contestId
int64 0
1.01k
| index
stringclasses 57
values | name
stringlengths 2
58
| type
stringclasses 2
values | rating
int64 0
3.5k
| tags
listlengths 0
11
| title
stringclasses 522
values | time-limit
stringclasses 8
values | memory-limit
stringclasses 8
values | problem-description
stringlengths 0
7.15k
| input-specification
stringlengths 0
2.05k
| output-specification
stringlengths 0
1.5k
| demo-input
listlengths 0
7
| demo-output
listlengths 0
7
| note
stringlengths 0
5.24k
| points
float64 0
425k
| test_cases
listlengths 0
402
| creationTimeSeconds
int64 1.37B
1.7B
| relativeTimeSeconds
int64 8
2.15B
| programmingLanguage
stringclasses 3
values | verdict
stringclasses 14
values | testset
stringclasses 12
values | passedTestCount
int64 0
1k
| timeConsumedMillis
int64 0
15k
| memoryConsumedBytes
int64 0
805M
| code
stringlengths 3
65.5k
| prompt
stringlengths 262
8.2k
| response
stringlengths 17
65.5k
| score
float64 -1
3.99
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
986
|
D
|
Perfect Encoding
|
PROGRAMMING
| 3,100
|
[
"fft",
"math"
] | null | null |
You are working as an analyst in a company working on a new system for big data storage. This system will store $n$ different objects. Each object should have a unique ID.
To create the system, you choose the parameters of the system — integers $m \ge 1$ and $b_{1}, b_{2}, \ldots, b_{m}$. With these parameters an ID of some object in the system is an array of integers $[a_{1}, a_{2}, \ldots, a_{m}]$ where $1 \le a_{i} \le b_{i}$ holds for every $1 \le i \le m$.
Developers say that production costs are proportional to $\sum_{i=1}^{m} b_{i}$. You are asked to choose parameters $m$ and $b_{i}$ so that the system will be able to assign unique IDs to $n$ different objects and production costs are minimized. Note that you don't have to use all available IDs.
|
In the only line of input there is one positive integer $n$. The length of the decimal representation of $n$ is no greater than $1.5 \cdot 10^{6}$. The integer does not contain leading zeros.
|
Print one number — minimal value of $\sum_{i=1}^{m} b_{i}$.
|
[
"36\n",
"37\n",
"12345678901234567890123456789\n"
] |
[
"10\n",
"11\n",
"177\n"
] |
none
| 2,500
|
[
{
"input": "36",
"output": "10"
},
{
"input": "37",
"output": "11"
},
{
"input": "12345678901234567890123456789",
"output": "177"
},
{
"input": "1",
"output": "1"
},
{
"input": "2",
"output": "2"
},
{
"input": "3",
"output": "3"
},
{
"input": "4",
"output": "4"
},
{
"input": "7421902501252475186372406731932548506197390793597574544727433297197476846519276598727359617092494798",
"output": "629"
},
{
"input": "71057885893313745806894531138592341136175030511382512555364579061229040750815096670263802546201989828165866147027119861863385397179695224216202346062872417111920113483747119385957051753101263769591892062039112567316036455789217245754461225443096439906225767290690128677713047690686004149082311677134836383178262318973298581951974863511315252485252083010690948164456205330279738760034861583874764199950445592461479109814313530332776429627014232776723160331462731018692207739471347664936326394313671025",
"output": "3144"
},
{
"input": "515377520732011331036461129765621272702107522001",
"output": "300"
},
{
"input": "515377520732011331036461129765621272702107522002",
"output": "301"
},
{
"input": "515377520732011331036461129765621272702107522000",
"output": "300"
},
{
"input": "2644141638961613273780910519504288731930844065504296335329840736453657194693409799081556627701216123927819555393745164711901909164201237823730685450515907348055240450396641607756029548457929682548780800235177236082257895631246188876123132346108173348981012356250960688811094108794077791634930736509832272441660537127557164580456832796615775793837112808169797875218746484343692719877391033530037881176218120852179342877728205628700771297494331664021228732264346205537805710440002",
"output": "3002"
}
] | 1,696,936,794
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 51
| 249
| 5,939,200
|
import decimal
from math import ceil, floor, inf, log
n = input()
if n=='1':
print(1)
exit()
decimal.getcontext().prec = len(n)+6
decimal.getcontext().Emax = len(n)+6
log3 = log(10)*(len(n)-1)/log(3)
pref = n
if len(pref)>20:
pref = pref[:20]
pref = pref[0] + '.' + pref[1:]
log3 += log(float(pref))/log(3)
log3+=1e-8
full = max(0, floor(log3))
small=0
if full>=1 and log3-full<=log(2)/log(3)*2-1:
small=2
full-=1
elif log3-full<=log(2)/log(3):
small = 1
else:
full+=1
n = decimal.Decimal(n)
ans = full*3 + small*2
def check(f,s):
global ans
res = decimal.Decimal(3)**f * (2**s)
if res>=n:
ans = min(ans,f*3+s*2)
if small==0 and full>=1:
full-=1
small+=1
check(full,small)
elif small==1 and full>=1:
full-=1
small+=1
check(full,small)
elif small==2:
small-=2
full+=1
check(full,small)
print(ans)
|
Title: Perfect Encoding
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are working as an analyst in a company working on a new system for big data storage. This system will store $n$ different objects. Each object should have a unique ID.
To create the system, you choose the parameters of the system — integers $m \ge 1$ and $b_{1}, b_{2}, \ldots, b_{m}$. With these parameters an ID of some object in the system is an array of integers $[a_{1}, a_{2}, \ldots, a_{m}]$ where $1 \le a_{i} \le b_{i}$ holds for every $1 \le i \le m$.
Developers say that production costs are proportional to $\sum_{i=1}^{m} b_{i}$. You are asked to choose parameters $m$ and $b_{i}$ so that the system will be able to assign unique IDs to $n$ different objects and production costs are minimized. Note that you don't have to use all available IDs.
Input Specification:
In the only line of input there is one positive integer $n$. The length of the decimal representation of $n$ is no greater than $1.5 \cdot 10^{6}$. The integer does not contain leading zeros.
Output Specification:
Print one number — minimal value of $\sum_{i=1}^{m} b_{i}$.
Demo Input:
['36\n', '37\n', '12345678901234567890123456789\n']
Demo Output:
['10\n', '11\n', '177\n']
Note:
none
|
```python
import decimal
from math import ceil, floor, inf, log
n = input()
if n=='1':
print(1)
exit()
decimal.getcontext().prec = len(n)+6
decimal.getcontext().Emax = len(n)+6
log3 = log(10)*(len(n)-1)/log(3)
pref = n
if len(pref)>20:
pref = pref[:20]
pref = pref[0] + '.' + pref[1:]
log3 += log(float(pref))/log(3)
log3+=1e-8
full = max(0, floor(log3))
small=0
if full>=1 and log3-full<=log(2)/log(3)*2-1:
small=2
full-=1
elif log3-full<=log(2)/log(3):
small = 1
else:
full+=1
n = decimal.Decimal(n)
ans = full*3 + small*2
def check(f,s):
global ans
res = decimal.Decimal(3)**f * (2**s)
if res>=n:
ans = min(ans,f*3+s*2)
if small==0 and full>=1:
full-=1
small+=1
check(full,small)
elif small==1 and full>=1:
full-=1
small+=1
check(full,small)
elif small==2:
small-=2
full+=1
check(full,small)
print(ans)
```
| 3
|
|
920
|
C
|
Swap Adjacent Elements
|
PROGRAMMING
| 1,400
|
[
"dfs and similar",
"greedy",
"math",
"sortings",
"two pointers"
] | null | null |
You have an array *a* consisting of *n* integers. Each integer from 1 to *n* appears exactly once in this array.
For some indices *i* (1<=≤<=*i*<=≤<=*n*<=-<=1) it is possible to swap *i*-th element with (*i*<=+<=1)-th, for other indices it is not possible. You may perform any number of swapping operations any order. There is no limit on the number of times you swap *i*-th element with (*i*<=+<=1)-th (if the position is not forbidden).
Can you make this array sorted in ascending order performing some sequence of swapping operations?
|
The first line contains one integer *n* (2<=≤<=*n*<=≤<=200000) — the number of elements in the array.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=200000) — the elements of the array. Each integer from 1 to *n* appears exactly once.
The third line contains a string of *n*<=-<=1 characters, each character is either 0 or 1. If *i*-th character is 1, then you can swap *i*-th element with (*i*<=+<=1)-th any number of times, otherwise it is forbidden to swap *i*-th element with (*i*<=+<=1)-th.
|
If it is possible to sort the array in ascending order using any sequence of swaps you are allowed to make, print YES. Otherwise, print NO.
|
[
"6\n1 2 5 3 4 6\n01110\n",
"6\n1 2 5 3 4 6\n01010\n"
] |
[
"YES\n",
"NO\n"
] |
In the first example you may swap *a*<sub class="lower-index">3</sub> and *a*<sub class="lower-index">4</sub>, and then swap *a*<sub class="lower-index">4</sub> and *a*<sub class="lower-index">5</sub>.
| 0
|
[
{
"input": "6\n1 2 5 3 4 6\n01110",
"output": "YES"
},
{
"input": "6\n1 2 5 3 4 6\n01010",
"output": "NO"
},
{
"input": "6\n1 6 3 4 5 2\n01101",
"output": "NO"
},
{
"input": "6\n2 3 1 4 5 6\n01111",
"output": "NO"
},
{
"input": "4\n2 3 1 4\n011",
"output": "NO"
},
{
"input": "2\n2 1\n0",
"output": "NO"
},
{
"input": "5\n1 2 4 5 3\n0101",
"output": "NO"
},
{
"input": "5\n1 2 4 5 3\n0001",
"output": "NO"
},
{
"input": "5\n1 4 5 2 3\n0110",
"output": "NO"
},
{
"input": "5\n4 5 1 2 3\n0111",
"output": "NO"
},
{
"input": "3\n3 1 2\n10",
"output": "NO"
},
{
"input": "5\n2 3 4 5 1\n0011",
"output": "NO"
},
{
"input": "16\n3 4 14 16 11 7 13 9 10 8 6 5 15 12 1 2\n111111101111111",
"output": "NO"
},
{
"input": "5\n1 5 3 4 2\n1101",
"output": "NO"
},
{
"input": "6\n6 1 2 3 4 5\n11101",
"output": "NO"
},
{
"input": "3\n2 3 1\n01",
"output": "NO"
},
{
"input": "6\n1 6 3 4 5 2\n01110",
"output": "NO"
},
{
"input": "7\n1 7 3 4 5 6 2\n010001",
"output": "NO"
},
{
"input": "5\n5 2 3 4 1\n1001",
"output": "NO"
},
{
"input": "4\n1 3 4 2\n001",
"output": "NO"
},
{
"input": "5\n4 5 1 2 3\n1011",
"output": "NO"
},
{
"input": "6\n1 5 3 4 2 6\n11011",
"output": "NO"
},
{
"input": "5\n1 4 2 5 3\n1101",
"output": "NO"
},
{
"input": "5\n3 2 4 1 5\n1010",
"output": "NO"
},
{
"input": "6\n1 4 3 5 6 2\n01101",
"output": "NO"
},
{
"input": "6\n2 3 4 5 1 6\n00010",
"output": "NO"
},
{
"input": "10\n5 2 7 9 1 10 3 4 6 8\n111101000",
"output": "NO"
},
{
"input": "5\n2 4 3 1 5\n0110",
"output": "NO"
},
{
"input": "4\n3 1 2 4\n100",
"output": "NO"
},
{
"input": "6\n1 5 3 4 2 6\n01010",
"output": "NO"
},
{
"input": "4\n3 1 2 4\n101",
"output": "NO"
},
{
"input": "4\n2 4 3 1\n011",
"output": "NO"
},
{
"input": "4\n2 3 4 1\n001",
"output": "NO"
},
{
"input": "4\n3 4 1 2\n011",
"output": "NO"
},
{
"input": "5\n2 4 1 3 5\n0110",
"output": "NO"
},
{
"input": "4\n1 3 4 2\n101",
"output": "NO"
},
{
"input": "20\n20 19 18 17 16 15 1 2 3 4 5 14 13 12 11 10 9 8 7 6\n1111111011111111111",
"output": "NO"
},
{
"input": "6\n6 5 4 1 2 3\n11100",
"output": "NO"
},
{
"input": "5\n2 3 5 1 4\n0011",
"output": "NO"
},
{
"input": "4\n1 4 2 3\n010",
"output": "NO"
},
{
"input": "6\n1 6 3 4 5 2\n01001",
"output": "NO"
},
{
"input": "7\n1 7 2 4 3 5 6\n011110",
"output": "NO"
},
{
"input": "5\n1 3 4 2 5\n0010",
"output": "NO"
},
{
"input": "5\n5 4 3 1 2\n1110",
"output": "NO"
},
{
"input": "5\n2 5 4 3 1\n0111",
"output": "NO"
},
{
"input": "4\n2 3 4 1\n101",
"output": "NO"
},
{
"input": "5\n1 4 5 2 3\n1011",
"output": "NO"
},
{
"input": "5\n1 3 2 5 4\n1110",
"output": "NO"
},
{
"input": "6\n3 2 4 1 5 6\n10111",
"output": "NO"
},
{
"input": "7\n3 1 7 4 5 2 6\n101110",
"output": "NO"
},
{
"input": "10\n5 4 10 9 2 1 6 7 3 8\n011111111",
"output": "NO"
},
{
"input": "5\n1 5 3 2 4\n1110",
"output": "NO"
},
{
"input": "4\n2 3 4 1\n011",
"output": "NO"
},
{
"input": "5\n5 4 3 2 1\n0000",
"output": "NO"
},
{
"input": "12\n6 9 11 1 12 7 5 8 10 4 3 2\n11111111110",
"output": "NO"
},
{
"input": "5\n3 1 5 2 4\n1011",
"output": "NO"
},
{
"input": "5\n4 5 1 2 3\n1110",
"output": "NO"
},
{
"input": "10\n1 2 3 4 5 6 8 9 7 10\n000000000",
"output": "NO"
},
{
"input": "6\n5 6 3 2 4 1\n01111",
"output": "NO"
},
{
"input": "5\n1 3 4 2 5\n0100",
"output": "NO"
},
{
"input": "4\n2 1 4 3\n100",
"output": "NO"
},
{
"input": "6\n1 2 3 4 6 5\n00000",
"output": "NO"
},
{
"input": "6\n4 6 5 3 2 1\n01111",
"output": "NO"
},
{
"input": "5\n3 1 4 5 2\n1001",
"output": "NO"
},
{
"input": "5\n5 2 3 1 4\n1011",
"output": "NO"
},
{
"input": "3\n2 3 1\n10",
"output": "NO"
},
{
"input": "10\n6 5 9 4 3 2 8 10 7 1\n111111110",
"output": "NO"
},
{
"input": "7\n1 2 7 3 4 5 6\n111101",
"output": "NO"
},
{
"input": "6\n5 6 1 2 4 3\n11101",
"output": "NO"
},
{
"input": "6\n4 6 3 5 2 1\n11110",
"output": "NO"
},
{
"input": "5\n5 4 2 3 1\n1110",
"output": "NO"
},
{
"input": "2\n2 1\n1",
"output": "YES"
},
{
"input": "3\n1 3 2\n10",
"output": "NO"
},
{
"input": "5\n3 4 5 1 2\n1110",
"output": "NO"
},
{
"input": "5\n3 4 2 1 5\n0110",
"output": "NO"
},
{
"input": "6\n6 1 2 3 4 5\n10001",
"output": "NO"
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10\n000000000",
"output": "YES"
},
{
"input": "3\n3 2 1\n00",
"output": "NO"
},
{
"input": "5\n5 4 3 2 1\n1110",
"output": "NO"
},
{
"input": "6\n3 1 2 5 6 4\n10011",
"output": "NO"
},
{
"input": "6\n3 2 1 6 5 4\n11000",
"output": "NO"
},
{
"input": "2\n1 2\n0",
"output": "YES"
},
{
"input": "2\n1 2\n1",
"output": "YES"
},
{
"input": "11\n1 2 3 4 5 6 7 8 9 10 11\n0000000000",
"output": "YES"
},
{
"input": "4\n2 4 3 1\n101",
"output": "NO"
},
{
"input": "4\n3 4 1 2\n101",
"output": "NO"
},
{
"input": "3\n1 3 2\n01",
"output": "YES"
},
{
"input": "6\n6 2 3 1 4 5\n11110",
"output": "NO"
},
{
"input": "3\n2 1 3\n01",
"output": "NO"
},
{
"input": "5\n1 5 4 3 2\n0111",
"output": "YES"
},
{
"input": "6\n1 2 6 3 4 5\n11110",
"output": "NO"
},
{
"input": "7\n2 3 1 7 6 5 4\n011111",
"output": "NO"
},
{
"input": "6\n5 6 1 2 3 4\n01111",
"output": "NO"
},
{
"input": "4\n1 2 4 3\n001",
"output": "YES"
},
{
"input": "6\n1 2 3 6 4 5\n11001",
"output": "NO"
},
{
"input": "11\n9 8 10 11 1 2 3 4 5 6 7\n1101111111",
"output": "NO"
},
{
"input": "5\n1 5 3 4 2\n0101",
"output": "NO"
},
{
"input": "10\n9 1 2 3 7 8 5 6 4 10\n110111100",
"output": "NO"
},
{
"input": "7\n1 2 7 3 4 5 6\n111011",
"output": "NO"
},
{
"input": "10\n3 10 1 2 6 4 5 7 8 9\n111111001",
"output": "NO"
},
{
"input": "10\n1 3 6 5 2 9 7 8 4 10\n001101111",
"output": "NO"
},
{
"input": "10\n1 8 9 7 6 10 4 2 3 5\n111111101",
"output": "NO"
},
{
"input": "7\n1 2 5 3 6 4 7\n111011",
"output": "NO"
},
{
"input": "4\n2 4 3 1\n100",
"output": "NO"
},
{
"input": "6\n1 2 3 4 6 5\n00001",
"output": "YES"
},
{
"input": "6\n2 1 3 4 5 6\n10000",
"output": "YES"
},
{
"input": "5\n3 2 1 5 4\n1100",
"output": "NO"
},
{
"input": "9\n2 1 3 6 5 4 7 9 8\n10011001",
"output": "YES"
},
{
"input": "8\n2 6 4 1 5 7 3 8\n1010010",
"output": "NO"
},
{
"input": "5\n1 2 4 5 3\n1101",
"output": "NO"
},
{
"input": "6\n1 3 5 2 4 6\n00110",
"output": "NO"
},
{
"input": "6\n1 3 6 2 4 5\n10111",
"output": "NO"
},
{
"input": "9\n9 8 7 6 5 4 3 1 2\n11111110",
"output": "NO"
},
{
"input": "10\n6 7 8 9 10 1 2 3 4 5\n111111110",
"output": "NO"
},
{
"input": "8\n6 1 7 8 3 2 5 4\n1011111",
"output": "NO"
},
{
"input": "70\n4 65 66 30 67 16 39 35 57 14 42 51 5 21 61 53 63 13 60 29 68 70 69 46 20 2 43 47 49 52 26 44 54 62 25 19 12 28 27 24 18 36 6 33 7 8 11 1 45 32 64 38 23 22 56 59 15 9 41 37 40 55 3 31 34 48 50 10 17 58\n111111101101111111111110101111111111111101101111010010110011011110010",
"output": "NO"
},
{
"input": "5\n5 3 2 4 1\n0100",
"output": "NO"
},
{
"input": "6\n3 2 6 5 1 4\n11011",
"output": "NO"
},
{
"input": "6\n1 2 4 5 6 3\n10011",
"output": "NO"
},
{
"input": "7\n1 7 3 2 5 6 4\n111001",
"output": "NO"
}
] | 1,518,344,882
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 124
| 1,000
| 19,456,000
|
n = int(input())
s = input().split()
cs = input()
t = []
if cs == (n-1)*'1':
st = True
else:
st = True
for c in s:
t.append(int(c))
for x in range(n):
if t[x]!=x+1:
pos=0
while(t[x+pos]!=x+1):
pos+=1
if cs[x:x+pos]!=pos*'1':
st = False
break
else:
z = t[x]
t[x]=t[x+pos]
t[x+pos] = z
if st:
print('YES')
else:
print('NO')
|
Title: Swap Adjacent Elements
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have an array *a* consisting of *n* integers. Each integer from 1 to *n* appears exactly once in this array.
For some indices *i* (1<=≤<=*i*<=≤<=*n*<=-<=1) it is possible to swap *i*-th element with (*i*<=+<=1)-th, for other indices it is not possible. You may perform any number of swapping operations any order. There is no limit on the number of times you swap *i*-th element with (*i*<=+<=1)-th (if the position is not forbidden).
Can you make this array sorted in ascending order performing some sequence of swapping operations?
Input Specification:
The first line contains one integer *n* (2<=≤<=*n*<=≤<=200000) — the number of elements in the array.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=200000) — the elements of the array. Each integer from 1 to *n* appears exactly once.
The third line contains a string of *n*<=-<=1 characters, each character is either 0 or 1. If *i*-th character is 1, then you can swap *i*-th element with (*i*<=+<=1)-th any number of times, otherwise it is forbidden to swap *i*-th element with (*i*<=+<=1)-th.
Output Specification:
If it is possible to sort the array in ascending order using any sequence of swaps you are allowed to make, print YES. Otherwise, print NO.
Demo Input:
['6\n1 2 5 3 4 6\n01110\n', '6\n1 2 5 3 4 6\n01010\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first example you may swap *a*<sub class="lower-index">3</sub> and *a*<sub class="lower-index">4</sub>, and then swap *a*<sub class="lower-index">4</sub> and *a*<sub class="lower-index">5</sub>.
|
```python
n = int(input())
s = input().split()
cs = input()
t = []
if cs == (n-1)*'1':
st = True
else:
st = True
for c in s:
t.append(int(c))
for x in range(n):
if t[x]!=x+1:
pos=0
while(t[x+pos]!=x+1):
pos+=1
if cs[x:x+pos]!=pos*'1':
st = False
break
else:
z = t[x]
t[x]=t[x+pos]
t[x+pos] = z
if st:
print('YES')
else:
print('NO')
```
| 0
|
|
875
|
A
|
Classroom Watch
|
PROGRAMMING
| 1,200
|
[
"brute force",
"math"
] | null | null |
Eighth-grader Vova is on duty today in the class. After classes, he went into the office to wash the board, and found on it the number *n*. He asked what is this number and the teacher of mathematics Inna Petrovna answered Vova that *n* is the answer to the arithmetic task for first-graders. In the textbook, a certain positive integer *x* was given. The task was to add *x* to the sum of the digits of the number *x* written in decimal numeral system.
Since the number *n* on the board was small, Vova quickly guessed which *x* could be in the textbook. Now he wants to get a program which will search for arbitrary values of the number *n* for all suitable values of *x* or determine that such *x* does not exist. Write such a program for Vova.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=109).
|
In the first line print one integer *k* — number of different values of *x* satisfying the condition.
In next *k* lines print these values in ascending order.
|
[
"21\n",
"20\n"
] |
[
"1\n15\n",
"0\n"
] |
In the first test case *x* = 15 there is only one variant: 15 + 1 + 5 = 21.
In the second test case there are no such *x*.
| 500
|
[
{
"input": "21",
"output": "1\n15"
},
{
"input": "20",
"output": "0"
},
{
"input": "1",
"output": "0"
},
{
"input": "2",
"output": "1\n1"
},
{
"input": "3",
"output": "0"
},
{
"input": "100000001",
"output": "2\n99999937\n100000000"
},
{
"input": "1000000000",
"output": "1\n999999932"
},
{
"input": "999999979",
"output": "2\n999999899\n999999908"
},
{
"input": "9",
"output": "0"
},
{
"input": "10",
"output": "1\n5"
},
{
"input": "11",
"output": "1\n10"
},
{
"input": "39",
"output": "1\n33"
},
{
"input": "66",
"output": "1\n60"
},
{
"input": "75",
"output": "0"
},
{
"input": "100",
"output": "1\n86"
},
{
"input": "101",
"output": "2\n91\n100"
},
{
"input": "2014",
"output": "2\n1988\n2006"
},
{
"input": "999999994",
"output": "0"
}
] | 1,603,988,750
| 2,147,483,647
|
PyPy 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 5
| 1,000
| 151,244,800
|
from itertools import permutations
from sys import stdin,stdout
def is_possible(n,x):
num_sum=int(x)
for i in x:
num_sum+=int(i)
return n==num_sum
n=input()
n_int=int(n)
poss="0123456789"
ans=[]
for i in range(1,len(n)+1):
se=list(permutations(poss,i))
for j in se:
temp=''
for c in j:
temp+=c
if(is_possible(n_int,temp)):
ans.append(temp)
stdout.write(str(len(ans))+'\n')
anss=''
for a in ans:
anss+=a+'\n'
stdout.write(anss)
|
Title: Classroom Watch
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Eighth-grader Vova is on duty today in the class. After classes, he went into the office to wash the board, and found on it the number *n*. He asked what is this number and the teacher of mathematics Inna Petrovna answered Vova that *n* is the answer to the arithmetic task for first-graders. In the textbook, a certain positive integer *x* was given. The task was to add *x* to the sum of the digits of the number *x* written in decimal numeral system.
Since the number *n* on the board was small, Vova quickly guessed which *x* could be in the textbook. Now he wants to get a program which will search for arbitrary values of the number *n* for all suitable values of *x* or determine that such *x* does not exist. Write such a program for Vova.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=109).
Output Specification:
In the first line print one integer *k* — number of different values of *x* satisfying the condition.
In next *k* lines print these values in ascending order.
Demo Input:
['21\n', '20\n']
Demo Output:
['1\n15\n', '0\n']
Note:
In the first test case *x* = 15 there is only one variant: 15 + 1 + 5 = 21.
In the second test case there are no such *x*.
|
```python
from itertools import permutations
from sys import stdin,stdout
def is_possible(n,x):
num_sum=int(x)
for i in x:
num_sum+=int(i)
return n==num_sum
n=input()
n_int=int(n)
poss="0123456789"
ans=[]
for i in range(1,len(n)+1):
se=list(permutations(poss,i))
for j in se:
temp=''
for c in j:
temp+=c
if(is_possible(n_int,temp)):
ans.append(temp)
stdout.write(str(len(ans))+'\n')
anss=''
for a in ans:
anss+=a+'\n'
stdout.write(anss)
```
| 0
|
|
343
|
A
|
Rational Resistance
|
PROGRAMMING
| 1,600
|
[
"math",
"number theory"
] | null | null |
Mad scientist Mike is building a time machine in his spare time. To finish the work, he needs a resistor with a certain resistance value.
However, all Mike has is lots of identical resistors with unit resistance *R*0<==<=1. Elements with other resistance can be constructed from these resistors. In this problem, we will consider the following as elements:
1. one resistor; 1. an element and one resistor plugged in sequence; 1. an element and one resistor plugged in parallel.
With the consecutive connection the resistance of the new element equals *R*<==<=*R**e*<=+<=*R*0. With the parallel connection the resistance of the new element equals . In this case *R**e* equals the resistance of the element being connected.
Mike needs to assemble an element with a resistance equal to the fraction . Determine the smallest possible number of resistors he needs to make such an element.
|
The single input line contains two space-separated integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=1018). It is guaranteed that the fraction is irreducible. It is guaranteed that a solution always exists.
|
Print a single number — the answer to the problem.
Please do not use the %lld specifier to read or write 64-bit integers in С++. It is recommended to use the cin, cout streams or the %I64d specifier.
|
[
"1 1\n",
"3 2\n",
"199 200\n"
] |
[
"1\n",
"3\n",
"200\n"
] |
In the first sample, one resistor is enough.
In the second sample one can connect the resistors in parallel, take the resulting element and connect it to a third resistor consecutively. Then, we get an element with resistance <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/5305da389756aab6423d918a08ced468f05604df.png" style="max-width: 100.0%;max-height: 100.0%;"/>. We cannot make this element using two resistors.
| 500
|
[
{
"input": "1 1",
"output": "1"
},
{
"input": "3 2",
"output": "3"
},
{
"input": "199 200",
"output": "200"
},
{
"input": "1 1000000000000000000",
"output": "1000000000000000000"
},
{
"input": "3 1",
"output": "3"
},
{
"input": "21 8",
"output": "7"
},
{
"input": "18 55",
"output": "21"
},
{
"input": "1 2",
"output": "2"
},
{
"input": "2 1",
"output": "2"
},
{
"input": "1 3",
"output": "3"
},
{
"input": "2 3",
"output": "3"
},
{
"input": "1 4",
"output": "4"
},
{
"input": "5 2",
"output": "4"
},
{
"input": "2 5",
"output": "4"
},
{
"input": "4 5",
"output": "5"
},
{
"input": "3 5",
"output": "4"
},
{
"input": "13 4",
"output": "7"
},
{
"input": "21 17",
"output": "9"
},
{
"input": "5 8",
"output": "5"
},
{
"input": "13 21",
"output": "7"
},
{
"input": "74 99",
"output": "28"
},
{
"input": "2377 1055",
"output": "33"
},
{
"input": "645597 134285",
"output": "87"
},
{
"input": "29906716 35911991",
"output": "92"
},
{
"input": "3052460231 856218974",
"output": "82"
},
{
"input": "288565475053 662099878640",
"output": "88"
},
{
"input": "11504415412768 12754036168327",
"output": "163"
},
{
"input": "9958408561221547 4644682781404278",
"output": "196"
},
{
"input": "60236007668635342 110624799949034113",
"output": "179"
},
{
"input": "4 43470202936783249",
"output": "10867550734195816"
},
{
"input": "16 310139055712567491",
"output": "19383690982035476"
},
{
"input": "15 110897893734203629",
"output": "7393192915613582"
},
{
"input": "439910263967866789 38",
"output": "11576585893891241"
},
{
"input": "36 316049483082136289",
"output": "8779152307837131"
},
{
"input": "752278442523506295 52",
"output": "14466893125452056"
},
{
"input": "4052739537881 6557470319842",
"output": "62"
},
{
"input": "44945570212853 72723460248141",
"output": "67"
},
{
"input": "498454011879264 806515533049393",
"output": "72"
},
{
"input": "8944394323791464 5527939700884757",
"output": "77"
},
{
"input": "679891637638612258 420196140727489673",
"output": "86"
},
{
"input": "1 923438",
"output": "923438"
},
{
"input": "3945894354376 1",
"output": "3945894354376"
},
{
"input": "999999999999999999 5",
"output": "200000000000000004"
},
{
"input": "999999999999999999 1000000000000000000",
"output": "1000000000000000000"
},
{
"input": "999999999999999991 1000000000000000000",
"output": "111111111111111120"
},
{
"input": "999999999999999993 999999999999999991",
"output": "499999999999999998"
},
{
"input": "3 1000000000000000000",
"output": "333333333333333336"
},
{
"input": "1000000000000000000 3",
"output": "333333333333333336"
},
{
"input": "10000000000 1000000001",
"output": "100000019"
},
{
"input": "2 999999999999999999",
"output": "500000000000000001"
},
{
"input": "999999999999999999 2",
"output": "500000000000000001"
},
{
"input": "2 1000000001",
"output": "500000002"
},
{
"input": "123 1000000000000000000",
"output": "8130081300813023"
}
] | 1,406,890,075
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 5
| 122
| 0
|
print(max([int(i)for i in input().split()]))
|
Title: Rational Resistance
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mad scientist Mike is building a time machine in his spare time. To finish the work, he needs a resistor with a certain resistance value.
However, all Mike has is lots of identical resistors with unit resistance *R*0<==<=1. Elements with other resistance can be constructed from these resistors. In this problem, we will consider the following as elements:
1. one resistor; 1. an element and one resistor plugged in sequence; 1. an element and one resistor plugged in parallel.
With the consecutive connection the resistance of the new element equals *R*<==<=*R**e*<=+<=*R*0. With the parallel connection the resistance of the new element equals . In this case *R**e* equals the resistance of the element being connected.
Mike needs to assemble an element with a resistance equal to the fraction . Determine the smallest possible number of resistors he needs to make such an element.
Input Specification:
The single input line contains two space-separated integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=1018). It is guaranteed that the fraction is irreducible. It is guaranteed that a solution always exists.
Output Specification:
Print a single number — the answer to the problem.
Please do not use the %lld specifier to read or write 64-bit integers in С++. It is recommended to use the cin, cout streams or the %I64d specifier.
Demo Input:
['1 1\n', '3 2\n', '199 200\n']
Demo Output:
['1\n', '3\n', '200\n']
Note:
In the first sample, one resistor is enough.
In the second sample one can connect the resistors in parallel, take the resulting element and connect it to a third resistor consecutively. Then, we get an element with resistance <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/5305da389756aab6423d918a08ced468f05604df.png" style="max-width: 100.0%;max-height: 100.0%;"/>. We cannot make this element using two resistors.
|
```python
print(max([int(i)for i in input().split()]))
```
| 0
|
|
839
|
A
|
Arya and Bran
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Bran and his older sister Arya are from the same house. Bran like candies so much, so Arya is going to give him some Candies.
At first, Arya and Bran have 0 Candies. There are *n* days, at the *i*-th day, Arya finds *a**i* candies in a box, that is given by the Many-Faced God. Every day she can give Bran at most 8 of her candies. If she don't give him the candies at the same day, they are saved for her and she can give them to him later.
Your task is to find the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day. Formally, you need to output the minimum day index to the end of which *k* candies will be given out (the days are indexed from 1 to *n*).
Print -1 if she can't give him *k* candies during *n* given days.
|
The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=10000).
The second line contains *n* integers *a*1,<=*a*2,<=*a*3,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=100).
|
If it is impossible for Arya to give Bran *k* candies within *n* days, print -1.
Otherwise print a single integer — the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day.
|
[
"2 3\n1 2\n",
"3 17\n10 10 10\n",
"1 9\n10\n"
] |
[
"2",
"3",
"-1"
] |
In the first sample, Arya can give Bran 3 candies in 2 days.
In the second sample, Arya can give Bran 17 candies in 3 days, because she can give him at most 8 candies per day.
In the third sample, Arya can't give Bran 9 candies, because she can give him at most 8 candies per day and she must give him the candies within 1 day.
| 500
|
[
{
"input": "2 3\n1 2",
"output": "2"
},
{
"input": "3 17\n10 10 10",
"output": "3"
},
{
"input": "1 9\n10",
"output": "-1"
},
{
"input": "10 70\n6 5 2 3 3 2 1 4 3 2",
"output": "-1"
},
{
"input": "20 140\n40 4 81 40 10 54 34 50 84 60 16 1 90 78 38 93 99 60 81 99",
"output": "18"
},
{
"input": "30 133\n3 2 3 4 3 7 4 5 5 6 7 2 1 3 4 6 7 4 6 4 7 5 7 1 3 4 1 6 8 5",
"output": "30"
},
{
"input": "40 320\n70 79 21 64 95 36 63 29 66 89 30 34 100 76 42 12 4 56 80 78 83 1 39 9 34 45 6 71 27 31 55 52 72 71 38 21 43 83 48 47",
"output": "40"
},
{
"input": "50 300\n5 3 11 8 7 4 9 5 5 1 6 3 5 7 4 2 2 10 8 1 7 10 4 4 11 5 2 4 9 1 5 4 11 9 11 2 7 4 4 8 10 9 1 11 10 2 4 11 6 9",
"output": "-1"
},
{
"input": "37 30\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "30"
},
{
"input": "100 456\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100",
"output": "57"
},
{
"input": "90 298\n94 90 98 94 93 90 99 98 90 96 93 96 92 92 97 98 94 94 96 100 93 96 95 98 94 91 95 95 94 90 93 96 93 100 99 98 94 95 98 91 91 98 97 100 98 93 92 93 91 100 92 97 95 95 97 94 98 97 99 100 90 96 93 100 95 99 92 100 99 91 97 99 98 93 90 93 97 95 94 96 90 100 94 93 91 92 97 97 97 100",
"output": "38"
},
{
"input": "7 43\n4 3 7 9 3 8 10",
"output": "-1"
},
{
"input": "99 585\n8 2 3 3 10 7 9 4 7 4 6 8 7 11 5 8 7 4 7 7 6 7 11 8 1 7 3 2 10 1 6 10 10 5 10 2 5 5 11 6 4 1 5 10 5 8 1 3 7 10 6 1 1 3 8 11 5 8 2 2 5 4 7 6 7 5 8 7 10 9 6 11 4 8 2 7 1 7 1 4 11 1 9 6 1 10 6 10 1 5 6 5 2 5 11 5 1 10 8",
"output": "-1"
},
{
"input": "30 177\n8 7 5 8 3 7 2 4 3 8 11 3 9 11 2 4 1 4 5 6 11 5 8 3 6 3 11 2 11 8",
"output": "-1"
},
{
"input": "19 129\n3 3 10 11 4 7 3 8 10 2 11 6 11 9 4 2 11 10 5",
"output": "-1"
},
{
"input": "100 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "100"
},
{
"input": "13 104\n94 55 20 96 86 76 13 71 13 1 32 76 69",
"output": "13"
},
{
"input": "85 680\n61 44 55 6 30 74 27 26 17 45 73 1 67 71 39 32 13 25 79 66 4 59 49 28 29 22 10 17 98 80 36 99 52 24 59 44 27 79 29 46 29 12 47 72 82 25 6 30 81 72 95 65 30 71 72 45 39 16 16 89 48 42 59 71 50 58 31 65 91 70 48 56 28 34 53 89 94 98 49 55 94 65 91 11 53",
"output": "85"
},
{
"input": "100 458\n3 6 4 1 8 4 1 5 4 4 5 8 4 4 6 6 5 1 2 2 2 1 7 1 1 2 6 5 7 8 3 3 8 3 7 5 7 6 6 2 4 2 2 1 1 8 6 1 5 3 3 4 1 4 6 8 5 4 8 5 4 5 5 1 3 1 6 7 6 2 7 3 4 8 1 8 6 7 1 2 4 6 7 4 8 8 8 4 8 7 5 2 8 4 2 5 6 8 8 5",
"output": "100"
},
{
"input": "98 430\n4 7 6 3 4 1 7 1 1 6 6 1 5 4 6 1 5 4 6 6 1 5 1 1 8 1 6 6 2 6 8 4 4 6 6 8 8 7 4 1 2 4 1 5 4 3 7 3 2 5 7 7 7 2 2 2 7 2 8 7 3 4 5 7 8 3 7 6 7 3 2 4 7 1 4 4 7 1 1 8 4 5 8 3 1 5 3 5 2 1 3 3 8 1 3 5 8 6",
"output": "98"
},
{
"input": "90 80\n6 1 7 1 1 8 6 6 6 1 5 4 2 2 8 4 8 7 7 2 5 7 7 8 5 5 6 3 3 8 3 5 6 3 4 2 6 5 5 3 3 3 8 6 6 1 8 3 6 5 4 8 5 4 3 7 1 3 2 3 3 7 7 7 3 5 2 6 2 3 6 4 6 5 5 3 2 1 1 7 3 3 4 3 4 2 1 2 3 1",
"output": "18"
},
{
"input": "89 99\n7 7 3 5 2 7 8 8 1 1 5 7 7 4 1 5 3 4 4 8 8 3 3 2 6 3 8 2 7 5 8 1 3 5 3 6 4 3 6 2 3 3 4 5 1 6 1 7 7 7 6 7 7 7 8 8 8 2 1 7 5 8 6 7 7 4 7 5 7 8 1 3 5 8 7 1 4 2 5 8 3 4 4 5 5 6 2 4 2",
"output": "21"
},
{
"input": "50 700\n4 3 2 8 8 5 5 3 3 4 7 2 6 6 3 3 8 4 2 4 8 6 5 4 5 4 5 8 6 5 4 7 2 4 1 6 2 6 8 6 2 5 8 1 3 8 3 8 4 1",
"output": "-1"
},
{
"input": "82 359\n95 98 95 90 90 96 91 94 93 99 100 100 92 99 96 94 99 90 94 96 91 91 90 93 97 96 90 94 97 99 93 90 99 98 96 100 93 97 100 91 100 92 93 100 92 90 90 94 99 95 100 98 99 96 94 96 96 99 99 91 97 100 95 100 99 91 94 91 98 98 100 97 93 93 96 97 94 94 92 100 91 91",
"output": "45"
},
{
"input": "60 500\n93 93 100 99 91 92 95 93 95 99 93 91 97 98 90 91 98 100 95 100 94 93 92 91 91 98 98 90 93 91 90 96 92 93 92 94 94 91 96 94 98 100 97 96 96 97 91 99 97 95 96 94 91 92 99 95 97 92 98 90",
"output": "-1"
},
{
"input": "98 776\n48 63 26 3 88 81 27 33 37 10 2 89 41 84 98 93 25 44 42 90 41 65 97 1 28 69 42 14 86 18 96 28 28 94 78 8 44 31 96 45 26 52 93 25 48 39 3 75 94 93 63 59 67 86 18 74 27 38 68 7 31 60 69 67 20 11 19 34 47 43 86 96 3 49 56 60 35 49 89 28 92 69 48 15 17 73 99 69 2 73 27 35 28 53 11 1 96 50",
"output": "97"
},
{
"input": "100 189\n15 14 32 65 28 96 33 93 48 28 57 20 32 20 90 42 57 53 18 58 94 21 27 29 37 22 94 45 67 60 83 23 20 23 35 93 3 42 6 46 68 46 34 25 17 16 50 5 49 91 23 76 69 100 58 68 81 32 88 41 64 29 37 13 95 25 6 59 74 58 31 35 16 80 13 80 10 59 85 18 16 70 51 40 44 28 8 76 8 87 53 86 28 100 2 73 14 100 52 9",
"output": "24"
},
{
"input": "99 167\n72 4 79 73 49 58 15 13 92 92 42 36 35 21 13 10 51 94 64 35 86 50 6 80 93 77 59 71 2 88 22 10 27 30 87 12 77 6 34 56 31 67 78 84 36 27 15 15 12 56 80 7 56 14 10 9 14 59 15 20 34 81 8 49 51 72 4 58 38 77 31 86 18 61 27 86 95 36 46 36 39 18 78 39 48 37 71 12 51 92 65 48 39 22 16 87 4 5 42",
"output": "21"
},
{
"input": "90 4\n48 4 4 78 39 3 85 29 69 52 70 39 11 98 42 56 65 98 77 24 61 31 6 59 60 62 84 46 67 59 15 44 99 23 12 74 2 48 84 60 51 28 17 90 10 82 3 43 50 100 45 57 57 95 53 71 20 74 52 46 64 59 72 33 74 16 44 44 80 71 83 1 70 59 61 6 82 69 81 45 88 28 17 24 22 25 53 97 1 100",
"output": "1"
},
{
"input": "30 102\n55 94 3 96 3 47 92 85 25 78 27 70 97 83 40 2 55 12 74 84 91 37 31 85 7 40 33 54 72 5",
"output": "13"
},
{
"input": "81 108\n61 59 40 100 8 75 5 74 87 12 6 23 98 26 59 68 27 4 98 79 14 44 4 11 89 77 29 90 33 3 43 1 87 91 28 24 4 84 75 7 37 46 15 46 8 87 68 66 5 21 36 62 77 74 91 95 88 28 12 48 18 93 14 51 33 5 99 62 99 38 49 15 56 87 52 64 69 46 41 12 92",
"output": "14"
},
{
"input": "2 16\n10 6",
"output": "2"
},
{
"input": "2 8\n7 8",
"output": "2"
},
{
"input": "2 9\n4 8",
"output": "2"
},
{
"input": "3 19\n9 9 1",
"output": "3"
},
{
"input": "4 32\n9 9 9 5",
"output": "4"
},
{
"input": "2 15\n14 1",
"output": "2"
},
{
"input": "2 3\n3 3",
"output": "1"
},
{
"input": "3 10\n10 1 1",
"output": "2"
},
{
"input": "12 20\n3 16 19 10 1 6 17 8 6 20 1 4",
"output": "4"
},
{
"input": "4 15\n14 3 3 3",
"output": "2"
},
{
"input": "5 40\n10 10 10 10 1",
"output": "5"
},
{
"input": "4 31\n9 9 8 5",
"output": "4"
},
{
"input": "4 31\n20 7 1 1",
"output": "-1"
},
{
"input": "2 10\n9 1",
"output": "2"
},
{
"input": "10 50\n100 10 1 1 1 1 1 1 1 1",
"output": "7"
},
{
"input": "2 11\n10 2",
"output": "2"
},
{
"input": "3 21\n10 10 1",
"output": "3"
},
{
"input": "2 2\n1 2",
"output": "2"
},
{
"input": "3 2\n1 8 8",
"output": "2"
},
{
"input": "2 11\n10 1",
"output": "2"
},
{
"input": "2 16\n12 4",
"output": "2"
},
{
"input": "3 11\n9 2 2",
"output": "2"
},
{
"input": "3 11\n4 3 4",
"output": "3"
},
{
"input": "2 13\n7 6",
"output": "2"
},
{
"input": "3 24\n14 3 4",
"output": "-1"
},
{
"input": "2 13\n10 3",
"output": "2"
},
{
"input": "3 11\n9 2 1",
"output": "2"
},
{
"input": "2 15\n12 3",
"output": "2"
},
{
"input": "2 14\n11 4",
"output": "2"
}
] | 1,697,369,937
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 7
| 31
| 0
|
x,y = list(map(int,input().split()))
y1 = y
z = list(map(int,input().split()))
count = 0
for i in range(x):
if y < 0:
count -= 1
break
elif y == 0:
break
y -= min(z[i],8)
count += 1
print(count) if x*8 >= y1 and sum(z) >= y1 else print(-1)
|
Title: Arya and Bran
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bran and his older sister Arya are from the same house. Bran like candies so much, so Arya is going to give him some Candies.
At first, Arya and Bran have 0 Candies. There are *n* days, at the *i*-th day, Arya finds *a**i* candies in a box, that is given by the Many-Faced God. Every day she can give Bran at most 8 of her candies. If she don't give him the candies at the same day, they are saved for her and she can give them to him later.
Your task is to find the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day. Formally, you need to output the minimum day index to the end of which *k* candies will be given out (the days are indexed from 1 to *n*).
Print -1 if she can't give him *k* candies during *n* given days.
Input Specification:
The first line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=100, 1<=≤<=*k*<=≤<=10000).
The second line contains *n* integers *a*1,<=*a*2,<=*a*3,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=100).
Output Specification:
If it is impossible for Arya to give Bran *k* candies within *n* days, print -1.
Otherwise print a single integer — the minimum number of days Arya needs to give Bran *k* candies before the end of the *n*-th day.
Demo Input:
['2 3\n1 2\n', '3 17\n10 10 10\n', '1 9\n10\n']
Demo Output:
['2', '3', '-1']
Note:
In the first sample, Arya can give Bran 3 candies in 2 days.
In the second sample, Arya can give Bran 17 candies in 3 days, because she can give him at most 8 candies per day.
In the third sample, Arya can't give Bran 9 candies, because she can give him at most 8 candies per day and she must give him the candies within 1 day.
|
```python
x,y = list(map(int,input().split()))
y1 = y
z = list(map(int,input().split()))
count = 0
for i in range(x):
if y < 0:
count -= 1
break
elif y == 0:
break
y -= min(z[i],8)
count += 1
print(count) if x*8 >= y1 and sum(z) >= y1 else print(-1)
```
| 0
|
|
630
|
A
|
Again Twenty Five!
|
PROGRAMMING
| 800
|
[
"number theory"
] | null | null |
The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and get last two digits of the number. Yes, of course, *n* can be rather big, and one cannot find the power using a calculator, but we need people who are able to think, not just follow the instructions."
Could you pass the interview in the machine vision company in IT City?
|
The only line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=2·1018) — the power in which you need to raise number 5.
|
Output the last two digits of 5*n* without spaces between them.
|
[
"2\n"
] |
[
"25"
] |
none
| 0
|
[
{
"input": "2",
"output": "25"
},
{
"input": "7",
"output": "25"
},
{
"input": "1000000000000000000",
"output": "25"
},
{
"input": "2000000000000000000",
"output": "25"
},
{
"input": "987654321012345678",
"output": "25"
}
] | 1,691,593,788
| 2,147,483,647
|
PyPy 3-64
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 2
| 500
| 19,558,400
|
n = int(input())
n = pow(5,n)
a = n%10
n//=10
b = n%10
print(f"{b}{a}")
|
Title: Again Twenty Five!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The HR manager was disappointed again. The last applicant failed the interview the same way as 24 previous ones. "Do I give such a hard task?" — the HR manager thought. "Just raise number 5 to the power of *n* and get last two digits of the number. Yes, of course, *n* can be rather big, and one cannot find the power using a calculator, but we need people who are able to think, not just follow the instructions."
Could you pass the interview in the machine vision company in IT City?
Input Specification:
The only line of the input contains a single integer *n* (2<=≤<=*n*<=≤<=2·1018) — the power in which you need to raise number 5.
Output Specification:
Output the last two digits of 5*n* without spaces between them.
Demo Input:
['2\n']
Demo Output:
['25']
Note:
none
|
```python
n = int(input())
n = pow(5,n)
a = n%10
n//=10
b = n%10
print(f"{b}{a}")
```
| 0
|
|
182
|
B
|
Vasya's Calendar
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
Vasya lives in a strange world. The year has *n* months and the *i*-th month has *a**i* days. Vasya got a New Year present — the clock that shows not only the time, but also the date.
The clock's face can display any number from 1 to *d*. It is guaranteed that *a**i*<=≤<=*d* for all *i* from 1 to *n*. The clock does not keep information about the current month, so when a new day comes, it simply increases the current day number by one. The clock cannot display number *d*<=+<=1, so after day number *d* it shows day 1 (the current day counter resets). The mechanism of the clock allows you to increase the day number by one manually. When you execute this operation, day *d* is also followed by day 1.
Vasya begins each day checking the day number on the clock. If the day number on the clock does not match the actual day number in the current month, then Vasya manually increases it by one. Vasya is persistent and repeats this operation until the day number on the clock matches the actual number of the current day in the current month.
A year passed and Vasya wonders how many times he manually increased the day number by one, from the first day of the first month to the last day of the *n*-th month inclusive, considering that on the first day of the first month the clock display showed day 1.
|
The first line contains the single number *d* — the maximum number of the day that Vasya's clock can show (1<=≤<=*d*<=≤<=106).
The second line contains a single integer *n* — the number of months in the year (1<=≤<=*n*<=≤<=2000).
The third line contains *n* space-separated integers: *a**i* (1<=≤<=*a**i*<=≤<=*d*) — the number of days in each month in the order in which they follow, starting from the first one.
|
Print a single number — the number of times Vasya manually increased the day number by one throughout the last year.
|
[
"4\n2\n2 2\n",
"5\n3\n3 4 3\n",
"31\n12\n31 28 31 30 31 30 31 31 30 31 30 31\n"
] |
[
"2\n",
"3\n",
"7\n"
] |
In the first sample the situation is like this:
- Day 1. Month 1. The clock shows 1. Vasya changes nothing. - Day 2. Month 1. The clock shows 2. Vasya changes nothing. - Day 1. Month 2. The clock shows 3. Vasya manually increases the day number by 1. After that the clock shows 4. Vasya increases the day number by 1 manually. After that the clock shows 1. - Day 2. Month 2. The clock shows 2. Vasya changes nothing.
| 500
|
[
{
"input": "4\n2\n2 2",
"output": "2"
},
{
"input": "5\n3\n3 4 3",
"output": "3"
},
{
"input": "31\n12\n31 28 31 30 31 30 31 31 30 31 30 31",
"output": "7"
},
{
"input": "1\n1\n1",
"output": "0"
},
{
"input": "1\n2\n1 1",
"output": "0"
},
{
"input": "2\n2\n1 1",
"output": "1"
},
{
"input": "10\n2\n10 2",
"output": "0"
},
{
"input": "10\n3\n6 3 6",
"output": "11"
},
{
"input": "10\n4\n8 7 1 5",
"output": "14"
},
{
"input": "10\n5\n2 7 8 4 4",
"output": "19"
},
{
"input": "10\n6\n8 3 4 9 6 1",
"output": "20"
},
{
"input": "10\n7\n10 5 3 1 1 9 1",
"output": "31"
},
{
"input": "10\n8\n6 5 10 6 8 1 3 2",
"output": "31"
},
{
"input": "10\n9\n6 2 7 5 5 4 8 6 2",
"output": "37"
},
{
"input": "10\n10\n1 10 1 10 1 1 7 8 6 7",
"output": "45"
},
{
"input": "100\n100\n85 50 17 89 65 89 5 20 86 26 16 21 85 14 44 31 87 31 6 2 48 67 8 80 79 1 48 36 97 1 5 30 79 50 78 12 2 55 76 100 54 40 26 81 97 96 68 56 87 14 51 17 54 37 52 33 69 62 38 63 74 15 62 78 9 19 67 2 60 58 93 60 18 96 55 48 34 7 79 82 32 58 90 67 20 50 27 15 7 89 98 10 11 15 99 49 4 51 77 52",
"output": "5099"
},
{
"input": "101\n100\n19 17 15 16 28 69 41 47 75 42 19 98 16 90 92 47 21 4 98 17 27 31 90 10 14 92 62 73 56 55 6 60 62 22 78 1 3 86 18 59 92 41 21 34 67 9 92 78 77 45 50 92 57 61 11 98 89 72 57 93 100 12 61 48 5 48 38 9 65 64 77 29 18 55 94 42 10 77 43 46 7 89 8 13 5 53 80 59 23 100 30 28 29 24 85 56 10 22 24 16",
"output": "5301"
},
{
"input": "102\n100\n31 22 59 16 11 56 81 4 19 31 8 72 4 92 18 7 13 12 62 40 34 67 40 23 96 4 90 28 3 18 54 49 10 71 73 79 69 7 41 75 59 13 2 78 72 6 95 33 52 97 7 86 57 94 12 93 19 94 59 28 5 96 46 102 2 101 57 85 53 69 72 39 14 75 8 16 10 57 26 4 85 18 89 84 48 93 54 21 78 6 67 35 11 78 91 91 97 15 8 32",
"output": "5447"
},
{
"input": "103\n100\n68 38 41 54 37 11 35 26 43 97 70 3 13 11 64 83 3 95 99 16 4 13 22 27 64 20 95 38 40 87 6 17 95 67 31 24 85 33 98 24 89 101 66 38 42 5 95 18 95 13 103 85 72 73 68 93 22 59 48 59 72 46 5 41 54 32 48 69 3 76 2 26 102 44 39 58 55 85 40 16 81 78 92 63 25 97 83 2 54 16 20 63 19 8 84 34 1 22 43 93",
"output": "5358"
},
{
"input": "104\n100\n65 74 94 71 98 38 88 67 71 84 45 79 55 86 55 51 27 89 14 66 29 63 8 103 98 94 87 81 58 68 24 96 60 36 48 95 28 72 95 42 87 7 14 23 99 77 34 14 90 31 8 99 29 30 9 88 42 1 77 61 55 85 17 98 62 78 27 1 58 69 82 62 62 81 56 104 66 8 17 23 7 61 59 70 79 64 78 16 32 11 59 4 24 73 55 2 95 39 62 13",
"output": "4773"
}
] | 1,660,210,694
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 92
| 0
|
d = int(input())
n = int(input())
przhm = list(map(int, input().split()))
slv = dict()
amn = 0
for i in range (len(przhm) - 1):
if przhm[i] == d:
continue
if przhm[i] not in slv:
slv[przhm[i]] = 1
else:
slv[przhm[i]] += 1
sps = slv.items()
for j in sps:
n_d = j[0] * j[1]
d_d = d * j[1]
amn = amn + (d_d - n_d)
print (amn)
# print (slv)
# print (sps)
# print (przhm)
|
Title: Vasya's Calendar
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya lives in a strange world. The year has *n* months and the *i*-th month has *a**i* days. Vasya got a New Year present — the clock that shows not only the time, but also the date.
The clock's face can display any number from 1 to *d*. It is guaranteed that *a**i*<=≤<=*d* for all *i* from 1 to *n*. The clock does not keep information about the current month, so when a new day comes, it simply increases the current day number by one. The clock cannot display number *d*<=+<=1, so after day number *d* it shows day 1 (the current day counter resets). The mechanism of the clock allows you to increase the day number by one manually. When you execute this operation, day *d* is also followed by day 1.
Vasya begins each day checking the day number on the clock. If the day number on the clock does not match the actual day number in the current month, then Vasya manually increases it by one. Vasya is persistent and repeats this operation until the day number on the clock matches the actual number of the current day in the current month.
A year passed and Vasya wonders how many times he manually increased the day number by one, from the first day of the first month to the last day of the *n*-th month inclusive, considering that on the first day of the first month the clock display showed day 1.
Input Specification:
The first line contains the single number *d* — the maximum number of the day that Vasya's clock can show (1<=≤<=*d*<=≤<=106).
The second line contains a single integer *n* — the number of months in the year (1<=≤<=*n*<=≤<=2000).
The third line contains *n* space-separated integers: *a**i* (1<=≤<=*a**i*<=≤<=*d*) — the number of days in each month in the order in which they follow, starting from the first one.
Output Specification:
Print a single number — the number of times Vasya manually increased the day number by one throughout the last year.
Demo Input:
['4\n2\n2 2\n', '5\n3\n3 4 3\n', '31\n12\n31 28 31 30 31 30 31 31 30 31 30 31\n']
Demo Output:
['2\n', '3\n', '7\n']
Note:
In the first sample the situation is like this:
- Day 1. Month 1. The clock shows 1. Vasya changes nothing. - Day 2. Month 1. The clock shows 2. Vasya changes nothing. - Day 1. Month 2. The clock shows 3. Vasya manually increases the day number by 1. After that the clock shows 4. Vasya increases the day number by 1 manually. After that the clock shows 1. - Day 2. Month 2. The clock shows 2. Vasya changes nothing.
|
```python
d = int(input())
n = int(input())
przhm = list(map(int, input().split()))
slv = dict()
amn = 0
for i in range (len(przhm) - 1):
if przhm[i] == d:
continue
if przhm[i] not in slv:
slv[przhm[i]] = 1
else:
slv[przhm[i]] += 1
sps = slv.items()
for j in sps:
n_d = j[0] * j[1]
d_d = d * j[1]
amn = amn + (d_d - n_d)
print (amn)
# print (slv)
# print (sps)
# print (przhm)
```
| 3
|
|
559
|
B
|
Equivalent Strings
|
PROGRAMMING
| 1,700
|
[
"divide and conquer",
"hashing",
"sortings",
"strings"
] | null | null |
Today on a lecture about strings Gerald learned a new definition of string equivalency. Two strings *a* and *b* of equal length are called equivalent in one of the two cases:
1. They are equal. 1. If we split string *a* into two halves of the same size *a*1 and *a*2, and string *b* into two halves of the same size *b*1 and *b*2, then one of the following is correct: *a*1 is equivalent to *b*1, and *a*2 is equivalent to *b*2 1. *a*1 is equivalent to *b*2, and *a*2 is equivalent to *b*1
As a home task, the teacher gave two strings to his students and asked to determine if they are equivalent.
Gerald has already completed this home task. Now it's your turn!
|
The first two lines of the input contain two strings given by the teacher. Each of them has the length from 1 to 200<=000 and consists of lowercase English letters. The strings have the same length.
|
Print "YES" (without the quotes), if these two strings are equivalent, and "NO" (without the quotes) otherwise.
|
[
"aaba\nabaa\n",
"aabb\nabab\n"
] |
[
"YES\n",
"NO\n"
] |
In the first sample you should split the first string into strings "aa" and "ba", the second one — into strings "ab" and "aa". "aa" is equivalent to "aa"; "ab" is equivalent to "ba" as "ab" = "a" + "b", "ba" = "b" + "a".
In the second sample the first string can be splitted into strings "aa" and "bb", that are equivalent only to themselves. That's why string "aabb" is equivalent only to itself and to string "bbaa".
| 1,000
|
[
{
"input": "aaba\nabaa",
"output": "YES"
},
{
"input": "aabb\nabab",
"output": "NO"
},
{
"input": "a\na",
"output": "YES"
},
{
"input": "a\nb",
"output": "NO"
},
{
"input": "ab\nab",
"output": "YES"
},
{
"input": "ab\nba",
"output": "YES"
},
{
"input": "ab\nbb",
"output": "NO"
},
{
"input": "zzaa\naazz",
"output": "YES"
},
{
"input": "azza\nzaaz",
"output": "YES"
},
{
"input": "abc\nabc",
"output": "YES"
},
{
"input": "abc\nacb",
"output": "NO"
},
{
"input": "azzz\nzzaz",
"output": "YES"
},
{
"input": "abcd\ndcab",
"output": "YES"
},
{
"input": "abcd\ncdab",
"output": "YES"
},
{
"input": "abcd\ndcba",
"output": "YES"
},
{
"input": "abcd\nacbd",
"output": "NO"
},
{
"input": "oloaxgddgujq\noloaxgujqddg",
"output": "YES"
},
{
"input": "uwzwdxfmosmqatyv\ndxfmzwwusomqvyta",
"output": "YES"
},
{
"input": "hagnzomowtledfdotnll\nledfdotnllomowthagnz",
"output": "YES"
},
{
"input": "snyaydaeobufdg\nsnyaydaeobufdg",
"output": "YES"
},
{
"input": "baaaaa\nabaaaa",
"output": "NO"
},
{
"input": "hhiisug\nmzdjwju",
"output": "NO"
},
{
"input": "bbbabbabaaab\naaaabbabbbbb",
"output": "NO"
},
{
"input": "bbaaab\naababb",
"output": "NO"
},
{
"input": "aabbaaaa\naaaaabab",
"output": "NO"
},
{
"input": "aab\naba",
"output": "NO"
},
{
"input": "abcddd\nbacddd",
"output": "NO"
},
{
"input": "qgiufelsfhanx\naaaaaaaaaaaaa",
"output": "NO"
},
{
"input": "aabaababaaba\naababaaababa",
"output": "NO"
},
{
"input": "nocdqzdriyyil\naaaaaaaaaaaaa",
"output": "NO"
},
{
"input": "zdmctxl\nkojqhgw",
"output": "NO"
},
{
"input": "yhwepqwyhwepqwyhwepqweahnqtueahnqtueahnqtuyhwepqwyhwepqwyhwepqwyhwepqweahnqtueahnqtuyhwepqweahnqtueahnqtueahnqtueahnqtueahnqtueahnqtu\neahnqtueahnqtueahnqtuyhwepqweahnqtuyhwepqwyhwepqweahnqtuyhwepqweahnqtuyhwepqweahnqtueahnqtuyhwepqweahnqtueahnqtuyhwepqwyhwepqwyhwepqw",
"output": "NO"
},
{
"input": "abc\nbac",
"output": "NO"
},
{
"input": "ottceez\npcstdvz",
"output": "NO"
}
] | 1,567,311,806
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 93
| 0
|
x = ""
y = ""
dp = {}
def pE(xl, yl, l):
if (xl,yl) in dp:
return dp[(xl,yl)]
if l&1:
for i in range(l):
if x[xl+i] != y[yl+i]:
return False
return True
n = l/2
dp[(xl,yl)] = (pE(xl,yl+n,n) and pE(xl+n,yl,n)) or (pE(xl+n,yl+n,n) and pE(xl,yl,n))
return dp[(xl,yl)]
def E(x,y):
return pE(0,0,len(x))
x = input()
y = input()
if E(x,y):
print("YES")
else:
print("NO")
|
Title: Equivalent Strings
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Today on a lecture about strings Gerald learned a new definition of string equivalency. Two strings *a* and *b* of equal length are called equivalent in one of the two cases:
1. They are equal. 1. If we split string *a* into two halves of the same size *a*1 and *a*2, and string *b* into two halves of the same size *b*1 and *b*2, then one of the following is correct: *a*1 is equivalent to *b*1, and *a*2 is equivalent to *b*2 1. *a*1 is equivalent to *b*2, and *a*2 is equivalent to *b*1
As a home task, the teacher gave two strings to his students and asked to determine if they are equivalent.
Gerald has already completed this home task. Now it's your turn!
Input Specification:
The first two lines of the input contain two strings given by the teacher. Each of them has the length from 1 to 200<=000 and consists of lowercase English letters. The strings have the same length.
Output Specification:
Print "YES" (without the quotes), if these two strings are equivalent, and "NO" (without the quotes) otherwise.
Demo Input:
['aaba\nabaa\n', 'aabb\nabab\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first sample you should split the first string into strings "aa" and "ba", the second one — into strings "ab" and "aa". "aa" is equivalent to "aa"; "ab" is equivalent to "ba" as "ab" = "a" + "b", "ba" = "b" + "a".
In the second sample the first string can be splitted into strings "aa" and "bb", that are equivalent only to themselves. That's why string "aabb" is equivalent only to itself and to string "bbaa".
|
```python
x = ""
y = ""
dp = {}
def pE(xl, yl, l):
if (xl,yl) in dp:
return dp[(xl,yl)]
if l&1:
for i in range(l):
if x[xl+i] != y[yl+i]:
return False
return True
n = l/2
dp[(xl,yl)] = (pE(xl,yl+n,n) and pE(xl+n,yl,n)) or (pE(xl+n,yl+n,n) and pE(xl,yl,n))
return dp[(xl,yl)]
def E(x,y):
return pE(0,0,len(x))
x = input()
y = input()
if E(x,y):
print("YES")
else:
print("NO")
```
| -1
|
|
1,011
|
B
|
Planning The Expedition
|
PROGRAMMING
| 1,200
|
[
"binary search",
"brute force",
"implementation"
] | null | null |
Natasha is planning an expedition to Mars for $n$ people. One of the important tasks is to provide food for each participant.
The warehouse has $m$ daily food packages. Each package has some food type $a_i$.
Each participant must eat exactly one food package each day. Due to extreme loads, each participant must eat the same food type throughout the expedition. Different participants may eat different (or the same) types of food.
Formally, for each participant $j$ Natasha should select his food type $b_j$ and each day $j$-th participant will eat one food package of type $b_j$. The values $b_j$ for different participants may be different.
What is the maximum possible number of days the expedition can last, following the requirements above?
|
The first line contains two integers $n$ and $m$ ($1 \le n \le 100$, $1 \le m \le 100$) — the number of the expedition participants and the number of the daily food packages available.
The second line contains sequence of integers $a_1, a_2, \dots, a_m$ ($1 \le a_i \le 100$), where $a_i$ is the type of $i$-th food package.
|
Print the single integer — the number of days the expedition can last. If it is not possible to plan the expedition for even one day, print 0.
|
[
"4 10\n1 5 2 1 1 1 2 5 7 2\n",
"100 1\n1\n",
"2 5\n5 4 3 2 1\n",
"3 9\n42 42 42 42 42 42 42 42 42\n"
] |
[
"2\n",
"0\n",
"1\n",
"3\n"
] |
In the first example, Natasha can assign type $1$ food to the first participant, the same type $1$ to the second, type $5$ to the third and type $2$ to the fourth. In this case, the expedition can last for $2$ days, since each participant can get two food packages of his food type (there will be used $4$ packages of type $1$, two packages of type $2$ and two packages of type $5$).
