.X\nX..",
"output": "NO"
},
{
"input": ".X.\nX.X\n.X.",
"output": "YES"
},
{
"input": "X.X\n.X.\nX.X",
"output": "YES"
},
{
"input": "...\n...\n..X",
"output": "NO"
},
{
"input": "XXX\n...\nXXX",
"output": "YES"
},
{
"input": "..X\nX..\n..X",
"output": "NO"
},
{
"input": ".X.\n...\nX.X",
"output": "NO"
},
{
"input": "X.X\nX.X\nX.X",
"output": "YES"
},
{
"input": ".X.\nX.X\nXX.",
"output": "NO"
},
{
"input": "...\nXXX\nXXX",
"output": "NO"
},
{
"input": "XXX\n..X\nXXX",
"output": "NO"
},
{
"input": "X..\nX.X\n.X.",
"output": "NO"
},
{
"input": "...\n..X\nXXX",
"output": "NO"
},
{
"input": "..X\nX.X\nX..",
"output": "YES"
},
{
"input": "..X\n..X\nXXX",
"output": "NO"
},
{
"input": "X..\nX..\nX..",
"output": "NO"
},
{
"input": "XXX\n.X.\nXXX",
"output": "YES"
},
{
"input": "..X\n...\nX..",
"output": "YES"
},
{
"input": "...\n...\nX..",
"output": "NO"
},
{
"input": "...\n...\n.X.",
"output": "NO"
},
{
"input": "...\n...\n..X",
"output": "NO"
},
{
"input": "...\n.X.\nX..",
"output": "NO"
}
] | 1,636,808,817
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 20
| 92
| 4,300,800
|
a=[input() for i in range(3)]
if a[0]==a[2][::-1]:
print('YES')
else:
print('NO')
|
Title: Super Agent
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
There is a very secret base in Potatoland where potato mash is made according to a special recipe. The neighbours from Porridgia decided to seize this recipe and to sell it to Pilauland. For this mission they have been preparing special agent Pearlo for many years. When, finally, Pearlo learned all secrets of espionage, he penetrated into the Potatoland territory and reached the secret base.
Now he is standing at the entrance, but to get inside he need to pass combination lock. Minute ago one of the workers entered the password on the terminal and opened the door. The terminal is a square digital keyboard 3<=×<=3 with digits from 1 to 9.
Pearlo knows that the password consists from distinct digits and is probably symmetric with respect to the central button of the terminal. He has heat sensor which allowed him to detect the digits which the worker pressed. Now he wants to check whether the password entered by the worker is symmetric with respect to the central button of the terminal. This fact can Help Pearlo to reduce the number of different possible password combinations.
Input Specification:
Input contains the matrix of three rows of three symbols each. Symbol «X» means that the corresponding button was pressed, and «.» means that is was not pressed. The matrix may contain no «X», also it may contain no «.».
Output Specification:
Print YES if the password is symmetric with respect to the central button of the terminal and NO otherwise.
Demo Input:
['XX.\n...\n.XX\n', 'X.X\nX..\n...\n']
Demo Output:
['YES\n', 'NO\n']
Note:
If you are not familiar with the term «central symmetry», you may look into http://en.wikipedia.org/wiki/Central_symmetry
|
```python
a=[input() for i in range(3)]
if a[0]==a[2][::-1]:
print('YES')
else:
print('NO')
```
| 0
|
992
|
A
|
Nastya and an Array
|
PROGRAMMING
| 800
|
[
"implementation",
"sortings"
] | null | null |
Nastya owns too many arrays now, so she wants to delete the least important of them. However, she discovered that this array is magic! Nastya now knows that the array has the following properties:
- In one second we can add an arbitrary (possibly negative) integer to all elements of the array that are not equal to zero. - When all elements of the array become equal to zero, the array explodes.
Nastya is always busy, so she wants to explode the array as fast as possible. Compute the minimum time in which the array can be exploded.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105) — the size of the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=105<=≤<=*a**i*<=≤<=105) — the elements of the array.
|
Print a single integer — the minimum number of seconds needed to make all elements of the array equal to zero.
|
[
"5\n1 1 1 1 1\n",
"3\n2 0 -1\n",
"4\n5 -6 -5 1\n"
] |
[
"1\n",
"2\n",
"4\n"
] |
In the first example you can add - 1 to all non-zero elements in one second and make them equal to zero.
In the second example you can add - 2 on the first second, then the array becomes equal to [0, 0, - 3]. On the second second you can add 3 to the third (the only non-zero) element.
| 500
|
[
{
"input": "5\n1 1 1 1 1",
"output": "1"
},
{
"input": "3\n2 0 -1",
"output": "2"
},
{
"input": "4\n5 -6 -5 1",
"output": "4"
},
{
"input": "1\n0",
"output": "0"
},
{
"input": "2\n21794 -79194",
"output": "2"
},
{
"input": "3\n-63526 95085 -5239",
"output": "3"
},
{
"input": "3\n0 53372 -20572",
"output": "2"
},
{
"input": "13\n-2075 -32242 27034 -37618 -96962 82203 64846 48249 -71761 28908 -21222 -61370 46899",
"output": "13"
},
{
"input": "5\n806 0 1308 1954 683",
"output": "4"
},
{
"input": "8\n-26 0 -249 -289 -126 -206 288 -11",
"output": "7"
},
{
"input": "10\n2 2 2 1 2 -1 0 2 -1 1",
"output": "3"
},
{
"input": "1\n8",
"output": "1"
},
{
"input": "3\n0 0 0",
"output": "0"
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10",
"output": "10"
},
{
"input": "5\n2 0 -1 0 0",
"output": "2"
},
{
"input": "2\n0 0",
"output": "0"
},
{
"input": "5\n0 0 0 0 0",
"output": "0"
},
{
"input": "2\n1 0",
"output": "1"
},
{
"input": "2\n-1 0",
"output": "1"
},
{
"input": "4\n0 0 0 0",
"output": "0"
},
{
"input": "8\n10 9 -1 0 0 3 2 3",
"output": "5"
},
{
"input": "5\n5 0 1 2 3",
"output": "4"
},
{
"input": "3\n1 1 0",
"output": "1"
},
{
"input": "1\n-1",
"output": "1"
},
{
"input": "5\n1 2 0 0 0",
"output": "2"
},
{
"input": "5\n1 0 0 0 0",
"output": "1"
},
{
"input": "5\n4 5 6 0 0",
"output": "3"
},
{
"input": "4\n-1 0 0 1",
"output": "2"
},
{
"input": "5\n3 0 0 4 5",
"output": "3"
},
{
"input": "3\n0 0 2",
"output": "1"
},
{
"input": "3\n1 0 0",
"output": "1"
},
{
"input": "4\n0 0 0 4",
"output": "1"
},
{
"input": "5\n-1 0 0 0 0",
"output": "1"
},
{
"input": "2\n0 1",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n5",
"output": "1"
},
{
"input": "10\n0 0 0 0 0 1 2 3 0 0",
"output": "3"
},
{
"input": "4\n0 1 2 3",
"output": "3"
},
{
"input": "3\n0 1 2",
"output": "2"
},
{
"input": "4\n2 0 0 -1",
"output": "2"
}
] | 1,619,516,849
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 77
| 0
|
n = int(input())
a=list(map(int,input().split()))
s=0
se=len(set(a))
#print(se)
if se==1:
print("1")
else:
for i in range(n):
if a[i]==0:
pass
else:
a[i]=0
s+=1
print(s)
|
Title: Nastya and an Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Nastya owns too many arrays now, so she wants to delete the least important of them. However, she discovered that this array is magic! Nastya now knows that the array has the following properties:
- In one second we can add an arbitrary (possibly negative) integer to all elements of the array that are not equal to zero. - When all elements of the array become equal to zero, the array explodes.
Nastya is always busy, so she wants to explode the array as fast as possible. Compute the minimum time in which the array can be exploded.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105) — the size of the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=105<=≤<=*a**i*<=≤<=105) — the elements of the array.
Output Specification:
Print a single integer — the minimum number of seconds needed to make all elements of the array equal to zero.
Demo Input:
['5\n1 1 1 1 1\n', '3\n2 0 -1\n', '4\n5 -6 -5 1\n']
Demo Output:
['1\n', '2\n', '4\n']
Note:
In the first example you can add - 1 to all non-zero elements in one second and make them equal to zero.
In the second example you can add - 2 on the first second, then the array becomes equal to [0, 0, - 3]. On the second second you can add 3 to the third (the only non-zero) element.
|
```python
n = int(input())
a=list(map(int,input().split()))
s=0
se=len(set(a))
#print(se)
if se==1:
print("1")
else:
for i in range(n):
if a[i]==0:
pass
else:
a[i]=0
s+=1
print(s)
```
| 0
|
|
691
|
C
|
Exponential notation
|
PROGRAMMING
| 1,800
|
[
"implementation",
"strings"
] | null | null |
You are given a positive decimal number *x*.
Your task is to convert it to the "simple exponential notation".
Let *x*<==<=*a*·10*b*, where 1<=≤<=*a*<=<<=10, then in general case the "simple exponential notation" looks like "aEb". If *b* equals to zero, the part "Eb" should be skipped. If *a* is an integer, it should be written without decimal point. Also there should not be extra zeroes in *a* and *b*.
|
The only line contains the positive decimal number *x*. The length of the line will not exceed 106. Note that you are given too large number, so you can't use standard built-in data types "float", "double" and other.
|
Print the only line — the "simple exponential notation" of the given number *x*.
|
[
"16\n",
"01.23400\n",
".100\n",
"100.\n"
] |
[
"1.6E1\n",
"1.234\n",
"1E-1\n",
"1E2\n"
] |
none
| 0
|
[
{
"input": "16",
"output": "1.6E1"
},
{
"input": "01.23400",
"output": "1.234"
},
{
"input": ".100",
"output": "1E-1"
},
{
"input": "100.",
"output": "1E2"
},
{
"input": "9000",
"output": "9E3"
},
{
"input": "0.0012",
"output": "1.2E-3"
},
{
"input": "0001100",
"output": "1.1E3"
},
{
"input": "1",
"output": "1"
},
{
"input": "1.0000",
"output": "1"
},
{
"input": "2206815224318443962208128404511577750057653265995300414539703580103256087275661997018352502651118684",
"output": "2.206815224318443962208128404511577750057653265995300414539703580103256087275661997018352502651118684E99"
},
{
"input": ".642190250125247518637240673193254850619739079359757454472743329719747684651927659872735961709249479",
"output": "6.42190250125247518637240673193254850619739079359757454472743329719747684651927659872735961709249479E-1"
},
{
"input": "143529100720960530144687499862369157252883621496987867683546098241081752607457981824764693332677189.",
"output": "1.43529100720960530144687499862369157252883621496987867683546098241081752607457981824764693332677189E98"
},
{
"input": "5649388306043547446322173224045662327678394712363.27277681139968970424738731716530805786323956813790",
"output": "5.6493883060435474463221732240456623276783947123632727768113996897042473873171653080578632395681379E48"
},
{
"input": "0.1",
"output": "1E-1"
},
{
"input": ".1",
"output": "1E-1"
},
{
"input": "1.",
"output": "1"
},
{
"input": "0.111",
"output": "1.11E-1"
},
{
"input": ".111",
"output": "1.11E-1"
},
{
"input": "1.1",
"output": "1.1"
},
{
"input": "01.1",
"output": "1.1"
},
{
"input": "1.10",
"output": "1.1"
},
{
"input": "01.10",
"output": "1.1"
},
{
"input": "10.0",
"output": "1E1"
},
{
"input": "16.00",
"output": "1.6E1"
},
{
"input": "0016.",
"output": "1.6E1"
},
{
"input": ".000016",
"output": "1.6E-5"
},
{
"input": "16000.000",
"output": "1.6E4"
},
{
"input": "016.00",
"output": "1.6E1"
},
{
"input": "0016.00",
"output": "1.6E1"
},
{
"input": "0.16",
"output": "1.6E-1"
},
{
"input": "00.16",
"output": "1.6E-1"
},
{
"input": "00.160",
"output": "1.6E-1"
}
] | 1,661,418,601
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 4
| 46
| 0
|
def solve(s):
s=s.strip('0')
pospot=s.find('.')
n=len(s)
if pospot==-1:
s+='.'
pospot=n
n+=1
b=pospot-1
if s[:pospot]=='':
t=s[pospot+1:].strip("0")
b-=len(s[pospot+1:])-len(t)
if int(t)>10:
a=t[0]+"."+t[1:]
else:
a=t
else:
if int(s[:pospot])>10:
a=s[0]+'.'+s[1:pospot]+s[pospot+1:]
else:
a=s
a=a.strip('0')
if a[-1]=='.':
a=a[:-1]
if b==0:
print(a)
else:
print(a+"E"+str(b))
s=input()
solve(s)
|
Title: Exponential notation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given a positive decimal number *x*.
Your task is to convert it to the "simple exponential notation".
Let *x*<==<=*a*·10*b*, where 1<=≤<=*a*<=<<=10, then in general case the "simple exponential notation" looks like "aEb". If *b* equals to zero, the part "Eb" should be skipped. If *a* is an integer, it should be written without decimal point. Also there should not be extra zeroes in *a* and *b*.
Input Specification:
The only line contains the positive decimal number *x*. The length of the line will not exceed 106. Note that you are given too large number, so you can't use standard built-in data types "float", "double" and other.
Output Specification:
Print the only line — the "simple exponential notation" of the given number *x*.
Demo Input:
['16\n', '01.23400\n', '.100\n', '100.\n']
Demo Output:
['1.6E1\n', '1.234\n', '1E-1\n', '1E2\n']
Note:
none
|
```python
def solve(s):
s=s.strip('0')
pospot=s.find('.')
n=len(s)
if pospot==-1:
s+='.'
pospot=n
n+=1
b=pospot-1
if s[:pospot]=='':
t=s[pospot+1:].strip("0")
b-=len(s[pospot+1:])-len(t)
if int(t)>10:
a=t[0]+"."+t[1:]
else:
a=t
else:
if int(s[:pospot])>10:
a=s[0]+'.'+s[1:pospot]+s[pospot+1:]
else:
a=s
a=a.strip('0')
if a[-1]=='.':
a=a[:-1]
if b==0:
print(a)
else:
print(a+"E"+str(b))
s=input()
solve(s)
```
| 0
|
|
11
|
A
|
Increasing Sequence
|
PROGRAMMING
| 900
|
[
"constructive algorithms",
"implementation",
"math"
] |
A. Increasing Sequence
|
1
|
64
|
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
|
The first line of the input contains two integer numbers *n* and *d* (2<=≤<=*n*<=≤<=2000,<=1<=≤<=*d*<=≤<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=≤<=*b**i*<=≤<=106).
|
Output the minimal number of moves needed to make the sequence increasing.
|
[
"4 2\n1 3 3 2\n"
] |
[
"3\n"
] |
none
| 0
|
[
{
"input": "4 2\n1 3 3 2",
"output": "3"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 1\n2 5",
"output": "0"
},
{
"input": "2 1\n1 2",
"output": "0"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 7\n10 20",
"output": "0"
},
{
"input": "2 7\n1 1",
"output": "1"
},
{
"input": "3 3\n18 1 9",
"output": "10"
},
{
"input": "3 3\n15 17 9",
"output": "3"
},
{
"input": "3 3\n10 9 12",
"output": "2"
},
{
"input": "10 3\n2 1 17 10 5 16 8 4 15 17",
"output": "31"
},
{
"input": "10 3\n6 11 4 12 22 15 23 26 24 26",
"output": "13"
},
{
"input": "10 3\n10 24 13 15 18 14 15 26 33 35",
"output": "29"
},
{
"input": "100 3\n529 178 280 403 326 531 671 427 188 866 669 646 421 804 494 609 53 1012 211 243 887 833 900 543 226 42 859 718 454 372 971 692 846 770 511 395 499 479 641 756 115 269 206 45 1039 727 400 779 859 614 146 214 196 919 702 959 380 830 535 878 859 784 316 305 782 924 536 243 236 978 564 150 291 877 808 983 537 839 490 120 168 838 267 650 900 170 211 504 326 771 895 984 994 483 776 100 471 1078 317 580",
"output": "15717"
},
{
"input": "100 3\n329 226 331 909 962 112 837 1005 194 818 506 416 125 648 367 459 400 582 989 547 329 438 234 121 272 226 821 376 834 427 718 164 834 113 654 177 737 212 169 696 744 180 89 944 233 147 667 990 809 1072 1085 1093 814 265 1067 312 833 572 303 901 1032 504 185 817 389 158 613 723 239 269 911 352 769 404 225 822 897 606 947 323 913 804 923 1084 552 901 486 249 209 898 847 610 728 1122 986 669 1116 1076 367 327",
"output": "16133"
}
] | 1,676,729,932
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 25
| 92
| 0
|
n,d=map(int,input().split())
L=[int(x) for x in input().split()]
ans=0
for i in range(n-1):
if L[i+1]<=L[i]:
x=L[i]-L[i+1]
ans+=x//d +1
L[i+1]+=d*(x//d +1)
print(ans)
|
Title: Increasing Sequence
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
Input Specification:
The first line of the input contains two integer numbers *n* and *d* (2<=≤<=*n*<=≤<=2000,<=1<=≤<=*d*<=≤<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=≤<=*b**i*<=≤<=106).
Output Specification:
Output the minimal number of moves needed to make the sequence increasing.
Demo Input:
['4 2\n1 3 3 2\n']
Demo Output:
['3\n']
Note:
none
|
```python
n,d=map(int,input().split())
L=[int(x) for x in input().split()]
ans=0
for i in range(n-1):
if L[i+1]<=L[i]:
x=L[i]-L[i+1]
ans+=x//d +1
L[i+1]+=d*(x//d +1)
print(ans)
```
| 3.954
|
520
|
A
|
Pangram
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] | null | null |
A word or a sentence in some language is called a pangram if all the characters of the alphabet of this language appear in it at least once. Pangrams are often used to demonstrate fonts in printing or test the output devices.
You are given a string consisting of lowercase and uppercase Latin letters. Check whether this string is a pangram. We say that the string contains a letter of the Latin alphabet if this letter occurs in the string in uppercase or lowercase.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of characters in the string.
The second line contains the string. The string consists only of uppercase and lowercase Latin letters.
|
Output "YES", if the string is a pangram and "NO" otherwise.
|
[
"12\ntoosmallword\n",
"35\nTheQuickBrownFoxJumpsOverTheLazyDog\n"
] |
[
"NO\n",
"YES\n"
] |
none
| 500
|
[
{
"input": "12\ntoosmallword",
"output": "NO"
},
{
"input": "35\nTheQuickBrownFoxJumpsOverTheLazyDog",
"output": "YES"
},
{
"input": "1\na",
"output": "NO"
},
{
"input": "26\nqwertyuiopasdfghjklzxcvbnm",
"output": "YES"
},
{
"input": "26\nABCDEFGHIJKLMNOPQRSTUVWXYZ",
"output": "YES"
},
{
"input": "48\nthereisasyetinsufficientdataforameaningfulanswer",
"output": "NO"
},
{
"input": "30\nToBeOrNotToBeThatIsTheQuestion",
"output": "NO"
},
{
"input": "30\njackdawslovemybigsphinxofquarz",
"output": "NO"
},
{
"input": "31\nTHEFIVEBOXINGWIZARDSJUMPQUICKLY",
"output": "YES"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "NO"
},
{
"input": "26\nMGJYIZDKsbhpVeNFlquRTcWoAx",
"output": "YES"
},
{
"input": "26\nfWMOhAPsbIVtyUEZrGNQXDklCJ",
"output": "YES"
},
{
"input": "26\nngPMVFSThiRCwLEuyOAbKxQzDJ",
"output": "YES"
},
{
"input": "25\nnxYTzLFwzNolAumjgcAboyxAj",
"output": "NO"
},
{
"input": "26\npRWdodGdxUESvcScPGbUoooZsC",
"output": "NO"
},
{
"input": "66\nBovdMlDzTaqKllZILFVfxbLGsRnzmtVVTmqiIDTYrossLEPlmsPrkUYtWEsGHVOnFj",
"output": "NO"
},
{
"input": "100\nmKtsiDRJypUieHIkvJaMFkwaKxcCIbBszZQLIyPpCDCjhNpAnYFngLjRpnKWpKWtGnwoSteeZXuFHWQxxxOpFlNeYTwKocsXuCoa",
"output": "YES"
},
{
"input": "26\nEoqxUbsLjPytUHMiFnvcGWZdRK",
"output": "NO"
},
{
"input": "26\nvCUFRKElZOnjmXGylWQaHDiPst",
"output": "NO"
},
{
"input": "26\nWtrPuaHdXLKJMsnvQfgOiJZBEY",
"output": "NO"
},
{
"input": "26\npGiFluRteQwkaVoPszJyNBChxM",
"output": "NO"
},
{
"input": "26\ncTUpqjPmANrdbzSFhlWIoKxgVY",
"output": "NO"
},
{
"input": "26\nLndjgvAEuICHKxPwqYztosrmBN",
"output": "NO"
},
{
"input": "26\nMdaXJrCipnOZLykfqHWEStevbU",
"output": "NO"
},
{
"input": "26\nEjDWsVxfKTqGXRnUMOLYcIzPba",
"output": "NO"
},
{
"input": "26\nxKwzRMpunYaqsdfaBgJcVElTHo",
"output": "NO"
},
{
"input": "26\nnRYUQsTwCPLZkgshfEXvBdoiMa",
"output": "NO"
},
{
"input": "26\nHNCQPfJutyAlDGsvRxZWMEbIdO",
"output": "NO"
},
{
"input": "26\nDaHJIpvKznQcmUyWsTGObXRFDe",
"output": "NO"
},
{
"input": "26\nkqvAnFAiRhzlJbtyuWedXSPcOG",
"output": "NO"
},
{
"input": "26\nhlrvgdwsIOyjcmUZXtAKEqoBpF",
"output": "NO"
},
{
"input": "26\njLfXXiMhBTcAwQVReGnpKzdsYu",
"output": "NO"
},
{
"input": "26\nlNMcVuwItjxRBGAekjhyDsQOzf",
"output": "NO"
},
{
"input": "26\nRkSwbNoYldUGtAZvpFMcxhIJFE",
"output": "NO"
},
{
"input": "26\nDqspXZJTuONYieKgaHLMBwfVSC",
"output": "NO"
},
{
"input": "26\necOyUkqNljFHRVXtIpWabGMLDz",
"output": "NO"
},
{
"input": "26\nEKAvqZhBnPmVCDRlgWJfOusxYI",
"output": "NO"
},
{
"input": "26\naLbgqeYchKdMrsZxIPFvTOWNjA",
"output": "NO"
},
{
"input": "26\nxfpBLsndiqtacOCHGmeWUjRkYz",
"output": "NO"
},
{
"input": "26\nXsbRKtqleZPNIVCdfUhyagAomJ",
"output": "NO"
},
{
"input": "26\nAmVtbrwquEthZcjKPLiyDgSoNF",
"output": "NO"
},
{
"input": "26\nOhvXDcwqAUmSEPRZGnjFLiKtNB",
"output": "NO"
},
{
"input": "26\nEKWJqCFLRmstxVBdYuinpbhaOg",
"output": "NO"
},
{
"input": "26\nmnbvcxxlkjhgfdsapoiuytrewq",
"output": "NO"
},
{
"input": "26\naAbcdefghijklmnopqrstuvwxy",
"output": "NO"
},
{
"input": "30\nABCDEFGHTYRIOPLabcdefghtyriopl",
"output": "NO"
},
{
"input": "25\nabcdefghijklmnopqrstuvwxy",
"output": "NO"
},
{
"input": "26\nabcdefhijklmnopqrstVxyzABC",
"output": "NO"
},
{
"input": "25\nqwertyuiopasdfghjklxcvbnm",
"output": "NO"
},
{
"input": "34\nTheQuickBrownFoxJumpsOverTheLayDog",
"output": "NO"
},
{
"input": "26\nabcdefghigklmnopqrstuvwxyz",
"output": "NO"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxyA",
"output": "NO"
},
{
"input": "50\nqazwsxedcrfvtgbyhnujmikolQWERTYUIOASDFGHJKLZXCVBNM",
"output": "NO"
},
{
"input": "35\nTheQuickBrownFoxJumpsOverTheLasyDog",
"output": "NO"
},
{
"input": "25\nbcdefghijklmnopqrstuvwxyz",
"output": "NO"
},
{
"input": "38\nAbCdEfGhIjKlMnOpQrStVwXyZzzzzzzaaaaaaa",
"output": "NO"
},
{
"input": "26\nabcdefghiklmnopqrstvxyzABC",
"output": "NO"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxzZ",
"output": "NO"
},
{
"input": "50\nabcdefghijklmnopqrstuvwxyABCDEFGHIJKLMNOPQRSTUVWXY",
"output": "NO"
}
] | 1,694,206,088
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 15
| 46
| 0
|
number_of_letters = int(input())
word = str(input())
set_word = set(word)
if number_of_letters < 26 :
print("NO")
elif len(set_word) < 26 :
print("NO")
else :
print("YES")
|
Title: Pangram
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A word or a sentence in some language is called a pangram if all the characters of the alphabet of this language appear in it at least once. Pangrams are often used to demonstrate fonts in printing or test the output devices.
You are given a string consisting of lowercase and uppercase Latin letters. Check whether this string is a pangram. We say that the string contains a letter of the Latin alphabet if this letter occurs in the string in uppercase or lowercase.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of characters in the string.
The second line contains the string. The string consists only of uppercase and lowercase Latin letters.
Output Specification:
Output "YES", if the string is a pangram and "NO" otherwise.
Demo Input:
['12\ntoosmallword\n', '35\nTheQuickBrownFoxJumpsOverTheLazyDog\n']
Demo Output:
['NO\n', 'YES\n']
Note:
none
|
```python
number_of_letters = int(input())
word = str(input())
set_word = set(word)
if number_of_letters < 26 :
print("NO")
elif len(set_word) < 26 :
print("NO")
else :
print("YES")
```
| 0
|
|
217
|
B
|
Blackboard Fibonacci
|
PROGRAMMING
| 2,100
|
[
"brute force",
"math"
] | null | null |
Fibonacci numbers are the sequence of integers: *f*0<==<=0, *f*1<==<=1, *f*2<==<=1, *f*3<==<=2, *f*4<==<=3, *f*5<==<=5, ..., *f**n*<==<=*f**n*<=-<=2<=+<=*f**n*<=-<=1. So every next number is the sum of the previous two.
Bajtek has developed a nice way to compute Fibonacci numbers on a blackboard. First, he writes a 0. Then, below it, he writes a 1. Then he performs the following two operations:
- operation "T": replace the top number with the sum of both numbers; - operation "B": replace the bottom number with the sum of both numbers.
If he performs *n* operations, starting with "T" and then choosing operations alternately (so that the sequence of operations looks like "TBTBTBTB..."), the last number written will be equal to *f**n*<=+<=1.
Unfortunately, Bajtek sometimes makes mistakes and repeats an operation two or more times in a row. For example, if Bajtek wanted to compute *f*7, then he would want to do *n*<==<=6 operations: "TBTBTB". If he instead performs the sequence of operations "TTTBBT", then he will have made 3 mistakes, and he will incorrectly compute that the seventh Fibonacci number is 10. The number of mistakes in the sequence of operations is the number of neighbouring equal operations («TT» or «BB»).
You are given the number *n* of operations that Bajtek has made in an attempt to compute *f**n*<=+<=1 and the number *r* that is the result of his computations (that is last written number). Find the minimum possible number of mistakes that Bajtek must have made and any possible sequence of *n* operations resulting in *r* with that number of mistakes.
Assume that Bajtek always correctly starts with operation "T".
|
The first line contains the integers *n* and *r* (1<=≤<=*n*,<=*r*<=≤<=106).
|
The first line of the output should contain one number — the minimum possible number of mistakes made by Bajtek. The second line should contain *n* characters, starting with "T", describing one possible sequence of operations with that number of mistakes. Each character must be either "T" or "B".
If the required sequence doesn't exist, output "IMPOSSIBLE" (without quotes).
|
[
"6 10\n",
"4 5\n",
"2 1\n"
] |
[
"2\nTBBTTB\n",
"0\nTBTB\n",
"IMPOSSIBLE\n"
] |
none
| 1,000
|
[
{
"input": "6 10",
"output": "2\nTBBTTB"
},
{
"input": "4 5",
"output": "0\nTBTB"
},
{
"input": "2 1",
"output": "IMPOSSIBLE"
},
{
"input": "15 682",
"output": "IMPOSSIBLE"
},
{
"input": "1145 997855",
"output": "IMPOSSIBLE"
},
{
"input": "16 458",
"output": "6\nTBBTBBBBBTBTBTTB"
},
{
"input": "55 997859",
"output": "35\nTBBTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTBTBTBTTBBTBBBBTBTBTB"
},
{
"input": "31 586",
"output": "24\nTBBBBBBBBBBBBBBBBBBBBBBTTBBBTBT"
},
{
"input": "21703 997863",
"output": "21696\nTBBTBBBBBTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT..."
},
{
"input": "38 362",
"output": "34\nTBBBBBBBBBBBBBBBBBBTTTTTTTTTTTTTTTTTTB"
},
{
"input": "997867 997867",
"output": "997864\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "12 194",
"output": "2\nTBTBTTBBTBTB"
},
{
"input": "50 997871",
"output": "28\nTBTBBTBTBTBTBTBBTBBTBBBBBBBBBBBBBBBBBBBBBBBBBBTBTB"
},
{
"input": "101 659",
"output": "97\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTTTTTTB"
},
{
"input": "46 970448",
"output": "25\nTBBTBBTBTBTBBBBBBBBBBBBBBBBBBBBBTBTBTBBBTBTTBT"
},
{
"input": "19 787",
"output": "8\nTBBTBBBBBBBBTBTBTBT"
},
{
"input": "29416 970463",
"output": "29408\nTBBTBTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "21 563",
"output": "12\nTBBBBBBBBBTBTBTBBBBBT"
},
{
"input": "970479 970479",
"output": "970476\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "15 395",
"output": "5\nTBBBBTBBTBTBBTB"
},
{
"input": "278 970495",
"output": "262\nTBTBTBTTBBTBTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTTBBTB"
},
{
"input": "26 171",
"output": "20\nTBBBBBBBBBBBBBBBBBBBBTTBTB"
},
{
"input": "40 970510",
"output": "18\nTBTBTBTBBBBBBBBBBBBBBTBBBTBTTTBTBTBBTBTB"
},
{
"input": "18 400",
"output": "10\nTBBBTTBTBBBBBBBBTB"
},
{
"input": "43442 998944",
"output": "43436\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "13 177",
"output": "4\nTBBBTBBBTBTBT"
},
{
"input": "332985 998948",
"output": "332980\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "14 305",
"output": "4\nTBBBTBTBTBBBTB"
},
{
"input": "52 998951",
"output": "31\nTBTTBTBTBTTBTTTTTTTTTTTTTTTTTTTTTTTTTTTTBTBTTBTBTTBT"
},
{
"input": "25 785",
"output": "17\nTBBBBBBBBBBBBBBTTBTBBBBTB"
},
{
"input": "42 998955",
"output": "21\nTBBBBTBBBTBBBBBBBBBBBBBBBTBTBTBTBTTBTBTTBT"
},
{
"input": "16 913",
"output": "4\nTBBTBTTBTBTBBBTB"
},
{
"input": "5959 998959",
"output": "5950\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "17 334",
"output": "9\nTBBBBBBBTBTTTBBTB"
},
{
"input": "992424 992424",
"output": "992421\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "40 110",
"output": "IMPOSSIBLE"
},
{
"input": "2579 992429",
"output": "IMPOSSIBLE"
},
{
"input": "19 238",
"output": "13\nTBBBBBTTTTTTTTTBTTB"
},
{
"input": "43 992434",
"output": "21\nTBBTBBTBBBBBBBBBBBBBBBBBBTBTBTBTBTBTTBTBBTB"
},
{
"input": "7 14",
"output": "2\nTBBBTBT"
},
{
"input": "6504 992439",
"output": "6498\nTBBBBBBBBBTTTTTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "24 846",
"output": "14\nTBBBBBBBBBBBBBBTTBTBTBTB"
},
{
"input": "992444 992444",
"output": "992441\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "18 267",
"output": "11\nTBBTTTBTTTTTTTTTBT"
},
{
"input": "49 982645",
"output": "27\nTBTBTBBTBBTBTBTBTBTBBBBBBBBBBBBBBBBBBBBBBBBBTBBTB"
},
{
"input": "10 43",
"output": "4\nTBBBTBBBTB"
},
{
"input": "37 982653",
"output": "14\nTBBBBBBBBBBBTBBTTBTBBTBTBTBTBTBTBBTBT"
},
{
"input": "22 171",
"output": "15\nTBTBTTTTTTTTTTTTTTTTBT"
},
{
"input": "7134 982661",
"output": "7126\nTBBBBBTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT..."
},
{
"input": "62 947",
"output": "55\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTBBTTBT"
},
{
"input": "327559 982670",
"output": "327554\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "92 779",
"output": "86\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTBTTTB"
},
{
"input": "52 982678",
"output": "32\nTBBBBBTBTBTBTBTBTBTTTTTBTBBBBBBBBBBBBBBBBBBBBBBBBBTB"
},
{
"input": "17 849",
"output": "5\nTBBBBBTBTBBTBTBTB"
},
{
"input": "248 962240",
"output": "233\nTBTTBBBTBTBBTBTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTBTTTTBT"
},
{
"input": "18 977",
"output": "6\nTBBBBBBTBTBBTBTBTB"
},
{
"input": "7720 962264",
"output": "7714\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "30 753",
"output": "22\nTBBBTBBBBBBBBBBBBBBBBBBBBTBBTB"
},
{
"input": "962288 962288",
"output": "962285\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "56 881",
"output": "50\nTBBBTTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTB"
},
{
"input": "36 962312",
"output": "14\nTBTBTTTTBBBBBBTBTBTBTBTBTBTBBBBBBBTB"
},
{
"input": "17 361",
"output": "8\nTBTBTBBBBBBBBTTBT"
},
{
"input": "141 962336",
"output": "126\nTBTBTBTTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTBTTTTTBBTTTTBT"
},
{
"input": "18 590",
"output": "9\nTBTBBBTTBTTTTTTTBT"
},
{
"input": "8611 997305",
"output": "8604\nTBBBBTBBBBTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT..."
},
{
"input": "18 718",
"output": "8\nTBTBBBBBBBTBTTBBTB"
},
{
"input": "997309 997309",
"output": "997306\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "25 494",
"output": "IMPOSSIBLE"
},
{
"input": "2606 997313",
"output": "IMPOSSIBLE"
},
{
"input": "19 622",
"output": "11\nTBBBBBTTTBTBBBBBBTB"
},
{
"input": "138 997317",
"output": "121\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBTBTTBTBTBBBTBBTBBTTBT"
},
{
"input": "19 102",
"output": "13\nTBBBBBBBBBBBBBTBTTB"
},
{
"input": "3045 997321",
"output": "3035\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "1000000 1000000",
"output": "999997\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
},
{
"input": "1 1",
"output": "0\nT"
},
{
"input": "1 2",
"output": "IMPOSSIBLE"
},
{
"input": "999997 999997",
"output": "999994\nTBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB..."
}
] | 1,691,470,101
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 0
|
print("_RANDOM_GUESS_1691470101.0400622")# 1691470101.0400784
|
Title: Blackboard Fibonacci
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fibonacci numbers are the sequence of integers: *f*0<==<=0, *f*1<==<=1, *f*2<==<=1, *f*3<==<=2, *f*4<==<=3, *f*5<==<=5, ..., *f**n*<==<=*f**n*<=-<=2<=+<=*f**n*<=-<=1. So every next number is the sum of the previous two.
Bajtek has developed a nice way to compute Fibonacci numbers on a blackboard. First, he writes a 0. Then, below it, he writes a 1. Then he performs the following two operations:
- operation "T": replace the top number with the sum of both numbers; - operation "B": replace the bottom number with the sum of both numbers.
If he performs *n* operations, starting with "T" and then choosing operations alternately (so that the sequence of operations looks like "TBTBTBTB..."), the last number written will be equal to *f**n*<=+<=1.
Unfortunately, Bajtek sometimes makes mistakes and repeats an operation two or more times in a row. For example, if Bajtek wanted to compute *f*7, then he would want to do *n*<==<=6 operations: "TBTBTB". If he instead performs the sequence of operations "TTTBBT", then he will have made 3 mistakes, and he will incorrectly compute that the seventh Fibonacci number is 10. The number of mistakes in the sequence of operations is the number of neighbouring equal operations («TT» or «BB»).
You are given the number *n* of operations that Bajtek has made in an attempt to compute *f**n*<=+<=1 and the number *r* that is the result of his computations (that is last written number). Find the minimum possible number of mistakes that Bajtek must have made and any possible sequence of *n* operations resulting in *r* with that number of mistakes.
Assume that Bajtek always correctly starts with operation "T".
Input Specification:
The first line contains the integers *n* and *r* (1<=≤<=*n*,<=*r*<=≤<=106).
Output Specification:
The first line of the output should contain one number — the minimum possible number of mistakes made by Bajtek. The second line should contain *n* characters, starting with "T", describing one possible sequence of operations with that number of mistakes. Each character must be either "T" or "B".
If the required sequence doesn't exist, output "IMPOSSIBLE" (without quotes).
Demo Input:
['6 10\n', '4 5\n', '2 1\n']
Demo Output:
['2\nTBBTTB\n', '0\nTBTB\n', 'IMPOSSIBLE\n']
Note:
none
|
```python
print("_RANDOM_GUESS_1691470101.0400622")# 1691470101.0400784
```
| 0
|
|
312
|
B
|
Archer
|
PROGRAMMING
| 1,300
|
[
"math",
"probabilities"
] | null | null |
SmallR is an archer. SmallR is taking a match of archer with Zanoes. They try to shoot in the target in turns, and SmallR shoots first. The probability of shooting the target each time is for SmallR while for Zanoes. The one who shoots in the target first should be the winner.
Output the probability that SmallR will win the match.
|
A single line contains four integers .
|
Print a single real number, the probability that SmallR will win the match.
The answer will be considered correct if the absolute or relative error doesn't exceed 10<=-<=6.
|
[
"1 2 1 2\n"
] |
[
"0.666666666667"
] |
none
| 1,000
|
[
{
"input": "1 2 1 2",
"output": "0.666666666667"
},
{
"input": "1 3 1 3",
"output": "0.600000000000"
},
{
"input": "1 3 2 3",
"output": "0.428571428571"
},
{
"input": "3 4 3 4",
"output": "0.800000000000"
},
{
"input": "1 2 10 11",
"output": "0.523809523810"
},
{
"input": "4 5 4 5",
"output": "0.833333333333"
},
{
"input": "466 701 95 721",
"output": "0.937693791148"
},
{
"input": "268 470 444 885",
"output": "0.725614009325"
},
{
"input": "632 916 713 821",
"output": "0.719292895126"
},
{
"input": "269 656 918 992",
"output": "0.428937461623"
},
{
"input": "71 657 187 695",
"output": "0.310488463257"
},
{
"input": "435 852 973 978",
"output": "0.511844133157"
},
{
"input": "518 816 243 359",
"output": "0.719734031025"
},
{
"input": "882 962 311 811",
"output": "0.966386645447"
},
{
"input": "684 774 580 736",
"output": "0.906051574446"
},
{
"input": "486 868 929 999",
"output": "0.577723252958"
},
{
"input": "132 359 996 998",
"output": "0.368154532345"
},
{
"input": "933 977 266 450",
"output": "0.972879407907"
},
{
"input": "298 833 615 872",
"output": "0.441270817024"
},
{
"input": "34 554 14 958",
"output": "0.817324099167"
},
{
"input": "836 934 800 905",
"output": "0.906105535462"
},
{
"input": "482 815 69 509",
"output": "0.914365577772"
},
{
"input": "284 423 137 521",
"output": "0.885974839378"
},
{
"input": "648 881 486 703",
"output": "0.800911421248"
},
{
"input": "450 885 755 836",
"output": "0.533901011176"
},
{
"input": "533 773 823 998",
"output": "0.729222130525"
},
{
"input": "897 957 92 898",
"output": "0.993193806364"
},
{
"input": "699 925 441 928",
"output": "0.866816866175"
},
{
"input": "64 704 148 603",
"output": "0.289486317811"
},
{
"input": "719 735 626 990",
"output": "0.986124079764"
},
{
"input": "1 1000 1 1000",
"output": "0.500250125063"
}
] | 1,623,760,738
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 2
| 77
| 0
|
a, b, c, d = list(map(int, input().split()))
a_win = a / b
b_loose = 1 - a / b
a_loose = 1 - a_win
result = a_win / (1 - a_loose*b_loose)
print(result)
|
Title: Archer
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
SmallR is an archer. SmallR is taking a match of archer with Zanoes. They try to shoot in the target in turns, and SmallR shoots first. The probability of shooting the target each time is for SmallR while for Zanoes. The one who shoots in the target first should be the winner.
Output the probability that SmallR will win the match.
Input Specification:
A single line contains four integers .
Output Specification:
Print a single real number, the probability that SmallR will win the match.
The answer will be considered correct if the absolute or relative error doesn't exceed 10<=-<=6.
Demo Input:
['1 2 1 2\n']
Demo Output:
['0.666666666667']
Note:
none
|
```python
a, b, c, d = list(map(int, input().split()))
a_win = a / b
b_loose = 1 - a / b
a_loose = 1 - a_win
result = a_win / (1 - a_loose*b_loose)
print(result)
```
| 0
|
|
27
|
A
|
Next Test
|
PROGRAMMING
| 1,200
|
[
"implementation",
"sortings"
] |
A. Next Test
|
2
|
256
|
«Polygon» is a system which allows to create programming tasks in a simple and professional way. When you add a test to the problem, the corresponding form asks you for the test index. As in most cases it is clear which index the next test will have, the system suggests the default value of the index. It is calculated as the smallest positive integer which is not used as an index for some previously added test.
You are to implement this feature. Create a program which determines the default index of the next test, given the indexes of the previously added tests.
|
The first line contains one integer *n* (1<=≤<=*n*<=≤<=3000) — the amount of previously added tests. The second line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=3000) — indexes of these tests.
|
Output the required default value for the next test index.
|
[
"3\n1 7 2\n"
] |
[
"3\n"
] |
none
| 500
|
[
{
"input": "1\n1",
"output": "2"
},
{
"input": "2\n2 1",
"output": "3"
},
{
"input": "3\n3 4 1",
"output": "2"
},
{
"input": "4\n6 4 3 5",
"output": "1"
},
{
"input": "5\n3 2 1 7 4",
"output": "5"
},
{
"input": "6\n4 1 2 5 3 7",
"output": "6"
},
{
"input": "7\n3 2 1 6 5 7 4",
"output": "8"
},
{
"input": "8\n2 8 3 7 6 9 1 5",
"output": "4"
},
{
"input": "9\n10 5 9 3 8 7 1 2 4",
"output": "6"
},
{
"input": "10\n7 2 3 8 9 6 5 4 1 10",
"output": "11"
},
{
"input": "1\n1",
"output": "2"
},
{
"input": "2\n1 2",
"output": "3"
},
{
"input": "3\n2 4 1",
"output": "3"
},
{
"input": "4\n4 2 3 1",
"output": "5"
},
{
"input": "5\n3 1 4 2 5",
"output": "6"
},
{
"input": "6\n1 3 6 7 2 4",
"output": "5"
},
{
"input": "7\n1 5 4 7 2 3 6",
"output": "8"
},
{
"input": "8\n12 1 6 5 2 8 3 4",
"output": "7"
},
{
"input": "9\n3 2 7 5 6 4 1 9 10",
"output": "8"
},
{
"input": "10\n1 7 13 6 5 10 3 8 2 4",
"output": "9"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "1\n3",
"output": "1"
},
{
"input": "1\n3000",
"output": "1"
},
{
"input": "2\n2 3",
"output": "1"
},
{
"input": "2\n3000 1",
"output": "2"
}
] | 1,531,851,507
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 248
| 0
|
import sys
n = input()
arr = [int(i) for i in input().split()]
arr.sort()
count =arr[0]
if count > 1:
print (1)
else:
for i in range(arr.__len__()):
if count<arr[i]and count>arr[i-1]:
break
count+=1
print (count)
|
Title: Next Test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
«Polygon» is a system which allows to create programming tasks in a simple and professional way. When you add a test to the problem, the corresponding form asks you for the test index. As in most cases it is clear which index the next test will have, the system suggests the default value of the index. It is calculated as the smallest positive integer which is not used as an index for some previously added test.
You are to implement this feature. Create a program which determines the default index of the next test, given the indexes of the previously added tests.
Input Specification:
The first line contains one integer *n* (1<=≤<=*n*<=≤<=3000) — the amount of previously added tests. The second line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=3000) — indexes of these tests.
Output Specification:
Output the required default value for the next test index.
Demo Input:
['3\n1 7 2\n']
Demo Output:
['3\n']
Note:
none
|
```python
import sys
n = input()
arr = [int(i) for i in input().split()]
arr.sort()
count =arr[0]
if count > 1:
print (1)
else:
for i in range(arr.__len__()):
if count<arr[i]and count>arr[i-1]:
break
count+=1
print (count)
```
| 3.938
|
735
|
A
|
Ostap and Grasshopper
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] | null | null |
On the way to Rio de Janeiro Ostap kills time playing with a grasshopper he took with him in a special box. Ostap builds a line of length *n* such that some cells of this line are empty and some contain obstacles. Then, he places his grasshopper to one of the empty cells and a small insect in another empty cell. The grasshopper wants to eat the insect.
Ostap knows that grasshopper is able to jump to any empty cell that is exactly *k* cells away from the current (to the left or to the right). Note that it doesn't matter whether intermediate cells are empty or not as the grasshopper makes a jump over them. For example, if *k*<==<=1 the grasshopper can jump to a neighboring cell only, and if *k*<==<=2 the grasshopper can jump over a single cell.
Your goal is to determine whether there is a sequence of jumps such that grasshopper will get from his initial position to the cell with an insect.
|
The first line of the input contains two integers *n* and *k* (2<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=*n*<=-<=1) — the number of cells in the line and the length of one grasshopper's jump.
The second line contains a string of length *n* consisting of characters '.', '#', 'G' and 'T'. Character '.' means that the corresponding cell is empty, character '#' means that the corresponding cell contains an obstacle and grasshopper can't jump there. Character 'G' means that the grasshopper starts at this position and, finally, 'T' means that the target insect is located at this cell. It's guaranteed that characters 'G' and 'T' appear in this line exactly once.
|
If there exists a sequence of jumps (each jump of length *k*), such that the grasshopper can get from his initial position to the cell with the insect, print "YES" (without quotes) in the only line of the input. Otherwise, print "NO" (without quotes).
|
[
"5 2\n#G#T#\n",
"6 1\nT....G\n",
"7 3\nT..#..G\n",
"6 2\n..GT..\n"
] |
[
"YES\n",
"YES\n",
"NO\n",
"NO\n"
] |
In the first sample, the grasshopper can make one jump to the right in order to get from cell 2 to cell 4.
In the second sample, the grasshopper is only able to jump to neighboring cells but the way to the insect is free — he can get there by jumping left 5 times.
In the third sample, the grasshopper can't make a single jump.
In the fourth sample, the grasshopper can only jump to the cells with odd indices, thus he won't be able to reach the insect.
| 500
|
[
{
"input": "5 2\n#G#T#",
"output": "YES"
},
{
"input": "6 1\nT....G",
"output": "YES"
},
{
"input": "7 3\nT..#..G",
"output": "NO"
},
{
"input": "6 2\n..GT..",
"output": "NO"
},
{
"input": "2 1\nGT",
"output": "YES"
},
{
"input": "100 5\nG####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####T####",
"output": "YES"
},
{
"input": "100 5\nG####.####.####.####.####.####.####.####.####.####.####.####.####.#########.####.####.####.####T####",
"output": "NO"
},
{
"input": "2 1\nTG",
"output": "YES"
},
{
"input": "99 1\n...T.............................................................................................G.",
"output": "YES"
},
{
"input": "100 2\nG............#.....#...........#....#...........##............#............#......................T.",
"output": "NO"
},
{
"input": "100 1\n#.#.#.##..#..##.#....##.##.##.#....####..##.#.##..GT..##...###.#.##.#..#..##.###..#.####..#.#.##..##",
"output": "YES"
},
{
"input": "100 2\n..#####.#.#.......#.#.#...##..####..###..#.#######GT####.#.#...##...##.#..###....##.#.#..#.###....#.",
"output": "NO"
},
{
"input": "100 3\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 3\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 3\nG..................................#......#......#.......#.#..........#........#......#..........#.T",
"output": "NO"
},
{
"input": "100 3\nG..............#..........#...#..............#.#.....................#......#........#.........#...T",
"output": "NO"
},
{
"input": "100 3\nG##################################################################################################T",
"output": "NO"
},
{
"input": "100 33\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 33\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 33\nG.........#........#..........#..............#.................#............................#.#....T",
"output": "YES"
},
{
"input": "100 33\nG.......#..................#..............................#............................#..........T.",
"output": "NO"
},
{
"input": "100 33\nG#..........##...#.#.....................#.#.#.........##..#...........#....#...........##...#..###T",
"output": "YES"
},
{
"input": "100 33\nG..#.#..#..####......#......##...##...#.##........#...#...#.##....###..#...###..##.#.....#......#.T.",
"output": "NO"
},
{
"input": "100 33\nG#....#..#..##.##..#.##.#......#.#.##..##.#.#.##.##....#.#.....####..##...#....##..##..........#...T",
"output": "NO"
},
{
"input": "100 33\nG#######.#..##.##.#...#..#.###.#.##.##.#..#.###..####.##.#.##....####...##..####.#..##.##.##.#....#T",
"output": "NO"
},
{
"input": "100 33\nG#####.#.##.###########.##..##..#######..########..###.###..#.####.######.############..####..#####T",
"output": "NO"
},
{
"input": "100 99\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 99\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 99\nT.#...............................#............#..............................##...................G",
"output": "YES"
},
{
"input": "100 99\nT..#....#.##...##########.#.#.#.#...####..#.....#..##..#######.######..#.....###..###...#.......#.#G",
"output": "YES"
},
{
"input": "100 99\nG##################################################################################################T",
"output": "YES"
},
{
"input": "100 9\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 9\nT.................................................................................................G.",
"output": "NO"
},
{
"input": "100 9\nT................................................................................................G..",
"output": "NO"
},
{
"input": "100 1\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 1\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 1\n##########G.........T###############################################################################",
"output": "YES"
},
{
"input": "100 1\n#################################################################################################G.T",
"output": "YES"
},
{
"input": "100 17\n##########G################.################.################.################T#####################",
"output": "YES"
},
{
"input": "100 17\n####.#..#.G######.#########.##..##########.#.################.################T######.####.#########",
"output": "YES"
},
{
"input": "100 17\n.########.G##.####.#.######.###############..#.###########.##.#####.##.#####.#T.###..###.########.##",
"output": "YES"
},
{
"input": "100 1\nG.............................................#....................................................T",
"output": "NO"
},
{
"input": "100 1\nT.#................................................................................................G",
"output": "NO"
},
{
"input": "100 1\n##########G....#....T###############################################################################",
"output": "NO"
},
{
"input": "100 1\n#################################################################################################G#T",
"output": "NO"
},
{
"input": "100 17\nG################.#################################.################T###############################",
"output": "NO"
},
{
"input": "100 17\nG################.###############..###.######.#######.###.#######.##T######################.###.####",
"output": "NO"
},
{
"input": "100 17\nG####.##.##.#####.####....##.####.#########.##.#..#.###############.T############.#########.#.####.#",
"output": "NO"
},
{
"input": "48 1\nT..............................................G",
"output": "YES"
},
{
"input": "23 1\nT.....................G",
"output": "YES"
},
{
"input": "49 1\nG...............................................T",
"output": "YES"
},
{
"input": "3 1\nTG#",
"output": "YES"
},
{
"input": "6 2\n..TG..",
"output": "NO"
},
{
"input": "14 3\n...G.....#..T.",
"output": "NO"
},
{
"input": "5 4\n##GT#",
"output": "NO"
},
{
"input": "6 2\nT#..G.",
"output": "YES"
},
{
"input": "5 2\nT.G.#",
"output": "YES"
},
{
"input": "6 1\nT...G#",
"output": "YES"
},
{
"input": "5 1\nTG###",
"output": "YES"
},
{
"input": "5 4\n.G..T",
"output": "NO"
},
{
"input": "7 2\nT#...#G",
"output": "YES"
},
{
"input": "7 1\n##TG###",
"output": "YES"
},
{
"input": "7 1\n###GT##",
"output": "YES"
},
{
"input": "5 2\nG..T.",
"output": "NO"
},
{
"input": "5 1\nG.T##",
"output": "YES"
},
{
"input": "6 2\nG.T###",
"output": "YES"
},
{
"input": "6 2\nG#T###",
"output": "YES"
},
{
"input": "10 2\n####T..G..",
"output": "NO"
},
{
"input": "3 1\nGT#",
"output": "YES"
},
{
"input": "4 1\nTG##",
"output": "YES"
},
{
"input": "6 1\n.G..T.",
"output": "YES"
},
{
"input": "10 3\n......G..T",
"output": "YES"
},
{
"input": "3 2\nG.T",
"output": "YES"
},
{
"input": "4 1\n#G.T",
"output": "YES"
},
{
"input": "5 2\nT#G##",
"output": "YES"
},
{
"input": "4 2\nG#.T",
"output": "NO"
},
{
"input": "4 1\nGT##",
"output": "YES"
}
] | 1,547,986,626
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 83
| 124
| 0
|
n, k = map(int, input().split())
s = input()
i = s.find("G")
ans = 0
while i < n:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i += k
i = s.find("G")
while i > -1:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i -= k
if ans == 1:
print("YES")
else:
print("NO")
|
Title: Ostap and Grasshopper
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
On the way to Rio de Janeiro Ostap kills time playing with a grasshopper he took with him in a special box. Ostap builds a line of length *n* such that some cells of this line are empty and some contain obstacles. Then, he places his grasshopper to one of the empty cells and a small insect in another empty cell. The grasshopper wants to eat the insect.
Ostap knows that grasshopper is able to jump to any empty cell that is exactly *k* cells away from the current (to the left or to the right). Note that it doesn't matter whether intermediate cells are empty or not as the grasshopper makes a jump over them. For example, if *k*<==<=1 the grasshopper can jump to a neighboring cell only, and if *k*<==<=2 the grasshopper can jump over a single cell.
Your goal is to determine whether there is a sequence of jumps such that grasshopper will get from his initial position to the cell with an insect.
Input Specification:
The first line of the input contains two integers *n* and *k* (2<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=*n*<=-<=1) — the number of cells in the line and the length of one grasshopper's jump.
The second line contains a string of length *n* consisting of characters '.', '#', 'G' and 'T'. Character '.' means that the corresponding cell is empty, character '#' means that the corresponding cell contains an obstacle and grasshopper can't jump there. Character 'G' means that the grasshopper starts at this position and, finally, 'T' means that the target insect is located at this cell. It's guaranteed that characters 'G' and 'T' appear in this line exactly once.
Output Specification:
If there exists a sequence of jumps (each jump of length *k*), such that the grasshopper can get from his initial position to the cell with the insect, print "YES" (without quotes) in the only line of the input. Otherwise, print "NO" (without quotes).
Demo Input:
['5 2\n#G#T#\n', '6 1\nT....G\n', '7 3\nT..#..G\n', '6 2\n..GT..\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n', 'NO\n']
Note:
In the first sample, the grasshopper can make one jump to the right in order to get from cell 2 to cell 4.
In the second sample, the grasshopper is only able to jump to neighboring cells but the way to the insect is free — he can get there by jumping left 5 times.
In the third sample, the grasshopper can't make a single jump.
In the fourth sample, the grasshopper can only jump to the cells with odd indices, thus he won't be able to reach the insect.
|
```python
n, k = map(int, input().split())
s = input()
i = s.find("G")
ans = 0
while i < n:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i += k
i = s.find("G")
while i > -1:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i -= k
if ans == 1:
print("YES")
else:
print("NO")
```
| 3
|
|
81
|
A
|
Plug-in
|
PROGRAMMING
| 1,400
|
[
"implementation"
] |
A. Plug-in
|
1
|
256
|
Polycarp thinks about the meaning of life very often. He does this constantly, even when typing in the editor. Every time he starts brooding he can no longer fully concentrate and repeatedly presses the keys that need to be pressed only once. For example, instead of the phrase "how are you" he can type "hhoow aaaare yyoouu".
Polycarp decided to automate the process of correcting such errors. He decided to write a plug-in to the text editor that will remove pairs of identical consecutive letters (if there are any in the text). Of course, this is not exactly what Polycarp needs, but he's got to start from something!
Help Polycarp and write the main plug-in module. Your program should remove from a string all pairs of identical letters, which are consecutive. If after the removal there appear new pairs, the program should remove them as well. Technically, its work should be equivalent to the following: while the string contains a pair of consecutive identical letters, the pair should be deleted. Note that deleting of the consecutive identical letters can be done in any order, as any order leads to the same result.
|
The input data consists of a single line to be processed. The length of the line is from 1 to 2·105 characters inclusive. The string contains only lowercase Latin letters.
|
Print the given string after it is processed. It is guaranteed that the result will contain at least one character.
|
[
"hhoowaaaareyyoouu\n",
"reallazy\n",
"abacabaabacabaa\n"
] |
[
"wre",
"rezy",
"a"
] |
none
| 500
|
[
{
"input": "hhoowaaaareyyoouu",
"output": "wre"
},
{
"input": "reallazy",
"output": "rezy"
},
{
"input": "abacabaabacabaa",
"output": "a"
},
{
"input": "xraccabccbry",
"output": "xy"
},
{
"input": "a",
"output": "a"
},
{
"input": "b",
"output": "b"
},
{
"input": "il",
"output": "il"
},
{
"input": "gfj",
"output": "gfj"
},
{
"input": "babbbbbababa",
"output": "babababa"
},
{
"input": "babbbbabbabbbababbabbbbbbabaabaababaaabbbbbabbbbaaaaabbaaabbaabaabbbbabbbababbabaaabbababaaababbbaaa",
"output": "babababababababababababa"
},
{
"input": "aab",
"output": "b"
},
{
"input": "abb",
"output": "a"
},
{
"input": "aba",
"output": "aba"
},
{
"input": "ab",
"output": "ab"
}
] | 1,626,638,633
| 2,147,483,647
|
PyPy 3
|
RUNTIME_ERROR
|
TESTS
| 4
| 310
| 26,521,600
|
s=input()
def rec(i):
global s
if i==len(s):
return
rec(i+1)
if i+1<len(s) and s[i]==s[i+1]:
if i+2<len(s):
s=s[:i]+s[i+2:]
else:
s=s[:i]
rec(0)
print(s)
|
Title: Plug-in
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Polycarp thinks about the meaning of life very often. He does this constantly, even when typing in the editor. Every time he starts brooding he can no longer fully concentrate and repeatedly presses the keys that need to be pressed only once. For example, instead of the phrase "how are you" he can type "hhoow aaaare yyoouu".
Polycarp decided to automate the process of correcting such errors. He decided to write a plug-in to the text editor that will remove pairs of identical consecutive letters (if there are any in the text). Of course, this is not exactly what Polycarp needs, but he's got to start from something!
Help Polycarp and write the main plug-in module. Your program should remove from a string all pairs of identical letters, which are consecutive. If after the removal there appear new pairs, the program should remove them as well. Technically, its work should be equivalent to the following: while the string contains a pair of consecutive identical letters, the pair should be deleted. Note that deleting of the consecutive identical letters can be done in any order, as any order leads to the same result.
Input Specification:
The input data consists of a single line to be processed. The length of the line is from 1 to 2·105 characters inclusive. The string contains only lowercase Latin letters.
Output Specification:
Print the given string after it is processed. It is guaranteed that the result will contain at least one character.