In the second example, there are $100$ participants and only $1$ food package. In this case, the expedition can't last even $1$ day.
| 1,000
|
[
{
"input": "4 10\n1 5 2 1 1 1 2 5 7 2",
"output": "2"
},
{
"input": "100 1\n1",
"output": "0"
},
{
"input": "2 5\n5 4 3 2 1",
"output": "1"
},
{
"input": "3 9\n42 42 42 42 42 42 42 42 42",
"output": "3"
},
{
"input": "1 1\n100",
"output": "1"
},
{
"input": "4 100\n84 99 66 69 86 94 89 96 98 93 93 82 87 93 91 100 69 99 93 81 99 84 75 100 86 88 98 100 84 96 44 70 94 91 85 78 86 79 45 88 91 78 98 94 81 87 93 72 96 88 96 97 96 62 86 72 94 84 80 98 88 90 93 73 73 98 78 50 91 96 97 82 85 90 87 41 97 82 97 77 100 100 92 83 98 81 70 81 74 78 84 79 98 98 55 99 97 99 79 98",
"output": "5"
},
{
"input": "100 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "1 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "100"
},
{
"input": "6 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4",
"output": "15"
},
{
"input": "1 1\n59",
"output": "1"
},
{
"input": "1 50\n39 1 46 21 23 28 100 32 63 63 18 15 40 29 34 49 56 74 47 42 96 97 59 62 76 62 69 61 36 21 66 18 92 58 63 85 5 6 77 75 91 66 38 10 66 43 20 74 37 83",
"output": "3"
},
{
"input": "1 100\n83 72 21 55 49 5 61 60 87 21 89 88 3 75 49 81 36 25 50 61 96 19 36 55 48 8 97 69 50 24 23 39 26 25 41 90 69 20 19 62 38 52 60 6 66 31 9 45 36 12 69 94 22 60 91 65 35 58 13 85 33 87 83 11 95 20 20 85 13 21 57 69 17 94 78 37 59 45 60 7 64 51 60 89 91 22 6 58 95 96 51 53 89 22 28 16 27 56 1 54",
"output": "5"
},
{
"input": "50 1\n75",
"output": "0"
},
{
"input": "50 50\n85 20 12 73 52 78 70 95 88 43 31 88 81 41 80 99 16 11 97 11 21 44 2 34 47 38 87 2 32 47 97 93 52 14 35 37 97 48 58 19 52 55 97 72 17 25 16 85 90 58",
"output": "1"
},
{
"input": "50 100\n2 37 74 32 99 75 73 86 67 33 62 30 15 21 51 41 73 75 67 39 90 10 56 74 72 26 38 65 75 55 46 99 34 49 92 82 11 100 15 71 75 12 22 56 47 74 20 98 59 65 14 76 1 40 89 36 43 93 83 73 75 100 50 95 27 10 72 51 25 69 15 3 57 60 84 99 31 44 12 61 69 95 51 31 28 36 57 35 31 52 44 19 79 12 27 27 7 81 68 1",
"output": "1"
},
{
"input": "100 1\n26",
"output": "0"
},
{
"input": "100 50\n8 82 62 11 85 57 5 32 99 92 77 2 61 86 8 88 10 28 83 4 68 79 8 64 56 98 4 88 22 54 30 60 62 79 72 38 17 28 32 16 62 26 56 44 72 33 22 84 77 45",
"output": "0"
},
{
"input": "100 100\n13 88 64 65 78 10 61 97 16 32 76 9 60 1 40 35 90 61 60 85 26 16 38 36 33 95 24 55 82 88 13 9 47 34 94 2 90 74 11 81 46 70 94 11 55 32 19 36 97 16 17 35 38 82 89 16 74 94 97 79 9 94 88 12 28 2 4 25 72 95 49 31 88 82 6 77 70 98 90 57 57 33 38 61 26 75 2 66 22 44 13 35 16 4 33 16 12 66 32 86",
"output": "1"
},
{
"input": "34 64\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "53 98\n1 1 2 2 2 2 2 1 2 2 2 1 1 2 2 2 1 1 2 1 1 2 2 1 1 2 1 1 1 2 1 2 1 1 1 2 2 1 2 1 1 1 2 2 1 2 1 1 2 1 2 2 1 2 2 2 2 2 2 2 2 2 1 1 2 2 1 2 1 2 1 2 1 1 2 2 2 1 1 2 1 2 1 1 1 1 2 2 2 2 2 1 1 2 2 2 1 1",
"output": "1"
},
{
"input": "17 8\n2 5 3 4 3 2 2 2",
"output": "0"
},
{
"input": "24 77\n8 6 10 4 6 6 4 10 9 7 7 5 5 4 6 7 10 6 3 4 6 6 4 9 4 6 2 5 3 4 4 1 4 6 6 8 1 1 6 4 6 2 5 7 7 2 4 4 10 1 10 9 2 3 8 1 10 4 3 9 3 8 3 5 6 3 4 9 5 3 4 1 1 6 1 2 1",
"output": "2"
},
{
"input": "65 74\n7 19 2 38 28 44 34 49 14 13 30 22 11 4 4 12 8 1 40 8 34 31 44 38 21 35 13 7 19 32 37 5 36 26 7 2 15 11 47 45 48 2 49 10 10 42 42 31 50 24 29 34 31 38 39 48 43 47 32 46 10 1 33 21 12 50 13 44 38 11 41 41 10 7",
"output": "1"
},
{
"input": "37 71\n50 93 15 80 82 23 35 90 70 73 55 23 23 6 86 63 38 70 38 52 88 34 25 75 32 19 6 98 31 38 21 8 66 8 59 71 7 80 69 23 17 70 6 40 72 5 48 59 18 1 48 91 17 41 11 27 53 95 87 31 62 94 94 60 38 99 70 50 81 86 44",
"output": "1"
},
{
"input": "35 4\n100 100 100 100",
"output": "0"
},
{
"input": "68 12\n100 100 100 99 99 100 100 100 99 99 99 99",
"output": "0"
},
{
"input": "91 33\n97 100 96 96 97 100 97 97 96 96 99 99 98 97 97 99 99 98 100 96 96 99 100 96 97 100 97 97 99 98 96 98 97",
"output": "0"
},
{
"input": "59 72\n99 96 96 93 94 97 93 96 100 99 93 99 96 92 92 97 93 100 92 100 91 96 99 100 97 98 93 93 96 100 97 99 100 100 91 93 96 91 93 100 95 96 92 97 91 91 99 100 91 95 95 100 92 93 98 93 95 92 95 100 91 95 99 95 92 91 100 93 98 98 96 99",
"output": "1"
},
{
"input": "9 35\n95 54 78 94 56 63 68 73 61 85 73 62 61 94 67 91 66 54 89 69 92 60 91 87 63 62 85 70 62 68 97 88 96 55 62",
"output": "2"
},
{
"input": "99 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1"
},
{
"input": "1 50\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "50"
}
] | 1,579,381,871
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 31
| 155
| 1,228,800
|
n,m=map(int,input().split())
a=input().split()
ls=[0 for i in range(100)]
for i in range(m):
ls[int(a[i])-1]+=1
a.sort(reverse=True)
ans=m//n
while ans:
count=0
for i in range(100):
count+=ls[i]//ans
if(count>=n):
break
ans-=1
print(max(ans,0))
|
Title: Planning The Expedition
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Natasha is planning an expedition to Mars for $n$ people. One of the important tasks is to provide food for each participant.
The warehouse has $m$ daily food packages. Each package has some food type $a_i$.
Each participant must eat exactly one food package each day. Due to extreme loads, each participant must eat the same food type throughout the expedition. Different participants may eat different (or the same) types of food.
Formally, for each participant $j$ Natasha should select his food type $b_j$ and each day $j$-th participant will eat one food package of type $b_j$. The values $b_j$ for different participants may be different.
What is the maximum possible number of days the expedition can last, following the requirements above?
Input Specification:
The first line contains two integers $n$ and $m$ ($1 \le n \le 100$, $1 \le m \le 100$) — the number of the expedition participants and the number of the daily food packages available.
The second line contains sequence of integers $a_1, a_2, \dots, a_m$ ($1 \le a_i \le 100$), where $a_i$ is the type of $i$-th food package.
Output Specification:
Print the single integer — the number of days the expedition can last. If it is not possible to plan the expedition for even one day, print 0.
Demo Input:
['4 10\n1 5 2 1 1 1 2 5 7 2\n', '100 1\n1\n', '2 5\n5 4 3 2 1\n', '3 9\n42 42 42 42 42 42 42 42 42\n']
Demo Output:
['2\n', '0\n', '1\n', '3\n']
Note:
In the first example, Natasha can assign type $1$ food to the first participant, the same type $1$ to the second, type $5$ to the third and type $2$ to the fourth. In this case, the expedition can last for $2$ days, since each participant can get two food packages of his food type (there will be used $4$ packages of type $1$, two packages of type $2$ and two packages of type $5$).
In the second example, there are $100$ participants and only $1$ food package. In this case, the expedition can't last even $1$ day.
|
```python
n,m=map(int,input().split())
a=input().split()
ls=[0 for i in range(100)]
for i in range(m):
ls[int(a[i])-1]+=1
a.sort(reverse=True)
ans=m//n
while ans:
count=0
for i in range(100):
count+=ls[i]//ans
if(count>=n):
break
ans-=1
print(max(ans,0))
```
| 3
|
|
467
|
A
|
George and Accommodation
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
George has recently entered the BSUCP (Berland State University for Cool Programmers). George has a friend Alex who has also entered the university. Now they are moving into a dormitory.
George and Alex want to live in the same room. The dormitory has *n* rooms in total. At the moment the *i*-th room has *p**i* people living in it and the room can accommodate *q**i* people in total (*p**i*<=≤<=*q**i*). Your task is to count how many rooms has free place for both George and Alex.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of rooms.
The *i*-th of the next *n* lines contains two integers *p**i* and *q**i* (0<=≤<=*p**i*<=≤<=*q**i*<=≤<=100) — the number of people who already live in the *i*-th room and the room's capacity.
|
Print a single integer — the number of rooms where George and Alex can move in.
|
[
"3\n1 1\n2 2\n3 3\n",
"3\n1 10\n0 10\n10 10\n"
] |
[
"0\n",
"2\n"
] |
none
| 500
|
[
{
"input": "3\n1 1\n2 2\n3 3",
"output": "0"
},
{
"input": "3\n1 10\n0 10\n10 10",
"output": "2"
},
{
"input": "2\n36 67\n61 69",
"output": "2"
},
{
"input": "3\n21 71\n10 88\n43 62",
"output": "3"
},
{
"input": "3\n1 2\n2 3\n3 4",
"output": "0"
},
{
"input": "10\n0 10\n0 20\n0 30\n0 40\n0 50\n0 60\n0 70\n0 80\n0 90\n0 100",
"output": "10"
},
{
"input": "13\n14 16\n30 31\n45 46\n19 20\n15 17\n66 67\n75 76\n95 97\n29 30\n37 38\n0 2\n36 37\n8 9",
"output": "4"
},
{
"input": "19\n66 67\n97 98\n89 91\n67 69\n67 68\n18 20\n72 74\n28 30\n91 92\n27 28\n75 77\n17 18\n74 75\n28 30\n16 18\n90 92\n9 11\n22 24\n52 54",
"output": "12"
},
{
"input": "15\n55 57\n95 97\n57 59\n34 36\n50 52\n96 98\n39 40\n13 15\n13 14\n74 76\n47 48\n56 58\n24 25\n11 13\n67 68",
"output": "10"
},
{
"input": "17\n68 69\n47 48\n30 31\n52 54\n41 43\n33 35\n38 40\n56 58\n45 46\n92 93\n73 74\n61 63\n65 66\n37 39\n67 68\n77 78\n28 30",
"output": "8"
},
{
"input": "14\n64 66\n43 44\n10 12\n76 77\n11 12\n25 27\n87 88\n62 64\n39 41\n58 60\n10 11\n28 29\n57 58\n12 14",
"output": "7"
},
{
"input": "38\n74 76\n52 54\n78 80\n48 49\n40 41\n64 65\n28 30\n6 8\n49 51\n68 70\n44 45\n57 59\n24 25\n46 48\n49 51\n4 6\n63 64\n76 78\n57 59\n18 20\n63 64\n71 73\n88 90\n21 22\n89 90\n65 66\n89 91\n96 98\n42 44\n1 1\n74 76\n72 74\n39 40\n75 76\n29 30\n48 49\n87 89\n27 28",
"output": "22"
},
{
"input": "100\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0",
"output": "0"
},
{
"input": "26\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2",
"output": "0"
},
{
"input": "68\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2",
"output": "68"
},
{
"input": "7\n0 1\n1 5\n2 4\n3 5\n4 6\n5 6\n6 8",
"output": "5"
},
{
"input": "1\n0 0",
"output": "0"
},
{
"input": "1\n100 100",
"output": "0"
},
{
"input": "44\n0 8\n1 11\n2 19\n3 5\n4 29\n5 45\n6 6\n7 40\n8 19\n9 22\n10 18\n11 26\n12 46\n13 13\n14 27\n15 48\n16 25\n17 20\n18 29\n19 27\n20 45\n21 39\n22 29\n23 39\n24 42\n25 37\n26 52\n27 36\n28 43\n29 35\n30 38\n31 70\n32 47\n33 38\n34 61\n35 71\n36 51\n37 71\n38 59\n39 77\n40 70\n41 80\n42 77\n43 73",
"output": "42"
},
{
"input": "3\n1 3\n2 7\n8 9",
"output": "2"
},
{
"input": "53\n0 1\n1 2\n2 3\n3 4\n4 5\n5 6\n6 7\n7 8\n8 9\n9 10\n10 11\n11 12\n12 13\n13 14\n14 15\n15 16\n16 17\n17 18\n18 19\n19 20\n20 21\n21 22\n22 23\n23 24\n24 25\n25 26\n26 27\n27 28\n28 29\n29 30\n30 31\n31 32\n32 33\n33 34\n34 35\n35 36\n36 37\n37 38\n38 39\n39 40\n40 41\n41 42\n42 43\n43 44\n44 45\n45 46\n46 47\n47 48\n48 49\n49 50\n50 51\n51 52\n52 53",
"output": "0"
},
{
"input": "55\n0 0\n1 1\n2 2\n3 3\n4 4\n5 5\n6 6\n7 7\n8 8\n9 9\n10 10\n11 11\n12 12\n13 13\n14 14\n15 15\n16 16\n17 17\n18 18\n19 19\n20 20\n21 21\n22 22\n23 23\n24 24\n25 25\n26 26\n27 27\n28 28\n29 29\n30 30\n31 31\n32 32\n33 33\n34 34\n35 35\n36 36\n37 37\n38 38\n39 39\n40 40\n41 41\n42 42\n43 43\n44 44\n45 45\n46 46\n47 47\n48 48\n49 49\n50 50\n51 51\n52 52\n53 53\n54 54",
"output": "0"
},
{
"input": "51\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 62\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 73\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 82\n55 68\n55 70\n55 63\n55 55\n55 55\n55 55\n55 75\n55 75\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 73\n55 55\n55 82\n55 99\n55 60",
"output": "12"
},
{
"input": "14\n1 1\n1 1\n1 55\n1 16\n1 1\n1 1\n1 55\n1 62\n1 53\n1 26\n1 1\n1 36\n1 2\n1 3",
"output": "8"
}
] | 1,698,823,027
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 6
| 62
| 0
|
n=int(input())
main=[]
count=0
for i in range(0,n):
lst=list(map(int, input().split()))
main.append(lst)
for j in main:
if j[1]-j[0]>+2:
count+=1
print(count)
|
Title: George and Accommodation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
George has recently entered the BSUCP (Berland State University for Cool Programmers). George has a friend Alex who has also entered the university. Now they are moving into a dormitory.
George and Alex want to live in the same room. The dormitory has *n* rooms in total. At the moment the *i*-th room has *p**i* people living in it and the room can accommodate *q**i* people in total (*p**i*<=≤<=*q**i*). Your task is to count how many rooms has free place for both George and Alex.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of rooms.
The *i*-th of the next *n* lines contains two integers *p**i* and *q**i* (0<=≤<=*p**i*<=≤<=*q**i*<=≤<=100) — the number of people who already live in the *i*-th room and the room's capacity.
Output Specification:
Print a single integer — the number of rooms where George and Alex can move in.
Demo Input:
['3\n1 1\n2 2\n3 3\n', '3\n1 10\n0 10\n10 10\n']
Demo Output:
['0\n', '2\n']
Note:
none
|
```python
n=int(input())
main=[]
count=0
for i in range(0,n):
lst=list(map(int, input().split()))
main.append(lst)
for j in main:
if j[1]-j[0]>+2:
count+=1
print(count)
```
| 0
|
|
681
|
C
|
Heap Operations
|
PROGRAMMING
| 1,600
|
[
"constructive algorithms",
"data structures",
"greedy"
] | null | null |
Petya has recently learned data structure named "Binary heap".
The heap he is now operating with allows the following operations:
- put the given number into the heap; - get the value of the minimum element in the heap; - extract the minimum element from the heap;
Thus, at any moment of time the heap contains several integers (possibly none), some of them might be equal.
In order to better learn this data structure Petya took an empty heap and applied some operations above to it. Also, he carefully wrote down all the operations and their results to his event log, following the format:
- insert *x* — put the element with value *x* in the heap; - getMin *x* — the value of the minimum element contained in the heap was equal to *x*; - removeMin — the minimum element was extracted from the heap (only one instance, if there were many).
All the operations were correct, i.e. there was at least one element in the heap each time getMin or removeMin operations were applied.
While Petya was away for a lunch, his little brother Vova came to the room, took away some of the pages from Petya's log and used them to make paper boats.
Now Vova is worried, if he made Petya's sequence of operations inconsistent. For example, if one apply operations one-by-one in the order they are written in the event log, results of getMin operations might differ from the results recorded by Petya, and some of getMin or removeMin operations may be incorrect, as the heap is empty at the moment they are applied.
Now Vova wants to add some new operation records to the event log in order to make the resulting sequence of operations correct. That is, the result of each getMin operation is equal to the result in the record, and the heap is non-empty when getMin ad removeMin are applied. Vova wants to complete this as fast as possible, as the Petya may get back at any moment. He asks you to add the least possible number of operation records to the current log. Note that arbitrary number of operations may be added at the beginning, between any two other operations, or at the end of the log.
|
The first line of the input contains the only integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of the records left in Petya's journal.
Each of the following *n* lines describe the records in the current log in the order they are applied. Format described in the statement is used. All numbers in the input are integers not exceeding 109 by their absolute value.
|
The first line of the output should contain a single integer *m* — the minimum possible number of records in the modified sequence of operations.
Next *m* lines should contain the corrected sequence of records following the format of the input (described in the statement), one per line and in the order they are applied. All the numbers in the output should be integers not exceeding 109 by their absolute value.
Note that the input sequence of operations must be the subsequence of the output sequence.
It's guaranteed that there exists the correct answer consisting of no more than 1<=000<=000 operations.
|
[
"2\ninsert 3\ngetMin 4\n",
"4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2\n"
] |
[
"4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4\n",
"6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2\n"
] |
In the first sample, after number 3 is inserted into the heap, the minimum number is 3. To make the result of the first getMin equal to 4 one should firstly remove number 3 from the heap and then add number 4 into the heap.
In the second sample case number 1 is inserted two times, so should be similarly removed twice.
| 1,500
|
[
{
"input": "2\ninsert 3\ngetMin 4",
"output": "4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4"
},
{
"input": "4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2",
"output": "6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2"
},
{
"input": "1\ninsert 1",
"output": "1\ninsert 1"
},
{
"input": "1\ngetMin 31",
"output": "2\ninsert 31\ngetMin 31"
},
{
"input": "1\nremoveMin",
"output": "2\ninsert 0\nremoveMin"
},
{
"input": "2\ninsert 2\ngetMin 2",
"output": "2\ninsert 2\ngetMin 2"
},
{
"input": "2\ninsert 31\nremoveMin",
"output": "2\ninsert 31\nremoveMin"
},
{
"input": "2\ngetMin 31\nremoveMin",
"output": "3\ninsert 31\ngetMin 31\nremoveMin"
},
{
"input": "2\nremoveMin\ngetMin 31",
"output": "4\ninsert 0\nremoveMin\ninsert 31\ngetMin 31"
},
{
"input": "8\ninsert 219147240\nremoveMin\ngetMin 923854124\nremoveMin\ngetMin -876779400\nremoveMin\ninsert 387686853\ngetMin 749998368",
"output": "12\ninsert 219147240\nremoveMin\ninsert 923854124\ngetMin 923854124\nremoveMin\ninsert -876779400\ngetMin -876779400\nremoveMin\ninsert 387686853\nremoveMin\ninsert 749998368\ngetMin 749998368"
},
{
"input": "2\nremoveMin\ninsert 450653162",
"output": "3\ninsert 0\nremoveMin\ninsert 450653162"
},
{
"input": "6\ninsert -799688192\ngetMin 491561656\nremoveMin\ninsert -805250162\ninsert -945439443\nremoveMin",
"output": "8\ninsert -799688192\nremoveMin\ninsert 491561656\ngetMin 491561656\nremoveMin\ninsert -805250162\ninsert -945439443\nremoveMin"
},
{
"input": "30\ninsert 62350949\ngetMin -928976719\nremoveMin\ngetMin 766590157\ngetMin -276914351\ninsert 858958907\ngetMin -794653029\ngetMin 505812710\ngetMin -181182543\ninsert -805198995\nremoveMin\ninsert -200361579\nremoveMin\ninsert 988531216\ninsert -474257426\ninsert 579296921\nremoveMin\ninsert -410043658\ngetMin 716684155\nremoveMin\ngetMin -850837161\ngetMin 368670814\ninsert 579000842\nremoveMin\ngetMin -169833018\ninsert 313148949\nremoveMin\nremoveMin\ngetMin 228901059\ngetMin 599172503",
"output": "52\ninsert 62350949\ninsert -928976719\ngetMin -928976719\nremoveMin\nremoveMin\ninsert 766590157\ngetMin 766590157\ninsert -276914351\ngetMin -276914351\ninsert 858958907\ninsert -794653029\ngetMin -794653029\nremoveMin\nremoveMin\ninsert 505812710\ngetMin 505812710\ninsert -181182543\ngetMin -181182543\ninsert -805198995\nremoveMin\ninsert -200361579\nremoveMin\ninsert 988531216\ninsert -474257426\ninsert 579296921\nremoveMin\ninsert -410043658\nremoveMin\nremoveMin\nremoveMin\nremoveMin\ninsert 71668415..."
},
{
"input": "9\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ngetMin 3\nremoveMin\ngetMin 4\nremoveMin\ngetMin 5",
"output": "10\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ninsert 3\ngetMin 3\nremoveMin\ngetMin 4\nremoveMin\ngetMin 5"
},
{
"input": "9\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ngetMin 5\nremoveMin\ngetMin 4\nremoveMin\ngetMin 3",
"output": "12\ninsert 3\ninsert 4\ninsert 5\nremoveMin\nremoveMin\ngetMin 5\nremoveMin\ninsert 4\ngetMin 4\nremoveMin\ninsert 3\ngetMin 3"
},
{
"input": "1\ngetMin 0",
"output": "2\ninsert 0\ngetMin 0"
},
{
"input": "3\ninsert 3\ninsert 4\ngetMin 4",
"output": "4\ninsert 3\ninsert 4\nremoveMin\ngetMin 4"
},
{
"input": "3\ninsert 1\ninsert 2\ngetMin 2",
"output": "4\ninsert 1\ninsert 2\nremoveMin\ngetMin 2"
},
{
"input": "3\ninsert -1\ninsert 0\ngetMin 0",
"output": "4\ninsert -1\ninsert 0\nremoveMin\ngetMin 0"
},
{
"input": "2\ninsert 0\ngetMin 0",
"output": "2\ninsert 0\ngetMin 0"
},
{
"input": "1\ninsert -1",
"output": "1\ninsert -1"
},
{
"input": "3\ninsert 1\ninsert 0\ngetMin 1",
"output": "4\ninsert 1\ninsert 0\nremoveMin\ngetMin 1"
}
] | 1,680,720,631
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 39
| 327
| 30,720,000
|
import sys
input = lambda: sys.stdin.readline().rstrip()
from heapq import *
ans = []
v = []
for _ in range(int(input())):
A = input().split()
a = A[0]
if a=='insert':
b = int(A[1])
ans.append(a+' ' +str(b))
heappush(v,b)
elif a=='getMin':
b = int(A[1])
while v and v[0]<b:
heappop(v)
ans.append('removeMin')
if not v or (v and v[0]>b):
heappush(v,b)
ans.append('insert ' + str(b))
ans.append('getMin ' + str(b))
else:
if not v:
heappush(v,1)
ans.append('insert 1')
ans.append('removeMin')
heappop(v)
print(len(ans))
for a in ans:
print(a)
|
Title: Heap Operations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya has recently learned data structure named "Binary heap".
The heap he is now operating with allows the following operations:
- put the given number into the heap; - get the value of the minimum element in the heap; - extract the minimum element from the heap;
Thus, at any moment of time the heap contains several integers (possibly none), some of them might be equal.
In order to better learn this data structure Petya took an empty heap and applied some operations above to it. Also, he carefully wrote down all the operations and their results to his event log, following the format:
- insert *x* — put the element with value *x* in the heap; - getMin *x* — the value of the minimum element contained in the heap was equal to *x*; - removeMin — the minimum element was extracted from the heap (only one instance, if there were many).
All the operations were correct, i.e. there was at least one element in the heap each time getMin or removeMin operations were applied.
While Petya was away for a lunch, his little brother Vova came to the room, took away some of the pages from Petya's log and used them to make paper boats.
Now Vova is worried, if he made Petya's sequence of operations inconsistent. For example, if one apply operations one-by-one in the order they are written in the event log, results of getMin operations might differ from the results recorded by Petya, and some of getMin or removeMin operations may be incorrect, as the heap is empty at the moment they are applied.
Now Vova wants to add some new operation records to the event log in order to make the resulting sequence of operations correct. That is, the result of each getMin operation is equal to the result in the record, and the heap is non-empty when getMin ad removeMin are applied. Vova wants to complete this as fast as possible, as the Petya may get back at any moment. He asks you to add the least possible number of operation records to the current log. Note that arbitrary number of operations may be added at the beginning, between any two other operations, or at the end of the log.
Input Specification:
The first line of the input contains the only integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of the records left in Petya's journal.
Each of the following *n* lines describe the records in the current log in the order they are applied. Format described in the statement is used. All numbers in the input are integers not exceeding 109 by their absolute value.
Output Specification:
The first line of the output should contain a single integer *m* — the minimum possible number of records in the modified sequence of operations.
Next *m* lines should contain the corrected sequence of records following the format of the input (described in the statement), one per line and in the order they are applied. All the numbers in the output should be integers not exceeding 109 by their absolute value.
Note that the input sequence of operations must be the subsequence of the output sequence.
It's guaranteed that there exists the correct answer consisting of no more than 1<=000<=000 operations.
Demo Input:
['2\ninsert 3\ngetMin 4\n', '4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2\n']
Demo Output:
['4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4\n', '6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2\n']
Note:
In the first sample, after number 3 is inserted into the heap, the minimum number is 3. To make the result of the first getMin equal to 4 one should firstly remove number 3 from the heap and then add number 4 into the heap.
In the second sample case number 1 is inserted two times, so should be similarly removed twice.
|
```python
import sys
input = lambda: sys.stdin.readline().rstrip()
from heapq import *
ans = []
v = []
for _ in range(int(input())):
A = input().split()
a = A[0]
if a=='insert':
b = int(A[1])
ans.append(a+' ' +str(b))
heappush(v,b)
elif a=='getMin':
b = int(A[1])
while v and v[0]<b:
heappop(v)
ans.append('removeMin')
if not v or (v and v[0]>b):
heappush(v,b)
ans.append('insert ' + str(b))
ans.append('getMin ' + str(b))
else:
if not v:
heappush(v,1)
ans.append('insert 1')
ans.append('removeMin')
heappop(v)
print(len(ans))
for a in ans:
print(a)
```
| 3
|
|
818
|
A
|
Diplomas and Certificates
|
PROGRAMMING
| 800
|
[
"implementation",
"math"
] | null | null |
There are *n* students who have taken part in an olympiad. Now it's time to award the students.
Some of them will receive diplomas, some wiil get certificates, and others won't receive anything. Students with diplomas and certificates are called winners. But there are some rules of counting the number of diplomas and certificates. The number of certificates must be exactly *k* times greater than the number of diplomas. The number of winners must not be greater than half of the number of all students (i.e. not be greater than half of *n*). It's possible that there are no winners.
You have to identify the maximum possible number of winners, according to these rules. Also for this case you have to calculate the number of students with diplomas, the number of students with certificates and the number of students who are not winners.
|
The first (and the only) line of input contains two integers *n* and *k* (1<=≤<=*n*,<=*k*<=≤<=1012), where *n* is the number of students and *k* is the ratio between the number of certificates and the number of diplomas.
|
Output three numbers: the number of students with diplomas, the number of students with certificates and the number of students who are not winners in case when the number of winners is maximum possible.
It's possible that there are no winners.
|
[
"18 2\n",
"9 10\n",
"1000000000000 5\n",
"1000000000000 499999999999\n"
] |
[
"3 6 9\n",
"0 0 9\n",
"83333333333 416666666665 500000000002\n",
"1 499999999999 500000000000\n"
] |
none
| 0
|
[
{
"input": "18 2",
"output": "3 6 9"
},
{
"input": "9 10",
"output": "0 0 9"
},
{
"input": "1000000000000 5",
"output": "83333333333 416666666665 500000000002"
},
{
"input": "1000000000000 499999999999",
"output": "1 499999999999 500000000000"
},
{
"input": "1 1",
"output": "0 0 1"
},
{
"input": "5 3",
"output": "0 0 5"
},
{
"input": "42 6",
"output": "3 18 21"
},
{
"input": "1000000000000 1000",
"output": "499500499 499500499000 500000000501"
},
{
"input": "999999999999 999999",
"output": "499999 499998500001 500000999999"
},
{
"input": "732577309725 132613",
"output": "2762066 366285858458 366288689201"
},
{
"input": "152326362626 15",
"output": "4760198832 71402982480 76163181314"
},
{
"input": "2 1",
"output": "0 0 2"
},
{
"input": "1000000000000 500000000000",
"output": "0 0 1000000000000"
},
{
"input": "100000000000 50000000011",
"output": "0 0 100000000000"
},
{
"input": "1000000000000 32416187567",
"output": "15 486242813505 513757186480"
},
{
"input": "1000000000000 7777777777",
"output": "64 497777777728 502222222208"
},
{
"input": "1000000000000 77777777777",
"output": "6 466666666662 533333333332"
},
{
"input": "100000000000 578485652",
"output": "86 49749766072 50250233842"
},
{
"input": "999999999999 10000000000",
"output": "49 490000000000 509999999950"
},
{
"input": "7 2",
"output": "1 2 4"
},
{
"input": "420506530901 752346673804",
"output": "0 0 420506530901"
},
{
"input": "960375521135 321688347872",
"output": "1 321688347872 638687173262"
},
{
"input": "1000000000000 1000000000000",
"output": "0 0 1000000000000"
},
{
"input": "99999999999 15253636363",
"output": "3 45760909089 54239090907"
},
{
"input": "19 2",
"output": "3 6 10"
},
{
"input": "999999999999 1000000000000",
"output": "0 0 999999999999"
},
{
"input": "1000000000000 5915587276",
"output": "84 496909331184 503090668732"
},
{
"input": "1000000000000 1000000006",
"output": "499 499000002994 500999996507"
},
{
"input": "549755813888 134217728",
"output": "2047 274743689216 275012122625"
},
{
"input": "99999999999 3333333",
"output": "14999 49996661667 50003323333"
},
{
"input": "9 1",
"output": "2 2 5"
},
{
"input": "1000000000000 250000000001",
"output": "1 250000000001 749999999998"
},
{
"input": "5 1",
"output": "1 1 3"
},
{
"input": "3107038133 596040207",
"output": "2 1192080414 1914957717"
},
{
"input": "1000000000000 73786977",
"output": "6776 499980556152 500019437072"
},
{
"input": "1000000000000 73786976",
"output": "6776 499980549376 500019443848"
},
{
"input": "1000000000000 25000000000",
"output": "19 475000000000 524999999981"
},
{
"input": "216929598879 768233755932",
"output": "0 0 216929598879"
},
{
"input": "1000000000000 250000000000",
"output": "1 250000000000 749999999999"
},
{
"input": "1000000000000 100000000001",
"output": "4 400000000004 599999999992"
},
{
"input": "100000000000 100000000001",
"output": "0 0 100000000000"
},
{
"input": "900000000000 100281800001",
"output": "4 401127200004 498872799992"
},
{
"input": "906028900004 109123020071",
"output": "4 436492080284 469536819716"
},
{
"input": "1000000000000 1",
"output": "250000000000 250000000000 500000000000"
}
] | 1,516,853,535
| 675
|
Python 3
|
OK
|
TESTS
| 44
| 62
| 5,632,000
|
def f(m):
global n,k
if(2*(m*k+m)<=n):
return True
else:
return False
n, k = [int(x) for x in input().split()]
l = -1
r = n
while( l+1!= r):
mid = (l+r) // 2
if(f(mid)):
l =mid
else:
r = mid
print(l,l*k,n-(l+l*k),sep = " ")
|
Title: Diplomas and Certificates
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* students who have taken part in an olympiad. Now it's time to award the students.
Some of them will receive diplomas, some wiil get certificates, and others won't receive anything. Students with diplomas and certificates are called winners. But there are some rules of counting the number of diplomas and certificates. The number of certificates must be exactly *k* times greater than the number of diplomas. The number of winners must not be greater than half of the number of all students (i.e. not be greater than half of *n*). It's possible that there are no winners.
You have to identify the maximum possible number of winners, according to these rules. Also for this case you have to calculate the number of students with diplomas, the number of students with certificates and the number of students who are not winners.
Input Specification:
The first (and the only) line of input contains two integers *n* and *k* (1<=≤<=*n*,<=*k*<=≤<=1012), where *n* is the number of students and *k* is the ratio between the number of certificates and the number of diplomas.
Output Specification:
Output three numbers: the number of students with diplomas, the number of students with certificates and the number of students who are not winners in case when the number of winners is maximum possible.
It's possible that there are no winners.
Demo Input:
['18 2\n', '9 10\n', '1000000000000 5\n', '1000000000000 499999999999\n']
Demo Output:
['3 6 9\n', '0 0 9\n', '83333333333 416666666665 500000000002\n', '1 499999999999 500000000000\n']
Note:
none
|
```python
def f(m):
global n,k
if(2*(m*k+m)<=n):
return True
else:
return False
n, k = [int(x) for x in input().split()]
l = -1
r = n
while( l+1!= r):
mid = (l+r) // 2
if(f(mid)):
l =mid
else:
r = mid
print(l,l*k,n-(l+l*k),sep = " ")
```
| 3
|
|
991
|
B
|
Getting an A
|
PROGRAMMING
| 900
|
[
"greedy",
"sortings"
] | null | null |
Translator's note: in Russia's most widespread grading system, there are four grades: 5, 4, 3, 2, the higher the better, roughly corresponding to A, B, C and F respectively in American grading system.
The term is coming to an end and students start thinking about their grades. Today, a professor told his students that the grades for his course would be given out automatically — he would calculate the simple average (arithmetic mean) of all grades given out for lab works this term and round to the nearest integer. The rounding would be done in favour of the student — $4.5$ would be rounded up to $5$ (as in example 3), but $4.4$ would be rounded down to $4$.
This does not bode well for Vasya who didn't think those lab works would influence anything, so he may receive a grade worse than $5$ (maybe even the dreaded $2$). However, the professor allowed him to redo some of his works of Vasya's choosing to increase his average grade. Vasya wants to redo as as few lab works as possible in order to get $5$ for the course. Of course, Vasya will get $5$ for the lab works he chooses to redo.
Help Vasya — calculate the minimum amount of lab works Vasya has to redo.
|
The first line contains a single integer $n$ — the number of Vasya's grades ($1 \leq n \leq 100$).
The second line contains $n$ integers from $2$ to $5$ — Vasya's grades for his lab works.
|
Output a single integer — the minimum amount of lab works that Vasya has to redo. It can be shown that Vasya can always redo enough lab works to get a $5$.
|
[
"3\n4 4 4\n",
"4\n5 4 5 5\n",
"4\n5 3 3 5\n"
] |
[
"2\n",
"0\n",
"1\n"
] |
In the first sample, it is enough to redo two lab works to make two $4$s into $5$s.
In the second sample, Vasya's average is already $4.75$ so he doesn't have to redo anything to get a $5$.
In the second sample Vasya has to redo one lab work to get rid of one of the $3$s, that will make the average exactly $4.5$ so the final grade would be $5$.
| 1,000
|
[
{
"input": "3\n4 4 4",
"output": "2"
},
{
"input": "4\n5 4 5 5",
"output": "0"
},
{
"input": "4\n5 3 3 5",
"output": "1"
},
{
"input": "1\n5",
"output": "0"
},
{
"input": "4\n3 2 5 4",
"output": "2"
},
{
"input": "5\n5 4 3 2 5",
"output": "2"
},
{
"input": "8\n5 4 2 5 5 2 5 5",
"output": "1"
},
{
"input": "5\n5 5 2 5 5",
"output": "1"
},
{
"input": "6\n5 5 5 5 5 2",
"output": "0"
},
{
"input": "6\n2 2 2 2 2 2",
"output": "5"
},
{
"input": "100\n3 2 4 3 3 3 4 2 3 5 5 2 5 2 3 2 4 4 4 5 5 4 2 5 4 3 2 5 3 4 3 4 2 4 5 4 2 4 3 4 5 2 5 3 3 4 2 2 4 4 4 5 4 3 3 3 2 5 2 2 2 3 5 4 3 2 4 5 5 5 2 2 4 2 3 3 3 5 3 2 2 4 5 5 4 5 5 4 2 3 2 2 2 2 5 3 5 2 3 4",
"output": "40"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "1\n3",
"output": "1"
},
{
"input": "1\n4",
"output": "1"
},
{
"input": "4\n3 2 5 5",
"output": "1"
},
{
"input": "6\n4 3 3 3 3 4",
"output": "4"
},
{
"input": "8\n3 3 5 3 3 3 5 5",
"output": "3"
},
{
"input": "10\n2 4 5 5 5 5 2 3 3 2",
"output": "3"
},
{
"input": "20\n5 2 5 2 2 2 2 2 5 2 2 5 2 5 5 2 2 5 2 2",
"output": "10"
},
{
"input": "25\n4 4 4 4 3 4 3 3 3 3 3 4 4 3 4 4 4 4 4 3 3 3 4 3 4",
"output": "13"
},
{
"input": "30\n4 2 4 2 4 2 2 4 4 4 4 2 4 4 4 2 2 2 2 4 2 4 4 4 2 4 2 4 2 2",
"output": "15"
},
{
"input": "52\n5 3 4 4 4 3 5 3 4 5 3 4 4 3 5 5 4 3 3 3 4 5 4 4 5 3 5 3 5 4 5 5 4 3 4 5 3 4 3 3 4 4 4 3 5 3 4 5 3 5 4 5",
"output": "14"
},
{
"input": "77\n5 3 2 3 2 3 2 3 5 2 2 3 3 3 3 5 3 3 2 2 2 5 5 5 5 3 2 2 5 2 3 2 2 5 2 5 3 3 2 2 5 5 2 3 3 2 3 3 3 2 5 5 2 2 3 3 5 5 2 2 5 5 3 3 5 5 2 2 5 2 2 5 5 5 2 5 2",
"output": "33"
},
{
"input": "55\n3 4 2 3 3 2 4 4 3 3 4 2 4 4 3 3 2 3 2 2 3 3 2 3 2 3 2 4 4 3 2 3 2 3 3 2 2 4 2 4 4 3 4 3 2 4 3 2 4 2 2 3 2 3 4",
"output": "34"
},
{
"input": "66\n5 4 5 5 4 4 4 4 4 2 5 5 2 4 2 2 2 5 4 4 4 4 5 2 2 5 5 2 2 4 4 2 4 2 2 5 2 5 4 5 4 5 4 4 2 5 2 4 4 4 2 2 5 5 5 5 4 4 4 4 4 2 4 5 5 5",
"output": "16"
},
{
"input": "99\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2",
"output": "83"
},
{
"input": "100\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2",
"output": "84"
},
{
"input": "99\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3",
"output": "75"
},
{
"input": "100\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3",
"output": "75"
},
{
"input": "99\n2 2 3 3 3 3 3 2 2 3 2 3 2 3 2 2 3 2 3 2 3 3 3 3 2 2 2 2 3 2 3 3 3 3 3 2 3 3 3 3 2 3 2 3 3 3 2 3 2 3 3 3 3 2 2 3 2 3 2 3 2 3 2 2 2 3 3 2 3 2 2 2 2 2 2 2 2 3 3 3 3 2 3 2 3 3 2 3 2 3 2 3 3 2 2 2 3 2 3",
"output": "75"
},
{
"input": "100\n3 2 3 3 2 2 3 2 2 3 3 2 3 2 2 2 2 2 3 2 2 2 3 2 3 3 2 2 3 2 2 2 2 3 2 3 3 2 2 3 2 2 3 2 3 2 2 3 2 3 2 2 3 2 2 3 3 3 3 3 2 2 3 2 3 3 2 2 3 2 2 2 3 2 2 3 3 2 2 3 3 3 3 2 3 2 2 2 3 3 2 2 3 2 2 2 2 3 2 2",
"output": "75"
},
{
"input": "99\n4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4",
"output": "50"
},
{
"input": "100\n4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4",
"output": "50"
},
{
"input": "99\n2 2 2 2 4 2 2 2 2 4 4 4 4 2 4 4 2 2 4 4 2 2 2 4 4 2 4 4 2 4 4 2 2 2 4 4 2 2 2 2 4 4 4 2 2 2 4 4 2 4 2 4 2 2 4 2 4 4 4 4 4 2 2 4 4 4 2 2 2 2 4 2 4 2 2 2 2 2 2 4 4 2 4 2 2 4 2 2 2 2 2 4 2 4 2 2 4 4 4",
"output": "54"
},
{
"input": "100\n4 2 4 4 2 4 2 2 4 4 4 4 4 4 4 4 4 2 4 4 2 2 4 4 2 2 4 4 2 2 2 4 4 2 4 4 2 4 2 2 4 4 2 4 2 4 4 4 2 2 2 2 2 2 2 4 2 2 2 4 4 4 2 2 2 2 4 2 2 2 2 2 2 2 4 4 4 4 4 4 4 4 4 2 2 2 2 2 2 2 2 4 4 4 4 2 4 2 2 4",
"output": "50"
},
{
"input": "99\n4 3 4 4 4 4 4 3 4 3 3 4 3 3 4 4 3 3 3 4 3 4 3 3 4 3 3 3 3 4 3 4 4 3 4 4 3 3 4 4 4 3 3 3 4 4 3 3 4 3 4 3 4 3 4 3 3 3 3 4 3 4 4 4 4 4 4 3 4 4 3 3 3 3 3 3 3 3 4 3 3 3 4 4 4 4 4 4 3 3 3 3 4 4 4 3 3 4 3",
"output": "51"
},
{
"input": "100\n3 3 4 4 4 4 4 3 4 4 3 3 3 3 4 4 4 4 4 4 3 3 3 4 3 4 3 4 3 3 4 3 3 3 3 3 3 3 3 4 3 4 3 3 4 3 3 3 4 4 3 4 4 3 3 4 4 4 4 4 4 3 4 4 3 4 3 3 3 4 4 3 3 4 4 3 4 4 4 3 3 4 3 3 4 3 4 3 4 3 3 4 4 4 3 3 4 3 3 4",
"output": "51"
},
{
"input": "99\n3 3 4 4 4 2 4 4 3 2 3 4 4 4 2 2 2 3 2 4 4 2 4 3 2 2 2 4 2 3 4 3 4 2 3 3 4 2 3 3 2 3 4 4 3 2 4 3 4 3 3 3 3 3 4 4 3 3 4 4 2 4 3 4 3 2 3 3 3 4 4 2 4 4 2 3 4 2 3 3 3 4 2 2 3 2 4 3 2 3 3 2 3 4 2 3 3 2 3",
"output": "58"
},
{
"input": "100\n2 2 4 2 2 3 2 3 4 4 3 3 4 4 4 2 3 2 2 3 4 2 3 2 4 3 4 2 3 3 3 2 4 3 3 2 2 3 2 4 4 2 4 3 4 4 3 3 3 2 4 2 2 2 2 2 2 3 2 3 2 3 4 4 4 2 2 3 4 4 3 4 3 3 2 3 3 3 4 3 2 3 3 2 4 2 3 3 4 4 3 3 4 3 4 3 3 4 3 3",
"output": "61"
},
{
"input": "99\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5",
"output": "0"
},
{
"input": "100\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5",
"output": "0"
},
{
"input": "99\n2 2 2 2 2 5 2 2 5 2 5 2 5 2 2 2 2 2 5 2 2 2 5 2 2 5 2 2 2 5 5 2 5 2 2 5 2 5 2 2 5 5 2 2 2 2 5 5 2 2 2 5 2 2 5 2 2 2 2 2 5 5 5 5 2 2 5 2 5 2 2 2 2 2 5 2 2 5 5 2 2 2 2 2 5 5 2 2 5 5 2 2 2 2 5 5 5 2 5",
"output": "48"
},
{
"input": "100\n5 5 2 2 2 2 2 2 5 5 2 5 2 2 2 2 5 2 5 2 5 5 2 5 5 2 2 2 2 2 2 5 2 2 2 5 2 2 5 2 2 5 5 5 2 5 5 5 5 5 5 2 2 5 2 2 5 5 5 5 5 2 5 2 5 2 2 2 5 2 5 2 5 5 2 5 5 2 2 5 2 5 5 2 5 2 2 5 2 2 2 5 2 2 2 2 5 5 2 5",
"output": "38"
},
{
"input": "99\n5 3 3 3 5 3 3 3 3 3 3 3 3 5 3 3 3 3 3 3 3 3 5 3 3 3 5 5 3 5 5 3 3 5 5 5 3 5 3 3 3 3 5 3 3 5 5 3 5 5 5 3 5 3 5 3 5 5 5 5 3 3 3 5 3 5 3 3 3 5 5 5 5 5 3 5 5 3 3 5 5 3 5 5 3 5 5 3 3 5 5 5 3 3 3 5 3 3 3",
"output": "32"
},
{
"input": "100\n3 3 3 5 3 3 3 3 3 3 5 5 5 5 3 3 3 3 5 3 3 3 3 3 5 3 5 3 3 5 5 5 5 5 5 3 3 5 3 3 5 3 5 5 5 3 5 3 3 3 3 3 3 3 3 3 3 3 5 5 3 5 3 5 5 3 5 3 3 5 3 5 5 5 5 3 5 3 3 3 5 5 5 3 3 3 5 3 5 5 5 3 3 3 5 3 5 5 3 5",
"output": "32"
},
{
"input": "99\n5 3 5 5 3 3 3 2 2 5 2 5 3 2 5 2 5 2 3 5 3 2 3 2 5 5 2 2 3 3 5 5 3 5 5 2 3 3 5 2 2 5 3 2 5 2 3 5 5 2 5 2 2 5 3 3 5 3 3 5 3 2 3 5 3 2 3 2 3 2 2 2 2 5 2 2 3 2 5 5 5 3 3 2 5 3 5 5 5 2 3 2 5 5 2 5 2 5 3",
"output": "39"
},
{
"input": "100\n3 5 3 3 5 5 3 3 2 5 5 3 3 3 2 2 3 2 5 3 2 2 3 3 3 3 2 5 3 2 3 3 5 2 2 2 3 2 3 5 5 3 2 5 2 2 5 5 3 5 5 5 2 2 5 5 3 3 2 2 2 5 3 3 2 2 3 5 3 2 3 5 5 3 2 3 5 5 3 3 2 3 5 2 5 5 5 5 5 5 3 5 3 2 3 3 2 5 2 2",
"output": "42"
},
{
"input": "99\n4 4 4 5 4 4 5 5 4 4 5 5 5 4 5 4 5 5 5 4 4 5 5 5 5 4 5 5 5 4 4 5 5 4 5 4 4 4 5 5 5 5 4 4 5 4 4 5 4 4 4 4 5 5 5 4 5 4 5 5 5 5 5 4 5 4 5 4 4 4 4 5 5 5 4 5 5 4 4 5 5 5 4 5 4 4 5 5 4 5 5 5 5 4 5 5 4 4 4",
"output": "0"
},
{
"input": "100\n4 4 5 5 5 5 5 5 4 4 5 5 4 4 5 5 4 5 4 4 4 4 4 4 4 4 5 5 5 5 5 4 4 4 4 4 5 4 4 5 4 4 4 5 5 5 4 5 5 5 5 5 5 4 4 4 4 4 4 5 5 4 5 4 4 5 4 4 4 4 5 5 4 5 5 4 4 4 5 5 5 5 4 5 5 5 4 4 5 5 5 4 5 4 5 4 4 5 5 4",
"output": "1"
},
{
"input": "99\n2 2 2 5 2 2 2 2 2 4 4 5 5 2 2 4 2 5 2 2 2 5 2 2 5 5 5 4 5 5 4 4 2 2 5 2 2 2 2 5 5 2 2 4 4 4 2 2 2 5 2 4 4 2 4 2 4 2 5 4 2 2 5 2 4 4 4 2 5 2 2 5 4 2 2 5 5 5 2 4 5 4 5 5 4 4 4 5 4 5 4 5 4 2 5 2 2 2 4",
"output": "37"
},
{
"input": "100\n4 4 5 2 2 5 4 5 2 2 2 4 2 5 4 4 2 2 4 5 2 4 2 5 5 4 2 4 4 2 2 5 4 2 5 4 5 2 5 2 4 2 5 4 5 2 2 2 5 2 5 2 5 2 2 4 4 5 5 5 5 5 5 5 4 2 2 2 4 2 2 4 5 5 4 5 4 2 2 2 2 4 2 2 5 5 4 2 2 5 4 5 5 5 4 5 5 5 2 2",
"output": "31"
},
{
"input": "99\n5 3 4 4 5 4 4 4 3 5 4 3 3 4 3 5 5 5 5 4 3 3 5 3 4 5 3 5 4 4 3 5 5 4 4 4 4 3 5 3 3 5 5 5 5 5 4 3 4 4 3 5 5 3 3 4 4 4 5 4 4 5 4 4 4 4 5 5 4 3 3 4 3 5 3 3 3 3 4 4 4 4 3 4 5 4 4 5 5 5 3 4 5 3 4 5 4 3 3",
"output": "24"
},
{
"input": "100\n5 4 4 4 5 5 5 4 5 4 4 3 3 4 4 4 5 4 5 5 3 5 5 4 5 5 5 4 4 5 3 5 3 5 3 3 5 4 4 5 5 4 5 5 3 4 5 4 4 3 4 4 3 3 5 4 5 4 5 3 4 5 3 4 5 4 3 5 4 5 4 4 4 3 4 5 3 4 3 5 3 4 4 4 3 4 4 5 3 3 4 4 5 5 4 3 4 4 3 5",
"output": "19"
},
{
"input": "99\n2 2 5 2 5 3 4 2 3 5 4 3 4 2 5 3 2 2 4 2 4 4 5 4 4 5 2 5 5 3 2 3 2 2 3 4 5 3 5 2 5 4 4 5 4 2 2 3 2 3 3 3 4 4 3 2 2 4 4 2 5 3 5 3 5 4 4 4 5 4 5 2 2 5 4 4 4 3 3 2 5 2 5 2 3 2 5 2 2 5 5 3 4 5 3 4 4 4 4",
"output": "37"
},
{
"input": "2\n5 2",
"output": "1"
},
{
"input": "5\n2 2 2 2 2",
"output": "5"
},
{
"input": "100\n2 3 2 2 2 3 2 3 3 3 3 3 2 3 3 2 2 3 3 2 3 2 3 2 3 4 4 4 3 3 3 3 3 4 4 3 3 4 3 2 3 4 3 3 3 3 2 3 4 3 4 3 3 2 4 4 2 4 4 3 3 3 3 4 3 2 3 4 3 4 4 4 4 4 3 2 2 3 4 2 4 4 4 2 2 4 2 2 3 2 2 4 4 3 4 2 3 3 2 2",
"output": "61"
},
{
"input": "100\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4",
"output": "1"
},
{
"input": "100\n5 4 3 5 3 5 4 2 3 3 4 5 4 5 5 4 2 4 2 2 5 2 5 3 4 4 4 5 5 5 3 4 4 4 3 5 3 2 5 4 3 3 3 5 2 3 4 2 5 4 3 4 5 2 2 3 4 4 2 3 3 3 2 5 2 3 4 3 3 3 2 5 4 3 4 5 4 2 5 4 5 2 2 4 2 2 5 5 4 5 2 2 2 2 5 2 4 4 4 5",
"output": "35"
},
{
"input": "2\n2 2",
"output": "2"
},
{
"input": "20\n4 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 5",
"output": "1"
}
] | 1,698,243,881
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 61
| 46
| 0
|
n = int(input())
a = list(map(int,input().split()))
counter = 0
a.sort()
while True:
if (sum(a))/n >= 4.5:
break
else:
a[0] = 5
a.sort()
counter += 1
print(counter)
|
Title: Getting an A
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Translator's note: in Russia's most widespread grading system, there are four grades: 5, 4, 3, 2, the higher the better, roughly corresponding to A, B, C and F respectively in American grading system.
The term is coming to an end and students start thinking about their grades. Today, a professor told his students that the grades for his course would be given out automatically — he would calculate the simple average (arithmetic mean) of all grades given out for lab works this term and round to the nearest integer. The rounding would be done in favour of the student — $4.5$ would be rounded up to $5$ (as in example 3), but $4.4$ would be rounded down to $4$.
This does not bode well for Vasya who didn't think those lab works would influence anything, so he may receive a grade worse than $5$ (maybe even the dreaded $2$). However, the professor allowed him to redo some of his works of Vasya's choosing to increase his average grade. Vasya wants to redo as as few lab works as possible in order to get $5$ for the course. Of course, Vasya will get $5$ for the lab works he chooses to redo.
Help Vasya — calculate the minimum amount of lab works Vasya has to redo.
Input Specification:
The first line contains a single integer $n$ — the number of Vasya's grades ($1 \leq n \leq 100$).
The second line contains $n$ integers from $2$ to $5$ — Vasya's grades for his lab works.
Output Specification:
Output a single integer — the minimum amount of lab works that Vasya has to redo. It can be shown that Vasya can always redo enough lab works to get a $5$.
Demo Input:
['3\n4 4 4\n', '4\n5 4 5 5\n', '4\n5 3 3 5\n']
Demo Output:
['2\n', '0\n', '1\n']
Note:
In the first sample, it is enough to redo two lab works to make two $4$s into $5$s.
In the second sample, Vasya's average is already $4.75$ so he doesn't have to redo anything to get a $5$.
In the second sample Vasya has to redo one lab work to get rid of one of the $3$s, that will make the average exactly $4.5$ so the final grade would be $5$.
|
```python
n = int(input())
a = list(map(int,input().split()))
counter = 0
a.sort()
while True:
if (sum(a))/n >= 4.5:
break
else:
a[0] = 5
a.sort()
counter += 1
print(counter)
```
| 3
|
|
926
|
I
|
A Vital Problem
|
PROGRAMMING
| 1,700
|
[] | null | null |
Polycarp has a strict daily schedule. He has *n* alarms set for each day, and the *i*-th alarm rings each day at the same time during exactly one minute.
Determine the longest time segment when Polycarp can sleep, i. e. no alarm rings in that period. It is possible that Polycarp begins to sleep in one day, and wakes up in another.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of alarms.
Each of the next *n* lines contains a description of one alarm. Each description has a format "hh:mm", where *hh* is the hour when the alarm rings, and *mm* is the minute of that hour when the alarm rings. The number of hours is between 0 and 23, and the number of minutes is between 0 and 59. All alarm times are distinct. The order of the alarms is arbitrary.
Each alarm starts ringing in the beginning of the corresponding minute and rings for exactly one minute (i. e. stops ringing in the beginning of the next minute). Polycarp can start sleeping instantly when no alarm is ringing, and he wakes up at the moment when some alarm starts ringing.
|
Print a line in format "hh:mm", denoting the maximum time Polycarp can sleep continuously. *hh* denotes the number of hours, and *mm* denotes the number of minutes. The number of minutes should be between 0 and 59. Look through examples to understand the format better.
|
[
"1\n05:43\n",
"4\n22:00\n03:21\n16:03\n09:59\n"
] |
[
"23:59\n",
"06:37\n"
] |
In the first example there is only one alarm which rings during one minute of a day, and then rings again on the next day, 23 hours and 59 minutes later. Polycarp can sleep all this time.
| 0
|
[
{
"input": "1\n05:43",
"output": "23:59"
},
{
"input": "4\n22:00\n03:21\n16:03\n09:59",
"output": "06:37"
},
{
"input": "20\n23:59\n00:00\n00:01\n00:02\n00:03\n00:04\n00:05\n00:06\n00:07\n00:08\n00:09\n00:10\n00:11\n00:12\n00:13\n00:14\n00:15\n00:16\n00:17\n00:18",
"output": "23:40"
},
{
"input": "21\n23:28\n23:29\n23:30\n23:31\n23:32\n23:33\n23:34\n23:35\n23:36\n23:37\n23:38\n23:39\n23:40\n23:41\n23:42\n23:43\n23:44\n23:45\n23:46\n23:47\n23:48",
"output": "23:39"
},
{
"input": "2\n00:00\n23:59",
"output": "23:58"
},
{
"input": "2\n01:00\n01:01",
"output": "23:58"
},
{
"input": "3\n01:00\n01:01\n01:02",
"output": "23:57"
},
{
"input": "2\n06:25\n22:43",
"output": "16:17"
},
{
"input": "2\n05:53\n04:15",
"output": "22:21"
},
{
"input": "2\n11:24\n13:53",
"output": "21:30"
},
{
"input": "3\n22:50\n11:46\n22:36",
"output": "12:55"
},
{
"input": "4\n10:00\n15:30\n03:48\n11:46",
"output": "12:17"
},
{
"input": "5\n01:40\n08:08\n14:58\n18:54\n17:52",
"output": "06:49"
},
{
"input": "6\n04:05\n03:46\n18:53\n04:07\n22:58\n08:49",
"output": "10:03"
},
{
"input": "7\n22:26\n21:15\n14:57\n08:27\n19:31\n13:51\n14:21",
"output": "10:00"
},
{
"input": "8\n15:52\n06:02\n13:08\n06:18\n21:54\n05:02\n22:56\n00:10",
"output": "06:49"
},
{
"input": "9\n01:38\n15:16\n18:50\n00:45\n17:26\n16:30\n09:10\n00:46\n05:49",
"output": "06:05"
},
{
"input": "10\n01:01\n04:46\n12:17\n04:37\n19:20\n10:46\n12:50\n03:17\n23:50\n19:13",
"output": "06:22"
},
{
"input": "20\n14:59\n00:52\n15:39\n08:40\n12:49\n15:15\n13:17\n14:29\n11:43\n14:39\n08:57\n12:53\n17:38\n11:23\n07:53\n12:58\n00:29\n06:20\n05:20\n23:59",
"output": "06:20"
},
{
"input": "31\n21:46\n16:36\n19:00\n03:43\n07:33\n16:16\n22:08\n16:27\n14:25\n18:43\n14:32\n13:15\n13:27\n06:13\n22:34\n09:39\n11:55\n12:33\n17:39\n00:49\n09:51\n07:38\n00:42\n00:57\n01:40\n08:06\n16:39\n12:13\n12:15\n08:38\n14:24",
"output": "02:45"
},
{
"input": "40\n22:10\n12:46\n13:20\n14:31\n23:38\n15:42\n15:53\n13:28\n00:03\n13:01\n10:44\n18:42\n12:35\n18:50\n19:35\n05:11\n02:29\n05:00\n06:06\n18:05\n08:09\n07:02\n14:51\n15:14\n09:48\n05:07\n04:53\n06:19\n00:18\n08:02\n15:08\n11:17\n00:59\n00:30\n01:17\n07:23\n10:20\n03:54\n16:55\n05:25",
"output": "02:34"
},
{
"input": "50\n21:58\n09:10\n01:27\n20:25\n12:48\n20:44\n23:13\n08:44\n14:55\n05:58\n09:30\n01:54\n04:15\n14:25\n12:22\n13:37\n06:18\n20:07\n00:40\n19:11\n15:06\n15:49\n01:40\n17:53\n01:04\n19:54\n00:31\n22:25\n07:52\n10:25\n11:52\n13:24\n06:52\n08:42\n00:42\n15:09\n09:58\n16:25\n23:31\n11:26\n11:43\n00:59\n10:08\n07:42\n00:39\n14:35\n08:00\n16:04\n01:01\n03:19",
"output": "01:42"
},
{
"input": "60\n17:21\n17:49\n12:33\n03:42\n16:16\n16:21\n22:06\n19:51\n14:52\n03:23\n08:16\n13:11\n19:16\n04:13\n12:22\n07:27\n07:09\n22:47\n20:21\n10:10\n19:52\n17:53\n15:45\n09:13\n18:36\n04:10\n03:59\n23:08\n19:30\n09:36\n18:58\n01:34\n14:25\n12:43\n19:12\n03:05\n04:25\n03:48\n04:14\n03:38\n02:29\n07:17\n19:06\n18:47\n12:24\n16:45\n21:40\n11:33\n07:52\n02:24\n01:00\n20:37\n21:20\n16:04\n20:24\n05:18\n00:57\n23:02\n18:56\n16:40",
"output": "01:50"
},
{
"input": "70\n03:33\n23:36\n03:16\n18:18\n06:36\n06:58\n17:27\n04:07\n14:39\n15:53\n17:09\n05:16\n20:28\n09:34\n02:41\n14:18\n20:00\n04:14\n00:25\n20:18\n16:34\n10:13\n21:45\n11:08\n16:19\n20:50\n03:08\n05:06\n02:08\n02:51\n15:16\n11:02\n18:13\n18:35\n00:04\n08:50\n06:12\n20:16\n12:05\n04:01\n08:38\n03:57\n22:44\n04:28\n04:37\n10:32\n18:02\n15:04\n10:31\n07:28\n13:55\n15:15\n09:08\n19:54\n04:18\n04:29\n10:00\n13:47\n02:14\n23:15\n22:11\n21:17\n20:51\n05:46\n00:17\n01:59\n19:41\n02:37\n03:00\n19:14",
"output": "01:41"
}
] | 1,521,363,647
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 22
| 93
| 7,065,600
|
n = int(input())
time = [0 for r in range(2881)]
for i in range(n):
h, m = map(int, input().split(':'))
time[h * 60 + m] = 1
time[1440 + h * 60 + m] = 1
ans = 0
cur_ans = 0
for i in range(2881):
if time[i] != 1:
cur_ans += 1
continue
ans = max(ans, cur_ans)
cur_ans = 0
h = str(ans // 60)
if len(h) == 1:
h = '0' + h
print(h + ':' + str(ans % 60))
|
Title: A Vital Problem
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarp has a strict daily schedule. He has *n* alarms set for each day, and the *i*-th alarm rings each day at the same time during exactly one minute.
Determine the longest time segment when Polycarp can sleep, i. e. no alarm rings in that period. It is possible that Polycarp begins to sleep in one day, and wakes up in another.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of alarms.
Each of the next *n* lines contains a description of one alarm. Each description has a format "hh:mm", where *hh* is the hour when the alarm rings, and *mm* is the minute of that hour when the alarm rings. The number of hours is between 0 and 23, and the number of minutes is between 0 and 59. All alarm times are distinct. The order of the alarms is arbitrary.
Each alarm starts ringing in the beginning of the corresponding minute and rings for exactly one minute (i. e. stops ringing in the beginning of the next minute). Polycarp can start sleeping instantly when no alarm is ringing, and he wakes up at the moment when some alarm starts ringing.
Output Specification:
Print a line in format "hh:mm", denoting the maximum time Polycarp can sleep continuously. *hh* denotes the number of hours, and *mm* denotes the number of minutes. The number of minutes should be between 0 and 59. Look through examples to understand the format better.
Demo Input:
['1\n05:43\n', '4\n22:00\n03:21\n16:03\n09:59\n']
Demo Output:
['23:59\n', '06:37\n']
Note:
In the first example there is only one alarm which rings during one minute of a day, and then rings again on the next day, 23 hours and 59 minutes later. Polycarp can sleep all this time.
|
```python
n = int(input())
time = [0 for r in range(2881)]
for i in range(n):
h, m = map(int, input().split(':'))
time[h * 60 + m] = 1
time[1440 + h * 60 + m] = 1
ans = 0
cur_ans = 0
for i in range(2881):
if time[i] != 1:
cur_ans += 1
continue
ans = max(ans, cur_ans)
cur_ans = 0
h = str(ans // 60)
if len(h) == 1:
h = '0' + h
print(h + ':' + str(ans % 60))
```
| 0
|
|
567
|
A
|
Lineland Mail
|
PROGRAMMING
| 900
|
[
"greedy",
"implementation"
] | null | null |
All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in).
Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city.
For each city calculate two values *min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city
|
The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order.
|
Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city.
|
[
"4\n-5 -2 2 7\n",
"2\n-1 1\n"
] |
[
"3 12\n3 9\n4 7\n5 12\n",
"2 2\n2 2\n"
] |
none
| 500
|
[
{
"input": "4\n-5 -2 2 7",
"output": "3 12\n3 9\n4 7\n5 12"
},
{
"input": "2\n-1 1",
"output": "2 2\n2 2"
},
{
"input": "3\n-1 0 1",
"output": "1 2\n1 1\n1 2"
},
{
"input": "4\n-1 0 1 3",
"output": "1 4\n1 3\n1 2\n2 4"
},
{
"input": "3\n-1000000000 0 1000000000",
"output": "1000000000 2000000000\n1000000000 1000000000\n1000000000 2000000000"
},
{
"input": "2\n-1000000000 1000000000",
"output": "2000000000 2000000000\n2000000000 2000000000"
},
{
"input": "10\n1 10 12 15 59 68 130 912 1239 9123",
"output": "9 9122\n2 9113\n2 9111\n3 9108\n9 9064\n9 9055\n62 8993\n327 8211\n327 7884\n7884 9122"
},
{
"input": "5\n-2 -1 0 1 2",
"output": "1 4\n1 3\n1 2\n1 3\n1 4"
},
{
"input": "5\n-2 -1 0 1 3",
"output": "1 5\n1 4\n1 3\n1 3\n2 5"
},
{
"input": "3\n-10000 1 10000",
"output": "10001 20000\n9999 10001\n9999 20000"
},
{
"input": "5\n-1000000000 -999999999 -999999998 -999999997 -999999996",
"output": "1 4\n1 3\n1 2\n1 3\n1 4"
},
{
"input": "10\n-857422304 -529223472 82412729 145077145 188538640 265299215 527377039 588634631 592896147 702473706",
"output": "328198832 1559896010\n328198832 1231697178\n62664416 939835033\n43461495 1002499449\n43461495 1045960944\n76760575 1122721519\n61257592 1384799343\n4261516 1446056935\n4261516 1450318451\n109577559 1559896010"
},
{
"input": "10\n-876779400 -829849659 -781819137 -570920213 18428128 25280705 121178189 219147240 528386329 923854124",
"output": "46929741 1800633524\n46929741 1753703783\n48030522 1705673261\n210898924 1494774337\n6852577 905425996\n6852577 902060105\n95897484 997957589\n97969051 1095926640\n309239089 1405165729\n395467795 1800633524"
},
{
"input": "30\n-15 1 21 25 30 40 59 60 77 81 97 100 103 123 139 141 157 158 173 183 200 215 226 231 244 256 267 279 289 292",
"output": "16 307\n16 291\n4 271\n4 267\n5 262\n10 252\n1 233\n1 232\n4 215\n4 211\n3 195\n3 192\n3 189\n16 169\n2 154\n2 156\n1 172\n1 173\n10 188\n10 198\n15 215\n11 230\n5 241\n5 246\n12 259\n11 271\n11 282\n10 294\n3 304\n3 307"
},
{
"input": "10\n-1000000000 -999999999 -999999997 -999999996 -999999995 -999999994 -999999992 -999999990 -999999988 -999999986",
"output": "1 14\n1 13\n1 11\n1 10\n1 9\n1 8\n2 8\n2 10\n2 12\n2 14"
},
{
"input": "50\n-50000 -49459 -48875 -48456 -48411 -48096 -47901 -47500 -47150 -46808 -46687 -46679 -46337 -45747 -45604 -45194 -44752 -44242 -44231 -44122 -43636 -43274 -42916 -42881 -42386 -42095 -41830 -41618 -41145 -40897 -40534 -40007 -39761 -39389 -39104 -38909 -38630 -38561 -38364 -38255 -38214 -38084 -37959 -37607 -37202 -36890 -36681 -36136 -36123 -35886",
"output": "541 14114\n541 13573\n419 12989\n45 12570\n45 12525\n195 12210\n195 12015\n350 11614\n342 11264\n121 10922\n8 10801\n8 10793\n342 10451\n143 9861\n143 9718\n410 9308\n442 8866\n11 8356\n11 8345\n109 8236\n362 7750\n358 7388\n35 7084\n35 7119\n291 7614\n265 7905\n212 8170\n212 8382\n248 8855\n248 9103\n363 9466\n246 9993\n246 10239\n285 10611\n195 10896\n195 11091\n69 11370\n69 11439\n109 11636\n41 11745\n41 11786\n125 11916\n125 12041\n352 12393\n312 12798\n209 13110\n209 13319\n13 13864\n13 13877\n237 141..."