Demo Input:
['hhoowaaaareyyoouu\n', 'reallazy\n', 'abacabaabacabaa\n']
Demo Output:
['wre', 'rezy', 'a']
Note:
none
|
```python
s=input()
def rec(i):
global s
if i==len(s):
return
rec(i+1)
if i+1<len(s) and s[i]==s[i+1]:
if i+2<len(s):
s=s[:i]+s[i+2:]
else:
s=s[:i]
rec(0)
print(s)
```
| -1
|
25
|
A
|
IQ test
|
PROGRAMMING
| 1,300
|
[
"brute force"
] |
A. IQ test
|
2
|
256
|
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
|
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
|
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
|
[
"5\n2 4 7 8 10\n",
"4\n1 2 1 1\n"
] |
[
"3\n",
"2\n"
] |
none
| 0
|
[
{
"input": "5\n2 4 7 8 10",
"output": "3"
},
{
"input": "4\n1 2 1 1",
"output": "2"
},
{
"input": "3\n1 2 2",
"output": "1"
},
{
"input": "3\n100 99 100",
"output": "2"
},
{
"input": "3\n5 3 2",
"output": "3"
},
{
"input": "4\n43 28 1 91",
"output": "2"
},
{
"input": "4\n75 13 94 77",
"output": "3"
},
{
"input": "4\n97 8 27 3",
"output": "2"
},
{
"input": "10\n95 51 12 91 85 3 1 31 25 7",
"output": "3"
},
{
"input": "20\n88 96 66 51 14 88 2 92 18 72 18 88 20 30 4 82 90 100 24 46",
"output": "4"
},
{
"input": "30\n20 94 56 50 10 98 52 32 14 22 24 60 4 8 98 46 34 68 82 82 98 90 50 20 78 49 52 94 64 36",
"output": "26"
},
{
"input": "50\n79 27 77 57 37 45 27 49 65 33 57 21 71 19 75 85 65 61 23 97 85 9 23 1 9 3 99 77 77 21 79 69 15 37 15 7 93 81 13 89 91 31 45 93 15 97 55 80 85 83",
"output": "48"
},
{
"input": "60\n46 11 73 65 3 69 3 53 43 53 97 47 55 93 31 75 35 3 9 73 23 31 3 81 91 79 61 21 15 11 11 11 81 7 83 75 39 87 83 59 89 55 93 27 49 67 67 29 1 93 11 17 9 19 35 21 63 31 31 25",
"output": "1"
},
{
"input": "70\n28 42 42 92 64 54 22 38 38 78 62 38 4 38 14 66 4 92 66 58 94 26 4 44 41 88 48 82 44 26 74 44 48 4 16 92 34 38 26 64 94 4 30 78 50 54 12 90 8 16 80 98 28 100 74 50 36 42 92 18 76 98 8 22 2 50 58 50 64 46",
"output": "25"
},
{
"input": "100\n43 35 79 53 13 91 91 45 65 83 57 9 42 39 85 45 71 51 61 59 31 13 63 39 25 21 79 39 91 67 21 61 97 75 93 83 29 79 59 97 11 37 63 51 39 55 91 23 21 17 47 23 35 75 49 5 69 99 5 7 41 17 25 89 15 79 21 63 53 81 43 91 59 91 69 99 85 15 91 51 49 37 65 7 89 81 21 93 61 63 97 93 45 17 13 69 57 25 75 73",
"output": "13"
},
{
"input": "100\n50 24 68 60 70 30 52 22 18 74 68 98 20 82 4 46 26 68 100 78 84 58 74 98 38 88 68 86 64 80 82 100 20 22 98 98 52 6 94 10 48 68 2 18 38 22 22 82 44 20 66 72 36 58 64 6 36 60 4 96 76 64 12 90 10 58 64 60 74 28 90 26 24 60 40 58 2 16 76 48 58 36 82 60 24 44 4 78 28 38 8 12 40 16 38 6 66 24 31 76",
"output": "99"
},
{
"input": "100\n47 48 94 48 14 18 94 36 96 22 12 30 94 20 48 98 40 58 2 94 8 36 98 18 98 68 2 60 76 38 18 100 8 72 100 68 2 86 92 72 58 16 48 14 6 58 72 76 6 88 80 66 20 28 74 62 86 68 90 86 2 56 34 38 56 90 4 8 76 44 32 86 12 98 38 34 54 92 70 94 10 24 82 66 90 58 62 2 32 58 100 22 58 72 2 22 68 72 42 14",
"output": "1"
},
{
"input": "99\n38 20 68 60 84 16 28 88 60 48 80 28 4 92 70 60 46 46 20 34 12 100 76 2 40 10 8 86 6 80 50 66 12 34 14 28 26 70 46 64 34 96 10 90 98 96 56 88 50 74 70 94 2 94 24 66 68 46 22 30 6 10 64 32 88 14 98 100 64 58 50 18 50 50 8 38 8 16 54 2 60 54 62 84 92 98 4 72 66 26 14 88 99 16 10 6 88 56 22",
"output": "93"
},
{
"input": "99\n50 83 43 89 53 47 69 1 5 37 63 87 95 15 55 95 75 89 33 53 89 75 93 75 11 85 49 29 11 97 49 67 87 11 25 37 97 73 67 49 87 43 53 97 43 29 53 33 45 91 37 73 39 49 59 5 21 43 87 35 5 63 89 57 63 47 29 99 19 85 13 13 3 13 43 19 5 9 61 51 51 57 15 89 13 97 41 13 99 79 13 27 97 95 73 33 99 27 23",
"output": "1"
},
{
"input": "98\n61 56 44 30 58 14 20 24 88 28 46 56 96 52 58 42 94 50 46 30 46 80 72 88 68 16 6 60 26 90 10 98 76 20 56 40 30 16 96 20 88 32 62 30 74 58 36 76 60 4 24 36 42 54 24 92 28 14 2 74 86 90 14 52 34 82 40 76 8 64 2 56 10 8 78 16 70 86 70 42 70 74 22 18 76 98 88 28 62 70 36 72 20 68 34 48 80 98",
"output": "1"
},
{
"input": "98\n66 26 46 42 78 32 76 42 26 82 8 12 4 10 24 26 64 44 100 46 94 64 30 18 88 28 8 66 30 82 82 28 74 52 62 80 80 60 94 86 64 32 44 88 92 20 12 74 94 28 34 58 4 22 16 10 94 76 82 58 40 66 22 6 30 32 92 54 16 76 74 98 18 48 48 30 92 2 16 42 84 74 30 60 64 52 50 26 16 86 58 96 79 60 20 62 82 94",
"output": "93"
},
{
"input": "95\n9 31 27 93 17 77 75 9 9 53 89 39 51 99 5 1 11 39 27 49 91 17 27 79 81 71 37 75 35 13 93 4 99 55 85 11 23 57 5 43 5 61 15 35 23 91 3 81 99 85 43 37 39 27 5 67 7 33 75 59 13 71 51 27 15 93 51 63 91 53 43 99 25 47 17 71 81 15 53 31 59 83 41 23 73 25 91 91 13 17 25 13 55 57 29",
"output": "32"
},
{
"input": "100\n91 89 81 45 53 1 41 3 77 93 55 97 55 97 87 27 69 95 73 41 93 21 75 35 53 56 5 51 87 59 91 67 33 3 99 45 83 17 97 47 75 97 7 89 17 99 23 23 81 25 55 97 27 35 69 5 77 35 93 19 55 59 37 21 31 37 49 41 91 53 73 69 7 37 37 39 17 71 7 97 55 17 47 23 15 73 31 39 57 37 9 5 61 41 65 57 77 79 35 47",
"output": "26"
},
{
"input": "99\n38 56 58 98 80 54 26 90 14 16 78 92 52 74 40 30 84 14 44 80 16 90 98 68 26 24 78 72 42 16 84 40 14 44 2 52 50 2 12 96 58 66 8 80 44 52 34 34 72 98 74 4 66 74 56 21 8 38 76 40 10 22 48 32 98 34 12 62 80 68 64 82 22 78 58 74 20 22 48 56 12 38 32 72 6 16 74 24 94 84 26 38 18 24 76 78 98 94 72",
"output": "56"
},
{
"input": "100\n44 40 6 40 56 90 98 8 36 64 76 86 98 76 36 92 6 30 98 70 24 98 96 60 24 82 88 68 86 96 34 42 58 10 40 26 56 10 88 58 70 32 24 28 14 82 52 12 62 36 70 60 52 34 74 30 78 76 10 16 42 94 66 90 70 38 52 12 58 22 98 96 14 68 24 70 4 30 84 98 8 50 14 52 66 34 100 10 28 100 56 48 38 12 38 14 91 80 70 86",
"output": "97"
},
{
"input": "100\n96 62 64 20 90 46 56 90 68 36 30 56 70 28 16 64 94 34 6 32 34 50 94 22 90 32 40 2 72 10 88 38 28 92 20 26 56 80 4 100 100 90 16 74 74 84 8 2 30 20 80 32 16 46 92 56 42 12 96 64 64 42 64 58 50 42 74 28 2 4 36 32 70 50 54 92 70 16 45 76 28 16 18 50 48 2 62 94 4 12 52 52 4 100 70 60 82 62 98 42",
"output": "79"
},
{
"input": "99\n14 26 34 68 90 58 50 36 8 16 18 6 2 74 54 20 36 84 32 50 52 2 26 24 3 64 20 10 54 26 66 44 28 72 4 96 78 90 96 86 68 28 94 4 12 46 100 32 22 36 84 32 44 94 76 94 4 52 12 30 74 4 34 64 58 72 44 16 70 56 54 8 14 74 8 6 58 62 98 54 14 40 80 20 36 72 28 98 20 58 40 52 90 64 22 48 54 70 52",
"output": "25"
},
{
"input": "95\n82 86 30 78 6 46 80 66 74 72 16 24 18 52 52 38 60 36 86 26 62 28 22 46 96 26 94 84 20 46 66 88 76 32 12 86 74 18 34 88 4 48 94 6 58 6 100 82 4 24 88 32 54 98 34 48 6 76 42 88 42 28 100 4 22 2 10 66 82 54 98 20 60 66 38 98 32 47 86 58 6 100 12 46 2 42 8 84 78 28 24 70 34 28 86",
"output": "78"
},
{
"input": "90\n40 50 8 42 76 24 58 42 26 68 20 48 54 12 34 84 14 36 32 88 6 50 96 56 20 92 48 16 40 34 96 46 20 84 30 50 20 98 8 44 96 42 8 76 70 38 84 30 40 88 84 72 2 22 52 58 16 62 100 66 80 40 50 32 14 62 88 72 22 99 76 50 84 82 8 82 98 46 26 40 2 98 18 78 30 72 70 18 34 68",
"output": "70"
},
{
"input": "80\n81 43 87 1 55 43 53 61 27 19 43 13 89 9 33 83 75 55 97 71 91 37 95 5 21 69 81 93 95 69 31 83 55 7 97 7 79 57 8 61 27 85 49 1 15 97 63 79 29 73 41 85 5 41 31 93 67 11 63 59 15 99 91 77 43 69 23 23 81 73 19 1 67 51 1 75 99 67 3 81",
"output": "39"
},
{
"input": "98\n13 83 61 27 35 1 85 95 97 73 95 65 73 45 5 43 27 83 91 19 11 3 85 59 9 39 69 23 45 7 51 85 5 71 5 95 1 51 75 3 43 57 3 11 33 71 21 99 47 41 87 39 71 87 31 85 91 49 83 5 49 85 47 91 55 99 33 23 31 23 23 73 29 77 55 31 25 5 81 49 91 15 15 39 87 5 9 40 69 47 29 33 11 21 49 79 51 83",
"output": "88"
},
{
"input": "3\n100 100 1",
"output": "3"
}
] | 1,692,121,752
| 2,147,483,647
|
PyPy 3-64
|
RUNTIME_ERROR
|
TESTS
| 0
| 186
| 3,481,600
|
n=int(input())
a=list(map(int,input().split()))
even=0
od=0
for i in range(n):
if a[i]%2==0:
even+=1
else:
od+=1
if even>=1 and odd>=1:
if even>odd:
for j in range(n):
if a[j]%2!=0:
print(j+1)
break
break
elif od>even:
for j in range(n):
if a[j]%2==0:
print(j+1)
break
break
|
Title: IQ test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
Input Specification:
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
Output Specification:
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
Demo Input:
['5\n2 4 7 8 10\n', '4\n1 2 1 1\n']
Demo Output:
['3\n', '2\n']
Note:
none
|
```python
n=int(input())
a=list(map(int,input().split()))
even=0
od=0
for i in range(n):
if a[i]%2==0:
even+=1
else:
od+=1
if even>=1 and odd>=1:
if even>odd:
for j in range(n):
if a[j]%2!=0:
print(j+1)
break
break
elif od>even:
for j in range(n):
if a[j]%2==0:
print(j+1)
break
break
```
| -1
|
958
|
B1
|
Maximum Control (easy)
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
The Resistance is trying to take control over all planets in a particular solar system. This solar system is shaped like a tree. More precisely, some planets are connected by bidirectional hyperspace tunnels in such a way that there is a path between every pair of the planets, but removing any tunnel would disconnect some of them.
The Resistance already has measures in place that will, when the time is right, enable them to control every planet that is not remote. A planet is considered to be remote if it is connected to the rest of the planets only via a single hyperspace tunnel.
How much work is there left to be done: that is, how many remote planets are there?
|
The first line of the input contains an integer *N* (2<=≤<=*N*<=≤<=1000) – the number of planets in the galaxy.
The next *N*<=-<=1 lines describe the hyperspace tunnels between the planets. Each of the *N*<=-<=1 lines contains two space-separated integers *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*N*) indicating that there is a bidirectional hyperspace tunnel between the planets *u* and *v*. It is guaranteed that every two planets are connected by a path of tunnels, and that each tunnel connects a different pair of planets.
|
A single integer denoting the number of remote planets.
|
[
"5\n4 1\n4 2\n1 3\n1 5\n",
"4\n1 2\n4 3\n1 4\n"
] |
[
"3\n",
"2\n"
] |
In the first example, only planets 2, 3 and 5 are connected by a single tunnel.
In the second example, the remote planets are 2 and 3.
Note that this problem has only two versions – easy and medium.
| 0
|
[
{
"input": "5\n4 1\n4 2\n1 3\n1 5",
"output": "3"
},
{
"input": "4\n1 2\n4 3\n1 4",
"output": "2"
},
{
"input": "10\n4 3\n2 6\n10 1\n5 7\n5 8\n10 6\n5 9\n9 3\n2 9",
"output": "4"
}
] | 1,687,142,478
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 9
| 280
| 1,433,600
|
n = int(input())
l = []
s = 0
for i in range(n - 1):
u, v = map(int, input().split())
l.append(u)
l.append(v)
for i in l:
if l.count(i) == 1:
s += 1
print(s)
|
Title: Maximum Control (easy)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Resistance is trying to take control over all planets in a particular solar system. This solar system is shaped like a tree. More precisely, some planets are connected by bidirectional hyperspace tunnels in such a way that there is a path between every pair of the planets, but removing any tunnel would disconnect some of them.
The Resistance already has measures in place that will, when the time is right, enable them to control every planet that is not remote. A planet is considered to be remote if it is connected to the rest of the planets only via a single hyperspace tunnel.
How much work is there left to be done: that is, how many remote planets are there?
Input Specification:
The first line of the input contains an integer *N* (2<=≤<=*N*<=≤<=1000) – the number of planets in the galaxy.
The next *N*<=-<=1 lines describe the hyperspace tunnels between the planets. Each of the *N*<=-<=1 lines contains two space-separated integers *u* and *v* (1<=≤<=*u*,<=*v*<=≤<=*N*) indicating that there is a bidirectional hyperspace tunnel between the planets *u* and *v*. It is guaranteed that every two planets are connected by a path of tunnels, and that each tunnel connects a different pair of planets.
Output Specification:
A single integer denoting the number of remote planets.
Demo Input:
['5\n4 1\n4 2\n1 3\n1 5\n', '4\n1 2\n4 3\n1 4\n']
Demo Output:
['3\n', '2\n']
Note:
In the first example, only planets 2, 3 and 5 are connected by a single tunnel.
In the second example, the remote planets are 2 and 3.
Note that this problem has only two versions – easy and medium.
|
```python
n = int(input())
l = []
s = 0
for i in range(n - 1):
u, v = map(int, input().split())
l.append(u)
l.append(v)
for i in l:
if l.count(i) == 1:
s += 1
print(s)
```
| 3
|
|
258
|
A
|
Little Elephant and Bits
|
PROGRAMMING
| 1,100
|
[
"greedy",
"math"
] | null | null |
The Little Elephant has an integer *a*, written in the binary notation. He wants to write this number on a piece of paper.
To make sure that the number *a* fits on the piece of paper, the Little Elephant ought to delete exactly one any digit from number *a* in the binary record. At that a new number appears. It consists of the remaining binary digits, written in the corresponding order (possible, with leading zeroes).
The Little Elephant wants the number he is going to write on the paper to be as large as possible. Help him find the maximum number that he can obtain after deleting exactly one binary digit and print it in the binary notation.
|
The single line contains integer *a*, written in the binary notation without leading zeroes. This number contains more than 1 and at most 105 digits.
|
In the single line print the number that is written without leading zeroes in the binary notation — the answer to the problem.
|
[
"101\n",
"110010\n"
] |
[
"11\n",
"11010\n"
] |
In the first sample the best strategy is to delete the second digit. That results in number 11<sub class="lower-index">2</sub> = 3<sub class="lower-index">10</sub>.
In the second sample the best strategy is to delete the third or fourth digits — that results in number 11010<sub class="lower-index">2</sub> = 26<sub class="lower-index">10</sub>.
| 500
|
[
{
"input": "101",
"output": "11"
},
{
"input": "110010",
"output": "11010"
},
{
"input": "10000",
"output": "1000"
},
{
"input": "1111111110",
"output": "111111111"
},
{
"input": "10100101011110101",
"output": "1100101011110101"
},
{
"input": "111010010111",
"output": "11110010111"
},
{
"input": "11110111011100000000",
"output": "1111111011100000000"
},
{
"input": "11110010010100001110110101110011110110100111101",
"output": "1111010010100001110110101110011110110100111101"
},
{
"input": "1001011111010010100111111",
"output": "101011111010010100111111"
},
{
"input": "1111111111",
"output": "111111111"
},
{
"input": "1111111111111111111100111101001110110111111000001111110101001101001110011000001011001111111000110101",
"output": "111111111111111111110111101001110110111111000001111110101001101001110011000001011001111111000110101"
},
{
"input": "11010110000100100101111110111001001010011000011011000010010100111010101000111010011101101111110001111000101000001100011101110100",
"output": "1110110000100100101111110111001001010011000011011000010010100111010101000111010011101101111110001111000101000001100011101110100"
},
{
"input": "11111111111111111111111110110111001101100111010010101101101001011100011011000111010011110010101100010001011101011010010100001000011100001101101001100010100001001010010100100001111110100110011000101100001111111011010111001011111110111101000100101001001011",
"output": "1111111111111111111111111110111001101100111010010101101101001011100011011000111010011110010101100010001011101011010010100001000011100001101101001100010100001001010010100100001111110100110011000101100001111111011010111001011111110111101000100101001001011"
},
{
"input": "11100010010010000110101101101100111111001010001101101001001111010110010111001011010000001100110101000101111000001111101111110010000010101110011110101101010110001100011101111011100010011101100111110010111111100110101000000111101000000000110100100101111101000110101010101101001110001110000101011010101100011100100111100010001011010010001100011111110010011010011000111000100111100010110100011010010101011011011111110100001110000011011",
"output": "1110010010010000110101101101100111111001010001101101001001111010110010111001011010000001100110101000101111000001111101111110010000010101110011110101101010110001100011101111011100010011101100111110010111111100110101000000111101000000000110100100101111101000110101010101101001110001110000101011010101100011100100111100010001011010010001100011111110010011010011000111000100111100010110100011010010101011011011111110100001110000011011"
},
{
"input": "11",
"output": "1"
},
{
"input": "111",
"output": "11"
},
{
"input": "111111",
"output": "11111"
},
{
"input": "11111",
"output": "1111"
},
{
"input": "1111",
"output": "111"
}
] | 1,682,882,248
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 37
| 154
| 1,638,400
|
n=input();flag=True
for i in range(len(n)):
if n[i]=="0":
n=n[:i]+n[i+1:]
flag=False
break
if flag:
print(n[:-1])
else:
print(n)
|
Title: Little Elephant and Bits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant has an integer *a*, written in the binary notation. He wants to write this number on a piece of paper.
To make sure that the number *a* fits on the piece of paper, the Little Elephant ought to delete exactly one any digit from number *a* in the binary record. At that a new number appears. It consists of the remaining binary digits, written in the corresponding order (possible, with leading zeroes).
The Little Elephant wants the number he is going to write on the paper to be as large as possible. Help him find the maximum number that he can obtain after deleting exactly one binary digit and print it in the binary notation.
Input Specification:
The single line contains integer *a*, written in the binary notation without leading zeroes. This number contains more than 1 and at most 105 digits.
Output Specification:
In the single line print the number that is written without leading zeroes in the binary notation — the answer to the problem.
Demo Input:
['101\n', '110010\n']
Demo Output:
['11\n', '11010\n']
Note:
In the first sample the best strategy is to delete the second digit. That results in number 11<sub class="lower-index">2</sub> = 3<sub class="lower-index">10</sub>.
In the second sample the best strategy is to delete the third or fourth digits — that results in number 11010<sub class="lower-index">2</sub> = 26<sub class="lower-index">10</sub>.
|
```python
n=input();flag=True
for i in range(len(n)):
if n[i]=="0":
n=n[:i]+n[i+1:]
flag=False
break
if flag:
print(n[:-1])
else:
print(n)
```
| 3
|
|
475
|
B
|
Strongly Connected City
|
PROGRAMMING
| 1,400
|
[
"brute force",
"dfs and similar",
"graphs",
"implementation"
] | null | null |
Imagine a city with *n* horizontal streets crossing *m* vertical streets, forming an (*n*<=-<=1)<=×<=(*m*<=-<=1) grid. In order to increase the traffic flow, mayor of the city has decided to make each street one way. This means in each horizontal street, the traffic moves only from west to east or only from east to west. Also, traffic moves only from north to south or only from south to north in each vertical street. It is possible to enter a horizontal street from a vertical street, or vice versa, at their intersection.
The mayor has received some street direction patterns. Your task is to check whether it is possible to reach any junction from any other junction in the proposed street direction pattern.
|
The first line of input contains two integers *n* and *m*, (2<=≤<=*n*,<=*m*<=≤<=20), denoting the number of horizontal streets and the number of vertical streets.
The second line contains a string of length *n*, made of characters '<' and '>', denoting direction of each horizontal street. If the *i*-th character is equal to '<', the street is directed from east to west otherwise, the street is directed from west to east. Streets are listed in order from north to south.
The third line contains a string of length *m*, made of characters '^' and 'v', denoting direction of each vertical street. If the *i*-th character is equal to '^', the street is directed from south to north, otherwise the street is directed from north to south. Streets are listed in order from west to east.
|
If the given pattern meets the mayor's criteria, print a single line containing "YES", otherwise print a single line containing "NO".
|
[
"3 3\n><>\nv^v\n",
"4 6\n<><>\nv^v^v^\n"
] |
[
"NO\n",
"YES\n"
] |
The figure above shows street directions in the second sample test case.
| 1,000
|
[
{
"input": "3 3\n><>\nv^v",
"output": "NO"
},
{
"input": "4 6\n<><>\nv^v^v^",
"output": "YES"
},
{
"input": "2 2\n<>\nv^",
"output": "YES"
},
{
"input": "2 2\n>>\n^v",
"output": "NO"
},
{
"input": "3 3\n>><\n^^v",
"output": "YES"
},
{
"input": "3 4\n>><\n^v^v",
"output": "YES"
},
{
"input": "3 8\n>><\nv^^^^^^^",
"output": "NO"
},
{
"input": "7 2\n<><<<<>\n^^",
"output": "NO"
},
{
"input": "4 5\n><<<\n^^^^v",
"output": "YES"
},
{
"input": "2 20\n><\n^v^^v^^v^^^v^vv^vv^^",
"output": "NO"
},
{
"input": "2 20\n<>\nv^vv^v^^vvv^^^v^vvv^",
"output": "YES"
},
{
"input": "20 2\n<><<><<>><<<>><><<<<\n^^",
"output": "NO"
},
{
"input": "20 2\n><>><>><>><<<><<><><\n^v",
"output": "YES"
},
{
"input": "11 12\n><<<><><<>>\nvv^^^^vvvvv^",
"output": "NO"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "16 11\n<<<<>><><<<<<><<\nvv^v^vvvv^v",
"output": "NO"
},
{
"input": "14 7\n><<<<>>>>>>><<\nvv^^^vv",
"output": "NO"
},
{
"input": "5 14\n<<><>\nv^vv^^vv^v^^^v",
"output": "NO"
},
{
"input": "8 18\n>>>><>>>\nv^vv^v^^^^^vvv^^vv",
"output": "NO"
},
{
"input": "18 18\n<<><>><<>><>><><<<\n^^v^v^vvvv^v^vv^vv",
"output": "NO"
},
{
"input": "4 18\n<<<>\n^^^^^vv^vv^^vv^v^v",
"output": "NO"
},
{
"input": "19 18\n><><>>><<<<<>>><<<>\n^^v^^v^^v^vv^v^vvv",
"output": "NO"
},
{
"input": "14 20\n<<<><><<>><><<\nvvvvvvv^v^vvvv^^^vv^",
"output": "NO"
},
{
"input": "18 18\n><>>><<<>><><>>>><\nvv^^^^v^v^^^^v^v^^",
"output": "NO"
},
{
"input": "8 18\n<><<<>>>\n^^^^^^v^^^vv^^vvvv",
"output": "NO"
},
{
"input": "11 12\n><><><<><><\n^^v^^^^^^^^v",
"output": "YES"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "16 11\n>><<><<<<>>><><<\n^^^^vvvv^vv",
"output": "YES"
},
{
"input": "14 7\n<><><<<>>>><>>\nvv^^v^^",
"output": "YES"
},
{
"input": "5 14\n>>>><\n^v^v^^^vv^vv^v",
"output": "YES"
},
{
"input": "8 18\n<<<><>>>\nv^^vvv^^v^v^vvvv^^",
"output": "YES"
},
{
"input": "18 18\n><><<><><>>><>>>><\n^^vvv^v^^^v^vv^^^v",
"output": "YES"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "19 18\n>>>><><<>>><<<><<<<\n^v^^^^vv^^v^^^^v^v",
"output": "YES"
},
{
"input": "14 20\n<>><<<><<>>>>>\nvv^^v^^^^v^^vv^^vvv^",
"output": "YES"
},
{
"input": "18 18\n><><<><><>>><>>>><\n^^vvv^v^^^v^vv^^^v",
"output": "YES"
},
{
"input": "8 18\n<<<><>>>\nv^^vvv^^v^v^vvvv^^",
"output": "YES"
},
{
"input": "20 19\n<><>>>>><<<<<><<>>>>\nv^vv^^vvvvvv^vvvv^v",
"output": "NO"
},
{
"input": "20 19\n<<<><<<>><<<>><><><>\nv^v^vvv^vvv^^^vvv^^",
"output": "YES"
},
{
"input": "19 20\n<><<<><><><<<<<<<<>\n^v^^^^v^^vvvv^^^^vvv",
"output": "NO"
},
{
"input": "19 20\n>>>>>>>><>>><><<<><\n^v^v^^^vvv^^^v^^vvvv",
"output": "YES"
},
{
"input": "20 20\n<<<>>>><>><<>><<>>>>\n^vvv^^^^vv^^^^^v^^vv",
"output": "NO"
},
{
"input": "20 20\n>>><><<><<<<<<<><<><\nvv^vv^vv^^^^^vv^^^^^",
"output": "NO"
},
{
"input": "20 20\n><<><<<<<<<>>><>>><<\n^^^^^^^^vvvv^vv^vvvv",
"output": "YES"
},
{
"input": "20 20\n<>>>>>>>><>>><>><<<>\nvv^^vv^^^^v^vv^v^^^^",
"output": "YES"
},
{
"input": "20 20\n><>><<>><>>>>>>>><<>\n^^v^vv^^^vvv^v^^^vv^",
"output": "NO"
},
{
"input": "20 20\n<<<<><<>><><<<>><<><\nv^^^^vvv^^^vvvv^v^vv",
"output": "NO"
},
{
"input": "20 20\n><<<><<><>>><><<<<<<\nvv^^vvv^^v^^v^vv^vvv",
"output": "NO"
},
{
"input": "20 20\n<<>>><>>>><<<<>>><<>\nv^vv^^^^^vvv^^v^^v^v",
"output": "NO"
},
{
"input": "20 20\n><<><<><<<<<<>><><>>\nv^^^v^vv^^v^^vvvv^vv",
"output": "NO"
},
{
"input": "20 20\n<<<<<<<<><>><><>><<<\n^vvv^^^v^^^vvv^^^^^v",
"output": "NO"
},
{
"input": "20 20\n>>><<<<<>>><><><<><<\n^^^vvv^^^v^^v^^v^vvv",
"output": "YES"
},
{
"input": "20 20\n<><<<><><>><><><<<<>\n^^^vvvv^vv^v^^^^v^vv",
"output": "NO"
},
{
"input": "20 20\n>>>>>>>>>><>>><>><>>\n^vvv^^^vv^^^^^^vvv^v",
"output": "NO"
},
{
"input": "20 20\n<><>><><<<<<>><<>>><\nv^^^v^v^v^vvvv^^^vv^",
"output": "NO"
},
{
"input": "20 20\n><<<><<<><<<><>>>><<\nvvvv^^^^^vv^v^^vv^v^",
"output": "NO"
},
{
"input": "20 20\n<<><<<<<<>>>>><<<>>>\nvvvvvv^v^vvv^^^^^^^^",
"output": "YES"
},
{
"input": "20 20\n><<><<>>>>><><>><>>>\nv^^^^vvv^^^^^v^v^vv^",
"output": "NO"
},
{
"input": "20 20\n<<>>><>><<>>>><<<><<\n^^vvv^^vvvv^vv^^v^v^",
"output": "NO"
},
{
"input": "20 20\n><<>><>>>><<><>><><<\n^v^^^^^^vvvv^v^v^v^^",
"output": "NO"
},
{
"input": "20 20\n<<><<<<><><<>>><>>>>\n^^vvvvv^v^^^^^^^vvv^",
"output": "NO"
},
{
"input": "20 20\n>><<<<<<><>>>><>>><>\n^^^v^v^vv^^vv^vvv^^^",
"output": "NO"
},
{
"input": "20 20\n>>>>>>>>>>>>>>>>>>>>\nvvvvvvvvvvvvvvvvvvvv",
"output": "NO"
},
{
"input": "2 2\n><\nv^",
"output": "NO"
},
{
"input": "2 2\n<>\n^v",
"output": "NO"
},
{
"input": "3 3\n>><\nvvv",
"output": "NO"
},
{
"input": "2 3\n<>\nv^^",
"output": "YES"
},
{
"input": "4 4\n>>><\nvvv^",
"output": "NO"
},
{
"input": "20 20\n<><><><><><><><><><>\nvvvvvvvvvvvvvvvvvvvv",
"output": "NO"
},
{
"input": "4 4\n<>>>\nv^^^",
"output": "YES"
},
{
"input": "20 20\n<><><><><><><><><><>\nv^v^v^v^v^v^v^v^v^v^",
"output": "YES"
},
{
"input": "2 3\n<>\n^v^",
"output": "NO"
},
{
"input": "4 3\n<><>\n^vv",
"output": "NO"
},
{
"input": "3 3\n<<>\nvv^",
"output": "YES"
},
{
"input": "2 3\n><\nvv^",
"output": "NO"
},
{
"input": "7 6\n>>><>><\n^vv^vv",
"output": "YES"
},
{
"input": "2 2\n<<\nv^",
"output": "NO"
},
{
"input": "3 3\n>><\n^^^",
"output": "NO"
},
{
"input": "3 3\n<><\nv^v",
"output": "NO"
},
{
"input": "20 20\n><><><><><><><><><><\n^v^v^v^v^v^v^v^v^v^v",
"output": "YES"
},
{
"input": "4 4\n<>>>\nvvv^",
"output": "YES"
}
] | 1,667,154,946
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 81
| 998
| 61,440,000
|
import sys
input = lambda: sys.stdin.buffer.readline().decode().strip()
# print = sys.stdout.write
inl = lambda: list(map(int, input().split()))
hs, vs = inl()
h_streets = input()
v_streets = input()
h_streets = [1 if i == ">" else -1 for i in h_streets]
v_streets = [1 if i == "v" else -1 for i in v_streets]
def dfs(i, j):
seen.add((i, j))
next_ps = [(i + v_streets[j], j), (i, j + h_streets[i])]
for p in next_ps:
if p[0] in range(hs) and p[1] in range(vs) and p not in seen:
dfs(p[0], p[1])
f = True
for i in range(hs):
for j in range(vs):
seen = set()
dfs(i, j)
if len(seen) < hs * vs:
f = False
break
if not f:
print("NO")
else:
print("YES")
|
Title: Strongly Connected City
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Imagine a city with *n* horizontal streets crossing *m* vertical streets, forming an (*n*<=-<=1)<=×<=(*m*<=-<=1) grid. In order to increase the traffic flow, mayor of the city has decided to make each street one way. This means in each horizontal street, the traffic moves only from west to east or only from east to west. Also, traffic moves only from north to south or only from south to north in each vertical street. It is possible to enter a horizontal street from a vertical street, or vice versa, at their intersection.
The mayor has received some street direction patterns. Your task is to check whether it is possible to reach any junction from any other junction in the proposed street direction pattern.
Input Specification:
The first line of input contains two integers *n* and *m*, (2<=≤<=*n*,<=*m*<=≤<=20), denoting the number of horizontal streets and the number of vertical streets.
The second line contains a string of length *n*, made of characters '<' and '>', denoting direction of each horizontal street. If the *i*-th character is equal to '<', the street is directed from east to west otherwise, the street is directed from west to east. Streets are listed in order from north to south.
The third line contains a string of length *m*, made of characters '^' and 'v', denoting direction of each vertical street. If the *i*-th character is equal to '^', the street is directed from south to north, otherwise the street is directed from north to south. Streets are listed in order from west to east.
Output Specification:
If the given pattern meets the mayor's criteria, print a single line containing "YES", otherwise print a single line containing "NO".
Demo Input:
['3 3\n><>\nv^v\n', '4 6\n<><>\nv^v^v^\n']
Demo Output:
['NO\n', 'YES\n']
Note:
The figure above shows street directions in the second sample test case.
|
```python
import sys
input = lambda: sys.stdin.buffer.readline().decode().strip()
# print = sys.stdout.write
inl = lambda: list(map(int, input().split()))
hs, vs = inl()
h_streets = input()
v_streets = input()
h_streets = [1 if i == ">" else -1 for i in h_streets]
v_streets = [1 if i == "v" else -1 for i in v_streets]
def dfs(i, j):
seen.add((i, j))
next_ps = [(i + v_streets[j], j), (i, j + h_streets[i])]
for p in next_ps:
if p[0] in range(hs) and p[1] in range(vs) and p not in seen:
dfs(p[0], p[1])
f = True
for i in range(hs):
for j in range(vs):
seen = set()
dfs(i, j)
if len(seen) < hs * vs:
f = False
break
if not f:
print("NO")
else:
print("YES")
```
| 3
|
|
120
|
A
|
Elevator
|
PROGRAMMING
| 1,000
|
[
"brute force",
"implementation",
"math"
] | null | null |
A sky scraper with 1000 floors has been built in the city of N. It has modern superfast elevators to help to travel from one floor to another. Each elevator has two doors, the front one and the back one. If one goes in through the front door, he goes out through the back one and vice versa. The elevator has two rails numbered with numbers 1 and 2. Rail 1 is located to the left of the entrance to the front door (or correspondingly, to the right of the entrance to the back door). Rail 2 is located opposite it, to the right of the entrance to the front door and to the left of the entrance to the back door. We know that each person in the city of N holds at a rail with the strongest hand.
One day a VIP person visited the city and of course, he took a look at the skyscraper and took a ride in the elevator. We know the door through which he entered and the rail he was holding at. Now we need to determine as soon as possible whether he is left-handed or right-handed.
|
The first line indicates the door through which the very important person entered the elevator. It contains "front" if the person enters the elevator through the front door and "back" if he entered the elevator through the back door. The second line contains integer *a* (1<=≤<=*a*<=≤<=2) which denotes the number of the rail at which the person was holding.
|
Print character "R" if the VIP is right-handed or "L" if he is left-handed.
|
[
"front\n1\n"
] |
[
"L\n"
] |
none
| 0
|
[
{
"input": "front\n1",
"output": "L"
},
{
"input": "back\n1",
"output": "R"
},
{
"input": "front\n2",
"output": "R"
},
{
"input": "back\n2",
"output": "L"
}
] | 1,592,806,650
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 186
| 0
|
n=input()
m=int(input())
if (n=='front' and m==1) or (n=='back' and m==2):
print("L")
else:
print("R")
|
Title: Elevator
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A sky scraper with 1000 floors has been built in the city of N. It has modern superfast elevators to help to travel from one floor to another. Each elevator has two doors, the front one and the back one. If one goes in through the front door, he goes out through the back one and vice versa. The elevator has two rails numbered with numbers 1 and 2. Rail 1 is located to the left of the entrance to the front door (or correspondingly, to the right of the entrance to the back door). Rail 2 is located opposite it, to the right of the entrance to the front door and to the left of the entrance to the back door. We know that each person in the city of N holds at a rail with the strongest hand.
One day a VIP person visited the city and of course, he took a look at the skyscraper and took a ride in the elevator. We know the door through which he entered and the rail he was holding at. Now we need to determine as soon as possible whether he is left-handed or right-handed.
Input Specification:
The first line indicates the door through which the very important person entered the elevator. It contains "front" if the person enters the elevator through the front door and "back" if he entered the elevator through the back door. The second line contains integer *a* (1<=≤<=*a*<=≤<=2) which denotes the number of the rail at which the person was holding.
Output Specification:
Print character "R" if the VIP is right-handed or "L" if he is left-handed.
Demo Input:
['front\n1\n']
Demo Output:
['L\n']
Note:
none
|
```python
n=input()
m=int(input())
if (n=='front' and m==1) or (n=='back' and m==2):
print("L")
else:
print("R")
```
| -1
|
|
805
|
B
|
3-palindrome
|
PROGRAMMING
| 1,000
|
[
"constructive algorithms"
] | null | null |
In the beginning of the new year Keivan decided to reverse his name. He doesn't like palindromes, so he changed Naviek to Navick.
He is too selfish, so for a given *n* he wants to obtain a string of *n* characters, each of which is either 'a', 'b' or 'c', with no palindromes of length 3 appearing in the string as a substring. For example, the strings "abc" and "abca" suit him, while the string "aba" doesn't. He also want the number of letters 'c' in his string to be as little as possible.
|
The first line contains single integer *n* (1<=≤<=*n*<=≤<=2·105) — the length of the string.
|
Print the string that satisfies all the constraints.
If there are multiple answers, print any of them.
|
[
"2\n",
"3\n"
] |
[
"aa\n",
"bba\n"
] |
A palindrome is a sequence of characters which reads the same backward and forward.
| 1,000
|
[
{
"input": "2",
"output": "aa"
},
{
"input": "3",
"output": "aab"
},
{
"input": "38",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaa"
},
{
"input": "47",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab"
},
{
"input": "59",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab"
},
{
"input": "67",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab"
},
{
"input": "77",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "89",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "98",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaa"
},
{
"input": "109",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "117",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabba"
},
{
"input": "1",
"output": "a"
},
{
"input": "200000",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "100000",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "143670",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "104217",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "17879",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "131809",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "140873",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "77859",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "153022",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "179227",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "182801",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "5188",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "86539",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "12802",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "120289",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "132866",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "133377",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "31775",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "160397",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "161415",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "163623",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "22942",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "134767",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "52257",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "64905",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "183758",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "60131",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "146883",
"output": "aabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaabbaab..."
},
{
"input": "6",
"output": "aabbaa"
},
{
"input": "4",
"output": "aabb"
}
] | 1,694,852,380
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 31
| 0
|
# cook your dish here
n = int(input())
if n == 1:
print("a")
elif n==2:
print("aa")
elif n==3:
print("aab")
elif n==4:
print("aabc")
else:
res = "aabc"
res+=("aabc"*(n//4))
if n%4==1:
res+="a"
elif n%4==2:
res+="aa"
elif n%4==3:
res+="aab"
print(res)
|
Title: 3-palindrome
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In the beginning of the new year Keivan decided to reverse his name. He doesn't like palindromes, so he changed Naviek to Navick.
He is too selfish, so for a given *n* he wants to obtain a string of *n* characters, each of which is either 'a', 'b' or 'c', with no palindromes of length 3 appearing in the string as a substring. For example, the strings "abc" and "abca" suit him, while the string "aba" doesn't. He also want the number of letters 'c' in his string to be as little as possible.
Input Specification:
The first line contains single integer *n* (1<=≤<=*n*<=≤<=2·105) — the length of the string.
Output Specification:
Print the string that satisfies all the constraints.
If there are multiple answers, print any of them.
Demo Input:
['2\n', '3\n']
Demo Output:
['aa\n', 'bba\n']
Note:
A palindrome is a sequence of characters which reads the same backward and forward.
|
```python
# cook your dish here
n = int(input())
if n == 1:
print("a")
elif n==2:
print("aa")
elif n==3:
print("aab")
elif n==4:
print("aabc")
else:
res = "aabc"
res+=("aabc"*(n//4))
if n%4==1:
res+="a"
elif n%4==2:
res+="aa"
elif n%4==3:
res+="aab"
print(res)
```
| 0
|
|
1
|
A
|
Theatre Square
|
PROGRAMMING
| 1,000
|
[
"math"
] |
A. Theatre Square
|
1
|
256
|
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
|
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
|
Write the needed number of flagstones.
|
[
"6 6 4\n"
] |
[
"4\n"
] |
none
| 0
|
[
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,665,854,447
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 20
| 46
| 0
|
from math import ceil
X,Y,Z = list(map(int,input().split()))
A = ceil(X/Z)
B = ceil(Y/Z)
print(int(A*B))
|
Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none
|
```python
from math import ceil
X,Y,Z = list(map(int,input().split()))
A = ceil(X/Z)
B = ceil(Y/Z)
print(int(A*B))
```
| 3.977
|
318
|
A
|
Even Odds
|
PROGRAMMING
| 900
|
[
"math"
] | null | null |
Being a nonconformist, Volodya is displeased with the current state of things, particularly with the order of natural numbers (natural number is positive integer number). He is determined to rearrange them. But there are too many natural numbers, so Volodya decided to start with the first *n*. He writes down the following sequence of numbers: firstly all odd integers from 1 to *n* (in ascending order), then all even integers from 1 to *n* (also in ascending order). Help our hero to find out which number will stand at the position number *k*.
|
The only line of input contains integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=1012).
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specifier.
|
Print the number that will stand at the position number *k* after Volodya's manipulations.
|
[
"10 3\n",
"7 7\n"
] |
[
"5",
"6"
] |
In the first sample Volodya's sequence will look like this: {1, 3, 5, 7, 9, 2, 4, 6, 8, 10}. The third place in the sequence is therefore occupied by the number 5.
| 500
|
[
{
"input": "10 3",
"output": "5"
},
{
"input": "7 7",
"output": "6"
},
{
"input": "7 1",
"output": "1"
},
{
"input": "7 2",
"output": "3"
},
{
"input": "8 5",
"output": "2"
},
{
"input": "8 3",
"output": "5"
},
{
"input": "8 4",
"output": "7"
},
{
"input": "1000000000000 500000000001",
"output": "2"
},
{
"input": "999999999997 499999999999",
"output": "999999999997"
},
{
"input": "999999999999 999999999999",
"output": "999999999998"
},
{
"input": "1000000000000 1",
"output": "1"
},
{
"input": "999999999999 1",
"output": "1"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1000000000000 1000000000000",
"output": "1000000000000"
},
{
"input": "1000000000000 500000000000",
"output": "999999999999"
},
{
"input": "1000000000000 499999999999",
"output": "999999999997"
},
{
"input": "999999999997 499999999998",
"output": "999999999995"
},
{
"input": "619234238 556154835",
"output": "493075432"
},
{
"input": "38151981 36650624",
"output": "35149266"
},
{
"input": "680402465 442571217",
"output": "204739968"
},
{
"input": "109135284 9408714",
"output": "18817427"
},
{
"input": "603701841 56038951",
"output": "112077901"
},
{
"input": "356764822 321510177",
"output": "286255532"
},
{
"input": "284911189 142190783",
"output": "284381565"
},
{
"input": "91028405 61435545",
"output": "31842684"
}
] | 1,694,282,559
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 4
| 92
| 0
|
finalNumberAndPosition = [int(a) for a in input().split()]
finalNumber = finalNumberAndPosition[0]
position = finalNumberAndPosition[1] - 1
evenNumbers = []
oddNumbers = []
Numbers = []
i = 1
if position < finalNumber/2:
while len(oddNumbers) <= position:
if i % 2 != 0:
oddNumbers.append(i)
i += 1
print(oddNumbers[position])
else:
while len(Numbers) <= position:
if i % 2 != 0:
oddNumbers.append(i)
else:
evenNumbers.append(i)
Numbers = []
Numbers = oddNumbers + evenNumbers
i+=1
print(Numbers[position])
|
Title: Even Odds
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Being a nonconformist, Volodya is displeased with the current state of things, particularly with the order of natural numbers (natural number is positive integer number). He is determined to rearrange them. But there are too many natural numbers, so Volodya decided to start with the first *n*. He writes down the following sequence of numbers: firstly all odd integers from 1 to *n* (in ascending order), then all even integers from 1 to *n* (also in ascending order). Help our hero to find out which number will stand at the position number *k*.
Input Specification:
The only line of input contains integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=1012).
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specifier.
Output Specification:
Print the number that will stand at the position number *k* after Volodya's manipulations.
Demo Input:
['10 3\n', '7 7\n']
Demo Output:
['5', '6']
Note:
In the first sample Volodya's sequence will look like this: {1, 3, 5, 7, 9, 2, 4, 6, 8, 10}. The third place in the sequence is therefore occupied by the number 5.
|
```python
finalNumberAndPosition = [int(a) for a in input().split()]
finalNumber = finalNumberAndPosition[0]
position = finalNumberAndPosition[1] - 1
evenNumbers = []
oddNumbers = []
Numbers = []
i = 1
if position < finalNumber/2:
while len(oddNumbers) <= position:
if i % 2 != 0:
oddNumbers.append(i)
i += 1
print(oddNumbers[position])
else:
while len(Numbers) <= position:
if i % 2 != 0:
oddNumbers.append(i)
else:
evenNumbers.append(i)
Numbers = []
Numbers = oddNumbers + evenNumbers
i+=1
print(Numbers[position])
```
| 0
|
|
265
|
A
|
Colorful Stones (Simplified Edition)
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
|
The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
|
Print the final 1-based position of Liss in a single line.
|
[
"RGB\nRRR\n",
"RRRBGBRBBB\nBBBRR\n",
"BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n"
] |
[
"2\n",
"3\n",
"15\n"
] |
none
| 500
|
[
{
"input": "RGB\nRRR",
"output": "2"
},
{
"input": "RRRBGBRBBB\nBBBRR",
"output": "3"
},
{
"input": "BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB",
"output": "15"
},
{
"input": "G\nRRBBRBRRBR",
"output": "1"
},
{
"input": "RRRRRBRRBRRGRBGGRRRGRBBRBBBBBRGRBGBRRGBBBRBBGBRGBB\nB",
"output": "1"
},
{
"input": "RRGGBRGRBG\nBRRGGBBGGR",
"output": "7"
},
{
"input": "BBRRGBGGRGBRGBRBRBGR\nGGGRBGGGBRRRRGRBGBGRGRRBGRBGBG",
"output": "15"
},
{
"input": "GBRRBGBGBBBBRRRGBGRRRGBGBBBRGR\nRRGBRRGRBBBBBBGRRBBR",
"output": "8"
},
{
"input": "BRGRRGRGRRGBBGBBBRRBBRRBGBBGRGBBGGRGBRBGGGRRRBGGBB\nRGBBGRRBBBRRGRRBRBBRGBBGGGRGBGRRRRBRBGGBRBGGGRGBRR",
"output": "16"
},
{
"input": "GGRGGBRRGRGBRRGGRBBGGRRGBBBGBBBGGRBGGBRBBRGBRRRBRG\nGGRGRRRRRRRRRGBBBBRGBRGRGRRGBBRGGBRBBRBGBRGRRRRGGR",
"output": "18"
},
{
"input": "RBBRBGBBGGGBRRBGBRGRRGGRBBBBGRBGGBRRBGBBRBRGBBGGGG\nBRRGRBGRBGBRGBRBGGBBBGBBRGRBGRGRBGRBGGRRBGBRGRRBBG",
"output": "23"
},
{
"input": "RRGGRRBRGRGBRGBRGBBRGGGBRBGBRGBRGGBRBRGBGRRBBGGRBR\nBRGRBBBGRBGRRGGRRRRRRRRGGGGGGGGBGGGGGGGRGRBBRGRGBR",
"output": "14"
},
{
"input": "RBRBRRRRRGGR\nBBBBRRGGBGRBRGBBRGGGRGGBRRBRBRBGGG",
"output": "12"
},
{
"input": "GGRGGGBRGRGRBBRGGGRBGRRR\nGBBBBGBGBGBBBRGGRGGBGRRGRRRGBGB",
"output": "12"
},
{
"input": "RGRBGBRBBGBRRGGGBBGBRRBGRGBBBBBGRRRGGRBB\nBGR",
"output": "2"
},
{
"input": "R\nB",
"output": "1"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR",
"output": "50"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
},
{
"input": "R\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
}
] | 1,697,041,457
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 19
| 92
| 0
|
x=input()
y=input()
c=0
for i in range(len(y)):
if y[i]==x[c]:
c+=1
else:
continue
print(c+1)
|
Title: Colorful Stones (Simplified Edition)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
Input Specification:
The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
Output Specification:
Print the final 1-based position of Liss in a single line.
Demo Input:
['RGB\nRRR\n', 'RRRBGBRBBB\nBBBRR\n', 'BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n']
Demo Output:
['2\n', '3\n', '15\n']
Note:
none
|
```python
x=input()
y=input()
c=0
for i in range(len(y)):
if y[i]==x[c]:
c+=1
else:
continue
print(c+1)
```
| 3
|
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,642,526,505
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 40
| 92
| 0
|
a = ['h', 'e', 'l', 'l', 'o']
j = 4
s = input()
i = len(s)-1
while(i >= 0 and j >= 0):
if(a[j] == s[i]):
j -= 1
i -= 1
else:
i -= 1
print("YES" if(j == -1) else "NO")
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
a = ['h', 'e', 'l', 'l', 'o']
j = 4
s = input()
i = len(s)-1
while(i >= 0 and j >= 0):
if(a[j] == s[i]):
j -= 1
i -= 1
else:
i -= 1
print("YES" if(j == -1) else "NO")
```
| 3.954
|
459
|
A
|
Pashmak and Garden
|
PROGRAMMING
| 1,200
|
[
"implementation"
] | null | null |
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones.
|
The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct.
|
If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=≤<=*x*3,<=*y*3,<=*x*4,<=*y*4<=≤<=1000).
|
[
"0 0 0 1\n",
"0 0 1 1\n",
"0 0 1 2\n"
] |
[
"1 0 1 1\n",
"0 1 1 0\n",
"-1\n"
] |
none
| 500
|
[
{
"input": "0 0 0 1",
"output": "1 0 1 1"
},
{
"input": "0 0 1 1",
"output": "0 1 1 0"
},
{
"input": "0 0 1 2",
"output": "-1"
},
{
"input": "-100 -100 100 100",
"output": "-100 100 100 -100"
},
{
"input": "-100 -100 99 100",
"output": "-1"
},
{
"input": "0 -100 0 100",
"output": "200 -100 200 100"
},
{
"input": "27 -74 27 74",
"output": "175 -74 175 74"
},
{
"input": "0 1 2 3",
"output": "0 3 2 1"
},
{
"input": "-100 100 100 -100",
"output": "-100 -100 100 100"
},
{
"input": "-100 -100 -100 100",
"output": "100 -100 100 100"
},
{
"input": "100 100 100 -100",
"output": "300 100 300 -100"
},
{
"input": "100 -100 -100 -100",
"output": "100 100 -100 100"
},
{
"input": "-100 100 100 100",
"output": "-100 300 100 300"
},
{
"input": "0 1 0 0",
"output": "1 1 1 0"
},
{
"input": "1 1 0 0",
"output": "1 0 0 1"
},
{
"input": "0 0 1 0",
"output": "0 1 1 1"
},
{
"input": "1 0 0 1",
"output": "1 1 0 0"
},
{
"input": "1 0 1 1",
"output": "2 0 2 1"
},
{
"input": "1 1 0 1",
"output": "1 2 0 2"
},
{
"input": "15 -9 80 -9",
"output": "15 56 80 56"
},
{
"input": "51 -36 18 83",
"output": "-1"
},
{
"input": "69 -22 60 16",
"output": "-1"
},
{
"input": "-68 -78 -45 -55",
"output": "-68 -55 -45 -78"
},
{
"input": "68 -92 8 -32",
"output": "68 -32 8 -92"
},
{
"input": "95 -83 -39 -6",
"output": "-1"
},
{
"input": "54 94 53 -65",
"output": "-1"
},
{
"input": "-92 15 84 15",
"output": "-92 191 84 191"
},
{
"input": "67 77 -11 -1",
"output": "67 -1 -11 77"
},
{
"input": "91 -40 30 21",
"output": "91 21 30 -40"
},
{
"input": "66 -64 -25 -64",
"output": "66 27 -25 27"
},
{
"input": "-42 84 -67 59",
"output": "-42 59 -67 84"
},
{
"input": "73 47 -5 -77",
"output": "-1"
},
{
"input": "6 85 -54 -84",
"output": "-1"
},
{
"input": "-58 -55 40 43",
"output": "-58 43 40 -55"
},
{
"input": "56 22 48 70",
"output": "-1"
},
{
"input": "-17 -32 76 -32",
"output": "-17 61 76 61"
},
{
"input": "0 2 2 0",
"output": "0 0 2 2"
},
{
"input": "0 0 -1 1",
"output": "0 1 -1 0"
},
{
"input": "0 2 1 1",
"output": "0 1 1 2"
},
{
"input": "0 0 1 -1",
"output": "0 -1 1 0"
},
{
"input": "-1 2 -2 3",
"output": "-1 3 -2 2"
},
{
"input": "0 1 1 0",
"output": "0 0 1 1"
},
{
"input": "1 2 2 1",
"output": "1 1 2 2"
},
{
"input": "4 1 2 1",
"output": "4 3 2 3"
},
{
"input": "70 0 0 10",
"output": "-1"
},
{
"input": "2 3 4 1",
"output": "2 1 4 3"
},
{
"input": "1 3 3 1",
"output": "1 1 3 3"
},
{
"input": "-3 3 0 0",
"output": "-3 0 0 3"
},
{
"input": "2 8 7 3",
"output": "2 3 7 8"
},
{
"input": "1 2 2 3",
"output": "1 3 2 2"
},
{
"input": "0 3 3 0",
"output": "0 0 3 3"
},
{
"input": "0 0 -3 3",
"output": "0 3 -3 0"
},
{
"input": "0 2 1 2",
"output": "0 3 1 3"
},
{
"input": "1 1 2 0",
"output": "1 0 2 1"
},
{
"input": "0 0 5 0",
"output": "0 5 5 5"
},
{
"input": "3 4 7 8",
"output": "3 8 7 4"
},
{
"input": "0 5 5 0",
"output": "0 0 5 5"
},
{
"input": "5 6 8 3",
"output": "5 3 8 6"
},
{
"input": "2 2 1 1",
"output": "2 1 1 2"
},
{
"input": "0 1 3 1",
"output": "0 4 3 4"
},
{
"input": "2 4 5 4",
"output": "2 7 5 7"
},
{
"input": "0 5 1 5",
"output": "0 6 1 6"
},
{
"input": "4 0 0 4",
"output": "4 4 0 0"
},
{
"input": "0 1 1 8",
"output": "-1"
},
{
"input": "2 3 3 4",
"output": "2 4 3 3"
},
{
"input": "1 0 2 1",
"output": "1 1 2 0"
},
{
"input": "0 0 2 14",
"output": "-1"
},
{
"input": "0 0 4 3",
"output": "-1"
},
{
"input": "3 5 5 3",
"output": "3 3 5 5"
},
{
"input": "-1 1 1 -1",
"output": "-1 -1 1 1"
},
{
"input": "0 0 2 0",
"output": "0 2 2 2"
},
{
"input": "0 0 1 7",
"output": "-1"
},
{
"input": "1 2 3 2",
"output": "1 4 3 4"
},
{
"input": "1 12 3 10",
"output": "1 10 3 12"
}
] | 1,699,659,670
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
#include <bits/stdc++.h>
using namespace std;
#define sz(v) (int)v.size()
#define ll long long
#define ull unsigned long long
#define mod 1000000007
// Already Broken :)
ll ceill(ll a,ll b){return ((a-1)/b)+1;}
ll modne(ll n){return ((n%mod)+mod)%mod;}
int main() {
ios_base::sync_with_stdio(false);
cout.tie(NULL), cin.tie(NULL);
int t = 1;
//cin >> t;
while (t--) {
int r1,c1,r2,c2; cin>>r1>>c1>>r2>>c2;
if(r1==r2){
int dif=max(c1,c2)-min(c1,c2);
cout<<r1+dif<<' '<<c1<<' '<<r1+dif<<' '<<c2;
}
else if(c1==c2){
int dif=max(r1,r2)-min(r2,r1);
cout<<r1<<' '<<c1+dif<<' '<<r2<<' '<<c1+dif;
}
else {
int d1=max(c1,c2)-min(c2,c1),d2=max(r1,r2)-min(r1,r2);
if(d1==d2)cout<<r1<<' '<<c2<<' '<<r2<<' '<<c1;
else cout<<-1;
}
}
}
|
Title: Pashmak and Garden
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones.
Input Specification:
The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct.
Output Specification:
If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=≤<=*x*3,<=*y*3,<=*x*4,<=*y*4<=≤<=1000).
Demo Input:
['0 0 0 1\n', '0 0 1 1\n', '0 0 1 2\n']
Demo Output:
['1 0 1 1\n', '0 1 1 0\n', '-1\n']
Note:
none
|
```python
#include <bits/stdc++.h>
using namespace std;
#define sz(v) (int)v.size()
#define ll long long
#define ull unsigned long long
#define mod 1000000007
// Already Broken :)
ll ceill(ll a,ll b){return ((a-1)/b)+1;}
ll modne(ll n){return ((n%mod)+mod)%mod;}
int main() {
ios_base::sync_with_stdio(false);
cout.tie(NULL), cin.tie(NULL);
int t = 1;
//cin >> t;
while (t--) {
int r1,c1,r2,c2; cin>>r1>>c1>>r2>>c2;
if(r1==r2){
int dif=max(c1,c2)-min(c1,c2);
cout<<r1+dif<<' '<<c1<<' '<<r1+dif<<' '<<c2;
}
else if(c1==c2){
int dif=max(r1,r2)-min(r2,r1);
cout<<r1<<' '<<c1+dif<<' '<<r2<<' '<<c1+dif;
}
else {
int d1=max(c1,c2)-min(c2,c1),d2=max(r1,r2)-min(r1,r2);
if(d1==d2)cout<<r1<<' '<<c2<<' '<<r2<<' '<<c1;
else cout<<-1;
}
}
}
```
| -1
|
|
623
|
A
|
Graph and String
|
PROGRAMMING
| 1,800
|
[
"constructive algorithms",
"graphs"
] | null | null |
One day student Vasya was sitting on a lecture and mentioned a string *s*1*s*2... *s**n*, consisting of letters "a", "b" and "c" that was written on his desk. As the lecture was boring, Vasya decided to complete the picture by composing a graph *G* with the following properties:
- *G* has exactly *n* vertices, numbered from 1 to *n*. - For all pairs of vertices *i* and *j*, where *i*<=≠<=*j*, there is an edge connecting them if and only if characters *s**i* and *s**j* are either equal or neighbouring in the alphabet. That is, letters in pairs "a"-"b" and "b"-"c" are neighbouring, while letters "a"-"c" are not.
Vasya painted the resulting graph near the string and then erased the string. Next day Vasya's friend Petya came to a lecture and found some graph at his desk. He had heard of Vasya's adventure and now he wants to find out whether it could be the original graph *G*, painted by Vasya. In order to verify this, Petya needs to know whether there exists a string *s*, such that if Vasya used this *s* he would produce the given graph *G*.
|
The first line of the input contains two integers *n* and *m* — the number of vertices and edges in the graph found by Petya, respectively.
Each of the next *m* lines contains two integers *u**i* and *v**i* (1<=≤<=*u**i*,<=*v**i*<=≤<=*n*,<=*u**i*<=≠<=*v**i*) — the edges of the graph *G*. It is guaranteed, that there are no multiple edges, that is any pair of vertexes appear in this list no more than once.
|
In the first line print "Yes" (without the quotes), if the string *s* Petya is interested in really exists and "No" (without the quotes) otherwise.
If the string *s* exists, then print it on the second line of the output. The length of *s* must be exactly *n*, it must consist of only letters "a", "b" and "c" only, and the graph built using this string must coincide with *G*. If there are multiple possible answers, you may print any of them.
|
[
"2 1\n1 2\n",
"4 3\n1 2\n1 3\n1 4\n"
] |
[
"Yes\naa\n",
"No\n"
] |
In the first sample you are given a graph made of two vertices with an edge between them. So, these vertices can correspond to both the same and adjacent letters. Any of the following strings "aa", "ab", "ba", "bb", "bc", "cb", "cc" meets the graph's conditions.