},
{
"input": "3\n-1000000000 999999999 1000000000",
"output": "1999999999 2000000000\n1 1999999999\n1 2000000000"
}
] | 1,648,645,225
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 451
| 8,294,400
|
n = int(input())
l = input().split()
cities = [int(i) for i in l]
left, right = cities[0], cities[-1]
last = float('inf')
m = max(cities[0] - left, right - cities[0])
for i in range(1, len(cities)):
diff = cities[i] - cities[i-1]
print(min(last, diff), end=" ")
last = diff
print(m)
m = max(cities[i] - left, right - cities[i])
print(cities[-1] - cities[-2], end=" ")
print(max(cities[-1] - left, right - cities[-1]))
|
Title: Lineland Mail
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* — a coordinate on the *Ox* axis. No two cities are located at a single point.
Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in).
Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city.
For each city calculate two values *min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city
Input Specification:
The first line of the input contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order.
Output Specification:
Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city.
Demo Input:
['4\n-5 -2 2 7\n', '2\n-1 1\n']
Demo Output:
['3 12\n3 9\n4 7\n5 12\n', '2 2\n2 2\n']
Note:
none
|
```python
n = int(input())
l = input().split()
cities = [int(i) for i in l]
left, right = cities[0], cities[-1]
last = float('inf')
m = max(cities[0] - left, right - cities[0])
for i in range(1, len(cities)):
diff = cities[i] - cities[i-1]
print(min(last, diff), end=" ")
last = diff
print(m)
m = max(cities[i] - left, right - cities[i])
print(cities[-1] - cities[-2], end=" ")
print(max(cities[-1] - left, right - cities[-1]))
```
| 3
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
You are given an array *a*1,<=*a*2,<=...,<=*a**n* consisting of *n* integers, and an integer *k*. You have to split the array into exactly *k* non-empty subsegments. You'll then compute the minimum integer on each subsegment, and take the maximum integer over the *k* obtained minimums. What is the maximum possible integer you can get?
Definitions of subsegment and array splitting are given in notes.
|
The first line contains two integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=<=105) — the size of the array *a* and the number of subsegments you have to split the array to.
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (<=-<=109<=<=≤<=<=*a**i*<=≤<=<=109).
|
Print single integer — the maximum possible integer you can get if you split the array into *k* non-empty subsegments and take maximum of minimums on the subsegments.
|
[
"5 2\n1 2 3 4 5\n",
"5 1\n-4 -5 -3 -2 -1\n"
] |
[
"5\n",
"-5\n"
] |
A subsegment [*l*, *r*] (*l* ≤ *r*) of array *a* is the sequence *a*<sub class="lower-index">*l*</sub>, *a*<sub class="lower-index">*l* + 1</sub>, ..., *a*<sub class="lower-index">*r*</sub>.
Splitting of array *a* of *n* elements into *k* subsegments [*l*<sub class="lower-index">1</sub>, *r*<sub class="lower-index">1</sub>], [*l*<sub class="lower-index">2</sub>, *r*<sub class="lower-index">2</sub>], ..., [*l*<sub class="lower-index">*k*</sub>, *r*<sub class="lower-index">*k*</sub>] (*l*<sub class="lower-index">1</sub> = 1, *r*<sub class="lower-index">*k*</sub> = *n*, *l*<sub class="lower-index">*i*</sub> = *r*<sub class="lower-index">*i* - 1</sub> + 1 for all *i* > 1) is *k* sequences (*a*<sub class="lower-index">*l*<sub class="lower-index">1</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">1</sub></sub>), ..., (*a*<sub class="lower-index">*l*<sub class="lower-index">*k*</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">*k*</sub></sub>).
In the first example you should split the array into subsegments [1, 4] and [5, 5] that results in sequences (1, 2, 3, 4) and (5). The minimums are *min*(1, 2, 3, 4) = 1 and *min*(5) = 5. The resulting maximum is *max*(1, 5) = 5. It is obvious that you can't reach greater result.
In the second example the only option you have is to split the array into one subsegment [1, 5], that results in one sequence ( - 4, - 5, - 3, - 2, - 1). The only minimum is *min*( - 4, - 5, - 3, - 2, - 1) = - 5. The resulting maximum is - 5.
| 0
|
[
{
"input": "5 2\n1 2 3 4 5",
"output": "5"
},
{
"input": "5 1\n-4 -5 -3 -2 -1",
"output": "-5"
},
{
"input": "10 2\n10 9 1 -9 -7 -9 3 8 -10 5",
"output": "10"
},
{
"input": "10 4\n-8 -1 2 -3 9 -8 4 -3 5 9",
"output": "9"
},
{
"input": "1 1\n504262064",
"output": "504262064"
},
{
"input": "3 3\n-54481850 -878017339 -486296116",
"output": "-54481850"
},
{
"input": "2 2\n-333653905 224013643",
"output": "224013643"
},
{
"input": "14 2\n-14 84 44 46 -75 -75 77 -49 44 -82 -74 -51 -9 -50",
"output": "-14"
},
{
"input": "88 71\n-497 -488 182 104 40 183 201 282 -384 44 -29 494 224 -80 -491 -197 157 130 -52 233 -426 252 -61 -51 203 -50 195 -442 -38 385 232 -243 -49 163 340 -200 406 -254 -29 227 -194 193 487 -325 230 146 421 158 20 447 -97 479 493 -130 164 -471 -198 -330 -152 359 -554 319 544 -444 235 281 -467 337 -385 227 -366 -210 266 69 -261 525 526 -234 -355 177 109 275 -301 7 -41 553 -284 540",
"output": "553"
},
{
"input": "39 1\n676941771 -923780377 -163050076 -230110947 -208029500 329620771 13954060 158950156 -252501602 926390671 -678745080 -921892226 -100127643 610420285 602175224 -839193819 471391946 910035173 777969600 -736144413 -489685522 60986249 830784148 278642552 -375298304 197973611 -354482364 187294011 636628282 25350767 636184407 -550869740 53830680 -42049274 -451383278 900048257 93225803 877923341 -279506435",
"output": "-923780377"
},
{
"input": "3 2\n1 5 3",
"output": "3"
},
{
"input": "5 2\n1 2 5 4 3",
"output": "3"
},
{
"input": "3 2\n1 3 2",
"output": "2"
},
{
"input": "3 2\n1 3 1",
"output": "1"
},
{
"input": "5 3\n-2 -2 -2 -2 -2",
"output": "-2"
},
{
"input": "5 2\n1 2 3 5 4",
"output": "4"
},
{
"input": "5 2\n1 1 11 1 1",
"output": "1"
},
{
"input": "3 3\n3 8 4",
"output": "8"
},
{
"input": "6 3\n4 3 1 5 6 2",
"output": "6"
},
{
"input": "2 1\n1 2",
"output": "1"
},
{
"input": "5 2\n2 5 4 3 1",
"output": "2"
},
{
"input": "5 2\n-1 1 5 4 3",
"output": "3"
},
{
"input": "5 2\n5 2 1 9 3",
"output": "5"
},
{
"input": "2 1\n1000000000 1000000000",
"output": "1000000000"
},
{
"input": "1 1\n1000000000",
"output": "1000000000"
},
{
"input": "5 2\n1 5 3 4 1",
"output": "1"
},
{
"input": "3 2\n-1000000000 -1000000000 -1000000000",
"output": "-1000000000"
},
{
"input": "2 2\n5 2",
"output": "5"
},
{
"input": "7 3\n1 1 1 10 1 1 1",
"output": "10"
},
{
"input": "9 3\n1 2 1 1 5 1 1 1 2",
"output": "5"
},
{
"input": "9 3\n2 2 2 2 9 2 2 2 2",
"output": "9"
},
{
"input": "3 3\n-1000000000 -1000000000 -1000000000",
"output": "-1000000000"
}
] | 1,648,660,723
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 1
| 46
| 512,000
|
while True:
try:
x = input()
n, k = list(map(int, x.split()))
x = input()
arr = list(map(int, x.split()))
if n == 1:
print(min(arr))
elif n > 2:
print(max(arr))
else:
prefix_min_l = [0] * n
prefix_min_l[0] = arr[0]
prefix_min_r = [0] * n
prefix_min_r[n-1] = arr[n-1]
for i in range(1, n):
prefix_min_l[i] = min(arr[i], prefix_min_l[i-1])
prefix_min_r[n-i] = min(arr[n-i], prefix_min_l[i+1])
print(min(min(prefix_min_l), min(prefix_min_r)))
except EOFError:
break
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an array *a*1,<=*a*2,<=...,<=*a**n* consisting of *n* integers, and an integer *k*. You have to split the array into exactly *k* non-empty subsegments. You'll then compute the minimum integer on each subsegment, and take the maximum integer over the *k* obtained minimums. What is the maximum possible integer you can get?
Definitions of subsegment and array splitting are given in notes.
Input Specification:
The first line contains two integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=<=105) — the size of the array *a* and the number of subsegments you have to split the array to.
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (<=-<=109<=<=≤<=<=*a**i*<=≤<=<=109).
Output Specification:
Print single integer — the maximum possible integer you can get if you split the array into *k* non-empty subsegments and take maximum of minimums on the subsegments.
Demo Input:
['5 2\n1 2 3 4 5\n', '5 1\n-4 -5 -3 -2 -1\n']
Demo Output:
['5\n', '-5\n']
Note:
A subsegment [*l*, *r*] (*l* ≤ *r*) of array *a* is the sequence *a*<sub class="lower-index">*l*</sub>, *a*<sub class="lower-index">*l* + 1</sub>, ..., *a*<sub class="lower-index">*r*</sub>.
Splitting of array *a* of *n* elements into *k* subsegments [*l*<sub class="lower-index">1</sub>, *r*<sub class="lower-index">1</sub>], [*l*<sub class="lower-index">2</sub>, *r*<sub class="lower-index">2</sub>], ..., [*l*<sub class="lower-index">*k*</sub>, *r*<sub class="lower-index">*k*</sub>] (*l*<sub class="lower-index">1</sub> = 1, *r*<sub class="lower-index">*k*</sub> = *n*, *l*<sub class="lower-index">*i*</sub> = *r*<sub class="lower-index">*i* - 1</sub> + 1 for all *i* > 1) is *k* sequences (*a*<sub class="lower-index">*l*<sub class="lower-index">1</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">1</sub></sub>), ..., (*a*<sub class="lower-index">*l*<sub class="lower-index">*k*</sub></sub>, ..., *a*<sub class="lower-index">*r*<sub class="lower-index">*k*</sub></sub>).
In the first example you should split the array into subsegments [1, 4] and [5, 5] that results in sequences (1, 2, 3, 4) and (5). The minimums are *min*(1, 2, 3, 4) = 1 and *min*(5) = 5. The resulting maximum is *max*(1, 5) = 5. It is obvious that you can't reach greater result.
In the second example the only option you have is to split the array into one subsegment [1, 5], that results in one sequence ( - 4, - 5, - 3, - 2, - 1). The only minimum is *min*( - 4, - 5, - 3, - 2, - 1) = - 5. The resulting maximum is - 5.
|
```python
while True:
try:
x = input()
n, k = list(map(int, x.split()))
x = input()
arr = list(map(int, x.split()))
if n == 1:
print(min(arr))
elif n > 2:
print(max(arr))
else:
prefix_min_l = [0] * n
prefix_min_l[0] = arr[0]
prefix_min_r = [0] * n
prefix_min_r[n-1] = arr[n-1]
for i in range(1, n):
prefix_min_l[i] = min(arr[i], prefix_min_l[i-1])
prefix_min_r[n-i] = min(arr[n-i], prefix_min_l[i+1])
print(min(min(prefix_min_l), min(prefix_min_r)))
except EOFError:
break
```
| 0
|
|
202
|
A
|
LLPS
|
PROGRAMMING
| 800
|
[
"binary search",
"bitmasks",
"brute force",
"greedy",
"implementation",
"strings"
] | null | null |
This problem's actual name, "Lexicographically Largest Palindromic Subsequence" is too long to fit into the page headline.
You are given string *s* consisting of lowercase English letters only. Find its lexicographically largest palindromic subsequence.
We'll call a non-empty string *s*[*p*1*p*2... *p**k*] = *s**p*1*s**p*2... *s**p**k* (1 <=≤<= *p*1<=<<=*p*2<=<<=...<=<<=*p**k* <=≤<= |*s*|) a subsequence of string *s* = *s*1*s*2... *s*|*s*|, where |*s*| is the length of string *s*. For example, strings "abcb", "b" and "abacaba" are subsequences of string "abacaba".
String *x* = *x*1*x*2... *x*|*x*| is lexicographically larger than string *y* = *y*1*y*2... *y*|*y*| if either |*x*| > |*y*| and *x*1<==<=*y*1, *x*2<==<=*y*2, ...,<=*x*|*y*|<==<=*y*|*y*|, or there exists such number *r* (*r*<=<<=|*x*|, *r*<=<<=|*y*|) that *x*1<==<=*y*1, *x*2<==<=*y*2, ..., *x**r*<==<=*y**r* and *x**r*<=<=+<=<=1<=><=*y**r*<=<=+<=<=1. Characters in the strings are compared according to their ASCII codes. For example, string "ranger" is lexicographically larger than string "racecar" and string "poster" is lexicographically larger than string "post".
String *s* = *s*1*s*2... *s*|*s*| is a palindrome if it matches string *rev*(*s*) = *s*|*s*|*s*|*s*|<=-<=1... *s*1. In other words, a string is a palindrome if it reads the same way from left to right and from right to left. For example, palindromic strings are "racecar", "refer" and "z".
|
The only input line contains a non-empty string *s* consisting of lowercase English letters only. Its length does not exceed 10.
|
Print the lexicographically largest palindromic subsequence of string *s*.
|
[
"radar\n",
"bowwowwow\n",
"codeforces\n",
"mississipp\n"
] |
[
"rr\n",
"wwwww\n",
"s\n",
"ssss\n"
] |
Among all distinct subsequences of string "radar" the following ones are palindromes: "a", "d", "r", "aa", "rr", "ada", "rar", "rdr", "raar" and "radar". The lexicographically largest of them is "rr".
| 500
|
[
{
"input": "radar",
"output": "rr"
},
{
"input": "bowwowwow",
"output": "wwwww"
},
{
"input": "codeforces",
"output": "s"
},
{
"input": "mississipp",
"output": "ssss"
},
{
"input": "tourist",
"output": "u"
},
{
"input": "romka",
"output": "r"
},
{
"input": "helloworld",
"output": "w"
},
{
"input": "zzzzzzzazz",
"output": "zzzzzzzzz"
},
{
"input": "testcase",
"output": "tt"
},
{
"input": "hahahahaha",
"output": "hhhhh"
},
{
"input": "abbbbbbbbb",
"output": "bbbbbbbbb"
},
{
"input": "zaz",
"output": "zz"
},
{
"input": "aza",
"output": "z"
},
{
"input": "dcbaedcba",
"output": "e"
},
{
"input": "abcdeabcd",
"output": "e"
},
{
"input": "edcbabcde",
"output": "ee"
},
{
"input": "aaaaaaaaab",
"output": "b"
},
{
"input": "testzzzzzz",
"output": "zzzzzz"
},
{
"input": "zzzzzzwait",
"output": "zzzzzz"
},
{
"input": "rrrrrqponm",
"output": "rrrrr"
},
{
"input": "zzyzyy",
"output": "zzz"
},
{
"input": "aababb",
"output": "bbb"
},
{
"input": "zanzibar",
"output": "zz"
},
{
"input": "hhgfedcbaa",
"output": "hh"
},
{
"input": "aabcdefghh",
"output": "hh"
},
{
"input": "aruaru",
"output": "uu"
},
{
"input": "uraura",
"output": "uu"
},
{
"input": "aru",
"output": "u"
},
{
"input": "aburvabur",
"output": "v"
},
{
"input": "ura",
"output": "u"
},
{
"input": "eurottat",
"output": "u"
},
{
"input": "referee",
"output": "rr"
},
{
"input": "joking",
"output": "o"
},
{
"input": "seriously",
"output": "y"
},
{
"input": "sets",
"output": "t"
},
{
"input": "test",
"output": "tt"
},
{
"input": "klmgameklm",
"output": "mmm"
},
{
"input": "dfkjafdkdd",
"output": "kk"
},
{
"input": "zzzzzzzzzz",
"output": "zzzzzzzzzz"
},
{
"input": "aaaaaaaaaa",
"output": "aaaaaaaaaa"
},
{
"input": "buzz",
"output": "zz"
},
{
"input": "b",
"output": "b"
},
{
"input": "y",
"output": "y"
},
{
"input": "yy",
"output": "yy"
},
{
"input": "zz",
"output": "zz"
},
{
"input": "bb",
"output": "bb"
},
{
"input": "aa",
"output": "aa"
},
{
"input": "a",
"output": "a"
},
{
"input": "z",
"output": "z"
},
{
"input": "zz",
"output": "zz"
},
{
"input": "zzazazzzaz",
"output": "zzzzzzz"
},
{
"input": "hellhellhe",
"output": "llll"
},
{
"input": "hellohello",
"output": "oo"
},
{
"input": "refer",
"output": "rr"
}
] | 1,566,852,362
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 218
| 0
|
st = input()
l = [ i for i in st]
l.sort()
n = len(st)
stc = l[n-1]
n1 = l.index(l[n-1])
n2 = n - n1
if n2 == 0:
print(stc)
else:
print(stc * n2)
|
Title: LLPS
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
This problem's actual name, "Lexicographically Largest Palindromic Subsequence" is too long to fit into the page headline.
You are given string *s* consisting of lowercase English letters only. Find its lexicographically largest palindromic subsequence.
We'll call a non-empty string *s*[*p*1*p*2... *p**k*] = *s**p*1*s**p*2... *s**p**k* (1 <=≤<= *p*1<=<<=*p*2<=<<=...<=<<=*p**k* <=≤<= |*s*|) a subsequence of string *s* = *s*1*s*2... *s*|*s*|, where |*s*| is the length of string *s*. For example, strings "abcb", "b" and "abacaba" are subsequences of string "abacaba".
String *x* = *x*1*x*2... *x*|*x*| is lexicographically larger than string *y* = *y*1*y*2... *y*|*y*| if either |*x*| > |*y*| and *x*1<==<=*y*1, *x*2<==<=*y*2, ...,<=*x*|*y*|<==<=*y*|*y*|, or there exists such number *r* (*r*<=<<=|*x*|, *r*<=<<=|*y*|) that *x*1<==<=*y*1, *x*2<==<=*y*2, ..., *x**r*<==<=*y**r* and *x**r*<=<=+<=<=1<=><=*y**r*<=<=+<=<=1. Characters in the strings are compared according to their ASCII codes. For example, string "ranger" is lexicographically larger than string "racecar" and string "poster" is lexicographically larger than string "post".
String *s* = *s*1*s*2... *s*|*s*| is a palindrome if it matches string *rev*(*s*) = *s*|*s*|*s*|*s*|<=-<=1... *s*1. In other words, a string is a palindrome if it reads the same way from left to right and from right to left. For example, palindromic strings are "racecar", "refer" and "z".
Input Specification:
The only input line contains a non-empty string *s* consisting of lowercase English letters only. Its length does not exceed 10.
Output Specification:
Print the lexicographically largest palindromic subsequence of string *s*.
Demo Input:
['radar\n', 'bowwowwow\n', 'codeforces\n', 'mississipp\n']
Demo Output:
['rr\n', 'wwwww\n', 's\n', 'ssss\n']
Note:
Among all distinct subsequences of string "radar" the following ones are palindromes: "a", "d", "r", "aa", "rr", "ada", "rar", "rdr", "raar" and "radar". The lexicographically largest of them is "rr".
|
```python
st = input()
l = [ i for i in st]
l.sort()
n = len(st)
stc = l[n-1]
n1 = l.index(l[n-1])
n2 = n - n1
if n2 == 0:
print(stc)
else:
print(stc * n2)
```
| 3
|
|
25
|
A
|
IQ test
|
PROGRAMMING
| 1,300
|
[
"brute force"
] |
A. IQ test
|
2
|
256
|
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
|
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
|
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
|
[
"5\n2 4 7 8 10\n",
"4\n1 2 1 1\n"
] |
[
"3\n",
"2\n"
] |
none
| 0
|
[
{
"input": "5\n2 4 7 8 10",
"output": "3"
},
{
"input": "4\n1 2 1 1",
"output": "2"
},
{
"input": "3\n1 2 2",
"output": "1"
},
{
"input": "3\n100 99 100",
"output": "2"
},
{
"input": "3\n5 3 2",
"output": "3"
},
{
"input": "4\n43 28 1 91",
"output": "2"
},
{
"input": "4\n75 13 94 77",
"output": "3"
},
{
"input": "4\n97 8 27 3",
"output": "2"
},
{
"input": "10\n95 51 12 91 85 3 1 31 25 7",
"output": "3"
},
{
"input": "20\n88 96 66 51 14 88 2 92 18 72 18 88 20 30 4 82 90 100 24 46",
"output": "4"
},
{
"input": "30\n20 94 56 50 10 98 52 32 14 22 24 60 4 8 98 46 34 68 82 82 98 90 50 20 78 49 52 94 64 36",
"output": "26"
},
{
"input": "50\n79 27 77 57 37 45 27 49 65 33 57 21 71 19 75 85 65 61 23 97 85 9 23 1 9 3 99 77 77 21 79 69 15 37 15 7 93 81 13 89 91 31 45 93 15 97 55 80 85 83",
"output": "48"
},
{
"input": "60\n46 11 73 65 3 69 3 53 43 53 97 47 55 93 31 75 35 3 9 73 23 31 3 81 91 79 61 21 15 11 11 11 81 7 83 75 39 87 83 59 89 55 93 27 49 67 67 29 1 93 11 17 9 19 35 21 63 31 31 25",
"output": "1"
},
{
"input": "70\n28 42 42 92 64 54 22 38 38 78 62 38 4 38 14 66 4 92 66 58 94 26 4 44 41 88 48 82 44 26 74 44 48 4 16 92 34 38 26 64 94 4 30 78 50 54 12 90 8 16 80 98 28 100 74 50 36 42 92 18 76 98 8 22 2 50 58 50 64 46",
"output": "25"
},
{
"input": "100\n43 35 79 53 13 91 91 45 65 83 57 9 42 39 85 45 71 51 61 59 31 13 63 39 25 21 79 39 91 67 21 61 97 75 93 83 29 79 59 97 11 37 63 51 39 55 91 23 21 17 47 23 35 75 49 5 69 99 5 7 41 17 25 89 15 79 21 63 53 81 43 91 59 91 69 99 85 15 91 51 49 37 65 7 89 81 21 93 61 63 97 93 45 17 13 69 57 25 75 73",
"output": "13"
},
{
"input": "100\n50 24 68 60 70 30 52 22 18 74 68 98 20 82 4 46 26 68 100 78 84 58 74 98 38 88 68 86 64 80 82 100 20 22 98 98 52 6 94 10 48 68 2 18 38 22 22 82 44 20 66 72 36 58 64 6 36 60 4 96 76 64 12 90 10 58 64 60 74 28 90 26 24 60 40 58 2 16 76 48 58 36 82 60 24 44 4 78 28 38 8 12 40 16 38 6 66 24 31 76",
"output": "99"
},
{
"input": "100\n47 48 94 48 14 18 94 36 96 22 12 30 94 20 48 98 40 58 2 94 8 36 98 18 98 68 2 60 76 38 18 100 8 72 100 68 2 86 92 72 58 16 48 14 6 58 72 76 6 88 80 66 20 28 74 62 86 68 90 86 2 56 34 38 56 90 4 8 76 44 32 86 12 98 38 34 54 92 70 94 10 24 82 66 90 58 62 2 32 58 100 22 58 72 2 22 68 72 42 14",
"output": "1"
},
{
"input": "99\n38 20 68 60 84 16 28 88 60 48 80 28 4 92 70 60 46 46 20 34 12 100 76 2 40 10 8 86 6 80 50 66 12 34 14 28 26 70 46 64 34 96 10 90 98 96 56 88 50 74 70 94 2 94 24 66 68 46 22 30 6 10 64 32 88 14 98 100 64 58 50 18 50 50 8 38 8 16 54 2 60 54 62 84 92 98 4 72 66 26 14 88 99 16 10 6 88 56 22",
"output": "93"
},
{
"input": "99\n50 83 43 89 53 47 69 1 5 37 63 87 95 15 55 95 75 89 33 53 89 75 93 75 11 85 49 29 11 97 49 67 87 11 25 37 97 73 67 49 87 43 53 97 43 29 53 33 45 91 37 73 39 49 59 5 21 43 87 35 5 63 89 57 63 47 29 99 19 85 13 13 3 13 43 19 5 9 61 51 51 57 15 89 13 97 41 13 99 79 13 27 97 95 73 33 99 27 23",
"output": "1"
},
{
"input": "98\n61 56 44 30 58 14 20 24 88 28 46 56 96 52 58 42 94 50 46 30 46 80 72 88 68 16 6 60 26 90 10 98 76 20 56 40 30 16 96 20 88 32 62 30 74 58 36 76 60 4 24 36 42 54 24 92 28 14 2 74 86 90 14 52 34 82 40 76 8 64 2 56 10 8 78 16 70 86 70 42 70 74 22 18 76 98 88 28 62 70 36 72 20 68 34 48 80 98",
"output": "1"
},
{
"input": "98\n66 26 46 42 78 32 76 42 26 82 8 12 4 10 24 26 64 44 100 46 94 64 30 18 88 28 8 66 30 82 82 28 74 52 62 80 80 60 94 86 64 32 44 88 92 20 12 74 94 28 34 58 4 22 16 10 94 76 82 58 40 66 22 6 30 32 92 54 16 76 74 98 18 48 48 30 92 2 16 42 84 74 30 60 64 52 50 26 16 86 58 96 79 60 20 62 82 94",
"output": "93"
},
{
"input": "95\n9 31 27 93 17 77 75 9 9 53 89 39 51 99 5 1 11 39 27 49 91 17 27 79 81 71 37 75 35 13 93 4 99 55 85 11 23 57 5 43 5 61 15 35 23 91 3 81 99 85 43 37 39 27 5 67 7 33 75 59 13 71 51 27 15 93 51 63 91 53 43 99 25 47 17 71 81 15 53 31 59 83 41 23 73 25 91 91 13 17 25 13 55 57 29",
"output": "32"
},
{
"input": "100\n91 89 81 45 53 1 41 3 77 93 55 97 55 97 87 27 69 95 73 41 93 21 75 35 53 56 5 51 87 59 91 67 33 3 99 45 83 17 97 47 75 97 7 89 17 99 23 23 81 25 55 97 27 35 69 5 77 35 93 19 55 59 37 21 31 37 49 41 91 53 73 69 7 37 37 39 17 71 7 97 55 17 47 23 15 73 31 39 57 37 9 5 61 41 65 57 77 79 35 47",
"output": "26"
},
{
"input": "99\n38 56 58 98 80 54 26 90 14 16 78 92 52 74 40 30 84 14 44 80 16 90 98 68 26 24 78 72 42 16 84 40 14 44 2 52 50 2 12 96 58 66 8 80 44 52 34 34 72 98 74 4 66 74 56 21 8 38 76 40 10 22 48 32 98 34 12 62 80 68 64 82 22 78 58 74 20 22 48 56 12 38 32 72 6 16 74 24 94 84 26 38 18 24 76 78 98 94 72",
"output": "56"
},
{
"input": "100\n44 40 6 40 56 90 98 8 36 64 76 86 98 76 36 92 6 30 98 70 24 98 96 60 24 82 88 68 86 96 34 42 58 10 40 26 56 10 88 58 70 32 24 28 14 82 52 12 62 36 70 60 52 34 74 30 78 76 10 16 42 94 66 90 70 38 52 12 58 22 98 96 14 68 24 70 4 30 84 98 8 50 14 52 66 34 100 10 28 100 56 48 38 12 38 14 91 80 70 86",
"output": "97"
},
{
"input": "100\n96 62 64 20 90 46 56 90 68 36 30 56 70 28 16 64 94 34 6 32 34 50 94 22 90 32 40 2 72 10 88 38 28 92 20 26 56 80 4 100 100 90 16 74 74 84 8 2 30 20 80 32 16 46 92 56 42 12 96 64 64 42 64 58 50 42 74 28 2 4 36 32 70 50 54 92 70 16 45 76 28 16 18 50 48 2 62 94 4 12 52 52 4 100 70 60 82 62 98 42",
"output": "79"
},
{
"input": "99\n14 26 34 68 90 58 50 36 8 16 18 6 2 74 54 20 36 84 32 50 52 2 26 24 3 64 20 10 54 26 66 44 28 72 4 96 78 90 96 86 68 28 94 4 12 46 100 32 22 36 84 32 44 94 76 94 4 52 12 30 74 4 34 64 58 72 44 16 70 56 54 8 14 74 8 6 58 62 98 54 14 40 80 20 36 72 28 98 20 58 40 52 90 64 22 48 54 70 52",
"output": "25"
},
{
"input": "95\n82 86 30 78 6 46 80 66 74 72 16 24 18 52 52 38 60 36 86 26 62 28 22 46 96 26 94 84 20 46 66 88 76 32 12 86 74 18 34 88 4 48 94 6 58 6 100 82 4 24 88 32 54 98 34 48 6 76 42 88 42 28 100 4 22 2 10 66 82 54 98 20 60 66 38 98 32 47 86 58 6 100 12 46 2 42 8 84 78 28 24 70 34 28 86",
"output": "78"
},
{
"input": "90\n40 50 8 42 76 24 58 42 26 68 20 48 54 12 34 84 14 36 32 88 6 50 96 56 20 92 48 16 40 34 96 46 20 84 30 50 20 98 8 44 96 42 8 76 70 38 84 30 40 88 84 72 2 22 52 58 16 62 100 66 80 40 50 32 14 62 88 72 22 99 76 50 84 82 8 82 98 46 26 40 2 98 18 78 30 72 70 18 34 68",
"output": "70"
},
{
"input": "80\n81 43 87 1 55 43 53 61 27 19 43 13 89 9 33 83 75 55 97 71 91 37 95 5 21 69 81 93 95 69 31 83 55 7 97 7 79 57 8 61 27 85 49 1 15 97 63 79 29 73 41 85 5 41 31 93 67 11 63 59 15 99 91 77 43 69 23 23 81 73 19 1 67 51 1 75 99 67 3 81",
"output": "39"
},
{
"input": "98\n13 83 61 27 35 1 85 95 97 73 95 65 73 45 5 43 27 83 91 19 11 3 85 59 9 39 69 23 45 7 51 85 5 71 5 95 1 51 75 3 43 57 3 11 33 71 21 99 47 41 87 39 71 87 31 85 91 49 83 5 49 85 47 91 55 99 33 23 31 23 23 73 29 77 55 31 25 5 81 49 91 15 15 39 87 5 9 40 69 47 29 33 11 21 49 79 51 83",
"output": "88"
},
{
"input": "3\n100 100 1",
"output": "3"
}
] | 1,690,811,480
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 62
| 0
|
num = int(input())
array = []
evenCount = 0
oddCount = 0
for i in range(num):
array.append(int(input()))
if array[i] % 2 == 0:
evenCount += 1
else:
oddCount += 1
if evenCount == 1:
for j in range(num):
if array[j] % 2 == 0:
print(j + 1)
if oddCount == 1:
for i in range(num):
if array[i] % 2 == 1:
print(i + 1)
|
Title: IQ test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that is different in evenness.
Input Specification:
The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness.
Output Specification:
Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order.
Demo Input:
['5\n2 4 7 8 10\n', '4\n1 2 1 1\n']
Demo Output:
['3\n', '2\n']
Note:
none
|
```python
num = int(input())
array = []
evenCount = 0
oddCount = 0
for i in range(num):
array.append(int(input()))
if array[i] % 2 == 0:
evenCount += 1
else:
oddCount += 1
if evenCount == 1:
for j in range(num):
if array[j] % 2 == 0:
print(j + 1)
if oddCount == 1:
for i in range(num):
if array[i] % 2 == 1:
print(i + 1)
```
| -1
|
474
|
A
|
Keyboard
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Our good friend Mole is trying to code a big message. He is typing on an unusual keyboard with characters arranged in following way:
Unfortunately Mole is blind, so sometimes it is problem for him to put his hands accurately. He accidentally moved both his hands with one position to the left or to the right. That means that now he presses not a button he wants, but one neighboring button (left or right, as specified in input).
We have a sequence of characters he has typed and we want to find the original message.
|
First line of the input contains one letter describing direction of shifting ('L' or 'R' respectively for left or right).
Second line contains a sequence of characters written by Mole. The size of this sequence will be no more than 100. Sequence contains only symbols that appear on Mole's keyboard. It doesn't contain spaces as there is no space on Mole's keyboard.
It is guaranteed that even though Mole hands are moved, he is still pressing buttons on keyboard and not hitting outside it.
|
Print a line that contains the original message.
|
[
"R\ns;;upimrrfod;pbr\n"
] |
[
"allyouneedislove\n"
] |
none
| 500
|
[
{
"input": "R\ns;;upimrrfod;pbr",
"output": "allyouneedislove"
},
{
"input": "R\nwertyuiop;lkjhgfdsxcvbnm,.",
"output": "qwertyuiolkjhgfdsazxcvbnm,"
},
{
"input": "L\nzxcvbnm,kjhgfdsaqwertyuio",
"output": "xcvbnm,.lkjhgfdswertyuiop"
},
{
"input": "R\nbubbuduppudup",
"output": "vyvvysyooysyo"
},
{
"input": "L\ngggggggggggggggggggggggggggggggggggggggggg",
"output": "hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh"
},
{
"input": "R\ngggggggggggggggggggggggggggggggggggggggggg",
"output": "ffffffffffffffffffffffffffffffffffffffffff"
},
{
"input": "L\nggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg",
"output": "hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh"
},
{
"input": "R\nggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg",
"output": "fffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff"
},
{
"input": "L\nxgwurenkxkiau,c,vonei.zltazmnkhqtwuogkgvgckvja,z.rhanuy.ybebmzcfwozkwvuuiolaqlgvvvewnbuinrncgjwjdsfw",
"output": "cheitrmlclosi.v.bpmro/x;ysx,mljwyeiphlhbhvlbks.x/tjsmiu/unrn,xvgepxlebiiop;sw;hbbbremniomtmvhkekfdge"
},
{
"input": "L\nuoz.vmks,wxrb,nwcvdzh.m,hwsios.lvu,ktes,,ythddhm.sh,d,c,cfj.wqam,bowofbyx,jathqayhreqvixvbmgdokofmym",
"output": "ipx/b,ld.ectn.mevbfxj/,.jedopd/;bi.lyrd..uyjffj,/dj.f.v.vgk/ews,.npepgnuc.ksyjwsujtrwbocbn,hfplpg,u,"
},
{
"input": "R\noedjyrvuw/rn.v.hdwndbiposiewgsn.pnyf;/tsdohp,hrtd/mx,;coj./billd..mwbneohcikrdes/ucjr,wspthleyp,..f,",
"output": "iwshtecyq.eb,c,gsqbsvuoiauwqfab,obtdl.rasigomgers.nzmlxih,.vukks,,nqvbwigxujeswa.yxhemqaorgkwtom,,dm"
},
{
"input": "R\nvgj;o;ijrtfyck,dthccioltcx,crub;oceooognsuvfx/kgo.fbsudv,yod.erdrxhbeiyltxhnrobbb;ydrgroefcr/f;uvdjd",
"output": "cfhliluherdtxjmsrgxxuikrxzmxeyvlixwiiifbaycdz.jfi,dvayscmtis,wesezgvwutkrzgbeivvvltsefeiwdxe.dlycshs"
},
{
"input": "L\nqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq",
"output": "wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww"
},
{
"input": "L\noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo",
"output": "pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp"
},
{
"input": "L\n,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
"output": "...................................................................................................."
},
{
"input": "L\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
},
{
"input": "R\noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo",
"output": "iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii"
},
{
"input": "R\nwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww",
"output": "qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq"
},
{
"input": "R\nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx",
"output": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz"
},
{
"input": "L\nq",
"output": "w"
},
{
"input": "L\no",
"output": "p"
},
{
"input": "L\n,",
"output": "."
},
{
"input": "L\nz",
"output": "x"
},
{
"input": "R\n.",
"output": ","
},
{
"input": "R\no",
"output": "i"
},
{
"input": "R\nw",
"output": "q"
},
{
"input": "R\nx",
"output": "z"
},
{
"input": "R\n,./",
"output": "m,."
},
{
"input": "R\nwertuk;;/",
"output": "qweryjll."
},
{
"input": "L\n..",
"output": "//"
}
] | 1,694,567,430
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 46
| 0
|
ll='qwertyuiopasdfghjkl;zxcvbnm,./'
#b='s;;upimrrfod;pbr'
if input()=='R':
b=input()
c=''
for x in b:
if ll.find(x)==0:
c+=ll[len(ll)-1]
else:
c+=ll[ll.find(x)%len(ll)-1]
print(c)
else:
b=input()
c=''
for x in b:
if ll.find(x)==29:
c+=ll[0]
else:
c+=ll[ll.find(x)%len(ll)+1]
print(c)
|
Title: Keyboard
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Our good friend Mole is trying to code a big message. He is typing on an unusual keyboard with characters arranged in following way:
Unfortunately Mole is blind, so sometimes it is problem for him to put his hands accurately. He accidentally moved both his hands with one position to the left or to the right. That means that now he presses not a button he wants, but one neighboring button (left or right, as specified in input).
We have a sequence of characters he has typed and we want to find the original message.
Input Specification:
First line of the input contains one letter describing direction of shifting ('L' or 'R' respectively for left or right).
Second line contains a sequence of characters written by Mole. The size of this sequence will be no more than 100. Sequence contains only symbols that appear on Mole's keyboard. It doesn't contain spaces as there is no space on Mole's keyboard.
It is guaranteed that even though Mole hands are moved, he is still pressing buttons on keyboard and not hitting outside it.
Output Specification:
Print a line that contains the original message.
Demo Input:
['R\ns;;upimrrfod;pbr\n']
Demo Output:
['allyouneedislove\n']
Note:
none
|
```python
ll='qwertyuiopasdfghjkl;zxcvbnm,./'
#b='s;;upimrrfod;pbr'
if input()=='R':
b=input()
c=''
for x in b:
if ll.find(x)==0:
c+=ll[len(ll)-1]
else:
c+=ll[ll.find(x)%len(ll)-1]
print(c)
else:
b=input()
c=''
for x in b:
if ll.find(x)==29:
c+=ll[0]
else:
c+=ll[ll.find(x)%len(ll)+1]
print(c)
```
| 3
|
|
224
|
A
|
Parallelepiped
|
PROGRAMMING
| 1,100
|
[
"brute force",
"geometry",
"math"
] | null | null |
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
|
The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=><=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
|
Print a single number — the sum of all edges of the parallelepiped.
|
[
"1 1 1\n",
"4 6 6\n"
] |
[
"12\n",
"28\n"
] |
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3.
| 500
|
[
{
"input": "1 1 1",
"output": "12"
},
{
"input": "4 6 6",
"output": "28"
},
{
"input": "20 10 50",
"output": "68"
},
{
"input": "9 4 36",
"output": "56"
},
{
"input": "324 9 36",
"output": "184"
},
{
"input": "1333 93 129",
"output": "308"
},
{
"input": "1022 584 112",
"output": "380"
},
{
"input": "66 174 319",
"output": "184"
},
{
"input": "912 276 1748",
"output": "444"
},
{
"input": "65 156 60",
"output": "120"
},
{
"input": "1 10000 10000",
"output": "40008"
},
{
"input": "1485 55 27",
"output": "332"
},
{
"input": "152 108 4104",
"output": "528"
},
{
"input": "1656 6900 1350",
"output": "740"
},
{
"input": "12 14 42",
"output": "60"
},
{
"input": "615 18 1230",
"output": "856"
},
{
"input": "680 60 408",
"output": "336"
},
{
"input": "644 966 6",
"output": "1308"
},
{
"input": "1 432 432",
"output": "1736"
},
{
"input": "2239 2239 1",
"output": "8964"
},
{
"input": "4106 8212 2",
"output": "16436"
},
{
"input": "10000 10000 10000",
"output": "1200"
},
{
"input": "3623 3623 1",
"output": "14500"
},
{
"input": "9801 9801 9801",
"output": "1188"
},
{
"input": "10000 1 10000",
"output": "40008"
},
{
"input": "9 9 9",
"output": "36"
},
{
"input": "9801 9702 9702",
"output": "1184"
}
] | 1,569,553,229
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 27
| 218
| 0
|
xz,xy,yz = map(int,input().split())
x = ((xz*xy)/yz)**0.5
print(int(4*(x+xy/x+xz/x)))
|
Title: Parallelepiped
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
Input Specification:
The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=><=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
Output Specification:
Print a single number — the sum of all edges of the parallelepiped.
Demo Input:
['1 1 1\n', '4 6 6\n']
Demo Output:
['12\n', '28\n']
Note:
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3.
|
```python
xz,xy,yz = map(int,input().split())
x = ((xz*xy)/yz)**0.5
print(int(4*(x+xy/x+xz/x)))
```
| 3
|
|
46
|
A
|
Ball Game
|
PROGRAMMING
| 800
|
[
"brute force",
"implementation"
] |
A. Ball Game
|
2
|
256
|
A kindergarten teacher Natalia Pavlovna has invented a new ball game. This game not only develops the children's physique, but also teaches them how to count.
The game goes as follows. Kids stand in circle. Let's agree to think of the children as numbered with numbers from 1 to *n* clockwise and the child number 1 is holding the ball. First the first child throws the ball to the next one clockwise, i.e. to the child number 2. Then the child number 2 throws the ball to the next but one child, i.e. to the child number 4, then the fourth child throws the ball to the child that stands two children away from him, i.e. to the child number 7, then the ball is thrown to the child who stands 3 children away from the child number 7, then the ball is thrown to the child who stands 4 children away from the last one, and so on. It should be mentioned that when a ball is thrown it may pass the beginning of the circle. For example, if *n*<==<=5, then after the third throw the child number 2 has the ball again. Overall, *n*<=-<=1 throws are made, and the game ends.
The problem is that not all the children get the ball during the game. If a child doesn't get the ball, he gets very upset and cries until Natalia Pavlovna gives him a candy. That's why Natalia Pavlovna asks you to help her to identify the numbers of the children who will get the ball after each throw.
|
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) which indicates the number of kids in the circle.
|
In the single line print *n*<=-<=1 numbers which are the numbers of children who will get the ball after each throw. Separate the numbers by spaces.
|
[
"10\n",
"3\n"
] |
[
"2 4 7 1 6 2 9 7 6\n",
"2 1\n"
] |
none
| 0
|
[
{
"input": "10",
"output": "2 4 7 1 6 2 9 7 6"
},
{
"input": "3",
"output": "2 1"
},
{
"input": "4",
"output": "2 4 3"
},
{
"input": "5",
"output": "2 4 2 1"
},
{
"input": "6",
"output": "2 4 1 5 4"
},
{
"input": "7",
"output": "2 4 7 4 2 1"
},
{
"input": "8",
"output": "2 4 7 3 8 6 5"
},
{
"input": "9",
"output": "2 4 7 2 7 4 2 1"
},
{
"input": "2",
"output": "2"
},
{
"input": "11",
"output": "2 4 7 11 5 11 7 4 2 1"
},
{
"input": "12",
"output": "2 4 7 11 4 10 5 1 10 8 7"
},
{
"input": "13",
"output": "2 4 7 11 3 9 3 11 7 4 2 1"
},
{
"input": "20",
"output": "2 4 7 11 16 2 9 17 6 16 7 19 12 6 1 17 14 12 11"
},
{
"input": "25",
"output": "2 4 7 11 16 22 4 12 21 6 17 4 17 6 21 12 4 22 16 11 7 4 2 1"
},
{
"input": "30",
"output": "2 4 7 11 16 22 29 7 16 26 7 19 2 16 1 17 4 22 11 1 22 14 7 1 26 22 19 17 16"
},
{
"input": "35",
"output": "2 4 7 11 16 22 29 2 11 21 32 9 22 1 16 32 14 32 16 1 22 9 32 21 11 2 29 22 16 11 7 4 2 1"
},
{
"input": "40",
"output": "2 4 7 11 16 22 29 37 6 16 27 39 12 26 1 17 34 12 31 11 32 14 37 21 6 32 19 7 36 26 17 9 2 36 31 27 24 22 21"
},
{
"input": "45",
"output": "2 4 7 11 16 22 29 37 1 11 22 34 2 16 31 2 19 37 11 31 7 29 7 31 11 37 19 2 31 16 2 34 22 11 1 37 29 22 16 11 7 4 2 1"
},
{
"input": "50",
"output": "2 4 7 11 16 22 29 37 46 6 17 29 42 6 21 37 4 22 41 11 32 4 27 1 26 2 29 7 36 16 47 29 12 46 31 17 4 42 31 21 12 4 47 41 36 32 29 27 26"
},
{
"input": "55",
"output": "2 4 7 11 16 22 29 37 46 1 12 24 37 51 11 27 44 7 26 46 12 34 2 26 51 22 49 22 51 26 2 34 12 46 26 7 44 27 11 51 37 24 12 1 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "60",
"output": "2 4 7 11 16 22 29 37 46 56 7 19 32 46 1 17 34 52 11 31 52 14 37 1 26 52 19 47 16 46 17 49 22 56 31 7 44 22 1 41 22 4 47 31 16 2 49 37 26 16 7 59 52 46 41 37 34 32 31"
},
{
"input": "65",
"output": "2 4 7 11 16 22 29 37 46 56 2 14 27 41 56 7 24 42 61 16 37 59 17 41 1 27 54 17 46 11 42 9 42 11 46 17 54 27 1 41 17 59 37 16 61 42 24 7 56 41 27 14 2 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "70",
"output": "2 4 7 11 16 22 29 37 46 56 67 9 22 36 51 67 14 32 51 1 22 44 67 21 46 2 29 57 16 46 7 39 2 36 1 37 4 42 11 51 22 64 37 11 56 32 9 57 36 16 67 49 32 16 1 57 44 32 21 11 2 64 57 51 46 42 39 37 36"
},
{
"input": "75",
"output": "2 4 7 11 16 22 29 37 46 56 67 4 17 31 46 62 4 22 41 61 7 29 52 1 26 52 4 32 61 16 47 4 37 71 31 67 29 67 31 71 37 4 47 16 61 32 4 52 26 1 52 29 7 61 41 22 4 62 46 31 17 4 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "80",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 12 26 41 57 74 12 31 51 72 14 37 61 6 32 59 7 36 66 17 49 2 36 71 27 64 22 61 21 62 24 67 31 76 42 9 57 26 76 47 19 72 46 21 77 54 32 11 71 52 34 17 1 66 52 39 27 16 6 77 69 62 56 51 47 44 42 41"
},
{
"input": "85",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 7 21 36 52 69 2 21 41 62 84 22 46 71 12 39 67 11 41 72 19 52 1 36 72 24 62 16 56 12 54 12 56 16 62 24 72 36 1 52 19 72 41 11 67 39 12 71 46 22 84 62 41 21 2 69 52 36 21 7 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "90",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 2 16 31 47 64 82 11 31 52 74 7 31 56 82 19 47 76 16 47 79 22 56 1 37 74 22 61 11 52 4 47 1 46 2 49 7 56 16 67 29 82 46 11 67 34 2 61 31 2 64 37 11 76 52 29 7 76 56 37 19 2 76 61 47 34 22 11 1 82 74 67 61 56 52 49 47 46"
},
{
"input": "95",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 11 26 42 59 77 1 21 42 64 87 16 41 67 94 27 56 86 22 54 87 26 61 2 39 77 21 61 7 49 92 41 86 37 84 37 86 41 92 49 7 61 21 77 39 2 61 26 87 54 22 86 56 27 94 67 41 16 87 64 42 21 1 77 59 42 26 11 92 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "96",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 10 25 41 58 76 95 19 40 62 85 13 38 64 91 23 52 82 17 49 82 20 55 91 32 70 13 53 94 40 83 31 76 26 73 25 74 28 79 35 88 46 5 61 22 80 43 7 68 34 1 65 34 4 71 43 16 86 61 37 14 88 67 47 28 10 89 73 58 44 31 19 8 94 85 77 70 64 59 55 52 50 49"
},
{
"input": "97",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 9 24 40 57 75 94 17 38 60 83 10 35 61 88 19 48 78 12 44 77 14 49 85 25 63 5 45 86 31 74 21 66 15 62 13 62 15 66 21 74 31 86 45 5 63 25 85 49 14 77 44 12 78 48 19 88 61 35 10 83 60 38 17 94 75 57 40 24 9 92 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "98",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 8 23 39 56 74 93 15 36 58 81 7 32 58 85 15 44 74 7 39 72 8 43 79 18 56 95 37 78 22 65 11 56 4 51 1 50 2 53 7 60 16 71 29 86 46 7 67 30 92 57 23 88 56 25 93 64 36 9 81 56 32 9 85 64 44 25 7 88 72 57 43 30 18 7 95 86 78 71 65 60 56 53 51 50"
},
{
"input": "99",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 7 22 38 55 73 92 13 34 56 79 4 29 55 82 11 40 70 2 34 67 2 37 73 11 49 88 29 70 13 56 1 46 92 40 88 38 88 40 92 46 1 56 13 70 29 88 49 11 73 37 2 67 34 2 70 40 11 82 55 29 4 79 56 34 13 92 73 55 38 22 7 92 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "100",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 6 21 37 54 72 91 11 32 54 77 1 26 52 79 7 36 66 97 29 62 96 31 67 4 42 81 21 62 4 47 91 36 82 29 77 26 76 27 79 32 86 41 97 54 12 71 31 92 54 17 81 46 12 79 47 16 86 57 29 2 76 51 27 4 82 61 41 22 4 87 71 56 42 29 17 6 96 87 79 72 66 61 57 54 52 51"
}
] | 1,619,602,069
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 33
| 124
| 0
|
'''
n = int(input())
holder, cycle, br, m = n, 2, 1, 2
if n > 2:
while n - 2:
if br == 1:
print(m, end=" ")
m += cycle
if m > holder:
m -= holder
print(m, end=" ")
n -= 1
br += 1
cycle += 1
elif n == 2:
print(2)
'''
n, ball, skip = int(input()), 1, 1
for i in range(n - 1):
ball = (ball + skip) % n
if ball == 0:
ball = n
print(ball, end=' ')
skip += 1
'''
10
1 2 3 4 5 6 7 8 9 10
'''
|
Title: Ball Game
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A kindergarten teacher Natalia Pavlovna has invented a new ball game. This game not only develops the children's physique, but also teaches them how to count.
The game goes as follows. Kids stand in circle. Let's agree to think of the children as numbered with numbers from 1 to *n* clockwise and the child number 1 is holding the ball. First the first child throws the ball to the next one clockwise, i.e. to the child number 2. Then the child number 2 throws the ball to the next but one child, i.e. to the child number 4, then the fourth child throws the ball to the child that stands two children away from him, i.e. to the child number 7, then the ball is thrown to the child who stands 3 children away from the child number 7, then the ball is thrown to the child who stands 4 children away from the last one, and so on. It should be mentioned that when a ball is thrown it may pass the beginning of the circle. For example, if *n*<==<=5, then after the third throw the child number 2 has the ball again. Overall, *n*<=-<=1 throws are made, and the game ends.
The problem is that not all the children get the ball during the game. If a child doesn't get the ball, he gets very upset and cries until Natalia Pavlovna gives him a candy. That's why Natalia Pavlovna asks you to help her to identify the numbers of the children who will get the ball after each throw.
Input Specification:
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) which indicates the number of kids in the circle.
Output Specification:
In the single line print *n*<=-<=1 numbers which are the numbers of children who will get the ball after each throw. Separate the numbers by spaces.
Demo Input:
['10\n', '3\n']
Demo Output:
['2 4 7 1 6 2 9 7 6\n', '2 1\n']
Note:
none
|
```python
'''
n = int(input())
holder, cycle, br, m = n, 2, 1, 2
if n > 2:
while n - 2:
if br == 1:
print(m, end=" ")
m += cycle
if m > holder:
m -= holder
print(m, end=" ")
n -= 1
br += 1
cycle += 1
elif n == 2:
print(2)
'''
n, ball, skip = int(input()), 1, 1
for i in range(n - 1):
ball = (ball + skip) % n
if ball == 0:
ball = n
print(ball, end=' ')
skip += 1
'''
10
1 2 3 4 5 6 7 8 9 10
'''
```
| 3.969
|
714
|
B
|
Filya and Homework
|
PROGRAMMING
| 1,200
|
[
"implementation",
"sortings"
] | null | null |
Today, hedgehog Filya went to school for the very first time! Teacher gave him a homework which Filya was unable to complete without your help.
Filya is given an array of non-negative integers *a*1,<=*a*2,<=...,<=*a**n*. First, he pick an integer *x* and then he adds *x* to some elements of the array (no more than once), subtract *x* from some other elements (also, no more than once) and do no change other elements. He wants all elements of the array to be equal.
Now he wonders if it's possible to pick such integer *x* and change some elements of the array using this *x* in order to make all elements equal.
|
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of integers in the Filya's array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109) — elements of the array.
|
If it's impossible to make all elements of the array equal using the process given in the problem statement, then print "NO" (without quotes) in the only line of the output. Otherwise print "YES" (without quotes).
|
[
"5\n1 3 3 2 1\n",
"5\n1 2 3 4 5\n"
] |
[
"YES\n",
"NO\n"
] |
In the first sample Filya should select *x* = 1, then add it to the first and the last elements of the array and subtract from the second and the third elements.
| 1,000
|
[
{
"input": "5\n1 3 3 2 1",
"output": "YES"
},
{
"input": "5\n1 2 3 4 5",
"output": "NO"
},
{
"input": "2\n1 2",
"output": "YES"
},
{
"input": "3\n1 2 3",
"output": "YES"
},
{
"input": "3\n1 1 1",
"output": "YES"
},
{
"input": "2\n1 1000000000",
"output": "YES"
},
{
"input": "4\n1 2 3 4",
"output": "NO"
},
{
"input": "10\n1 1 1 1 1 2 2 2 2 2",
"output": "YES"
},
{
"input": "2\n4 2",
"output": "YES"
},
{
"input": "4\n1 1 4 7",
"output": "YES"
},
{
"input": "3\n99999999 1 50000000",
"output": "YES"
},
{
"input": "1\n0",
"output": "YES"
},
{
"input": "5\n0 0 0 0 0",
"output": "YES"
},
{
"input": "4\n4 2 2 1",
"output": "NO"
},
{
"input": "3\n1 4 2",
"output": "NO"
},
{
"input": "3\n1 4 100",
"output": "NO"
},
{
"input": "3\n2 5 11",
"output": "NO"
},
{
"input": "3\n1 4 6",
"output": "NO"
},
{
"input": "3\n1 2 4",
"output": "NO"
},
{
"input": "3\n1 2 7",
"output": "NO"
},
{
"input": "5\n1 1 1 4 5",
"output": "NO"
},
{
"input": "2\n100000001 100000003",
"output": "YES"
},
{
"input": "3\n7 4 5",
"output": "NO"
},
{
"input": "3\n2 3 5",
"output": "NO"
},
{
"input": "3\n1 2 5",
"output": "NO"
},
{
"input": "2\n2 3",
"output": "YES"
},
{
"input": "3\n2 100 29",
"output": "NO"
},
{
"input": "3\n0 1 5",
"output": "NO"
},
{
"input": "3\n1 3 6",
"output": "NO"
},
{
"input": "3\n2 1 3",
"output": "YES"
},
{
"input": "3\n1 5 100",
"output": "NO"
},
{
"input": "3\n1 4 8",
"output": "NO"
},
{
"input": "3\n1 7 10",
"output": "NO"
},
{
"input": "3\n5 4 1",
"output": "NO"
},
{
"input": "3\n1 6 10",
"output": "NO"
},
{
"input": "4\n1 3 4 5",
"output": "NO"
},
{
"input": "3\n1 5 4",
"output": "NO"
},
{
"input": "5\n1 2 3 3 5",
"output": "NO"
},
{
"input": "3\n2 3 1",
"output": "YES"
},
{
"input": "3\n2 3 8",
"output": "NO"
},
{
"input": "3\n0 3 5",
"output": "NO"
},
{
"input": "3\n1 5 10",
"output": "NO"
},
{
"input": "3\n1 7 2",
"output": "NO"
},
{
"input": "3\n1 3 9",
"output": "NO"
},
{
"input": "3\n1 1 2",
"output": "YES"
},
{
"input": "7\n1 1 1 1 1 2 4",
"output": "NO"
},
{
"input": "5\n1 4 4 4 6",
"output": "NO"
},
{
"input": "5\n1 2 2 4 4",
"output": "NO"
},
{
"input": "3\n1 9 10",
"output": "NO"
},
{
"input": "8\n1 1 1 1 1 1 2 3",
"output": "YES"
},
{
"input": "3\n1 2 100",
"output": "NO"
},
{
"input": "3\n1 3 4",
"output": "NO"
},
{
"input": "3\n1 15 14",
"output": "NO"
},
{
"input": "3\n1 3 8",
"output": "NO"
},
{
"input": "3\n1 2 10",
"output": "NO"
},
{
"input": "4\n2 2 4 5",
"output": "NO"
},
{
"input": "3\n1 3 5",
"output": "YES"
},
{
"input": "5\n3 6 7 8 9",
"output": "NO"
},
{
"input": "3\n7 6 8",
"output": "YES"
},
{
"input": "3\n3 2 1",
"output": "YES"
},
{
"input": "5\n1 2 2 2 3",
"output": "YES"
},
{
"input": "3\n4 6 7",
"output": "NO"
},
{
"input": "3\n2 0 4",
"output": "YES"
},
{
"input": "4\n10 20 21 30",
"output": "NO"
},
{
"input": "4\n0 2 3 4",
"output": "NO"
},
{
"input": "3\n3 6 12",
"output": "NO"
},
{
"input": "5\n0 0 1 3 5",
"output": "NO"
},
{
"input": "3\n3 5 8",
"output": "NO"
},
{
"input": "3\n1 4 4",
"output": "YES"
},
{
"input": "4\n2 4 5 6",
"output": "NO"
}
] | 1,592,774,682
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 79
| 202
| 9,523,200
|
n = int(input())
lista = list(map(int,input().split()))
lista.sort()
countDiff = 1
diff = []
for i in range(n-1):
if(lista[i] != lista[i + 1]):
countDiff +=1
value = lista[i + 1] - lista[i]
diff.append(value)
if(countDiff < 3):
print("YES")
elif(countDiff > 3):
print("NO")
else:
if(diff[0] == diff[1]):
print("YES")
else:
print("NO")
|
Title: Filya and Homework
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Today, hedgehog Filya went to school for the very first time! Teacher gave him a homework which Filya was unable to complete without your help.
Filya is given an array of non-negative integers *a*1,<=*a*2,<=...,<=*a**n*. First, he pick an integer *x* and then he adds *x* to some elements of the array (no more than once), subtract *x* from some other elements (also, no more than once) and do no change other elements. He wants all elements of the array to be equal.
Now he wonders if it's possible to pick such integer *x* and change some elements of the array using this *x* in order to make all elements equal.
Input Specification:
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of integers in the Filya's array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109) — elements of the array.
Output Specification:
If it's impossible to make all elements of the array equal using the process given in the problem statement, then print "NO" (without quotes) in the only line of the output. Otherwise print "YES" (without quotes).
Demo Input:
['5\n1 3 3 2 1\n', '5\n1 2 3 4 5\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first sample Filya should select *x* = 1, then add it to the first and the last elements of the array and subtract from the second and the third elements.
|
```python
n = int(input())
lista = list(map(int,input().split()))
lista.sort()
countDiff = 1
diff = []
for i in range(n-1):
if(lista[i] != lista[i + 1]):
countDiff +=1
value = lista[i + 1] - lista[i]
diff.append(value)
if(countDiff < 3):
print("YES")
elif(countDiff > 3):
print("NO")
else:
if(diff[0] == diff[1]):
print("YES")
else:
print("NO")
```
| 3
|
|
519
|
B
|
A and B and Compilation Errors
|
PROGRAMMING
| 1,100
|
[
"data structures",
"implementation",
"sortings"
] | null | null |
A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake.
However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared — the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change.
Can you help B find out exactly what two errors he corrected?
|
The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=105) — the initial number of compilation errors.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the errors the compiler displayed for the first time.
The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 — the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one.
The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 — the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one.
|
Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively.
|
[
"5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n",
"6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n"
] |
[
"8\n123\n",
"1\n3\n"
] |
In the first test sample B first corrects the error number 8, then the error number 123.
In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
| 1,000
|
[
{
"input": "5\n1 5 8 123 7\n123 7 5 1\n5 1 7",
"output": "8\n123"
},
{
"input": "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5",
"output": "1\n3"
},
{
"input": "3\n1 2 3\n3 2\n2",
"output": "1\n3"
},
{
"input": "10\n460626451 802090732 277246428 661369649 388684428 784303821 376287098 656422756 9301599 25720377\n277246428 388684428 661369649 460626451 656422756 802090732 9301599 784303821 376287098\n376287098 802090732 388684428 9301599 656422756 784303821 460626451 277246428",
"output": "25720377\n661369649"
},
{
"input": "3\n796067435 964699482 819602309\n964699482 796067435\n964699482",
"output": "819602309\n796067435"
},
{
"input": "3\n374054998 726316780 902899520\n902899520 726316780\n726316780",
"output": "374054998\n902899520"
},
{
"input": "3\n168638990 939116221 323703261\n168638990 323703261\n168638990",
"output": "939116221\n323703261"
},
{
"input": "3\n77 77 77\n77 77\n77",
"output": "77\n77"
},
{
"input": "3\n84 30 9\n9 84\n9",
"output": "30\n84"
},
{
"input": "6\n5 4 3 3 5 5\n3 5 5 4 3\n3 5 4 3",
"output": "5\n5"
},
{
"input": "4\n1 5 7 8\n1 5 7\n1 5",
"output": "8\n7"
}
] | 1,630,412,810
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 33
| 374
| 33,792,000
|
n = int(input())
ans = []
base = sum(list(map(int, input().split())))
for _ in range(2):
new = sum(list(map(int, input().split())))
ans.append(base - new)
base = new
for answer in ans:
print(answer)
|
Title: A and B and Compilation Errors
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake.
However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared — the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change.
Can you help B find out exactly what two errors he corrected?
Input Specification:
The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=105) — the initial number of compilation errors.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the errors the compiler displayed for the first time.
The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 — the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one.
The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 — the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one.
Output Specification:
Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively.
Demo Input:
['5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n', '6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n']
Demo Output:
['8\n123\n', '1\n3\n']
Note:
In the first test sample B first corrects the error number 8, then the error number 123.
In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
|
```python
n = int(input())
ans = []
base = sum(list(map(int, input().split())))
for _ in range(2):
new = sum(list(map(int, input().split())))
ans.append(base - new)
base = new
for answer in ans:
print(answer)
```
| 3
|
|
47
|
B
|
Coins
|
PROGRAMMING
| 1,200
|
[
"implementation"
] |
B. Coins
|
2
|
256
|
One day Vasya came across three Berland coins. They didn't have any numbers that's why Vasya didn't understand how their denominations differ. He supposed that if one coin is heavier than the other one, then it should be worth more. Vasya weighed all the three pairs of coins on pan balance scales and told you the results. Find out how the deminations of the coins differ or if Vasya has a mistake in the weighting results. No two coins are equal.
|
The input data contains the results of all the weighting, one result on each line. It is guaranteed that every coin pair was weighted exactly once. Vasya labelled the coins with letters «A», «B» and «C». Each result is a line that appears as (letter)(> or < sign)(letter). For example, if coin "A" proved lighter than coin "B", the result of the weighting is A<B.
|
It the results are contradictory, print Impossible. Otherwise, print without spaces the rearrangement of letters «A», «B» and «C» which represent the coins in the increasing order of their weights.
|
[
"A>B\nC<B\nA>C\n",
"A<B\nB>C\nC>A\n"
] |
[
"CBA",
"ACB"
] |
none
| 1,000
|
[
{
"input": "A>B\nC<B\nA>C",
"output": "CBA"
},
{
"input": "A<B\nB>C\nC>A",
"output": "ACB"
},
{
"input": "A<C\nB<A\nB>C",
"output": "Impossible"
},
{
"input": "A<B\nA<C\nB>C",
"output": "ACB"
},
{
"input": "B>A\nC<B\nC>A",
"output": "ACB"
},
{
"input": "A>B\nB>C\nC<A",
"output": "CBA"
},
{
"input": "A>C\nA>B\nB<C",
"output": "BCA"
},
{
"input": "C<B\nB>A\nA<C",
"output": "ACB"
},
{
"input": "C<B\nA>B\nC<A",
"output": "CBA"
},
{
"input": "C>B\nB>A\nA<C",
"output": "ABC"
},
{
"input": "C<B\nB<A\nC>A",
"output": "Impossible"
},
{
"input": "B<C\nC<A\nA>B",
"output": "BCA"
},
{
"input": "A>B\nC<B\nC<A",
"output": "CBA"
},
{
"input": "B>A\nC>B\nA>C",
"output": "Impossible"
},
{
"input": "B<A\nC>B\nC>A",
"output": "BAC"
},
{
"input": "A<B\nC>B\nA<C",
"output": "ABC"
},
{
"input": "A<B\nC<A\nB<C",
"output": "Impossible"
},
{
"input": "A>C\nC<B\nB>A",
"output": "CAB"
},
{
"input": "C>A\nA<B\nB>C",
"output": "ACB"
},
{
"input": "C>A\nC<B\nB>A",
"output": "ACB"
},
{
"input": "B>C\nB>A\nA<C",
"output": "ACB"
},
{
"input": "C<B\nC<A\nB<A",
"output": "CBA"
},
{
"input": "A<C\nA<B\nB>C",
"output": "ACB"
},
{
"input": "B>A\nA>C\nB>C",
"output": "CAB"
},
{
"input": "B<A\nA<C\nC<B",
"output": "Impossible"
},
{
"input": "A<C\nB>C\nA>B",
"output": "Impossible"
},
{
"input": "B>A\nC<A\nC>B",
"output": "Impossible"
},
{
"input": "A>C\nC>B\nB<A",
"output": "BCA"
},
{
"input": "B<C\nB<A\nA>C",
"output": "BCA"
},
{
"input": "A>B\nC>B\nA<C",
"output": "BAC"
},
{
"input": "C<B\nC<A\nB<A",
"output": "CBA"
},
{
"input": "A<C\nA>B\nB>C",
"output": "Impossible"
},
{
"input": "B>A\nB>C\nA<C",
"output": "ACB"
},
{
"input": "B>C\nC<A\nB<A",
"output": "CBA"
},
{
"input": "C>A\nB>A\nB>C",
"output": "ACB"
},
{
"input": "B<A\nB>C\nA<C",
"output": "Impossible"
},
{
"input": "B<C\nA<B\nC>A",
"output": "ABC"
},
{
"input": "C<B\nB>A\nA>C",
"output": "CAB"
},
{
"input": "A>B\nC>A\nB<C",
"output": "BAC"
},
{
"input": "A>B\nB>C\nC<A",
"output": "CBA"
},
{
"input": "B>C\nC>A\nA>B",
"output": "Impossible"
},
{
"input": "B<A\nB>C\nC<A",
"output": "CBA"
},
{
"input": "C>B\nB>A\nC>A",
"output": "ABC"
},
{
"input": "A>C\nA>B\nB>C",
"output": "CBA"
},
{
"input": "B<C\nA>B\nA<C",
"output": "BAC"
},
{
"input": "C>A\nC<B\nB>A",
"output": "ACB"
},
{
"input": "C>B\nA<B\nC<A",
"output": "Impossible"
},
{
"input": "A<C\nC<B\nA>B",
"output": "Impossible"
},
{
"input": "B>C\nA<B\nA<C",
"output": "ACB"
},
{
"input": "C>A\nA<B\nC>B",
"output": "ABC"
}
] | 1,680,999,825
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 50
| 92
| 0
|
a={'A':1,'B':1,'C':1}
b=[]
for i in range(3):
x=input()
b.append(x)
if x[1]=='>':
a[x[0]]+=1
else :
a[x[2]]+=1
if b[1]==b[0] or b[1]==b[2] or b[0]==b[2]:
print('Impossible')
else :
c=[a['A'],a['B'],a['C']]
if c.count(2)>1:
print('Impossible')
else :
for i in a.keys():
if a[i]==1:
print(i,end='')
for i in a.keys():
if a[i]==2:
print(i,end='')
for i in a.keys():
if a[i]==3:
print(i)
|
Title: Coins
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya came across three Berland coins. They didn't have any numbers that's why Vasya didn't understand how their denominations differ. He supposed that if one coin is heavier than the other one, then it should be worth more. Vasya weighed all the three pairs of coins on pan balance scales and told you the results. Find out how the deminations of the coins differ or if Vasya has a mistake in the weighting results. No two coins are equal.
Input Specification:
The input data contains the results of all the weighting, one result on each line. It is guaranteed that every coin pair was weighted exactly once. Vasya labelled the coins with letters «A», «B» and «C». Each result is a line that appears as (letter)(> or < sign)(letter). For example, if coin "A" proved lighter than coin "B", the result of the weighting is A<B.
Output Specification:
It the results are contradictory, print Impossible. Otherwise, print without spaces the rearrangement of letters «A», «B» and «C» which represent the coins in the increasing order of their weights.
Demo Input:
['A>B\nC<B\nA>C\n', 'A<B\nB>C\nC>A\n']
Demo Output:
['CBA', 'ACB']
Note:
none
|
```python
a={'A':1,'B':1,'C':1}
b=[]
for i in range(3):
x=input()
b.append(x)
if x[1]=='>':
a[x[0]]+=1
else :
a[x[2]]+=1
if b[1]==b[0] or b[1]==b[2] or b[0]==b[2]:
print('Impossible')
else :
c=[a['A'],a['B'],a['C']]
if c.count(2)>1:
print('Impossible')
else :
for i in a.keys():
if a[i]==1:
print(i,end='')
for i in a.keys():
if a[i]==2:
print(i,end='')
for i in a.keys():
if a[i]==3:
print(i)
```
| 3.977
|
45
|
A
|
Codecraft III
|
PROGRAMMING
| 900
|
[
"implementation"
] |
A. Codecraft III
|
2
|
256
|
Today Vasya visited a widely known site and learned that the continuation of his favourite game Codecraft II will appear after exactly *k* months. He looked at the calendar and learned that at the moment is the month number *s*. Vasya immediately got interested in what month Codecraft III will appear. Help him understand that.
All the twelve months in Vasya's calendar are named using their usual English names: January, February, March, April, May, June, July, August, September, October, November, December.
|
The first input line contains the name of the current month. It is guaranteed that it is a proper English name of one of twelve months. The first letter is uppercase, the rest are lowercase. The second line contains integer *k* (0<=≤<=*k*<=≤<=100) — the number of months left till the appearance of Codecraft III.
|
Print starting from an uppercase letter the name of the month in which the continuation of Codeforces II will appear. The printed name must be contained in the list January, February, March, April, May, June, July, August, September, October, November, December.
|
[
"November\n3\n",
"May\n24\n"
] |
[
"February\n",
"May\n"
] |
none
| 0
|
[
{
"input": "November\n3",
"output": "February"
},
{
"input": "May\n24",
"output": "May"
},
{
"input": "April\n0",
"output": "April"
},
{
"input": "September\n0",
"output": "September"
},
{
"input": "August\n0",
"output": "August"
},
{
"input": "June\n1",
"output": "July"
},
{
"input": "July\n2",
"output": "September"
},
{
"input": "September\n3",
"output": "December"
},
{
"input": "July\n4",
"output": "November"
},
{
"input": "August\n24",
"output": "August"
},
{
"input": "May\n48",
"output": "May"
},
{
"input": "November\n47",
"output": "October"
},
{
"input": "December\n49",
"output": "January"
},
{
"input": "June\n99",
"output": "September"
},
{
"input": "March\n100",
"output": "July"
},
{
"input": "December\n1",
"output": "January"
},
{
"input": "January\n11",
"output": "December"
},
{
"input": "December\n0",
"output": "December"
},
{
"input": "January\n0",
"output": "January"
},
{
"input": "July\n77",
"output": "December"
},
{
"input": "February\n11",
"output": "January"
},
{
"input": "February\n22",
"output": "December"
},
{
"input": "July\n33",
"output": "April"
},
{
"input": "May\n44",
"output": "January"
},
{
"input": "June\n97",
"output": "July"
}
] | 1,602,923,027
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 11
| 186
| 0
|
a=["January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December"]
inp=input()
b=int(input())
if b%12==0:
print(inp)
elif(b<12):
i=(a.index(inp))+1
g=12-b
h=i-g
print(a[h-1])
|
Title: Codecraft III
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Today Vasya visited a widely known site and learned that the continuation of his favourite game Codecraft II will appear after exactly *k* months. He looked at the calendar and learned that at the moment is the month number *s*. Vasya immediately got interested in what month Codecraft III will appear. Help him understand that.
All the twelve months in Vasya's calendar are named using their usual English names: January, February, March, April, May, June, July, August, September, October, November, December.
Input Specification:
The first input line contains the name of the current month. It is guaranteed that it is a proper English name of one of twelve months. The first letter is uppercase, the rest are lowercase. The second line contains integer *k* (0<=≤<=*k*<=≤<=100) — the number of months left till the appearance of Codecraft III.
Output Specification:
Print starting from an uppercase letter the name of the month in which the continuation of Codeforces II will appear. The printed name must be contained in the list January, February, March, April, May, June, July, August, September, October, November, December.
Demo Input:
['November\n3\n', 'May\n24\n']
Demo Output:
['February\n', 'May\n']
Note:
none
|
```python
a=["January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December"]
inp=input()
b=int(input())
if b%12==0:
print(inp)
elif(b<12):
i=(a.index(inp))+1
g=12-b
h=i-g
print(a[h-1])
```
| 0
|
427
|
A
|
Police Recruits
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups.
Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime.
If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated.
Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated.
|
The first line of input will contain an integer *n* (1<=≤<=*n*<=≤<=105), the number of events. The next line will contain *n* space-separated integers.
If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time.
|
Print a single integer, the number of crimes which will go untreated.
|
[
"3\n-1 -1 1\n",
"8\n1 -1 1 -1 -1 1 1 1\n",
"11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n"
] |
[
"2\n",
"1\n",
"8\n"
] |
Lets consider the second example:
1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired.
The answer is one, as one crime (on step 5) will go untreated.
| 500
|
[
{
"input": "3\n-1 -1 1",
"output": "2"
},
{
"input": "8\n1 -1 1 -1 -1 1 1 1",
"output": "1"
},
{
"input": "11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1",
"output": "8"
},
{
"input": "7\n-1 -1 1 1 -1 -1 1",
"output": "2"
},
{
"input": "21\n-1 -1 -1 -1 -1 3 2 -1 6 -1 -1 2 1 -1 2 2 1 6 5 -1 5",
"output": "5"
},
{
"input": "98\n-1 -1 1 -1 -1 -1 -1 1 -1 -1 1 -1 -1 1 -1 1 1 1 -1 1 1 1 1 1 -1 1 -1 -1 -1 -1 1 -1 -1 1 1 -1 1 1 1 -1 -1 -1 -1 -1 -1 1 -1 -1 -1 1 -1 1 -1 1 -1 1 1 1 1 1 1 1 -1 -1 1 1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 1 -1 1 1 1 -1 1 1 -1 -1 -1 1 1 1 -1 -1 -1 1 -1 1 1",
"output": "13"
},
{
"input": "3\n-1 5 4",
"output": "1"
},
{
"input": "146\n4 -1 -1 -1 -1 -1 -1 -1 -1 -1 4 -1 3 -1 3 -1 -1 1 4 -1 2 -1 -1 3 -1 -1 -1 4 1 -1 -1 -1 4 -1 -1 -1 -1 -1 -1 3 2 -1 3 2 4 5 2 4 1 5 -1 -1 2 -1 -1 1 -1 5 3 -1 1 2 2 3 5 3 -1 -1 3 -1 -1 3 5 5 -1 -1 5 -1 4 4 1 -1 -1 -1 2 1 -1 -1 -1 2 5 3 -1 -1 -1 3 -1 5 4 -1 1 -1 -1 3 -1 -1 3 1 1 2 -1 -1 -1 1 3 1 -1 2 -1 -1 5 5 -1 -1 3 4 5 1 -1 2 -1 -1 -1 3 -1 5 3 2 -1 2 -1 -1 5 -1 3 -1",
"output": "5"
},
{
"input": "1\n2",
"output": "0"
},
{
"input": "1\n-1",
"output": "1"
},
{
"input": "2\n1 -1",
"output": "0"
},
{
"input": "2\n-1 1",
"output": "1"
},
{
"input": "2\n1 1",
"output": "0"
},
{
"input": "2\n-1 -1",
"output": "2"
},
{
"input": "4\n10 -1 -1 -1",
"output": "0"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "4\n-1 -1 1 1",
"output": "2"
}
] | 1,699,106,243
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 63
| 92
| 9,830,400
|
n = int(input())
a = [int(i) for i in input().split()]
ans = 0
p = 0
for i in range(n):
if a[i] > 0:
p += a[i]
else:
if p == 0:
ans += 1
else:
p -= 1
print(ans)
|
Title: Police Recruits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups.
Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime.
If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated.
Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated.
Input Specification:
The first line of input will contain an integer *n* (1<=≤<=*n*<=≤<=105), the number of events. The next line will contain *n* space-separated integers.
If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time.
Output Specification:
Print a single integer, the number of crimes which will go untreated.
Demo Input:
['3\n-1 -1 1\n', '8\n1 -1 1 -1 -1 1 1 1\n', '11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n']
Demo Output:
['2\n', '1\n', '8\n']
Note:
Lets consider the second example:
1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired.
The answer is one, as one crime (on step 5) will go untreated.
|
```python
n = int(input())
a = [int(i) for i in input().split()]
ans = 0
p = 0
for i in range(n):
if a[i] > 0:
p += a[i]
else:
if p == 0:
ans += 1
else:
p -= 1
print(ans)
```
| 3
|
|
475
|
B
|
Strongly Connected City
|
PROGRAMMING
| 1,400
|
[
"brute force",
"dfs and similar",
"graphs",
"implementation"
] | null | null |
Imagine a city with *n* horizontal streets crossing *m* vertical streets, forming an (*n*<=-<=1)<=×<=(*m*<=-<=1) grid. In order to increase the traffic flow, mayor of the city has decided to make each street one way. This means in each horizontal street, the traffic moves only from west to east or only from east to west. Also, traffic moves only from north to south or only from south to north in each vertical street. It is possible to enter a horizontal street from a vertical street, or vice versa, at their intersection.
The mayor has received some street direction patterns. Your task is to check whether it is possible to reach any junction from any other junction in the proposed street direction pattern.
|
The first line of input contains two integers *n* and *m*, (2<=≤<=*n*,<=*m*<=≤<=20), denoting the number of horizontal streets and the number of vertical streets.
The second line contains a string of length *n*, made of characters '<' and '>', denoting direction of each horizontal street. If the *i*-th character is equal to '<', the street is directed from east to west otherwise, the street is directed from west to east. Streets are listed in order from north to south.
The third line contains a string of length *m*, made of characters '^' and 'v', denoting direction of each vertical street. If the *i*-th character is equal to '^', the street is directed from south to north, otherwise the street is directed from north to south. Streets are listed in order from west to east.
|
If the given pattern meets the mayor's criteria, print a single line containing "YES", otherwise print a single line containing "NO".
|
[
"3 3\n><>\nv^v\n",
"4 6\n<><>\nv^v^v^\n"
] |
[
"NO\n",
"YES\n"
] |
The figure above shows street directions in the second sample test case.
| 1,000
|
[
{
"input": "3 3\n><>\nv^v",
"output": "NO"
},
{
"input": "4 6\n<><>\nv^v^v^",
"output": "YES"
},
{
"input": "2 2\n<>\nv^",
"output": "YES"
},
{
"input": "2 2\n>>\n^v",
"output": "NO"
},
{
"input": "3 3\n>><\n^^v",
"output": "YES"
},
{
"input": "3 4\n>><\n^v^v",
"output": "YES"
},
{
"input": "3 8\n>><\nv^^^^^^^",
"output": "NO"
},
{
"input": "7 2\n<><<<<>\n^^",
"output": "NO"
},
{
"input": "4 5\n><<<\n^^^^v",
"output": "YES"
},
{
"input": "2 20\n><\n^v^^v^^v^^^v^vv^vv^^",
"output": "NO"
},
{
"input": "2 20\n<>\nv^vv^v^^vvv^^^v^vvv^",
"output": "YES"
},
{
"input": "20 2\n<><<><<>><<<>><><<<<\n^^",
"output": "NO"
},
{
"input": "20 2\n><>><>><>><<<><<><><\n^v",
"output": "YES"
},
{
"input": "11 12\n><<<><><<>>\nvv^^^^vvvvv^",
"output": "NO"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "16 11\n<<<<>><><<<<<><<\nvv^v^vvvv^v",
"output": "NO"
},
{
"input": "14 7\n><<<<>>>>>>><<\nvv^^^vv",
"output": "NO"
},
{
"input": "5 14\n<<><>\nv^vv^^vv^v^^^v",
"output": "NO"
},
{
"input": "8 18\n>>>><>>>\nv^vv^v^^^^^vvv^^vv",
"output": "NO"
},
{
"input": "18 18\n<<><>><<>><>><><<<\n^^v^v^vvvv^v^vv^vv",
"output": "NO"
},
{
"input": "4 18\n<<<>\n^^^^^vv^vv^^vv^v^v",
"output": "NO"
},
{
"input": "19 18\n><><>>><<<<<>>><<<>\n^^v^^v^^v^vv^v^vvv",
"output": "NO"
},
{
"input": "14 20\n<<<><><<>><><<\nvvvvvvv^v^vvvv^^^vv^",
"output": "NO"
},
{
"input": "18 18\n><>>><<<>><><>>>><\nvv^^^^v^v^^^^v^v^^",
"output": "NO"
},
{
"input": "8 18\n<><<<>>>\n^^^^^^v^^^vv^^vvvv",
"output": "NO"
},
{
"input": "11 12\n><><><<><><\n^^v^^^^^^^^v",
"output": "YES"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "16 11\n>><<><<<<>>><><<\n^^^^vvvv^vv",
"output": "YES"
},
{
"input": "14 7\n<><><<<>>>><>>\nvv^^v^^",
"output": "YES"
},
{
"input": "5 14\n>>>><\n^v^v^^^vv^vv^v",
"output": "YES"
},
{
"input": "8 18\n<<<><>>>\nv^^vvv^^v^v^vvvv^^",
"output": "YES"
},
{
"input": "18 18\n><><<><><>>><>>>><\n^^vvv^v^^^v^vv^^^v",
"output": "YES"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "19 18\n>>>><><<>>><<<><<<<\n^v^^^^vv^^v^^^^v^v",
"output": "YES"
},
{
"input": "14 20\n<>><<<><<>>>>>\nvv^^v^^^^v^^vv^^vvv^",
"output": "YES"
},
{
"input": "18 18\n><><<><><>>><>>>><\n^^vvv^v^^^v^vv^^^v",
"output": "YES"
},
{
"input": "8 18\n<<<><>>>\nv^^vvv^^v^v^vvvv^^",
"output": "YES"
},
{
"input": "20 19\n<><>>>>><<<<<><<>>>>\nv^vv^^vvvvvv^vvvv^v",
"output": "NO"
},
{
"input": "20 19\n<<<><<<>><<<>><><><>\nv^v^vvv^vvv^^^vvv^^",
"output": "YES"
},
{
"input": "19 20\n<><<<><><><<<<<<<<>\n^v^^^^v^^vvvv^^^^vvv",
"output": "NO"
},
{
"input": "19 20\n>>>>>>>><>>><><<<><\n^v^v^^^vvv^^^v^^vvvv",
"output": "YES"
},
{
"input": "20 20\n<<<>>>><>><<>><<>>>>\n^vvv^^^^vv^^^^^v^^vv",
"output": "NO"
},
{
"input": "20 20\n>>><><<><<<<<<<><<><\nvv^vv^vv^^^^^vv^^^^^",
"output": "NO"
},
{
"input": "20 20\n><<><<<<<<<>>><>>><<\n^^^^^^^^vvvv^vv^vvvv",
"output": "YES"
},
{
"input": "20 20\n<>>>>>>>><>>><>><<<>\nvv^^vv^^^^v^vv^v^^^^",
"output": "YES"
},
{
"input": "20 20\n><>><<>><>>>>>>>><<>\n^^v^vv^^^vvv^v^^^vv^",
"output": "NO"
},
{
"input": "20 20\n<<<<><<>><><<<>><<><\nv^^^^vvv^^^vvvv^v^vv",
"output": "NO"
},
{
"input": "20 20\n><<<><<><>>><><<<<<<\nvv^^vvv^^v^^v^vv^vvv",
"output": "NO"
},
{
"input": "20 20\n<<>>><>>>><<<<>>><<>\nv^vv^^^^^vvv^^v^^v^v",
"output": "NO"
},
{
"input": "20 20\n><<><<><<<<<<>><><>>\nv^^^v^vv^^v^^vvvv^vv",
"output": "NO"
},
{
"input": "20 20\n<<<<<<<<><>><><>><<<\n^vvv^^^v^^^vvv^^^^^v",
"output": "NO"
},
{
"input": "20 20\n>>><<<<<>>><><><<><<\n^^^vvv^^^v^^v^^v^vvv",
"output": "YES"
},
{
"input": "20 20\n<><<<><><>><><><<<<>\n^^^vvvv^vv^v^^^^v^vv",
"output": "NO"
},
{
"input": "20 20\n>>>>>>>>>><>>><>><>>\n^vvv^^^vv^^^^^^vvv^v",
"output": "NO"
},
{
"input": "20 20\n<><>><><<<<<>><<>>><\nv^^^v^v^v^vvvv^^^vv^",
"output": "NO"
},
{
"input": "20 20\n><<<><<<><<<><>>>><<\nvvvv^^^^^vv^v^^vv^v^",
"output": "NO"
},
{
"input": "20 20\n<<><<<<<<>>>>><<<>>>\nvvvvvv^v^vvv^^^^^^^^",
"output": "YES"
},
{
"input": "20 20\n><<><<>>>>><><>><>>>\nv^^^^vvv^^^^^v^v^vv^",
"output": "NO"
},
{
"input": "20 20\n<<>>><>><<>>>><<<><<\n^^vvv^^vvvv^vv^^v^v^",
"output": "NO"
},
{
"input": "20 20\n><<>><>>>><<><>><><<\n^v^^^^^^vvvv^v^v^v^^",
"output": "NO"
},
{
"input": "20 20\n<<><<<<><><<>>><>>>>\n^^vvvvv^v^^^^^^^vvv^",
"output": "NO"
},
{
"input": "20 20\n>><<<<<<><>>>><>>><>\n^^^v^v^vv^^vv^vvv^^^",
"output": "NO"
},
{
"input": "20 20\n>>>>>>>>>>>>>>>>>>>>\nvvvvvvvvvvvvvvvvvvvv",
"output": "NO"
},
{
"input": "2 2\n><\nv^",
"output": "NO"
},
{
"input": "2 2\n<>\n^v",
"output": "NO"
},
{
"input": "3 3\n>><\nvvv",
"output": "NO"
},
{
"input": "2 3\n<>\nv^^",
"output": "YES"
},
{
"input": "4 4\n>>><\nvvv^",
"output": "NO"
},
{
"input": "20 20\n<><><><><><><><><><>\nvvvvvvvvvvvvvvvvvvvv",
"output": "NO"
},
{
"input": "4 4\n<>>>\nv^^^",
"output": "YES"
},
{
"input": "20 20\n<><><><><><><><><><>\nv^v^v^v^v^v^v^v^v^v^",
"output": "YES"
},
{
"input": "2 3\n<>\n^v^",
"output": "NO"
},
{
"input": "4 3\n<><>\n^vv",
"output": "NO"
},
{
"input": "3 3\n<<>\nvv^",
"output": "YES"
},
{
"input": "2 3\n><\nvv^",
"output": "NO"
},
{
"input": "7 6\n>>><>><\n^vv^vv",
"output": "YES"
},
{
"input": "2 2\n<<\nv^",
"output": "NO"
},
{
"input": "3 3\n>><\n^^^",
"output": "NO"
},
{
"input": "3 3\n<><\nv^v",
"output": "NO"
},
{
"input": "20 20\n><><><><><><><><><><\n^v^v^v^v^v^v^v^v^v^v",
"output": "YES"
},
{
"input": "4 4\n<>>>\nvvv^",
"output": "YES"
}
] | 1,542,691,546
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
import sys
with open(sys.stdin) as f:
line1 = f.readline().strip('\n').split()
numh, numv = line1[0], line1[1]
hor = f.readline().strip('\n').split('')
vert = f.readline().strip('\n').split('')
if (hor[0], vert[0]) == ('<', '^') or
(hor[-1], vert[0]) == ('<', 'v') or
(hor[0], vert[-1]) == ('>', '^') or
(hor[-1], vert[-1]) == ('>', 'v'):
print('NO')
else:
print('YES')
|
Title: Strongly Connected City
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Imagine a city with *n* horizontal streets crossing *m* vertical streets, forming an (*n*<=-<=1)<=×<=(*m*<=-<=1) grid. In order to increase the traffic flow, mayor of the city has decided to make each street one way. This means in each horizontal street, the traffic moves only from west to east or only from east to west. Also, traffic moves only from north to south or only from south to north in each vertical street. It is possible to enter a horizontal street from a vertical street, or vice versa, at their intersection.
The mayor has received some street direction patterns. Your task is to check whether it is possible to reach any junction from any other junction in the proposed street direction pattern.
Input Specification:
The first line of input contains two integers *n* and *m*, (2<=≤<=*n*,<=*m*<=≤<=20), denoting the number of horizontal streets and the number of vertical streets.
The second line contains a string of length *n*, made of characters '<' and '>', denoting direction of each horizontal street. If the *i*-th character is equal to '<', the street is directed from east to west otherwise, the street is directed from west to east. Streets are listed in order from north to south.
The third line contains a string of length *m*, made of characters '^' and 'v', denoting direction of each vertical street. If the *i*-th character is equal to '^', the street is directed from south to north, otherwise the street is directed from north to south. Streets are listed in order from west to east.
Output Specification:
If the given pattern meets the mayor's criteria, print a single line containing "YES", otherwise print a single line containing "NO".
Demo Input:
['3 3\n><>\nv^v\n', '4 6\n<><>\nv^v^v^\n']
Demo Output:
['NO\n', 'YES\n']
Note:
The figure above shows street directions in the second sample test case.
|
```python
import sys
with open(sys.stdin) as f:
line1 = f.readline().strip('\n').split()
numh, numv = line1[0], line1[1]
hor = f.readline().strip('\n').split('')
vert = f.readline().strip('\n').split('')
if (hor[0], vert[0]) == ('<', '^') or
(hor[-1], vert[0]) == ('<', 'v') or
(hor[0], vert[-1]) == ('>', '^') or
(hor[-1], vert[-1]) == ('>', 'v'):
print('NO')
else:
print('YES')
```
| -1
|
|
313
|
A
|
Ilya and Bank Account
|
PROGRAMMING
| 900
|
[
"implementation",
"number theory"
] | null | null |
Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money.
Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance.
Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift.
|
The single line contains integer *n* (10<=≤<=|*n*|<=≤<=109) — the state of Ilya's bank account.
|
In a single line print an integer — the maximum state of the bank account that Ilya can get.
|
[
"2230\n",
"-10\n",
"-100003\n"
] |
[
"2230\n",
"0\n",
"-10000\n"
] |
In the first test sample Ilya doesn't profit from using the present.
In the second test sample you can delete digit 1 and get the state of the account equal to 0.
| 500
|
[
{
"input": "2230",
"output": "2230"
},
{
"input": "-10",
"output": "0"
},
{
"input": "-100003",
"output": "-10000"
},
{
"input": "544883178",
"output": "544883178"
},
{
"input": "-847251738",
"output": "-84725173"
},
{
"input": "423654797",
"output": "423654797"
},
{
"input": "-623563697",
"output": "-62356367"
},
{
"input": "645894116",
"output": "645894116"
},
{
"input": "-384381709",
"output": "-38438170"
},
{
"input": "437587210",
"output": "437587210"
},
{
"input": "-297534606",
"output": "-29753460"
},
{
"input": "891773002",
"output": "891773002"
},
{
"input": "-56712976",
"output": "-5671296"
},
{
"input": "963662765",
"output": "963662765"
},
{
"input": "-272656295",
"output": "-27265625"
},
{
"input": "383441522",
"output": "383441522"
},
{
"input": "-477665112",
"output": "-47766511"
},
{
"input": "791725034",
"output": "791725034"
},
{
"input": "-812168727",
"output": "-81216872"
},
{
"input": "528894922",
"output": "528894922"
},
{
"input": "-479977172",
"output": "-47997712"
},
{
"input": "568044564",
"output": "568044564"
},
{
"input": "-392784794",
"output": "-39278474"
},
{
"input": "925596634",
"output": "925596634"
},
{
"input": "-836078769",
"output": "-83607876"
},
{
"input": "71036059",
"output": "71036059"
},
{
"input": "-337396162",
"output": "-33739612"
},
{
"input": "87129297",
"output": "87129297"
},
{
"input": "-648171877",
"output": "-64817187"
},
{
"input": "20218400",
"output": "20218400"
},
{
"input": "10",
"output": "10"
},
{
"input": "1000000000",
"output": "1000000000"
},
{
"input": "-1000000000",
"output": "-100000000"
},
{
"input": "-102",
"output": "-10"
},
{
"input": "-120",
"output": "-10"
},
{
"input": "-20",
"output": "0"
},
{
"input": "-15",
"output": "-1"
},
{
"input": "-5575533",
"output": "-557553"
},
{
"input": "-50",
"output": "0"
},
{
"input": "-31",
"output": "-1"
},
{
"input": "-55",
"output": "-5"
},
{
"input": "-81",
"output": "-1"
},
{
"input": "-99",
"output": "-9"
},
{
"input": "-23",
"output": "-2"
},
{
"input": "-41",
"output": "-1"
},
{
"input": "-24",
"output": "-2"
},
{
"input": "46",
"output": "46"
}
] | 1,693,574,278
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 30
| 0
|
def maximize_number(n):
s = str(n)
if n > 0:
print(n)
else:
for i in range(1, len(s) - 1):
if s[i] > s[i + 1]:
return int(s[:i] + s[i+1:])
return int(s[:-1])
n = int(input())
print(maximize_number(n))
|
Title: Ilya and Bank Account
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money.
Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance.
Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift.
Input Specification:
The single line contains integer *n* (10<=≤<=|*n*|<=≤<=109) — the state of Ilya's bank account.
Output Specification:
In a single line print an integer — the maximum state of the bank account that Ilya can get.
Demo Input:
['2230\n', '-10\n', '-100003\n']
Demo Output:
['2230\n', '0\n', '-10000\n']
Note:
In the first test sample Ilya doesn't profit from using the present.
In the second test sample you can delete digit 1 and get the state of the account equal to 0.
|
```python
def maximize_number(n):
s = str(n)
if n > 0:
print(n)
else:
for i in range(1, len(s) - 1):
if s[i] > s[i + 1]:
return int(s[:i] + s[i+1:])
return int(s[:-1])
n = int(input())
print(maximize_number(n))
```
| 0
|
|
230
|
A
|
Dragons
|
PROGRAMMING
| 1,000
|
[
"greedy",
"sortings"
] | null | null |
Kirito is stuck on a level of the MMORPG he is playing now. To move on in the game, he's got to defeat all *n* dragons that live on this level. Kirito and the dragons have strength, which is represented by an integer. In the duel between two opponents the duel's outcome is determined by their strength. Initially, Kirito's strength equals *s*.
If Kirito starts duelling with the *i*-th (1<=≤<=*i*<=≤<=*n*) dragon and Kirito's strength is not greater than the dragon's strength *x**i*, then Kirito loses the duel and dies. But if Kirito's strength is greater than the dragon's strength, then he defeats the dragon and gets a bonus strength increase by *y**i*.
Kirito can fight the dragons in any order. Determine whether he can move on to the next level of the game, that is, defeat all dragons without a single loss.
|
The first line contains two space-separated integers *s* and *n* (1<=≤<=*s*<=≤<=104, 1<=≤<=*n*<=≤<=103). Then *n* lines follow: the *i*-th line contains space-separated integers *x**i* and *y**i* (1<=≤<=*x**i*<=≤<=104, 0<=≤<=*y**i*<=≤<=104) — the *i*-th dragon's strength and the bonus for defeating it.
|
On a single line print "YES" (without the quotes), if Kirito can move on to the next level and print "NO" (without the quotes), if he can't.
|
[
"2 2\n1 99\n100 0\n",
"10 1\n100 100\n"
] |
[
"YES\n",
"NO\n"
] |
In the first sample Kirito's strength initially equals 2. As the first dragon's strength is less than 2, Kirito can fight it and defeat it. After that he gets the bonus and his strength increases to 2 + 99 = 101. Now he can defeat the second dragon and move on to the next level.
In the second sample Kirito's strength is too small to defeat the only dragon and win.
| 500
|
[
{
"input": "2 2\n1 99\n100 0",
"output": "YES"
},
{
"input": "10 1\n100 100",
"output": "NO"
},
{
"input": "123 2\n78 10\n130 0",
"output": "YES"
},
{
"input": "999 2\n1010 10\n67 89",
"output": "YES"
},
{
"input": "2 5\n5 1\n2 1\n3 1\n1 1\n4 1",
"output": "YES"
},
{
"input": "2 2\n3 5\n1 2",
"output": "YES"
},
{
"input": "1 2\n1 0\n1 0",
"output": "NO"
},
{
"input": "5 10\n20 1\n4 3\n5 1\n100 1\n4 2\n101 1\n10 0\n10 2\n17 3\n12 84",
"output": "YES"
},
{
"input": "2 2\n1 98\n100 0",
"output": "NO"
},
{
"input": "2 2\n1 2\n3 5",
"output": "YES"
},
{
"input": "5 3\n13 20\n3 10\n15 5",
"output": "YES"
},
{
"input": "2 5\n1 1\n2 1\n3 1\n4 1\n5 1",
"output": "YES"
},
{
"input": "3 3\n1 1\n1 2\n4 0",
"output": "YES"
},
{
"input": "10 4\n20 1\n3 5\n2 4\n1 3",
"output": "YES"
},
{
"input": "10 1\n1 1",
"output": "YES"
},
{
"input": "4 1\n100 1000",
"output": "NO"
},
{
"input": "5 1\n6 7",
"output": "NO"
},
{
"input": "10 1\n10 10",
"output": "NO"
},
{
"input": "6 2\n496 0\n28 8128",
"output": "NO"
},
{
"input": "4 2\n2 1\n10 3",
"output": "NO"
},
{
"input": "11 2\n22 0\n33 0",
"output": "NO"
},
{
"input": "1 2\n100 1\n100 1",
"output": "NO"
},
{
"input": "10 3\n12 0\n13 0\n14 0",
"output": "NO"
},
{
"input": "50 3\n39 0\n38 0\n37 0",
"output": "YES"
},
{
"input": "14 3\n1 5\n1 6\n1 7",
"output": "YES"
},
{
"input": "1 3\n1 10\n1 11\n1 9",
"output": "NO"
},
{
"input": "10 10\n2 10\n3 10\n4 10\n2 20\n3 20\n3 20\n100 50\n100 30\n150 30\n200 10",
"output": "NO"
},
{
"input": "9983 34\n6626 5976\n4448 3568\n2794 2309\n3741 8806\n4754 129\n2780 9275\n5785 9243\n3915 6159\n2609 4331\n238 6756\n6987 3887\n3384 5711\n4349 5563\n1135 4483\n9151 1584\n1500 766\n1608 4440\n7768 5005\n7205 2360\n9088 2933\n3923 7814\n7538 9372\n7504 165\n5277 1636\n2061 4384\n7668 1422\n9582 2121\n5483 7967\n487 2944\n7432 5794\n8208 8970\n5747 3800\n4322 3920\n8261 9319",
"output": "YES"
},
{
"input": "1 10\n8 8\n54 3\n1 8\n26 3\n16 1\n29 9\n38 10\n57 8\n48 6\n17 9",
"output": "NO"
},
{
"input": "5 10\n7 0\n7 0\n10 0\n10 0\n7 2\n4 2\n9 0\n6 1\n7 0\n7 0",
"output": "NO"
},
{
"input": "2 3\n1 1\n1 10\n17 2",
"output": "NO"
},
{
"input": "100 5\n99 100\n199 1\n199 1\n199 1\n202 1",
"output": "YES"
},
{
"input": "1 1\n10000 1",
"output": "NO"
}
] | 1,698,157,954
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 92
| 0
|
s, n = map(int, input().split())
data = []
for i in range(n):
dragonStrength, gain = map(int, input().split())
data.append((dragonStrength, gain))
data = sorted(data)
Won = True
for i in data:
if s > i[0]:
s += i[1]
else:
print("NO")
Won = False
break
if Won:
print("YES")
|
Title: Dragons
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kirito is stuck on a level of the MMORPG he is playing now. To move on in the game, he's got to defeat all *n* dragons that live on this level. Kirito and the dragons have strength, which is represented by an integer. In the duel between two opponents the duel's outcome is determined by their strength. Initially, Kirito's strength equals *s*.
If Kirito starts duelling with the *i*-th (1<=≤<=*i*<=≤<=*n*) dragon and Kirito's strength is not greater than the dragon's strength *x**i*, then Kirito loses the duel and dies. But if Kirito's strength is greater than the dragon's strength, then he defeats the dragon and gets a bonus strength increase by *y**i*.
Kirito can fight the dragons in any order. Determine whether he can move on to the next level of the game, that is, defeat all dragons without a single loss.
Input Specification:
The first line contains two space-separated integers *s* and *n* (1<=≤<=*s*<=≤<=104, 1<=≤<=*n*<=≤<=103). Then *n* lines follow: the *i*-th line contains space-separated integers *x**i* and *y**i* (1<=≤<=*x**i*<=≤<=104, 0<=≤<=*y**i*<=≤<=104) — the *i*-th dragon's strength and the bonus for defeating it.
Output Specification:
On a single line print "YES" (without the quotes), if Kirito can move on to the next level and print "NO" (without the quotes), if he can't.
Demo Input:
['2 2\n1 99\n100 0\n', '10 1\n100 100\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first sample Kirito's strength initially equals 2. As the first dragon's strength is less than 2, Kirito can fight it and defeat it. After that he gets the bonus and his strength increases to 2 + 99 = 101. Now he can defeat the second dragon and move on to the next level.
In the second sample Kirito's strength is too small to defeat the only dragon and win.
|
```python
s, n = map(int, input().split())
data = []
for i in range(n):
dragonStrength, gain = map(int, input().split())
data.append((dragonStrength, gain))
data = sorted(data)
Won = True
for i in data:
if s > i[0]:
s += i[1]
else:
print("NO")
Won = False
break
if Won:
print("YES")
```
| 3
|
|
96
|
A
|
Football
|
PROGRAMMING
| 900
|
[
"implementation",
"strings"
] |
A. Football
|
2
|
256
|
Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A zero corresponds to players of one team; a one corresponds to players of another team. If there are at least 7 players of some team standing one after another, then the situation is considered dangerous. For example, the situation 00100110111111101 is dangerous and 11110111011101 is not. You are given the current situation. Determine whether it is dangerous or not.
|
The first input line contains a non-empty string consisting of characters "0" and "1", which represents players. The length of the string does not exceed 100 characters. There's at least one player from each team present on the field.
|
Print "YES" if the situation is dangerous. Otherwise, print "NO".
|
[
"001001\n",
"1000000001\n"
] |
[
"NO\n",
"YES\n"
] |
none
| 500
|
[
{
"input": "001001",
"output": "NO"
},
{
"input": "1000000001",
"output": "YES"
},
{
"input": "00100110111111101",
"output": "YES"
},
{
"input": "11110111111111111",
"output": "YES"
},
{
"input": "01",
"output": "NO"
},
{
"input": "10100101",
"output": "NO"
},
{
"input": "1010010100000000010",
"output": "YES"
},
{
"input": "101010101",
"output": "NO"
},
{
"input": "000000000100000000000110101100000",
"output": "YES"
},
{
"input": "100001000000110101100000",
"output": "NO"
},
{
"input": "100001000011010110000",
"output": "NO"
},
{
"input": "010",
"output": "NO"
},
{
"input": "10101011111111111111111111111100",
"output": "YES"
},
{
"input": "1001101100",
"output": "NO"
},
{
"input": "1001101010",
"output": "NO"
},
{
"input": "1111100111",
"output": "NO"
},
{
"input": "00110110001110001111",
"output": "NO"
},
{
"input": "11110001001111110001",
"output": "NO"
},
{
"input": "10001111001011111101",
"output": "NO"
},
{
"input": "10000010100000001000110001010100001001001010011",
"output": "YES"
},
{
"input": "01111011111010111100101100001011001010111110000010",
"output": "NO"
},
{
"input": "00100000100100101110011001011011101110110110010100",
"output": "NO"
},
{
"input": "10110100110001001011110101110010100010000000000100101010111110111110100011",
"output": "YES"
},
{
"input": "00011101010101111001011011001101101011111101000010100000111000011100101011",
"output": "NO"
},
{
"input": "01110000110100110101110100111000101101011101011110110100100111100001110111",
"output": "NO"
},
{
"input": "11110110011000100111100111101101011111110100010101011011111101110110110111",
"output": "YES"
},
{
"input": "100100010101110010001011001110100011100010011110100101100011010001001010001001101111001100",
"output": "NO"
},
{
"input": "111110010001011010010011111100110110001111000010100011011100111101111101110010101111011110000001010",
"output": "NO"
},
{
"input": "111110111100010100000100001010111011101011000111011011011010110010100010000101011111000011010011110",
"output": "NO"
},
{
"input": "1011110110111010110111111010010010100011111011110000011000110010011110111010110100011010100010111000",
"output": "NO"
},
{
"input": "0010100111100010110110000011100111110100111110001010000100111111111010111100101101010101001011010110",
"output": "YES"
},
{
"input": "1111010100010100101011101100101101110011000010100010000001111100010011100101010001101111000001011000",
"output": "NO"
},
{
"input": "0101100011001110001110100111100011010101011000000000110110010010111100101111010111100011101100100101",
"output": "YES"
},
{
"input": "0001101110011101110000000010011111101001101111100001001010110000110001100000010001111011011110001101",
"output": "YES"
},
{
"input": "1000010000100000100010000100001000010000100001000010000100001000010000100001000010000100001000010000",
"output": "NO"
},
{
"input": "1000000000100000000010000000001000000000100000000010000000001000000000100000000010000000001000000000",
"output": "YES"
},
{
"input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001",
"output": "YES"
},
{
"input": "1111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111",
"output": "YES"
},
{
"input": "10100101000",
"output": "NO"
},
{
"input": "11110111011101",
"output": "NO"
},
{
"input": "10000000",
"output": "YES"
},
{
"input": "00000001",
"output": "YES"
},
{
"input": "01111111",
"output": "YES"
},
{
"input": "11111110",
"output": "YES"
}
] | 1,692,987,511
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 44
| 92
| 0
|
a = input()
zero = one = 0
for i in a:
if int(i) == 0:
zero += 1
one = 0
else:
one += 1
zero = 0
if zero == 7 or one == 7:
print('YES')
break
else:
print('NO')
|
Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A zero corresponds to players of one team; a one corresponds to players of another team. If there are at least 7 players of some team standing one after another, then the situation is considered dangerous. For example, the situation 00100110111111101 is dangerous and 11110111011101 is not. You are given the current situation. Determine whether it is dangerous or not.
Input Specification:
The first input line contains a non-empty string consisting of characters "0" and "1", which represents players. The length of the string does not exceed 100 characters. There's at least one player from each team present on the field.
Output Specification:
Print "YES" if the situation is dangerous. Otherwise, print "NO".
Demo Input:
['001001\n', '1000000001\n']
Demo Output:
['NO\n', 'YES\n']
Note:
none
|
```python
a = input()
zero = one = 0
for i in a:
if int(i) == 0:
zero += 1
one = 0
else:
one += 1
zero = 0
if zero == 7 or one == 7:
print('YES')
break
else:
print('NO')
```
| 3.977
|
499
|
B
|
Lecture
|
PROGRAMMING
| 1,000
|
[
"implementation",
"strings"
] | null | null |
You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes.
You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning.
You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language.
You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes.
|
The first line contains two integers, *n* and *m* (1<=≤<=*n*<=≤<=3000, 1<=≤<=*m*<=≤<=3000) — the number of words in the professor's lecture and the number of words in each of these languages.
The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once.
The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* — the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}.
All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters.
|
Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input.
|
[
"4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n",
"5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n"
] |
[
"codeforces round letter round\n",
"hbnyiyc joll joll un joll\n"
] |
none
| 500
|
[
{
"input": "4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest",
"output": "codeforces round letter round"
},
{
"input": "5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll",
"output": "hbnyiyc joll joll un joll"
},
{
"input": "5 5\nqueyqj f\nb vn\ntabzvk qpfzoqx\nytnyonoc hnxsd\njpggvr lchinjmt\nqueyqj jpggvr b ytnyonoc b",
"output": "f jpggvr b hnxsd b"
},
{
"input": "10 22\nazbrll oen\ngh vdyayei\njphveblohx vfglv\nmfyxib jepnvhcuwo\nrpikazqj uam\nl rx\nokjenof qpnyi\nj tixqrno\nod itozmfct\nikkdxmirx ev\nqexftojc p\nkdazb zjs\nmbk ykvqjrxaxu\nhbcwhouzq pwt\nmirpsz zfaegpl\nuhkkvcj rlvwj\nef iqnnwtolrc\npjzfcpmeag ecdayth\nsa qcthz\ncbfhfxi qrnbvdryz\nwqel tj\natx smkbid\nef hbcwhouzq cbfhfxi hbcwhouzq mirpsz cbfhfxi cbfhfxi okjenof pjzfcpmeag kdazb",
"output": "ef pwt cbfhfxi pwt mirpsz cbfhfxi cbfhfxi qpnyi ecdayth zjs"
},
{
"input": "1 1\namit am\namit",
"output": "am"
},
{
"input": "1 1\na c\na",
"output": "a"
}
] | 1,601,915,628
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 37
| 202
| 4,505,600
|
n, m = map(int, input().split())
dict = {}
for i in range(m):
str1, str2 = input().split()
dict[str1] = str2
prof = input().split()
res = []
for i in prof:
if len(dict[i]) < len(i):
res.append(dict[i])
else:
res.append(i)
res = " ".join(res)
print(res)
|
Title: Lecture
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes.
You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning.
You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language.
You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes.
Input Specification:
The first line contains two integers, *n* and *m* (1<=≤<=*n*<=≤<=3000, 1<=≤<=*m*<=≤<=3000) — the number of words in the professor's lecture and the number of words in each of these languages.
The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once.
The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* — the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}.
All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters.
Output Specification:
Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input.
Demo Input:
['4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n', '5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n']
Demo Output:
['codeforces round letter round\n', 'hbnyiyc joll joll un joll\n']
Note:
none
|
```python
n, m = map(int, input().split())
dict = {}
for i in range(m):
str1, str2 = input().split()
dict[str1] = str2
prof = input().split()
res = []
for i in prof:
if len(dict[i]) < len(i):
res.append(dict[i])
else:
res.append(i)
res = " ".join(res)
print(res)
```
| 3
|
|
236
|
A
|
Boy or Girl
|
PROGRAMMING
| 800
|
[
"brute force",
"implementation",
"strings"
] | null | null |
Those days, many boys use beautiful girls' photos as avatars in forums. So it is pretty hard to tell the gender of a user at the first glance. Last year, our hero went to a forum and had a nice chat with a beauty (he thought so). After that they talked very often and eventually they became a couple in the network.
But yesterday, he came to see "her" in the real world and found out "she" is actually a very strong man! Our hero is very sad and he is too tired to love again now. So he came up with a way to recognize users' genders by their user names.
This is his method: if the number of distinct characters in one's user name is odd, then he is a male, otherwise she is a female. You are given the string that denotes the user name, please help our hero to determine the gender of this user by his method.
|
The first line contains a non-empty string, that contains only lowercase English letters — the user name. This string contains at most 100 letters.
|
If it is a female by our hero's method, print "CHAT WITH HER!" (without the quotes), otherwise, print "IGNORE HIM!" (without the quotes).
|
[
"wjmzbmr\n",
"xiaodao\n",
"sevenkplus\n"
] |
[
"CHAT WITH HER!\n",
"IGNORE HIM!\n",
"CHAT WITH HER!\n"
] |
For the first example. There are 6 distinct characters in "wjmzbmr". These characters are: "w", "j", "m", "z", "b", "r". So wjmzbmr is a female and you should print "CHAT WITH HER!".
| 500
|
[
{
"input": "wjmzbmr",
"output": "CHAT WITH HER!"
},
{
"input": "xiaodao",
"output": "IGNORE HIM!"
},
{
"input": "sevenkplus",
"output": "CHAT WITH HER!"
},
{
"input": "pezu",
"output": "CHAT WITH HER!"
},
{
"input": "wnemlgppy",
"output": "CHAT WITH HER!"
},
{
"input": "zcinitufxoldnokacdvtmdohsfdjepyfioyvclhmujiqwvmudbfjzxjfqqxjmoiyxrfsbvseawwoyynn",
"output": "IGNORE HIM!"
},
{
"input": "qsxxuoynwtebujwpxwpajitiwxaxwgbcylxneqiebzfphugwkftpaikixmumkhfbjiswmvzbtiyifbx",
"output": "CHAT WITH HER!"
},
{
"input": "qwbdfzfylckctudyjlyrtmvbidfatdoqfmrfshsqqmhzohhsczscvwzpwyoyswhktjlykumhvaounpzwpxcspxwlgt",
"output": "IGNORE HIM!"
},
{
"input": "nuezoadauueermoeaabjrkxttkatspjsjegjcjcdmcxgodowzbwuqncfbeqlhkk",
"output": "IGNORE HIM!"
},
{
"input": "lggvdmulrsvtuagoavstuyufhypdxfomjlzpnduulukszqnnwfvxbvxyzmleocmofwclmzz",
"output": "IGNORE HIM!"
},
{
"input": "tgcdptnkc",
"output": "IGNORE HIM!"
},
{
"input": "wvfgnfrzabgibzxhzsojskmnlmrokydjoexnvi",
"output": "IGNORE HIM!"
},
{
"input": "sxtburpzskucowowebgrbovhadrrayamuwypmmxhscrujkmcgvyinp",
"output": "IGNORE HIM!"
},
{
"input": "pjqxhvxkyeqqvyuujxhmbspatvrckhhkfloottuybjivkkhpyivcighxumavrxzxslfpggnwbtalmhysyfllznphzia",
"output": "IGNORE HIM!"
},
{
"input": "fpellxwskyekoyvrfnuf",
"output": "CHAT WITH HER!"
},
{
"input": "xninyvkuvakfbs",
"output": "IGNORE HIM!"
},
{
"input": "vnxhrweyvhqufpfywdwftoyrfgrhxuamqhblkvdpxmgvphcbeeqbqssresjifwyzgfhurmamhkwupymuomak",
"output": "CHAT WITH HER!"
},
{
"input": "kmsk",
"output": "IGNORE HIM!"
},
{
"input": "lqonogasrkzhryjxppjyriyfxmdfubieglthyswz",
"output": "CHAT WITH HER!"
},
{
"input": "ndormkufcrkxlihdhmcehzoimcfhqsmombnfjrlcalffq",
"output": "CHAT WITH HER!"
},
{
"input": "zqzlnnuwcfufwujygtczfakhcpqbtxtejrbgoodychepzdphdahtxyfpmlrycyicqthsgm",
"output": "IGNORE HIM!"
},
{
"input": "ppcpbnhwoizajrl",
"output": "IGNORE HIM!"
},
{
"input": "sgubujztzwkzvztitssxxxwzanfmddfqvv",
"output": "CHAT WITH HER!"
},
{
"input": "ptkyaxycecpbrjnvxcjtbqiocqcswnmicxbvhdsptbxyxswbw",
"output": "IGNORE HIM!"
},
{
"input": "yhbtzfppwcycxqjpqdfmjnhwaogyuaxamwxpnrdrnqsgdyfvxu",
"output": "CHAT WITH HER!"
},
{
"input": "ojjvpnkrxibyevxk",
"output": "CHAT WITH HER!"
},
{
"input": "wjweqcrqfuollfvfbiyriijovweg",
"output": "IGNORE HIM!"
},
{
"input": "hkdbykboclchfdsuovvpknwqr",
"output": "IGNORE HIM!"
},
{
"input": "stjvyfrfowopwfjdveduedqylerqugykyu",
"output": "IGNORE HIM!"
},
{
"input": "rafcaanqytfclvfdegak",
"output": "CHAT WITH HER!"
},
{
"input": "xczn",
"output": "CHAT WITH HER!"
},
{
"input": "arcoaeozyeawbveoxpmafxxzdjldsielp",
"output": "IGNORE HIM!"
},
{
"input": "smdfafbyehdylhaleevhoggiurdgeleaxkeqdixyfztkuqsculgslheqfafxyghyuibdgiuwrdxfcitojxika",
"output": "CHAT WITH HER!"
},
{
"input": "vbpfgjqnhfazmvtkpjrdasfhsuxnpiepxfrzvoh",
"output": "CHAT WITH HER!"
},
{
"input": "dbdokywnpqnotfrhdbrzmuyoxfdtrgrzcccninbtmoqvxfatcqg",
"output": "CHAT WITH HER!"
},
{
"input": "udlpagtpq",
"output": "CHAT WITH HER!"
},
{
"input": "zjurevbytijifnpfuyswfchdzelxheboruwjqijxcucylysmwtiqsqqhktexcynquvcwhbjsipy",
"output": "CHAT WITH HER!"
},
{
"input": "qagzrqjomdwhagkhrjahhxkieijyten",
"output": "CHAT WITH HER!"
},
{
"input": "achhcfjnnfwgoufxamcqrsontgjjhgyfzuhklkmiwybnrlsvblnsrjqdytglipxsulpnphpjpoewvlusalsgovwnsngb",
"output": "CHAT WITH HER!"
},
{
"input": "qbkjsdwpahdbbohggbclfcufqelnojoehsxxkr",
"output": "CHAT WITH HER!"
},
{
"input": "cpvftiwgyvnlmbkadiafddpgfpvhqqvuehkypqjsoibpiudfvpkhzlfrykc",
"output": "IGNORE HIM!"
},
{
"input": "lnpdosnceumubvk",
"output": "IGNORE HIM!"
},
{
"input": "efrk",
"output": "CHAT WITH HER!"
},
{
"input": "temnownneghnrujforif",
"output": "IGNORE HIM!"
},
{
"input": "ottnneymszwbumgobazfjyxewkjakglbfflsajuzescplpcxqta",
"output": "IGNORE HIM!"
},
{
"input": "eswpaclodzcwhgixhpyzvhdwsgneqidanbzdzszquefh",
"output": "IGNORE HIM!"
},
{
"input": "gwntwbpj",
"output": "IGNORE HIM!"
},
{
"input": "wuqvlbblkddeindiiswsinkfrnkxghhwunzmmvyovpqapdfbolyim",
"output": "IGNORE HIM!"
},
{
"input": "swdqsnzmzmsyvktukaoyqsqzgfmbzhezbfaqeywgwizrwjyzquaahucjchegknqaioliqd",
"output": "CHAT WITH HER!"
},
{
"input": "vlhrpzezawyolhbmvxbwhtjustdbqggexmzxyieihjlelvwjosmkwesfjmramsikhkupzvfgezmrqzudjcalpjacmhykhgfhrjx",
"output": "IGNORE HIM!"
},
{
"input": "lxxwbkrjgnqjwsnflfnsdyxihmlspgivirazsbveztnkuzpaxtygidniflyjheejelnjyjvgkgvdqks",
"output": "CHAT WITH HER!"
},
{
"input": "wpxbxzfhtdecetpljcrvpjjnllosdqirnkzesiqeukbedkayqx",
"output": "CHAT WITH HER!"
},
{
"input": "vmzxgacicvweclaodrunmjnfwtimceetsaoickarqyrkdghcmyjgmtgsqastcktyrjgvjqimdc",
"output": "CHAT WITH HER!"
},
{
"input": "yzlzmesxdttfcztooypjztlgxwcr",
"output": "IGNORE HIM!"
},
{
"input": "qpbjwzwgdzmeluheirjrvzrhbmagfsjdgvzgwumjtjzecsfkrfqjasssrhhtgdqqfydlmrktlgfc",
"output": "IGNORE HIM!"
},
{
"input": "aqzftsvezdgouyrirsxpbuvdjupnzvbhguyayeqozfzymfnepvwgblqzvmxxkxcilmsjvcgyqykpoaktjvsxbygfgsalbjoq",
"output": "CHAT WITH HER!"
},
{
"input": "znicjjgijhrbdlnwmtjgtdgziollrfxroabfhadygnomodaembllreorlyhnehijfyjbfxucazellblegyfrzuraogadj",
"output": "IGNORE HIM!"
},
{
"input": "qordzrdiknsympdrkgapjxokbldorpnmnpucmwakklmqenpmkom",
"output": "CHAT WITH HER!"
},
{
"input": "wqfldgihuxfktzanyycluzhtewmwvnawqlfoavuguhygqrrxtstxwouuzzsryjqtfqo",
"output": "CHAT WITH HER!"
},
{
"input": "vujtrrpshinkskgyknlcfckmqdrwtklkzlyipmetjvaqxdsslkskschbalmdhzsdrrjmxdltbtnxbh",
"output": "IGNORE HIM!"
},
{
"input": "zioixjibuhrzyrbzqcdjbbhhdmpgmqykixcxoqupggaqajuzonrpzihbsogjfsrrypbiphehonyhohsbybnnukqebopppa",
"output": "CHAT WITH HER!"
},
{
"input": "oh",
"output": "CHAT WITH HER!"
},
{
"input": "kxqthadqesbpgpsvpbcbznxpecqrzjoilpauttzlnxvaczcqwuri",
"output": "IGNORE HIM!"
},
{
"input": "zwlunigqnhrwirkvufqwrnwcnkqqonebrwzcshcbqqwkjxhymjjeakuzjettebciadjlkbfp",
"output": "CHAT WITH HER!"
},
{
"input": "fjuldpuejgmggvvigkwdyzytfxzwdlofrpifqpdnhfyroginqaufwgjcbgshyyruwhofctsdaisqpjxqjmtpp",
"output": "CHAT WITH HER!"
},
{
"input": "xiwntnheuitbtqxrmzvxmieldudakogealwrpygbxsbluhsqhtwmdlpjwzyafckrqrdduonkgo",
"output": "CHAT WITH HER!"
},
{
"input": "mnmbupgo",
"output": "IGNORE HIM!"
},
{
"input": "mcjehdiygkbmrbfjqwpwxidbdfelifwhstaxdapigbymmsgrhnzsdjhsqchl",
"output": "IGNORE HIM!"
},
{
"input": "yocxrzspinchmhtmqo",
"output": "CHAT WITH HER!"
},
{
"input": "vasvvnpymtgjirnzuynluluvmgpquskuaafwogeztfnvybblajvuuvfomtifeuzpikjrolzeeoftv",
"output": "CHAT WITH HER!"
},
{
"input": "ecsdicrznvglwggrdbrvehwzaenzjutjydhvimtqegweurpxtjkmpcznshtrvotkvrghxhacjkedidqqzrduzad",
"output": "IGNORE HIM!"
},
{
"input": "ubvhyaebyxoghakajqrpqpctwbrfqzli",
"output": "CHAT WITH HER!"
},
{
"input": "gogbxfeqylxoummvgxpkoqzsmobasesxbqjjktqbwqxeiaagnnhbvepbpy",
"output": "IGNORE HIM!"
},
{
"input": "nheihhxkbbrmlpxpxbhnpofcjmxemyvqqdbanwd",
"output": "IGNORE HIM!"
},
{
"input": "acrzbavz",
"output": "CHAT WITH HER!"
},
{
"input": "drvzznznvrzskftnrhvvzxcalwutxmdza",
"output": "IGNORE HIM!"
},
{
"input": "oacwxipdfcoabhkwxqdbtowiekpnflnqhlrkustgzryvws",
"output": "CHAT WITH HER!"
},
{
"input": "tpnwfmfsibnccvdwjvzviyvjfljupinfigfunyff",
"output": "CHAT WITH HER!"
},
{
"input": "gavaihhamfolcndgytcsgucqdqngxkrlovpthvteacmmthoglxu",
"output": "CHAT WITH HER!"
},
{
"input": "hsfcfvameeupldgvchmogrvwxrvsmnwxxkxoawwodtsahqvehlcw",
"output": "IGNORE HIM!"
},
{
"input": "sbkydrscoojychxchqsuciperfroumenelgiyiwlqfwximrgdbyvkmacy",
"output": "CHAT WITH HER!"
},
{
"input": "rhh",
"output": "CHAT WITH HER!"
},
{
"input": "zhdouqfmlkenjzdijxdfxnlegxeuvhelo",
"output": "IGNORE HIM!"
},
{
"input": "yufkkfwyhhvcjntsgsvpzbhqtmtgyxifqoewmuplphykmptfdebjxuaxigomjtwgtljwdjhjernkitifbomifbhysnmadtnyn",
"output": "CHAT WITH HER!"
},
{
"input": "urigreuzpxnej",
"output": "CHAT WITH HER!"
}
] | 1,698,173,908
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 30
| 0
|
nickname=input()
l=len(nickname)
if nickname.count(nickname[i])>1:
l-=nickname.count(nickname[i])
if l%2==0:
print('CHAT WITH HER!')
else:
print('IGNORE HIM!')
|
Title: Boy or Girl
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Those days, many boys use beautiful girls' photos as avatars in forums. So it is pretty hard to tell the gender of a user at the first glance. Last year, our hero went to a forum and had a nice chat with a beauty (he thought so). After that they talked very often and eventually they became a couple in the network.
But yesterday, he came to see "her" in the real world and found out "she" is actually a very strong man! Our hero is very sad and he is too tired to love again now. So he came up with a way to recognize users' genders by their user names.
This is his method: if the number of distinct characters in one's user name is odd, then he is a male, otherwise she is a female. You are given the string that denotes the user name, please help our hero to determine the gender of this user by his method.
Input Specification:
The first line contains a non-empty string, that contains only lowercase English letters — the user name. This string contains at most 100 letters.
Output Specification:
If it is a female by our hero's method, print "CHAT WITH HER!" (without the quotes), otherwise, print "IGNORE HIM!" (without the quotes).
Demo Input:
['wjmzbmr\n', 'xiaodao\n', 'sevenkplus\n']
Demo Output:
['CHAT WITH HER!\n', 'IGNORE HIM!\n', 'CHAT WITH HER!\n']
Note:
For the first example. There are 6 distinct characters in "wjmzbmr". These characters are: "w", "j", "m", "z", "b", "r". So wjmzbmr is a female and you should print "CHAT WITH HER!".
|
```python
nickname=input()
l=len(nickname)
if nickname.count(nickname[i])>1:
l-=nickname.count(nickname[i])
if l%2==0:
print('CHAT WITH HER!')
else:
print('IGNORE HIM!')
```
| -1
|
|
427
|
A
|
Police Recruits
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups.
Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime.
If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated.
Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated.
|
The first line of input will contain an integer *n* (1<=≤<=*n*<=≤<=105), the number of events. The next line will contain *n* space-separated integers.
If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time.
|
Print a single integer, the number of crimes which will go untreated.
|
[
"3\n-1 -1 1\n",
"8\n1 -1 1 -1 -1 1 1 1\n",
"11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n"
] |
[
"2\n",
"1\n",
"8\n"
] |
Lets consider the second example:
1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired.
The answer is one, as one crime (on step 5) will go untreated.
| 500
|
[
{
"input": "3\n-1 -1 1",
"output": "2"
},
{
"input": "8\n1 -1 1 -1 -1 1 1 1",
"output": "1"
},
{
"input": "11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1",
"output": "8"
},
{
"input": "7\n-1 -1 1 1 -1 -1 1",
"output": "2"
},
{
"input": "21\n-1 -1 -1 -1 -1 3 2 -1 6 -1 -1 2 1 -1 2 2 1 6 5 -1 5",
"output": "5"
},
{
"input": "98\n-1 -1 1 -1 -1 -1 -1 1 -1 -1 1 -1 -1 1 -1 1 1 1 -1 1 1 1 1 1 -1 1 -1 -1 -1 -1 1 -1 -1 1 1 -1 1 1 1 -1 -1 -1 -1 -1 -1 1 -1 -1 -1 1 -1 1 -1 1 -1 1 1 1 1 1 1 1 -1 -1 1 1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 1 -1 1 1 1 -1 1 1 -1 -1 -1 1 1 1 -1 -1 -1 1 -1 1 1",
"output": "13"
},
{
"input": "3\n-1 5 4",
"output": "1"
},
{
"input": "146\n4 -1 -1 -1 -1 -1 -1 -1 -1 -1 4 -1 3 -1 3 -1 -1 1 4 -1 2 -1 -1 3 -1 -1 -1 4 1 -1 -1 -1 4 -1 -1 -1 -1 -1 -1 3 2 -1 3 2 4 5 2 4 1 5 -1 -1 2 -1 -1 1 -1 5 3 -1 1 2 2 3 5 3 -1 -1 3 -1 -1 3 5 5 -1 -1 5 -1 4 4 1 -1 -1 -1 2 1 -1 -1 -1 2 5 3 -1 -1 -1 3 -1 5 4 -1 1 -1 -1 3 -1 -1 3 1 1 2 -1 -1 -1 1 3 1 -1 2 -1 -1 5 5 -1 -1 3 4 5 1 -1 2 -1 -1 -1 3 -1 5 3 2 -1 2 -1 -1 5 -1 3 -1",
"output": "5"
},
{
"input": "1\n2",
"output": "0"
},
{
"input": "1\n-1",
"output": "1"
},
{
"input": "2\n1 -1",
"output": "0"
},
{
"input": "2\n-1 1",
"output": "1"
},
{
"input": "2\n1 1",
"output": "0"
},
{
"input": "2\n-1 -1",
"output": "2"
},
{
"input": "4\n10 -1 -1 -1",
"output": "0"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "4\n-1 -1 1 1",
"output": "2"
}
] | 1,681,845,865
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 63
| 140
| 13,516,800
|
n = int(input())
a = list(map(int,input().split()))
p = 0
c = 0
for i in a:
if i!=-1:
p+=i
else:
if p==0:
c+=1
else:
p-=1
print(c)
|
Title: Police Recruits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups.
Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime.
If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated.
Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated.
Input Specification:
The first line of input will contain an integer *n* (1<=≤<=*n*<=≤<=105), the number of events. The next line will contain *n* space-separated integers.
If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time.
Output Specification:
Print a single integer, the number of crimes which will go untreated.
Demo Input:
['3\n-1 -1 1\n', '8\n1 -1 1 -1 -1 1 1 1\n', '11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n']
Demo Output:
['2\n', '1\n', '8\n']
Note:
Lets consider the second example:
1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired.
The answer is one, as one crime (on step 5) will go untreated.
|
```python
n = int(input())
a = list(map(int,input().split()))
p = 0
c = 0
for i in a:
if i!=-1:
p+=i
else:
if p==0:
c+=1
else:
p-=1
print(c)
```
| 3
|
|
71
|
A
|
Way Too Long Words
|
PROGRAMMING
| 800
|
[
"strings"
] |
A. Way Too Long Words
|
1
|
256
|
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation.
This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes.
Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n".