In the second sample the first vertex is connected to all three other vertices, but these three vertices are not connected with each other. That means that they must correspond to distinct letters that are not adjacent, but that is impossible as there are only two such letters: a and c.
| 500
|
[
{
"input": "2 1\n1 2",
"output": "Yes\naa"
},
{
"input": "4 3\n1 2\n1 3\n1 4",
"output": "No"
},
{
"input": "4 4\n1 2\n1 3\n1 4\n3 4",
"output": "Yes\nbacc"
},
{
"input": "1 0",
"output": "Yes\na"
},
{
"input": "8 28\n3 2\n4 2\n7 4\n6 3\n3 7\n8 1\n3 4\n5 1\n6 5\n5 3\n7 1\n5 8\n5 4\n6 1\n6 4\n2 1\n4 1\n8 2\n7 2\n6 8\n8 4\n6 7\n3 1\n7 8\n3 8\n5 7\n5 2\n6 2",
"output": "Yes\naaaaaaaa"
},
{
"input": "8 28\n3 2\n4 2\n7 4\n6 3\n3 7\n8 1\n3 4\n5 1\n6 5\n5 3\n7 1\n5 8\n5 4\n6 1\n6 4\n2 1\n4 1\n8 2\n7 2\n6 8\n8 4\n6 7\n3 1\n7 8\n3 8\n5 7\n5 2\n6 2",
"output": "Yes\naaaaaaaa"
},
{
"input": "4 3\n4 3\n2 4\n2 3",
"output": "Yes\naccc"
},
{
"input": "4 2\n4 3\n1 2",
"output": "Yes\naacc"
},
{
"input": "5 3\n1 2\n1 3\n4 5",
"output": "No"
},
{
"input": "6 4\n1 2\n1 3\n4 5\n4 6",
"output": "No"
},
{
"input": "6 4\n1 2\n2 3\n4 5\n4 6",
"output": "No"
},
{
"input": "6 4\n3 2\n1 3\n6 5\n4 6",
"output": "No"
},
{
"input": "6 4\n1 2\n1 3\n4 6\n5 6",
"output": "No"
},
{
"input": "7 13\n1 2\n2 3\n1 3\n4 5\n5 6\n4 6\n2 5\n2 7\n3 7\n7 4\n7 6\n7 1\n7 5",
"output": "No"
},
{
"input": "8 18\n3 7\n2 5\n5 3\n3 8\n8 6\n6 3\n6 4\n4 8\n1 2\n6 1\n2 7\n2 4\n4 5\n4 3\n6 5\n1 4\n5 7\n3 1",
"output": "No"
},
{
"input": "20 55\n20 11\n14 5\n4 9\n17 5\n16 5\n20 16\n11 17\n2 14\n14 19\n9 15\n20 19\n5 18\n15 20\n1 16\n12 20\n4 7\n16 19\n17 19\n16 12\n19 9\n11 13\n18 17\n10 8\n20 1\n16 8\n1 13\n11 12\n13 18\n4 13\n14 10\n9 13\n8 9\n6 9\n2 13\n10 16\n19 1\n7 17\n20 4\n12 8\n3 2\n18 10\n6 13\n14 9\n7 9\n19 7\n8 15\n20 6\n16 13\n14 13\n19 8\n7 14\n6 2\n9 1\n7 1\n10 6",
"output": "No"
},
{
"input": "15 84\n11 9\n3 11\n13 10\n2 12\n5 9\n1 7\n14 4\n14 2\n14 1\n11 8\n1 8\n14 10\n4 15\n10 5\n5 12\n13 11\n6 14\n5 7\n12 11\n9 1\n10 15\n2 6\n7 15\n14 9\n9 7\n11 14\n8 15\n12 7\n13 6\n2 9\n9 6\n15 3\n12 15\n6 15\n4 6\n4 1\n9 12\n10 7\n6 1\n11 10\n2 3\n5 2\n13 2\n13 3\n12 6\n4 3\n5 8\n12 1\n9 15\n14 5\n12 14\n10 1\n9 4\n7 13\n3 6\n15 1\n13 9\n11 1\n10 4\n9 3\n8 12\n13 12\n6 7\n12 10\n4 12\n13 15\n2 10\n3 8\n1 5\n15 2\n4 11\n2 1\n10 8\n14 3\n14 8\n8 7\n13 1\n5 4\n11 2\n6 8\n5 15\n2 4\n9 8\n9 10",
"output": "No"
},
{
"input": "15 13\n13 15\n13 3\n14 3\n10 7\n2 5\n5 12\n12 11\n9 2\n13 7\n7 4\n12 10\n15 7\n6 13",
"output": "No"
},
{
"input": "6 6\n1 4\n3 4\n6 4\n2 6\n5 3\n3 2",
"output": "No"
},
{
"input": "4 6\n4 2\n3 1\n3 4\n3 2\n4 1\n2 1",
"output": "Yes\naaaa"
},
{
"input": "4 4\n3 2\n2 4\n1 2\n3 4",
"output": "Yes\nabcc"
},
{
"input": "4 3\n1 3\n1 4\n3 4",
"output": "Yes\nacaa"
},
{
"input": "4 4\n1 2\n4 1\n3 4\n3 1",
"output": "Yes\nbacc"
},
{
"input": "4 4\n4 2\n3 4\n3 1\n2 3",
"output": "Yes\nacbc"
},
{
"input": "4 5\n3 1\n2 1\n3 4\n2 4\n3 2",
"output": "Yes\nabbc"
},
{
"input": "4 4\n4 1\n3 1\n3 2\n3 4",
"output": "Yes\nacba"
},
{
"input": "4 5\n3 4\n2 1\n3 1\n4 1\n2 3",
"output": "Yes\nbabc"
},
{
"input": "4 4\n1 3\n3 4\n2 1\n3 2",
"output": "Yes\naabc"
},
{
"input": "4 3\n2 1\n1 4\n2 4",
"output": "Yes\naaca"
},
{
"input": "4 4\n2 4\n1 2\n1 3\n1 4",
"output": "Yes\nbaca"
},
{
"input": "4 2\n3 1\n2 4",
"output": "Yes\nacac"
},
{
"input": "4 4\n4 2\n2 1\n3 2\n1 4",
"output": "Yes\nabca"
},
{
"input": "4 5\n4 1\n2 4\n2 1\n2 3\n3 1",
"output": "Yes\nbbac"
},
{
"input": "4 4\n1 2\n3 1\n2 4\n2 3",
"output": "Yes\nabac"
},
{
"input": "4 2\n2 3\n1 4",
"output": "Yes\nacca"
},
{
"input": "4 4\n2 1\n1 4\n2 3\n3 1",
"output": "Yes\nbaac"
},
{
"input": "4 3\n3 2\n1 2\n1 3",
"output": "Yes\naaac"
},
{
"input": "4 4\n3 2\n2 4\n3 4\n4 1",
"output": "Yes\naccb"
},
{
"input": "4 5\n4 2\n3 2\n4 3\n4 1\n2 1",
"output": "Yes\nabcb"
},
{
"input": "4 4\n3 1\n2 4\n1 4\n3 4",
"output": "Yes\nacab"
},
{
"input": "4 5\n3 1\n4 3\n4 1\n2 1\n2 4",
"output": "Yes\nbacb"
},
{
"input": "4 4\n2 4\n3 4\n1 2\n4 1",
"output": "Yes\naacb"
},
{
"input": "4 5\n1 4\n4 3\n4 2\n3 2\n1 3",
"output": "Yes\nacbb"
},
{
"input": "2 0",
"output": "Yes\nac"
},
{
"input": "3 0",
"output": "No"
},
{
"input": "3 1\n1 2",
"output": "Yes\naac"
},
{
"input": "3 2\n1 2\n3 2",
"output": "Yes\nabc"
},
{
"input": "3 3\n1 2\n1 3\n2 3",
"output": "Yes\naaa"
},
{
"input": "3 1\n2 3",
"output": "Yes\nacc"
},
{
"input": "3 1\n1 3",
"output": "Yes\naca"
},
{
"input": "4 3\n1 2\n2 3\n3 4",
"output": "No"
},
{
"input": "5 9\n4 3\n4 2\n3 1\n5 1\n4 1\n2 1\n5 2\n3 2\n5 4",
"output": "Yes\nbbabc"
},
{
"input": "6 9\n1 4\n1 6\n3 6\n5 4\n2 6\n3 5\n4 6\n1 5\n5 6",
"output": "No"
},
{
"input": "8 21\n4 7\n7 8\n6 4\n8 5\n8 1\n3 4\n4 8\n4 5\n6 7\n6 8\n7 1\n4 2\n1 5\n6 5\n8 2\n3 6\n5 2\n7 5\n1 2\n7 2\n4 1",
"output": "No"
},
{
"input": "4 3\n1 4\n1 3\n2 4",
"output": "No"
},
{
"input": "4 4\n1 3\n1 4\n2 3\n2 4",
"output": "No"
},
{
"input": "4 3\n1 3\n2 4\n3 4",
"output": "No"
},
{
"input": "4 3\n1 3\n2 4\n1 4",
"output": "No"
},
{
"input": "5 6\n1 2\n2 4\n2 5\n3 4\n3 5\n4 5",
"output": "No"
},
{
"input": "6 10\n1 5\n1 4\n3 4\n3 6\n1 2\n3 5\n2 5\n2 6\n1 6\n4 6",
"output": "No"
},
{
"input": "4 3\n1 2\n3 4\n2 3",
"output": "No"
}
] | 1,638,604,530
| 2,147,483,647
|
PyPy 3
|
RUNTIME_ERROR
|
TESTS
| 2
| 77
| 2,150,400
|
n, m = map(int, input().split())
adj_list = [[] for i in range(n+1)]
for i in range(m):
u, v = map(int, input().split())
adj_list[u].append(v)
adj_list[v].append(u)
b_dict = {}
for i in range(1, n+1):
if len(adj_list[i]) == n-1:
b_dict[i] = True
unique_count = {}
for i in range(1, n+1):
if len(adj_list[i]) != n-1:
if len(adj_list[i]) not in unique_count:
unique_count[i] = True
if len(unique_count) > 2:
print('No')
else:
a_dict = {}
c_dict = {}
a_val = -1
c_val = -1
for i in range(1, n+1):
if len(adj_list[i]) != n-1:
if a_val == -1:
a_val = len(adj_list[i])
a_dict[i] = True
elif len(adj_list[i]) == a_val:
a_dict[i] = True
elif c_val == -1:
c_val = len(adj_list[i])
c_dict[i] == True
else:
c_dict[i] = True
ans = []
for i in range(1, n+1):
if i in a_dict:
ans.append('a')
elif i in b_dict:
ans.append('b')
else:
ans.append('c')
print('Yes')
print(''.join(ans))
|
Title: Graph and String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day student Vasya was sitting on a lecture and mentioned a string *s*1*s*2... *s**n*, consisting of letters "a", "b" and "c" that was written on his desk. As the lecture was boring, Vasya decided to complete the picture by composing a graph *G* with the following properties:
- *G* has exactly *n* vertices, numbered from 1 to *n*. - For all pairs of vertices *i* and *j*, where *i*<=≠<=*j*, there is an edge connecting them if and only if characters *s**i* and *s**j* are either equal or neighbouring in the alphabet. That is, letters in pairs "a"-"b" and "b"-"c" are neighbouring, while letters "a"-"c" are not.
Vasya painted the resulting graph near the string and then erased the string. Next day Vasya's friend Petya came to a lecture and found some graph at his desk. He had heard of Vasya's adventure and now he wants to find out whether it could be the original graph *G*, painted by Vasya. In order to verify this, Petya needs to know whether there exists a string *s*, such that if Vasya used this *s* he would produce the given graph *G*.
Input Specification:
The first line of the input contains two integers *n* and *m* — the number of vertices and edges in the graph found by Petya, respectively.
Each of the next *m* lines contains two integers *u**i* and *v**i* (1<=≤<=*u**i*,<=*v**i*<=≤<=*n*,<=*u**i*<=≠<=*v**i*) — the edges of the graph *G*. It is guaranteed, that there are no multiple edges, that is any pair of vertexes appear in this list no more than once.
Output Specification:
In the first line print "Yes" (without the quotes), if the string *s* Petya is interested in really exists and "No" (without the quotes) otherwise.
If the string *s* exists, then print it on the second line of the output. The length of *s* must be exactly *n*, it must consist of only letters "a", "b" and "c" only, and the graph built using this string must coincide with *G*. If there are multiple possible answers, you may print any of them.
Demo Input:
['2 1\n1 2\n', '4 3\n1 2\n1 3\n1 4\n']
Demo Output:
['Yes\naa\n', 'No\n']
Note:
In the first sample you are given a graph made of two vertices with an edge between them. So, these vertices can correspond to both the same and adjacent letters. Any of the following strings "aa", "ab", "ba", "bb", "bc", "cb", "cc" meets the graph's conditions.
In the second sample the first vertex is connected to all three other vertices, but these three vertices are not connected with each other. That means that they must correspond to distinct letters that are not adjacent, but that is impossible as there are only two such letters: a and c.
|
```python
n, m = map(int, input().split())
adj_list = [[] for i in range(n+1)]
for i in range(m):
u, v = map(int, input().split())
adj_list[u].append(v)
adj_list[v].append(u)
b_dict = {}
for i in range(1, n+1):
if len(adj_list[i]) == n-1:
b_dict[i] = True
unique_count = {}
for i in range(1, n+1):
if len(adj_list[i]) != n-1:
if len(adj_list[i]) not in unique_count:
unique_count[i] = True
if len(unique_count) > 2:
print('No')
else:
a_dict = {}
c_dict = {}
a_val = -1
c_val = -1
for i in range(1, n+1):
if len(adj_list[i]) != n-1:
if a_val == -1:
a_val = len(adj_list[i])
a_dict[i] = True
elif len(adj_list[i]) == a_val:
a_dict[i] = True
elif c_val == -1:
c_val = len(adj_list[i])
c_dict[i] == True
else:
c_dict[i] = True
ans = []
for i in range(1, n+1):
if i in a_dict:
ans.append('a')
elif i in b_dict:
ans.append('b')
else:
ans.append('c')
print('Yes')
print(''.join(ans))
```
| -1
|
|
625
|
B
|
War of the Corporations
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms",
"greedy",
"strings"
] | null | null |
A long time ago, in a galaxy far far away two giant IT-corporations Pineapple and Gogol continue their fierce competition. Crucial moment is just around the corner: Gogol is ready to release it's new tablet Lastus 3000.
This new device is equipped with specially designed artificial intelligence (AI). Employees of Pineapple did their best to postpone the release of Lastus 3000 as long as possible. Finally, they found out, that the name of the new artificial intelligence is similar to the name of the phone, that Pineapple released 200 years ago. As all rights on its name belong to Pineapple, they stand on changing the name of Gogol's artificial intelligence.
Pineapple insists, that the name of their phone occurs in the name of AI as a substring. Because the name of technology was already printed on all devices, the Gogol's director decided to replace some characters in AI name with "#". As this operation is pretty expensive, you should find the minimum number of characters to replace with "#", such that the name of AI doesn't contain the name of the phone as a substring.
Substring is a continuous subsequence of a string.
|
The first line of the input contains the name of AI designed by Gogol, its length doesn't exceed 100<=000 characters. Second line contains the name of the phone released by Pineapple 200 years ago, its length doesn't exceed 30. Both string are non-empty and consist of only small English letters.
|
Print the minimum number of characters that must be replaced with "#" in order to obtain that the name of the phone doesn't occur in the name of AI as a substring.
|
[
"intellect\ntell\n",
"google\napple\n",
"sirisiri\nsir\n"
] |
[
"1",
"0",
"2"
] |
In the first sample AI's name may be replaced with "int#llect".
In the second sample Gogol can just keep things as they are.
In the third sample one of the new possible names of AI may be "s#ris#ri".
| 750
|
[
{
"input": "intellect\ntell",
"output": "1"
},
{
"input": "google\napple",
"output": "0"
},
{
"input": "sirisiri\nsir",
"output": "2"
},
{
"input": "sirisiri\nsiri",
"output": "2"
},
{
"input": "aaaaaaa\naaaa",
"output": "1"
},
{
"input": "bbbbbb\nbb",
"output": "3"
},
{
"input": "abc\nabcabc",
"output": "0"
},
{
"input": "kek\nkekekek",
"output": "0"
},
{
"input": "aaaaa\naaa",
"output": "1"
},
{
"input": "abcdabcv\nabcd",
"output": "1"
},
{
"input": "abcabcabczabcabcabcz\ncab",
"output": "4"
},
{
"input": "aatopotopotopotaa\ntopot",
"output": "2"
},
{
"input": "abcabcabcabcabcabcabcabcabcabc\nabcabcabcabcabcabcabcabcabcabc",
"output": "1"
},
{
"input": "sosossosos\nsos",
"output": "2"
},
{
"input": "sosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosos\nsos",
"output": "20"
},
{
"input": "tatatx\ntatx",
"output": "1"
},
{
"input": "sxxsxxsxxd\nsxxsxxd",
"output": "1"
}
] | 1,604,069,611
| 1,111
|
PyPy 3
|
OK
|
TESTS
| 56
| 155
| 512,000
|
s1=str(input())
s2=str(input())
ans=s1.count(s2)
print(ans)
|
Title: War of the Corporations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A long time ago, in a galaxy far far away two giant IT-corporations Pineapple and Gogol continue their fierce competition. Crucial moment is just around the corner: Gogol is ready to release it's new tablet Lastus 3000.
This new device is equipped with specially designed artificial intelligence (AI). Employees of Pineapple did their best to postpone the release of Lastus 3000 as long as possible. Finally, they found out, that the name of the new artificial intelligence is similar to the name of the phone, that Pineapple released 200 years ago. As all rights on its name belong to Pineapple, they stand on changing the name of Gogol's artificial intelligence.
Pineapple insists, that the name of their phone occurs in the name of AI as a substring. Because the name of technology was already printed on all devices, the Gogol's director decided to replace some characters in AI name with "#". As this operation is pretty expensive, you should find the minimum number of characters to replace with "#", such that the name of AI doesn't contain the name of the phone as a substring.
Substring is a continuous subsequence of a string.
Input Specification:
The first line of the input contains the name of AI designed by Gogol, its length doesn't exceed 100<=000 characters. Second line contains the name of the phone released by Pineapple 200 years ago, its length doesn't exceed 30. Both string are non-empty and consist of only small English letters.
Output Specification:
Print the minimum number of characters that must be replaced with "#" in order to obtain that the name of the phone doesn't occur in the name of AI as a substring.
Demo Input:
['intellect\ntell\n', 'google\napple\n', 'sirisiri\nsir\n']
Demo Output:
['1', '0', '2']
Note:
In the first sample AI's name may be replaced with "int#llect".
In the second sample Gogol can just keep things as they are.
In the third sample one of the new possible names of AI may be "s#ris#ri".
|
```python
s1=str(input())
s2=str(input())
ans=s1.count(s2)
print(ans)
```
| 3
|
|
43
|
A
|
Football
|
PROGRAMMING
| 1,000
|
[
"strings"
] |
A. Football
|
2
|
256
|
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
|
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
|
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
|
[
"1\nABC\n",
"5\nA\nABA\nABA\nA\nA\n"
] |
[
"ABC\n",
"A\n"
] |
none
| 500
|
[
{
"input": "1\nABC",
"output": "ABC"
},
{
"input": "5\nA\nABA\nABA\nA\nA",
"output": "A"
},
{
"input": "2\nXTSJEP\nXTSJEP",
"output": "XTSJEP"
},
{
"input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ",
"output": "XZYDJAEDZ"
},
{
"input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD",
"output": "QCCYXL"
},
{
"input": "3\nAZID\nEERWBC\nEERWBC",
"output": "EERWBC"
},
{
"input": "3\nHNCGYL\nHNCGYL\nHNCGYL",
"output": "HNCGYL"
},
{
"input": "4\nZZWZTG\nZZWZTG\nZZWZTG\nZZWZTG",
"output": "ZZWZTG"
},
{
"input": "4\nA\nA\nKUDLJMXCSE\nA",
"output": "A"
},
{
"input": "5\nPHBTW\nPHBTW\nPHBTW\nPHBTW\nPHBTW",
"output": "PHBTW"
},
{
"input": "5\nPKUZYTFYWN\nPKUZYTFYWN\nSTC\nPKUZYTFYWN\nPKUZYTFYWN",
"output": "PKUZYTFYWN"
},
{
"input": "5\nHH\nHH\nNTQWPA\nNTQWPA\nHH",
"output": "HH"
},
{
"input": "10\nW\nW\nW\nW\nW\nD\nW\nD\nD\nW",
"output": "W"
},
{
"input": "19\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nTGACNIH\nTGACNIH\nXBCP",
"output": "XBCP"
},
{
"input": "33\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS",
"output": "PYPAS"
},
{
"input": "51\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC",
"output": "NC"
},
{
"input": "89\nH\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nVOCI\nVOCI\nH\nH\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nH\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI",
"output": "VOCI"
},
{
"input": "100\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nM\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA",
"output": "HA"
},
{
"input": "100\nG\nG\nS\nS\nG\nG\nS\nS\nG\nS\nS\nS\nG\nS\nG\nG\nS\nG\nS\nS\nG\nS\nS\nS\nS\nS\nG\nS\nG\nS\nS\nG\nG\nG\nS\nS\nS\nS\nG\nS\nS\nG\nG\nG\nG\nG\nS\nG\nG\nS\nS\nS\nS\nS\nG\nG\nS\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nS\nS\nG\nS\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nG\nG\nS\nG\nG\nG\nS",
"output": "G"
},
{
"input": "100\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nOBH\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL",
"output": "WL"
}
] | 1,554,990,286
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 218
| 0
|
num = int(input())
lst = []
for i in range(num):
komanda = input()
lst.append(komanda)
set_lst = set(lst)
spisok = list(set_lst)
if len(spisok) == 1:
print(spisok[0])
else:
if lst.count(spisok[0]) > lst.count(spisok[1]):
print(spisok[0])
else:
print(spisok[1])
|
Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Output Specification:
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
Demo Input:
['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n']
Demo Output:
['ABC\n', 'A\n']
Note:
none
|
```python
num = int(input())
lst = []
for i in range(num):
komanda = input()
lst.append(komanda)
set_lst = set(lst)
spisok = list(set_lst)
if len(spisok) == 1:
print(spisok[0])
else:
if lst.count(spisok[0]) > lst.count(spisok[1]):
print(spisok[0])
else:
print(spisok[1])
```
| 3.9455
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,596,824,609
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 154
| 6,656,000
|
a=input()
if a>='a' and a<='z' and len(a)<100:
a=(a.lower())
else:
a=(a.upper())
print(a)
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
a=input()
if a>='a' and a<='z' and len(a)<100:
a=(a.lower())
else:
a=(a.upper())
print(a)
```
| 0
|
157
|
B
|
Trace
|
PROGRAMMING
| 1,000
|
[
"geometry",
"sortings"
] | null | null |
One day, as Sherlock Holmes was tracking down one very important criminal, he found a wonderful painting on the wall. This wall could be represented as a plane. The painting had several concentric circles that divided the wall into several parts. Some parts were painted red and all the other were painted blue. Besides, any two neighboring parts were painted different colors, that is, the red and the blue color were alternating, i. e. followed one after the other. The outer area of the wall (the area that lied outside all circles) was painted blue. Help Sherlock Holmes determine the total area of red parts of the wall.
Let us remind you that two circles are called concentric if their centers coincide. Several circles are called concentric if any two of them are concentric.
|
The first line contains the single integer *n* (1<=≤<=*n*<=≤<=100). The second line contains *n* space-separated integers *r**i* (1<=≤<=*r**i*<=≤<=1000) — the circles' radii. It is guaranteed that all circles are different.
|
Print the single real number — total area of the part of the wall that is painted red. The answer is accepted if absolute or relative error doesn't exceed 10<=-<=4.
|
[
"1\n1\n",
"3\n1 4 2\n"
] |
[
"3.1415926536\n",
"40.8407044967\n"
] |
In the first sample the picture is just one circle of radius 1. Inner part of the circle is painted red. The area of the red part equals π × 1<sup class="upper-index">2</sup> = π.
In the second sample there are three circles of radii 1, 4 and 2. Outside part of the second circle is painted blue. Part between the second and the third circles is painted red. Part between the first and the third is painted blue. And, finally, the inner part of the first circle is painted red. Overall there are two red parts: the ring between the second and the third circles and the inner part of the first circle. Total area of the red parts is equal (π × 4<sup class="upper-index">2</sup> - π × 2<sup class="upper-index">2</sup>) + π × 1<sup class="upper-index">2</sup> = π × 12 + π = 13π
| 1,000
|
[
{
"input": "1\n1",
"output": "3.1415926536"
},
{
"input": "3\n1 4 2",
"output": "40.8407044967"
},
{
"input": "4\n4 1 3 2",
"output": "31.4159265359"
},
{
"input": "4\n100 10 2 1",
"output": "31111.1920484997"
},
{
"input": "10\n10 9 8 7 6 5 4 3 2 1",
"output": "172.7875959474"
},
{
"input": "1\n1000",
"output": "3141592.6535897931"
},
{
"input": "8\n8 1 7 2 6 3 5 4",
"output": "113.0973355292"
},
{
"input": "100\n1000 999 998 997 996 995 994 993 992 991 990 989 988 987 986 985 984 983 982 981 980 979 978 977 976 975 974 973 972 971 970 969 968 967 966 965 964 963 962 961 960 959 958 957 956 955 954 953 952 951 950 949 948 947 946 945 944 943 942 941 940 939 938 937 936 935 934 933 932 931 930 929 928 927 926 925 924 923 922 921 920 919 918 917 916 915 914 913 912 911 910 909 908 907 906 905 904 903 902 901",
"output": "298608.3817237098"
},
{
"input": "6\n109 683 214 392 678 10",
"output": "397266.9574170437"
},
{
"input": "2\n151 400",
"output": "431023.3704798660"
},
{
"input": "6\n258 877 696 425 663 934",
"output": "823521.3902487604"
},
{
"input": "9\n635 707 108 234 52 180 910 203 782",
"output": "1100144.9065826489"
},
{
"input": "8\n885 879 891 428 522 176 135 983",
"output": "895488.9947571954"
},
{
"input": "3\n269 918 721",
"output": "1241695.6467754442"
},
{
"input": "7\n920 570 681 428 866 935 795",
"output": "1469640.1849419588"
},
{
"input": "2\n517 331",
"output": "495517.1260654109"
},
{
"input": "2\n457 898",
"output": "1877274.3981158488"
},
{
"input": "8\n872 704 973 612 183 274 739 253",
"output": "1780774.0965755312"
},
{
"input": "74\n652 446 173 457 760 847 670 25 196 775 998 279 656 809 883 148 969 884 792 502 641 800 663 938 362 339 545 608 107 184 834 666 149 458 864 72 199 658 618 987 126 723 806 643 689 958 626 904 944 415 427 498 628 331 636 261 281 276 478 220 513 595 510 384 354 561 469 462 799 449 747 109 903 456",
"output": "1510006.5089479341"
},
{
"input": "76\n986 504 673 158 87 332 124 218 714 235 212 122 878 370 938 81 686 323 386 348 410 468 875 107 50 960 82 834 234 663 651 422 794 633 294 771 945 607 146 913 950 858 297 88 882 725 247 872 645 749 799 987 115 394 380 382 971 429 593 426 652 353 351 233 868 598 889 116 71 376 916 464 414 976 138 903",
"output": "1528494.7817143100"
},
{
"input": "70\n12 347 748 962 514 686 192 159 990 4 10 788 602 542 946 215 523 727 799 717 955 796 529 465 897 103 181 515 495 153 710 179 747 145 16 585 943 998 923 708 156 399 770 547 775 285 9 68 713 722 570 143 913 416 663 624 925 218 64 237 797 138 942 213 188 818 780 840 480 758",
"output": "1741821.4892636713"
},
{
"input": "26\n656 508 45 189 561 366 96 486 547 386 703 570 780 689 264 26 11 74 466 76 421 48 982 886 215 650",
"output": "1818821.9252031571"
},
{
"input": "52\n270 658 808 249 293 707 700 78 791 167 92 772 807 502 830 991 945 102 968 376 556 578 326 980 688 368 280 853 646 256 666 638 424 737 321 996 925 405 199 680 953 541 716 481 727 143 577 919 892 355 346 298",
"output": "1272941.9273080483"
},
{
"input": "77\n482 532 200 748 692 697 171 863 586 547 301 149 326 812 147 698 303 691 527 805 681 387 619 947 598 453 167 799 840 508 893 688 643 974 998 341 804 230 538 669 271 404 477 759 943 596 949 235 880 160 151 660 832 82 969 539 708 889 258 81 224 655 790 144 462 582 646 256 445 52 456 920 67 819 631 484 534",
"output": "2045673.1891262225"
},
{
"input": "27\n167 464 924 575 775 97 944 390 297 315 668 296 533 829 851 406 702 366 848 512 71 197 321 900 544 529 116",
"output": "1573959.9105970615"
},
{
"input": "38\n488 830 887 566 720 267 583 102 65 200 884 220 263 858 510 481 316 804 754 568 412 166 374 869 356 977 145 421 500 58 664 252 745 70 381 927 670 772",
"output": "1479184.3434235646"
},
{
"input": "64\n591 387 732 260 840 397 563 136 571 876 831 953 799 493 579 13 559 872 53 678 256 232 969 993 847 14 837 365 547 997 604 199 834 529 306 443 739 49 19 276 343 835 904 588 900 870 439 576 975 955 518 117 131 347 800 83 432 882 869 709 32 950 314 450",
"output": "1258248.6984672088"
},
{
"input": "37\n280 281 169 68 249 389 977 101 360 43 448 447 368 496 125 507 747 392 338 270 916 150 929 428 118 266 589 470 774 852 263 644 187 817 808 58 637",
"output": "1495219.0323274869"
},
{
"input": "97\n768 569 306 968 437 779 227 561 412 60 44 807 234 645 169 858 580 396 343 145 842 723 416 80 456 247 81 150 297 116 760 964 312 558 101 850 549 650 299 868 121 435 579 705 118 424 302 812 970 397 659 565 916 183 933 459 6 593 518 717 326 305 744 470 75 981 824 221 294 324 194 293 251 446 481 215 338 861 528 829 921 945 540 89 450 178 24 460 990 392 148 219 934 615 932 340 937",
"output": "1577239.7333274092"
},
{
"input": "94\n145 703 874 425 277 652 239 496 458 658 339 842 564 699 893 352 625 980 432 121 798 872 499 859 850 721 414 825 543 843 304 111 342 45 219 311 50 748 465 902 781 822 504 985 919 656 280 310 917 438 464 527 491 713 906 329 635 777 223 810 501 535 156 252 806 112 971 719 103 443 165 98 579 554 244 996 221 560 301 51 977 422 314 858 528 772 448 626 185 194 536 66 577 677",
"output": "1624269.3753516484"
},
{
"input": "97\n976 166 649 81 611 927 480 231 998 711 874 91 969 521 531 414 993 790 317 981 9 261 437 332 173 573 904 777 882 990 658 878 965 64 870 896 271 732 431 53 761 943 418 602 708 949 930 130 512 240 363 458 673 319 131 784 224 48 919 126 208 212 911 59 677 535 450 273 479 423 79 807 336 18 72 290 724 28 123 605 287 228 350 897 250 392 885 655 746 417 643 114 813 378 355 635 905",
"output": "1615601.7212203942"
},
{
"input": "91\n493 996 842 9 748 178 1 807 841 519 796 998 84 670 778 143 707 208 165 893 154 943 336 150 761 881 434 112 833 55 412 682 552 945 758 189 209 600 354 325 440 844 410 20 136 665 88 791 688 17 539 821 133 236 94 606 483 446 429 60 960 476 915 134 137 852 754 908 276 482 117 252 297 903 981 203 829 811 471 135 188 667 710 393 370 302 874 872 551 457 692",
"output": "1806742.5014501044"
},
{
"input": "95\n936 736 17 967 229 607 589 291 242 244 29 698 800 566 630 667 90 416 11 94 812 838 668 520 678 111 490 823 199 973 681 676 683 721 262 896 682 713 402 691 874 44 95 704 56 322 822 887 639 433 406 35 988 61 176 496 501 947 440 384 372 959 577 370 754 802 1 945 427 116 746 408 308 391 397 730 493 183 203 871 831 862 461 565 310 344 504 378 785 137 279 123 475 138 415",
"output": "1611115.5269110680"
},
{
"input": "90\n643 197 42 218 582 27 66 704 195 445 641 675 285 639 503 686 242 327 57 955 848 287 819 992 756 749 363 48 648 736 580 117 752 921 923 372 114 313 202 337 64 497 399 25 883 331 24 871 917 8 517 486 323 529 325 92 891 406 864 402 263 773 931 253 625 31 17 271 140 131 232 586 893 525 846 54 294 562 600 801 214 55 768 683 389 738 314 284 328 804",
"output": "1569819.2914796301"
},
{
"input": "98\n29 211 984 75 333 96 840 21 352 168 332 433 130 944 215 210 620 442 363 877 91 491 513 955 53 82 351 19 998 706 702 738 770 453 344 117 893 590 723 662 757 16 87 546 312 669 568 931 224 374 927 225 751 962 651 587 361 250 256 240 282 600 95 64 384 589 813 783 39 918 412 648 506 283 886 926 443 173 946 241 310 33 622 565 261 360 547 339 943 367 354 25 479 743 385 485 896 741",
"output": "2042921.1539616778"
},
{
"input": "93\n957 395 826 67 185 4 455 880 683 654 463 84 258 878 553 592 124 585 9 133 20 609 43 452 725 125 801 537 700 685 771 155 566 376 19 690 383 352 174 208 177 416 304 1000 533 481 87 509 358 233 681 22 507 659 36 859 952 259 138 271 594 779 576 782 119 69 608 758 283 616 640 523 710 751 34 106 774 92 874 568 864 660 998 992 474 679 180 409 15 297 990 689 501",
"output": "1310703.8710041976"
},
{
"input": "97\n70 611 20 30 904 636 583 262 255 501 604 660 212 128 199 138 545 576 506 528 12 410 77 888 783 972 431 188 338 485 148 793 907 678 281 922 976 680 252 724 253 920 177 361 721 798 960 572 99 622 712 466 608 49 612 345 266 751 63 594 40 695 532 789 520 930 825 929 48 59 405 135 109 735 508 186 495 772 375 587 201 324 447 610 230 947 855 318 856 956 313 810 931 175 668 183 688",
"output": "1686117.9099228707"
},
{
"input": "96\n292 235 391 180 840 172 218 997 166 287 329 20 886 325 400 471 182 356 448 337 417 319 58 106 366 764 393 614 90 831 924 314 667 532 64 874 3 434 350 352 733 795 78 640 967 63 47 879 635 272 145 569 468 792 153 761 770 878 281 467 209 208 298 37 700 18 334 93 5 750 412 779 523 517 360 649 447 328 311 653 57 578 767 460 647 663 50 670 151 13 511 580 625 907 227 89",
"output": "1419726.5608617242"
},
{
"input": "100\n469 399 735 925 62 153 707 723 819 529 200 624 57 708 245 384 889 11 639 638 260 419 8 142 403 298 204 169 887 388 241 983 885 267 643 943 417 237 452 562 6 839 149 742 832 896 100 831 712 754 679 743 135 222 445 680 210 955 220 63 960 487 514 824 481 584 441 997 795 290 10 45 510 678 844 503 407 945 850 84 858 934 500 320 936 663 736 592 161 670 606 465 864 969 293 863 868 393 899 744",
"output": "1556458.0979239127"
},
{
"input": "100\n321 200 758 415 190 710 920 992 873 898 814 259 359 66 971 210 838 545 663 652 684 277 36 756 963 459 335 484 462 982 532 423 131 703 307 229 391 938 253 847 542 975 635 928 220 980 222 567 557 181 366 824 900 180 107 979 112 564 525 413 300 422 876 615 737 343 902 8 654 628 469 913 967 785 893 314 909 215 912 262 20 709 363 915 997 954 986 454 596 124 74 159 660 550 787 418 895 786 293 50",
"output": "1775109.8050211088"
},
{
"input": "100\n859 113 290 762 701 63 188 431 810 485 671 673 99 658 194 227 511 435 941 212 551 124 89 222 42 321 657 815 898 171 216 482 707 567 724 491 414 942 820 351 48 653 685 312 586 24 20 627 602 498 533 173 463 262 621 466 119 299 580 964 510 987 40 698 521 998 847 651 746 215 808 563 785 837 631 772 404 923 682 244 232 214 390 350 968 771 517 900 70 543 934 554 681 368 642 575 891 728 478 317",
"output": "1447969.4788174964"
},
{
"input": "100\n941 283 349 457 52 837 299 284 796 305 893 624 101 972 738 204 121 70 17 704 836 791 95 111 162 952 472 724 733 580 878 177 705 804 11 211 463 417 288 409 410 485 896 755 921 267 164 656 505 765 539 439 535 19 991 689 220 474 114 944 884 144 926 849 486 566 117 35 749 499 797 303 362 905 690 890 976 66 590 183 234 683 39 297 769 787 376 541 571 759 495 200 261 352 73 493 831 442 273 339",
"output": "1597889.4218394549"
},
{
"input": "100\n110 868 147 888 291 282 916 542 917 337 235 595 498 621 814 249 261 713 445 666 142 275 319 49 900 543 333 606 487 670 620 769 852 258 230 867 603 491 714 839 879 37 21 74 590 190 397 506 499 967 152 862 200 107 145 23 614 167 857 475 79 598 270 906 626 116 89 59 651 846 723 201 50 699 522 408 634 132 226 414 824 764 513 586 526 238 556 162 667 173 684 415 527 743 10 442 552 274 350 822",
"output": "1567230.6191330721"
},
{
"input": "100\n901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000",
"output": "298608.3817237098"
}
] | 1,629,811,328
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 44
| 154
| 6,963,200
|
n=int(input())
l=list(map(int,input().split()))
l.sort()
pi=3.1415926536
area=[l[0]**2]
for i in range(1,n):
area.append(l[i]**2-l[i-1]**2)
ans=0
#print(l,area)
if n%2==1:
for i in range(0,n,2):
ans+=area[i]
#print(ans,area[i])
else:
for i in range(1,n,2):
ans+=area[i]
print(ans*pi)
|
Title: Trace
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day, as Sherlock Holmes was tracking down one very important criminal, he found a wonderful painting on the wall. This wall could be represented as a plane. The painting had several concentric circles that divided the wall into several parts. Some parts were painted red and all the other were painted blue. Besides, any two neighboring parts were painted different colors, that is, the red and the blue color were alternating, i. e. followed one after the other. The outer area of the wall (the area that lied outside all circles) was painted blue. Help Sherlock Holmes determine the total area of red parts of the wall.