You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
|
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
|
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
|
[
"4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n"
] |
[
"word\nl10n\ni18n\np43s\n"
] |
none
| 500
|
[
{
"input": "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis",
"output": "word\nl10n\ni18n\np43s"
},
{
"input": "5\nabcdefgh\nabcdefghi\nabcdefghij\nabcdefghijk\nabcdefghijklm",
"output": "abcdefgh\nabcdefghi\nabcdefghij\na9k\na11m"
},
{
"input": "3\nnjfngnrurunrgunrunvurn\njfvnjfdnvjdbfvsbdubruvbubvkdb\nksdnvidnviudbvibd",
"output": "n20n\nj27b\nk15d"
},
{
"input": "1\ntcyctkktcctrcyvbyiuhihhhgyvyvyvyvjvytchjckt",
"output": "t41t"
},
{
"input": "24\nyou\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nunofficially\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings",
"output": "you\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nu10y\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "26\na\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz",
"output": "a\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz"
},
{
"input": "1\nabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij",
"output": "a98j"
},
{
"input": "10\ngyartjdxxlcl\nfzsck\nuidwu\nxbymclornemdmtj\nilppyoapitawgje\ncibzc\ndrgbeu\nhezplmsdekhhbo\nfeuzlrimbqbytdu\nkgdco",
"output": "g10l\nfzsck\nuidwu\nx13j\ni13e\ncibzc\ndrgbeu\nh12o\nf13u\nkgdco"
},
{
"input": "20\nlkpmx\nkovxmxorlgwaomlswjxlpnbvltfv\nhykasjxqyjrmybejnmeumzha\ntuevlumpqbbhbww\nqgqsphvrmupxxc\ntrissbaf\nqfgrlinkzvzqdryckaizutd\nzzqtoaxkvwoscyx\noswytrlnhpjvvnwookx\nlpuzqgec\ngyzqfwxggtvpjhzmzmdw\nrlxjgmvdftvrmvbdwudra\nvsntnjpepnvdaxiporggmglhagv\nxlvcqkqgcrbgtgglj\nlyxwxbiszyhlsrgzeedzprbmcpduvq\nyrmqqvrkqskqukzqrwukpsifgtdc\nxpuohcsjhhuhvr\nvvlfrlxpvqejngwrbfbpmqeirxlw\nsvmasocxdvadmaxtrpakysmeaympy\nyuflqboqfdt",
"output": "lkpmx\nk26v\nh22a\nt13w\nq12c\ntrissbaf\nq21d\nz13x\no17x\nlpuzqgec\ng18w\nr19a\nv25v\nx15j\nl28q\ny26c\nx12r\nv26w\ns27y\ny9t"
},
{
"input": "100\nm\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr",
"output": "m\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr"
}
] | 1,697,004,143
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 20
| 46
| 0
|
#program
def abbreviate_words(n, words):
abbreviated_words = []
for word in words:
if len(word) > 10:
abbreviation = word[0] + str(len(word) - 2) + word[-1]
abbreviated_words.append(abbreviation)
else:
abbreviated_words.append(word)
for abbreviation in abbreviated_words:
print(abbreviation)
n = int(input())
words = []
for _ in range(n):
word = input()
words.append(word)
abbreviate_words(n, words)
|
Title: Way Too Long Words
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation.
This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes.
Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n".
You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
Output Specification:
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
Demo Input:
['4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n']
Demo Output:
['word\nl10n\ni18n\np43s\n']
Note:
none
|
```python
#program
def abbreviate_words(n, words):
abbreviated_words = []
for word in words:
if len(word) > 10:
abbreviation = word[0] + str(len(word) - 2) + word[-1]
abbreviated_words.append(abbreviation)
else:
abbreviated_words.append(word)
for abbreviation in abbreviated_words:
print(abbreviation)
n = int(input())
words = []
for _ in range(n):
word = input()
words.append(word)
abbreviate_words(n, words)
```
| 3.977
|
791
|
A
|
Bear and Big Brother
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Bear Limak wants to become the largest of bears, or at least to become larger than his brother Bob.
Right now, Limak and Bob weigh *a* and *b* respectively. It's guaranteed that Limak's weight is smaller than or equal to his brother's weight.
Limak eats a lot and his weight is tripled after every year, while Bob's weight is doubled after every year.
After how many full years will Limak become strictly larger (strictly heavier) than Bob?
|
The only line of the input contains two integers *a* and *b* (1<=≤<=*a*<=≤<=*b*<=≤<=10) — the weight of Limak and the weight of Bob respectively.
|
Print one integer, denoting the integer number of years after which Limak will become strictly larger than Bob.
|
[
"4 7\n",
"4 9\n",
"1 1\n"
] |
[
"2\n",
"3\n",
"1\n"
] |
In the first sample, Limak weighs 4 and Bob weighs 7 initially. After one year their weights are 4·3 = 12 and 7·2 = 14 respectively (one weight is tripled while the other one is doubled). Limak isn't larger than Bob yet. After the second year weights are 36 and 28, so the first weight is greater than the second one. Limak became larger than Bob after two years so you should print 2.
In the second sample, Limak's and Bob's weights in next years are: 12 and 18, then 36 and 36, and finally 108 and 72 (after three years). The answer is 3. Remember that Limak wants to be larger than Bob and he won't be satisfied with equal weights.
In the third sample, Limak becomes larger than Bob after the first year. Their weights will be 3 and 2 then.
| 500
|
[
{
"input": "4 7",
"output": "2"
},
{
"input": "4 9",
"output": "3"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "4 6",
"output": "2"
},
{
"input": "1 10",
"output": "6"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1 2",
"output": "2"
},
{
"input": "1 3",
"output": "3"
},
{
"input": "1 4",
"output": "4"
},
{
"input": "1 5",
"output": "4"
},
{
"input": "1 6",
"output": "5"
},
{
"input": "1 7",
"output": "5"
},
{
"input": "1 8",
"output": "6"
},
{
"input": "1 9",
"output": "6"
},
{
"input": "1 10",
"output": "6"
},
{
"input": "2 2",
"output": "1"
},
{
"input": "2 3",
"output": "2"
},
{
"input": "2 4",
"output": "2"
},
{
"input": "2 5",
"output": "3"
},
{
"input": "2 6",
"output": "3"
},
{
"input": "2 7",
"output": "4"
},
{
"input": "2 8",
"output": "4"
},
{
"input": "2 9",
"output": "4"
},
{
"input": "2 10",
"output": "4"
},
{
"input": "3 3",
"output": "1"
},
{
"input": "3 4",
"output": "1"
},
{
"input": "3 5",
"output": "2"
},
{
"input": "3 6",
"output": "2"
},
{
"input": "3 7",
"output": "3"
},
{
"input": "3 8",
"output": "3"
},
{
"input": "3 9",
"output": "3"
},
{
"input": "3 10",
"output": "3"
},
{
"input": "4 4",
"output": "1"
},
{
"input": "4 5",
"output": "1"
},
{
"input": "4 6",
"output": "2"
},
{
"input": "4 7",
"output": "2"
},
{
"input": "4 8",
"output": "2"
},
{
"input": "4 9",
"output": "3"
},
{
"input": "4 10",
"output": "3"
},
{
"input": "5 5",
"output": "1"
},
{
"input": "5 6",
"output": "1"
},
{
"input": "5 7",
"output": "1"
},
{
"input": "5 8",
"output": "2"
},
{
"input": "5 9",
"output": "2"
},
{
"input": "5 10",
"output": "2"
},
{
"input": "6 6",
"output": "1"
},
{
"input": "6 7",
"output": "1"
},
{
"input": "6 8",
"output": "1"
},
{
"input": "6 9",
"output": "2"
},
{
"input": "6 10",
"output": "2"
},
{
"input": "7 7",
"output": "1"
},
{
"input": "7 8",
"output": "1"
},
{
"input": "7 9",
"output": "1"
},
{
"input": "7 10",
"output": "1"
},
{
"input": "8 8",
"output": "1"
},
{
"input": "8 9",
"output": "1"
},
{
"input": "8 10",
"output": "1"
},
{
"input": "9 9",
"output": "1"
},
{
"input": "9 10",
"output": "1"
},
{
"input": "10 10",
"output": "1"
},
{
"input": "10 10",
"output": "1"
},
{
"input": "1 2",
"output": "2"
}
] | 1,694,696,492
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 62
| 46
| 0
|
Limak, Bob = map(int, input().split())
t = 0
while True:
Limak = Limak*3
Bob = Bob*2
t += 1
if Limak > Bob:
print(t)
break
|
Title: Bear and Big Brother
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bear Limak wants to become the largest of bears, or at least to become larger than his brother Bob.
Right now, Limak and Bob weigh *a* and *b* respectively. It's guaranteed that Limak's weight is smaller than or equal to his brother's weight.
Limak eats a lot and his weight is tripled after every year, while Bob's weight is doubled after every year.
After how many full years will Limak become strictly larger (strictly heavier) than Bob?
Input Specification:
The only line of the input contains two integers *a* and *b* (1<=≤<=*a*<=≤<=*b*<=≤<=10) — the weight of Limak and the weight of Bob respectively.
Output Specification:
Print one integer, denoting the integer number of years after which Limak will become strictly larger than Bob.
Demo Input:
['4 7\n', '4 9\n', '1 1\n']
Demo Output:
['2\n', '3\n', '1\n']
Note:
In the first sample, Limak weighs 4 and Bob weighs 7 initially. After one year their weights are 4·3 = 12 and 7·2 = 14 respectively (one weight is tripled while the other one is doubled). Limak isn't larger than Bob yet. After the second year weights are 36 and 28, so the first weight is greater than the second one. Limak became larger than Bob after two years so you should print 2.
In the second sample, Limak's and Bob's weights in next years are: 12 and 18, then 36 and 36, and finally 108 and 72 (after three years). The answer is 3. Remember that Limak wants to be larger than Bob and he won't be satisfied with equal weights.
In the third sample, Limak becomes larger than Bob after the first year. Their weights will be 3 and 2 then.
|
```python
Limak, Bob = map(int, input().split())
t = 0
while True:
Limak = Limak*3
Bob = Bob*2
t += 1
if Limak > Bob:
print(t)
break
```
| 3
|
|
545
|
C
|
Woodcutters
|
PROGRAMMING
| 1,500
|
[
"dp",
"greedy"
] | null | null |
Little Susie listens to fairy tales before bed every day. Today's fairy tale was about wood cutters and the little girl immediately started imagining the choppers cutting wood. She imagined the situation that is described below.
There are *n* trees located along the road at points with coordinates *x*1,<=*x*2,<=...,<=*x**n*. Each tree has its height *h**i*. Woodcutters can cut down a tree and fell it to the left or to the right. After that it occupies one of the segments [*x**i*<=-<=*h**i*,<=*x**i*] or [*x**i*;*x**i*<=+<=*h**i*]. The tree that is not cut down occupies a single point with coordinate *x**i*. Woodcutters can fell a tree if the segment to be occupied by the fallen tree doesn't contain any occupied point. The woodcutters want to process as many trees as possible, so Susie wonders, what is the maximum number of trees to fell.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of trees.
Next *n* lines contain pairs of integers *x**i*,<=*h**i* (1<=≤<=*x**i*,<=*h**i*<=≤<=109) — the coordinate and the height of the *і*-th tree.
The pairs are given in the order of ascending *x**i*. No two trees are located at the point with the same coordinate.
|
Print a single number — the maximum number of trees that you can cut down by the given rules.
|
[
"5\n1 2\n2 1\n5 10\n10 9\n19 1\n",
"5\n1 2\n2 1\n5 10\n10 9\n20 1\n"
] |
[
"3\n",
"4\n"
] |
In the first sample you can fell the trees like that:
- fell the 1-st tree to the left — now it occupies segment [ - 1;1] - fell the 2-nd tree to the right — now it occupies segment [2;3] - leave the 3-rd tree — it occupies point 5 - leave the 4-th tree — it occupies point 10 - fell the 5-th tree to the right — now it occupies segment [19;20]
In the second sample you can also fell 4-th tree to the right, after that it will occupy segment [10;19].
| 1,750
|
[
{
"input": "5\n1 2\n2 1\n5 10\n10 9\n19 1",
"output": "3"
},
{
"input": "5\n1 2\n2 1\n5 10\n10 9\n20 1",
"output": "4"
},
{
"input": "4\n10 4\n15 1\n19 3\n20 1",
"output": "4"
},
{
"input": "35\n1 7\n3 11\n6 12\n7 6\n8 5\n9 11\n15 3\n16 10\n22 2\n23 3\n25 7\n27 3\n34 5\n35 10\n37 3\n39 4\n40 5\n41 1\n44 1\n47 7\n48 11\n50 6\n52 5\n57 2\n58 7\n60 4\n62 1\n67 3\n68 12\n69 8\n70 1\n71 5\n72 5\n73 6\n74 4",
"output": "10"
},
{
"input": "40\n1 1\n2 1\n3 1\n4 1\n5 1\n6 1\n7 1\n8 1\n9 1\n10 1\n11 1\n12 1\n13 1\n14 1\n15 1\n16 1\n17 1\n18 1\n19 1\n20 1\n21 1\n22 1\n23 1\n24 1\n25 1\n26 1\n27 1\n28 1\n29 1\n30 1\n31 1\n32 1\n33 1\n34 1\n35 1\n36 1\n37 1\n38 1\n39 1\n40 1",
"output": "2"
},
{
"input": "67\n1 1\n3 8\n4 10\n7 8\n9 2\n10 1\n11 5\n12 8\n13 4\n16 6\n18 3\n19 3\n22 5\n24 6\n27 5\n28 3\n29 3\n30 5\n32 5\n33 10\n34 7\n35 8\n36 5\n41 3\n42 2\n43 5\n46 4\n48 4\n49 9\n52 4\n53 9\n55 1\n56 4\n59 7\n68 7\n69 4\n71 9\n72 10\n74 5\n76 4\n77 9\n80 7\n81 9\n82 5\n83 5\n84 9\n85 7\n86 9\n87 4\n88 7\n89 10\n90 3\n91 5\n92 10\n93 5\n94 8\n95 4\n96 2\n97 10\n98 1\n99 3\n100 1\n101 5\n102 4\n103 8\n104 8\n105 8",
"output": "5"
},
{
"input": "1\n1000000000 1000000000",
"output": "1"
},
{
"input": "10\n7 12\n10 2\n12 2\n15 1\n19 2\n20 1\n53 25\n63 10\n75 12\n87 1",
"output": "9"
},
{
"input": "3\n1 1\n1000 1000\n1000000000 1000000000",
"output": "3"
},
{
"input": "2\n1 999999999\n1000000000 1000000000",
"output": "2"
},
{
"input": "10\n999999900 1000000000\n999999901 1000000000\n999999902 1000000000\n999999903 1000000000\n999999904 1000000000\n999999905 1000000000\n999999906 1000000000\n999999907 1000000000\n999999908 1000000000\n999999909 1000000000",
"output": "2"
},
{
"input": "2\n100000000 1000000000\n1000000000 1000000000",
"output": "2"
}
] | 1,697,873,779
| 2,147,483,647
|
PyPy 3-64
|
MEMORY_LIMIT_EXCEEDED
|
TESTS
| 3
| 1,216
| 268,390,400
|
num=int(input())
t=[]
ocu=set()
for i in range(num):
x,h=map(int,input().split())
t.append([x,h])
ocu.add(x)
ctree=0
for i in t:
lef={i for i in range(i[0]-i[1],i[0])}
if len(lef.intersection(ocu))==0:
ocu.union(lef)
ctree+=1
else:
ri={i for i in range(i[0]+1,i[0]+i[1]+1)}
if len(ri.intersection(ocu))==0:
ocu.union(ri)
ctree+=1
print(ctree)
|
Title: Woodcutters
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Susie listens to fairy tales before bed every day. Today's fairy tale was about wood cutters and the little girl immediately started imagining the choppers cutting wood. She imagined the situation that is described below.
There are *n* trees located along the road at points with coordinates *x*1,<=*x*2,<=...,<=*x**n*. Each tree has its height *h**i*. Woodcutters can cut down a tree and fell it to the left or to the right. After that it occupies one of the segments [*x**i*<=-<=*h**i*,<=*x**i*] or [*x**i*;*x**i*<=+<=*h**i*]. The tree that is not cut down occupies a single point with coordinate *x**i*. Woodcutters can fell a tree if the segment to be occupied by the fallen tree doesn't contain any occupied point. The woodcutters want to process as many trees as possible, so Susie wonders, what is the maximum number of trees to fell.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of trees.
Next *n* lines contain pairs of integers *x**i*,<=*h**i* (1<=≤<=*x**i*,<=*h**i*<=≤<=109) — the coordinate and the height of the *і*-th tree.
The pairs are given in the order of ascending *x**i*. No two trees are located at the point with the same coordinate.
Output Specification:
Print a single number — the maximum number of trees that you can cut down by the given rules.
Demo Input:
['5\n1 2\n2 1\n5 10\n10 9\n19 1\n', '5\n1 2\n2 1\n5 10\n10 9\n20 1\n']
Demo Output:
['3\n', '4\n']
Note:
In the first sample you can fell the trees like that:
- fell the 1-st tree to the left — now it occupies segment [ - 1;1] - fell the 2-nd tree to the right — now it occupies segment [2;3] - leave the 3-rd tree — it occupies point 5 - leave the 4-th tree — it occupies point 10 - fell the 5-th tree to the right — now it occupies segment [19;20]
In the second sample you can also fell 4-th tree to the right, after that it will occupy segment [10;19].
|
```python
num=int(input())
t=[]
ocu=set()
for i in range(num):
x,h=map(int,input().split())
t.append([x,h])
ocu.add(x)
ctree=0
for i in t:
lef={i for i in range(i[0]-i[1],i[0])}
if len(lef.intersection(ocu))==0:
ocu.union(lef)
ctree+=1
else:
ri={i for i in range(i[0]+1,i[0]+i[1]+1)}
if len(ri.intersection(ocu))==0:
ocu.union(ri)
ctree+=1
print(ctree)
```
| 0
|
|
224
|
A
|
Parallelepiped
|
PROGRAMMING
| 1,100
|
[
"brute force",
"geometry",
"math"
] | null | null |
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
|
The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=><=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
|
Print a single number — the sum of all edges of the parallelepiped.
|
[
"1 1 1\n",
"4 6 6\n"
] |
[
"12\n",
"28\n"
] |
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3.
| 500
|
[
{
"input": "1 1 1",
"output": "12"
},
{
"input": "4 6 6",
"output": "28"
},
{
"input": "20 10 50",
"output": "68"
},
{
"input": "9 4 36",
"output": "56"
},
{
"input": "324 9 36",
"output": "184"
},
{
"input": "1333 93 129",
"output": "308"
},
{
"input": "1022 584 112",
"output": "380"
},
{
"input": "66 174 319",
"output": "184"
},
{
"input": "912 276 1748",
"output": "444"
},
{
"input": "65 156 60",
"output": "120"
},
{
"input": "1 10000 10000",
"output": "40008"
},
{
"input": "1485 55 27",
"output": "332"
},
{
"input": "152 108 4104",
"output": "528"
},
{
"input": "1656 6900 1350",
"output": "740"
},
{
"input": "12 14 42",
"output": "60"
},
{
"input": "615 18 1230",
"output": "856"
},
{
"input": "680 60 408",
"output": "336"
},
{
"input": "644 966 6",
"output": "1308"
},
{
"input": "1 432 432",
"output": "1736"
},
{
"input": "2239 2239 1",
"output": "8964"
},
{
"input": "4106 8212 2",
"output": "16436"
},
{
"input": "10000 10000 10000",
"output": "1200"
},
{
"input": "3623 3623 1",
"output": "14500"
},
{
"input": "9801 9801 9801",
"output": "1188"
},
{
"input": "10000 1 10000",
"output": "40008"
},
{
"input": "9 9 9",
"output": "36"
},
{
"input": "9801 9702 9702",
"output": "1184"
}
] | 1,679,419,739
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 27
| 124
| 0
|
import math
ins = [int(x) for x in input().split()]
x = round(math.sqrt(ins[0] * ins[2] // ins[1]))
z = ins[2]//x
y = ins[1]//z
# print(x , y ,z)
print(4*(x + y + z))
|
Title: Parallelepiped
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
Input Specification:
The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=><=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
Output Specification:
Print a single number — the sum of all edges of the parallelepiped.
Demo Input:
['1 1 1\n', '4 6 6\n']
Demo Output:
['12\n', '28\n']
Note:
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3.
|
```python
import math
ins = [int(x) for x in input().split()]
x = round(math.sqrt(ins[0] * ins[2] // ins[1]))
z = ins[2]//x
y = ins[1]//z
# print(x , y ,z)
print(4*(x + y + z))
```
| 3
|
|
445
|
A
|
DZY Loves Chessboard
|
PROGRAMMING
| 1,200
|
[
"dfs and similar",
"implementation"
] | null | null |
DZY loves chessboard, and he enjoys playing with it.
He has a chessboard of *n* rows and *m* columns. Some cells of the chessboard are bad, others are good. For every good cell, DZY wants to put a chessman on it. Each chessman is either white or black. After putting all chessmen, DZY wants that no two chessmen with the same color are on two adjacent cells. Two cells are adjacent if and only if they share a common edge.
You task is to find any suitable placement of chessmen on the given chessboard.
|
The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100).
Each of the next *n* lines contains a string of *m* characters: the *j*-th character of the *i*-th string is either "." or "-". A "." means that the corresponding cell (in the *i*-th row and the *j*-th column) is good, while a "-" means it is bad.
|
Output must contain *n* lines, each line must contain a string of *m* characters. The *j*-th character of the *i*-th string should be either "W", "B" or "-". Character "W" means the chessman on the cell is white, "B" means it is black, "-" means the cell is a bad cell.
If multiple answers exist, print any of them. It is guaranteed that at least one answer exists.
|
[
"1 1\n.\n",
"2 2\n..\n..\n",
"3 3\n.-.\n---\n--."
] |
[
"B\n",
"BW\nWB\n",
"B-B\n---\n--B"
] |
In the first sample, DZY puts a single black chessman. Of course putting a white one is also OK.
In the second sample, all 4 cells are good. No two same chessmen share an edge in the sample output.
In the third sample, no good cells are adjacent. So you can just put 3 chessmen, no matter what their colors are.
| 500
|
[
{
"input": "1 1\n.",
"output": "B"
},
{
"input": "2 2\n..\n..",
"output": "BW\nWB"
},
{
"input": "3 3\n.-.\n---\n--.",
"output": "B-B\n---\n--B"
},
{
"input": "3 1\n-\n.\n.",
"output": "-\nW\nB"
},
{
"input": "11 11\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------",
"output": "-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------"
},
{
"input": "1 1\n-",
"output": "-"
},
{
"input": "4 2\n..\n..\n..\n..",
"output": "BW\nWB\nBW\nWB"
},
{
"input": "5 1\n.\n.\n.\n.\n.",
"output": "B\nW\nB\nW\nB"
}
] | 1,628,207,698
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 37
| 77
| 6,963,200
|
n_m = input().split()
cells_array = []
A=['B','W']
for i in range(int(n_m[0])):
cells = input()
cells_list = list(cells)
cells_array.append(cells_list)
for j in range(len(cells_array)):
for k in range(int(n_m[1])):
if cells_array[j][k] == '.':
cells_array[j][k]=A[(j+k)%2]
for i in range(int(n_m[0])):
print (''.join(cells_array[i]))
|
Title: DZY Loves Chessboard
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
DZY loves chessboard, and he enjoys playing with it.
He has a chessboard of *n* rows and *m* columns. Some cells of the chessboard are bad, others are good. For every good cell, DZY wants to put a chessman on it. Each chessman is either white or black. After putting all chessmen, DZY wants that no two chessmen with the same color are on two adjacent cells. Two cells are adjacent if and only if they share a common edge.
You task is to find any suitable placement of chessmen on the given chessboard.
Input Specification:
The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100).
Each of the next *n* lines contains a string of *m* characters: the *j*-th character of the *i*-th string is either "." or "-". A "." means that the corresponding cell (in the *i*-th row and the *j*-th column) is good, while a "-" means it is bad.
Output Specification:
Output must contain *n* lines, each line must contain a string of *m* characters. The *j*-th character of the *i*-th string should be either "W", "B" or "-". Character "W" means the chessman on the cell is white, "B" means it is black, "-" means the cell is a bad cell.
If multiple answers exist, print any of them. It is guaranteed that at least one answer exists.
Demo Input:
['1 1\n.\n', '2 2\n..\n..\n', '3 3\n.-.\n---\n--.']
Demo Output:
['B\n', 'BW\nWB\n', 'B-B\n---\n--B']
Note:
In the first sample, DZY puts a single black chessman. Of course putting a white one is also OK.
In the second sample, all 4 cells are good. No two same chessmen share an edge in the sample output.
In the third sample, no good cells are adjacent. So you can just put 3 chessmen, no matter what their colors are.
|
```python
n_m = input().split()
cells_array = []
A=['B','W']
for i in range(int(n_m[0])):
cells = input()
cells_list = list(cells)
cells_array.append(cells_list)
for j in range(len(cells_array)):
for k in range(int(n_m[1])):
if cells_array[j][k] == '.':
cells_array[j][k]=A[(j+k)%2]
for i in range(int(n_m[0])):
print (''.join(cells_array[i]))
```
| 3
|
|
812
|
C
|
Sagheer and Nubian Market
|
PROGRAMMING
| 1,500
|
[
"binary search",
"sortings"
] | null | null |
On his trip to Luxor and Aswan, Sagheer went to a Nubian market to buy some souvenirs for his friends and relatives. The market has some strange rules. It contains *n* different items numbered from 1 to *n*. The *i*-th item has base cost *a**i* Egyptian pounds. If Sagheer buys *k* items with indices *x*1,<=*x*2,<=...,<=*x**k*, then the cost of item *x**j* is *a**x**j*<=+<=*x**j*·*k* for 1<=≤<=*j*<=≤<=*k*. In other words, the cost of an item is equal to its base cost in addition to its index multiplied by the factor *k*.
Sagheer wants to buy as many souvenirs as possible without paying more than *S* Egyptian pounds. Note that he cannot buy a souvenir more than once. If there are many ways to maximize the number of souvenirs, he will choose the way that will minimize the total cost. Can you help him with this task?
|
The first line contains two integers *n* and *S* (1<=≤<=*n*<=≤<=105 and 1<=≤<=*S*<=≤<=109) — the number of souvenirs in the market and Sagheer's budget.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105) — the base costs of the souvenirs.
|
On a single line, print two integers *k*, *T* — the maximum number of souvenirs Sagheer can buy and the minimum total cost to buy these *k* souvenirs.
|
[
"3 11\n2 3 5\n",
"4 100\n1 2 5 6\n",
"1 7\n7\n"
] |
[
"2 11\n",
"4 54\n",
"0 0\n"
] |
In the first example, he cannot take the three items because they will cost him [5, 9, 14] with total cost 28. If he decides to take only two items, then the costs will be [4, 7, 11]. So he can afford the first and second items.
In the second example, he can buy all items as they will cost him [5, 10, 17, 22].
In the third example, there is only one souvenir in the market which will cost him 8 pounds, so he cannot buy it.
| 1,500
|
[
{
"input": "3 11\n2 3 5",
"output": "2 11"
},
{
"input": "4 100\n1 2 5 6",
"output": "4 54"
},
{
"input": "1 7\n7",
"output": "0 0"
},
{
"input": "1 7\n5",
"output": "1 6"
},
{
"input": "1 1\n1",
"output": "0 0"
},
{
"input": "4 33\n4 3 2 1",
"output": "3 27"
},
{
"input": "86 96\n89 48 14 55 5 35 7 79 49 70 74 18 64 63 35 93 63 97 90 77 33 11 100 75 60 99 54 38 3 6 55 1 7 64 56 90 21 76 35 16 61 78 38 78 93 21 89 1 58 53 34 77 56 37 46 59 30 5 85 1 52 87 84 99 97 9 15 66 29 60 17 16 59 23 88 93 32 2 98 89 63 42 9 86 70 80",
"output": "3 71"
},
{
"input": "9 2727\n73 41 68 90 51 7 20 48 69",
"output": "9 872"
},
{
"input": "35 792600\n61 11 82 29 3 50 65 60 62 86 83 78 15 82 7 77 38 87 100 12 93 86 96 79 14 58 60 47 94 39 36 23 69 93 18",
"output": "35 24043"
},
{
"input": "63 47677090\n53 4 59 68 6 12 47 63 28 93 9 53 61 63 53 70 77 63 49 76 70 23 4 40 4 34 24 70 42 83 84 95 11 46 38 83 26 85 34 29 67 96 3 62 97 7 42 65 49 45 50 54 81 74 83 59 10 87 95 87 89 27 3",
"output": "63 130272"
},
{
"input": "88 631662736\n93 75 25 7 6 55 92 23 22 32 4 48 61 29 91 79 16 18 18 9 66 9 57 62 3 81 48 16 21 90 93 58 30 8 31 47 44 70 34 85 52 71 58 42 99 53 43 54 96 26 6 13 38 4 13 60 1 48 32 100 52 8 27 99 66 34 98 45 19 50 37 59 31 56 58 70 61 14 100 66 74 85 64 57 92 89 7 92",
"output": "88 348883"
},
{
"input": "12 12\n1232 1848 2048 4694 5121 3735 9968 4687 2040 6033 5839 2507",
"output": "0 0"
},
{
"input": "37 5271\n368 6194 4856 8534 944 4953 2085 5350 788 7772 9786 1321 4310 4453 7078 9912 5799 4066 5471 5079 5161 9773 1300 5474 1202 1353 9499 9694 9020 6332 595 7619 1271 7430 1199 3127 8867",
"output": "5 4252"
},
{
"input": "65 958484\n9597 1867 5346 637 6115 5833 3318 6059 4430 9169 8155 7895 3534 7962 9900 9495 5694 3461 5370 1945 1724 9264 3475 618 3421 551 8359 6889 1843 6716 9216 2356 1592 6265 2945 6496 4947 2840 9057 6141 887 4823 4004 8027 1993 1391 796 7059 5500 4369 4012 4983 6495 8990 3633 5439 421 1129 6970 8796 7826 1200 8741 6555 5037",
"output": "65 468998"
},
{
"input": "90 61394040\n2480 6212 4506 829 8191 797 5336 6722 3178 1007 5849 3061 3588 6684 5983 5452 7654 5321 660 2569 2809 2179 679 4858 6887 2580 6880 6120 4159 5542 4999 8703 2386 8221 7046 1229 1662 4542 7089 3548 4298 1973 1854 2473 5507 241 359 5248 7907 5201 9624 4596 1723 2622 4800 4716 693 961 7402 9004 7994 8048 6590 5866 7502 3304 4331 5218 6906 1016 5342 6644 2205 5823 8525 4839 1914 2651 3940 7751 3489 4178 7234 6640 7602 9765 8559 7819 5827 163",
"output": "90 795634"
},
{
"input": "14 891190480\n1424 3077 9632 6506 4568 9650 5534 1085 6934 9340 2867 367 7075 618",
"output": "14 70147"
},
{
"input": "39 43\n22166 81842 15513 80979 39645 60168 96994 13493 12904 79871 49910 45356 93691 51829 18226 34288 11525 41944 40433 67295 30123 1081 55623 22279 75814 82316 2963 39329 38223 8445 43202 61912 15122 86367 37200 68113 57194 38541 49641",
"output": "0 0"
},
{
"input": "67 8824\n75515 67590 86373 34191 3446 27408 31581 24727 40005 23718 39738 30960 4786 51040 32590 80454 14335 47173 20079 41204 67289 58347 88969 88396 37681 43963 13886 85690 12259 14732 42036 62620 15011 41890 20150 59469 62104 30136 47163 19790 25699 27453 36151 52914 52684 20503 78622 81082 94500 55756 94030 54764 72763 37830 13210 64559 53600 87998 80472 19001 83769 79700 88794 10161 99980 95184 74439",
"output": "2 8268"
},
{
"input": "16 56532535\n84567 85265 99012 62115 58908 10120 27355 90226 17191 35588 43807 6327 89157 71156 16253 22387",
"output": "16 821610"
},
{
"input": "42 818723640\n57019 99450 43192 25131 80678 41786 52490 34454 51620 56132 41773 94622 23949 11597 96944 51420 44164 85727 72959 26622 1838 36302 99335 35572 92734 10651 22293 97601 38634 24066 81870 10904 5825 71968 2377 61198 3104 4191 97851 99920 65295 1385",
"output": "42 2094569"
}
] | 1,591,118,324
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 0
| 109
| 0
|
n,r=map(int,input().split())
l=list(map(int,input().split()))
x,y=0,0
for k in range(1,n+1):
d=[]
for i in range(n):
d.append(l[i]+(i+1)*k)
s=sum(d[:k])
if(s<=r):
x=i+1
y=s
print(x,y)
|
Title: Sagheer and Nubian Market
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
On his trip to Luxor and Aswan, Sagheer went to a Nubian market to buy some souvenirs for his friends and relatives. The market has some strange rules. It contains *n* different items numbered from 1 to *n*. The *i*-th item has base cost *a**i* Egyptian pounds. If Sagheer buys *k* items with indices *x*1,<=*x*2,<=...,<=*x**k*, then the cost of item *x**j* is *a**x**j*<=+<=*x**j*·*k* for 1<=≤<=*j*<=≤<=*k*. In other words, the cost of an item is equal to its base cost in addition to its index multiplied by the factor *k*.
Sagheer wants to buy as many souvenirs as possible without paying more than *S* Egyptian pounds. Note that he cannot buy a souvenir more than once. If there are many ways to maximize the number of souvenirs, he will choose the way that will minimize the total cost. Can you help him with this task?
Input Specification:
The first line contains two integers *n* and *S* (1<=≤<=*n*<=≤<=105 and 1<=≤<=*S*<=≤<=109) — the number of souvenirs in the market and Sagheer's budget.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=105) — the base costs of the souvenirs.
Output Specification:
On a single line, print two integers *k*, *T* — the maximum number of souvenirs Sagheer can buy and the minimum total cost to buy these *k* souvenirs.
Demo Input:
['3 11\n2 3 5\n', '4 100\n1 2 5 6\n', '1 7\n7\n']
Demo Output:
['2 11\n', '4 54\n', '0 0\n']
Note:
In the first example, he cannot take the three items because they will cost him [5, 9, 14] with total cost 28. If he decides to take only two items, then the costs will be [4, 7, 11]. So he can afford the first and second items.
In the second example, he can buy all items as they will cost him [5, 10, 17, 22].
In the third example, there is only one souvenir in the market which will cost him 8 pounds, so he cannot buy it.
|
```python
n,r=map(int,input().split())
l=list(map(int,input().split()))
x,y=0,0
for k in range(1,n+1):
d=[]
for i in range(n):
d.append(l[i]+(i+1)*k)
s=sum(d[:k])
if(s<=r):
x=i+1
y=s
print(x,y)
```
| 0
|
|
214
|
A
|
System of Equations
|
PROGRAMMING
| 800
|
[
"brute force"
] | null | null |
Furik loves math lessons very much, so he doesn't attend them, unlike Rubik. But now Furik wants to get a good mark for math. For that Ms. Ivanova, his math teacher, gave him a new task. Furik solved the task immediately. Can you?
You are given a system of equations:
You should count, how many there are pairs of integers (*a*,<=*b*) (0<=≤<=*a*,<=*b*) which satisfy the system.
|
A single line contains two integers *n*,<=*m* (1<=≤<=*n*,<=*m*<=≤<=1000) — the parameters of the system. The numbers on the line are separated by a space.
|
On a single line print the answer to the problem.
|
[
"9 3\n",
"14 28\n",
"4 20\n"
] |
[
"1\n",
"1\n",
"0\n"
] |
In the first sample the suitable pair is integers (3, 0). In the second sample the suitable pair is integers (3, 5). In the third sample there is no suitable pair.
| 500
|
[
{
"input": "9 3",
"output": "1"
},
{
"input": "14 28",
"output": "1"
},
{
"input": "4 20",
"output": "0"
},
{
"input": "18 198",
"output": "1"
},
{
"input": "22 326",
"output": "1"
},
{
"input": "26 104",
"output": "1"
},
{
"input": "14 10",
"output": "0"
},
{
"input": "8 20",
"output": "0"
},
{
"input": "2 8",
"output": "0"
},
{
"input": "20 11",
"output": "0"
},
{
"input": "57 447",
"output": "1"
},
{
"input": "1 1",
"output": "2"
},
{
"input": "66 296",
"output": "1"
},
{
"input": "75 683",
"output": "1"
},
{
"input": "227 975",
"output": "1"
},
{
"input": "247 499",
"output": "1"
},
{
"input": "266 116",
"output": "1"
},
{
"input": "286 916",
"output": "1"
},
{
"input": "307 341",
"output": "1"
},
{
"input": "451 121",
"output": "1"
},
{
"input": "471 921",
"output": "1"
},
{
"input": "502 346",
"output": "1"
},
{
"input": "535 59",
"output": "1"
},
{
"input": "555 699",
"output": "1"
},
{
"input": "747 351",
"output": "1"
},
{
"input": "790 64",
"output": "1"
},
{
"input": "810 704",
"output": "1"
},
{
"input": "855 225",
"output": "1"
},
{
"input": "902 34",
"output": "1"
},
{
"input": "922 514",
"output": "1"
},
{
"input": "971 131",
"output": "1"
},
{
"input": "991 931",
"output": "1"
},
{
"input": "840 780",
"output": "0"
},
{
"input": "102 595",
"output": "0"
},
{
"input": "139 433",
"output": "0"
},
{
"input": "968 288",
"output": "0"
},
{
"input": "563 354",
"output": "0"
},
{
"input": "994 975",
"output": "0"
},
{
"input": "456 221",
"output": "0"
},
{
"input": "205 210",
"output": "0"
},
{
"input": "1 11",
"output": "0"
},
{
"input": "1000 1000",
"output": "0"
},
{
"input": "3 3",
"output": "0"
},
{
"input": "11 99",
"output": "0"
},
{
"input": "2 2",
"output": "1"
},
{
"input": "11 1",
"output": "0"
},
{
"input": "6 6",
"output": "1"
},
{
"input": "100 452",
"output": "0"
},
{
"input": "420 380",
"output": "0"
},
{
"input": "31 31",
"output": "0"
},
{
"input": "2 6",
"output": "0"
},
{
"input": "112 134",
"output": "0"
},
{
"input": "13 13",
"output": "0"
},
{
"input": "1 571",
"output": "0"
}
] | 1,633,977,455
| 2,147,483,647
|
PyPy 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 216
| 2,150,400
|
n,m=map(int,input().split())
start_time=time.time()
count=0
for b in range(1001):
for a in range(1001):
if (a*a+b==n) and (a+b*b==m):
count=count+1
print(count)
print("--- %s seconds ---" % (time. time() - start_time))
|
Title: System of Equations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Furik loves math lessons very much, so he doesn't attend them, unlike Rubik. But now Furik wants to get a good mark for math. For that Ms. Ivanova, his math teacher, gave him a new task. Furik solved the task immediately. Can you?
You are given a system of equations:
You should count, how many there are pairs of integers (*a*,<=*b*) (0<=≤<=*a*,<=*b*) which satisfy the system.
Input Specification:
A single line contains two integers *n*,<=*m* (1<=≤<=*n*,<=*m*<=≤<=1000) — the parameters of the system. The numbers on the line are separated by a space.
Output Specification:
On a single line print the answer to the problem.
Demo Input:
['9 3\n', '14 28\n', '4 20\n']
Demo Output:
['1\n', '1\n', '0\n']
Note:
In the first sample the suitable pair is integers (3, 0). In the second sample the suitable pair is integers (3, 5). In the third sample there is no suitable pair.
|
```python
n,m=map(int,input().split())
start_time=time.time()
count=0
for b in range(1001):
for a in range(1001):
if (a*a+b==n) and (a+b*b==m):
count=count+1
print(count)
print("--- %s seconds ---" % (time. time() - start_time))
```
| -1
|
|
472
|
A
|
Design Tutorial: Learn from Math
|
PROGRAMMING
| 800
|
[
"math",
"number theory"
] | null | null |
One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that.
For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem.
You are given an integer *n* no less than 12, express it as a sum of two composite numbers.
|
The only line contains an integer *n* (12<=≤<=*n*<=≤<=106).
|
Output two composite integers *x* and *y* (1<=<<=*x*,<=*y*<=<<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them.
|
[
"12\n",
"15\n",
"23\n",
"1000000\n"
] |
[
"4 8\n",
"6 9\n",
"8 15\n",
"500000 500000\n"
] |
In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well.
In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
| 500
|
[
{
"input": "12",
"output": "4 8"
},
{
"input": "15",
"output": "6 9"
},
{
"input": "23",
"output": "8 15"
},
{
"input": "1000000",
"output": "500000 500000"
},
{
"input": "63874",
"output": "4 63870"
},
{
"input": "14568",
"output": "4 14564"
},
{
"input": "192",
"output": "4 188"
},
{
"input": "86",
"output": "4 82"
},
{
"input": "46220",
"output": "4 46216"
},
{
"input": "57114",
"output": "4 57110"
},
{
"input": "869",
"output": "4 865"
},
{
"input": "738457",
"output": "4 738453"
},
{
"input": "58113",
"output": "6 58107"
},
{
"input": "4864",
"output": "4 4860"
},
{
"input": "15",
"output": "6 9"
},
{
"input": "74752",
"output": "4 74748"
},
{
"input": "6073",
"output": "4 6069"
},
{
"input": "1289",
"output": "4 1285"
},
{
"input": "20",
"output": "4 16"
},
{
"input": "58134",
"output": "4 58130"
},
{
"input": "57756",
"output": "4 57752"
},
{
"input": "765",
"output": "6 759"
},
{
"input": "59",
"output": "4 55"
},
{
"input": "991666",
"output": "4 991662"
},
{
"input": "70761",
"output": "4 70757"
},
{
"input": "13",
"output": "4 9"
},
{
"input": "999999",
"output": "4 999995"
},
{
"input": "17",
"output": "8 9"
},
{
"input": "21",
"output": "6 15"
},
{
"input": "19",
"output": "4 15"
},
{
"input": "100007",
"output": "6 100001"
},
{
"input": "999987",
"output": "6 999981"
},
{
"input": "22",
"output": "4 18"
}
] | 1,687,142,028
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 27
| 62
| 0
|
x = int(input())
result = []
def prime(n):
for i in range(2,n):
if n % i == 0:
return False
return True
for i in range(x//2):
x1, x2 = i, x-i
if prime(x1) is False and prime(x2) is False:
result.append(x1)
result.append(x2)
break
for i in result:
print(i, end=" ")
|
Title: Design Tutorial: Learn from Math
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that.
For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem.
You are given an integer *n* no less than 12, express it as a sum of two composite numbers.
Input Specification:
The only line contains an integer *n* (12<=≤<=*n*<=≤<=106).
Output Specification:
Output two composite integers *x* and *y* (1<=<<=*x*,<=*y*<=<<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them.
Demo Input:
['12\n', '15\n', '23\n', '1000000\n']
Demo Output:
['4 8\n', '6 9\n', '8 15\n', '500000 500000\n']
Note:
In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well.
In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
|
```python
x = int(input())
result = []
def prime(n):
for i in range(2,n):
if n % i == 0:
return False
return True
for i in range(x//2):
x1, x2 = i, x-i
if prime(x1) is False and prime(x2) is False:
result.append(x1)
result.append(x2)
break
for i in result:
print(i, end=" ")
```
| 0
|
|
584
|
A
|
Olesya and Rodion
|
PROGRAMMING
| 1,000
|
[
"math"
] | null | null |
Olesya loves numbers consisting of *n* digits, and Rodion only likes numbers that are divisible by *t*. Find some number that satisfies both of them.
Your task is: given the *n* and *t* print an integer strictly larger than zero consisting of *n* digits that is divisible by *t*. If such number doesn't exist, print <=-<=1.
|
The single line contains two numbers, *n* and *t* (1<=≤<=*n*<=≤<=100, 2<=≤<=*t*<=≤<=10) — the length of the number and the number it should be divisible by.
|
Print one such positive number without leading zeroes, — the answer to the problem, or <=-<=1, if such number doesn't exist. If there are multiple possible answers, you are allowed to print any of them.
|
[
"3 2\n"
] |
[
"712"
] |
none
| 500
|
[
{
"input": "3 2",
"output": "222"
},
{
"input": "2 2",
"output": "22"
},
{
"input": "4 3",
"output": "3333"
},
{
"input": "5 3",
"output": "33333"
},
{
"input": "10 7",
"output": "7777777777"
},
{
"input": "2 9",
"output": "99"
},
{
"input": "18 8",
"output": "888888888888888888"
},
{
"input": "1 5",
"output": "5"
},
{
"input": "1 10",
"output": "-1"
},
{
"input": "100 5",
"output": "5555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555"
},
{
"input": "10 2",
"output": "2222222222"
},
{
"input": "18 10",
"output": "111111111111111110"
},
{
"input": "1 9",
"output": "9"
},
{
"input": "7 6",
"output": "6666666"
},
{
"input": "4 4",
"output": "4444"
},
{
"input": "14 7",
"output": "77777777777777"
},
{
"input": "3 8",
"output": "888"
},
{
"input": "1 3",
"output": "3"
},
{
"input": "2 8",
"output": "88"
},
{
"input": "3 8",
"output": "888"
},
{
"input": "4 3",
"output": "3333"
},
{
"input": "5 9",
"output": "99999"
},
{
"input": "4 8",
"output": "8888"
},
{
"input": "3 4",
"output": "444"
},
{
"input": "9 4",
"output": "444444444"
},
{
"input": "8 10",
"output": "11111110"
},
{
"input": "1 6",
"output": "6"
},
{
"input": "20 3",
"output": "33333333333333333333"
},
{
"input": "15 10",
"output": "111111111111110"
},
{
"input": "31 4",
"output": "4444444444444444444444444444444"
},
{
"input": "18 9",
"output": "999999999999999999"
},
{
"input": "72 4",
"output": "444444444444444444444444444444444444444444444444444444444444444444444444"
},
{
"input": "76 8",
"output": "8888888888888888888888888888888888888888888888888888888888888888888888888888"
},
{
"input": "12 5",
"output": "555555555555"
},
{
"input": "54 5",
"output": "555555555555555555555555555555555555555555555555555555"
},
{
"input": "96 10",
"output": "111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "15 9",
"output": "999999999999999"
},
{
"input": "100 2",
"output": "2222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222222"
},
{
"input": "99 3",
"output": "333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333333"
},
{
"input": "98 4",
"output": "44444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444444"
},
{
"input": "97 5",
"output": "5555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555"
},
{
"input": "100 6",
"output": "6666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666666"
},
{
"input": "99 7",
"output": "777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777"
},
{
"input": "98 8",
"output": "88888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888888"
},
{
"input": "97 9",
"output": "9999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999999"
},
{
"input": "100 10",
"output": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "3 10",
"output": "110"
},
{
"input": "2 4",
"output": "44"
},
{
"input": "2 10",
"output": "10"
},
{
"input": "10 10",
"output": "1111111110"
},
{
"input": "4 10",
"output": "1110"
},
{
"input": "25 10",
"output": "1111111111111111111111110"
},
{
"input": "50 10",
"output": "11111111111111111111111111111111111111111111111110"
},
{
"input": "5 10",
"output": "11110"
},
{
"input": "99 10",
"output": "111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "100 10",
"output": "1111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111110"
},
{
"input": "1 2",
"output": "2"
},
{
"input": "20 10",
"output": "11111111111111111110"
},
{
"input": "99 7",
"output": "777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777"
},
{
"input": "89 5",
"output": "55555555555555555555555555555555555555555555555555555555555555555555555555555555555555555"
},
{
"input": "6 10",
"output": "111110"
},
{
"input": "3 8",
"output": "888"
},
{
"input": "1 9",
"output": "9"
},
{
"input": "1 4",
"output": "4"
},
{
"input": "100 7",
"output": "7777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777777"
}
] | 1,681,557,913
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 46
| 0
|
n = int(input())
t = int(input())
a = 10**(n - 1)
b = a // t
print((b + 2) * t)
|
Title: Olesya and Rodion
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Olesya loves numbers consisting of *n* digits, and Rodion only likes numbers that are divisible by *t*. Find some number that satisfies both of them.
Your task is: given the *n* and *t* print an integer strictly larger than zero consisting of *n* digits that is divisible by *t*. If such number doesn't exist, print <=-<=1.
Input Specification:
The single line contains two numbers, *n* and *t* (1<=≤<=*n*<=≤<=100, 2<=≤<=*t*<=≤<=10) — the length of the number and the number it should be divisible by.
Output Specification:
Print one such positive number without leading zeroes, — the answer to the problem, or <=-<=1, if such number doesn't exist. If there are multiple possible answers, you are allowed to print any of them.
Demo Input:
['3 2\n']
Demo Output:
['712']
Note:
none
|
```python
n = int(input())
t = int(input())
a = 10**(n - 1)
b = a // t
print((b + 2) * t)
```
| -1
|
|
770
|
A
|
New Password
|
PROGRAMMING
| 800
|
[
"*special",
"implementation"
] | null | null |
Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help.
Innokentiy decides that new password should satisfy the following conditions:
- the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct.
Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions.
|
The first line contains two positive integers *n* and *k* (2<=≤<=*n*<=≤<=100, 2<=≤<=*k*<=≤<=*min*(*n*,<=26)) — the length of the password and the number of distinct symbols in it.
Pay attention that a desired new password always exists.
|
Print any password which satisfies all conditions given by Innokentiy.
|
[
"4 3\n",
"6 6\n",
"5 2\n"
] |
[
"java\n",
"python\n",
"phphp\n"
] |
In the first test there is one of the appropriate new passwords — java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it.
In the second test there is one of the appropriate new passwords — python, because its length is equal to 6 and it consists of 6 distinct lowercase letters.
In the third test there is one of the appropriate new passwords — phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it.
Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
| 500
|
[
{
"input": "4 3",
"output": "abca"
},
{
"input": "6 6",
"output": "abcdef"
},
{
"input": "5 2",
"output": "ababa"
},
{
"input": "3 2",
"output": "aba"
},
{
"input": "10 2",
"output": "ababababab"
},
{
"input": "26 13",
"output": "abcdefghijklmabcdefghijklm"
},
{
"input": "100 2",
"output": "abababababababababababababababababababababababababababababababababababababababababababababababababab"
},
{
"input": "100 10",
"output": "abcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij"
},
{
"input": "3 3",
"output": "abc"
},
{
"input": "6 3",
"output": "abcabc"
},
{
"input": "10 3",
"output": "abcabcabca"
},
{
"input": "50 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcab"
},
{
"input": "90 2",
"output": "ababababababababababababababababababababababababababababababababababababababababababababab"
},
{
"input": "6 2",
"output": "ababab"
},
{
"input": "99 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabc"
},
{
"input": "4 2",
"output": "abab"
},
{
"input": "100 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca"
},
{
"input": "40 22",
"output": "abcdefghijklmnopqrstuvabcdefghijklmnopqr"
},
{
"input": "13 8",
"output": "abcdefghabcde"
},
{
"input": "16 15",
"output": "abcdefghijklmnoa"
},
{
"input": "17 17",
"output": "abcdefghijklmnopq"
},
{
"input": "19 4",
"output": "abcdabcdabcdabcdabc"
},
{
"input": "100 26",
"output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv"
},
{
"input": "100 25",
"output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxy"
},
{
"input": "26 26",
"output": "abcdefghijklmnopqrstuvwxyz"
},
{
"input": "27 26",
"output": "abcdefghijklmnopqrstuvwxyza"
},
{
"input": "2 2",
"output": "ab"
},
{
"input": "26 25",
"output": "abcdefghijklmnopqrstuvwxya"
},
{
"input": "99 2",
"output": "abababababababababababababababababababababababababababababababababababababababababababababababababa"
},
{
"input": "99 26",
"output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstu"
},
{
"input": "4 4",
"output": "abcd"
},
{
"input": "5 3",
"output": "abcab"
},
{
"input": "5 4",
"output": "abcda"
},
{
"input": "5 5",
"output": "abcde"
},
{
"input": "24 22",
"output": "abcdefghijklmnopqrstuvab"
},
{
"input": "26 14",
"output": "abcdefghijklmnabcdefghijkl"
},
{
"input": "26 15",
"output": "abcdefghijklmnoabcdefghijk"
},
{
"input": "30 12",
"output": "abcdefghijklabcdefghijklabcdef"
},
{
"input": "35 4",
"output": "abcdabcdabcdabcdabcdabcdabcdabcdabc"
},
{
"input": "79 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca"
},
{
"input": "79 14",
"output": "abcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghi"
},
{
"input": "85 13",
"output": "abcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefg"
},
{
"input": "90 25",
"output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmno"
},
{
"input": "90 19",
"output": "abcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmn"
},
{
"input": "26 24",
"output": "abcdefghijklmnopqrstuvwxab"
},
{
"input": "100 17",
"output": "abcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmno"
},
{
"input": "26 2",
"output": "ababababababababababababab"
}
] | 1,609,921,084
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 47
| 109
| 0
|
n, k = [int(x) for x in input().split()]
origk = k
res = ""
while n>0:
k = origk
o = 97
while k>0 and n>0:
res = res+ chr(o)
o+=1
k-=1
n-=1
print(res)
|
Title: New Password
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help.
Innokentiy decides that new password should satisfy the following conditions:
- the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct.
Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions.
Input Specification:
The first line contains two positive integers *n* and *k* (2<=≤<=*n*<=≤<=100, 2<=≤<=*k*<=≤<=*min*(*n*,<=26)) — the length of the password and the number of distinct symbols in it.
Pay attention that a desired new password always exists.
Output Specification:
Print any password which satisfies all conditions given by Innokentiy.
Demo Input:
['4 3\n', '6 6\n', '5 2\n']
Demo Output:
['java\n', 'python\n', 'phphp\n']
Note:
In the first test there is one of the appropriate new passwords — java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it.
In the second test there is one of the appropriate new passwords — python, because its length is equal to 6 and it consists of 6 distinct lowercase letters.
In the third test there is one of the appropriate new passwords — phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it.
Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
|
```python
n, k = [int(x) for x in input().split()]
origk = k
res = ""
while n>0:
k = origk
o = 97
while k>0 and n>0:
res = res+ chr(o)
o+=1
k-=1
n-=1
print(res)
```
| 3
|
|
818
|
D
|
Multicolored Cars
|
PROGRAMMING
| 1,700
|
[
"data structures",
"implementation"
] | null | null |
Alice and Bob got very bored during a long car trip so they decided to play a game. From the window they can see cars of different colors running past them. Cars are going one after another.
The game rules are like this. Firstly Alice chooses some color *A*, then Bob chooses some color *B* (*A*<=≠<=*B*). After each car they update the number of cars of their chosen color that have run past them. Let's define this numbers after *i*-th car *cnt**A*(*i*) and *cnt**B*(*i*).
- If *cnt**A*(*i*)<=><=*cnt**B*(*i*) for every *i* then the winner is Alice. - If *cnt**B*(*i*)<=≥<=*cnt**A*(*i*) for every *i* then the winner is Bob. - Otherwise it's a draw.
Bob knows all the colors of cars that they will encounter and order of their appearance. Alice have already chosen her color *A* and Bob now wants to choose such color *B* that he will win the game (draw is not a win). Help him find this color.
If there are multiple solutions, print any of them. If there is no such color then print -1.
|
The first line contains two integer numbers *n* and *A* (1<=≤<=*n*<=≤<=105,<=1<=≤<=*A*<=≤<=106) – number of cars and the color chosen by Alice.
The second line contains *n* integer numbers *c*1,<=*c*2,<=...,<=*c**n* (1<=≤<=*c**i*<=≤<=106) — colors of the cars that Alice and Bob will encounter in the order of their appearance.
|
Output such color *B* (1<=≤<=*B*<=≤<=106) that if Bob chooses it then he will win the game. If there are multiple solutions, print any of them. If there is no such color then print -1.
It is guaranteed that if there exists any solution then there exists solution with (1<=≤<=*B*<=≤<=106).
|
[
"4 1\n2 1 4 2\n",
"5 2\n2 2 4 5 3\n",
"3 10\n1 2 3\n"
] |
[
"2\n",
"-1\n",
"4\n"
] |
Let's consider availability of colors in the first example:
- *cnt*<sub class="lower-index">2</sub>(*i*) ≥ *cnt*<sub class="lower-index">1</sub>(*i*) for every *i*, and color 2 can be the answer. - *cnt*<sub class="lower-index">4</sub>(2) < *cnt*<sub class="lower-index">1</sub>(2), so color 4 isn't the winning one for Bob. - All the other colors also have *cnt*<sub class="lower-index">*j*</sub>(2) < *cnt*<sub class="lower-index">1</sub>(2), thus they are not available.
In the third example every color is acceptable except for 10.
| 0
|
[
{
"input": "4 1\n2 1 4 2",
"output": "2"
},
{
"input": "5 2\n2 2 4 5 3",
"output": "-1"
},
{
"input": "3 10\n1 2 3",
"output": "4"
},
{
"input": "1 1\n2",
"output": "3"
},
{
"input": "1 2\n2",
"output": "-1"
},
{
"input": "10 6\n8 5 1 6 6 5 10 6 9 8",
"output": "-1"
},
{
"input": "7 2\n1 2 2 1 1 1 1",
"output": "-1"
},
{
"input": "8 2\n1 1 3 2 3 2 3 2",
"output": "3"
},
{
"input": "10 9\n6 4 7 1 8 9 5 9 4 5",
"output": "-1"
},
{
"input": "6 1\n2 3 3 1 1 2",
"output": "3"
},
{
"input": "4 1\n2 1 1 2",
"output": "-1"
},
{
"input": "5 1\n3 2 1 2 1",
"output": "2"
},
{
"input": "5 3\n1 2 3 2 3",
"output": "2"
},
{
"input": "1 1000000\n1",
"output": "2"
},
{
"input": "6 3\n1 2 3 2 3 2",
"output": "2"
},
{
"input": "3 2\n1 2 3",
"output": "1"
},
{
"input": "6 2\n5 3 2 4 4 2",
"output": "-1"
},
{
"input": "6 1\n5 2 1 4 2 1",
"output": "2"
},
{
"input": "6 1\n2 2 2 1 1 1",
"output": "2"
},
{
"input": "5 2\n3 1 1 2 2",
"output": "1"
},
{
"input": "2 2\n1 2",
"output": "1"
},
{
"input": "30 1\n2 2 2 2 2 3 3 3 1 1 1 1 3 3 3 3 3 3 3 3 3 3 3 2 2 2 2 1 1 1",
"output": "2"
},
{
"input": "2 1\n1 2",
"output": "-1"
},
{
"input": "5 3\n1 2 2 3 3",
"output": "2"
},
{
"input": "10 1000000\n1 2 3 4 5 6 7 8 9 10",
"output": "11"
},
{
"input": "6 1\n3 1 2 2 3 1",
"output": "3"
},
{
"input": "5 1\n2 3 3 1 1",
"output": "3"
},
{
"input": "9 1\n2 3 3 1 4 1 3 2 1",
"output": "3"
},
{
"input": "10 9\n8 9 1 1 1 1 1 1 1 9",
"output": "-1"
},
{
"input": "13 2\n3 3 3 2 1 1 1 1 1 2 3 2 2",
"output": "3"
},
{
"input": "5 1\n2 3 1 3 1",
"output": "3"
},
{
"input": "8 7\n6 7 2 2 4 5 4 4",
"output": "6"
},
{
"input": "2 7\n6 7",
"output": "6"
},
{
"input": "3 5\n9 5 7",
"output": "9"
},
{
"input": "6 2\n1 2 1 2 1 2",
"output": "1"
},
{
"input": "6 3\n1000 2 3 2 2 3",
"output": "2"
},
{
"input": "10 5\n1 1 1 1 1 5 5 5 5 5",
"output": "1"
},
{
"input": "4 9\n4 9 9 4",
"output": "-1"
},
{
"input": "4 1\n2 1 3 3",
"output": "2"
},
{
"input": "19 3\n1 2 3 1 2 3 1 2 3 5 5 5 5 5 5 5 5 2 3",
"output": "2"
},
{
"input": "15 1\n2 5 5 1 2 1 5 2 1 5 2 1 5 1 5",
"output": "5"
},
{
"input": "14 1\n2 5 5 1 2 1 5 2 1 5 2 1 5 1",
"output": "5"
},
{
"input": "8 5\n1 2 5 1 2 5 2 5",
"output": "2"
},
{
"input": "5 1000000\n1 2 1000000 2 1",
"output": "1"
},
{
"input": "8 2\n1 2 1 3 2 3 3 3",
"output": "1"
},
{
"input": "9 10\n4 9 7 3 3 3 10 3 10",
"output": "3"
},
{
"input": "6 2\n5 3 9 2 10 1",
"output": "3"
},
{
"input": "10 4\n7 5 4 4 1 5 7 9 10 6",
"output": "-1"
},
{
"input": "2 1\n9 1",
"output": "9"
},
{
"input": "3 7\n5 7 1",
"output": "5"
},
{
"input": "6 3\n1 3 5 4 2 3",
"output": "-1"
},
{
"input": "7 1\n7 3 1 4 5 8 5",
"output": "3"
},
{
"input": "2 3\n6 3",
"output": "6"
},
{
"input": "10 8\n2 8 8 9 6 9 1 3 2 4",
"output": "-1"
},
{
"input": "6 1\n1 7 8 4 8 6",
"output": "-1"
}
] | 1,526,071,931
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 6
| 77
| 7,065,600
|
aracSayisi,aliceRenk=map(int,input().split())
araclar=list(map(int,input().split()))
renk_tekrar={}
CB=-1
CA=0;
for i in range(aracSayisi):
if(araclar[i]==aliceRenk):
CA+=1
elif(araclar[i] in renk_tekrar):
renk_tekrar[araclar[i]]+=1
else:
renk_tekrar[araclar[i]]=1
liste_renk=list(renk_tekrar.keys())
liste_tekrar=list(renk_tekrar.values())
for index,deger in enumerate(liste_tekrar,0):
if(deger)>=CA:
CB=liste_renk[index]
break
print(CB)
|
Title: Multicolored Cars
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Alice and Bob got very bored during a long car trip so they decided to play a game. From the window they can see cars of different colors running past them. Cars are going one after another.
The game rules are like this. Firstly Alice chooses some color *A*, then Bob chooses some color *B* (*A*<=≠<=*B*). After each car they update the number of cars of their chosen color that have run past them. Let's define this numbers after *i*-th car *cnt**A*(*i*) and *cnt**B*(*i*).
- If *cnt**A*(*i*)<=><=*cnt**B*(*i*) for every *i* then the winner is Alice. - If *cnt**B*(*i*)<=≥<=*cnt**A*(*i*) for every *i* then the winner is Bob. - Otherwise it's a draw.
Bob knows all the colors of cars that they will encounter and order of their appearance. Alice have already chosen her color *A* and Bob now wants to choose such color *B* that he will win the game (draw is not a win). Help him find this color.
If there are multiple solutions, print any of them. If there is no such color then print -1.
Input Specification:
The first line contains two integer numbers *n* and *A* (1<=≤<=*n*<=≤<=105,<=1<=≤<=*A*<=≤<=106) – number of cars and the color chosen by Alice.
The second line contains *n* integer numbers *c*1,<=*c*2,<=...,<=*c**n* (1<=≤<=*c**i*<=≤<=106) — colors of the cars that Alice and Bob will encounter in the order of their appearance.
Output Specification:
Output such color *B* (1<=≤<=*B*<=≤<=106) that if Bob chooses it then he will win the game. If there are multiple solutions, print any of them. If there is no such color then print -1.
It is guaranteed that if there exists any solution then there exists solution with (1<=≤<=*B*<=≤<=106).
Demo Input:
['4 1\n2 1 4 2\n', '5 2\n2 2 4 5 3\n', '3 10\n1 2 3\n']
Demo Output:
['2\n', '-1\n', '4\n']
Note:
Let's consider availability of colors in the first example:
- *cnt*<sub class="lower-index">2</sub>(*i*) ≥ *cnt*<sub class="lower-index">1</sub>(*i*) for every *i*, and color 2 can be the answer. - *cnt*<sub class="lower-index">4</sub>(2) < *cnt*<sub class="lower-index">1</sub>(2), so color 4 isn't the winning one for Bob. - All the other colors also have *cnt*<sub class="lower-index">*j*</sub>(2) < *cnt*<sub class="lower-index">1</sub>(2), thus they are not available.
In the third example every color is acceptable except for 10.
|
```python
aracSayisi,aliceRenk=map(int,input().split())
araclar=list(map(int,input().split()))
renk_tekrar={}
CB=-1
CA=0;
for i in range(aracSayisi):
if(araclar[i]==aliceRenk):
CA+=1
elif(araclar[i] in renk_tekrar):
renk_tekrar[araclar[i]]+=1
else:
renk_tekrar[araclar[i]]=1
liste_renk=list(renk_tekrar.keys())
liste_tekrar=list(renk_tekrar.values())
for index,deger in enumerate(liste_tekrar,0):
if(deger)>=CA:
CB=liste_renk[index]
break
print(CB)
```
| 0
|
|
344
|
A
|
Magnets
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Mad scientist Mike entertains himself by arranging rows of dominoes. He doesn't need dominoes, though: he uses rectangular magnets instead. Each magnet has two poles, positive (a "plus") and negative (a "minus"). If two magnets are put together at a close distance, then the like poles will repel each other and the opposite poles will attract each other.
Mike starts by laying one magnet horizontally on the table. During each following step Mike adds one more magnet horizontally to the right end of the row. Depending on how Mike puts the magnet on the table, it is either attracted to the previous one (forming a group of multiple magnets linked together) or repelled by it (then Mike lays this magnet at some distance to the right from the previous one). We assume that a sole magnet not linked to others forms a group of its own.
Mike arranged multiple magnets in a row. Determine the number of groups that the magnets formed.
|
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100000) — the number of magnets. Then *n* lines follow. The *i*-th line (1<=≤<=*i*<=≤<=*n*) contains either characters "01", if Mike put the *i*-th magnet in the "plus-minus" position, or characters "10", if Mike put the magnet in the "minus-plus" position.
|
On the single line of the output print the number of groups of magnets.
|
[
"6\n10\n10\n10\n01\n10\n10\n",
"4\n01\n01\n10\n10\n"
] |
[
"3\n",
"2\n"
] |
The first testcase corresponds to the figure. The testcase has three groups consisting of three, one and two magnets.
The second testcase has two groups, each consisting of two magnets.
| 500
|
[
{
"input": "6\n10\n10\n10\n01\n10\n10",
"output": "3"
},
{
"input": "4\n01\n01\n10\n10",
"output": "2"
},
{
"input": "1\n10",
"output": "1"
},
{
"input": "2\n01\n10",
"output": "2"
},
{
"input": "2\n10\n10",
"output": "1"
},
{
"input": "3\n10\n01\n10",
"output": "3"
},
{
"input": "1\n01",
"output": "1"
},
{
"input": "2\n01\n01",
"output": "1"
},
{
"input": "2\n10\n01",
"output": "2"
},
{
"input": "3\n01\n01\n01",
"output": "1"
},
{
"input": "3\n10\n10\n01",
"output": "2"
},
{
"input": "3\n01\n10\n10",
"output": "2"
},
{
"input": "115\n10\n10\n10\n10\n01\n01\n10\n10\n10\n01\n01\n10\n01\n01\n10\n10\n10\n01\n10\n01\n10\n10\n01\n01\n10\n10\n10\n10\n01\n10\n01\n01\n10\n10\n10\n10\n01\n10\n10\n10\n01\n10\n01\n10\n10\n10\n10\n01\n01\n01\n10\n10\n01\n01\n01\n10\n10\n01\n10\n01\n01\n01\n01\n10\n10\n01\n10\n01\n01\n01\n01\n01\n10\n01\n10\n10\n01\n01\n01\n10\n01\n01\n10\n10\n01\n01\n01\n01\n01\n10\n01\n10\n01\n10\n01\n01\n01\n10\n01\n10\n10\n01\n10\n10\n01\n01\n01\n10\n10\n10\n10\n10\n10\n10\n10",
"output": "55"
}
] | 1,699,457,423
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 92
| 0
|
n = int(input())
l = []
for i in range(n):
l.append(int(input()))
group = 0
maxm = 0
for i in range(len(l)-1):
if l[i] == l[i+1]:
group += 1
maxm = max(group, maxm)
print(maxm)
|
Title: Magnets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mad scientist Mike entertains himself by arranging rows of dominoes. He doesn't need dominoes, though: he uses rectangular magnets instead. Each magnet has two poles, positive (a "plus") and negative (a "minus"). If two magnets are put together at a close distance, then the like poles will repel each other and the opposite poles will attract each other.
Mike starts by laying one magnet horizontally on the table. During each following step Mike adds one more magnet horizontally to the right end of the row. Depending on how Mike puts the magnet on the table, it is either attracted to the previous one (forming a group of multiple magnets linked together) or repelled by it (then Mike lays this magnet at some distance to the right from the previous one). We assume that a sole magnet not linked to others forms a group of its own.
Mike arranged multiple magnets in a row. Determine the number of groups that the magnets formed.
Input Specification:
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100000) — the number of magnets. Then *n* lines follow. The *i*-th line (1<=≤<=*i*<=≤<=*n*) contains either characters "01", if Mike put the *i*-th magnet in the "plus-minus" position, or characters "10", if Mike put the magnet in the "minus-plus" position.
Output Specification:
On the single line of the output print the number of groups of magnets.
Demo Input:
['6\n10\n10\n10\n01\n10\n10\n', '4\n01\n01\n10\n10\n']
Demo Output:
['3\n', '2\n']
Note:
The first testcase corresponds to the figure. The testcase has three groups consisting of three, one and two magnets.
The second testcase has two groups, each consisting of two magnets.
|
```python
n = int(input())
l = []
for i in range(n):
l.append(int(input()))
group = 0
maxm = 0
for i in range(len(l)-1):
if l[i] == l[i+1]:
group += 1
maxm = max(group, maxm)
print(maxm)
```
| 0
|
|
178
|
A2
|
Educational Game
|
PROGRAMMING
| 1,000
|
[
"greedy"
] | null | null |
The Smart Beaver from ABBYY began to develop a new educational game for children. The rules of the game are fairly simple and are described below.
The playing field is a sequence of *n* non-negative integers *a**i* numbered from 1 to *n*. The goal of the game is to make numbers *a*1,<=*a*2,<=...,<=*a**k* (i.e. some prefix of the sequence) equal to zero for some fixed *k* (*k*<=<<=*n*), and this should be done in the smallest possible number of moves.
One move is choosing an integer *i* (1<=≤<=*i*<=≤<=*n*) such that *a**i*<=><=0 and an integer *t* (*t*<=≥<=0) such that *i*<=+<=2*t*<=≤<=*n*. After the values of *i* and *t* have been selected, the value of *a**i* is decreased by 1, and the value of *a**i*<=+<=2*t* is increased by 1. For example, let *n*<==<=4 and *a*<==<=(1,<=0,<=1,<=2), then it is possible to make move *i*<==<=3, *t*<==<=0 and get *a*<==<=(1,<=0,<=0,<=3) or to make move *i*<==<=1, *t*<==<=1 and get *a*<==<=(0,<=0,<=2,<=2) (the only possible other move is *i*<==<=1, *t*<==<=0).
You are given *n* and the initial sequence *a**i*. The task is to calculate the minimum number of moves needed to make the first *k* elements of the original sequence equal to zero for each possible *k* (1<=≤<=*k*<=<<=*n*).
|
The first input line contains a single integer *n*. The second line contains *n* integers *a**i* (0<=≤<=*a**i*<=≤<=104), separated by single spaces.
The input limitations for getting 20 points are:
- 1<=≤<=*n*<=≤<=300
The input limitations for getting 50 points are:
- 1<=≤<=*n*<=≤<=2000
The input limitations for getting 100 points are:
- 1<=≤<=*n*<=≤<=105
|
Print exactly *n*<=-<=1 lines: the *k*-th output line must contain the minimum number of moves needed to make the first *k* elements of the original sequence *a**i* equal to zero.
Please do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams, or the %I64d specifier.
|
[
"4\n1 0 1 2\n",
"8\n1 2 3 4 5 6 7 8\n"
] |
[
"1\n1\n3\n",
"1\n3\n6\n10\n16\n24\n40\n"
] |
none
| 30
|
[
{
"input": "4\n1 0 1 2",
"output": "1\n1\n3"
},
{
"input": "8\n1 2 3 4 5 6 7 8",
"output": "1\n3\n6\n10\n16\n24\n40"
},
{
"input": "5\n4 1 4 7 6",
"output": "4\n5\n9\n17"
},
{
"input": "9\n13 13 7 11 3 9 3 5 5",
"output": "13\n26\n33\n44\n47\n69\n79\n117"
},
{
"input": "30\n8 17 20 15 18 15 20 10 5 13 5 4 15 9 11 14 18 15 7 16 18 9 17 7 10 9 5 13 17 16",
"output": "8\n25\n45\n60\n78\n93\n113\n123\n128\n141\n146\n150\n165\n174\n185\n199\n225\n257\n284\n315\n351\n375\n423\n454\n495\n549\n634\n713\n907"
},
{
"input": "80\n72 66 82 46 44 22 63 92 71 65 5 30 45 84 29 73 9 90 25 19 26 15 12 29 33 19 85 92 91 66 83 39 100 53 20 99 11 81 26 41 36 51 21 72 28 100 34 3 24 58 11 85 73 18 4 45 90 99 42 85 26 71 58 49 76 32 88 13 40 98 57 95 20 36 70 66 75 12 54 96",
"output": "72\n138\n220\n266\n310\n332\n395\n487\n558\n623\n628\n658\n703\n787\n816\n889\n898\n988\n1013\n1032\n1058\n1073\n1085\n1114\n1147\n1166\n1251\n1343\n1434\n1500\n1583\n1622\n1722\n1775\n1795\n1894\n1905\n1986\n2012\n2053\n2089\n2140\n2161\n2233\n2261\n2361\n2395\n2398\n2431\n2579\n2615\n2719\n2818\n2851\n2867\n2941\n3064\n3182\n3309\n3486\n3603\n3740\n3881\n3969\n4250\n4549\n4775\n5037\n5231\n5465\n5627\n5929\n6460\n7029\n7478\n8085\n9075\n10211\n12070"
},
{
"input": "120\n242 524 420 973 816 432 247 666 134 849 145 366 608 930 613 315 863 628 97 109 65 704 741 314 736 17 872 971 559 648 223 771 171 327 782 837 303 393 292 339 730 834 794 868 540 251 789 893 23 305 116 220 699 863 580 992 861 393 98 253 544 171 336 207 348 496 316 285 286 727 613 616 304 811 592 916 91 554 962 950 475 473 806 510 986 254 290 351 143 710 573 949 256 216 235 246 533 177 12 764 543 689 490 386 849 694 386 693 134 416 293 589 171 76 527 324 782 661 943 134",
"output": "242\n766\n1186\n2159\n2975\n3407\n3654\n4320\n4454\n5303\n5448\n5814\n6422\n7352\n7965\n8280\n9143\n9771\n9868\n9977\n10042\n10746\n11487\n11801\n12537\n12554\n13426\n14397\n14956\n15604\n15827\n16598\n16769\n17096\n17878\n18715\n19018\n19411\n19703\n20042\n20772\n21606\n22400\n23268\n23808\n24059\n24848\n25741\n25764\n26069\n26185\n26405\n27104\n27967\n28547\n29539\n30400\n30793\n30891\n31144\n31688\n31859\n32195\n32402\n32992\n34012\n34748\n36006\n37108\n38267\n39127\n40409\n40847\n42507\n43244\n44526\n4..."
}
] | 1,673,509,952
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS2
| 0
| 60
| 0
|
n = int(input())
lst = []
for i in range(n - 1):
x = [*map(int, input().split())]
for j in x:
lst.append(j)
Sum = 0
for k in range(1, n + 1):
if lst.count(k) == 1:
Sum += 1
print(Sum)
|
Title: Educational Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Smart Beaver from ABBYY began to develop a new educational game for children. The rules of the game are fairly simple and are described below.
The playing field is a sequence of *n* non-negative integers *a**i* numbered from 1 to *n*. The goal of the game is to make numbers *a*1,<=*a*2,<=...,<=*a**k* (i.e. some prefix of the sequence) equal to zero for some fixed *k* (*k*<=<<=*n*), and this should be done in the smallest possible number of moves.
One move is choosing an integer *i* (1<=≤<=*i*<=≤<=*n*) such that *a**i*<=><=0 and an integer *t* (*t*<=≥<=0) such that *i*<=+<=2*t*<=≤<=*n*. After the values of *i* and *t* have been selected, the value of *a**i* is decreased by 1, and the value of *a**i*<=+<=2*t* is increased by 1. For example, let *n*<==<=4 and *a*<==<=(1,<=0,<=1,<=2), then it is possible to make move *i*<==<=3, *t*<==<=0 and get *a*<==<=(1,<=0,<=0,<=3) or to make move *i*<==<=1, *t*<==<=1 and get *a*<==<=(0,<=0,<=2,<=2) (the only possible other move is *i*<==<=1, *t*<==<=0).
You are given *n* and the initial sequence *a**i*. The task is to calculate the minimum number of moves needed to make the first *k* elements of the original sequence equal to zero for each possible *k* (1<=≤<=*k*<=<<=*n*).
Input Specification:
The first input line contains a single integer *n*. The second line contains *n* integers *a**i* (0<=≤<=*a**i*<=≤<=104), separated by single spaces.
The input limitations for getting 20 points are:
- 1<=≤<=*n*<=≤<=300
The input limitations for getting 50 points are:
- 1<=≤<=*n*<=≤<=2000
The input limitations for getting 100 points are:
- 1<=≤<=*n*<=≤<=105
Output Specification:
Print exactly *n*<=-<=1 lines: the *k*-th output line must contain the minimum number of moves needed to make the first *k* elements of the original sequence *a**i* equal to zero.
Please do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams, or the %I64d specifier.
Demo Input:
['4\n1 0 1 2\n', '8\n1 2 3 4 5 6 7 8\n']
Demo Output:
['1\n1\n3\n', '1\n3\n6\n10\n16\n24\n40\n']
Note:
none
|
```python
n = int(input())
lst = []
for i in range(n - 1):
x = [*map(int, input().split())]
for j in x:
lst.append(j)
Sum = 0
for k in range(1, n + 1):
if lst.count(k) == 1:
Sum += 1
print(Sum)
```
| -1
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
Watchmen are in a danger and Doctor Manhattan together with his friend Daniel Dreiberg should warn them as soon as possible. There are *n* watchmen on a plane, the *i*-th watchman is located at point (*x**i*,<=*y**i*).
They need to arrange a plan, but there are some difficulties on their way. As you know, Doctor Manhattan considers the distance between watchmen *i* and *j* to be |*x**i*<=-<=*x**j*|<=+<=|*y**i*<=-<=*y**j*|. Daniel, as an ordinary person, calculates the distance using the formula .
The success of the operation relies on the number of pairs (*i*,<=*j*) (1<=≤<=*i*<=<<=*j*<=≤<=*n*), such that the distance between watchman *i* and watchmen *j* calculated by Doctor Manhattan is equal to the distance between them calculated by Daniel. You were asked to compute the number of such pairs.
|
The first line of the input contains the single integer *n* (1<=≤<=*n*<=≤<=200<=000) — the number of watchmen.
Each of the following *n* lines contains two integers *x**i* and *y**i* (|*x**i*|,<=|*y**i*|<=≤<=109).
Some positions may coincide.
|
Print the number of pairs of watchmen such that the distance between them calculated by Doctor Manhattan is equal to the distance calculated by Daniel.
|
[
"3\n1 1\n7 5\n1 5\n",
"6\n0 0\n0 1\n0 2\n-1 1\n0 1\n1 1\n"
] |
[
"2\n",
"11\n"
] |
In the first sample, the distance between watchman 1 and watchman 2 is equal to |1 - 7| + |1 - 5| = 10 for Doctor Manhattan and <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/bcb5b7064b5f02088da0fdcf677e6fda495dd0df.png" style="max-width: 100.0%;max-height: 100.0%;"/> for Daniel. For pairs (1, 1), (1, 5) and (7, 5), (1, 5) Doctor Manhattan and Daniel will calculate the same distances.
| 0
|
[
{
"input": "3\n1 1\n7 5\n1 5",
"output": "2"
},
{
"input": "6\n0 0\n0 1\n0 2\n-1 1\n0 1\n1 1",
"output": "11"
},
{
"input": "10\n46 -55\n46 45\n46 45\n83 -55\n46 45\n83 -55\n46 45\n83 45\n83 45\n46 -55",
"output": "33"
},
{
"input": "1\n-5 -90",
"output": "0"
},
{
"input": "2\n315 845\n-669 -762",
"output": "0"
},
{
"input": "3\n8911 7861\n-6888 7861\n8911 7861",
"output": "3"
},
{
"input": "2\n-1 1000000000\n0 -1",
"output": "0"
},
{
"input": "2\n1000000000 0\n-7 1",
"output": "0"
},
{
"input": "2\n1 4\n2 1",
"output": "0"
},
{
"input": "2\n1 0\n0 2333333",
"output": "0"
},
{
"input": "2\n2 1\n1 2",
"output": "0"
},
{
"input": "2\n1 1000000000\n2 -1000000000",
"output": "0"
},
{
"input": "2\n0 1000000000\n1 -7",
"output": "0"
},
{
"input": "2\n1 0\n0 19990213",
"output": "0"
}
] | 1,593,353,652
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 2
| 155
| 20,480,000
|
from collections import Counter
n=int(input())
l=[0]*n
lx=[0]*n
ly=[0]*n
for i in range(n):
a,b=map(int,input().split())
l[i]=[a,b]
lx[i]=a
ly[i]=b
x=len(l)
res=list(set(tuple(e) for e in l))
y=len(res)
cx=Counter(lx)
cy=Counter(ly)
#print(cx,cy)
c=0
for e in cx:
if(cx[e]>1):
n=cx[e]
c=c+((n*(n-1))//2)
for e in cy:
if(cy[e]>1):
n=cy[e]
c=c+((n*(n-1))//2)
v=x-y
print(c-v)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Watchmen are in a danger and Doctor Manhattan together with his friend Daniel Dreiberg should warn them as soon as possible. There are *n* watchmen on a plane, the *i*-th watchman is located at point (*x**i*,<=*y**i*).
They need to arrange a plan, but there are some difficulties on their way. As you know, Doctor Manhattan considers the distance between watchmen *i* and *j* to be |*x**i*<=-<=*x**j*|<=+<=|*y**i*<=-<=*y**j*|. Daniel, as an ordinary person, calculates the distance using the formula .
The success of the operation relies on the number of pairs (*i*,<=*j*) (1<=≤<=*i*<=<<=*j*<=≤<=*n*), such that the distance between watchman *i* and watchmen *j* calculated by Doctor Manhattan is equal to the distance between them calculated by Daniel. You were asked to compute the number of such pairs.
Input Specification:
The first line of the input contains the single integer *n* (1<=≤<=*n*<=≤<=200<=000) — the number of watchmen.
Each of the following *n* lines contains two integers *x**i* and *y**i* (|*x**i*|,<=|*y**i*|<=≤<=109).
Some positions may coincide.
Output Specification:
Print the number of pairs of watchmen such that the distance between them calculated by Doctor Manhattan is equal to the distance calculated by Daniel.
Demo Input:
['3\n1 1\n7 5\n1 5\n', '6\n0 0\n0 1\n0 2\n-1 1\n0 1\n1 1\n']
Demo Output:
['2\n', '11\n']
Note:
In the first sample, the distance between watchman 1 and watchman 2 is equal to |1 - 7| + |1 - 5| = 10 for Doctor Manhattan and <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/bcb5b7064b5f02088da0fdcf677e6fda495dd0df.png" style="max-width: 100.0%;max-height: 100.0%;"/> for Daniel. For pairs (1, 1), (1, 5) and (7, 5), (1, 5) Doctor Manhattan and Daniel will calculate the same distances.
|
```python
from collections import Counter
n=int(input())
l=[0]*n
lx=[0]*n
ly=[0]*n
for i in range(n):
a,b=map(int,input().split())
l[i]=[a,b]
lx[i]=a
ly[i]=b
x=len(l)
res=list(set(tuple(e) for e in l))
y=len(res)
cx=Counter(lx)
cy=Counter(ly)
#print(cx,cy)
c=0
for e in cx:
if(cx[e]>1):
n=cx[e]
c=c+((n*(n-1))//2)
for e in cy:
if(cy[e]>1):
n=cy[e]
c=c+((n*(n-1))//2)
v=x-y
print(c-v)
```
| 0
|
|
987
|
A
|
Infinity Gauntlet
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems:
- the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color.
Using colors of Gems you saw in the Gauntlet determine the names of absent Gems.
|
In the first line of input there is one integer $n$ ($0 \le n \le 6$) — the number of Gems in Infinity Gauntlet.
In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters.
|
In the first line output one integer $m$ ($0 \le m \le 6$) — the number of absent Gems.
Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase.
|
[
"4\nred\npurple\nyellow\norange\n",
"0\n"
] |
[
"2\nSpace\nTime\n",
"6\nTime\nMind\nSoul\nPower\nReality\nSpace\n"
] |
In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space.
In the second sample Thanos doesn't have any Gems, so he needs all six.
| 500
|
[
{
"input": "4\nred\npurple\nyellow\norange",
"output": "2\nSpace\nTime"
},
{
"input": "0",
"output": "6\nMind\nSpace\nPower\nTime\nReality\nSoul"
},
{
"input": "6\npurple\nblue\nyellow\nred\ngreen\norange",
"output": "0"
},
{
"input": "1\npurple",
"output": "5\nTime\nReality\nSoul\nSpace\nMind"
},
{
"input": "3\nblue\norange\npurple",
"output": "3\nTime\nReality\nMind"
},
{
"input": "2\nyellow\nred",
"output": "4\nPower\nSoul\nSpace\nTime"
},
{
"input": "1\ngreen",
"output": "5\nReality\nSpace\nPower\nSoul\nMind"
},
{
"input": "2\npurple\ngreen",
"output": "4\nReality\nMind\nSpace\nSoul"
},
{
"input": "1\nblue",
"output": "5\nPower\nReality\nSoul\nTime\nMind"
},
{
"input": "2\npurple\nblue",
"output": "4\nMind\nSoul\nTime\nReality"
},
{
"input": "2\ngreen\nblue",
"output": "4\nReality\nMind\nPower\nSoul"
},
{
"input": "3\npurple\ngreen\nblue",
"output": "3\nMind\nReality\nSoul"
},
{
"input": "1\norange",
"output": "5\nReality\nTime\nPower\nSpace\nMind"
},
{
"input": "2\npurple\norange",
"output": "4\nReality\nMind\nTime\nSpace"
},
{
"input": "2\norange\ngreen",
"output": "4\nSpace\nMind\nReality\nPower"
},
{
"input": "3\norange\npurple\ngreen",
"output": "3\nReality\nSpace\nMind"
},
{
"input": "2\norange\nblue",
"output": "4\nTime\nMind\nReality\nPower"
},
{
"input": "3\nblue\ngreen\norange",
"output": "3\nPower\nMind\nReality"
},
{
"input": "4\nblue\norange\ngreen\npurple",
"output": "2\nMind\nReality"
},
{
"input": "1\nred",
"output": "5\nTime\nSoul\nMind\nPower\nSpace"
},
{
"input": "2\nred\npurple",
"output": "4\nMind\nSpace\nTime\nSoul"
},
{
"input": "2\nred\ngreen",
"output": "4\nMind\nSpace\nPower\nSoul"
},
{
"input": "3\nred\npurple\ngreen",
"output": "3\nSoul\nSpace\nMind"
},
{
"input": "2\nblue\nred",
"output": "4\nMind\nTime\nPower\nSoul"
},
{
"input": "3\nred\nblue\npurple",
"output": "3\nTime\nMind\nSoul"
},
{
"input": "3\nred\nblue\ngreen",
"output": "3\nSoul\nPower\nMind"
},
{
"input": "4\npurple\nblue\ngreen\nred",
"output": "2\nMind\nSoul"
},
{
"input": "2\norange\nred",
"output": "4\nPower\nMind\nTime\nSpace"
},
{
"input": "3\nred\norange\npurple",
"output": "3\nMind\nSpace\nTime"
},
{
"input": "3\nred\norange\ngreen",
"output": "3\nMind\nSpace\nPower"
},
{
"input": "4\nred\norange\ngreen\npurple",
"output": "2\nSpace\nMind"
},
{
"input": "3\nblue\norange\nred",
"output": "3\nPower\nMind\nTime"
},
{
"input": "4\norange\nblue\npurple\nred",
"output": "2\nTime\nMind"
},
{
"input": "4\ngreen\norange\nred\nblue",
"output": "2\nMind\nPower"
},
{
"input": "5\npurple\norange\nblue\nred\ngreen",
"output": "1\nMind"
},
{
"input": "1\nyellow",
"output": "5\nPower\nSoul\nReality\nSpace\nTime"
},
{
"input": "2\npurple\nyellow",
"output": "4\nTime\nReality\nSpace\nSoul"
},
{
"input": "2\ngreen\nyellow",
"output": "4\nSpace\nReality\nPower\nSoul"
},
{
"input": "3\npurple\nyellow\ngreen",
"output": "3\nSoul\nReality\nSpace"
},
{
"input": "2\nblue\nyellow",
"output": "4\nTime\nReality\nPower\nSoul"
},
{
"input": "3\nyellow\nblue\npurple",
"output": "3\nSoul\nReality\nTime"
},
{
"input": "3\ngreen\nyellow\nblue",
"output": "3\nSoul\nReality\nPower"
},
{
"input": "4\nyellow\nblue\ngreen\npurple",
"output": "2\nReality\nSoul"
},
{
"input": "2\nyellow\norange",
"output": "4\nTime\nSpace\nReality\nPower"
},
{
"input": "3\nyellow\npurple\norange",
"output": "3\nSpace\nReality\nTime"
},
{
"input": "3\norange\nyellow\ngreen",
"output": "3\nSpace\nReality\nPower"
},
{
"input": "4\ngreen\nyellow\norange\npurple",
"output": "2\nSpace\nReality"
},
{
"input": "3\nyellow\nblue\norange",
"output": "3\nTime\nReality\nPower"
},
{
"input": "4\norange\npurple\nblue\nyellow",
"output": "2\nReality\nTime"
},
{
"input": "4\nblue\norange\nyellow\ngreen",
"output": "2\nReality\nPower"
},
{
"input": "5\ngreen\nyellow\norange\nblue\npurple",
"output": "1\nReality"
},
{
"input": "3\nyellow\npurple\nred",
"output": "3\nTime\nSoul\nSpace"
},
{
"input": "3\nred\ngreen\nyellow",
"output": "3\nPower\nSoul\nSpace"
},
{
"input": "4\nred\npurple\ngreen\nyellow",
"output": "2\nSpace\nSoul"
},
{
"input": "3\nred\nyellow\nblue",
"output": "3\nPower\nSoul\nTime"
},
{
"input": "4\nblue\nyellow\nred\npurple",
"output": "2\nTime\nSoul"
},
{
"input": "4\nblue\nyellow\nred\ngreen",
"output": "2\nSoul\nPower"
},
{
"input": "5\nred\nyellow\ngreen\nblue\npurple",
"output": "1\nSoul"
},
{
"input": "3\nred\nyellow\norange",
"output": "3\nPower\nSpace\nTime"
},
{
"input": "4\norange\ngreen\nyellow\nred",
"output": "2\nPower\nSpace"
},
{
"input": "5\norange\nred\ngreen\nyellow\npurple",
"output": "1\nSpace"
},
{
"input": "4\nyellow\nred\norange\nblue",
"output": "2\nTime\nPower"
},
{
"input": "5\npurple\nblue\norange\nyellow\nred",
"output": "1\nTime"
},
{
"input": "5\norange\nblue\nyellow\nred\ngreen",
"output": "1\nPower"
}
] | 1,622,906,107
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 64
| 109
| 0
|
# -*- coding: utf-8 -*-
"""
Created on Sat Jun 5 23:05:06 2021
@author: nagan
"""
n = int(input())
d = {'purple':'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind'}
for i in range(n):
a = input()
d.pop(a)
print(len(d))
for i in d:
print(d[i])
|
Title: Infinity Gauntlet
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems:
- the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color.
Using colors of Gems you saw in the Gauntlet determine the names of absent Gems.
Input Specification:
In the first line of input there is one integer $n$ ($0 \le n \le 6$) — the number of Gems in Infinity Gauntlet.
In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters.
Output Specification:
In the first line output one integer $m$ ($0 \le m \le 6$) — the number of absent Gems.
Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase.
Demo Input:
['4\nred\npurple\nyellow\norange\n', '0\n']
Demo Output:
['2\nSpace\nTime\n', '6\nTime\nMind\nSoul\nPower\nReality\nSpace\n']
Note:
In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space.
In the second sample Thanos doesn't have any Gems, so he needs all six.
|
```python
# -*- coding: utf-8 -*-
"""
Created on Sat Jun 5 23:05:06 2021
@author: nagan
"""
n = int(input())
d = {'purple':'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind'}
for i in range(n):
a = input()
d.pop(a)
print(len(d))
for i in d:
print(d[i])
```
| 3
|
|
119
|
A
|
Epic Game
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take).
Your task is to determine by the given *a*, *b* and *n* who wins the game.
|
The only string contains space-separated integers *a*, *b* and *n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=100) — the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile.
|
If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes).
|
[
"3 5 9\n",
"1 1 100\n"
] |
[
"0",
"1"
] |
The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*, *b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*, 0) = *gcd*(0, *x*) = *x*.
In the first sample the game will go like that:
- Simon should take *gcd*(3, 9) = 3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5, 6) = 1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3, 5) = 1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5, 4) = 1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3, 3) = 3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5, 0) = 5 stones from the heap. As 0 < 5, it is impossible and Antisimon loses.
In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
| 500
|
[
{
"input": "3 5 9",
"output": "0"
},
{
"input": "1 1 100",
"output": "1"
},
{
"input": "23 12 16",
"output": "1"
},
{
"input": "95 26 29",
"output": "1"
},
{
"input": "73 32 99",
"output": "1"
},
{
"input": "1 1 1",
"output": "0"
},
{
"input": "41 12 65",
"output": "1"
},
{
"input": "13 61 100",
"output": "1"
},
{
"input": "100 100 10",
"output": "0"
},
{
"input": "12 24 26",
"output": "1"
},
{
"input": "73 21 96",
"output": "1"
},
{
"input": "17 22 81",
"output": "1"
},
{
"input": "14 88 97",
"output": "1"
},
{
"input": "42 81 17",
"output": "0"
},
{
"input": "34 36 19",
"output": "1"
},
{
"input": "21 87 12",
"output": "1"
},
{
"input": "97 92 98",
"output": "1"
},
{
"input": "49 25 62",
"output": "1"
},
{
"input": "29 17 44",
"output": "1"
},
{
"input": "10 1 10",
"output": "0"
},
{
"input": "99 98 100",
"output": "1"
},
{
"input": "100 100 1",
"output": "0"
},
{
"input": "11 99 55",
"output": "0"
},
{
"input": "8 13 21",
"output": "0"
},
{
"input": "34 55 89",
"output": "0"
},
{
"input": "21 34 55",
"output": "1"
},
{
"input": "13 21 34",
"output": "1"
},
{
"input": "34 21 55",
"output": "0"
},
{
"input": "10 20 84",
"output": "1"
},
{
"input": "4 2 5",
"output": "0"
},
{
"input": "3 2 3",
"output": "0"
},
{
"input": "31 23 1",
"output": "0"
},
{
"input": "100 100 100",
"output": "0"
},
{
"input": "100 1 100",
"output": "0"
},
{
"input": "1 100 100",
"output": "1"
},
{
"input": "1 1 100",
"output": "1"
},
{
"input": "17 23 100",
"output": "1"
},
{
"input": "99 98 100",
"output": "1"
},
{
"input": "1 1 2",
"output": "1"
},
{
"input": "2 1 1",
"output": "0"
},
{
"input": "1 2 1",
"output": "0"
},
{
"input": "2 1 2",
"output": "0"
},
{
"input": "10 10 3",
"output": "1"
},
{
"input": "2 2 1",
"output": "0"
},
{
"input": "9 5 1",
"output": "0"
}
] | 1,590,509,171
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 45
| 280
| 0
|
a, b, c = map(int, input().split())
e = 1
def gcd(x, y):
if y == 0:
return x
else:
return gcd(y, x % y)
while True:
if e % 2 != 0:
s = gcd(a, c)
else:
s = gcd(b, c)
if s > c:
break
else:
c -= s
e += 1
if e % 2 == 0:
print(0)
else:
print(1)
|
Title: Epic Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take).
Your task is to determine by the given *a*, *b* and *n* who wins the game.
Input Specification:
The only string contains space-separated integers *a*, *b* and *n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=100) — the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile.
Output Specification:
If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes).
Demo Input:
['3 5 9\n', '1 1 100\n']
Demo Output:
['0', '1']
Note:
The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*, *b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*, 0) = *gcd*(0, *x*) = *x*.
In the first sample the game will go like that:
- Simon should take *gcd*(3, 9) = 3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5, 6) = 1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3, 5) = 1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5, 4) = 1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3, 3) = 3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5, 0) = 5 stones from the heap. As 0 < 5, it is impossible and Antisimon loses.
In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
|
```python
a, b, c = map(int, input().split())
e = 1
def gcd(x, y):
if y == 0:
return x
else:
return gcd(y, x % y)
while True:
if e % 2 != 0:
s = gcd(a, c)
else:
s = gcd(b, c)
if s > c:
break
else:
c -= s
e += 1
if e % 2 == 0:
print(0)
else:
print(1)
```
| 3
|
|
764
|
A
|
Taymyr is calling you
|
PROGRAMMING
| 800
|
[
"brute force",
"implementation",
"math"
] | null | null |
Comrade Dujikov is busy choosing artists for Timofey's birthday and is recieving calls from Taymyr from Ilia-alpinist.
Ilia-alpinist calls every *n* minutes, i.e. in minutes *n*, 2*n*, 3*n* and so on. Artists come to the comrade every *m* minutes, i.e. in minutes *m*, 2*m*, 3*m* and so on. The day is *z* minutes long, i.e. the day consists of minutes 1,<=2,<=...,<=*z*. How many artists should be killed so that there are no artists in the room when Ilia calls? Consider that a call and a talk with an artist take exactly one minute.
|
The only string contains three integers — *n*, *m* and *z* (1<=≤<=*n*,<=*m*,<=*z*<=≤<=104).
|
Print single integer — the minimum number of artists that should be killed so that there are no artists in the room when Ilia calls.
|
[
"1 1 10\n",
"1 2 5\n",
"2 3 9\n"
] |
[
"10\n",
"2\n",
"1\n"
] |
Taymyr is a place in the north of Russia.
In the first test the artists come each minute, as well as the calls, so we need to kill all of them.
In the second test we need to kill artists which come on the second and the fourth minutes.
In the third test — only the artist which comes on the sixth minute.
| 500
|
[
{
"input": "1 1 10",
"output": "10"
},
{
"input": "1 2 5",
"output": "2"
},
{
"input": "2 3 9",
"output": "1"
},
{
"input": "4 8 9",
"output": "1"
},
{
"input": "7 9 2",
"output": "0"
},
{
"input": "10000 10000 10000",
"output": "1"
},
{
"input": "24 22 9235",
"output": "34"
},
{
"input": "74 8 417",
"output": "1"
},
{
"input": "972 1 203",
"output": "0"
},
{
"input": "550 1 754",
"output": "1"
},
{
"input": "860 1 884",
"output": "1"
},
{
"input": "358 2 809",
"output": "2"
},
{
"input": "33 27 216",
"output": "0"
},
{
"input": "2940 1 9311",
"output": "3"
},
{
"input": "4624 1 1953",
"output": "0"
},
{
"input": "2696 2 7345",
"output": "2"
},
{
"input": "3443 2 6701",
"output": "0"
},
{
"input": "3 613 2275",
"output": "1"
},
{
"input": "1 10000 10000",
"output": "1"
},
{
"input": "10000 1 10000",
"output": "1"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "1 1 10000",
"output": "10000"
},
{
"input": "34 27 10000",
"output": "10"
},
{
"input": "2 2 9999",
"output": "4999"
},
{
"input": "2 2 1",
"output": "0"
},
{
"input": "6 4 36",
"output": "3"
},
{
"input": "33 6 3005",
"output": "45"
},
{
"input": "5 1 20",
"output": "4"
},
{
"input": "1 2 10",
"output": "5"
},
{
"input": "2 1 100",
"output": "50"
},
{
"input": "10 20 10000",
"output": "500"
},
{
"input": "8 12 12",
"output": "0"
}
] | 1,583,289,489
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 32
| 155
| 2,150,400
|
n,m,z=map(int,input().split())
x,y=[],[]
for i in range(1,z//n+1):
x.append(n*i)
for i in range(1,z//m+1):
y.append(m*i)
l=set(x)&set(y)
print(len(l))
|
Title: Taymyr is calling you
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Comrade Dujikov is busy choosing artists for Timofey's birthday and is recieving calls from Taymyr from Ilia-alpinist.
Ilia-alpinist calls every *n* minutes, i.e. in minutes *n*, 2*n*, 3*n* and so on. Artists come to the comrade every *m* minutes, i.e. in minutes *m*, 2*m*, 3*m* and so on. The day is *z* minutes long, i.e. the day consists of minutes 1,<=2,<=...,<=*z*. How many artists should be killed so that there are no artists in the room when Ilia calls? Consider that a call and a talk with an artist take exactly one minute.
Input Specification:
The only string contains three integers — *n*, *m* and *z* (1<=≤<=*n*,<=*m*,<=*z*<=≤<=104).
Output Specification:
Print single integer — the minimum number of artists that should be killed so that there are no artists in the room when Ilia calls.
Demo Input:
['1 1 10\n', '1 2 5\n', '2 3 9\n']
Demo Output:
['10\n', '2\n', '1\n']
Note:
Taymyr is a place in the north of Russia.
In the first test the artists come each minute, as well as the calls, so we need to kill all of them.
In the second test we need to kill artists which come on the second and the fourth minutes.
In the third test — only the artist which comes on the sixth minute.
|
```python
n,m,z=map(int,input().split())
x,y=[],[]
for i in range(1,z//n+1):
x.append(n*i)
for i in range(1,z//m+1):
y.append(m*i)
l=set(x)&set(y)
print(len(l))
```
| 3
|
|
801
|
A
|
Vicious Keyboard
|
PROGRAMMING
| 1,100
|
[
"brute force"
] | null | null |
Tonio has a keyboard with only two letters, "V" and "K".
One day, he has typed out a string *s* with only these two letters. He really likes it when the string "VK" appears, so he wishes to change at most one letter in the string (or do no changes) to maximize the number of occurrences of that string. Compute the maximum number of times "VK" can appear as a substring (i. e. a letter "K" right after a letter "V") in the resulting string.
|
The first line will contain a string *s* consisting only of uppercase English letters "V" and "K" with length not less than 1 and not greater than 100.
|
Output a single integer, the maximum number of times "VK" can appear as a substring of the given string after changing at most one character.
|
[
"VK\n",
"VV\n",
"V\n",
"VKKKKKKKKKVVVVVVVVVK\n",
"KVKV\n"
] |
[
"1\n",
"1\n",
"0\n",
"3\n",
"1\n"
] |
For the first case, we do not change any letters. "VK" appears once, which is the maximum number of times it could appear.
For the second case, we can change the second character from a "V" to a "K". This will give us the string "VK". This has one occurrence of the string "VK" as a substring.
For the fourth case, we can change the fourth character from a "K" to a "V". This will give us the string "VKKVKKKKKKVVVVVVVVVK". This has three occurrences of the string "VK" as a substring. We can check no other moves can give us strictly more occurrences.
| 500
|
[
{
"input": "VK",
"output": "1"
},
{
"input": "VV",
"output": "1"
},
{
"input": "V",
"output": "0"
},
{
"input": "VKKKKKKKKKVVVVVVVVVK",
"output": "3"
},
{
"input": "KVKV",
"output": "1"
},
{
"input": "VKKVVVKVKVK",
"output": "5"
},
{
"input": "VKVVKVKVVKVKKKKVVVVVVVVKVKVVVVVVKKVKKVKVVKVKKVVVVKV",
"output": "14"
},
{
"input": "VVKKVKKVVKKVKKVKVVKKVKKVVKKVKVVKKVKKVKVVKKVVKKVKVVKKVKVVKKVVKVVKKVKKVKKVKKVKKVKVVKKVKKVKKVKKVKKVVKVK",
"output": "32"
},
{
"input": "KVVKKVKVKVKVKVKKVKVKVVKVKVVKVVKVKKVKVKVKVKVKVKVKVKVKVKVKVKVKVKVVKVKVVKKVKVKK",
"output": "32"
},
{
"input": "KVVVVVKKVKVVKVVVKVVVKKKVKKKVVKVKKKVKKKKVKVVVVVKKKVVVVKKVVVVKKKVKVVVVVVVKKVKVKKKVVKVVVKVVKK",
"output": "21"
},
{
"input": "VVVVVKKVKVKVKVVKVVKKVVKVKKKKKKKVKKKVVVVVVKKVVVKVKVVKVKKVVKVVVKKKKKVVVVVKVVVVKVVVKKVKKVKKKVKKVKKVVKKV",
"output": "25"
},
{
"input": "KKVVKVVKVVKKVVKKVKVVKKV",
"output": "7"
},
{
"input": "KKVVKKVVVKKVKKVKKVVVKVVVKKVKKVVVKKVVVKVVVKVVVKKVVVKKVVVKVVVKKVVVKVVKKVVVKKVVVKKVVKVVVKKVVKKVKKVVVKKV",
"output": "24"
},
{
"input": "KVKVKVKVKVKVKVKVKVKVVKVKVKVKVKVKVKVVKVKVKKVKVKVKVKVVKVKVKVKVKVKVKVKVKKVKVKVV",
"output": "35"
},
{
"input": "VKVVVKKKVKVVKVKVKVKVKVV",
"output": "9"
},
{
"input": "KKKKVKKVKVKVKKKVVVVKK",
"output": "6"
},
{
"input": "KVKVKKVVVVVVKKKVKKKKVVVVKVKKVKVVK",
"output": "9"
},
{
"input": "KKVKKVKKKVKKKVKKKVKVVVKKVVVVKKKVKKVVKVKKVKVKVKVVVKKKVKKKKKVVKVVKVVVKKVVKVVKKKKKVK",
"output": "22"
},
{
"input": "VVVKVKVKVVVVVKVVVKKVVVKVVVVVKKVVKVVVKVVVKVKKKVVKVVVVVKVVVVKKVVKVKKVVKKKVKVVKVKKKKVVKVVVKKKVKVKKKKKK",
"output": "25"
},
{
"input": "VKVVKVVKKKVVKVKKKVVKKKVVKVVKVVKKVKKKVKVKKKVVKVKKKVVKVVKKKVVKKKVKKKVVKKVVKKKVKVKKKVKKKVKKKVKVKKKVVKVK",
"output": "29"
},
{
"input": "KKVKVVVKKVV",
"output": "3"
},
{
"input": "VKVKVKVKVKVKVKVKVKVKVVKVKVKVKVKVK",
"output": "16"
},
{
"input": "VVKKKVVKKKVVKKKVVKKKVVKKKVVKKKVVKKKVVKKKVVKKKVVKKKVVKKKVVKKKVV",
"output": "13"
},
{
"input": "VVKKVKVKKKVVVKVVVKVKKVKKKVVVKVVKVKKVKKVKVKVVKKVVKKVKVVKKKVVKKVVVKVKVVVKVKVVKVKKVKKV",
"output": "26"
},
{
"input": "VVKVKKVVKKVVKKVVKKVVKKVKKVVKVKKVVKKVVKKVVKKVVKKVVKVVKKVVKVVKKVVKVVKKVVKKVKKVVKVVKKVVKVVKKVV",
"output": "26"
},
{
"input": "K",
"output": "0"
},
{
"input": "VKVK",
"output": "2"
},
{
"input": "VKVV",
"output": "2"
},
{
"input": "KV",
"output": "0"
},
{
"input": "KK",
"output": "1"
},
{
"input": "KKVK",
"output": "2"
},
{
"input": "KKKK",
"output": "1"
},
{
"input": "KKV",
"output": "1"
},
{
"input": "KKVKVK",
"output": "3"
},
{
"input": "VKKVK",
"output": "2"
},
{
"input": "VKKK",
"output": "2"
},
{
"input": "KKK",
"output": "1"
},
{
"input": "KVV",
"output": "1"
},
{
"input": "KKVKV",
"output": "2"
},
{
"input": "VVK",
"output": "1"
},
{
"input": "VVVKVKVKVKVKVKVK",
"output": "8"
},
{
"input": "KVVVK",
"output": "2"
},
{
"input": "VVVKK",
"output": "2"
},
{
"input": "KKVV",
"output": "1"
},
{
"input": "KKKKKKK",
"output": "1"
},
{
"input": "VKKKVK",
"output": "3"
},
{
"input": "KKVVV",
"output": "1"
},
{
"input": "VVVVVV",
"output": "1"
},
{
"input": "KKKV",
"output": "1"
},
{
"input": "VVKVV",
"output": "2"
},
{
"input": "VKVKKK",
"output": "3"
},
{
"input": "VKKV",
"output": "1"
},
{
"input": "VKKVV",
"output": "2"
},
{
"input": "VVKKVV",
"output": "2"
},
{
"input": "KKVVKKV",
"output": "2"
},
{
"input": "KKKKK",
"output": "1"
},
{
"input": "VKVVKKVKKVVKVKKVKKKVKKVKVKK",
"output": "10"
},
{
"input": "VKVKVV",
"output": "3"
},
{
"input": "VKVVKVV",
"output": "3"
},
{
"input": "VVV",
"output": "1"
},
{
"input": "VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV",
"output": "1"
},
{
"input": "VVKKKKKKVKK",
"output": "3"
},
{
"input": "KVKVKVV",
"output": "3"
}
] | 1,492,357,689
| 789
|
Python 3
|
WRONG_ANSWER
|
PRETESTS
| 7
| 61
| 5,529,600
|
s=input()
ans=s.count('VK')
x=s.count('VV')
y=s.count('KK')
if x!=0 or y!=0:
ans+=1
print(ans)
|
Title: Vicious Keyboard
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Tonio has a keyboard with only two letters, "V" and "K".
One day, he has typed out a string *s* with only these two letters. He really likes it when the string "VK" appears, so he wishes to change at most one letter in the string (or do no changes) to maximize the number of occurrences of that string. Compute the maximum number of times "VK" can appear as a substring (i. e. a letter "K" right after a letter "V") in the resulting string.
Input Specification:
The first line will contain a string *s* consisting only of uppercase English letters "V" and "K" with length not less than 1 and not greater than 100.
Output Specification:
Output a single integer, the maximum number of times "VK" can appear as a substring of the given string after changing at most one character.
Demo Input:
['VK\n', 'VV\n', 'V\n', 'VKKKKKKKKKVVVVVVVVVK\n', 'KVKV\n']
Demo Output:
['1\n', '1\n', '0\n', '3\n', '1\n']
Note:
For the first case, we do not change any letters. "VK" appears once, which is the maximum number of times it could appear.
For the second case, we can change the second character from a "V" to a "K". This will give us the string "VK". This has one occurrence of the string "VK" as a substring.
For the fourth case, we can change the fourth character from a "K" to a "V". This will give us the string "VKKVKKKKKKVVVVVVVVVK". This has three occurrences of the string "VK" as a substring. We can check no other moves can give us strictly more occurrences.
|
```python
s=input()
ans=s.count('VK')
x=s.count('VV')
y=s.count('KK')
if x!=0 or y!=0:
ans+=1
print(ans)
```
| 0
|
|
44
|
A
|
Indian Summer
|
PROGRAMMING
| 900
|
[
"implementation"
] |
A. Indian Summer
|
2
|
256
|
Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy — she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked.
|
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space.
|
Output the single number — the number of Alyona's leaves.
|
[
"5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n",
"3\noak yellow\noak yellow\noak yellow\n"
] |
[
"4\n",
"1\n"
] |
none
| 0
|
[
{
"input": "5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green",
"output": "4"
},
{
"input": "3\noak yellow\noak yellow\noak yellow",
"output": "1"
},
{
"input": "5\nxbnbkzn hp\nkaqkl vrgzbvqstu\nj aqidx\nhos gyul\nwefxmh tygpluae",
"output": "5"
},
{
"input": "1\nqvwli hz",
"output": "1"
},
{
"input": "4\nsrhk x\nsrhk x\nqfoe vnrjuab\nqfoe vnrjuab",
"output": "2"
},
{
"input": "4\nsddqllmmpk syded\nfprsq fnenjnaz\nn hdej\nsddqllmmpk syded",
"output": "3"
},
{
"input": "17\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw",
"output": "1"
},
{
"input": "18\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nb d\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp",
"output": "2"
},
{
"input": "13\nsvpzwtwn rykzfdce\nqweiyeck jkreouy\nhk nnli\ntwxrnbbdt vtuv\nxokqjtylly sz\nesdt dbfidjslq\ng ybqgomvw\nxcpfjmf zcqvz\nifajadhj invzueip\nvdemdnxifb hckwebmi\nsdpnhipam wvowzavh\nuqdlfskhgo vunbpghae\ne dtigwnb",
"output": "13"
},
{
"input": "20\nm vkfh\nvptikamead mvx\nitu mf\nklruxckw aqega\nekqkd enjllwol\ncc uybfdh\nimrfdngvo u\ne uh\ntwt jsslcfuogk\nbljwqsag tuqbdn\nqcv q\nasx gzhvwwmajj\nqcv q\nekqkd enjllwol\nasx gzhvwwmajj\nks vv\nkzyfi cn\ncc uybfdh\nitu mf\ncjbjhtbyvk vatwfmux",
"output": "15"
},
{
"input": "2\nab ab\na bab",
"output": "2"
}
] | 1,651,940,084
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 29
| 92
| 0
|
# your code goes here
n=int(input())
lst1=set()
for i in range(n):
s=input()
lst1.add(s)
print(len(lst1))
|
Title: Indian Summer
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy — she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space.
Output Specification:
Output the single number — the number of Alyona's leaves.
Demo Input:
['5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n', '3\noak yellow\noak yellow\noak yellow\n']
Demo Output:
['4\n', '1\n']
Note:
none
|
```python
# your code goes here
n=int(input())
lst1=set()
for i in range(n):
s=input()
lst1.add(s)
print(len(lst1))
```
| 3.977
|
234
|
B
|
Reading
|
PROGRAMMING
| 1,000
|
[
"sortings"
] | null | null |
Vasya is going to the Olympics in the city Ntown by train. The boy wants to read the textbook to prepare for the Olympics. He counted that he needed *k* hours for this. He also found that the light in the train changes every hour. The light is measured on a scale from 0 to 100, where 0 is very dark, and 100 is very light.
Vasya has a train lighting schedule for all *n* hours of the trip — *n* numbers from 0 to 100 each (the light level in the first hour, the second hour and so on). During each of those hours he will either read the whole time, or not read at all. He wants to choose *k* hours to read a book, not necessarily consecutive, so that the minimum level of light among the selected hours were maximum. Vasya is very excited before the upcoming contest, help him choose reading hours.
|
The first input line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=1000,<=1<=≤<=*k*<=≤<=*n*) — the number of hours on the train and the number of hours to read, correspondingly. The second line contains *n* space-separated integers *a**i* (0<=≤<=*a**i*<=≤<=100), *a**i* is the light level at the *i*-th hour.
|
In the first output line print the minimum light level Vasya will read at. In the second line print *k* distinct space-separated integers *b*1,<=*b*2,<=...,<=*b**k*, — the indexes of hours Vasya will read at (1<=≤<=*b**i*<=≤<=*n*). The hours are indexed starting from 1. If there are multiple optimal solutions, print any of them. Print the numbers *b**i* in an arbitrary order.
|
[
"5 3\n20 10 30 40 10\n",
"6 5\n90 20 35 40 60 100\n"
] |
[
"20\n1 3 4 \n",
"35\n1 3 4 5 6 \n"
] |
In the first sample Vasya should read at the first hour (light 20), third hour (light 30) and at the fourth hour (light 40). The minimum light Vasya will have to read at is 20.
| 0
|
[
{
"input": "5 3\n20 10 30 40 10",
"output": "20\n1 3 4 "
},
{
"input": "6 5\n90 20 35 40 60 100",
"output": "35\n1 3 4 5 6 "
},
{
"input": "100 7\n85 66 9 91 50 46 61 12 55 65 95 1 25 97 95 4 59 59 52 34 94 30 60 11 68 36 17 84 87 68 72 87 46 99 24 66 75 77 75 2 19 3 33 19 7 20 22 3 71 29 88 63 89 47 7 52 47 55 87 77 9 81 44 13 30 43 66 74 9 42 9 72 97 61 9 94 92 29 18 7 92 68 76 43 35 71 54 49 77 50 77 68 57 24 84 73 32 85 24 37",
"output": "94\n11 14 15 21 34 73 76 "
},
{
"input": "1 1\n10",
"output": "10\n1 "
},
{
"input": "1 1\n86",
"output": "86\n1 "
},
{
"input": "100 79\n83 83 83 83 83 94 94 83 83 83 83 90 83 99 83 91 83 83 83 83 83 83 83 83 83 83 83 91 83 83 83 83 83 96 83 83 83 91 83 83 92 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 98 83 83 91 97 83 83 83 83 83 83 83 92 83 83 83 83 83 83 83 93 83 83 91 83 83 83 83 83 83 83 83 83 83 83 96 83 83 83 83 83",
"output": "83\n6 7 12 14 16 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "20 3\n17 76 98 17 55 17 17 99 65 17 17 17 17 52 17 17 69 88 17 17",
"output": "88\n3 8 18 "
},
{
"input": "15 1\n0 78 24 24 61 60 0 65 52 57 97 51 56 13 10",
"output": "97\n11 "
},
{
"input": "50 50\n59 40 52 0 65 49 3 58 57 22 86 37 55 72 11 3 30 30 20 64 44 45 12 48 96 96 39 14 8 53 40 37 8 58 97 16 96 48 30 89 66 19 31 50 23 80 67 16 11 7",
"output": "0\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 "
},
{
"input": "60 8\n59 12 34 86 57 65 42 24 62 18 94 92 43 29 95 33 73 3 69 18 36 18 34 97 85 65 74 25 26 70 46 31 57 73 78 89 95 77 94 71 38 23 30 97 69 97 76 43 76 31 38 50 13 16 55 85 47 5 71 4",
"output": "92\n11 12 15 24 37 39 44 46 "
},
{
"input": "70 5\n76 16 20 60 5 96 32 50 35 9 79 42 38 35 72 45 98 33 55 0 86 92 49 87 22 79 35 27 69 35 89 29 31 43 88 1 48 95 3 92 82 97 53 80 79 0 78 58 37 38 45 9 5 38 53 49 71 7 91 3 75 17 76 44 77 31 78 91 59 91",
"output": "92\n6 17 38 40 42 "
},
{
"input": "12 3\n18 64 98 27 36 27 65 43 39 41 69 47",
"output": "65\n3 7 11 "
},
{
"input": "15 13\n6 78 78 78 78 20 78 78 8 3 78 18 32 56 78",
"output": "8\n2 3 4 5 6 7 8 9 11 12 13 14 15 "
},
{
"input": "17 4\n75 52 24 74 70 24 24 53 24 48 24 0 67 47 24 24 6",
"output": "67\n1 4 5 13 "
},
{
"input": "14 2\n31 18 78 90 96 2 90 27 86 9 94 98 94 34",
"output": "96\n5 12 "
},
{
"input": "100 56\n56 64 54 22 46 0 51 27 8 10 5 26 68 37 51 53 4 64 82 23 38 89 97 20 23 31 7 95 55 27 33 23 95 6 64 69 27 54 36 4 96 61 68 26 46 10 61 53 32 19 28 62 7 32 86 84 12 88 92 51 53 23 80 7 36 46 48 29 12 98 72 99 16 0 94 22 83 23 12 37 29 13 93 16 53 21 8 37 67 33 33 67 35 72 3 97 46 30 9 57",
"output": "33\n1 2 3 5 7 13 14 15 16 18 19 21 22 23 28 29 33 35 36 38 39 41 42 43 45 47 48 52 55 56 58 59 60 61 63 65 66 67 70 71 72 75 77 80 83 85 88 89 90 91 92 93 94 96 97 100 "
},
{
"input": "90 41\n43 24 4 69 54 87 33 34 9 77 87 66 66 0 71 43 42 10 78 48 26 40 8 61 80 38 76 63 7 47 99 69 77 43 29 74 86 93 39 28 99 98 11 27 43 58 50 61 1 79 45 17 23 13 10 98 41 28 19 98 87 51 26 28 88 60 42 25 19 3 29 18 0 56 84 27 43 92 93 97 25 90 13 90 75 52 99 6 66 87",
"output": "52\n4 5 6 10 11 12 13 15 19 24 25 27 28 31 32 33 36 37 38 41 42 46 48 50 56 60 61 65 66 74 75 78 79 80 82 84 85 86 87 89 90 "
},
{
"input": "100 71\n29 56 85 57 40 89 93 81 92 38 81 41 18 9 89 21 81 6 95 94 38 11 90 38 6 81 61 43 81 12 36 35 33 10 81 49 59 37 81 61 95 34 43 20 94 88 57 81 42 81 50 24 85 81 1 90 33 8 59 87 17 52 91 54 81 98 28 11 24 51 95 31 98 29 5 81 91 52 41 81 7 9 81 81 13 81 3 81 10 0 37 47 62 50 81 81 81 94 93 38",
"output": "35\n2 3 4 5 6 7 8 9 10 11 12 15 17 19 20 21 23 24 26 27 28 29 31 32 35 36 37 38 39 40 41 43 45 46 47 48 49 50 51 53 54 56 59 60 62 63 64 65 66 70 71 73 76 77 78 79 80 83 84 86 88 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 55\n72 70 77 90 86 96 60 60 60 60 87 62 60 87 0 60 82 60 86 74 60 60 60 60 60 60 78 60 60 60 96 60 60 0 60 60 89 99 60 60 60 60 60 60 89 60 88 84 60 93 0 60 60 60 75 60 67 64 65 60 65 60 72 60 76 4 60 60 60 63 96 62 78 71 63 81 89 98 60 60 69 60 61 60 60 60 85 71 82 79 67 60 60 60 79 96 2 60 60 60",
"output": "60\n1 2 3 4 5 6 11 12 14 17 19 20 27 31 37 38 45 47 48 50 55 57 58 59 61 63 65 70 71 72 73 74 75 76 77 78 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 98 99 100 "
},
{
"input": "100 27\n25 87 25 25 77 78 25 73 91 25 25 70 84 25 61 75 82 25 25 25 25 65 25 25 82 63 93 25 93 75 25 25 25 89 98 25 25 72 70 25 72 25 25 25 70 25 25 98 90 25 25 25 25 25 91 25 78 71 63 69 25 25 25 63 25 25 75 94 25 25 25 25 25 97 25 78 66 87 25 89 25 25 73 85 25 91 72 25 25 80 25 70 25 96 25 25 25 25 25 25",
"output": "75\n2 5 6 9 13 16 17 25 27 29 30 34 35 48 49 55 57 67 68 74 76 78 80 84 86 90 94 "
},
{
"input": "100 99\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "1\n2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 50\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "2\n2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 96 98 100 "
},
{
"input": "100 51\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "1\n2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 96 98 99 100 "
},
{
"input": "100 75\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "1\n2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100 45\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2",
"output": "2\n12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 96 98 100 "
},
{
"input": "2 2\n2 2",
"output": "2\n1 2 "
},
{
"input": "2 1\n2 1",
"output": "2\n1 "
},
{
"input": "2 1\n1 2",
"output": "2\n2 "
},
{
"input": "3 1\n1 2 0",
"output": "2\n2 "
},
{
"input": "3 2\n0 0 0",
"output": "0\n2 3 "
},
{
"input": "3 3\n0 1 0",
"output": "0\n1 2 3 "
},
{
"input": "3 2\n99 100 99",
"output": "99\n2 3 "
},
{
"input": "1 1\n0",
"output": "0\n1 "
},
{
"input": "4 1\n100 100 0 100",
"output": "100\n4 "
},
{
"input": "4 2\n0 1 0 1",
"output": "1\n2 4 "
},
{
"input": "10 3\n0 1 2 3 0 1 2 3 0 1",
"output": "2\n4 7 8 "
},
{
"input": "10 9\n0 1 0 1 100 100 1 0 1 0",
"output": "0\n2 3 4 5 6 7 8 9 10 "
},
{
"input": "7 7\n1 0 0 0 0 0 0",
"output": "0\n1 2 3 4 5 6 7 "
},
{
"input": "7 6\n0 0 0 0 0 0 1",
"output": "0\n2 3 4 5 6 7 "
},
{
"input": "7 1\n12 33 12 88 10 0 3",
"output": "88\n4 "
},
{
"input": "7 1\n0 1 1 1 1 1 1",
"output": "1\n7 "
},
{
"input": "7 6\n1 1 1 1 1 1 0",
"output": "1\n1 2 3 4 5 6 "
},
{
"input": "7 2\n1 0 1 1 1 1 1",
"output": "1\n6 7 "
},
{
"input": "8 4\n1 1 1 1 0 0 0 0",
"output": "1\n1 2 3 4 "
},
{
"input": "7 5\n1 1 1 2 0 0 0",
"output": "0\n1 2 3 4 7 "
}
] | 1,675,455,814
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 62
| 0
|
f_in = open('input.txt')
n, k = f.readline().split()
n = int(n)
k = int(k)
mas = f.readline().split()
f_in.close()
f_out = open('output.txt', 'w')
mas_index = []
for i in range(n):
mas[i] = int(mas[i])
for j in range(k):
if j == (k - 1): f_out.write(max(mas))
mas_index.append(mas.index(max(mas)) + 1)
mas[mas.index(max(mas))] = 0
f_out.write(*mas_index)
|
Title: Reading
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya is going to the Olympics in the city Ntown by train. The boy wants to read the textbook to prepare for the Olympics. He counted that he needed *k* hours for this. He also found that the light in the train changes every hour. The light is measured on a scale from 0 to 100, where 0 is very dark, and 100 is very light.
Vasya has a train lighting schedule for all *n* hours of the trip — *n* numbers from 0 to 100 each (the light level in the first hour, the second hour and so on). During each of those hours he will either read the whole time, or not read at all. He wants to choose *k* hours to read a book, not necessarily consecutive, so that the minimum level of light among the selected hours were maximum. Vasya is very excited before the upcoming contest, help him choose reading hours.
Input Specification:
The first input line contains two integers *n* and *k* (1<=≤<=*n*<=≤<=1000,<=1<=≤<=*k*<=≤<=*n*) — the number of hours on the train and the number of hours to read, correspondingly. The second line contains *n* space-separated integers *a**i* (0<=≤<=*a**i*<=≤<=100), *a**i* is the light level at the *i*-th hour.
Output Specification:
In the first output line print the minimum light level Vasya will read at. In the second line print *k* distinct space-separated integers *b*1,<=*b*2,<=...,<=*b**k*, — the indexes of hours Vasya will read at (1<=≤<=*b**i*<=≤<=*n*). The hours are indexed starting from 1. If there are multiple optimal solutions, print any of them. Print the numbers *b**i* in an arbitrary order.
Demo Input:
['5 3\n20 10 30 40 10\n', '6 5\n90 20 35 40 60 100\n']
Demo Output:
['20\n1 3 4 \n', '35\n1 3 4 5 6 \n']
Note:
In the first sample Vasya should read at the first hour (light 20), third hour (light 30) and at the fourth hour (light 40). The minimum light Vasya will have to read at is 20.
|
```python
f_in = open('input.txt')
n, k = f.readline().split()
n = int(n)
k = int(k)
mas = f.readline().split()
f_in.close()
f_out = open('output.txt', 'w')
mas_index = []
for i in range(n):
mas[i] = int(mas[i])
for j in range(k):
if j == (k - 1): f_out.write(max(mas))
mas_index.append(mas.index(max(mas)) + 1)
mas[mas.index(max(mas))] = 0
f_out.write(*mas_index)
```
| -1
|
|
264
|
A
|
Escape from Stones
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms",
"data structures",
"implementation",
"two pointers"
] | null | null |
Squirrel Liss lived in a forest peacefully, but unexpected trouble happens. Stones fall from a mountain. Initially Squirrel Liss occupies an interval [0,<=1]. Next, *n* stones will fall and Liss will escape from the stones. The stones are numbered from 1 to *n* in order.
The stones always fall to the center of Liss's interval. When Liss occupies the interval [*k*<=-<=*d*,<=*k*<=+<=*d*] and a stone falls to *k*, she will escape to the left or to the right. If she escapes to the left, her new interval will be [*k*<=-<=*d*,<=*k*]. If she escapes to the right, her new interval will be [*k*,<=*k*<=+<=*d*].
You are given a string *s* of length *n*. If the *i*-th character of *s* is "l" or "r", when the *i*-th stone falls Liss will escape to the left or to the right, respectively. Find the sequence of stones' numbers from left to right after all the *n* stones falls.
|
The input consists of only one line. The only line contains the string *s* (1<=≤<=|*s*|<=≤<=106). Each character in *s* will be either "l" or "r".
|
Output *n* lines — on the *i*-th line you should print the *i*-th stone's number from the left.
|
[
"llrlr\n",
"rrlll\n",
"lrlrr\n"
] |
[
"3\n5\n4\n2\n1\n",
"1\n2\n5\n4\n3\n",
"2\n4\n5\n3\n1\n"
] |
In the first example, the positions of stones 1, 2, 3, 4, 5 will be <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/58fdb5684df807bfcb705a9da9ce175613362b7d.png" style="max-width: 100.0%;max-height: 100.0%;"/>, respectively. So you should print the sequence: 3, 5, 4, 2, 1.
| 500
|
[
{
"input": "llrlr",
"output": "3\n5\n4\n2\n1"
},
{
"input": "rrlll",
"output": "1\n2\n5\n4\n3"
},
{
"input": "lrlrr",
"output": "2\n4\n5\n3\n1"
},
{
"input": "lllrlrllrl",
"output": "4\n6\n9\n10\n8\n7\n5\n3\n2\n1"
},
{
"input": "llrlrrrlrr",
"output": "3\n5\n6\n7\n9\n10\n8\n4\n2\n1"
},
{
"input": "rlrrrllrrr",
"output": "1\n3\n4\n5\n8\n9\n10\n7\n6\n2"
},
{
"input": "lrrlrrllrrrrllllllrr",
"output": "2\n3\n5\n6\n9\n10\n11\n12\n19\n20\n18\n17\n16\n15\n14\n13\n8\n7\n4\n1"
},
{
"input": "rlrrrlrrrllrrllrlrll",
"output": "1\n3\n4\n5\n7\n8\n9\n12\n13\n16\n18\n20\n19\n17\n15\n14\n11\n10\n6\n2"
},
{
"input": "lllrrlrlrllrrrrrllrl",
"output": "4\n5\n7\n9\n12\n13\n14\n15\n16\n19\n20\n18\n17\n11\n10\n8\n6\n3\n2\n1"
},
{
"input": "rrrllrrrlllrlllrlrrr",
"output": "1\n2\n3\n6\n7\n8\n12\n16\n18\n19\n20\n17\n15\n14\n13\n11\n10\n9\n5\n4"
},
{
"input": "rrlllrrrlrrlrrrlllrlrlrrrlllrllrrllrllrrlrlrrllllrlrrrrlrlllrlrrrlrlrllrlrlrrlrrllrrrlrlrlllrrllllrl",
"output": "1\n2\n6\n7\n8\n10\n11\n13\n14\n15\n19\n21\n23\n24\n25\n29\n32\n33\n36\n39\n40\n42\n44\n45\n50\n52\n53\n54\n55\n57\n61\n63\n64\n65\n67\n69\n72\n74\n76\n77\n79\n80\n83\n84\n85\n87\n89\n93\n94\n99\n100\n98\n97\n96\n95\n92\n91\n90\n88\n86\n82\n81\n78\n75\n73\n71\n70\n68\n66\n62\n60\n59\n58\n56\n51\n49\n48\n47\n46\n43\n41\n38\n37\n35\n34\n31\n30\n28\n27\n26\n22\n20\n18\n17\n16\n12\n9\n5\n4\n3"
},
{
"input": "llrlrlllrrllrllllrlrrlrlrrllrlrlrrlrrrrrrlllrrlrrrrrlrrrlrlrlrrlllllrrrrllrrlrlrrrllllrlrrlrrlrlrrll",
"output": "3\n5\n9\n10\n13\n18\n20\n21\n23\n25\n26\n29\n31\n33\n34\n36\n37\n38\n39\n40\n41\n45\n46\n48\n49\n50\n51\n52\n54\n55\n56\n58\n60\n62\n63\n69\n70\n71\n72\n75\n76\n78\n80\n81\n82\n87\n89\n90\n92\n93\n95\n97\n98\n100\n99\n96\n94\n91\n88\n86\n85\n84\n83\n79\n77\n74\n73\n68\n67\n66\n65\n64\n61\n59\n57\n53\n47\n44\n43\n42\n35\n32\n30\n28\n27\n24\n22\n19\n17\n16\n15\n14\n12\n11\n8\n7\n6\n4\n2\n1"
},
{
"input": "llrrrrllrrlllrlrllrlrllllllrrrrrrrrllrrrrrrllrlrrrlllrrrrrrlllllllrrlrrllrrrllllrrlllrrrlrlrrlrlrllr",
"output": "3\n4\n5\n6\n9\n10\n14\n16\n19\n21\n28\n29\n30\n31\n32\n33\n34\n35\n38\n39\n40\n41\n42\n43\n46\n48\n49\n50\n54\n55\n56\n57\n58\n59\n67\n68\n70\n71\n74\n75\n76\n81\n82\n86\n87\n88\n90\n92\n93\n95\n97\n100\n99\n98\n96\n94\n91\n89\n85\n84\n83\n80\n79\n78\n77\n73\n72\n69\n66\n65\n64\n63\n62\n61\n60\n53\n52\n51\n47\n45\n44\n37\n36\n27\n26\n25\n24\n23\n22\n20\n18\n17\n15\n13\n12\n11\n8\n7\n2\n1"
},
{
"input": "lllllrllrrlllrrrllrrrrlrrlrllllrrrrrllrlrllllllrrlrllrlrllrlrrlrlrrlrrrlrrrrllrlrrrrrrrllrllrrlrllrl",
"output": "6\n9\n10\n14\n15\n16\n19\n20\n21\n22\n24\n25\n27\n32\n33\n34\n35\n36\n39\n41\n48\n49\n51\n54\n56\n59\n61\n62\n64\n66\n67\n69\n70\n71\n73\n74\n75\n76\n79\n81\n82\n83\n84\n85\n86\n87\n90\n93\n94\n96\n99\n100\n98\n97\n95\n92\n91\n89\n88\n80\n78\n77\n72\n68\n65\n63\n60\n58\n57\n55\n53\n52\n50\n47\n46\n45\n44\n43\n42\n40\n38\n37\n31\n30\n29\n28\n26\n23\n18\n17\n13\n12\n11\n8\n7\n5\n4\n3\n2\n1"
},
{
"input": "llrlrlrlrlrlrrlllllllrllllrllrrrlllrrllrllrrlllrrlllrlrrllllrrlllrrllrrllllrrlllrlllrrrllrrrrrrllrrl",
"output": "3\n5\n7\n9\n11\n13\n14\n22\n27\n30\n31\n32\n36\n37\n40\n43\n44\n48\n49\n53\n55\n56\n61\n62\n66\n67\n70\n71\n76\n77\n81\n85\n86\n87\n90\n91\n92\n93\n94\n95\n98\n99\n100\n97\n96\n89\n88\n84\n83\n82\n80\n79\n78\n75\n74\n73\n72\n69\n68\n65\n64\n63\n60\n59\n58\n57\n54\n52\n51\n50\n47\n46\n45\n42\n41\n39\n38\n35\n34\n33\n29\n28\n26\n25\n24\n23\n21\n20\n19\n18\n17\n16\n15\n12\n10\n8\n6\n4\n2\n1"
},
{
"input": "l",
"output": "1"
},
{
"input": "r",
"output": "1"
}
] | 1,694,624,103
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 57
| 1,528
| 50,995,200
|
s = input()
l, r = [], []
for i in range(len(s)):
if s[i] == 'l':
l.append(i+1)
else:
r.append(i+1)
for n in r:
print(n)
for i in range(len(l)-1,-1,-1):
print(l[i])
|
Title: Escape from Stones
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Squirrel Liss lived in a forest peacefully, but unexpected trouble happens. Stones fall from a mountain. Initially Squirrel Liss occupies an interval [0,<=1]. Next, *n* stones will fall and Liss will escape from the stones. The stones are numbered from 1 to *n* in order.