Let us remind you that two circles are called concentric if their centers coincide. Several circles are called concentric if any two of them are concentric.
Input Specification:
The first line contains the single integer *n* (1<=≤<=*n*<=≤<=100). The second line contains *n* space-separated integers *r**i* (1<=≤<=*r**i*<=≤<=1000) — the circles' radii. It is guaranteed that all circles are different.
Output Specification:
Print the single real number — total area of the part of the wall that is painted red. The answer is accepted if absolute or relative error doesn't exceed 10<=-<=4.
Demo Input:
['1\n1\n', '3\n1 4 2\n']
Demo Output:
['3.1415926536\n', '40.8407044967\n']
Note:
In the first sample the picture is just one circle of radius 1. Inner part of the circle is painted red. The area of the red part equals π × 1<sup class="upper-index">2</sup> = π.
In the second sample there are three circles of radii 1, 4 and 2. Outside part of the second circle is painted blue. Part between the second and the third circles is painted red. Part between the first and the third is painted blue. And, finally, the inner part of the first circle is painted red. Overall there are two red parts: the ring between the second and the third circles and the inner part of the first circle. Total area of the red parts is equal (π × 4<sup class="upper-index">2</sup> - π × 2<sup class="upper-index">2</sup>) + π × 1<sup class="upper-index">2</sup> = π × 12 + π = 13π
|
```python
n=int(input())
l=list(map(int,input().split()))
l.sort()
pi=3.1415926536
area=[l[0]**2]
for i in range(1,n):
area.append(l[i]**2-l[i-1]**2)
ans=0
#print(l,area)
if n%2==1:
for i in range(0,n,2):
ans+=area[i]
#print(ans,area[i])
else:
for i in range(1,n,2):
ans+=area[i]
print(ans*pi)
```
| 3
|
|
689
|
C
|
Mike and Chocolate Thieves
|
PROGRAMMING
| 1,700
|
[
"binary search",
"combinatorics",
"math"
] | null | null |
Bad news came to Mike's village, some thieves stole a bunch of chocolates from the local factory! Horrible!
Aside from loving sweet things, thieves from this area are known to be very greedy. So after a thief takes his number of chocolates for himself, the next thief will take exactly *k* times more than the previous one. The value of *k* (*k*<=><=1) is a secret integer known only to them. It is also known that each thief's bag can carry at most *n* chocolates (if they intend to take more, the deal is cancelled) and that there were exactly four thieves involved.
Sadly, only the thieves know the value of *n*, but rumours say that the numbers of ways they could have taken the chocolates (for a fixed *n*, but not fixed *k*) is *m*. Two ways are considered different if one of the thieves (they should be numbered in the order they take chocolates) took different number of chocolates in them.
Mike want to track the thieves down, so he wants to know what their bags are and value of *n* will help him in that. Please find the smallest possible value of *n* or tell him that the rumors are false and there is no such *n*.
|
The single line of input contains the integer *m* (1<=≤<=*m*<=≤<=1015) — the number of ways the thieves might steal the chocolates, as rumours say.
|
Print the only integer *n* — the maximum amount of chocolates that thieves' bags can carry. If there are more than one *n* satisfying the rumors, print the smallest one.
If there is no such *n* for a false-rumoured *m*, print <=-<=1.
|
[
"1\n",
"8\n",
"10\n"
] |
[
"8\n",
"54\n",
"-1\n"
] |
In the first sample case the smallest *n* that leads to exactly one way of stealing chocolates is *n* = 8, whereas the amounts of stealed chocolates are (1, 2, 4, 8) (the number of chocolates stolen by each of the thieves).
In the second sample case the smallest *n* that leads to exactly 8 ways is *n* = 54 with the possibilities: (1, 2, 4, 8), (1, 3, 9, 27), (2, 4, 8, 16), (2, 6, 18, 54), (3, 6, 12, 24), (4, 8, 16, 32), (5, 10, 20, 40), (6, 12, 24, 48).
There is no *n* leading to exactly 10 ways of stealing chocolates in the third sample case.
| 1,500
|
[
{
"input": "1",
"output": "8"
},
{
"input": "8",
"output": "54"
},
{
"input": "10",
"output": "-1"
},
{
"input": "27",
"output": "152"
},
{
"input": "28206",
"output": "139840"
},
{
"input": "32",
"output": "184"
},
{
"input": "115",
"output": "608"
},
{
"input": "81258",
"output": "402496"
},
{
"input": "116003",
"output": "574506"
},
{
"input": "149344197",
"output": "739123875"
},
{
"input": "57857854",
"output": "286347520"
},
{
"input": "999999999999999",
"output": "-1"
},
{
"input": "181023403153",
"output": "895903132760"
},
{
"input": "196071196742",
"output": "970376182648"
},
{
"input": "49729446417673",
"output": "246116048009288"
},
{
"input": "14821870173923",
"output": "73354931125416"
},
{
"input": "29031595887308",
"output": "143680297402952"
},
{
"input": "195980601490039",
"output": "969927770453672"
},
{
"input": "181076658641313",
"output": "896166653569800"
},
{
"input": "166173583620704",
"output": "822409831653228"
},
{
"input": "151269640772354",
"output": "748648714769352"
},
{
"input": "136366565751970",
"output": "674891892852776"
},
{
"input": "121463490731834",
"output": "601135070936200"
},
{
"input": "106559547884220",
"output": "527373954052328"
},
{
"input": "91656472864718",
"output": "453617132135750"
},
{
"input": "184061307002930",
"output": "910937979445720"
},
{
"input": "57857853",
"output": "-1"
},
{
"input": "1000000000000000",
"output": "4949100894494448"
},
{
"input": "375402146575334",
"output": "-1"
},
{
"input": "550368702711851",
"output": "-1"
},
{
"input": "645093839227897",
"output": "-1"
},
{
"input": "431",
"output": "-1"
},
{
"input": "99999",
"output": "-1"
},
{
"input": "2",
"output": "16"
},
{
"input": "3",
"output": "24"
},
{
"input": "4",
"output": "27"
},
{
"input": "5",
"output": "32"
},
{
"input": "6",
"output": "40"
},
{
"input": "7",
"output": "48"
},
{
"input": "13",
"output": "80"
},
{
"input": "999999999999998",
"output": "-1"
},
{
"input": "999999999999997",
"output": "4949100894494440"
},
{
"input": "999999999999996",
"output": "4949100894494432"
},
{
"input": "999999999999995",
"output": "4949100894494424"
},
{
"input": "999999999999993",
"output": "4949100894494416"
},
{
"input": "999999999999991",
"output": "4949100894494400"
},
{
"input": "999999999999992",
"output": "4949100894494408"
},
{
"input": "999999999999994",
"output": "4949100894494421"
},
{
"input": "4235246",
"output": "-1"
},
{
"input": "34",
"output": "-1"
},
{
"input": "998749999999991",
"output": "4942914518376840"
},
{
"input": "999999874999991",
"output": "4949100275856792"
},
{
"input": "987654129875642",
"output": "4887999937625136"
},
{
"input": "237648237648000",
"output": "1176145105832192"
}
] | 1,678,376,921
| 1,421
|
PyPy 3-64
|
OK
|
TESTS
| 54
| 811
| 10,035,200
|
import sys, os, io
input = io.BytesIO(os.read(0, os.fstat(0).st_size)).readline
def binary_search(c1, c2):
c = (c1 + c2 + 1) // 2
while abs(c1 - c2) > 1:
c = (c1 + c2 + 1) // 2
if ok(c):
c2 = c
else:
c1 = c
c = max(c - 1, 0)
while not ok(c):
c += 1
return c
def ok(c):
u = 0
for i in p:
u += c // i
return True if u >= m else False
m = int(input())
p = [pow(i, 3) for i in range(2, pow(10, 6) + 5)]
n = binary_search(0, pow(10, 18) + 5)
u = 0
for i in p:
u += n // i
if u ^ m:
n = -1
print(n)
|
Title: Mike and Chocolate Thieves
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bad news came to Mike's village, some thieves stole a bunch of chocolates from the local factory! Horrible!
Aside from loving sweet things, thieves from this area are known to be very greedy. So after a thief takes his number of chocolates for himself, the next thief will take exactly *k* times more than the previous one. The value of *k* (*k*<=><=1) is a secret integer known only to them. It is also known that each thief's bag can carry at most *n* chocolates (if they intend to take more, the deal is cancelled) and that there were exactly four thieves involved.
Sadly, only the thieves know the value of *n*, but rumours say that the numbers of ways they could have taken the chocolates (for a fixed *n*, but not fixed *k*) is *m*. Two ways are considered different if one of the thieves (they should be numbered in the order they take chocolates) took different number of chocolates in them.
Mike want to track the thieves down, so he wants to know what their bags are and value of *n* will help him in that. Please find the smallest possible value of *n* or tell him that the rumors are false and there is no such *n*.
Input Specification:
The single line of input contains the integer *m* (1<=≤<=*m*<=≤<=1015) — the number of ways the thieves might steal the chocolates, as rumours say.
Output Specification:
Print the only integer *n* — the maximum amount of chocolates that thieves' bags can carry. If there are more than one *n* satisfying the rumors, print the smallest one.
If there is no such *n* for a false-rumoured *m*, print <=-<=1.
Demo Input:
['1\n', '8\n', '10\n']
Demo Output:
['8\n', '54\n', '-1\n']
Note:
In the first sample case the smallest *n* that leads to exactly one way of stealing chocolates is *n* = 8, whereas the amounts of stealed chocolates are (1, 2, 4, 8) (the number of chocolates stolen by each of the thieves).
In the second sample case the smallest *n* that leads to exactly 8 ways is *n* = 54 with the possibilities: (1, 2, 4, 8), (1, 3, 9, 27), (2, 4, 8, 16), (2, 6, 18, 54), (3, 6, 12, 24), (4, 8, 16, 32), (5, 10, 20, 40), (6, 12, 24, 48).
There is no *n* leading to exactly 10 ways of stealing chocolates in the third sample case.
|
```python
import sys, os, io
input = io.BytesIO(os.read(0, os.fstat(0).st_size)).readline
def binary_search(c1, c2):
c = (c1 + c2 + 1) // 2
while abs(c1 - c2) > 1:
c = (c1 + c2 + 1) // 2
if ok(c):
c2 = c
else:
c1 = c
c = max(c - 1, 0)
while not ok(c):
c += 1
return c
def ok(c):
u = 0
for i in p:
u += c // i
return True if u >= m else False
m = int(input())
p = [pow(i, 3) for i in range(2, pow(10, 6) + 5)]
n = binary_search(0, pow(10, 18) + 5)
u = 0
for i in p:
u += n // i
if u ^ m:
n = -1
print(n)
```
| 3
|
|
844
|
A
|
Diversity
|
PROGRAMMING
| 1,000
|
[
"greedy",
"implementation",
"strings"
] | null | null |
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
|
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
|
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
|
[
"yandex\n6\n",
"yahoo\n5\n",
"google\n7\n"
] |
[
"0\n",
"1\n",
"impossible\n"
] |
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
| 500
|
[
{
"input": "yandex\n6",
"output": "0"
},
{
"input": "yahoo\n5",
"output": "1"
},
{
"input": "google\n7",
"output": "impossible"
},
{
"input": "a\n1",
"output": "0"
},
{
"input": "z\n2",
"output": "impossible"
},
{
"input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26",
"output": "14"
},
{
"input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26",
"output": "12"
},
{
"input": "a\n3",
"output": "impossible"
},
{
"input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1",
"output": "0"
},
{
"input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4",
"output": "1"
},
{
"input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20",
"output": "18"
},
{
"input": "swmkwaruyv\n5",
"output": "0"
},
{
"input": "tnbqpsuhkczmejirvyfdolxwga\n22",
"output": "0"
},
{
"input": "abcde\n3",
"output": "0"
},
{
"input": "abb\n1",
"output": "0"
},
{
"input": "aaaa\n1",
"output": "0"
},
{
"input": "abcde\n2",
"output": "0"
},
{
"input": "yandex\n4",
"output": "0"
},
{
"input": "aaabbbccc\n1",
"output": "0"
},
{
"input": "abcd\n2",
"output": "0"
},
{
"input": "asdfgh\n2",
"output": "0"
},
{
"input": "aab\n1",
"output": "0"
},
{
"input": "mynameissako\n5",
"output": "0"
},
{
"input": "abcde\n1",
"output": "0"
},
{
"input": "abcd\n3",
"output": "0"
},
{
"input": "abcdef\n2",
"output": "0"
},
{
"input": "abcdefg\n4",
"output": "0"
},
{
"input": "abc\n1",
"output": "0"
},
{
"input": "asdafjsgljdllgjdgkl\n5",
"output": "0"
},
{
"input": "yaay\n3",
"output": "1"
},
{
"input": "yaay\n4",
"output": "2"
},
{
"input": "zzzzzz\n2",
"output": "1"
}
] | 1,567,835,533
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 41
| 109
| 0
|
def Diversity(s,k):
if len(s)<k:
return "impossible"
charCnt = [0] * 26
for c in s:
charCnt[ord(c)-97]+=1
numberOfUniqueCharacters = 26 - charCnt.count(0)
if(numberOfUniqueCharacters>=k):
return 0
return k - numberOfUniqueCharacters
s = input()
k = int(input())
print(Diversity(s,k))
|
Title: Diversity
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
Input Specification:
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
Output Specification:
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
Demo Input:
['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n']
Demo Output:
['0\n', '1\n', 'impossible\n']
Note:
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
|
```python
def Diversity(s,k):
if len(s)<k:
return "impossible"
charCnt = [0] * 26
for c in s:
charCnt[ord(c)-97]+=1
numberOfUniqueCharacters = 26 - charCnt.count(0)
if(numberOfUniqueCharacters>=k):
return 0
return k - numberOfUniqueCharacters
s = input()
k = int(input())
print(Diversity(s,k))
```
| 3
|
|
69
|
A
|
Young Physicist
|
PROGRAMMING
| 1,000
|
[
"implementation",
"math"
] |
A. Young Physicist
|
2
|
256
|
A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasya and decided to teach him a lesson. He gave the lazy student a seemingly easy task: You are given an idle body in space and the forces that affect it. The body can be considered as a material point with coordinates (0; 0; 0). Vasya had only to answer whether it is in equilibrium. "Piece of cake" — thought Vasya, we need only to check if the sum of all vectors is equal to 0. So, Vasya began to solve the problem. But later it turned out that there can be lots and lots of these forces, and Vasya can not cope without your help. Help him. Write a program that determines whether a body is idle or is moving by the given vectors of forces.
|
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100).
|
Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not.
|
[
"3\n4 1 7\n-2 4 -1\n1 -5 -3\n",
"3\n3 -1 7\n-5 2 -4\n2 -1 -3\n"
] |
[
"NO",
"YES"
] |
none
| 500
|
[
{
"input": "3\n4 1 7\n-2 4 -1\n1 -5 -3",
"output": "NO"
},
{
"input": "3\n3 -1 7\n-5 2 -4\n2 -1 -3",
"output": "YES"
},
{
"input": "10\n21 32 -46\n43 -35 21\n42 2 -50\n22 40 20\n-27 -9 38\n-4 1 1\n-40 6 -31\n-13 -2 34\n-21 34 -12\n-32 -29 41",
"output": "NO"
},
{
"input": "10\n25 -33 43\n-27 -42 28\n-35 -20 19\n41 -42 -1\n49 -39 -4\n-49 -22 7\n-19 29 41\n8 -27 -43\n8 34 9\n-11 -3 33",
"output": "NO"
},
{
"input": "10\n-6 21 18\n20 -11 -8\n37 -11 41\n-5 8 33\n29 23 32\n30 -33 -11\n39 -49 -36\n28 34 -49\n22 29 -34\n-18 -6 7",
"output": "NO"
},
{
"input": "10\n47 -2 -27\n0 26 -14\n5 -12 33\n2 18 3\n45 -30 -49\n4 -18 8\n-46 -44 -41\n-22 -10 -40\n-35 -21 26\n33 20 38",
"output": "NO"
},
{
"input": "13\n-3 -36 -46\n-11 -50 37\n42 -11 -15\n9 42 44\n-29 -12 24\n3 9 -40\n-35 13 50\n14 43 18\n-13 8 24\n-48 -15 10\n50 9 -50\n21 0 -50\n0 0 -6",
"output": "YES"
},
{
"input": "14\n43 23 17\n4 17 44\n5 -5 -16\n-43 -7 -6\n47 -48 12\n50 47 -45\n2 14 43\n37 -30 15\n4 -17 -11\n17 9 -45\n-50 -3 -8\n-50 0 0\n-50 0 0\n-16 0 0",
"output": "YES"
},
{
"input": "13\n29 49 -11\n38 -11 -20\n25 1 -40\n-11 28 11\n23 -19 1\n45 -41 -17\n-3 0 -19\n-13 -33 49\n-30 0 28\n34 17 45\n-50 9 -27\n-50 0 0\n-37 0 0",
"output": "YES"
},
{
"input": "12\n3 28 -35\n-32 -44 -17\n9 -25 -6\n-42 -22 20\n-19 15 38\n-21 38 48\n-1 -37 -28\n-10 -13 -50\n-5 21 29\n34 28 50\n50 11 -49\n34 0 0",
"output": "YES"
},
{
"input": "37\n-64 -79 26\n-22 59 93\n-5 39 -12\n77 -9 76\n55 -86 57\n83 100 -97\n-70 94 84\n-14 46 -94\n26 72 35\n14 78 -62\n17 82 92\n-57 11 91\n23 15 92\n-80 -1 1\n12 39 18\n-23 -99 -75\n-34 50 19\n-39 84 -7\n45 -30 -39\n-60 49 37\n45 -16 -72\n33 -51 -56\n-48 28 5\n97 91 88\n45 -82 -11\n-21 -15 -90\n-53 73 -26\n-74 85 -90\n-40 23 38\n100 -13 49\n32 -100 -100\n0 -100 -70\n0 -100 0\n0 -100 0\n0 -100 0\n0 -100 0\n0 -37 0",
"output": "YES"
},
{
"input": "4\n68 3 100\n68 21 -100\n-100 -24 0\n-36 0 0",
"output": "YES"
},
{
"input": "33\n-1 -46 -12\n45 -16 -21\n-11 45 -21\n-60 -42 -93\n-22 -45 93\n37 96 85\n-76 26 83\n-4 9 55\n7 -52 -9\n66 8 -85\n-100 -54 11\n-29 59 74\n-24 12 2\n-56 81 85\n-92 69 -52\n-26 -97 91\n54 59 -51\n58 21 -57\n7 68 56\n-47 -20 -51\n-59 77 -13\n-85 27 91\n79 60 -56\n66 -80 5\n21 -99 42\n-31 -29 98\n66 93 76\n-49 45 61\n100 -100 -100\n100 -100 -100\n66 -75 -100\n0 0 -100\n0 0 -87",
"output": "YES"
},
{
"input": "3\n1 2 3\n3 2 1\n0 0 0",
"output": "NO"
},
{
"input": "2\n5 -23 12\n0 0 0",
"output": "NO"
},
{
"input": "1\n0 0 0",
"output": "YES"
},
{
"input": "1\n1 -2 0",
"output": "NO"
},
{
"input": "2\n-23 77 -86\n23 -77 86",
"output": "YES"
},
{
"input": "26\n86 7 20\n-57 -64 39\n-45 6 -93\n-44 -21 100\n-11 -49 21\n73 -71 -80\n-2 -89 56\n-65 -2 7\n5 14 84\n57 41 13\n-12 69 54\n40 -25 27\n-17 -59 0\n64 -91 -30\n-53 9 42\n-54 -8 14\n-35 82 27\n-48 -59 -80\n88 70 79\n94 57 97\n44 63 25\n84 -90 -40\n-100 100 -100\n-92 100 -100\n0 10 -100\n0 0 -82",
"output": "YES"
},
{
"input": "42\n11 27 92\n-18 -56 -57\n1 71 81\n33 -92 30\n82 83 49\n-87 -61 -1\n-49 45 49\n73 26 15\n-22 22 -77\n29 -93 87\n-68 44 -90\n-4 -84 20\n85 67 -6\n-39 26 77\n-28 -64 20\n65 -97 24\n-72 -39 51\n35 -75 -91\n39 -44 -8\n-25 -27 -57\n91 8 -46\n-98 -94 56\n94 -60 59\n-9 -95 18\n-53 -37 98\n-8 -94 -84\n-52 55 60\n15 -14 37\n65 -43 -25\n94 12 66\n-8 -19 -83\n29 81 -78\n-58 57 33\n24 86 -84\n-53 32 -88\n-14 7 3\n89 97 -53\n-5 -28 -91\n-100 100 -6\n-84 100 0\n0 100 0\n0 70 0",
"output": "YES"
},
{
"input": "3\n96 49 -12\n2 -66 28\n-98 17 -16",
"output": "YES"
},
{
"input": "5\n70 -46 86\n-100 94 24\n-27 63 -63\n57 -100 -47\n0 -11 0",
"output": "YES"
},
{
"input": "18\n-86 -28 70\n-31 -89 42\n31 -48 -55\n95 -17 -43\n24 -95 -85\n-21 -14 31\n68 -18 81\n13 31 60\n-15 28 99\n-42 15 9\n28 -61 -62\n-16 71 29\n-28 75 -48\n-77 -67 36\n-100 83 89\n100 100 -100\n57 34 -100\n0 0 -53",
"output": "YES"
},
{
"input": "44\n52 -54 -29\n-82 -5 -94\n-54 43 43\n91 16 71\n7 80 -91\n3 15 29\n-99 -6 -77\n-3 -77 -64\n73 67 34\n25 -10 -18\n-29 91 63\n-72 86 -16\n-68 85 -81\n-3 36 44\n-74 -14 -80\n34 -96 -97\n-76 -78 -33\n-24 44 -58\n98 12 77\n95 -63 -6\n-51 3 -90\n-92 -10 72\n7 3 -68\n57 -53 71\n29 57 -48\n35 -60 10\n79 -70 -61\n-20 77 55\n-86 -15 -35\n84 -88 -18\n100 -42 77\n-20 46 8\n-41 -43 -65\n38 -98 -23\n-100 65 45\n-7 -91 -63\n46 88 -85\n48 59 100\n0 0 100\n0 0 100\n0 0 100\n0 0 100\n0 0 100\n0 0 1",
"output": "YES"
},
{
"input": "18\n-14 -64 -91\n-8 -66 -86\n-23 92 -40\n6 -3 -53\n57 41 78\n-79 42 -22\n-88 -17 45\n4 -45 44\n83 -18 -25\n34 86 -92\n75 -30 12\n44 99 11\n-67 -13 72\n22 83 -56\n-37 71 72\n-9 -100 100\n0 -100 31\n0 -58 0",
"output": "YES"
},
{
"input": "23\n-70 37 78\n42 84 6\n28 -94 -24\n-49 76 95\n-67 18 84\n-53 78 -5\n65 -63 -64\n-66 -64 -69\n81 -93 95\n10 52 -79\n-89 -61 -64\n-64 -47 43\n-81 -35 55\n80 82 73\n-60 -81 -18\n49 -10 -19\n-58 70 12\n-24 -15 -93\n98 -93 -54\n-28 -75 11\n100 100 -63\n100 100 0\n56 34 0",
"output": "YES"
},
{
"input": "3\n0 2 -2\n1 -1 3\n-3 0 0",
"output": "NO"
}
] | 1,638,397,542
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 80
| 124
| 0
|
n = int(input())
res = []
for _ in range(n):
res.append(list(map(int, input().split())))
resSum = 0
for i in res:
resSum += sum(i)
if resSum == 0:
print('YES')
else:
print('NO')
|
Title: Young Physicist
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A guy named Vasya attends the final grade of a high school. One day Vasya decided to watch a match of his favorite hockey team. And, as the boy loves hockey very much, even more than physics, he forgot to do the homework. Specifically, he forgot to complete his physics tasks. Next day the teacher got very angry at Vasya and decided to teach him a lesson. He gave the lazy student a seemingly easy task: You are given an idle body in space and the forces that affect it. The body can be considered as a material point with coordinates (0; 0; 0). Vasya had only to answer whether it is in equilibrium. "Piece of cake" — thought Vasya, we need only to check if the sum of all vectors is equal to 0. So, Vasya began to solve the problem. But later it turned out that there can be lots and lots of these forces, and Vasya can not cope without your help. Help him. Write a program that determines whether a body is idle or is moving by the given vectors of forces.
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100), then follow *n* lines containing three integers each: the *x**i* coordinate, the *y**i* coordinate and the *z**i* coordinate of the force vector, applied to the body (<=-<=100<=≤<=*x**i*,<=*y**i*,<=*z**i*<=≤<=100).
Output Specification:
Print the word "YES" if the body is in equilibrium, or the word "NO" if it is not.
Demo Input:
['3\n4 1 7\n-2 4 -1\n1 -5 -3\n', '3\n3 -1 7\n-5 2 -4\n2 -1 -3\n']
Demo Output:
['NO', 'YES']
Note:
none
|
```python
n = int(input())
res = []
for _ in range(n):
res.append(list(map(int, input().split())))
resSum = 0
for i in res:
resSum += sum(i)
if resSum == 0:
print('YES')
else:
print('NO')
```
| 0
|
463
|
B
|
Caisa and Pylons
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation",
"math"
] | null | null |
Caisa solved the problem with the sugar and now he is on the way back to home.
Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=><=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time.
Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game?