The stones always fall to the center of Liss's interval. When Liss occupies the interval [*k*<=-<=*d*,<=*k*<=+<=*d*] and a stone falls to *k*, she will escape to the left or to the right. If she escapes to the left, her new interval will be [*k*<=-<=*d*,<=*k*]. If she escapes to the right, her new interval will be [*k*,<=*k*<=+<=*d*].
You are given a string *s* of length *n*. If the *i*-th character of *s* is "l" or "r", when the *i*-th stone falls Liss will escape to the left or to the right, respectively. Find the sequence of stones' numbers from left to right after all the *n* stones falls.
Input Specification:
The input consists of only one line. The only line contains the string *s* (1<=≤<=|*s*|<=≤<=106). Each character in *s* will be either "l" or "r".
Output Specification:
Output *n* lines — on the *i*-th line you should print the *i*-th stone's number from the left.
Demo Input:
['llrlr\n', 'rrlll\n', 'lrlrr\n']
Demo Output:
['3\n5\n4\n2\n1\n', '1\n2\n5\n4\n3\n', '2\n4\n5\n3\n1\n']
Note:
In the first example, the positions of stones 1, 2, 3, 4, 5 will be <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/58fdb5684df807bfcb705a9da9ce175613362b7d.png" style="max-width: 100.0%;max-height: 100.0%;"/>, respectively. So you should print the sequence: 3, 5, 4, 2, 1.
|
```python
s = input()
l, r = [], []
for i in range(len(s)):
if s[i] == 'l':
l.append(i+1)
else:
r.append(i+1)
for n in r:
print(n)
for i in range(len(l)-1,-1,-1):
print(l[i])
```
| 3
|
|
50
|
A
|
Domino piling
|
PROGRAMMING
| 800
|
[
"greedy",
"math"
] |
A. Domino piling
|
2
|
256
|
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
|
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
|
Output one number — the maximal number of dominoes, which can be placed.
|
[
"2 4\n",
"3 3\n"
] |
[
"4\n",
"4\n"
] |
none
| 500
|
[
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "2 6",
"output": "6"
},
{
"input": "2 7",
"output": "7"
},
{
"input": "2 14",
"output": "14"
},
{
"input": "2 15",
"output": "15"
},
{
"input": "1 4",
"output": "2"
},
{
"input": "2 16",
"output": "16"
},
{
"input": "3 5",
"output": "7"
},
{
"input": "3 6",
"output": "9"
},
{
"input": "3 10",
"output": "15"
},
{
"input": "3 14",
"output": "21"
},
{
"input": "3 15",
"output": "22"
},
{
"input": "3 16",
"output": "24"
},
{
"input": "5 7",
"output": "17"
},
{
"input": "16 16",
"output": "128"
},
{
"input": "15 16",
"output": "120"
},
{
"input": "2 3",
"output": "3"
},
{
"input": "15 15",
"output": "112"
},
{
"input": "14 16",
"output": "112"
},
{
"input": "11 13",
"output": "71"
},
{
"input": "5 16",
"output": "40"
},
{
"input": "8 15",
"output": "60"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "3 4",
"output": "6"
},
{
"input": "4 4",
"output": "8"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "14 15",
"output": "105"
}
] | 1,631,573,855
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 35
| 124
| 6,758,400
|
from math import floor
m,n=map(int,input().split())
area=m*n
print(floor(area/2))
|
Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
Input Specification:
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
Output Specification:
Output one number — the maximal number of dominoes, which can be placed.
Demo Input:
['2 4\n', '3 3\n']
Demo Output:
['4\n', '4\n']
Note:
none
|
```python
from math import floor
m,n=map(int,input().split())
area=m*n
print(floor(area/2))
```
| 3.956411
|
592
|
A
|
PawnChess
|
PROGRAMMING
| 1,200
|
[
"implementation"
] | null | null |
Galois is one of the strongest chess players of Byteforces. He has even invented a new variant of chess, which he named «PawnChess».
This new game is played on a board consisting of 8 rows and 8 columns. At the beginning of every game some black and white pawns are placed on the board. The number of black pawns placed is not necessarily equal to the number of white pawns placed.
Lets enumerate rows and columns with integers from 1 to 8. Rows are numbered from top to bottom, while columns are numbered from left to right. Now we denote as (*r*,<=*c*) the cell located at the row *r* and at the column *c*.
There are always two players A and B playing the game. Player A plays with white pawns, while player B plays with black ones. The goal of player A is to put any of his pawns to the row 1, while player B tries to put any of his pawns to the row 8. As soon as any of the players completes his goal the game finishes immediately and the succeeded player is declared a winner.
Player A moves first and then they alternate turns. On his move player A must choose exactly one white pawn and move it one step upward and player B (at his turn) must choose exactly one black pawn and move it one step down. Any move is possible only if the targeted cell is empty. It's guaranteed that for any scenario of the game there will always be at least one move available for any of the players.
Moving upward means that the pawn located in (*r*,<=*c*) will go to the cell (*r*<=-<=1,<=*c*), while moving down means the pawn located in (*r*,<=*c*) will go to the cell (*r*<=+<=1,<=*c*). Again, the corresponding cell must be empty, i.e. not occupied by any other pawn of any color.
Given the initial disposition of the board, determine who wins the game if both players play optimally. Note that there will always be a winner due to the restriction that for any game scenario both players will have some moves available.
|
The input consists of the board description given in eight lines, each line contains eight characters. Character 'B' is used to denote a black pawn, and character 'W' represents a white pawn. Empty cell is marked with '.'.
It's guaranteed that there will not be white pawns on the first row neither black pawns on the last row.
|
Print 'A' if player A wins the game on the given board, and 'B' if player B will claim the victory. Again, it's guaranteed that there will always be a winner on the given board.
|
[
"........\n........\n.B....B.\n....W...\n........\n..W.....\n........\n........\n",
"..B.....\n..W.....\n......B.\n........\n.....W..\n......B.\n........\n........\n"
] |
[
"A\n",
"B\n"
] |
In the first sample player A is able to complete his goal in 3 steps by always moving a pawn initially located at (4, 5). Player B needs at least 5 steps for any of his pawns to reach the row 8. Hence, player A will be the winner.
| 500
|
[
{
"input": ".BB.B.B.\nB..B..B.\n.B.BB...\nBB.....B\nBBB....B\nB..BB...\nBB.B...B\n....WWW.",
"output": "B"
},
{
"input": "B.B.BB.B\nW.WWW.WW\n.WWWWW.W\nW.BB.WBW\n.W..BBWB\nBB.WWBBB\n.W.W.WWB\nWWW..WW.",
"output": "A"
},
{
"input": "BB..BB..\nBW.W.W.B\n..B.....\n.....BB.\n.B..B..B\n........\n...BB.B.\nW.WWWW.W",
"output": "A"
},
{
"input": "BB......\nW....BBW\n........\n.B.B.BBB\n....BB..\nB....BB.\n...WWWW.\n....WW..",
"output": "A"
},
{
"input": ".B.B..B.\nB.B....B\n...B.B.B\n..B.W..B\n.BBB.B.B\nB.BB.B.B\nBB..BBBB\nW.W.W.WW",
"output": "B"
},
{
"input": "..BB....\n.B.B.B.B\n..B.B...\n..B..B.B\nWWWBWWB.\n.BB...B.\n..BBB...\n......W.",
"output": "B"
},
{
"input": "..BB....\n.WBWBWBB\n.....BBB\n..WW....\n.W.W...W\nWWW...W.\n.W....W.\nW...W.W.",
"output": "A"
},
{
"input": "....BB..\nBB......\n.B.....B\nWW..WWW.\n...BB.B.\nB...BB..\n..W..WWW\n...W...W",
"output": "B"
},
{
"input": "B...BBBB\n...BBB..\nBBWBWW.W\n.B..BB.B\nW..W..WW\nW.WW....\n........\nWW.....W",
"output": "A"
},
{
"input": ".B......\n.B....B.\n...W....\n......W.\nW.WWWW.W\nW.WW....\n..WWW...\n..W...WW",
"output": "A"
},
{
"input": "B.......\nBBB.....\n.B....B.\n.W.BWB.W\n......B.\nW..WW...\n...W....\nW...W..W",
"output": "A"
},
{
"input": ".....B..\n........\n........\n.BB..B..\n..BB....\n........\n....WWW.\n......W.",
"output": "B"
},
{
"input": "B.B...B.\n...BBBBB\n....B...\n...B...B\nB.B.B..B\n........\n........\nWWW..WW.",
"output": "B"
},
{
"input": "B.B...B.\n........\n.......B\n.BB....B\n.....W..\n.W.WW.W.\n...W.WW.\nW..WW..W",
"output": "A"
},
{
"input": "......B.\nB....B..\n...B.BB.\n...B....\n........\n..W....W\nWW......\n.W....W.",
"output": "B"
},
{
"input": ".BBB....\nB.B.B...\nB.BB.B..\nB.BB.B.B\n........\n........\nW.....W.\n..WW..W.",
"output": "B"
},
{
"input": "..B..BBB\n........\n........\n........\n...W.W..\n...W..W.\nW.......\n..W...W.",
"output": "A"
},
{
"input": "........\n.B.B....\n...B..BB\n........\n........\nW...W...\nW...W...\nW.WW.W..",
"output": "A"
},
{
"input": "B....BB.\n...B...B\n.B......\n........\n........\n........\n........\n....W..W",
"output": "B"
},
{
"input": "...BB.BB\nBB...B..\n........\n........\n........\n........\n..W..W..\n......W.",
"output": "A"
},
{
"input": "...BB...\n........\n........\n........\n........\n........\n......W.\nWW...WW.",
"output": "A"
},
{
"input": "...B.B..\n........\n........\n........\n........\n........\n........\nWWW...WW",
"output": "A"
},
{
"input": "BBBBBBB.\n........\n........\n........\n........\n........\n........\n.WWWWWWW",
"output": "A"
},
{
"input": ".BBBBBB.\nB.......\n........\n........\n........\n........\n........\n.WWWWWWW",
"output": "B"
},
{
"input": ".BBBBBBB\n........\n........\n........\n........\n........\n........\nWWWWWWW.",
"output": "A"
},
{
"input": ".BBBBBB.\n.......B\n........\n........\n........\n........\n........\nWWWWWWW.",
"output": "B"
},
{
"input": "B..BB...\n..B...B.\n.WBB...B\nBW......\nW.B...W.\n..BBW.B.\nBW..BB..\n......W.",
"output": "B"
},
{
"input": "B.BBBBBB\nB..BBB.B\nW.BB.W.B\nB.BWBB.B\nBWBWBBBB\n...BBBBB\nB.B...BB\nWW..WW.W",
"output": "B"
},
{
"input": "BBBB.BBB\nBBBB.B.B\nB.B..BBB\nB.BB.BWW\nB.BB.BBB\nB.BB.BBB\n..BW.BB.\nW.WWWWWW",
"output": "B"
},
{
"input": "BBBB.BBB\n.B....WB\nBB.B...B\nWWWW.WWB\nBB...BWW\nWWW..BBB\nW.BW.BB.\nWWWWWWW.",
"output": "B"
},
{
"input": "B.BBBBBB\nW.WWBBBW\nW.BB.WBB\nW.W.BBBW\nW.BWW.WB\nB..B..BB\nB.B.W.BB\nWWWWW.WW",
"output": "B"
},
{
"input": "BBBBBB.B\n.BBWBB.B\nWWW..B.W\n..WW.W.W\nBWB..W.W\n..BW.B.W\nB..B....\nWWWW.WWW",
"output": "B"
},
{
"input": ".B...BB.\nWBB.BWBB\n.BWBW...\n..W...B.\nWB.BWW..\nWBW.....\n.W..W.B.\n.W.W.WW.",
"output": "A"
},
{
"input": ".B..BBBB\nBB...WWB\nB..B.W.B\nWB.W...B\n...W.WW.\nW.....W.\nWB.W.W.W\n.WW...WW",
"output": "A"
},
{
"input": "B.BBBBBB\nW.BB.W.B\nW.BBW...\n..WWWW.B\n....W..B\n.WW.W..W\n.W..WW.W\nW.W....W",
"output": "A"
},
{
"input": "........\n.B......\n.W......\n........\n....B...\n........\n........\n.......W",
"output": "B"
}
] | 1,678,882,399
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 56
| 93
| 0
|
a = [input() for i in range(8)]
ra, rb = 8, 8
for j in range(8) :
for i in range(8) :
if a[i][j] == 'W' :
ra = min(ra, i)
if a[i][j] != '.' :
break
for j in range(8) :
for i in range(7,-1,-1) :
if a[i][j] == 'B' :
rb = min(rb, 7 - i)
if a[i][j] != '.' :
break
print ('A' if ra <= rb else 'B')
|
Title: PawnChess
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Galois is one of the strongest chess players of Byteforces. He has even invented a new variant of chess, which he named «PawnChess».
This new game is played on a board consisting of 8 rows and 8 columns. At the beginning of every game some black and white pawns are placed on the board. The number of black pawns placed is not necessarily equal to the number of white pawns placed.
Lets enumerate rows and columns with integers from 1 to 8. Rows are numbered from top to bottom, while columns are numbered from left to right. Now we denote as (*r*,<=*c*) the cell located at the row *r* and at the column *c*.
There are always two players A and B playing the game. Player A plays with white pawns, while player B plays with black ones. The goal of player A is to put any of his pawns to the row 1, while player B tries to put any of his pawns to the row 8. As soon as any of the players completes his goal the game finishes immediately and the succeeded player is declared a winner.
Player A moves first and then they alternate turns. On his move player A must choose exactly one white pawn and move it one step upward and player B (at his turn) must choose exactly one black pawn and move it one step down. Any move is possible only if the targeted cell is empty. It's guaranteed that for any scenario of the game there will always be at least one move available for any of the players.
Moving upward means that the pawn located in (*r*,<=*c*) will go to the cell (*r*<=-<=1,<=*c*), while moving down means the pawn located in (*r*,<=*c*) will go to the cell (*r*<=+<=1,<=*c*). Again, the corresponding cell must be empty, i.e. not occupied by any other pawn of any color.
Given the initial disposition of the board, determine who wins the game if both players play optimally. Note that there will always be a winner due to the restriction that for any game scenario both players will have some moves available.
Input Specification:
The input consists of the board description given in eight lines, each line contains eight characters. Character 'B' is used to denote a black pawn, and character 'W' represents a white pawn. Empty cell is marked with '.'.
It's guaranteed that there will not be white pawns on the first row neither black pawns on the last row.
Output Specification:
Print 'A' if player A wins the game on the given board, and 'B' if player B will claim the victory. Again, it's guaranteed that there will always be a winner on the given board.
Demo Input:
['........\n........\n.B....B.\n....W...\n........\n..W.....\n........\n........\n', '..B.....\n..W.....\n......B.\n........\n.....W..\n......B.\n........\n........\n']
Demo Output:
['A\n', 'B\n']
Note:
In the first sample player A is able to complete his goal in 3 steps by always moving a pawn initially located at (4, 5). Player B needs at least 5 steps for any of his pawns to reach the row 8. Hence, player A will be the winner.
|
```python
a = [input() for i in range(8)]
ra, rb = 8, 8
for j in range(8) :
for i in range(8) :
if a[i][j] == 'W' :
ra = min(ra, i)
if a[i][j] != '.' :
break
for j in range(8) :
for i in range(7,-1,-1) :
if a[i][j] == 'B' :
rb = min(rb, 7 - i)
if a[i][j] != '.' :
break
print ('A' if ra <= rb else 'B')
```
| 3
|
|
30
|
A
|
Accounting
|
PROGRAMMING
| 1,400
|
[
"brute force",
"math"
] |
A. Accounting
|
2
|
256
|
A long time ago in some far country lived king Copa. After the recent king's reform, he got so large powers that started to keep the books by himself.
The total income *A* of his kingdom during 0-th year is known, as well as the total income *B* during *n*-th year (these numbers can be negative — it means that there was a loss in the correspondent year).
King wants to show financial stability. To do this, he needs to find common coefficient *X* — the coefficient of income growth during one year. This coefficient should satisfy the equation:
Surely, the king is not going to do this job by himself, and demands you to find such number *X*.
It is necessary to point out that the fractional numbers are not used in kingdom's economy. That's why all input numbers as well as coefficient *X* must be integers. The number *X* may be zero or negative.
|
The input contains three integers *A*, *B*, *n* (|*A*|,<=|*B*|<=≤<=1000, 1<=≤<=*n*<=≤<=10).
|
Output the required integer coefficient *X*, or «No solution», if such a coefficient does not exist or it is fractional. If there are several possible solutions, output any of them.
|
[
"2 18 2\n",
"-1 8 3\n",
"0 0 10\n",
"1 16 5\n"
] |
[
"3",
"-2",
"5",
"No solution"
] |
none
| 500
|
[
{
"input": "2 18 2",
"output": "3"
},
{
"input": "-1 8 3",
"output": "-2"
},
{
"input": "0 0 10",
"output": "5"
},
{
"input": "1 16 5",
"output": "No solution"
},
{
"input": "0 1 2",
"output": "No solution"
},
{
"input": "3 0 4",
"output": "0"
},
{
"input": "1 1000 1",
"output": "1000"
},
{
"input": "7 896 7",
"output": "2"
},
{
"input": "4 972 1",
"output": "243"
},
{
"input": "-1 -1 5",
"output": "1"
},
{
"input": "-1 0 4",
"output": "0"
},
{
"input": "-7 0 1",
"output": "0"
},
{
"input": "-5 -5 3",
"output": "1"
},
{
"input": "-5 -5 9",
"output": "1"
},
{
"input": "-5 -5 6",
"output": "1"
},
{
"input": "-4 0 1",
"output": "0"
},
{
"input": "-5 0 3",
"output": "0"
},
{
"input": "-4 4 9",
"output": "-1"
},
{
"input": "10 0 6",
"output": "0"
},
{
"input": "-5 3 4",
"output": "No solution"
},
{
"input": "0 3 6",
"output": "No solution"
},
{
"input": "3 6 10",
"output": "No solution"
},
{
"input": "-3 7 5",
"output": "No solution"
},
{
"input": "-526 526 1",
"output": "-1"
},
{
"input": "-373 373 3",
"output": "-1"
},
{
"input": "-141 0 8",
"output": "0"
},
{
"input": "7 175 1",
"output": "25"
},
{
"input": "-5 -560 1",
"output": "112"
},
{
"input": "-1 -512 10",
"output": "No solution"
},
{
"input": "-3 -768 8",
"output": "2"
},
{
"input": "-3 -768 7",
"output": "No solution"
},
{
"input": "-3 -768 9",
"output": "No solution"
},
{
"input": "-3 -768 4",
"output": "4"
},
{
"input": "4 972 4",
"output": "No solution"
},
{
"input": "4 972 5",
"output": "3"
},
{
"input": "4 972 6",
"output": "No solution"
},
{
"input": "4 972 1",
"output": "243"
},
{
"input": "4 972 2",
"output": "No solution"
},
{
"input": "1 1000 1",
"output": "1000"
},
{
"input": "1 961 2",
"output": "31"
},
{
"input": "1 1000 3",
"output": "10"
},
{
"input": "1 625 4",
"output": "5"
},
{
"input": "4 972 5",
"output": "3"
},
{
"input": "1 729 6",
"output": "3"
},
{
"input": "7 896 7",
"output": "2"
},
{
"input": "3 768 8",
"output": "2"
},
{
"input": "1 512 9",
"output": "2"
},
{
"input": "1 1000 1",
"output": "1000"
},
{
"input": "1 961 2",
"output": "31"
},
{
"input": "1 1000 3",
"output": "10"
},
{
"input": "1 625 4",
"output": "5"
},
{
"input": "4 972 5",
"output": "3"
},
{
"input": "1 729 6",
"output": "3"
},
{
"input": "7 896 7",
"output": "2"
},
{
"input": "3 768 8",
"output": "2"
},
{
"input": "1 512 9",
"output": "2"
},
{
"input": "1 1000 1",
"output": "1000"
},
{
"input": "1 961 2",
"output": "31"
},
{
"input": "1 1000 3",
"output": "10"
},
{
"input": "1 625 4",
"output": "5"
},
{
"input": "4 972 5",
"output": "3"
},
{
"input": "1 729 6",
"output": "3"
},
{
"input": "7 896 7",
"output": "2"
},
{
"input": "3 768 8",
"output": "2"
},
{
"input": "1 512 9",
"output": "2"
},
{
"input": "1 1 5",
"output": "1"
},
{
"input": "1 1 4",
"output": "1"
},
{
"input": "1 -1 1",
"output": "-1"
}
] | 1,631,021,339
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 0
| 124
| 20,172,800
|
a,b,n = map(int,input().split())
if a == 0:
if b:
print('No solution')
else:
print(0)
elif b == 0:
if n == 0:
print('No solution')
else:
print(0)
elif b % a:
print('No solution')
else:
b //= a
q = True
for i in range(b,1 - b):
if i ** n == b:
print(i)
q = False
break
if q:
print('No solution')
|
Title: Accounting
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A long time ago in some far country lived king Copa. After the recent king's reform, he got so large powers that started to keep the books by himself.
The total income *A* of his kingdom during 0-th year is known, as well as the total income *B* during *n*-th year (these numbers can be negative — it means that there was a loss in the correspondent year).
King wants to show financial stability. To do this, he needs to find common coefficient *X* — the coefficient of income growth during one year. This coefficient should satisfy the equation:
Surely, the king is not going to do this job by himself, and demands you to find such number *X*.
It is necessary to point out that the fractional numbers are not used in kingdom's economy. That's why all input numbers as well as coefficient *X* must be integers. The number *X* may be zero or negative.
Input Specification:
The input contains three integers *A*, *B*, *n* (|*A*|,<=|*B*|<=≤<=1000, 1<=≤<=*n*<=≤<=10).
Output Specification:
Output the required integer coefficient *X*, or «No solution», if such a coefficient does not exist or it is fractional. If there are several possible solutions, output any of them.
Demo Input:
['2 18 2\n', '-1 8 3\n', '0 0 10\n', '1 16 5\n']
Demo Output:
['3', '-2', '5', 'No solution']
Note:
none
|
```python
a,b,n = map(int,input().split())
if a == 0:
if b:
print('No solution')
else:
print(0)
elif b == 0:
if n == 0:
print('No solution')
else:
print(0)
elif b % a:
print('No solution')
else:
b //= a
q = True
for i in range(b,1 - b):
if i ** n == b:
print(i)
q = False
break
if q:
print('No solution')
```
| 0
|
835
|
A
|
Key races
|
PROGRAMMING
| 800
|
[
"math"
] | null | null |
Two boys decided to compete in text typing on the site "Key races". During the competition, they have to type a text consisting of *s* characters. The first participant types one character in *v*1 milliseconds and has ping *t*1 milliseconds. The second participant types one character in *v*2 milliseconds and has ping *t*2 milliseconds.
If connection ping (delay) is *t* milliseconds, the competition passes for a participant as follows:
1. Exactly after *t* milliseconds after the start of the competition the participant receives the text to be entered. 1. Right after that he starts to type it. 1. Exactly *t* milliseconds after he ends typing all the text, the site receives information about it.
The winner is the participant whose information on the success comes earlier. If the information comes from both participants at the same time, it is considered that there is a draw.
Given the length of the text and the information about participants, determine the result of the game.
|
The first line contains five integers *s*, *v*1, *v*2, *t*1, *t*2 (1<=≤<=*s*,<=*v*1,<=*v*2,<=*t*1,<=*t*2<=≤<=1000) — the number of characters in the text, the time of typing one character for the first participant, the time of typing one character for the the second participant, the ping of the first participant and the ping of the second participant.
|
If the first participant wins, print "First". If the second participant wins, print "Second". In case of a draw print "Friendship".
|
[
"5 1 2 1 2\n",
"3 3 1 1 1\n",
"4 5 3 1 5\n"
] |
[
"First\n",
"Second\n",
"Friendship\n"
] |
In the first example, information on the success of the first participant comes in 7 milliseconds, of the second participant — in 14 milliseconds. So, the first wins.
In the second example, information on the success of the first participant comes in 11 milliseconds, of the second participant — in 5 milliseconds. So, the second wins.
In the third example, information on the success of the first participant comes in 22 milliseconds, of the second participant — in 22 milliseconds. So, it is be a draw.
| 500
|
[
{
"input": "5 1 2 1 2",
"output": "First"
},
{
"input": "3 3 1 1 1",
"output": "Second"
},
{
"input": "4 5 3 1 5",
"output": "Friendship"
},
{
"input": "1000 1000 1000 1000 1000",
"output": "Friendship"
},
{
"input": "1 1 1 1 1",
"output": "Friendship"
},
{
"input": "8 8 1 1 1",
"output": "Second"
},
{
"input": "15 14 32 65 28",
"output": "First"
},
{
"input": "894 197 325 232 902",
"output": "First"
},
{
"input": "1 2 8 8 5",
"output": "Friendship"
},
{
"input": "37 261 207 1 1000",
"output": "Friendship"
},
{
"input": "29 344 406 900 1",
"output": "Friendship"
},
{
"input": "1 2 8 9 8",
"output": "First"
},
{
"input": "2 9 8 8 9",
"output": "Friendship"
},
{
"input": "213 480 811 134 745",
"output": "First"
},
{
"input": "2 313 856 964 421",
"output": "Friendship"
},
{
"input": "1 10 2 6 10",
"output": "Friendship"
},
{
"input": "2 7 6 2 3",
"output": "Friendship"
},
{
"input": "637 324 69 612 998",
"output": "Second"
},
{
"input": "13 849 819 723 918",
"output": "Friendship"
},
{
"input": "9 5 7 8 7",
"output": "First"
},
{
"input": "6 5 7 10 4",
"output": "Friendship"
},
{
"input": "61 464 623 89 548",
"output": "First"
},
{
"input": "641 31 29 161 802",
"output": "Friendship"
},
{
"input": "3 3 1 6 9",
"output": "Friendship"
},
{
"input": "2 3 9 8 2",
"output": "Friendship"
},
{
"input": "485 117 368 567 609",
"output": "First"
},
{
"input": "4 202 512 995 375",
"output": "Friendship"
},
{
"input": "424 41 41 909 909",
"output": "Friendship"
},
{
"input": "884 913 263 641 265",
"output": "Second"
},
{
"input": "12 462 8 311 327",
"output": "Second"
},
{
"input": "436 306 266 493 580",
"output": "Second"
},
{
"input": "69 1 2 1 2",
"output": "First"
}
] | 1,583,600,783
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 1
| 93
| 0
|
s,v1,v2,t1,t2=map(int,input().split())
a=(s*v1)+2*t1
b= (s*v2)+2*t2
if (a<b):
print("First")
if (a==b):
print("Friendship")
if (a>b):
print("second")
|
Title: Key races
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two boys decided to compete in text typing on the site "Key races". During the competition, they have to type a text consisting of *s* characters. The first participant types one character in *v*1 milliseconds and has ping *t*1 milliseconds. The second participant types one character in *v*2 milliseconds and has ping *t*2 milliseconds.
If connection ping (delay) is *t* milliseconds, the competition passes for a participant as follows:
1. Exactly after *t* milliseconds after the start of the competition the participant receives the text to be entered. 1. Right after that he starts to type it. 1. Exactly *t* milliseconds after he ends typing all the text, the site receives information about it.
The winner is the participant whose information on the success comes earlier. If the information comes from both participants at the same time, it is considered that there is a draw.
Given the length of the text and the information about participants, determine the result of the game.
Input Specification:
The first line contains five integers *s*, *v*1, *v*2, *t*1, *t*2 (1<=≤<=*s*,<=*v*1,<=*v*2,<=*t*1,<=*t*2<=≤<=1000) — the number of characters in the text, the time of typing one character for the first participant, the time of typing one character for the the second participant, the ping of the first participant and the ping of the second participant.
Output Specification:
If the first participant wins, print "First". If the second participant wins, print "Second". In case of a draw print "Friendship".
Demo Input:
['5 1 2 1 2\n', '3 3 1 1 1\n', '4 5 3 1 5\n']
Demo Output:
['First\n', 'Second\n', 'Friendship\n']
Note:
In the first example, information on the success of the first participant comes in 7 milliseconds, of the second participant — in 14 milliseconds. So, the first wins.
In the second example, information on the success of the first participant comes in 11 milliseconds, of the second participant — in 5 milliseconds. So, the second wins.
In the third example, information on the success of the first participant comes in 22 milliseconds, of the second participant — in 22 milliseconds. So, it is be a draw.
|
```python
s,v1,v2,t1,t2=map(int,input().split())
a=(s*v1)+2*t1
b= (s*v2)+2*t2
if (a<b):
print("First")
if (a==b):
print("Friendship")
if (a>b):
print("second")
```
| 0
|
|
844
|
A
|
Diversity
|
PROGRAMMING
| 1,000
|
[
"greedy",
"implementation",
"strings"
] | null | null |
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
|
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
|
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
|
[
"yandex\n6\n",
"yahoo\n5\n",
"google\n7\n"
] |
[
"0\n",
"1\n",
"impossible\n"
] |
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
| 500
|
[
{
"input": "yandex\n6",
"output": "0"
},
{
"input": "yahoo\n5",
"output": "1"
},
{
"input": "google\n7",
"output": "impossible"
},
{
"input": "a\n1",
"output": "0"
},
{
"input": "z\n2",
"output": "impossible"
},
{
"input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26",
"output": "14"
},
{
"input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26",
"output": "12"
},
{
"input": "a\n3",
"output": "impossible"
},
{
"input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1",
"output": "0"
},
{
"input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4",
"output": "1"
},
{
"input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20",
"output": "18"
},
{
"input": "swmkwaruyv\n5",
"output": "0"
},
{
"input": "tnbqpsuhkczmejirvyfdolxwga\n22",
"output": "0"
},
{
"input": "abcde\n3",
"output": "0"
},
{
"input": "abb\n1",
"output": "0"
},
{
"input": "aaaa\n1",
"output": "0"
},
{
"input": "abcde\n2",
"output": "0"
},
{
"input": "yandex\n4",
"output": "0"
},
{
"input": "aaabbbccc\n1",
"output": "0"
},
{
"input": "abcd\n2",
"output": "0"
},
{
"input": "asdfgh\n2",
"output": "0"
},
{
"input": "aab\n1",
"output": "0"
},
{
"input": "mynameissako\n5",
"output": "0"
},
{
"input": "abcde\n1",
"output": "0"
},
{
"input": "abcd\n3",
"output": "0"
},
{
"input": "abcdef\n2",
"output": "0"
},
{
"input": "abcdefg\n4",
"output": "0"
},
{
"input": "abc\n1",
"output": "0"
},
{
"input": "asdafjsgljdllgjdgkl\n5",
"output": "0"
},
{
"input": "yaay\n3",
"output": "1"
},
{
"input": "yaay\n4",
"output": "2"
},
{
"input": "zzzzzz\n2",
"output": "1"
}
] | 1,504,013,348
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 41
| 61
| 0
|
# encoding: utf-8
string = input().strip()
k = int(input())
print('impossible' if len(string) < k else max(0, k - len(set(string))))
|
Title: Diversity
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
Input Specification:
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
Output Specification:
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
Demo Input:
['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n']
Demo Output:
['0\n', '1\n', 'impossible\n']
Note:
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
|
```python
# encoding: utf-8
string = input().strip()
k = int(input())
print('impossible' if len(string) < k else max(0, k - len(set(string))))
```
| 3
|
|
38
|
A
|
Army
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Army
|
2
|
256
|
The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank.
One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<=1. Reaching a certain rank *i* having not reached all the previous *i*<=-<=1 ranks is impossible.
Vasya has just reached a new rank of *a*, but he dreams of holding the rank of *b*. Find for how many more years Vasya should serve in the army until he can finally realize his dream.
|
The first input line contains an integer *n* (2<=≤<=*n*<=≤<=100). The second line contains *n*<=-<=1 integers *d**i* (1<=≤<=*d**i*<=≤<=100). The third input line contains two integers *a* and *b* (1<=≤<=*a*<=<<=*b*<=≤<=*n*). The numbers on the lines are space-separated.
|
Print the single number which is the number of years that Vasya needs to rise from rank *a* to rank *b*.
|
[
"3\n5 6\n1 2\n",
"3\n5 6\n1 3\n"
] |
[
"5\n",
"11\n"
] |
none
| 0
|
[
{
"input": "3\n5 6\n1 2",
"output": "5"
},
{
"input": "3\n5 6\n1 3",
"output": "11"
},
{
"input": "2\n55\n1 2",
"output": "55"
},
{
"input": "3\n85 78\n1 3",
"output": "163"
},
{
"input": "4\n63 4 49\n2 3",
"output": "4"
},
{
"input": "5\n93 83 42 56\n2 5",
"output": "181"
},
{
"input": "6\n22 9 87 89 57\n1 6",
"output": "264"
},
{
"input": "7\n52 36 31 23 74 78\n2 7",
"output": "242"
},
{
"input": "8\n82 14 24 5 91 49 94\n3 8",
"output": "263"
},
{
"input": "9\n12 40 69 39 59 21 59 5\n4 6",
"output": "98"
},
{
"input": "10\n95 81 32 59 71 30 50 61 100\n1 6",
"output": "338"
},
{
"input": "15\n89 55 94 4 15 69 19 60 91 77 3 94 91 62\n3 14",
"output": "617"
},
{
"input": "20\n91 1 41 51 95 67 92 35 23 70 44 91 57 50 21 8 9 71 40\n8 17",
"output": "399"
},
{
"input": "25\n70 95 21 84 97 39 12 98 53 24 78 29 84 65 70 22 100 17 69 27 62 48 35 80\n8 23",
"output": "846"
},
{
"input": "30\n35 69 50 44 19 56 86 56 98 24 21 2 61 24 85 30 2 22 57 35 59 84 12 77 92 53 50 92 9\n1 16",
"output": "730"
},
{
"input": "35\n2 34 47 15 27 61 6 88 67 20 53 65 29 68 77 5 78 86 44 98 32 81 91 79 54 84 95 23 65 97 22 33 42 87\n8 35",
"output": "1663"
},
{
"input": "40\n32 88 59 36 95 45 28 78 73 30 97 13 13 47 48 100 43 21 22 45 88 25 15 13 63 25 72 92 29 5 25 11 50 5 54 51 48 84 23\n7 26",
"output": "862"
},
{
"input": "45\n83 74 73 95 10 31 100 26 29 15 80 100 22 70 31 88 9 56 19 70 2 62 48 30 27 47 52 50 94 44 21 94 23 85 15 3 95 72 43 62 94 89 68 88\n17 40",
"output": "1061"
},
{
"input": "50\n28 8 16 29 19 82 70 51 96 84 74 72 17 69 12 21 37 21 39 3 18 66 19 49 86 96 94 93 2 90 96 84 59 88 58 15 61 33 55 22 35 54 51 29 64 68 29 38 40\n23 28",
"output": "344"
},
{
"input": "60\n24 28 25 21 43 71 64 73 71 90 51 83 69 43 75 43 78 72 56 61 99 7 23 86 9 16 16 94 23 74 18 56 20 72 13 31 75 34 35 86 61 49 4 72 84 7 65 70 66 52 21 38 6 43 69 40 73 46 5\n28 60",
"output": "1502"
},
{
"input": "70\n69 95 34 14 67 61 6 95 94 44 28 94 73 66 39 13 19 71 73 71 28 48 26 22 32 88 38 95 43 59 88 77 80 55 17 95 40 83 67 1 38 95 58 63 56 98 49 2 41 4 73 8 78 41 64 71 60 71 41 61 67 4 4 19 97 14 39 20 27\n9 41",
"output": "1767"
},
{
"input": "80\n65 15 43 6 43 98 100 16 69 98 4 54 25 40 2 35 12 23 38 29 10 89 30 6 4 8 7 96 64 43 11 49 89 38 20 59 54 85 46 16 16 89 60 54 28 37 32 34 67 9 78 30 50 87 58 53 99 48 77 3 5 6 19 99 16 20 31 10 80 76 82 56 56 83 72 81 84 60 28\n18 24",
"output": "219"
},
{
"input": "90\n61 35 100 99 67 87 42 90 44 4 81 65 29 63 66 56 53 22 55 87 39 30 34 42 27 80 29 97 85 28 81 22 50 22 24 75 67 86 78 79 94 35 13 97 48 76 68 66 94 13 82 1 22 85 5 36 86 73 65 97 43 56 35 26 87 25 74 47 81 67 73 75 99 75 53 38 70 21 66 78 38 17 57 40 93 57 68 55 1\n12 44",
"output": "1713"
},
{
"input": "95\n37 74 53 96 65 84 65 72 95 45 6 77 91 35 58 50 51 51 97 30 51 20 79 81 92 10 89 34 40 76 71 54 26 34 73 72 72 28 53 19 95 64 97 10 44 15 12 38 5 63 96 95 86 8 36 96 45 53 81 5 18 18 47 97 65 9 33 53 41 86 37 53 5 40 15 76 83 45 33 18 26 5 19 90 46 40 100 42 10 90 13 81 40 53\n6 15",
"output": "570"
},
{
"input": "96\n51 32 95 75 23 54 70 89 67 3 1 51 4 100 97 30 9 35 56 38 54 77 56 98 43 17 60 43 72 46 87 61 100 65 81 22 74 38 16 96 5 10 54 22 23 22 10 91 9 54 49 82 29 73 33 98 75 8 4 26 24 90 71 42 90 24 94 74 94 10 41 98 56 63 18 43 56 21 26 64 74 33 22 38 67 66 38 60 64 76 53 10 4 65 76\n21 26",
"output": "328"
},
{
"input": "97\n18 90 84 7 33 24 75 55 86 10 96 72 16 64 37 9 19 71 62 97 5 34 85 15 46 72 82 51 52 16 55 68 27 97 42 72 76 97 32 73 14 56 11 86 2 81 59 95 60 93 1 22 71 37 77 100 6 16 78 47 78 62 94 86 16 91 56 46 47 35 93 44 7 86 70 10 29 45 67 62 71 61 74 39 36 92 24 26 65 14 93 92 15 28 79 59\n6 68",
"output": "3385"
},
{
"input": "98\n32 47 26 86 43 42 79 72 6 68 40 46 29 80 24 89 29 7 21 56 8 92 13 33 50 79 5 7 84 85 24 23 1 80 51 21 26 55 96 51 24 2 68 98 81 88 57 100 64 84 54 10 14 2 74 1 89 71 1 20 84 85 17 31 42 58 69 67 48 60 97 90 58 10 21 29 2 21 60 61 68 89 77 39 57 18 61 44 67 100 33 74 27 40 83 29 6\n8 77",
"output": "3319"
},
{
"input": "99\n46 5 16 66 53 12 84 89 26 27 35 68 41 44 63 17 88 43 80 15 59 1 42 50 53 34 75 16 16 55 92 30 28 11 12 71 27 65 11 28 86 47 24 10 60 47 7 53 16 75 6 49 56 66 70 3 20 78 75 41 38 57 89 23 16 74 30 39 1 32 49 84 9 33 25 95 75 45 54 59 17 17 29 40 79 96 47 11 69 86 73 56 91 4 87 47 31 24\n23 36",
"output": "514"
},
{
"input": "100\n63 65 21 41 95 23 3 4 12 23 95 50 75 63 58 34 71 27 75 31 23 94 96 74 69 34 43 25 25 55 44 19 43 86 68 17 52 65 36 29 72 96 84 25 84 23 71 54 6 7 71 7 21 100 99 58 93 35 62 47 36 70 68 9 75 13 35 70 76 36 62 22 52 51 2 87 66 41 54 35 78 62 30 35 65 44 74 93 78 37 96 70 26 32 71 27 85 85 63\n43 92",
"output": "2599"
},
{
"input": "51\n85 38 22 38 42 36 55 24 36 80 49 15 66 91 88 61 46 82 1 61 89 92 6 56 28 8 46 80 56 90 91 38 38 17 69 64 57 68 13 44 45 38 8 72 61 39 87 2 73 88\n15 27",
"output": "618"
},
{
"input": "2\n3\n1 2",
"output": "3"
},
{
"input": "5\n6 8 22 22\n2 3",
"output": "8"
},
{
"input": "6\n3 12 27 28 28\n3 4",
"output": "27"
},
{
"input": "9\n1 2 2 2 2 3 3 5\n3 7",
"output": "9"
},
{
"input": "10\n1 1 1 1 1 1 1 1 1\n6 8",
"output": "2"
},
{
"input": "20\n1 1 1 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3 3\n5 17",
"output": "23"
},
{
"input": "25\n1 1 1 4 5 6 8 11 11 11 11 12 13 14 14 14 15 16 16 17 17 17 19 19\n4 8",
"output": "23"
},
{
"input": "35\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2\n30 31",
"output": "2"
},
{
"input": "45\n1 1 1 1 2 2 2 2 2 2 2 3 3 3 3 3 3 4 5 5 5 5 6 6 6 6 6 6 6 7 7 7 7 8 8 8 9 9 9 9 9 10 10 10\n42 45",
"output": "30"
},
{
"input": "50\n1 8 8 13 14 15 15 16 19 21 22 24 26 31 32 37 45 47 47 47 50 50 51 54 55 56 58 61 61 61 63 63 64 66 66 67 67 70 71 80 83 84 85 92 92 94 95 95 100\n4 17",
"output": "285"
},
{
"input": "60\n1 2 4 4 4 6 6 8 9 10 10 13 14 18 20 20 21 22 23 23 26 29 30 32 33 34 35 38 40 42 44 44 46 48 52 54 56 56 60 60 66 67 68 68 69 73 73 74 80 80 81 81 82 84 86 86 87 89 89\n56 58",
"output": "173"
},
{
"input": "70\n1 2 3 3 4 5 5 7 7 7 8 8 8 8 9 9 10 12 12 12 12 13 16 16 16 16 16 16 17 17 18 18 20 20 21 23 24 25 25 26 29 29 29 29 31 32 32 34 35 36 36 37 37 38 39 39 40 40 40 40 41 41 42 43 44 44 44 45 45\n62 65",
"output": "126"
},
{
"input": "80\n1 1 1 1 1 1 1 1 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4 4 4 5 5 5 5 5 5 5 6 7 7 7 7 7 7 8 8 8 8 9 9 9 9 9 9 9 9 9 10 10 10 10 10 10 10 10 10 11 11 11 11 11 11 11 12 12 12 12 12 12 12 12\n17 65",
"output": "326"
},
{
"input": "90\n1 1 3 5 8 9 10 11 11 11 11 12 13 14 15 15 15 16 16 19 19 20 22 23 24 25 25 28 29 29 30 31 33 34 35 37 37 38 41 43 43 44 45 47 51 54 55 56 58 58 59 59 60 62 66 67 67 67 68 68 69 70 71 72 73 73 76 77 77 78 78 78 79 79 79 82 83 84 85 85 87 87 89 93 93 93 95 99 99\n28 48",
"output": "784"
},
{
"input": "95\n2 2 3 3 4 6 6 7 7 7 9 10 12 12 12 12 13 14 15 16 17 18 20 20 20 20 21 21 21 21 22 22 22 22 22 23 23 23 25 26 26 27 27 27 28 29 29 30 30 31 32 33 34 36 37 37 38 39 39 39 42 43 43 43 45 47 48 50 50 51 52 53 54 54 54 55 55 55 58 59 60 61 61 61 61 62 62 63 64 65 66 67 67 67\n64 93",
"output": "1636"
},
{
"input": "96\n1 1 2 3 3 5 8 9 9 10 10 10 11 11 11 11 11 12 13 13 13 14 15 15 16 16 17 17 17 17 18 18 20 20 20 21 21 21 23 24 24 25 25 26 27 27 27 27 29 29 29 30 30 30 32 32 32 32 32 32 33 33 34 34 34 35 35 35 36 36 37 37 37 38 39 40 41 41 41 41 42 42 43 43 45 45 45 46 46 47 47 49 50 52 52\n76 96",
"output": "898"
},
{
"input": "98\n2 3 4 4 5 7 8 10 10 10 11 11 12 12 12 12 13 14 15 15 16 16 18 19 19 20 21 21 21 21 22 23 24 25 26 26 27 27 27 27 29 29 30 30 31 31 37 40 40 40 41 41 41 42 43 44 44 44 46 46 47 49 49 50 50 50 51 53 55 55 56 56 56 56 56 57 57 58 59 60 60 60 62 62 63 64 64 64 65 66 66 67 68 70 70 71 71\n8 90",
"output": "3016"
},
{
"input": "99\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n66 95",
"output": "29"
},
{
"input": "100\n1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 3 3 3 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 8 8 8 8 9 9 9 9 10 10 10 10 11 11 11 11 12 12 12 13 13 13 13 13 13 13 13 13 13 14 14 14 14 14 14 15 15 15 15 15 15 16 16 16 17 17\n39 52",
"output": "82"
},
{
"input": "51\n5 7 9 16 19 25 26 29 29 30 31 32 32 41 43 44 47 49 50 50 51 52 54 55 56 63 64 66 67 70 74 74 77 78 79 80 80 85 86 87 89 89 90 92 93 94 94 95 95 97\n3 44",
"output": "2268"
}
] | 1,588,832,419
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 50
| 218
| 6,656,000
|
n = int(input())
grades = [int(i) for i in input().split()]
a, b = map(int, input().split())
k = 0
for i in range(a, b):
k += grades[i-1]
print(k)
|
Title: Army
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank.
One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<=1. Reaching a certain rank *i* having not reached all the previous *i*<=-<=1 ranks is impossible.
Vasya has just reached a new rank of *a*, but he dreams of holding the rank of *b*. Find for how many more years Vasya should serve in the army until he can finally realize his dream.
Input Specification:
The first input line contains an integer *n* (2<=≤<=*n*<=≤<=100). The second line contains *n*<=-<=1 integers *d**i* (1<=≤<=*d**i*<=≤<=100). The third input line contains two integers *a* and *b* (1<=≤<=*a*<=<<=*b*<=≤<=*n*). The numbers on the lines are space-separated.
Output Specification:
Print the single number which is the number of years that Vasya needs to rise from rank *a* to rank *b*.
Demo Input:
['3\n5 6\n1 2\n', '3\n5 6\n1 3\n']
Demo Output:
['5\n', '11\n']
Note:
none
|
```python
n = int(input())
grades = [int(i) for i in input().split()]
a, b = map(int, input().split())
k = 0
for i in range(a, b):
k += grades[i-1]
print(k)
```
| 3.933102
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,604,393,272
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 30
| 280
| 0
|
s = input()
ts = 0
tz = 0
for i in range(len(s)):
if 'z'>=s[i]>='a':
ts += 1
else:
tz += 1
if ts>=tz:
print(s.lower())
else:
print(s.upper())
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
s = input()
ts = 0
tz = 0
for i in range(len(s)):
if 'z'>=s[i]>='a':
ts += 1
else:
tz += 1
if ts>=tz:
print(s.lower())
else:
print(s.upper())
```
| 3.93
|
965
|
A
|
Paper Airplanes
|
PROGRAMMING
| 800
|
[
"math"
] | null | null |
To make a paper airplane, one has to use a rectangular piece of paper. From a sheet of standard size you can make $s$ airplanes.
A group of $k$ people decided to make $n$ airplanes each. They are going to buy several packs of paper, each of them containing $p$ sheets, and then distribute the sheets between the people. Each person should have enough sheets to make $n$ airplanes. How many packs should they buy?
|
The only line contains four integers $k$, $n$, $s$, $p$ ($1 \le k, n, s, p \le 10^4$) — the number of people, the number of airplanes each should make, the number of airplanes that can be made using one sheet and the number of sheets in one pack, respectively.
|
Print a single integer — the minimum number of packs they should buy.
|
[
"5 3 2 3\n",
"5 3 100 1\n"
] |
[
"4\n",
"5\n"
] |
In the first sample they have to buy $4$ packs of paper: there will be $12$ sheets in total, and giving $2$ sheets to each person is enough to suit everyone's needs.
In the second sample they have to buy a pack for each person as they can't share sheets.
| 500
|
[
{
"input": "5 3 2 3",
"output": "4"
},
{
"input": "5 3 100 1",
"output": "5"
},
{
"input": "10000 10000 1 1",
"output": "100000000"
},
{
"input": "1 1 10000 10000",
"output": "1"
},
{
"input": "300 300 21 23",
"output": "196"
},
{
"input": "300 2 37 51",
"output": "6"
},
{
"input": "2 400 23 57",
"output": "1"
},
{
"input": "1 1 1 1",
"output": "1"
},
{
"input": "10000 10000 3 2",
"output": "16670000"
},
{
"input": "1 2 1 2",
"output": "1"
},
{
"input": "1 1 2 2",
"output": "1"
},
{
"input": "1 1 10 10",
"output": "1"
},
{
"input": "5324 5439 32 13",
"output": "69622"
},
{
"input": "9000 1 2432 1",
"output": "9000"
},
{
"input": "230 1234 9124 23",
"output": "10"
},
{
"input": "11 1 1 1",
"output": "11"
},
{
"input": "6246 8489 1227 9",
"output": "4858"
},
{
"input": "9 20 5 7",
"output": "6"
}
] | 1,525,352,025
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 18
| 93
| 7,065,600
|
k, n, s, p = input().split()[:4]
k, n, s, p = int(k), int(n), int(s), int(p)
tmp = n / s
if not tmp.is_integer():
tmp = int(tmp) + 1
else:
tmp = int(tmp)
tmp *= k
res = tmp / p
if not res.is_integer():
res = int(res) + 1
else:
res = int(res)
print(res)
|
Title: Paper Airplanes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
To make a paper airplane, one has to use a rectangular piece of paper. From a sheet of standard size you can make $s$ airplanes.
A group of $k$ people decided to make $n$ airplanes each. They are going to buy several packs of paper, each of them containing $p$ sheets, and then distribute the sheets between the people. Each person should have enough sheets to make $n$ airplanes. How many packs should they buy?
Input Specification:
The only line contains four integers $k$, $n$, $s$, $p$ ($1 \le k, n, s, p \le 10^4$) — the number of people, the number of airplanes each should make, the number of airplanes that can be made using one sheet and the number of sheets in one pack, respectively.
Output Specification:
Print a single integer — the minimum number of packs they should buy.
Demo Input:
['5 3 2 3\n', '5 3 100 1\n']
Demo Output:
['4\n', '5\n']
Note:
In the first sample they have to buy $4$ packs of paper: there will be $12$ sheets in total, and giving $2$ sheets to each person is enough to suit everyone's needs.
In the second sample they have to buy a pack for each person as they can't share sheets.
|
```python
k, n, s, p = input().split()[:4]
k, n, s, p = int(k), int(n), int(s), int(p)
tmp = n / s
if not tmp.is_integer():
tmp = int(tmp) + 1
else:
tmp = int(tmp)
tmp *= k
res = tmp / p
if not res.is_integer():
res = int(res) + 1
else:
res = int(res)
print(res)
```
| 3
|
|
271
|
A
|
Beautiful Year
|
PROGRAMMING
| 800
|
[
"brute force"
] | null | null |
It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits.
Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits.
|
The single line contains integer *y* (1000<=≤<=*y*<=≤<=9000) — the year number.
|
Print a single integer — the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists.
|
[
"1987\n",
"2013\n"
] |
[
"2013\n",
"2014\n"
] |
none
| 500
|
[
{
"input": "1987",
"output": "2013"
},
{
"input": "2013",
"output": "2014"
},
{
"input": "1000",
"output": "1023"
},
{
"input": "1001",
"output": "1023"
},
{
"input": "1234",
"output": "1235"
},
{
"input": "5555",
"output": "5601"
},
{
"input": "9000",
"output": "9012"
},
{
"input": "1111",
"output": "1203"
},
{
"input": "8999",
"output": "9012"
},
{
"input": "4572",
"output": "4573"
},
{
"input": "6666",
"output": "6701"
},
{
"input": "2001",
"output": "2013"
},
{
"input": "3000",
"output": "3012"
},
{
"input": "7712",
"output": "7801"
},
{
"input": "8088",
"output": "8091"
},
{
"input": "1594",
"output": "1596"
},
{
"input": "6016",
"output": "6017"
},
{
"input": "8800",
"output": "8901"
},
{
"input": "3331",
"output": "3401"
},
{
"input": "5090",
"output": "5091"
},
{
"input": "2342",
"output": "2345"
},
{
"input": "2334",
"output": "2340"
},
{
"input": "1123",
"output": "1203"
},
{
"input": "8989",
"output": "9012"
},
{
"input": "8977",
"output": "9012"
},
{
"input": "6869",
"output": "6870"
},
{
"input": "8999",
"output": "9012"
}
] | 1,691,516,922
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 27
| 92
| 0
|
y = int(input())
while True:
y += 1
flag = True
for i in str(y):
if str(y).count(i) > 1:
flag = False;
if flag:
print(y)
break
|
Title: Beautiful Year
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits.
Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits.
Input Specification:
The single line contains integer *y* (1000<=≤<=*y*<=≤<=9000) — the year number.
Output Specification:
Print a single integer — the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists.
Demo Input:
['1987\n', '2013\n']
Demo Output:
['2013\n', '2014\n']
Note:
none
|
```python
y = int(input())
while True:
y += 1
flag = True
for i in str(y):
if str(y).count(i) > 1:
flag = False;
if flag:
print(y)
break
```
| 3
|
|
1,004
|
A
|
Sonya and Hotels
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Sonya decided that having her own hotel business is the best way of earning money because she can profit and rest wherever she wants.
The country where Sonya lives is an endless line. There is a city in each integer coordinate on this line. She has $n$ hotels, where the $i$-th hotel is located in the city with coordinate $x_i$. Sonya is a smart girl, so she does not open two or more hotels in the same city.
Sonya understands that her business needs to be expanded by opening new hotels, so she decides to build one more. She wants to make the minimum distance from this hotel to all others to be equal to $d$. The girl understands that there are many possible locations to construct such a hotel. Thus she wants to know the number of possible coordinates of the cities where she can build a new hotel.
Because Sonya is lounging in a jacuzzi in one of her hotels, she is asking you to find the number of cities where she can build a new hotel so that the minimum distance from the original $n$ hotels to the new one is equal to $d$.
|
The first line contains two integers $n$ and $d$ ($1\leq n\leq 100$, $1\leq d\leq 10^9$) — the number of Sonya's hotels and the needed minimum distance from a new hotel to all others.
The second line contains $n$ different integers in strictly increasing order $x_1, x_2, \ldots, x_n$ ($-10^9\leq x_i\leq 10^9$) — coordinates of Sonya's hotels.
|
Print the number of cities where Sonya can build a new hotel so that the minimum distance from this hotel to all others is equal to $d$.
|
[
"4 3\n-3 2 9 16\n",
"5 2\n4 8 11 18 19\n"
] |
[
"6\n",
"5\n"
] |
In the first example, there are $6$ possible cities where Sonya can build a hotel. These cities have coordinates $-6$, $5$, $6$, $12$, $13$, and $19$.
In the second example, there are $5$ possible cities where Sonya can build a hotel. These cities have coordinates $2$, $6$, $13$, $16$, and $21$.
| 500
|
[
{
"input": "4 3\n-3 2 9 16",
"output": "6"
},
{
"input": "5 2\n4 8 11 18 19",
"output": "5"
},
{
"input": "10 10\n-67 -59 -49 -38 -8 20 41 59 74 83",
"output": "8"
},
{
"input": "10 10\n0 20 48 58 81 95 111 137 147 159",
"output": "9"
},
{
"input": "100 1\n0 1 2 3 4 5 7 8 10 11 12 13 14 15 16 17 19 21 22 23 24 25 26 27 28 30 32 33 36 39 40 41 42 46 48 53 54 55 59 60 61 63 65 68 70 71 74 75 76 79 80 81 82 84 88 89 90 91 93 94 96 97 98 100 101 102 105 106 107 108 109 110 111 113 114 115 116 117 118 120 121 122 125 126 128 131 132 133 134 135 137 138 139 140 143 144 146 147 148 149",
"output": "47"
},
{
"input": "1 1000000000\n-1000000000",
"output": "2"
},
{
"input": "2 1000000000\n-1000000000 1000000000",
"output": "3"
},
{
"input": "100 2\n1 3 5 6 8 9 12 13 14 17 18 21 22 23 24 25 26 27 29 30 34 35 36 39 41 44 46 48 52 53 55 56 57 59 61 63 64 66 68 69 70 71 72 73 75 76 77 79 80 81 82 87 88 91 92 93 94 95 96 97 99 100 102 103 104 106 109 110 111 112 113 114 115 117 118 119 120 122 124 125 127 128 129 130 131 132 133 134 136 137 139 140 141 142 143 145 146 148 149 150",
"output": "6"
},
{
"input": "100 3\n0 1 3 6 7 8 9 10 13 14 16 17 18 20 21 22 24 26 27 30 33 34 35 36 37 39 42 43 44 45 46 48 53 54 55 56 57 58 61 63 64 65 67 69 70 72 73 76 77 78 79 81 82 83 85 86 87 88 90 92 93 95 96 97 98 99 100 101 104 105 108 109 110 113 114 115 116 118 120 121 123 124 125 128 130 131 132 133 134 135 136 137 139 140 141 142 146 147 148 150",
"output": "2"
},
{
"input": "1 1000000000\n1000000000",
"output": "2"
},
{
"input": "10 2\n-93 -62 -53 -42 -38 11 57 58 87 94",
"output": "17"
},
{
"input": "2 500000000\n-1000000000 1000000000",
"output": "4"
},
{
"input": "100 10\n-489 -476 -445 -432 -430 -421 -420 -418 -412 -411 -404 -383 -356 -300 -295 -293 -287 -276 -265 -263 -258 -251 -249 -246 -220 -219 -205 -186 -166 -157 -143 -137 -136 -130 -103 -86 -80 -69 -67 -55 -43 -41 -40 -26 -19 -9 16 29 41 42 54 76 84 97 98 99 101 115 134 151 157 167 169 185 197 204 208 226 227 232 234 249 259 266 281 282 293 298 300 306 308 313 319 328 331 340 341 344 356 362 366 380 390 399 409 411 419 444 455 498",
"output": "23"
},
{
"input": "1 1000000000\n999999999",
"output": "2"
},
{
"input": "1 1\n-5",
"output": "2"
},
{
"input": "2 1\n-1000000000 1000000000",
"output": "4"
},
{
"input": "1 2\n1",
"output": "2"
},
{
"input": "4 5\n0 20 40 60",
"output": "8"
},
{
"input": "1 1\n-10",
"output": "2"
},
{
"input": "1 1\n-1000000000",
"output": "2"
},
{
"input": "1 1000000000\n0",
"output": "2"
},
{
"input": "1 2\n-10",
"output": "2"
},
{
"input": "1 1\n2",
"output": "2"
},
{
"input": "1 5\n-100",
"output": "2"
},
{
"input": "2 1000000000\n999999999 1000000000",
"output": "2"
},
{
"input": "2 2\n0 5",
"output": "4"
},
{
"input": "1 2\n-5",
"output": "2"
},
{
"input": "1 1\n1",
"output": "2"
},
{
"input": "1 5\n-20",
"output": "2"
},
{
"input": "2 100000000\n-1000000000 1000000000",
"output": "4"
},
{
"input": "1 1000000000\n147483641",
"output": "2"
},
{
"input": "3 3\n1 8 9",
"output": "4"
},
{
"input": "2 1\n1 1000000000",
"output": "4"
},
{
"input": "1 2\n-4",
"output": "2"
},
{
"input": "2 1\n-1000000000 -1",
"output": "4"
}
] | 1,621,483,147
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 2
| 93
| 0
|
n,d=map(int,input().split())
x=list(map(int,input().split()))
a=abs(min(x))
b=max(x)
print(b//a+1)
|
Title: Sonya and Hotels
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sonya decided that having her own hotel business is the best way of earning money because she can profit and rest wherever she wants.
The country where Sonya lives is an endless line. There is a city in each integer coordinate on this line. She has $n$ hotels, where the $i$-th hotel is located in the city with coordinate $x_i$. Sonya is a smart girl, so she does not open two or more hotels in the same city.
Sonya understands that her business needs to be expanded by opening new hotels, so she decides to build one more. She wants to make the minimum distance from this hotel to all others to be equal to $d$. The girl understands that there are many possible locations to construct such a hotel. Thus she wants to know the number of possible coordinates of the cities where she can build a new hotel.
Because Sonya is lounging in a jacuzzi in one of her hotels, she is asking you to find the number of cities where she can build a new hotel so that the minimum distance from the original $n$ hotels to the new one is equal to $d$.
Input Specification:
The first line contains two integers $n$ and $d$ ($1\leq n\leq 100$, $1\leq d\leq 10^9$) — the number of Sonya's hotels and the needed minimum distance from a new hotel to all others.
The second line contains $n$ different integers in strictly increasing order $x_1, x_2, \ldots, x_n$ ($-10^9\leq x_i\leq 10^9$) — coordinates of Sonya's hotels.
Output Specification:
Print the number of cities where Sonya can build a new hotel so that the minimum distance from this hotel to all others is equal to $d$.
Demo Input:
['4 3\n-3 2 9 16\n', '5 2\n4 8 11 18 19\n']
Demo Output:
['6\n', '5\n']
Note:
In the first example, there are $6$ possible cities where Sonya can build a hotel. These cities have coordinates $-6$, $5$, $6$, $12$, $13$, and $19$.
In the second example, there are $5$ possible cities where Sonya can build a hotel. These cities have coordinates $2$, $6$, $13$, $16$, and $21$.
|
```python
n,d=map(int,input().split())
x=list(map(int,input().split()))
a=abs(min(x))
b=max(x)
print(b//a+1)
```
| 0
|
|
6
|
C
|
Alice, Bob and Chocolate
|
PROGRAMMING
| 1,200
|
[
"greedy",
"two pointers"
] |
C. Alice, Bob and Chocolate
|
2
|
64
|
Alice and Bob like games. And now they are ready to start a new game. They have placed *n* chocolate bars in a line. Alice starts to eat chocolate bars one by one from left to right, and Bob — from right to left. For each chocololate bar the time, needed for the player to consume it, is known (Alice and Bob eat them with equal speed). When the player consumes a chocolate bar, he immediately starts with another. It is not allowed to eat two chocolate bars at the same time, to leave the bar unfinished and to make pauses. If both players start to eat the same bar simultaneously, Bob leaves it to Alice as a true gentleman.
How many bars each of the players will consume?
|
The first line contains one integer *n* (1<=≤<=*n*<=≤<=105) — the amount of bars on the table. The second line contains a sequence *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=1000), where *t**i* is the time (in seconds) needed to consume the *i*-th bar (in the order from left to right).
|
Print two numbers *a* and *b*, where *a* is the amount of bars consumed by Alice, and *b* is the amount of bars consumed by Bob.
|
[
"5\n2 9 8 2 7\n"
] |
[
"2 3\n"
] |
none
| 0
|
[
{
"input": "5\n2 9 8 2 7",
"output": "2 3"
},
{
"input": "1\n1",
"output": "1 0"
},
{
"input": "2\n1 1",
"output": "1 1"
},
{
"input": "3\n1 1 1",
"output": "2 1"
},
{
"input": "4\n1 1 1 1",
"output": "2 2"
},
{
"input": "1\n6",
"output": "1 0"
},
{
"input": "2\n8 2",
"output": "1 1"
},
{
"input": "3\n6 8 4",
"output": "1 2"
},
{
"input": "4\n4 3 2 8",
"output": "3 1"
},
{
"input": "5\n1 9 8 2 7",
"output": "2 3"
},
{
"input": "6\n1 4 7 3 2 1",
"output": "3 3"
},
{
"input": "11\n7 9 1 8 7 1 7 1 4 8 1",
"output": "4 7"
},
{
"input": "12\n4 2 7 1 9 5 6 2 7 8 5 7",
"output": "7 5"
},
{
"input": "13\n9 9 9 9 9 9 9 9 9 9 9 9 9",
"output": "7 6"
}
] | 1,684,326,256
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 2
| 92
| 0
|
n=int(input())
nums = list(map(int,input().split()))
from_left = 0
from_right = 0
j=n-1
for i in range(n):
from_left = from_left+nums[i]
while j!=i and from_left>=from_right+nums[j]:
from_right=from_right+nums[j]
j=j-1
# print(i,j)
if i==j:
j=j-1
break
if i+1==j:
# j=j+1
break
# print(j)
print(i+1,n-(n-j)+1)
|
Title: Alice, Bob and Chocolate
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
Alice and Bob like games. And now they are ready to start a new game. They have placed *n* chocolate bars in a line. Alice starts to eat chocolate bars one by one from left to right, and Bob — from right to left. For each chocololate bar the time, needed for the player to consume it, is known (Alice and Bob eat them with equal speed). When the player consumes a chocolate bar, he immediately starts with another. It is not allowed to eat two chocolate bars at the same time, to leave the bar unfinished and to make pauses. If both players start to eat the same bar simultaneously, Bob leaves it to Alice as a true gentleman.
How many bars each of the players will consume?
Input Specification:
The first line contains one integer *n* (1<=≤<=*n*<=≤<=105) — the amount of bars on the table. The second line contains a sequence *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=1000), where *t**i* is the time (in seconds) needed to consume the *i*-th bar (in the order from left to right).
Output Specification:
Print two numbers *a* and *b*, where *a* is the amount of bars consumed by Alice, and *b* is the amount of bars consumed by Bob.
Demo Input:
['5\n2 9 8 2 7\n']
Demo Output:
['2 3\n']
Note:
none
|
```python
n=int(input())
nums = list(map(int,input().split()))
from_left = 0
from_right = 0
j=n-1
for i in range(n):
from_left = from_left+nums[i]
while j!=i and from_left>=from_right+nums[j]:
from_right=from_right+nums[j]
j=j-1
# print(i,j)
if i==j:
j=j-1
break
if i+1==j:
# j=j+1
break
# print(j)
print(i+1,n-(n-j)+1)
```
| 0
|
617
|
A
|
Elephant
|
PROGRAMMING
| 800
|
[
"math"
] | null | null |
An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=><=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house.
|
The first line of the input contains an integer *x* (1<=≤<=*x*<=≤<=1<=000<=000) — The coordinate of the friend's house.
|
Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*.
|
[
"5\n",
"12\n"
] |
[
"1\n",
"3\n"
] |
In the first sample the elephant needs to make one step of length 5 to reach the point *x*.