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons.
|
Print a single number representing the minimum number of dollars paid by Caisa.
|
[
"5\n3 4 3 2 4\n",
"3\n4 4 4\n"
] |
[
"4\n",
"4\n"
] |
In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
| 1,000
|
[
{
"input": "5\n3 4 3 2 4",
"output": "4"
},
{
"input": "3\n4 4 4",
"output": "4"
},
{
"input": "99\n1401 2019 1748 3785 3236 3177 3443 3772 2138 1049 353 908 310 2388 1322 88 2160 2783 435 2248 1471 706 2468 2319 3156 3506 2794 1999 1983 2519 2597 3735 537 344 3519 3772 3872 2961 3895 2010 10 247 3269 671 2986 942 758 1146 77 1545 3745 1547 2250 2565 217 1406 2070 3010 3404 404 1528 2352 138 2065 3047 3656 2188 2919 2616 2083 1280 2977 2681 548 4000 1667 1489 1109 3164 1565 2653 3260 3463 903 1824 3679 2308 245 2689 2063 648 568 766 785 2984 3812 440 1172 2730",
"output": "4000"
},
{
"input": "68\n477 1931 3738 3921 2306 1823 3328 2057 661 3993 2967 3520 171 1739 1525 1817 209 3475 1902 2666 518 3283 3412 3040 3383 2331 1147 1460 1452 1800 1327 2280 82 1416 2200 2388 3238 1879 796 250 1872 114 121 2042 1853 1645 211 2061 1472 2464 726 1989 1746 489 1380 1128 2819 2527 2939 622 678 265 2902 1111 2032 1453 3850 1621",
"output": "3993"
},
{
"input": "30\n30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "30"
},
{
"input": "3\n3 2 1",
"output": "3"
},
{
"input": "1\n69",
"output": "69"
}
] | 1,651,688,638
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 1
| 31
| 0
|
n = int(input())
heights = input().split()
heights = [int(x) for x in heights]
sum = 0
Min = float('inf')
for i in range(n-1):
sum += heights[i] - heights[i+1]
Min = min(Min,sum)
print(heights[0] - Min if Min < 0 else 0)
|
Title: Caisa and Pylons
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Caisa solved the problem with the sugar and now he is on the way back to home.
Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=><=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time.
Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game?
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons.
Output Specification:
Print a single number representing the minimum number of dollars paid by Caisa.
Demo Input:
['5\n3 4 3 2 4\n', '3\n4 4 4\n']
Demo Output:
['4\n', '4\n']
Note:
In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
|
```python
n = int(input())
heights = input().split()
heights = [int(x) for x in heights]
sum = 0
Min = float('inf')
for i in range(n-1):
sum += heights[i] - heights[i+1]
Min = min(Min,sum)
print(heights[0] - Min if Min < 0 else 0)
```
| 0
|
|
461
|
A
|
Appleman and Toastman
|
PROGRAMMING
| 1,200
|
[
"greedy",
"sortings"
] | null | null |
Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks:
- Each time Toastman gets a group of numbers, he sums up all the numbers and adds this sum to the score. Then he gives the group to the Appleman. - Each time Appleman gets a group consisting of a single number, he throws this group out. Each time Appleman gets a group consisting of more than one number, he splits the group into two non-empty groups (he can do it in any way) and gives each of them to Toastman.
After guys complete all the tasks they look at the score value. What is the maximum possible value of score they can get?
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=3·105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=106) — the initial group that is given to Toastman.
|
Print a single integer — the largest possible score.
|
[
"3\n3 1 5\n",
"1\n10\n"
] |
[
"26\n",
"10\n"
] |
Consider the following situation in the first example. Initially Toastman gets group [3, 1, 5] and adds 9 to the score, then he give the group to Appleman. Appleman splits group [3, 1, 5] into two groups: [3, 5] and [1]. Both of them should be given to Toastman. When Toastman receives group [1], he adds 1 to score and gives the group to Appleman (he will throw it out). When Toastman receives group [3, 5], he adds 8 to the score and gives the group to Appleman. Appleman splits [3, 5] in the only possible way: [5] and [3]. Then he gives both groups to Toastman. When Toastman receives [5], he adds 5 to the score and gives the group to Appleman (he will throws it out). When Toastman receives [3], he adds 3 to the score and gives the group to Appleman (he will throws it out). Finally Toastman have added 9 + 1 + 8 + 5 + 3 = 26 to the score. This is the optimal sequence of actions.
| 500
|
[
{
"input": "3\n3 1 5",
"output": "26"
},
{
"input": "1\n10",
"output": "10"
},
{
"input": "10\n8 10 2 5 6 2 4 7 2 1",
"output": "376"
},
{
"input": "10\n171308 397870 724672 431255 228496 892002 542924 718337 888642 161821",
"output": "40204082"
},
{
"input": "10\n1 2 2 2 4 5 6 7 8 10",
"output": "376"
},
{
"input": "10\n161821 171308 228496 397870 431255 542924 718337 724672 888642 892002",
"output": "40204082"
},
{
"input": "1\n397870",
"output": "397870"
},
{
"input": "1\n1000000",
"output": "1000000"
},
{
"input": "10\n10 8 7 6 5 4 2 2 2 1",
"output": "376"
},
{
"input": "10\n892002 888642 724672 718337 542924 431255 397870 228496 171308 161821",
"output": "40204082"
},
{
"input": "10\n5 2 6 10 10 10 10 2 2 5",
"output": "485"
},
{
"input": "10\n431255 724672 228496 397870 397870 397870 397870 724672 888642 431255",
"output": "36742665"
},
{
"input": "10\n2 2 2 5 5 6 10 10 10 10",
"output": "485"
},
{
"input": "10\n228496 397870 397870 397870 397870 431255 431255 724672 724672 888642",
"output": "36742665"
},
{
"input": "10\n10 10 10 10 6 5 5 2 2 2",
"output": "485"
},
{
"input": "10\n888642 724672 724672 431255 431255 397870 397870 397870 397870 228496",
"output": "36742665"
},
{
"input": "10\n10 10 10 10 10 10 10 10 10 10",
"output": "640"
},
{
"input": "10\n1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000",
"output": "64000000"
},
{
"input": "1\n397870",
"output": "397870"
},
{
"input": "2\n1 2",
"output": "6"
},
{
"input": "2\n2 3",
"output": "10"
},
{
"input": "2\n1 1",
"output": "4"
}
] | 1,512,563,205
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 46
| 5,529,600
|
n=int(input())
list=input().split()
list.sort()
for i in range(n):
list[i]=int(list[i])
score=0
for i in range(n):
score+=list[i]*(i+2)
print(score-list[n-1])
|
Title: Appleman and Toastman
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Appleman and Toastman play a game. Initially Appleman gives one group of *n* numbers to the Toastman, then they start to complete the following tasks:
- Each time Toastman gets a group of numbers, he sums up all the numbers and adds this sum to the score. Then he gives the group to the Appleman. - Each time Appleman gets a group consisting of a single number, he throws this group out. Each time Appleman gets a group consisting of more than one number, he splits the group into two non-empty groups (he can do it in any way) and gives each of them to Toastman.
After guys complete all the tasks they look at the score value. What is the maximum possible value of score they can get?
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=3·105). The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=106) — the initial group that is given to Toastman.
Output Specification:
Print a single integer — the largest possible score.
Demo Input:
['3\n3 1 5\n', '1\n10\n']
Demo Output:
['26\n', '10\n']
Note:
Consider the following situation in the first example. Initially Toastman gets group [3, 1, 5] and adds 9 to the score, then he give the group to Appleman. Appleman splits group [3, 1, 5] into two groups: [3, 5] and [1]. Both of them should be given to Toastman. When Toastman receives group [1], he adds 1 to score and gives the group to Appleman (he will throw it out). When Toastman receives group [3, 5], he adds 8 to the score and gives the group to Appleman. Appleman splits [3, 5] in the only possible way: [5] and [3]. Then he gives both groups to Toastman. When Toastman receives [5], he adds 5 to the score and gives the group to Appleman (he will throws it out). When Toastman receives [3], he adds 3 to the score and gives the group to Appleman (he will throws it out). Finally Toastman have added 9 + 1 + 8 + 5 + 3 = 26 to the score. This is the optimal sequence of actions.
|
```python
n=int(input())
list=input().split()
list.sort()
for i in range(n):
list[i]=int(list[i])
score=0
for i in range(n):
score+=list[i]*(i+2)
print(score-list[n-1])
```
| 0
|
|
598
|
B
|
Queries on a String
|
PROGRAMMING
| 1,300
|
[
"implementation",
"strings"
] | null | null |
You are given a string *s* and should process *m* queries. Each query is described by two 1-based indices *l**i*, *r**i* and integer *k**i*. It means that you should cyclically shift the substring *s*[*l**i*... *r**i*] *k**i* times. The queries should be processed one after another in the order they are given.
One operation of a cyclic shift (rotation) is equivalent to moving the last character to the position of the first character and shifting all other characters one position to the right.
For example, if the string *s* is abacaba and the query is *l*1<==<=3,<=*r*1<==<=6,<=*k*1<==<=1 then the answer is abbacaa. If after that we would process the query *l*2<==<=1,<=*r*2<==<=4,<=*k*2<==<=2 then we would get the string baabcaa.
|
The first line of the input contains the string *s* (1<=≤<=|*s*|<=≤<=10<=000) in its initial state, where |*s*| stands for the length of *s*. It contains only lowercase English letters.
Second line contains a single integer *m* (1<=≤<=*m*<=≤<=300) — the number of queries.
The *i*-th of the next *m* lines contains three integers *l**i*, *r**i* and *k**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=|*s*|,<=1<=≤<=*k**i*<=≤<=1<=000<=000) — the description of the *i*-th query.
|
Print the resulting string *s* after processing all *m* queries.
|
[
"abacaba\n2\n3 6 1\n1 4 2\n"
] |
[
"baabcaa\n"
] |
The sample is described in problem statement.
| 0
|
[
{
"input": "abacaba\n2\n3 6 1\n1 4 2",
"output": "baabcaa"
},
{
"input": "u\n1\n1 1 1",
"output": "u"
},
{
"input": "p\n5\n1 1 5\n1 1 9\n1 1 10\n1 1 10\n1 1 4",
"output": "p"
},
{
"input": "ssssssssss\n5\n5 7 9\n3 9 3\n2 7 1\n7 7 10\n1 9 6",
"output": "ssssssssss"
},
{
"input": "tcpyzttcpo\n10\n2 3 6\n2 4 1\n2 6 9\n7 10 5\n2 3 5\n4 5 6\n3 4 5\n7 9 4\n9 10 7\n1 10 8",
"output": "zctycopttp"
},
{
"input": "yywlblbblw\n10\n4 7 2\n3 8 2\n4 10 6\n4 7 1\n3 9 6\n1 7 3\n3 7 3\n3 7 1\n1 8 7\n2 7 5",
"output": "bylwlwylbb"
},
{
"input": "thisisahacktest\n1\n1 2 1",
"output": "htisisahacktest"
},
{
"input": "ozozumuhackleyan\n1\n1 4 1",
"output": "zozoumuhackleyan"
},
{
"input": "lacongaithattuyet\n1\n1 1 1",
"output": "lacongaithattuyet"
}
] | 1,679,572,735
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 1
| 61
| 0
|
s = input()
n = int(input())
for i in range(n):
l, r, k = map(int, input().split())
l -= 1
r -= 1
s = s[0:l] + s[r - k:r] + s[l:r - k + 1] + s[r + 1:]
print(s)
|
Title: Queries on a String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given a string *s* and should process *m* queries. Each query is described by two 1-based indices *l**i*, *r**i* and integer *k**i*. It means that you should cyclically shift the substring *s*[*l**i*... *r**i*] *k**i* times. The queries should be processed one after another in the order they are given.
One operation of a cyclic shift (rotation) is equivalent to moving the last character to the position of the first character and shifting all other characters one position to the right.
For example, if the string *s* is abacaba and the query is *l*1<==<=3,<=*r*1<==<=6,<=*k*1<==<=1 then the answer is abbacaa. If after that we would process the query *l*2<==<=1,<=*r*2<==<=4,<=*k*2<==<=2 then we would get the string baabcaa.
Input Specification:
The first line of the input contains the string *s* (1<=≤<=|*s*|<=≤<=10<=000) in its initial state, where |*s*| stands for the length of *s*. It contains only lowercase English letters.
Second line contains a single integer *m* (1<=≤<=*m*<=≤<=300) — the number of queries.
The *i*-th of the next *m* lines contains three integers *l**i*, *r**i* and *k**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=|*s*|,<=1<=≤<=*k**i*<=≤<=1<=000<=000) — the description of the *i*-th query.
Output Specification:
Print the resulting string *s* after processing all *m* queries.
Demo Input:
['abacaba\n2\n3 6 1\n1 4 2\n']
Demo Output:
['baabcaa\n']
Note:
The sample is described in problem statement.
|
```python
s = input()
n = int(input())
for i in range(n):
l, r, k = map(int, input().split())
l -= 1
r -= 1
s = s[0:l] + s[r - k:r] + s[l:r - k + 1] + s[r + 1:]
print(s)
```
| 0
|
|
766
|
B
|
Mahmoud and a Triangle
|
PROGRAMMING
| 1,000
|
[
"constructive algorithms",
"geometry",
"greedy",
"math",
"number theory",
"sortings"
] | null | null |
Mahmoud has *n* line segments, the *i*-th of them has length *a**i*. Ehab challenged him to use exactly 3 line segments to form a non-degenerate triangle. Mahmoud doesn't accept challenges unless he is sure he can win, so he asked you to tell him if he should accept the challenge. Given the lengths of the line segments, check if he can choose exactly 3 of them to form a non-degenerate triangle.
Mahmoud should use exactly 3 line segments, he can't concatenate two line segments or change any length. A non-degenerate triangle is a triangle with positive area.
|
The first line contains single integer *n* (3<=≤<=*n*<=≤<=105) — the number of line segments Mahmoud has.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the lengths of line segments Mahmoud has.
|
In the only line print "YES" if he can choose exactly three line segments and form a non-degenerate triangle with them, and "NO" otherwise.
|
[
"5\n1 5 3 2 4\n",
"3\n4 1 2\n"
] |
[
"YES\n",
"NO\n"
] |
For the first example, he can use line segments with lengths 2, 4 and 5 to form a non-degenerate triangle.
| 1,000
|
[
{
"input": "5\n1 5 3 2 4",
"output": "YES"
},
{
"input": "3\n4 1 2",
"output": "NO"
},
{
"input": "30\n197 75 517 39724 7906061 1153471 3 15166 168284 3019844 272293 316 16 24548 42 118 5792 5 9373 1866366 4886214 24 2206 712886 104005 1363 836 64273 440585 3576",
"output": "NO"
},
{
"input": "30\n229017064 335281886 247217656 670601882 743442492 615491486 544941439 911270108 474843964 803323771 177115397 62179276 390270885 754889875 881720571 902691435 154083299 328505383 761264351 182674686 94104683 357622370 573909964 320060691 33548810 247029007 812823597 946798893 813659359 710111761",
"output": "YES"
},
{
"input": "40\n740553458 532562042 138583675 75471987 487348843 476240280 972115023 103690894 546736371 915774563 35356828 819948191 138721993 24257926 761587264 767176616 608310208 78275645 386063134 227581756 672567198 177797611 87579917 941781518 274774331 843623616 981221615 630282032 118843963 749160513 354134861 132333165 405839062 522698334 29698277 541005920 856214146 167344951 398332403 68622974",
"output": "YES"
},
{
"input": "40\n155 1470176 7384 765965701 1075 4 561554 6227772 93 16304522 1744 662 3 292572860 19335 908613 42685804 347058 20 132560 3848974 69067081 58 2819 111752888 408 81925 30 11951 4564 251 26381275 473392832 50628 180819969 2378797 10076746 9 214492 31291",
"output": "NO"
},
{
"input": "3\n1 1000000000 1000000000",
"output": "YES"
},
{
"input": "4\n1 1000000000 1000000000 1000000000",
"output": "YES"
},
{
"input": "3\n1 1000000000 1",
"output": "NO"
},
{
"input": "5\n1 2 3 5 2",
"output": "YES"
},
{
"input": "41\n19 161 4090221 118757367 2 45361275 1562319 596751 140871 97 1844 310910829 10708344 6618115 698 1 87059 33 2527892 12703 73396090 17326460 3 368811 20550 813975131 10 53804 28034805 7847 2992 33254 1139 227930 965568 261 4846 503064297 192153458 57 431",
"output": "NO"
},
{
"input": "42\n4317083 530966905 202811311 104 389267 35 1203 18287479 125344279 21690 859122498 65 859122508 56790 1951 148683 457 1 22 2668100 8283 2 77467028 13405 11302280 47877251 328155592 35095 29589769 240574 4 10 1019123 6985189 629846 5118 169 1648973 91891 741 282 3159",
"output": "YES"
},
{
"input": "43\n729551585 11379 5931704 330557 1653 15529406 729551578 278663905 1 729551584 2683 40656510 29802 147 1400284 2 126260 865419 51 17 172223763 86 1 534861 450887671 32 234 25127103 9597697 48226 7034 389 204294 2265706 65783617 4343 3665990 626 78034 106440137 5 18421 1023",
"output": "YES"
},
{
"input": "44\n719528276 2 235 444692918 24781885 169857576 18164 47558 15316043 9465834 64879816 2234575 1631 853530 8 1001 621 719528259 84 6933 31 1 3615623 719528266 40097928 274835337 1381044 11225 2642 5850203 6 527506 18 104977753 76959 29393 49 4283 141 201482 380 1 124523 326015",
"output": "YES"
},
{
"input": "45\n28237 82 62327732 506757 691225170 5 970 4118 264024506 313192 367 14713577 73933 691225154 6660 599 691225145 3473403 51 427200630 1326718 2146678 100848386 1569 27 163176119 193562 10784 45687 819951 38520653 225 119620 1 3 691225169 691225164 17445 23807072 1 9093493 5620082 2542 139 14",
"output": "YES"
},
{
"input": "44\n165580141 21 34 55 1 89 144 17711 2 377 610 987 2584 13 5 4181 6765 10946 1597 8 28657 3 233 75025 121393 196418 317811 9227465 832040 1346269 2178309 3524578 5702887 1 14930352 102334155 24157817 39088169 63245986 701408733 267914296 433494437 514229 46368",
"output": "NO"
},
{
"input": "3\n1 1000000000 999999999",
"output": "NO"
},
{
"input": "5\n1 1 1 1 1",
"output": "YES"
},
{
"input": "10\n1 10 100 1000 10000 100000 1000000 10000000 100000000 1000000000",
"output": "NO"
},
{
"input": "5\n2 3 4 10 20",
"output": "YES"
},
{
"input": "6\n18 23 40 80 160 161",
"output": "YES"
},
{
"input": "4\n5 6 7 888",
"output": "YES"
},
{
"input": "9\n1 1 2 2 4 5 10 10 20",
"output": "YES"
},
{
"input": "7\n3 150 900 4 500 1500 5",
"output": "YES"
},
{
"input": "3\n2 2 3",
"output": "YES"
},
{
"input": "7\n1 2 100 200 250 1000000 2000000",
"output": "YES"
},
{
"input": "8\n2 3 5 5 5 6 6 13",
"output": "YES"
},
{
"input": "3\n2 3 4",
"output": "YES"
},
{
"input": "6\n1 1 1 4 5 100",
"output": "YES"
},
{
"input": "13\n1 2 3 5 8 13 22 34 55 89 144 233 377",
"output": "YES"
},
{
"input": "4\n2 3 4 8",
"output": "YES"
},
{
"input": "3\n5 6 7",
"output": "YES"
},
{
"input": "5\n1 4 5 6 1000000",
"output": "YES"
},
{
"input": "4\n5 6 7 20",
"output": "YES"
},
{
"input": "6\n1 1 1 1 1 65",
"output": "YES"
},
{
"input": "4\n3 4 5 100",
"output": "YES"
},
{
"input": "3\n2 4 5",
"output": "YES"
},
{
"input": "7\n1 1 1 1 1 10 1000",
"output": "YES"
},
{
"input": "4\n1 1 2 3",
"output": "NO"
},
{
"input": "11\n1 2 5 6 7 8 9 17 18 19 100",
"output": "YES"
},
{
"input": "4\n5 16 20 200",
"output": "YES"
},
{
"input": "5\n17 6 3 3 1",
"output": "YES"
},
{
"input": "3\n1 1 1",
"output": "YES"
},
{
"input": "6\n1 1 1 2 3 5",
"output": "YES"
},
{
"input": "4\n2 4 6 6",
"output": "YES"
},
{
"input": "9\n1 2 4 4 4 4 7 8 20",
"output": "YES"
},
{
"input": "9\n1 1 2 5 5 5 10 10 20",
"output": "YES"
},
{
"input": "7\n3 150 600 4 1700 6000 5",
"output": "YES"
},
{
"input": "5\n5761 20966 27841 28800 29399",
"output": "YES"
},
{
"input": "9\n1 2 3 6 7 10 11 12 24",
"output": "YES"
},
{
"input": "4\n1 2 1 1",
"output": "YES"
},
{
"input": "5\n1 1 2 3 4",
"output": "YES"
}
] | 1,685,388,672
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 87
| 78
| 13,619,200
|
n = int(input())
lens = list(map(int, input().split()))
lens.sort()
triangle = False
for i in range(n - 2):
if lens[i] + lens[i + 1] > lens[i + 2]:
triangle = True
break
if triangle:
print("YES")
else:
print("NO")
|
Title: Mahmoud and a Triangle
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mahmoud has *n* line segments, the *i*-th of them has length *a**i*. Ehab challenged him to use exactly 3 line segments to form a non-degenerate triangle. Mahmoud doesn't accept challenges unless he is sure he can win, so he asked you to tell him if he should accept the challenge. Given the lengths of the line segments, check if he can choose exactly 3 of them to form a non-degenerate triangle.
Mahmoud should use exactly 3 line segments, he can't concatenate two line segments or change any length. A non-degenerate triangle is a triangle with positive area.
Input Specification:
The first line contains single integer *n* (3<=≤<=*n*<=≤<=105) — the number of line segments Mahmoud has.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the lengths of line segments Mahmoud has.
Output Specification:
In the only line print "YES" if he can choose exactly three line segments and form a non-degenerate triangle with them, and "NO" otherwise.
Demo Input:
['5\n1 5 3 2 4\n', '3\n4 1 2\n']
Demo Output:
['YES\n', 'NO\n']
Note:
For the first example, he can use line segments with lengths 2, 4 and 5 to form a non-degenerate triangle.
|
```python
n = int(input())
lens = list(map(int, input().split()))
lens.sort()
triangle = False
for i in range(n - 2):
if lens[i] + lens[i + 1] > lens[i + 2]:
triangle = True
break
if triangle:
print("YES")
else:
print("NO")
```
| 3
|
|
304
|
A
|
Pythagorean Theorem II
|
PROGRAMMING
| 1,200
|
[
"brute force",
"math"
] | null | null |
In mathematics, the Pythagorean theorem — is a relation in Euclidean geometry among the three sides of a right-angled triangle. In terms of areas, it states:
In any right-angled triangle, the area of the square whose side is the hypotenuse (the side opposite the right angle) is equal to the sum of the areas of the squares whose sides are the two legs (the two sides that meet at a right angle).
The theorem can be written as an equation relating the lengths of the sides *a*, *b* and *c*, often called the Pythagorean equation:
where *c* represents the length of the hypotenuse, and *a* and *b* represent the lengths of the other two sides.
Given *n*, your task is to count how many right-angled triangles with side-lengths *a*, *b* and *c* that satisfied an inequality 1<=≤<=*a*<=≤<=*b*<=≤<=*c*<=≤<=*n*.
|
The only line contains one integer *n* (1<=≤<=*n*<=≤<=104) as we mentioned above.
|
Print a single integer — the answer to the problem.
|
[
"5\n",
"74\n"
] |
[
"1\n",
"35\n"
] |
none
| 500
|
[
{
"input": "5",
"output": "1"
},
{
"input": "74",
"output": "35"
},
{
"input": "1000",
"output": "881"
},
{
"input": "586",
"output": "472"
},
{
"input": "2",
"output": "0"
},
{
"input": "362",
"output": "258"
},
{
"input": "778",
"output": "653"
},
{
"input": "194",
"output": "120"
},
{
"input": "906",
"output": "786"
},
{
"input": "659",
"output": "535"
},
{
"input": "75",
"output": "37"
},
{
"input": "787",
"output": "664"
},
{
"input": "851",
"output": "730"
},
{
"input": "563",
"output": "446"
},
{
"input": "979",
"output": "862"
},
{
"input": "395",
"output": "291"
},
{
"input": "755",
"output": "634"
},
{
"input": "171",
"output": "103"
},
{
"input": "883",
"output": "759"
},
{
"input": "400",
"output": "294"
},
{
"input": "817",
"output": "693"
},
{
"input": "177",
"output": "107"
},
{
"input": "593",
"output": "476"
},
{
"input": "305",
"output": "214"
},
{
"input": "721",
"output": "595"
},
{
"input": "785",
"output": "664"
},
{
"input": "497",
"output": "383"
},
{
"input": "913",
"output": "791"
},
{
"input": "625",
"output": "507"
},
{
"input": "334",
"output": "236"
},
{
"input": "10000",
"output": "12471"
},
{
"input": "9999",
"output": "12467"
}
] | 1,369,359,303
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 2
| 3,000
| 102,400
|
n = int(input())
d = [];
for i in range (0, 10000):
d.append((i + 1) * (i + 1));
res = 0;
for i in range (0, n):
for j in range (i, n):
ld = j; rd = n - 1;
while ld <= rd:
md = int((ld + rd) / 2);
if d[md] == d[i] + d[j]:
res = res + 1;
break;
else:
if d[md] > d[i] + d[j]:
rd = md - 1;
else:
ld = md + 1;
print (res)
|
Title: Pythagorean Theorem II
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In mathematics, the Pythagorean theorem — is a relation in Euclidean geometry among the three sides of a right-angled triangle. In terms of areas, it states:
In any right-angled triangle, the area of the square whose side is the hypotenuse (the side opposite the right angle) is equal to the sum of the areas of the squares whose sides are the two legs (the two sides that meet at a right angle).
The theorem can be written as an equation relating the lengths of the sides *a*, *b* and *c*, often called the Pythagorean equation:
where *c* represents the length of the hypotenuse, and *a* and *b* represent the lengths of the other two sides.
Given *n*, your task is to count how many right-angled triangles with side-lengths *a*, *b* and *c* that satisfied an inequality 1<=≤<=*a*<=≤<=*b*<=≤<=*c*<=≤<=*n*.
Input Specification:
The only line contains one integer *n* (1<=≤<=*n*<=≤<=104) as we mentioned above.
Output Specification:
Print a single integer — the answer to the problem.
Demo Input:
['5\n', '74\n']
Demo Output:
['1\n', '35\n']
Note:
none
|
```python
n = int(input())
d = [];
for i in range (0, 10000):
d.append((i + 1) * (i + 1));
res = 0;
for i in range (0, n):
for j in range (i, n):
ld = j; rd = n - 1;
while ld <= rd:
md = int((ld + rd) / 2);
if d[md] == d[i] + d[j]:
res = res + 1;
break;
else:
if d[md] > d[i] + d[j]:
rd = md - 1;
else:
ld = md + 1;
print (res)
```
| 0
|
|
534
|
B
|
Covered Path
|
PROGRAMMING
| 1,400
|
[
"dp",
"greedy",
"math"
] | null | null |
The on-board computer on Polycarp's car measured that the car speed at the beginning of some section of the path equals *v*1 meters per second, and in the end it is *v*2 meters per second. We know that this section of the route took exactly *t* seconds to pass.
Assuming that at each of the seconds the speed is constant, and between seconds the speed can change at most by *d* meters per second in absolute value (i.e., the difference in the speed of any two adjacent seconds does not exceed *d* in absolute value), find the maximum possible length of the path section in meters.
|
The first line contains two integers *v*1 and *v*2 (1<=≤<=*v*1,<=*v*2<=≤<=100) — the speeds in meters per second at the beginning of the segment and at the end of the segment, respectively.
The second line contains two integers *t* (2<=≤<=*t*<=≤<=100) — the time when the car moves along the segment in seconds, *d* (0<=≤<=*d*<=≤<=10) — the maximum value of the speed change between adjacent seconds.
It is guaranteed that there is a way to complete the segment so that:
- the speed in the first second equals *v*1, - the speed in the last second equals *v*2, - the absolute value of difference of speeds between any two adjacent seconds doesn't exceed *d*.
|
Print the maximum possible length of the path segment in meters.
|
[
"5 6\n4 2\n",
"10 10\n10 0\n"
] |
[
"26",
"100"
] |
In the first sample the sequence of speeds of Polycarpus' car can look as follows: 5, 7, 8, 6. Thus, the total path is 5 + 7 + 8 + 6 = 26 meters.
In the second sample, as *d* = 0, the car covers the whole segment at constant speed *v* = 10. In *t* = 10 seconds it covers the distance of 100 meters.
| 1,000
|
[
{
"input": "5 6\n4 2",
"output": "26"
},
{
"input": "10 10\n10 0",
"output": "100"
},
{
"input": "87 87\n2 10",
"output": "174"
},
{
"input": "1 11\n6 2",
"output": "36"
},
{
"input": "100 10\n10 10",
"output": "550"
},
{
"input": "1 1\n100 10",
"output": "24600"
},
{
"input": "1 1\n5 1",
"output": "9"
},
{
"input": "1 1\n5 2",
"output": "13"
},
{
"input": "100 100\n100 0",
"output": "10000"
},
{
"input": "100 100\n100 10",
"output": "34500"
},
{
"input": "1 100\n100 1",
"output": "5050"
},
{
"input": "1 100\n100 10",
"output": "29305"
},
{
"input": "100 1\n100 1",
"output": "5050"
},
{
"input": "100 1\n100 10",
"output": "29305"
},
{
"input": "1 10\n2 10",
"output": "11"
},
{
"input": "1 1\n2 1",
"output": "2"
},
{
"input": "1 1\n2 10",
"output": "2"
},
{
"input": "1 2\n2 1",
"output": "3"
},
{
"input": "1 2\n2 10",
"output": "3"
},
{
"input": "1 5\n3 2",
"output": "9"
},
{
"input": "2 1\n2 2",
"output": "3"
},
{
"input": "2 1\n2 10",
"output": "3"
},
{
"input": "1 11\n2 10",
"output": "12"
},
{
"input": "11 1\n2 10",
"output": "12"
},
{
"input": "1 1\n3 5",
"output": "8"
},
{
"input": "1 10\n3 5",
"output": "17"
},
{
"input": "1 21\n3 10",
"output": "33"
},
{
"input": "21 1\n3 10",
"output": "33"
},
{
"input": "100 100\n99 1",
"output": "12301"
},
{
"input": "100 100\n100 1",
"output": "12450"
},
{
"input": "99 99\n99 1",
"output": "12202"
},
{
"input": "99 99\n99 10",
"output": "33811"
},
{
"input": "1 100\n99 10",
"output": "28764"
},
{
"input": "13 31\n7 5",
"output": "182"
},
{
"input": "88 78\n8 5",
"output": "719"
},
{
"input": "34 48\n47 4",
"output": "4030"
},
{
"input": "91 29\n78 3",
"output": "8806"
},
{
"input": "90 81\n21 6",
"output": "2391"
},
{
"input": "95 89\n45 3",
"output": "5589"
},
{
"input": "48 54\n84 2",
"output": "7724"
},
{
"input": "72 31\n59 7",
"output": "8865"
},
{
"input": "51 13\n47 3",
"output": "2970"
},
{
"input": "97 91\n82 2",
"output": "10984"
},
{
"input": "71 71\n9 5",
"output": "719"
},
{
"input": "16 49\n40 3",
"output": "2350"
},
{
"input": "22 41\n68 4",
"output": "6608"
},
{
"input": "13 71\n72 6",
"output": "10444"
},
{
"input": "77 78\n46 3",
"output": "5083"
},
{
"input": "36 60\n54 2",
"output": "3924"
},
{
"input": "55 39\n93 2",
"output": "8571"
},
{
"input": "34 7\n48 6",
"output": "4266"
},
{
"input": "80 88\n79 3",
"output": "11193"
},
{
"input": "34 62\n15 4",
"output": "866"
},
{
"input": "81 40\n73 2",
"output": "6798"
},
{
"input": "13 38\n97 6",
"output": "16271"
},
{
"input": "84 87\n45 2",
"output": "4814"
},
{
"input": "42 65\n76 3",
"output": "8240"
},
{
"input": "55 6\n24 4",
"output": "1110"
},
{
"input": "41 16\n43 2",
"output": "2029"
},
{
"input": "99 93\n78 1",
"output": "8961"
},
{
"input": "10 7\n44 2",
"output": "1297"
},
{
"input": "72 54\n91 3",
"output": "11781"
},
{
"input": "48 34\n80 2",
"output": "6376"
},
{
"input": "92 85\n70 1",
"output": "7373"
}
] | 1,621,661,567
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 64
| 170
| 4,403,200
|
def f(start,end,time,dif):
dp=[[-float("inf") for j in range(1000) ]for i in range(time+1)]
dp[0][start]=start
for i in range(time):
for val in range(1000):
for d in range(-dif,dif+1):
if val+d>=0 and val+d<1000:
dp[i+1][val+d]=max(dp[i][val]+val+d,dp[i+1][val+d])
return dp[time-1][end]
start,end=map(int,input().strip().split())
time,dif=map(int,input().strip().split())
print(f(start,end,time,dif))
'''
▄████████ ▄█ █▄ ▄█ ▄█ █▄ ▄████████ ▄████████ ▄█
███ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███
███ █▀ ███ ███ ███▌ ███ ███ ███ ███ ███ ███ ███
███ ▄███▄▄▄▄███▄▄ ███▌ ███ ███ ▄███▄▄▄▄██▀ ███ ███ ███
▀███████████ ▀▀███▀▀▀▀███▀ ███▌ ███ ███ ▀▀███▀▀▀▀▀ ▀███████████ ███
███ ███ ███ ███ ███ ███ ▀███████████ ███ ███ ███
▄█ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███▌ ▄
▄████████▀ ███ █▀ █▀ ▀██████▀ ███ ███ ███ █▀ █████▄▄██
███ ███ ▀
'''
|
Title: Covered Path
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The on-board computer on Polycarp's car measured that the car speed at the beginning of some section of the path equals *v*1 meters per second, and in the end it is *v*2 meters per second. We know that this section of the route took exactly *t* seconds to pass.
Assuming that at each of the seconds the speed is constant, and between seconds the speed can change at most by *d* meters per second in absolute value (i.e., the difference in the speed of any two adjacent seconds does not exceed *d* in absolute value), find the maximum possible length of the path section in meters.
Input Specification:
The first line contains two integers *v*1 and *v*2 (1<=≤<=*v*1,<=*v*2<=≤<=100) — the speeds in meters per second at the beginning of the segment and at the end of the segment, respectively.
The second line contains two integers *t* (2<=≤<=*t*<=≤<=100) — the time when the car moves along the segment in seconds, *d* (0<=≤<=*d*<=≤<=10) — the maximum value of the speed change between adjacent seconds.
It is guaranteed that there is a way to complete the segment so that:
- the speed in the first second equals *v*1, - the speed in the last second equals *v*2, - the absolute value of difference of speeds between any two adjacent seconds doesn't exceed *d*.
Output Specification:
Print the maximum possible length of the path segment in meters.
Demo Input:
['5 6\n4 2\n', '10 10\n10 0\n']
Demo Output:
['26', '100']
Note:
In the first sample the sequence of speeds of Polycarpus' car can look as follows: 5, 7, 8, 6. Thus, the total path is 5 + 7 + 8 + 6 = 26 meters.
In the second sample, as *d* = 0, the car covers the whole segment at constant speed *v* = 10. In *t* = 10 seconds it covers the distance of 100 meters.
|
```python
def f(start,end,time,dif):
dp=[[-float("inf") for j in range(1000) ]for i in range(time+1)]
dp[0][start]=start
for i in range(time):
for val in range(1000):
for d in range(-dif,dif+1):
if val+d>=0 and val+d<1000:
dp[i+1][val+d]=max(dp[i][val]+val+d,dp[i+1][val+d])
return dp[time-1][end]
start,end=map(int,input().strip().split())
time,dif=map(int,input().strip().split())
print(f(start,end,time,dif))
'''
▄████████ ▄█ █▄ ▄█ ▄█ █▄ ▄████████ ▄████████ ▄█
███ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███
███ █▀ ███ ███ ███▌ ███ ███ ███ ███ ███ ███ ███
███ ▄███▄▄▄▄███▄▄ ███▌ ███ ███ ▄███▄▄▄▄██▀ ███ ███ ███
▀███████████ ▀▀███▀▀▀▀███▀ ███▌ ███ ███ ▀▀███▀▀▀▀▀ ▀███████████ ███
███ ███ ███ ███ ███ ███ ▀███████████ ███ ███ ███
▄█ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███ ███▌ ▄
▄████████▀ ███ █▀ █▀ ▀██████▀ ███ ███ ███ █▀ █████▄▄██
███ ███ ▀
'''
```
| 3
|
|
946
|
B
|
Weird Subtraction Process
|
PROGRAMMING
| 1,100
|
[
"math",
"number theory"
] | null | null |
You have two variables *a* and *b*. Consider the following sequence of actions performed with these variables:
1. If *a*<==<=0 or *b*<==<=0, end the process. Otherwise, go to step 2;1. If *a*<=≥<=2·*b*, then set the value of *a* to *a*<=-<=2·*b*, and repeat step 1. Otherwise, go to step 3;1. If *b*<=≥<=2·*a*, then set the value of *b* to *b*<=-<=2·*a*, and repeat step 1. Otherwise, end the process.
Initially the values of *a* and *b* are positive integers, and so the process will be finite.
You have to determine the values of *a* and *b* after the process ends.
|
The only line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=1018). *n* is the initial value of variable *a*, and *m* is the initial value of variable *b*.
|
Print two integers — the values of *a* and *b* after the end of the process.
|
[
"12 5\n",
"31 12\n"
] |
[
"0 1\n",
"7 12\n"
] |
Explanations to the samples:
1. *a* = 12, *b* = 5 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 2, *b* = 5 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 2, *b* = 1 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 0, *b* = 1;1. *a* = 31, *b* = 12 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 7, *b* = 12.
| 0
|
[
{
"input": "12 5",
"output": "0 1"
},
{
"input": "31 12",
"output": "7 12"
},
{
"input": "1000000000000000000 7",
"output": "8 7"
},
{
"input": "31960284556200 8515664064180",
"output": "14928956427840 8515664064180"
},
{
"input": "1000000000000000000 1000000000000000000",
"output": "1000000000000000000 1000000000000000000"
},
{
"input": "1 1000",
"output": "1 0"
},
{
"input": "1 1000000",
"output": "1 0"
},
{
"input": "1 1000000000000000",
"output": "1 0"
},
{
"input": "1 99999999999999999",
"output": "1 1"
},
{
"input": "1 4",
"output": "1 0"
},
{
"input": "1000000000000001 500000000000000",
"output": "1 0"
},
{
"input": "1 1000000000000000000",
"output": "1 0"
},
{
"input": "2 4",
"output": "2 0"
},
{
"input": "2 1",
"output": "0 1"
},
{
"input": "6 19",
"output": "6 7"
},
{
"input": "22 5",
"output": "0 1"
},
{
"input": "10000000000000000 100000000000000001",
"output": "0 1"
},
{
"input": "1 1000000000000",
"output": "1 0"
},
{
"input": "2 1000000000000000",
"output": "2 0"
},
{
"input": "2 10",
"output": "2 2"
},
{
"input": "51 100",
"output": "51 100"
},
{
"input": "3 1000000000000000000",
"output": "3 4"
},
{
"input": "1000000000000000000 3",
"output": "4 3"
},
{
"input": "1 10000000000000000",
"output": "1 0"
},
{
"input": "8796203 7556",
"output": "1019 1442"
},
{
"input": "5 22",
"output": "1 0"
},
{
"input": "1000000000000000000 1",
"output": "0 1"
},
{
"input": "1 100000000000",
"output": "1 0"
},
{
"input": "2 1000000000000",
"output": "2 0"
},
{
"input": "5 4567865432345678",
"output": "5 8"
},
{
"input": "576460752303423487 288230376151711743",
"output": "1 1"
},
{
"input": "499999999999999999 1000000000000000000",
"output": "3 2"
},
{
"input": "1 9999999999999",
"output": "1 1"
},
{
"input": "103 1000000000000000000",
"output": "103 196"
},
{
"input": "7 1",
"output": "1 1"
},
{
"input": "100000000000000001 10000000000000000",
"output": "1 0"
},
{
"input": "5 10",
"output": "5 0"
},
{
"input": "7 11",
"output": "7 11"
},
{
"input": "1 123456789123456",
"output": "1 0"
},
{
"input": "5000000000000 100000000000001",
"output": "0 1"
},
{
"input": "1000000000000000 1",
"output": "0 1"
},
{
"input": "1000000000000000000 499999999999999999",
"output": "2 3"
},
{
"input": "10 5",
"output": "0 5"
},
{
"input": "9 18917827189272",
"output": "9 0"
},
{
"input": "179 100000000000497000",
"output": "179 270"
},
{
"input": "5 100000000000001",
"output": "1 1"
},
{
"input": "5 20",
"output": "5 0"
},
{
"input": "100000001 50000000",
"output": "1 0"
},
{
"input": "345869461223138161 835002744095575440",
"output": "1 0"
},
{
"input": "8589934592 4294967296",
"output": "0 4294967296"
},
{
"input": "4 8",
"output": "4 0"
},
{
"input": "1 100000000000000000",
"output": "1 0"
},
{
"input": "1000000000000000000 333333333333333",
"output": "1000 1333"
},
{
"input": "25 12",
"output": "1 0"
},
{
"input": "24 54",
"output": "0 6"
},
{
"input": "6 12",
"output": "6 0"
},
{
"input": "129200000000305 547300000001292",
"output": "1 0"
},
{
"input": "1000000000000000000 49999999999999999",
"output": "20 39"
},
{
"input": "1 2",
"output": "1 0"
},
{
"input": "1 123456789876",
"output": "1 0"
},
{
"input": "2 3",
"output": "2 3"
},
{
"input": "1 3",
"output": "1 1"
},
{
"input": "1 1",
"output": "1 1"
},
{
"input": "19 46",
"output": "3 2"
},
{
"input": "3 6",
"output": "3 0"
},
{
"input": "129 1000000000000000000",
"output": "1 0"
},
{
"input": "12 29",
"output": "0 1"
},
{
"input": "8589934592 2147483648",
"output": "0 2147483648"
},
{
"input": "2147483648 8589934592",
"output": "2147483648 0"
},
{
"input": "5 6",
"output": "5 6"
},
{
"input": "1000000000000000000 2",
"output": "0 2"
},
{
"input": "2 7",
"output": "2 3"
},
{
"input": "17174219820754872 61797504734333370",
"output": "17174219820754872 27449065092823626"
},
{
"input": "49 100",
"output": "1 0"
},
{
"input": "7 17",
"output": "1 1"
},
{
"input": "1000000000000000000 10000001",
"output": "0 1"
},
{
"input": "49999999999999999 2",
"output": "3 2"
},
{
"input": "49999999999999999 1",
"output": "1 1"
},
{
"input": "576460752303423487 2",
"output": "3 2"
},
{
"input": "19395 19395",
"output": "19395 19395"
},
{
"input": "19394 19394",
"output": "19394 19394"
}
] | 1,537,825,633
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 2
| 1,000
| 0
|
numbers = input()
numbersList = numbers.split()
a = int(numbersList[0])
b = int(numbersList[1])
while(a>0 or b>0):
if a==0 or b==0:
print(str(a) + " " + str(b))
break
elif a >= 2*b:
a -= 2*b
elif b >= 2*a:
b -= 2*a
else:
print(str(a) + " " + str(b))
break
|
Title: Weird Subtraction Process
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have two variables *a* and *b*. Consider the following sequence of actions performed with these variables:
1. If *a*<==<=0 or *b*<==<=0, end the process. Otherwise, go to step 2;1. If *a*<=≥<=2·*b*, then set the value of *a* to *a*<=-<=2·*b*, and repeat step 1. Otherwise, go to step 3;1. If *b*<=≥<=2·*a*, then set the value of *b* to *b*<=-<=2·*a*, and repeat step 1. Otherwise, end the process.
Initially the values of *a* and *b* are positive integers, and so the process will be finite.
You have to determine the values of *a* and *b* after the process ends.
Input Specification:
The only line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=1018). *n* is the initial value of variable *a*, and *m* is the initial value of variable *b*.
Output Specification:
Print two integers — the values of *a* and *b* after the end of the process.
Demo Input:
['12 5\n', '31 12\n']
Demo Output:
['0 1\n', '7 12\n']
Note:
Explanations to the samples:
1. *a* = 12, *b* = 5 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 2, *b* = 5 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 2, *b* = 1 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 0, *b* = 1;1. *a* = 31, *b* = 12 <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> *a* = 7, *b* = 12.
|
```python
numbers = input()
numbersList = numbers.split()
a = int(numbersList[0])
b = int(numbersList[1])
while(a>0 or b>0):
if a==0 or b==0:
print(str(a) + " " + str(b))
break
elif a >= 2*b:
a -= 2*b
elif b >= 2*a:
b -= 2*a
else:
print(str(a) + " " + str(b))
break
```
| 0
|
|
52
|
C
|
Circular RMQ
|
PROGRAMMING
| 2,200
|
[
"data structures"
] |
C. Circular RMQ
|
1
|
256
|
You are given circular array *a*0,<=*a*1,<=...,<=*a**n*<=-<=1. There are two types of operations with it:
- *inc*(*lf*,<=*rg*,<=*v*) — this operation increases each element on the segment [*lf*,<=*rg*] (inclusively) by *v*; - *rmq*(*lf*,<=*rg*) — this operation returns minimal value on the segment [*lf*,<=*rg*] (inclusively).
Assume segments to be circular, so if *n*<==<=5 and *lf*<==<=3,<=*rg*<==<=1, it means the index sequence: 3,<=4,<=0,<=1.
Write program to process given sequence of operations.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=200000). The next line contains initial state of the array: *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 (<=-<=106<=≤<=*a**i*<=≤<=106), *a**i* are integer. The third line contains integer *m* (0<=≤<=*m*<=≤<=200000), *m* — the number of operartons. Next *m* lines contain one operation each. If line contains two integer *lf*,<=*rg* (0<=≤<=*lf*,<=*rg*<=≤<=*n*<=-<=1) it means *rmq* operation, it contains three integers *lf*,<=*rg*,<=*v* (0<=≤<=*lf*,<=*rg*<=≤<=*n*<=-<=1;<=-<=106<=≤<=*v*<=≤<=106) — *inc* operation.
|
For each *rmq* operation write result for it. Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preffered to use cout (also you may use %I64d).
|
[
"4\n1 2 3 4\n4\n3 0\n3 0 -1\n0 1\n2 1\n"
] |
[
"1\n0\n0\n"
] |
none
| 1,500
|
[
{
"input": "4\n1 2 3 4\n4\n3 0\n3 0 -1\n0 1\n2 1",
"output": "1\n0\n0"
},
{
"input": "1\n-1\n10\n0 0 -1\n0 0\n0 0 1\n0 0\n0 0 1\n0 0\n0 0 0\n0 0\n0 0 -1\n0 0 1",
"output": "-2\n-1\n0\n0"
},
{
"input": "2\n-1 -1\n10\n0 0\n0 0\n0 0 1\n0 0\n1 1\n0 0 -1\n0 0 0\n0 0 1\n1 1 0\n0 0 -1",
"output": "-1\n-1\n0\n-1"
}
] | 1,687,684,268
| 2,147,483,647
|
PyPy 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 7
| 1,500
| 21,811,200
|
from sys import stdin
def read_input():
n = int(stdin.readline())
a = list(map(int, stdin.readline().split()))
m = int(stdin.readline())
return n, a, m
def write_output(result):
print('\n'.join(map(str, result)))
def inc(lf, rg, v):
if lf <= rg:
for i in range(lf, rg + 1):
a[i] += v
else:
for i in range(lf, n):
a[i] += v
for i in range(rg + 1):
a[i] += v
def rmq(lf, rg):
if lf <= rg:
return min(a[lf:rg + 1])
else:
return min(a[lf:] + a[:rg + 1])
def solve():
result = []
for _ in range(m):
op = list(map(int, stdin.readline().split()))
if len(op) == 2:
result.append(rmq(op[0], op[1]))
else:
inc(op[0], op[1], op[2])
return result
n, a, m = read_input()
result = solve()
write_output(result)
|
Title: Circular RMQ
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given circular array *a*0,<=*a*1,<=...,<=*a**n*<=-<=1. There are two types of operations with it:
- *inc*(*lf*,<=*rg*,<=*v*) — this operation increases each element on the segment [*lf*,<=*rg*] (inclusively) by *v*; - *rmq*(*lf*,<=*rg*) — this operation returns minimal value on the segment [*lf*,<=*rg*] (inclusively).
Assume segments to be circular, so if *n*<==<=5 and *lf*<==<=3,<=*rg*<==<=1, it means the index sequence: 3,<=4,<=0,<=1.
Write program to process given sequence of operations.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=200000). The next line contains initial state of the array: *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 (<=-<=106<=≤<=*a**i*<=≤<=106), *a**i* are integer. The third line contains integer *m* (0<=≤<=*m*<=≤<=200000), *m* — the number of operartons. Next *m* lines contain one operation each. If line contains two integer *lf*,<=*rg* (0<=≤<=*lf*,<=*rg*<=≤<=*n*<=-<=1) it means *rmq* operation, it contains three integers *lf*,<=*rg*,<=*v* (0<=≤<=*lf*,<=*rg*<=≤<=*n*<=-<=1;<=-<=106<=≤<=*v*<=≤<=106) — *inc* operation.
Output Specification:
For each *rmq* operation write result for it. Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preffered to use cout (also you may use %I64d).
Demo Input:
['4\n1 2 3 4\n4\n3 0\n3 0 -1\n0 1\n2 1\n']
Demo Output:
['1\n0\n0\n']
Note:
none
|
```python
from sys import stdin
def read_input():
n = int(stdin.readline())
a = list(map(int, stdin.readline().split()))
m = int(stdin.readline())
return n, a, m
def write_output(result):
print('\n'.join(map(str, result)))
def inc(lf, rg, v):
if lf <= rg:
for i in range(lf, rg + 1):
a[i] += v
else:
for i in range(lf, n):
a[i] += v
for i in range(rg + 1):
a[i] += v
def rmq(lf, rg):
if lf <= rg:
return min(a[lf:rg + 1])
else:
return min(a[lf:] + a[:rg + 1])
def solve():
result = []
for _ in range(m):
op = list(map(int, stdin.readline().split()))
if len(op) == 2:
result.append(rmq(op[0], op[1]))
else:
inc(op[0], op[1], op[2])
return result
n, a, m = read_input()
result = solve()
write_output(result)
```
| 0
|
499
|
B
|
Lecture
|
PROGRAMMING
| 1,000
|
[
"implementation",
"strings"
] | null | null |
You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes.
You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning.
You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language.
You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes.
|
The first line contains two integers, *n* and *m* (1<=≤<=*n*<=≤<=3000, 1<=≤<=*m*<=≤<=3000) — the number of words in the professor's lecture and the number of words in each of these languages.
The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once.
The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* — the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}.
All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters.
|
Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input.
|
[
"4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n",
"5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n"
] |
[
"codeforces round letter round\n",
"hbnyiyc joll joll un joll\n"
] |
none
| 500
|
[
{
"input": "4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest",
"output": "codeforces round letter round"
},
{
"input": "5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll",
"output": "hbnyiyc joll joll un joll"
},
{
"input": "5 5\nqueyqj f\nb vn\ntabzvk qpfzoqx\nytnyonoc hnxsd\njpggvr lchinjmt\nqueyqj jpggvr b ytnyonoc b",
"output": "f jpggvr b hnxsd b"
},
{
"input": "10 22\nazbrll oen\ngh vdyayei\njphveblohx vfglv\nmfyxib jepnvhcuwo\nrpikazqj uam\nl rx\nokjenof qpnyi\nj tixqrno\nod itozmfct\nikkdxmirx ev\nqexftojc p\nkdazb zjs\nmbk ykvqjrxaxu\nhbcwhouzq pwt\nmirpsz zfaegpl\nuhkkvcj rlvwj\nef iqnnwtolrc\npjzfcpmeag ecdayth\nsa qcthz\ncbfhfxi qrnbvdryz\nwqel tj\natx smkbid\nef hbcwhouzq cbfhfxi hbcwhouzq mirpsz cbfhfxi cbfhfxi okjenof pjzfcpmeag kdazb",
"output": "ef pwt cbfhfxi pwt mirpsz cbfhfxi cbfhfxi qpnyi ecdayth zjs"
},
{
"input": "1 1\namit am\namit",
"output": "am"
},
{
"input": "1 1\na c\na",
"output": "a"
}
] | 1,684,824,587
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 37
| 61
| 921,600
|
dictionary = {}
n, m = map(int, input().split())
for i in range(m):
a, b = input().split()
dictionary[a] = b
#print(dictionary)
for i in input().split():
print(min(i, dictionary[i], key=len), "", end="")
|
Title: Lecture
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes.
You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning.
You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language.
You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes.
Input Specification:
The first line contains two integers, *n* and *m* (1<=≤<=*n*<=≤<=3000, 1<=≤<=*m*<=≤<=3000) — the number of words in the professor's lecture and the number of words in each of these languages.
The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once.
The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* — the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}.
All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters.
Output Specification:
Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input.
Demo Input:
['4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n', '5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n']
Demo Output:
['codeforces round letter round\n', 'hbnyiyc joll joll un joll\n']
Note:
none
|
```python
dictionary = {}
n, m = map(int, input().split())
for i in range(m):
a, b = input().split()
dictionary[a] = b
#print(dictionary)
for i in input().split():
print(min(i, dictionary[i], key=len), "", end="")
```
| 3
|
|
676
|
C
|
Vasya and String
|
PROGRAMMING
| 1,500
|
[
"binary search",
"dp",
"strings",
"two pointers"
] | null | null |
High school student Vasya got a string of length *n* as a birthday present. This string consists of letters 'a' and 'b' only. Vasya denotes beauty of the string as the maximum length of a substring (consecutive subsequence) consisting of equal letters.
Vasya can change no more than *k* characters of the original string. What is the maximum beauty of the string he can achieve?
|
The first line of the input contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100<=000,<=0<=≤<=*k*<=≤<=*n*) — the length of the string and the maximum number of characters to change.
The second line contains the string, consisting of letters 'a' and 'b' only.
|
Print the only integer — the maximum beauty of the string Vasya can achieve by changing no more than *k* characters.
|
[
"4 2\nabba\n",
"8 1\naabaabaa\n"
] |
[
"4\n",
"5\n"
] |
In the first sample, Vasya can obtain both strings "aaaa" and "bbbb".
In the second sample, the optimal answer is obtained with the string "aaaaabaa" or with the string "aabaaaaa".
| 1,500
|
[
{
"input": "4 2\nabba",
"output": "4"
},
{
"input": "8 1\naabaabaa",
"output": "5"
},
{
"input": "1 0\na",
"output": "1"
},
{
"input": "1 1\nb",
"output": "1"
},
{
"input": "1 0\nb",
"output": "1"
},
{
"input": "1 1\na",
"output": "1"
},
{
"input": "10 10\nbbbbbbbbbb",
"output": "10"
},
{
"input": "10 2\nbbbbbbbbbb",
"output": "10"
},
{
"input": "10 1\nbbabbabbba",
"output": "6"
},
{
"input": "10 10\nbbabbbaabb",
"output": "10"
},
{
"input": "10 9\nbabababbba",
"output": "10"
},
{
"input": "10 4\nbababbaaab",
"output": "9"
},
{
"input": "10 10\naabaaabaaa",
"output": "10"
},
{
"input": "10 10\naaaabbbaaa",
"output": "10"
},
{
"input": "10 1\nbaaaaaaaab",
"output": "9"
},
{
"input": "10 5\naaaaabaaaa",
"output": "10"
},
{
"input": "10 4\naaaaaaaaaa",
"output": "10"
},
{
"input": "100 10\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "100"
},
{
"input": "100 7\nbbbbabbbbbaabbbabbbbbbbbbbbabbbbbbbbbbbbbbbbbbbbbbbbbabbbbbbbbbbbabbabbbbbbbbbbbbbbbbbbbbbbbbbbbbbab",
"output": "93"
},
{
"input": "100 30\nbbaabaaabbbbbbbbbbaababababbbbbbaabaabbbbbbbbabbbbbabbbbabbbbbbbbaabbbbbbbbbabbbbbabbbbbbbbbaaaaabba",
"output": "100"
},
{
"input": "100 6\nbaababbbaabbabbaaabbabbaabbbbbbbbaabbbabbbbaabbabbbbbabababbbbabbbbbbabbbbbbbbbaaaabbabbbbaabbabaabb",
"output": "34"
},
{
"input": "100 45\naabababbabbbaaabbbbbbaabbbabbaabbbbbabbbbbbbbabbbbbbabbaababbaabbababbbbbbababbbbbaabbbbbbbaaaababab",
"output": "100"
},
{
"input": "100 2\nababaabababaaababbaaaabbaabbbababbbaaabbbbabababbbabababaababaaabaabbbbaaabbbabbbbbabbbbbbbaabbabbba",
"output": "17"
},
{
"input": "100 25\nbabbbaaababaaabbbaabaabaabbbabbabbbbaaaaaaabaaabaaaaaaaaaabaaaabaaabbbaaabaaababaaabaabbbbaaaaaaaaaa",
"output": "80"
},
{
"input": "100 14\naabaaaaabababbabbabaaaabbaaaabaaabbbaaabaaaaaaaabaaaaabbaaaaaaaaabaaaaaaabbaababaaaababbbbbabaaaabaa",
"output": "61"
},
{
"input": "100 8\naaaaabaaaabaabaaaaaaaabaaaabaaaaaaaaaaaaaabaaaaabaaaaaaaaaaaaaaaaabaaaababaabaaaaaaaaaaaaabbabaaaaaa",
"output": "76"
},
{
"input": "100 12\naaaaaaaaaaaaaaaabaaabaaaaaaaaaabbaaaabbabaaaaaaaaaaaaaaaaaaaaabbaaabaaaaaaaaaaaabaaaaaaaabaaaaaaaaaa",
"output": "100"
},
{
"input": "100 65\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "100"
},
{
"input": "10 0\nbbbbbbbbbb",
"output": "10"
},
{
"input": "10 0\nbbbbabbbbb",
"output": "5"
},
{
"input": "10 0\nbbabbbabba",
"output": "3"
},
{
"input": "10 0\nbaabbbbaba",
"output": "4"
},
{
"input": "10 0\naababbbbaa",
"output": "4"
},
{
"input": "10 2\nabbbbbaaba",
"output": "8"
},
{
"input": "10 0\nabbaaabaaa",
"output": "3"
},
{
"input": "10 0\naabbaaabaa",
"output": "3"
},
{
"input": "10 1\naaaaaababa",
"output": "8"
},
{
"input": "10 0\nbaaaaaaaaa",
"output": "9"
},
{
"input": "10 0\naaaaaaaaaa",
"output": "10"
},
{
"input": "100 0\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "100"
},
{
"input": "100 0\nbbbbbbbbbbabbbbaaabbbbbbbbbbbabbbabbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbabbbbbbbbbabbbbbbbbbbbbbab",
"output": "40"
},
{
"input": "100 11\nbaabbbbbababbbbabbbbbbbabbbbbbbbbbbbbbabbbbbbababbbbababbbbaaabbbbabbbbbabbbbbbbbabababbbabbbbbbbabb",
"output": "65"
},
{
"input": "100 8\nbbababbbbbaabbbaaababbbbababababbbbababbabbbabbbbbaabbbabbbababbabbbbabbbabbbbaabbbbabbbaabbbbaaaabb",
"output": "33"
},
{
"input": "100 21\nabbaaaabbbababaabbbababbbbbbbbabbaababababbbabbbaaabbaaabbbbabbabbbabbbabaababbbabbbbbabbbbbbabbbbab",
"output": "65"
},
{
"input": "100 9\nabbbaabaabaaaaaaabbabbbababbaaabbbaaabbaabaaaaabbbbbabbaabaabbbbbaaaaababbaaabbabaabaaabababbaababbb",
"output": "26"
},
{
"input": "100 5\naababababbaaaaaaaabbbabaaaabbabaaaabbaabaaaaabababbabaabaaabaaaaaaaabaababbabbaaabaabbabbaaaaabbabba",
"output": "22"
},
{
"input": "100 9\naababaabaaaaaaaaabbbaabaaaaaaabaaaaaaaaaaaaabaaabaabaabbbbabbaababbabbaaaabbababaabaababaabaaaaaaaaa",
"output": "49"
},
{
"input": "100 6\naaaaabbaaaaaaaaaaabaaaabaaaaaaaaabaaabaaaaaabaaaaaaaaaaabaabaaaabaaaaaaaaaaaaaaabaabbaaaaaaaaaaaaaaa",
"output": "56"
},
{
"input": "100 7\nabaaabaabaabaaaaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaabaaabaaaaaaabbabaaaaaaaaaaaaaaaaabaaaaaaaaaaaaaaaaba",
"output": "86"
},
{
"input": "100 0\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "100"
}
] | 1,646,616,394
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 117
| 124
| 102,400
|
n, k = map(int, input().split())
s = input()
a, b = 0, 0
j = 0
ans = 0
for i in s:
if i == 'a':
a += 1
else:
b += 1
if min(a, b) > k:
if s[j] == 'a':
a -= 1
else:
b -= 1
j += 1
else:
ans += 1
print(ans)
|
Title: Vasya and String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
High school student Vasya got a string of length *n* as a birthday present. This string consists of letters 'a' and 'b' only. Vasya denotes beauty of the string as the maximum length of a substring (consecutive subsequence) consisting of equal letters.
Vasya can change no more than *k* characters of the original string. What is the maximum beauty of the string he can achieve?
Input Specification:
The first line of the input contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100<=000,<=0<=≤<=*k*<=≤<=*n*) — the length of the string and the maximum number of characters to change.
The second line contains the string, consisting of letters 'a' and 'b' only.
Output Specification:
Print the only integer — the maximum beauty of the string Vasya can achieve by changing no more than *k* characters.
Demo Input:
['4 2\nabba\n', '8 1\naabaabaa\n']
Demo Output:
['4\n', '5\n']
Note:
In the first sample, Vasya can obtain both strings "aaaa" and "bbbb".
In the second sample, the optimal answer is obtained with the string "aaaaabaa" or with the string "aabaaaaa".
|
```python
n, k = map(int, input().split())
s = input()
a, b = 0, 0
j = 0
ans = 0
for i in s:
if i == 'a':
a += 1
else:
b += 1
if min(a, b) > k:
if s[j] == 'a':
a -= 1
else:
b -= 1
j += 1
else:
ans += 1
print(ans)
```
| 3
|
Subsets and Splits
Successful Python Submissions
Retrieves all records from the train dataset where the verdict is 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Retrieves records of users with a rating of 1600 or higher and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a rating above 2000 and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a 'OK' verdict, providing a basic overview of a specific category within the dataset.