In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
| 500
|
[
{
"input": "5",
"output": "1"
},
{
"input": "12",
"output": "3"
},
{
"input": "999999",
"output": "200000"
},
{
"input": "41",
"output": "9"
},
{
"input": "1000000",
"output": "200000"
},
{
"input": "1",
"output": "1"
},
{
"input": "2",
"output": "1"
},
{
"input": "3",
"output": "1"
},
{
"input": "4",
"output": "1"
},
{
"input": "534204",
"output": "106841"
},
{
"input": "469569",
"output": "93914"
},
{
"input": "502877",
"output": "100576"
},
{
"input": "942212",
"output": "188443"
},
{
"input": "97",
"output": "20"
},
{
"input": "53",
"output": "11"
},
{
"input": "89",
"output": "18"
},
{
"input": "574",
"output": "115"
},
{
"input": "716",
"output": "144"
},
{
"input": "729",
"output": "146"
},
{
"input": "8901",
"output": "1781"
},
{
"input": "3645",
"output": "729"
},
{
"input": "4426",
"output": "886"
},
{
"input": "46573",
"output": "9315"
},
{
"input": "86380",
"output": "17276"
},
{
"input": "94190",
"output": "18838"
},
{
"input": "999990",
"output": "199998"
},
{
"input": "999991",
"output": "199999"
},
{
"input": "999992",
"output": "199999"
},
{
"input": "999993",
"output": "199999"
},
{
"input": "999994",
"output": "199999"
},
{
"input": "999995",
"output": "199999"
},
{
"input": "999996",
"output": "200000"
},
{
"input": "999997",
"output": "200000"
},
{
"input": "999998",
"output": "200000"
}
] | 1,699,241,879
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 77
| 0
|
def ex(n):
chod = [1, 2, 3, 4, 5]
if n in chod:
return 1
k = 4
final = 0
while True:
if n - chod[k] == 0:
return final + 1
elif n - chod[k] > 0:
final += 1
n = n - chod[k]
else:
k -= 1
n = int(input())
print(ex(n))
|
Title: Elephant
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=><=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house.
Input Specification:
The first line of the input contains an integer *x* (1<=≤<=*x*<=≤<=1<=000<=000) — The coordinate of the friend's house.
Output Specification:
Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*.
Demo Input:
['5\n', '12\n']
Demo Output:
['1\n', '3\n']
Note:
In the first sample the elephant needs to make one step of length 5 to reach the point *x*.
In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
|
```python
def ex(n):
chod = [1, 2, 3, 4, 5]
if n in chod:
return 1
k = 4
final = 0
while True:
if n - chod[k] == 0:
return final + 1
elif n - chod[k] > 0:
final += 1
n = n - chod[k]
else:
k -= 1
n = int(input())
print(ex(n))
```
| 3
|
|
57
|
B
|
Martian Architecture
|
PROGRAMMING
| 1,600
|
[
"implementation"
] |
B. Martian Architecture
|
2
|
256
|
Chris the Rabbit found the traces of an ancient Martian civilization. The brave astronomer managed to see through a small telescope an architecture masterpiece — "A Road to the Sun". The building stands on cubical stones of the same size. The foundation divides the entire "road" into cells, into which the cubical stones are fit tightly. Thus, to any cell of the foundation a coordinate can be assigned. To become the leader of the tribe, a Martian should build a Road to the Sun, that is to build from those cubical stones on a given foundation a stairway. The stairway should be described by the number of stones in the initial coordinate and the coordinates of the stairway's beginning and end. Each following cell in the coordinate's increasing order should contain one cubical stone more than the previous one. At that if the cell has already got stones, they do not count in this building process, the stairways were simply built on them. In other words, let us assume that a stairway is built with the initial coordinate of *l*, the final coordinate of *r* and the number of stones in the initial coordinate *x*. That means that *x* stones will be added in the cell *l*, *x*<=+<=1 stones will be added in the cell *l*<=+<=1, ..., *x*<=+<=*r*<=-<=*l* stones will be added in the cell *r*.
Chris managed to find an ancient manuscript, containing the descriptions of all the stairways. Now he wants to compare the data to be sure that he has really found "A Road to the Sun". For that he chose some road cells and counted the total number of cubical stones that has been accumulated throughout the Martian history and then asked you to count using the manuscript to what the sum should ideally total.
|
The first line contains three space-separated integers: *n*,<=*m*,<=*k* (1<=≤<=*n*,<=*m*<=≤<=105,<=1<=≤<=*k*<=≤<=*min*(*n*,<=100)) which is the number of cells, the number of "Roads to the Sun" and the number of cells in the query correspondingly. Each of the following *m* roads contain three space-separated integers: *a**i*,<=*b**i*,<=*c**i* (1<=≤<=*a**i*<=≤<=*b**i*<=≤<=*n*,<=1<=≤<=*c**i*<=≤<=1000) which are the stairway's description, its beginning, end and the initial cell's height. Then follow a line, containing *k* different space-separated integers *b**i*. All these numbers ranging from 1 to *n* are cells, the number of stones in which interests Chris.
|
You have to print a single number on a single line which is the sum of stones in all the cells Chris is interested in.
Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preffered to use cin (also you may use %I64d).
|
[
"5 2 1\n1 5 1\n2 4 1\n3\n",
"3 2 1\n1 3 1\n1 3 1\n2\n",
"3 2 1\n1 3 1\n1 3 1\n3\n"
] |
[
"5\n",
"4\n",
"6\n"
] |
none
| 1,000
|
[
{
"input": "5 2 1\n1 5 1\n2 4 1\n3",
"output": "5"
},
{
"input": "3 2 1\n1 3 1\n1 3 1\n2",
"output": "4"
},
{
"input": "3 2 1\n1 3 1\n1 3 1\n3",
"output": "6"
},
{
"input": "10 10 3\n6 10 74\n7 9 35\n3 6 63\n2 4 80\n2 10 78\n10 10 13\n4 10 16\n1 2 13\n3 7 17\n4 6 67\n9 8 10",
"output": "635"
},
{
"input": "10 10 6\n5 9 618\n4 8 717\n4 7 815\n7 10 22\n4 6 186\n8 10 205\n2 6 424\n5 10 267\n2 3 512\n1 6 967\n5 8 9 1 3 2",
"output": "11745"
},
{
"input": "10 10 1\n4 9 6\n4 5 5\n1 5 6\n4 5 6\n8 10 5\n7 10 1\n2 3 6\n4 8 4\n5 8 7\n7 8 6\n1",
"output": "6"
},
{
"input": "100 10 19\n75 86 9\n3 16 49\n12 94 58\n67 78 98\n32 54 30\n34 36 46\n39 89 4\n7 75 38\n6 85 73\n11 66 79\n91 69 65 43 82 19 96 50 97 20 58 49 8 83 85 73 70 56 57",
"output": "6666"
},
{
"input": "272 10 10\n16 29 2\n43 269 2\n146 265 2\n198 267 8\n38 140 3\n172 187 1\n2 172 4\n142 230 1\n12 199 5\n15 27 8\n70 3 190 83 81 17 16 148 15 107",
"output": "1994"
},
{
"input": "986 10 20\n249 846 37\n110 335 5\n170 568 34\n399 668 30\n118 832 42\n294 336 62\n335 713 60\n245 671 18\n263 512 61\n94 417 75\n63 641 553 61 818 339 254 784 673 572 932 657 432 257 335 971 223 548 758 79",
"output": "21557"
}
] | 1,553,952,839
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 25
| 2,000
| 8,806,400
|
n, m, k = (int(x) for x in input().strip().split())
roads = []
for i in range(m):
roads.append([int(x) for x in input().strip().split()])
_k = sorted([int(x) for x in input().strip().split()])
ful_s = 0
for road in roads:
s = 0
c = 0
for el in _k:
if el >= road[0]:
if el > road[1]:
break
else:
s += el
c += 1
ful_s += s + (c * (road[2] - road[0]))
print(ful_s)
|
Title: Martian Architecture
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Chris the Rabbit found the traces of an ancient Martian civilization. The brave astronomer managed to see through a small telescope an architecture masterpiece — "A Road to the Sun". The building stands on cubical stones of the same size. The foundation divides the entire "road" into cells, into which the cubical stones are fit tightly. Thus, to any cell of the foundation a coordinate can be assigned. To become the leader of the tribe, a Martian should build a Road to the Sun, that is to build from those cubical stones on a given foundation a stairway. The stairway should be described by the number of stones in the initial coordinate and the coordinates of the stairway's beginning and end. Each following cell in the coordinate's increasing order should contain one cubical stone more than the previous one. At that if the cell has already got stones, they do not count in this building process, the stairways were simply built on them. In other words, let us assume that a stairway is built with the initial coordinate of *l*, the final coordinate of *r* and the number of stones in the initial coordinate *x*. That means that *x* stones will be added in the cell *l*, *x*<=+<=1 stones will be added in the cell *l*<=+<=1, ..., *x*<=+<=*r*<=-<=*l* stones will be added in the cell *r*.
Chris managed to find an ancient manuscript, containing the descriptions of all the stairways. Now he wants to compare the data to be sure that he has really found "A Road to the Sun". For that he chose some road cells and counted the total number of cubical stones that has been accumulated throughout the Martian history and then asked you to count using the manuscript to what the sum should ideally total.
Input Specification:
The first line contains three space-separated integers: *n*,<=*m*,<=*k* (1<=≤<=*n*,<=*m*<=≤<=105,<=1<=≤<=*k*<=≤<=*min*(*n*,<=100)) which is the number of cells, the number of "Roads to the Sun" and the number of cells in the query correspondingly. Each of the following *m* roads contain three space-separated integers: *a**i*,<=*b**i*,<=*c**i* (1<=≤<=*a**i*<=≤<=*b**i*<=≤<=*n*,<=1<=≤<=*c**i*<=≤<=1000) which are the stairway's description, its beginning, end and the initial cell's height. Then follow a line, containing *k* different space-separated integers *b**i*. All these numbers ranging from 1 to *n* are cells, the number of stones in which interests Chris.
Output Specification:
You have to print a single number on a single line which is the sum of stones in all the cells Chris is interested in.
Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preffered to use cin (also you may use %I64d).
Demo Input:
['5 2 1\n1 5 1\n2 4 1\n3\n', '3 2 1\n1 3 1\n1 3 1\n2\n', '3 2 1\n1 3 1\n1 3 1\n3\n']
Demo Output:
['5\n', '4\n', '6\n']
Note:
none
|
```python
n, m, k = (int(x) for x in input().strip().split())
roads = []
for i in range(m):
roads.append([int(x) for x in input().strip().split()])
_k = sorted([int(x) for x in input().strip().split()])
ful_s = 0
for road in roads:
s = 0
c = 0
for el in _k:
if el >= road[0]:
if el > road[1]:
break
else:
s += el
c += 1
ful_s += s + (c * (road[2] - road[0]))
print(ful_s)
```
| 0
|
1,006
|
B
|
Polycarp's Practice
|
PROGRAMMING
| 1,200
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
Polycarp is practicing his problem solving skill. He has a list of $n$ problems with difficulties $a_1, a_2, \dots, a_n$, respectively. His plan is to practice for exactly $k$ days. Each day he has to solve at least one problem from his list. Polycarp solves the problems in the order they are given in his list, he cannot skip any problem from his list. He has to solve all $n$ problems in exactly $k$ days.
Thus, each day Polycarp solves a contiguous sequence of (consecutive) problems from the start of the list. He can't skip problems or solve them multiple times. As a result, in $k$ days he will solve all the $n$ problems.
The profit of the $j$-th day of Polycarp's practice is the maximum among all the difficulties of problems Polycarp solves during the $j$-th day (i.e. if he solves problems with indices from $l$ to $r$ during a day, then the profit of the day is $\max\limits_{l \le i \le r}a_i$). The total profit of his practice is the sum of the profits over all $k$ days of his practice.
You want to help Polycarp to get the maximum possible total profit over all valid ways to solve problems. Your task is to distribute all $n$ problems between $k$ days satisfying the conditions above in such a way, that the total profit is maximum.
For example, if $n = 8, k = 3$ and $a = [5, 4, 2, 6, 5, 1, 9, 2]$, one of the possible distributions with maximum total profit is: $[5, 4, 2], [6, 5], [1, 9, 2]$. Here the total profit equals $5 + 6 + 9 = 20$.
|
The first line of the input contains two integers $n$ and $k$ ($1 \le k \le n \le 2000$) — the number of problems and the number of days, respectively.
The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 2000$) — difficulties of problems in Polycarp's list, in the order they are placed in the list (i.e. in the order Polycarp will solve them).
|
In the first line of the output print the maximum possible total profit.
In the second line print exactly $k$ positive integers $t_1, t_2, \dots, t_k$ ($t_1 + t_2 + \dots + t_k$ must equal $n$), where $t_j$ means the number of problems Polycarp will solve during the $j$-th day in order to achieve the maximum possible total profit of his practice.
If there are many possible answers, you may print any of them.
|
[
"8 3\n5 4 2 6 5 1 9 2\n",
"5 1\n1 1 1 1 1\n",
"4 2\n1 2000 2000 2\n"
] |
[
"20\n3 2 3",
"1\n5\n",
"4000\n2 2\n"
] |
The first example is described in the problem statement.
In the second example there is only one possible distribution.
In the third example the best answer is to distribute problems in the following way: $[1, 2000], [2000, 2]$. The total profit of this distribution is $2000 + 2000 = 4000$.
| 0
|
[
{
"input": "8 3\n5 4 2 6 5 1 9 2",
"output": "20\n4 1 3"
},
{
"input": "5 1\n1 1 1 1 1",
"output": "1\n5"
},
{
"input": "4 2\n1 2000 2000 2",
"output": "4000\n2 2"
},
{
"input": "1 1\n2000",
"output": "2000\n1"
},
{
"input": "1 1\n1234",
"output": "1234\n1"
},
{
"input": "3 2\n1 1 1",
"output": "2\n2 1"
},
{
"input": "4 2\n3 5 1 1",
"output": "8\n1 3"
},
{
"input": "5 3\n5 5 6 7 1",
"output": "18\n2 1 2"
},
{
"input": "6 4\n1 1 1 1 2 2",
"output": "6\n3 1 1 1"
},
{
"input": "5 3\n5 5 6 6 4",
"output": "17\n2 1 2"
},
{
"input": "16 15\n14 4 9 12 17 1 1 8 12 13 6 9 17 2 18 12",
"output": "154\n1 1 1 1 1 2 1 1 1 1 1 1 1 1 1"
},
{
"input": "1 1\n1996",
"output": "1996\n1"
},
{
"input": "5 3\n5 5 5 9 10",
"output": "24\n3 1 1"
},
{
"input": "18 15\n18 2 13 1 18 3 2 18 18 20 9 2 20 20 4 20 9 12",
"output": "204\n1 2 2 1 2 1 1 1 1 1 1 1 1 1 1"
},
{
"input": "5 3\n1 20 20 50 50",
"output": "120\n3 1 1"
},
{
"input": "8 3\n15 14 11 19 17 14 14 8",
"output": "51\n1 3 4"
},
{
"input": "5 2\n15 20 6 19 6",
"output": "39\n2 3"
},
{
"input": "6 3\n5 5 5 5 6 9",
"output": "20\n4 1 1"
},
{
"input": "5 3\n2 2 2 3 3",
"output": "8\n3 1 1"
},
{
"input": "7 3\n2 2 2 2 2 3 3",
"output": "8\n5 1 1"
},
{
"input": "6 5\n1 1 6 6 6 6",
"output": "25\n2 1 1 1 1"
},
{
"input": "8 4\n1 2 2 2 2 3 4 5",
"output": "14\n5 1 1 1"
},
{
"input": "6 4\n1 1 1 5 5 5",
"output": "16\n3 1 1 1"
},
{
"input": "6 3\n1 2 2 2 4 5",
"output": "11\n4 1 1"
},
{
"input": "18 6\n17 17 19 14 10 20 18 16 6 7 2 15 14 16 13 6 12 11",
"output": "107\n1 1 1 3 1 11"
},
{
"input": "6 3\n1 1 2 2 3 4",
"output": "9\n4 1 1"
},
{
"input": "8 3\n5 4 2 5 6 1 9 2",
"output": "20\n4 1 3"
}
] | 1,652,914,126
| 4,726
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 4,505,600
|
line1=str(input())
line1=line1.split(" ")
n=int(line1[0])
k=int(line1[1])
string=str(input())
string=string.split(" ")
sort=[]
notsort=[]
for i in range(n):
sort.append(int(string[i]))
notsort.append(int(string[i]))
sort.sort()
maximum=[]
sum=0
maximumind=[]
for i in range(1,k+1):
maximum.append(sort[len(sort)-i])
sum+=sort[len(sort)-i]
for i in range(len(maximum)):
for j in range(n):
if(maximum[i]==notsort[j]):
maximumind.append(j)
break
maximumind.sort()
size=[]
f=0
for i in range(len(maximumind)):
count=0
if (i==len(maximumind)-1):
for j in range(f, n):
count += 1
f += 1
size.append(count)
else:
for j in range(f,maximumind[i]+1):
count+=1
f+=1
size.append(count)
print(sum)
for i in range(len(size)):
print(size[i])
|
Title: Polycarp's Practice
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarp is practicing his problem solving skill. He has a list of $n$ problems with difficulties $a_1, a_2, \dots, a_n$, respectively. His plan is to practice for exactly $k$ days. Each day he has to solve at least one problem from his list. Polycarp solves the problems in the order they are given in his list, he cannot skip any problem from his list. He has to solve all $n$ problems in exactly $k$ days.
Thus, each day Polycarp solves a contiguous sequence of (consecutive) problems from the start of the list. He can't skip problems or solve them multiple times. As a result, in $k$ days he will solve all the $n$ problems.
The profit of the $j$-th day of Polycarp's practice is the maximum among all the difficulties of problems Polycarp solves during the $j$-th day (i.e. if he solves problems with indices from $l$ to $r$ during a day, then the profit of the day is $\max\limits_{l \le i \le r}a_i$). The total profit of his practice is the sum of the profits over all $k$ days of his practice.
You want to help Polycarp to get the maximum possible total profit over all valid ways to solve problems. Your task is to distribute all $n$ problems between $k$ days satisfying the conditions above in such a way, that the total profit is maximum.
For example, if $n = 8, k = 3$ and $a = [5, 4, 2, 6, 5, 1, 9, 2]$, one of the possible distributions with maximum total profit is: $[5, 4, 2], [6, 5], [1, 9, 2]$. Here the total profit equals $5 + 6 + 9 = 20$.
Input Specification:
The first line of the input contains two integers $n$ and $k$ ($1 \le k \le n \le 2000$) — the number of problems and the number of days, respectively.
The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 2000$) — difficulties of problems in Polycarp's list, in the order they are placed in the list (i.e. in the order Polycarp will solve them).
Output Specification:
In the first line of the output print the maximum possible total profit.
In the second line print exactly $k$ positive integers $t_1, t_2, \dots, t_k$ ($t_1 + t_2 + \dots + t_k$ must equal $n$), where $t_j$ means the number of problems Polycarp will solve during the $j$-th day in order to achieve the maximum possible total profit of his practice.
If there are many possible answers, you may print any of them.
Demo Input:
['8 3\n5 4 2 6 5 1 9 2\n', '5 1\n1 1 1 1 1\n', '4 2\n1 2000 2000 2\n']
Demo Output:
['20\n3 2 3', '1\n5\n', '4000\n2 2\n']
Note:
The first example is described in the problem statement.
In the second example there is only one possible distribution.
In the third example the best answer is to distribute problems in the following way: $[1, 2000], [2000, 2]$. The total profit of this distribution is $2000 + 2000 = 4000$.
|
```python
line1=str(input())
line1=line1.split(" ")
n=int(line1[0])
k=int(line1[1])
string=str(input())
string=string.split(" ")
sort=[]
notsort=[]
for i in range(n):
sort.append(int(string[i]))
notsort.append(int(string[i]))
sort.sort()
maximum=[]
sum=0
maximumind=[]
for i in range(1,k+1):
maximum.append(sort[len(sort)-i])
sum+=sort[len(sort)-i]
for i in range(len(maximum)):
for j in range(n):
if(maximum[i]==notsort[j]):
maximumind.append(j)
break
maximumind.sort()
size=[]
f=0
for i in range(len(maximumind)):
count=0
if (i==len(maximumind)-1):
for j in range(f, n):
count += 1
f += 1
size.append(count)
else:
for j in range(f,maximumind[i]+1):
count+=1
f+=1
size.append(count)
print(sum)
for i in range(len(size)):
print(size[i])
```
| 0
|
|
597
|
A
|
Divisibility
|
PROGRAMMING
| 1,600
|
[
"math"
] | null | null |
Find the number of *k*-divisible numbers on the segment [*a*,<=*b*]. In other words you need to find the number of such integer values *x* that *a*<=≤<=*x*<=≤<=*b* and *x* is divisible by *k*.
|
The only line contains three space-separated integers *k*, *a* and *b* (1<=≤<=*k*<=≤<=1018;<=-<=1018<=≤<=*a*<=≤<=*b*<=≤<=1018).
|
Print the required number.
|
[
"1 1 10\n",
"2 -4 4\n"
] |
[
"10\n",
"5\n"
] |
none
| 500
|
[
{
"input": "1 1 10",
"output": "10"
},
{
"input": "2 -4 4",
"output": "5"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "1 0 0",
"output": "1"
},
{
"input": "1 0 1",
"output": "2"
},
{
"input": "1 10181 10182",
"output": "2"
},
{
"input": "1 10182 10183",
"output": "2"
},
{
"input": "1 -191 1011",
"output": "1203"
},
{
"input": "2 0 0",
"output": "1"
},
{
"input": "2 0 1",
"output": "1"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "2 2 3",
"output": "1"
},
{
"input": "2 -1 0",
"output": "1"
},
{
"input": "2 -1 1",
"output": "1"
},
{
"input": "2 -7 -6",
"output": "1"
},
{
"input": "2 -7 -5",
"output": "1"
},
{
"input": "2 -6 -6",
"output": "1"
},
{
"input": "2 -6 -4",
"output": "2"
},
{
"input": "2 -6 13",
"output": "10"
},
{
"input": "2 -19171 1911",
"output": "10541"
},
{
"input": "3 123 456",
"output": "112"
},
{
"input": "3 124 456",
"output": "111"
},
{
"input": "3 125 456",
"output": "111"
},
{
"input": "3 381 281911",
"output": "93844"
},
{
"input": "3 381 281912",
"output": "93844"
},
{
"input": "3 381 281913",
"output": "93845"
},
{
"input": "3 382 281911",
"output": "93843"
},
{
"input": "3 382 281912",
"output": "93843"
},
{
"input": "3 382 281913",
"output": "93844"
},
{
"input": "3 383 281911",
"output": "93843"
},
{
"input": "3 383 281912",
"output": "93843"
},
{
"input": "3 383 281913",
"output": "93844"
},
{
"input": "3 -381 281911",
"output": "94098"
},
{
"input": "3 -381 281912",
"output": "94098"
},
{
"input": "3 -381 281913",
"output": "94099"
},
{
"input": "3 -380 281911",
"output": "94097"
},
{
"input": "3 -380 281912",
"output": "94097"
},
{
"input": "3 -380 281913",
"output": "94098"
},
{
"input": "3 -379 281911",
"output": "94097"
},
{
"input": "3 -379 281912",
"output": "94097"
},
{
"input": "3 -379 281913",
"output": "94098"
},
{
"input": "3 -191381 -1911",
"output": "63157"
},
{
"input": "3 -191381 -1910",
"output": "63157"
},
{
"input": "3 -191381 -1909",
"output": "63157"
},
{
"input": "3 -191380 -1911",
"output": "63157"
},
{
"input": "3 -191380 -1910",
"output": "63157"
},
{
"input": "3 -191380 -1909",
"output": "63157"
},
{
"input": "3 -191379 -1911",
"output": "63157"
},
{
"input": "3 -191379 -1910",
"output": "63157"
},
{
"input": "3 -191379 -1909",
"output": "63157"
},
{
"input": "3 -2810171 0",
"output": "936724"
},
{
"input": "3 0 29101",
"output": "9701"
},
{
"input": "3 -2810170 0",
"output": "936724"
},
{
"input": "3 0 29102",
"output": "9701"
},
{
"input": "3 -2810169 0",
"output": "936724"
},
{
"input": "3 0 29103",
"output": "9702"
},
{
"input": "1 -1000000000000000000 1000000000000000000",
"output": "2000000000000000001"
},
{
"input": "2 -1000000000000000000 1000000000000000000",
"output": "1000000000000000001"
},
{
"input": "3 -1000000000000000000 1000000000000000000",
"output": "666666666666666667"
},
{
"input": "4 -1000000000000000000 1000000000000000000",
"output": "500000000000000001"
},
{
"input": "5 -1000000000000000000 1000000000000000000",
"output": "400000000000000001"
},
{
"input": "6 -1000000000000000000 1000000000000000000",
"output": "333333333333333333"
},
{
"input": "7 -1000000000000000000 1000000000000000000",
"output": "285714285714285715"
},
{
"input": "1 -1000000000000000000 -100000000000000000",
"output": "900000000000000001"
},
{
"input": "2 -1000000000000000000 -10000000000000000",
"output": "495000000000000001"
},
{
"input": "3 -1000000000000000000 -10218000000000000",
"output": "329927333333333334"
},
{
"input": "4 -1000000000000000000 -320110181919100",
"output": "249919972454520226"
},
{
"input": "5 -1000000000000000000 -402710171917",
"output": "199999919457965617"
},
{
"input": "6 -1000000000000000000 -6666666666",
"output": "166666665555555556"
},
{
"input": "7 -1000000000000000000 -77777777777778",
"output": "142846031746031746"
},
{
"input": "1000000000000000000 -1000000000000000000 1000000000000000000",
"output": "3"
},
{
"input": "1000000000000000000 0 1000000000000000000",
"output": "2"
},
{
"input": "1000000000000000000 1000000000000000000 1000000000000000000",
"output": "1"
},
{
"input": "100000000000000321 1000000000000000000 1000000000000000000",
"output": "0"
},
{
"input": "100000000000000321 -1000000000000000000 1000000000000000000",
"output": "19"
},
{
"input": "1000000000000000000 0 0",
"output": "1"
},
{
"input": "1000000000000000000 1 1",
"output": "0"
},
{
"input": "1000000000000000000 -1 -1",
"output": "0"
},
{
"input": "1000000000000000000 -2 -1",
"output": "0"
},
{
"input": "142000000000000271 -228118171 -1382811",
"output": "0"
},
{
"input": "1 1 1000000000000000000",
"output": "1000000000000000000"
}
] | 1,450,960,398
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 56
| 1,000
| 0
|
b = list(map(int, input().split()))
k = b[0]
a = b[1]
b = b[2]
n = 0
for x in range(a, b + 1):
if x % k == 0:
n += 1
print(n)
|
Title: Divisibility
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Find the number of *k*-divisible numbers on the segment [*a*,<=*b*]. In other words you need to find the number of such integer values *x* that *a*<=≤<=*x*<=≤<=*b* and *x* is divisible by *k*.
Input Specification:
The only line contains three space-separated integers *k*, *a* and *b* (1<=≤<=*k*<=≤<=1018;<=-<=1018<=≤<=*a*<=≤<=*b*<=≤<=1018).
Output Specification:
Print the required number.
Demo Input:
['1 1 10\n', '2 -4 4\n']
Demo Output:
['10\n', '5\n']
Note:
none
|
```python
b = list(map(int, input().split()))
k = b[0]
a = b[1]
b = b[2]
n = 0
for x in range(a, b + 1):
if x % k == 0:
n += 1
print(n)
```
| 0
|
|
659
|
A
|
Round House
|
PROGRAMMING
| 1,000
|
[
"implementation",
"math"
] | null | null |
Vasya lives in a round building, whose entrances are numbered sequentially by integers from 1 to *n*. Entrance *n* and entrance 1 are adjacent.
Today Vasya got bored and decided to take a walk in the yard. Vasya lives in entrance *a* and he decided that during his walk he will move around the house *b* entrances in the direction of increasing numbers (in this order entrance *n* should be followed by entrance 1). The negative value of *b* corresponds to moving |*b*| entrances in the order of decreasing numbers (in this order entrance 1 is followed by entrance *n*). If *b*<==<=0, then Vasya prefers to walk beside his entrance.
Help Vasya to determine the number of the entrance, near which he will be at the end of his walk.
|
The single line of the input contains three space-separated integers *n*, *a* and *b* (1<=≤<=*n*<=≤<=100,<=1<=≤<=*a*<=≤<=*n*,<=<=-<=100<=≤<=*b*<=≤<=100) — the number of entrances at Vasya's place, the number of his entrance and the length of his walk, respectively.
|
Print a single integer *k* (1<=≤<=*k*<=≤<=*n*) — the number of the entrance where Vasya will be at the end of his walk.
|
[
"6 2 -5\n",
"5 1 3\n",
"3 2 7\n"
] |
[
"3\n",
"4\n",
"3\n"
] |
The first example is illustrated by the picture in the statements.
| 500
|
[
{
"input": "6 2 -5",
"output": "3"
},
{
"input": "5 1 3",
"output": "4"
},
{
"input": "3 2 7",
"output": "3"
},
{
"input": "1 1 0",
"output": "1"
},
{
"input": "1 1 -1",
"output": "1"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "100 1 -1",
"output": "100"
},
{
"input": "100 54 100",
"output": "54"
},
{
"input": "100 37 -100",
"output": "37"
},
{
"input": "99 41 0",
"output": "41"
},
{
"input": "97 37 -92",
"output": "42"
},
{
"input": "99 38 59",
"output": "97"
},
{
"input": "35 34 1",
"output": "35"
},
{
"input": "48 1 -1",
"output": "48"
},
{
"input": "87 65 -76",
"output": "76"
},
{
"input": "76 26 29",
"output": "55"
},
{
"input": "100 65 0",
"output": "65"
},
{
"input": "2 1 100",
"output": "1"
},
{
"input": "3 2 -100",
"output": "1"
},
{
"input": "1 1 100",
"output": "1"
},
{
"input": "1 1 -100",
"output": "1"
},
{
"input": "3 1 -100",
"output": "3"
},
{
"input": "4 3 -100",
"output": "3"
},
{
"input": "3 2 -12",
"output": "2"
},
{
"input": "2 2 -100",
"output": "2"
},
{
"input": "3 2 -90",
"output": "2"
},
{
"input": "6 2 -10",
"output": "4"
},
{
"input": "3 3 -100",
"output": "2"
},
{
"input": "5 2 4",
"output": "1"
},
{
"input": "6 4 5",
"output": "3"
},
{
"input": "3 2 -6",
"output": "2"
},
{
"input": "5 1 -99",
"output": "2"
},
{
"input": "6 2 5",
"output": "1"
},
{
"input": "10 1 -100",
"output": "1"
},
{
"input": "2 2 1",
"output": "1"
},
{
"input": "3 3 1",
"output": "1"
},
{
"input": "6 4 4",
"output": "2"
},
{
"input": "17 17 2",
"output": "2"
},
{
"input": "6 6 1",
"output": "1"
},
{
"input": "5 3 -2",
"output": "1"
},
{
"input": "6 2 -100",
"output": "4"
},
{
"input": "5 3 -100",
"output": "3"
},
{
"input": "5 4 3",
"output": "2"
},
{
"input": "3 2 2",
"output": "1"
},
{
"input": "5 5 2",
"output": "2"
},
{
"input": "3 2 5",
"output": "1"
},
{
"input": "5 5 -1",
"output": "4"
},
{
"input": "5 3 3",
"output": "1"
},
{
"input": "4 2 3",
"output": "1"
},
{
"input": "88 76 74",
"output": "62"
}
] | 1,669,113,246
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 3
| 46
| 0
|
import sys
input = sys.stdin.readline
out = 0
n, a, b = map(int, input().split())
x = abs(b) % n
if (b>0):
if ((a+x)%n == 0):
print(n)
else: print((a+x)%n)
else:
print((a+(n-x)))
|
Title: Round House
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya lives in a round building, whose entrances are numbered sequentially by integers from 1 to *n*. Entrance *n* and entrance 1 are adjacent.
Today Vasya got bored and decided to take a walk in the yard. Vasya lives in entrance *a* and he decided that during his walk he will move around the house *b* entrances in the direction of increasing numbers (in this order entrance *n* should be followed by entrance 1). The negative value of *b* corresponds to moving |*b*| entrances in the order of decreasing numbers (in this order entrance 1 is followed by entrance *n*). If *b*<==<=0, then Vasya prefers to walk beside his entrance.
Help Vasya to determine the number of the entrance, near which he will be at the end of his walk.
Input Specification:
The single line of the input contains three space-separated integers *n*, *a* and *b* (1<=≤<=*n*<=≤<=100,<=1<=≤<=*a*<=≤<=*n*,<=<=-<=100<=≤<=*b*<=≤<=100) — the number of entrances at Vasya's place, the number of his entrance and the length of his walk, respectively.
Output Specification:
Print a single integer *k* (1<=≤<=*k*<=≤<=*n*) — the number of the entrance where Vasya will be at the end of his walk.
Demo Input:
['6 2 -5\n', '5 1 3\n', '3 2 7\n']
Demo Output:
['3\n', '4\n', '3\n']
Note:
The first example is illustrated by the picture in the statements.
|
```python
import sys
input = sys.stdin.readline
out = 0
n, a, b = map(int, input().split())
x = abs(b) % n
if (b>0):
if ((a+x)%n == 0):
print(n)
else: print((a+x)%n)
else:
print((a+(n-x)))
```
| 0
|
|
478
|
A
|
Initial Bet
|
PROGRAMMING
| 1,100
|
[
"implementation"
] | null | null |
There are five people playing a game called "Generosity". Each person gives some non-zero number of coins *b* as an initial bet. After all players make their bets of *b* coins, the following operation is repeated for several times: a coin is passed from one player to some other player.
Your task is to write a program that can, given the number of coins each player has at the end of the game, determine the size *b* of the initial bet or find out that such outcome of the game cannot be obtained for any positive number of coins *b* in the initial bet.
|
The input consists of a single line containing five integers *c*1,<=*c*2,<=*c*3,<=*c*4 and *c*5 — the number of coins that the first, second, third, fourth and fifth players respectively have at the end of the game (0<=≤<=*c*1,<=*c*2,<=*c*3,<=*c*4,<=*c*5<=≤<=100).
|
Print the only line containing a single positive integer *b* — the number of coins in the initial bet of each player. If there is no such value of *b*, then print the only value "-1" (quotes for clarity).
|
[
"2 5 4 0 4\n",
"4 5 9 2 1\n"
] |
[
"3\n",
"-1\n"
] |
In the first sample the following sequence of operations is possible:
1. One coin is passed from the fourth player to the second player; 1. One coin is passed from the fourth player to the fifth player; 1. One coin is passed from the first player to the third player; 1. One coin is passed from the fourth player to the second player.
| 500
|
[
{
"input": "2 5 4 0 4",
"output": "3"
},
{
"input": "4 5 9 2 1",
"output": "-1"
},
{
"input": "0 0 0 0 0",
"output": "-1"
},
{
"input": "1 2 1 2 3",
"output": "-1"
},
{
"input": "100 0 0 0 0",
"output": "20"
},
{
"input": "2 3 4 5 6",
"output": "4"
},
{
"input": "1 1 1 1 1",
"output": "1"
},
{
"input": "0 1 2 3 4",
"output": "2"
},
{
"input": "100 100 100 100 100",
"output": "100"
},
{
"input": "93 100 99 90 98",
"output": "96"
},
{
"input": "99 99 99 99 99",
"output": "99"
},
{
"input": "99 98 98 99 100",
"output": "-1"
},
{
"input": "43 83 1 0 23",
"output": "30"
},
{
"input": "43 83 1 100 23",
"output": "50"
},
{
"input": "57 83 11 4 93",
"output": "-1"
},
{
"input": "87 38 19 33 100",
"output": "-1"
},
{
"input": "56 0 0 0 4",
"output": "12"
},
{
"input": "0 0 0 0 1",
"output": "-1"
},
{
"input": "99 100 100 100 100",
"output": "-1"
}
] | 1,664,992,109
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 19
| 61
| 0
|
def main():
v = [int(i) for i in input().split()]
s = sum(v)
if s % 5 == 0 and s != 0:
print(s // 5)
else:
print(-1)
if __name__ == "__main__":
main()
|
Title: Initial Bet
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are five people playing a game called "Generosity". Each person gives some non-zero number of coins *b* as an initial bet. After all players make their bets of *b* coins, the following operation is repeated for several times: a coin is passed from one player to some other player.
Your task is to write a program that can, given the number of coins each player has at the end of the game, determine the size *b* of the initial bet or find out that such outcome of the game cannot be obtained for any positive number of coins *b* in the initial bet.
Input Specification:
The input consists of a single line containing five integers *c*1,<=*c*2,<=*c*3,<=*c*4 and *c*5 — the number of coins that the first, second, third, fourth and fifth players respectively have at the end of the game (0<=≤<=*c*1,<=*c*2,<=*c*3,<=*c*4,<=*c*5<=≤<=100).
Output Specification:
Print the only line containing a single positive integer *b* — the number of coins in the initial bet of each player. If there is no such value of *b*, then print the only value "-1" (quotes for clarity).
Demo Input:
['2 5 4 0 4\n', '4 5 9 2 1\n']
Demo Output:
['3\n', '-1\n']
Note:
In the first sample the following sequence of operations is possible:
1. One coin is passed from the fourth player to the second player; 1. One coin is passed from the fourth player to the fifth player; 1. One coin is passed from the first player to the third player; 1. One coin is passed from the fourth player to the second player.
|
```python
def main():
v = [int(i) for i in input().split()]
s = sum(v)
if s % 5 == 0 and s != 0:
print(s // 5)
else:
print(-1)
if __name__ == "__main__":
main()
```
| 3
|
|
894
|
A
|
QAQ
|
PROGRAMMING
| 800
|
[
"brute force",
"dp"
] | null | null |
"QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!).
Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact.
|
The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters.
|
Print a single integer — the number of subsequences "QAQ" in the string.
|
[
"QAQAQYSYIOIWIN\n",
"QAQQQZZYNOIWIN\n"
] |
[
"4\n",
"3\n"
] |
In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN".
| 500
|
[
{
"input": "QAQAQYSYIOIWIN",
"output": "4"
},
{
"input": "QAQQQZZYNOIWIN",
"output": "3"
},
{
"input": "QA",
"output": "0"
},
{
"input": "IAQVAQZLQBQVQFTQQQADAQJA",
"output": "24"
},
{
"input": "QQAAQASGAYAAAAKAKAQIQEAQAIAAIAQQQQQ",
"output": "378"
},
{
"input": "AMVFNFJIAVNQJWIVONQOAOOQSNQSONOASONAONQINAONAOIQONANOIQOANOQINAONOQINAONOXJCOIAQOAOQAQAQAQAQWWWAQQAQ",
"output": "1077"
},
{
"input": "AAQQAXBQQBQQXBNQRJAQKQNAQNQVDQASAGGANQQQQTJFFQQQTQQA",
"output": "568"
},
{
"input": "KAZXAVLPJQBQVQQQQQAPAQQGQTQVZQAAAOYA",
"output": "70"
},
{
"input": "W",
"output": "0"
},
{
"input": "DBA",
"output": "0"
},
{
"input": "RQAWNACASAAKAGAAAAQ",
"output": "10"
},
{
"input": "QJAWZAAOAAGIAAAAAOQATASQAEAAAAQFQQHPA",
"output": "111"
},
{
"input": "QQKWQAQAAAAAAAAGAAVAQUEQQUMQMAQQQNQLAMAAAUAEAAEMAAA",
"output": "411"
},
{
"input": "QQUMQAYAUAAGWAAAQSDAVAAQAAAASKQJJQQQQMAWAYYAAAAAAEAJAXWQQ",
"output": "625"
},
{
"input": "QORZOYAQ",
"output": "1"
},
{
"input": "QCQAQAGAWAQQQAQAVQAQQQQAQAQQQAQAAATQAAVAAAQQQQAAAUUQAQQNQQWQQWAQAAQQKQYAQAAQQQAAQRAQQQWBQQQQAPBAQGQA",
"output": "13174"
},
{
"input": "QQAQQAKQFAQLQAAWAMQAZQAJQAAQQOACQQAAAYANAQAQQAQAAQQAOBQQJQAQAQAQQQAAAAABQQQAVNZAQQQQAMQQAFAAEAQAQHQT",
"output": "10420"
},
{
"input": "AQEGQHQQKQAQQPQKAQQQAAAAQQQAQEQAAQAAQAQFSLAAQQAQOQQAVQAAAPQQAWAQAQAFQAXAQQQQTRLOQAQQJQNQXQQQQSQVDQQQ",
"output": "12488"
},
{
"input": "QNQKQQQLASQBAVQQQQAAQQOQRJQQAQQQEQZUOANAADAAQQJAQAQARAAAQQQEQBHTQAAQAAAAQQMKQQQIAOJJQQAQAAADADQUQQQA",
"output": "9114"
},
{
"input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ",
"output": "35937"
},
{
"input": "AMQQAAQAAQAAAAAAQQQBOAAANAAKQJCYQAE",
"output": "254"
},
{
"input": "AYQBAEQGAQEOAKGIXLQJAIAKQAAAQPUAJAKAATFWQQAOQQQUFQYAQQMQHOKAAJXGFCARAQSATHAUQQAATQJJQDQRAANQQAE",
"output": "2174"
},
{
"input": "AAQXAAQAYQAAAAGAQHVQYAGIVACADFAAQAAAAQZAAQMAKZAADQAQDAAQDAAAMQQOXYAQQQAKQBAAQQKAXQBJZDDLAAHQQ",
"output": "2962"
},
{
"input": "AYQQYAVAMNIAUAAKBBQVACWKTQSAQZAAQAAASZJAWBCAALAARHACQAKQQAQAARPAQAAQAQAAZQUSHQAMFVFZQQQQSAQQXAA",
"output": "2482"
},
{
"input": "LQMAQQARQAQBJQQQAGAAZQQXALQQAARQAQQQQAAQQAQQQAQQCAQQAQQAYQQQRAAZATQALYQQAAHHAAQHAAAAAAAAQQMAAQNAKQ",
"output": "7768"
},
{
"input": "MAQQWAQOYQMAAAQAQPQZAOAAQAUAQNAAQAAAITQSAQAKAQKAQQWSQAAQQAGUCDQMQWKQUXKWQQAAQQAAQQZQDQQQAABXQUUXQOA",
"output": "5422"
},
{
"input": "QTAAQDAQXAQQJQQQGAAAQQQQSBQZKAQQAQQQQEAQNUQBZCQLYQZQEQQAAQHQVAORKQVAQYQNASZQAARZAAGAAAAOQDCQ",
"output": "3024"
},
{
"input": "QQWAQQGQQUZQQQLZAAQYQXQVAQFQUAQZUQZZQUKBHSHTQYLQAOQXAQQGAQQTQOAQARQADAJRAAQPQAQQUQAUAMAUVQAAAQQAWQ",
"output": "4527"
},
{
"input": "QQAAQQAQVAQZQQQQAOEAQZPQIBQZACQQAFQQLAAQDATZQANHKYQQAQTAAFQRQAIQAJPWQAQTEIRXAEQQAYWAAAUKQQAQAQQQSQQH",
"output": "6416"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAAAA",
"output": "14270"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQ",
"output": "13136"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAA",
"output": "14270"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQQAA",
"output": "14231"
},
{
"input": "QQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAA",
"output": "15296"
},
{
"input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ",
"output": "0"
},
{
"input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA",
"output": "0"
},
{
"input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ",
"output": "0"
},
{
"input": "QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQA",
"output": "20825"
},
{
"input": "AQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQ",
"output": "20825"
},
{
"input": "Q",
"output": "0"
},
{
"input": "A",
"output": "0"
},
{
"input": "FFF",
"output": "0"
},
{
"input": "AAAAAA",
"output": "0"
}
] | 1,677,997,290
| 2,147,483,647
|
PyPy 3-64
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 3
| 1,000
| 3,686,400
|
a=input()
n=len(a)
s=0
for i in range(1,2**n):
mask=bin(i)[2:].zfill(n)
s1=''
for j in range(n): s1+=a[j]*int(mask[j])
if s1=='QAQ': s+=1
print(s)
|
Title: QAQ
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!).
Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact.
Input Specification:
The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters.
Output Specification:
Print a single integer — the number of subsequences "QAQ" in the string.
Demo Input:
['QAQAQYSYIOIWIN\n', 'QAQQQZZYNOIWIN\n']
Demo Output:
['4\n', '3\n']
Note:
In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN".
|
```python
a=input()
n=len(a)
s=0
for i in range(1,2**n):
mask=bin(i)[2:].zfill(n)
s1=''
for j in range(n): s1+=a[j]*int(mask[j])
if s1=='QAQ': s+=1
print(s)
```
| 0
|
|
313
|
A
|
Ilya and Bank Account
|
PROGRAMMING
| 900
|
[
"implementation",
"number theory"
] | null | null |
Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money.
Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance.
Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift.
|
The single line contains integer *n* (10<=≤<=|*n*|<=≤<=109) — the state of Ilya's bank account.
|
In a single line print an integer — the maximum state of the bank account that Ilya can get.
|
[
"2230\n",
"-10\n",
"-100003\n"
] |
[
"2230\n",
"0\n",
"-10000\n"
] |
In the first test sample Ilya doesn't profit from using the present.
In the second test sample you can delete digit 1 and get the state of the account equal to 0.
| 500
|
[
{
"input": "2230",
"output": "2230"
},
{
"input": "-10",
"output": "0"
},
{
"input": "-100003",
"output": "-10000"
},
{
"input": "544883178",
"output": "544883178"
},
{
"input": "-847251738",
"output": "-84725173"
},
{
"input": "423654797",
"output": "423654797"
},
{
"input": "-623563697",
"output": "-62356367"
},
{
"input": "645894116",
"output": "645894116"
},
{
"input": "-384381709",
"output": "-38438170"
},
{
"input": "437587210",
"output": "437587210"
},
{
"input": "-297534606",
"output": "-29753460"
},
{
"input": "891773002",
"output": "891773002"
},
{
"input": "-56712976",
"output": "-5671296"
},
{
"input": "963662765",
"output": "963662765"
},
{
"input": "-272656295",
"output": "-27265625"
},
{
"input": "383441522",
"output": "383441522"
},
{
"input": "-477665112",
"output": "-47766511"
},
{
"input": "791725034",
"output": "791725034"
},
{
"input": "-812168727",
"output": "-81216872"
},
{
"input": "528894922",
"output": "528894922"
},
{
"input": "-479977172",
"output": "-47997712"
},
{
"input": "568044564",
"output": "568044564"
},
{
"input": "-392784794",
"output": "-39278474"
},
{
"input": "925596634",
"output": "925596634"
},
{
"input": "-836078769",
"output": "-83607876"
},
{
"input": "71036059",
"output": "71036059"
},
{
"input": "-337396162",
"output": "-33739612"
},
{
"input": "87129297",
"output": "87129297"
},
{
"input": "-648171877",
"output": "-64817187"
},
{
"input": "20218400",
"output": "20218400"
},
{
"input": "10",
"output": "10"
},
{
"input": "1000000000",
"output": "1000000000"
},
{
"input": "-1000000000",
"output": "-100000000"
},
{
"input": "-102",
"output": "-10"
},
{
"input": "-120",
"output": "-10"
},
{
"input": "-20",
"output": "0"
},
{
"input": "-15",
"output": "-1"
},
{
"input": "-5575533",
"output": "-557553"
},
{
"input": "-50",
"output": "0"
},
{
"input": "-31",
"output": "-1"
},
{
"input": "-55",
"output": "-5"
},
{
"input": "-81",
"output": "-1"
},
{
"input": "-99",
"output": "-9"
},
{
"input": "-23",
"output": "-2"
},
{
"input": "-41",
"output": "-1"
},
{
"input": "-24",
"output": "-2"
},
{
"input": "46",
"output": "46"
}
] | 1,688,998,694
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 47
| 122
| 0
|
n=int(input())
if n<0:
ld=(-1*n)%10
a_ld=(-1*n)//10
lbd= (a_ld)%10
lbd_n=(a_ld)//10
lbd_n=((lbd_n*10)+ld)
ans1=a_ld*-1
ans2=lbd_n*-1
if ans1>ans2:
print(ans1)
else:
print(ans2)
else:
print(n)
|
Title: Ilya and Bank Account
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money.
Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance.
Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift.
Input Specification:
The single line contains integer *n* (10<=≤<=|*n*|<=≤<=109) — the state of Ilya's bank account.
Output Specification:
In a single line print an integer — the maximum state of the bank account that Ilya can get.
Demo Input:
['2230\n', '-10\n', '-100003\n']
Demo Output:
['2230\n', '0\n', '-10000\n']
Note:
In the first test sample Ilya doesn't profit from using the present.
In the second test sample you can delete digit 1 and get the state of the account equal to 0.
|
```python
n=int(input())
if n<0:
ld=(-1*n)%10
a_ld=(-1*n)//10
lbd= (a_ld)%10
lbd_n=(a_ld)//10
lbd_n=((lbd_n*10)+ld)
ans1=a_ld*-1
ans2=lbd_n*-1
if ans1>ans2:
print(ans1)
else:
print(ans2)
else:
print(n)
```
| 3
|
|
625
|
A
|
Guest From the Past
|
PROGRAMMING
| 1,700
|
[
"implementation",
"math"
] | null | null |
Kolya Gerasimov loves kefir very much. He lives in year 1984 and knows all the details of buying this delicious drink. One day, as you probably know, he found himself in year 2084, and buying kefir there is much more complicated.
Kolya is hungry, so he went to the nearest milk shop. In 2084 you may buy kefir in a plastic liter bottle, that costs *a* rubles, or in glass liter bottle, that costs *b* rubles. Also, you may return empty glass bottle and get *c* (*c*<=<<=*b*) rubles back, but you cannot return plastic bottles.
Kolya has *n* rubles and he is really hungry, so he wants to drink as much kefir as possible. There were no plastic bottles in his 1984, so Kolya doesn't know how to act optimally and asks for your help.
|
First line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1018) — the number of rubles Kolya has at the beginning.
Then follow three lines containing integers *a*, *b* and *c* (1<=≤<=*a*<=≤<=1018, 1<=≤<=*c*<=<<=*b*<=≤<=1018) — the cost of one plastic liter bottle, the cost of one glass liter bottle and the money one can get back by returning an empty glass bottle, respectively.
|
Print the only integer — maximum number of liters of kefir, that Kolya can drink.
|
[
"10\n11\n9\n8\n",
"10\n5\n6\n1\n"
] |
[
"2\n",
"2\n"
] |
In the first sample, Kolya can buy one glass bottle, then return it and buy one more glass bottle. Thus he will drink 2 liters of kefir.
In the second sample, Kolya can buy two plastic bottle and get two liters of kefir, or he can buy one liter glass bottle, then return it and buy one plastic bottle. In both cases he will drink two liters of kefir.
| 750
|
[
{
"input": "10\n11\n9\n8",
"output": "2"
},
{
"input": "10\n5\n6\n1",
"output": "2"
},
{
"input": "2\n2\n2\n1",
"output": "1"
},
{
"input": "10\n3\n3\n1",
"output": "4"
},
{
"input": "10\n1\n2\n1",
"output": "10"
},
{
"input": "10\n2\n3\n1",
"output": "5"
},
{
"input": "9\n2\n4\n1",
"output": "4"
},
{
"input": "9\n2\n2\n1",
"output": "8"
},
{
"input": "9\n10\n10\n1",
"output": "0"
},
{
"input": "10\n2\n2\n1",
"output": "9"
},
{
"input": "1000000000000000000\n2\n10\n9",
"output": "999999999999999995"
},
{
"input": "501000000000000000\n300000000000000000\n301000000000000000\n100000000000000000",
"output": "2"
},
{
"input": "10\n1\n9\n8",
"output": "10"
},
{
"input": "10\n8\n8\n7",
"output": "3"
},
{
"input": "10\n5\n5\n1",
"output": "2"
},
{
"input": "29\n3\n3\n1",
"output": "14"
},
{
"input": "45\n9\n9\n8",
"output": "37"
},
{
"input": "45\n9\n9\n1",
"output": "5"
},
{
"input": "100\n10\n10\n9",
"output": "91"
},
{
"input": "179\n10\n9\n1",
"output": "22"
},
{
"input": "179\n2\n2\n1",
"output": "178"
},
{
"input": "179\n179\n179\n1",
"output": "1"
},
{
"input": "179\n59\n59\n58",
"output": "121"
},
{
"input": "500\n250\n250\n1",
"output": "2"
},
{
"input": "500\n1\n250\n1",
"output": "500"
},
{
"input": "501\n500\n500\n499",
"output": "2"
},
{
"input": "501\n450\n52\n1",
"output": "9"
},
{
"input": "501\n300\n301\n100",
"output": "2"
},
{
"input": "500\n179\n10\n1",
"output": "55"
},
{
"input": "1000\n500\n10\n9",
"output": "991"
},
{
"input": "1000\n2\n10\n9",
"output": "995"
},
{
"input": "1001\n1000\n1000\n999",
"output": "2"
},
{
"input": "10000\n10000\n10000\n1",
"output": "1"
},
{
"input": "10000\n10\n5000\n4999",
"output": "5500"
},
{
"input": "1000000000\n999999998\n999999999\n999999998",
"output": "3"
},
{
"input": "1000000000\n50\n50\n49",
"output": "999999951"
},
{
"input": "1000000000\n500\n5000\n4999",
"output": "999995010"
},
{
"input": "1000000000\n51\n100\n98",
"output": "499999952"
},
{
"input": "1000000000\n100\n51\n50",
"output": "999999950"
},
{
"input": "1000000000\n2\n5\n4",
"output": "999999998"
},
{
"input": "1000000000000000000\n999999998000000000\n999999999000000000\n999999998000000000",
"output": "3"
},
{
"input": "1000000000\n2\n2\n1",
"output": "999999999"
},
{
"input": "999999999\n2\n999999998\n1",
"output": "499999999"
},
{
"input": "999999999999999999\n2\n2\n1",
"output": "999999999999999998"
},
{
"input": "999999999999999999\n10\n10\n9",
"output": "999999999999999990"
},
{
"input": "999999999999999999\n999999999999999998\n999999999999999998\n999999999999999997",
"output": "2"
},
{
"input": "999999999999999999\n501\n501\n1",
"output": "1999999999999999"
},
{
"input": "999999999999999999\n2\n50000000000000000\n49999999999999999",
"output": "974999999999999999"
},
{
"input": "999999999999999999\n180\n180\n1",
"output": "5586592178770949"
},
{
"input": "1000000000000000000\n42\n41\n1",
"output": "24999999999999999"
},
{
"input": "1000000000000000000\n41\n40\n1",
"output": "25641025641025641"
},
{
"input": "100000000000000000\n79\n100\n25",
"output": "1333333333333333"
},
{
"input": "1\n100\n5\n4",
"output": "0"
},
{
"input": "1000000000000000000\n1000000000000000000\n10000000\n9999999",
"output": "999999999990000001"
},
{
"input": "999999999999999999\n999999999000000000\n900000000000000000\n899999999999999999",
"output": "100000000000000000"
},
{
"input": "13\n10\n15\n11",
"output": "1"
},
{
"input": "1\n1000\n5\n4",
"output": "0"
},
{
"input": "10\n100\n10\n1",
"output": "1"
},
{
"input": "3\n2\n100000\n99999",
"output": "1"
},
{
"input": "4\n2\n4\n2",
"output": "2"
},
{
"input": "5\n3\n6\n4",
"output": "1"
},
{
"input": "1\n7\n65\n49",
"output": "0"
},
{
"input": "10\n20\n100\n99",
"output": "0"
},
{
"input": "10000000000\n10000000000\n9000000000\n8999999999",
"output": "1000000001"
},
{
"input": "90\n30\n101\n100",
"output": "3"
},
{
"input": "999999999999999\n5\n500000000000000\n499999999999999",
"output": "599999999999999"
},
{
"input": "1000000000000000000\n1000000000000000000\n1000000000\n999999999",
"output": "999999999000000001"
},
{
"input": "1\n1000000000000000000\n1000000000\n999999999",
"output": "0"
},
{
"input": "100000000000000000\n100000000000000000\n1000000000\n999999999",
"output": "99999999000000001"
},
{
"input": "100000000000000009\n100\n1000000000000000\n999999999999999",
"output": "99010000000000009"
},
{
"input": "10\n20\n10\n9",
"output": "1"
},
{
"input": "10\n4\n14\n13",
"output": "2"
},
{
"input": "11\n3\n9\n7",
"output": "4"
},
{
"input": "1000000000\n5\n7\n4",
"output": "333333332"
},
{
"input": "12155\n1943\n28717\n24074",
"output": "6"
},
{
"input": "1000000000000000000\n10\n20\n5",
"output": "100000000000000000"
},
{
"input": "98\n33\n440\n314",
"output": "2"
},
{
"input": "1070252292\n57449678\n237309920\n221182550",
"output": "56"
},
{
"input": "100\n3\n102\n101",
"output": "33"
},
{
"input": "100000000000000000\n100000000000000001\n1000000000000000\n999999999999999",
"output": "99000000000000001"
},
{
"input": "66249876257975628\n302307316\n406102416\n182373516",
"output": "296116756"
},
{
"input": "10\n5\n10\n1",
"output": "2"
},
{
"input": "1000000000000000000\n10\n1000000000\n999999998",
"output": "499999999600000000"
}
] | 1,454,841,669
| 5,769
|
Python 3
|
OK
|
TESTS
| 82
| 62
| 0
|
n = int(input())
a = int(input())
b = int(input())
c = int(input())
l = 0
while n >= a or n >= b:
if n >= b and b - c < a:
nl1 = (n - b) // (b - c)
nl2 = n // b
nl = max(nl1, nl2)
l += nl
n -= (b - c) * nl
else:
nl = n // a
l += nl
n -= a * nl
print(l)
|
Title: Guest From the Past
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kolya Gerasimov loves kefir very much. He lives in year 1984 and knows all the details of buying this delicious drink. One day, as you probably know, he found himself in year 2084, and buying kefir there is much more complicated.
Kolya is hungry, so he went to the nearest milk shop. In 2084 you may buy kefir in a plastic liter bottle, that costs *a* rubles, or in glass liter bottle, that costs *b* rubles. Also, you may return empty glass bottle and get *c* (*c*<=<<=*b*) rubles back, but you cannot return plastic bottles.
Kolya has *n* rubles and he is really hungry, so he wants to drink as much kefir as possible. There were no plastic bottles in his 1984, so Kolya doesn't know how to act optimally and asks for your help.
Input Specification:
First line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1018) — the number of rubles Kolya has at the beginning.
Then follow three lines containing integers *a*, *b* and *c* (1<=≤<=*a*<=≤<=1018, 1<=≤<=*c*<=<<=*b*<=≤<=1018) — the cost of one plastic liter bottle, the cost of one glass liter bottle and the money one can get back by returning an empty glass bottle, respectively.
Output Specification:
Print the only integer — maximum number of liters of kefir, that Kolya can drink.
Demo Input:
['10\n11\n9\n8\n', '10\n5\n6\n1\n']
Demo Output:
['2\n', '2\n']
Note:
In the first sample, Kolya can buy one glass bottle, then return it and buy one more glass bottle. Thus he will drink 2 liters of kefir.
In the second sample, Kolya can buy two plastic bottle and get two liters of kefir, or he can buy one liter glass bottle, then return it and buy one plastic bottle. In both cases he will drink two liters of kefir.
|
```python
n = int(input())
a = int(input())
b = int(input())
c = int(input())
l = 0
while n >= a or n >= b:
if n >= b and b - c < a:
nl1 = (n - b) // (b - c)
nl2 = n // b
nl = max(nl1, nl2)
l += nl
n -= (b - c) * nl
else:
nl = n // a
l += nl
n -= a * nl
print(l)
```
| 3
|
|
784
|
F
|
Crunching Numbers Just for You
|
PROGRAMMING
| 1,900
|
[
"*special",
"implementation"
] | null | null |
You are developing a new feature for the website which sells airline tickets: being able to sort tickets by price! You have already extracted the tickets' prices, so there's just the last step to be done...
You are given an array of integers. Sort it in non-descending order.
|
The input consists of a single line of space-separated integers. The first number is *n* (1<=≤<=*n*<=≤<=10) — the size of the array. The following *n* numbers are the elements of the array (1<=≤<=*a**i*<=≤<=100).
|
Output space-separated elements of the sorted array.
|
[
"3 3 1 2\n"
] |
[
"1 2 3 \n"
] |
Remember, this is a very important feature, and you have to make sure the customers appreciate it!
| 0
|
[
{
"input": "3 3 1 2",
"output": "1 2 3 "
},
{
"input": "10 54 100 27 1 33 27 80 49 27 6",
"output": "1 6 27 27 27 33 49 54 80 100 "
}
] | 1,680,287,663
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 0
| 30
| 0
|
a = [int(i) for i in input().split()][:-1]
print(*sorted(a))
|
Title: Crunching Numbers Just for You
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are developing a new feature for the website which sells airline tickets: being able to sort tickets by price! You have already extracted the tickets' prices, so there's just the last step to be done...
You are given an array of integers. Sort it in non-descending order.
Input Specification:
The input consists of a single line of space-separated integers. The first number is *n* (1<=≤<=*n*<=≤<=10) — the size of the array. The following *n* numbers are the elements of the array (1<=≤<=*a**i*<=≤<=100).
Output Specification:
Output space-separated elements of the sorted array.
Demo Input:
['3 3 1 2\n']
Demo Output:
['1 2 3 \n']
Note:
Remember, this is a very important feature, and you have to make sure the customers appreciate it!
|
```python
a = [int(i) for i in input().split()][:-1]
print(*sorted(a))
```
| 0
|
|
989
|
C
|
A Mist of Florescence
|
PROGRAMMING
| 1,800
|
[
"constructive algorithms",
"graphs"
] | null | null |
"I've been here once," Mino exclaims with delight, "it's breathtakingly amazing."
"What is it like?"
"Look, Kanno, you've got your paintbrush, and I've got my words. Have a try, shall we?"
There are four kinds of flowers in the wood, Amaranths, Begonias, Centaureas and Dianthuses.
The wood can be represented by a rectangular grid of $n$ rows and $m$ columns. In each cell of the grid, there is exactly one type of flowers.
According to Mino, the numbers of connected components formed by each kind of flowers are $a$, $b$, $c$ and $d$ respectively. Two cells are considered in the same connected component if and only if a path exists between them that moves between cells sharing common edges and passes only through cells containing the same flowers.
You are to help Kanno depict such a grid of flowers, with $n$ and $m$ arbitrarily chosen under the constraints given below. It can be shown that at least one solution exists under the constraints of this problem.
Note that you can choose arbitrary $n$ and $m$ under the constraints below, they are not given in the input.
|
The first and only line of input contains four space-separated integers $a$, $b$, $c$ and $d$ ($1 \leq a, b, c, d \leq 100$) — the required number of connected components of Amaranths, Begonias, Centaureas and Dianthuses, respectively.
|
In the first line, output two space-separated integers $n$ and $m$ ($1 \leq n, m \leq 50$) — the number of rows and the number of columns in the grid respectively.
Then output $n$ lines each consisting of $m$ consecutive English letters, representing one row of the grid. Each letter should be among 'A', 'B', 'C' and 'D', representing Amaranths, Begonias, Centaureas and Dianthuses, respectively.
In case there are multiple solutions, print any. You can output each letter in either case (upper or lower).
|
[
"5 3 2 1\n",
"50 50 1 1\n",
"1 6 4 5\n"
] |
[
"4 7\nDDDDDDD\nDABACAD\nDBABACD\nDDDDDDD",
"4 50\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nABABABABABABABABABABABABABABABABABABABABABABABABAB\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD",
"7 7\nDDDDDDD\nDDDBDBD\nDDCDCDD\nDBDADBD\nDDCDCDD\nDBDBDDD\nDDDDDDD"
] |
In the first example, each cell of Amaranths, Begonias and Centaureas forms a connected component, while all the Dianthuses form one.
| 1,500
|
[
{
"input": "5 3 2 1",
"output": "5 13\nAABABBBBCDDAD\nABAABBBBCDADD\nAAAABBBBCDDAD\nAAAABCBBCDADD\nAAAABBBBCDDDD"
},
{
"input": "50 50 1 1",
"output": "10 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD\nDADADADADADADADADADADADADADADADADADADADADADADADADD\nADADADADADADADADADADADADADADADADADADADADADADADADAD\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD..."
},
{
"input": "1 6 4 5",
"output": "6 13\nAABABBCBCCDCD\nABAABBBBCCCCD\nAABABBCBCCDCD\nABAABCBBCDCCD\nAABABBBBCCDCD\nAAAABBBBCCCCD"
},
{
"input": "1 1 1 1",
"output": "2 4\nABCD\nABCD"
},
{
"input": "4 8 16 32",
"output": "16 32\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABAAAAAAABAAAAAAAAAAAAAAABABAAAA\nBAAAAAAAAAAABAAAAAAAAAAABAAAAAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBBBBBCBCBCBCBCBBBCBCBBBBBBBBBB\nCBCBBBBBBBBBCBBBCBBBCBBBBBCBBBCB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCC\nDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDC\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD\nADDDDDDDDDDDDDDDADDDDDDDDDDD..."
},
{
"input": "1 1 1 50",
"output": "7 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCC\nDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDC\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD"
},
{
"input": "19 58 20 18",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABAAABABABABABAAABABAAAAABABAAABABAAAAABAA\nAAAABABABAAABABABABABAAABAAABAAABAAAAAAABAAAAAAAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABAAABABABAAABABABABAAAAAAABABAAABAAABAAABAAABABA\nABABAAABAAABABAAABAAAAABAAABABAAABAAAAABAAABAAAAAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBBBBBCBBBCBCBBBBBBBBBCBBBCBBBBBBBBBBBCBCBB\nBBBBCBCBCBCBBBBBCBBBBBCBCBCBBBCBBBBB..."
},
{
"input": "100 100 100 100",
"output": "40 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAABAAABAAABAAABABABABABABAAABABABABABABAAAAABABAA\nAABAAAAAAAAAAABAAABAAABABABAAABABAAABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAAABABABAAAAAAABABABABABAAABABABABABABAAAAAAABABA\nABABABAAABABABAAABABAAABAAABABABABABAAABABABABABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABAAABAAABABAAAAAAABAAAAAAABABAAABAAABAAAAABAA\nBABABABAAABABABABABAAABABABABAAABABAAABABABAAABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA..."
},
{
"input": "1 1 1 2",
"output": "2 7\nABCCDCD\nABCCCCD"
},
{
"input": "1 1 3 1",
"output": "3 7\nABBCBCD\nABCBBCD\nABBBBCD"
},
{
"input": "1 4 1 1",
"output": "4 7\nAABABCD\nABAABCD\nAABABCD\nAAAABCD"
},
{
"input": "5 1 1 1",
"output": "5 7\nABCDDAD\nABCDADD\nABCDDAD\nABCDADD\nABCDDDD"
},
{
"input": "1 4 7 3",
"output": "7 13\nAAAABBCBCCDCD\nABAABCBBCCCCD\nAAAABBCBCCCCD\nABAABCBBCCCCD\nAABABBCBCCCCD\nAAAABCBBCDCCD\nAAAABBBBCCCCD"
},
{
"input": "6 2 5 1",
"output": "6 13\nAAAABBCBCDDAD\nAAAABBBBCDADD\nAAAABBCBCDDAD\nAAAABCBBCDADD\nAABABBCBCDDAD\nAAAABBBBCDDDD"
},
{
"input": "1 5 6 3",
"output": "6 13\nAAAABBCBCCCCD\nABAABCBBCCCCD\nAABABBCBCCCCD\nABAABCBBCDCCD\nAABABBCBCCDCD\nAAAABBBBCCCCD"
},
{
"input": "4 1 4 5",
"output": "5 13\nABBCBCCDCDDAD\nABCBBCDCCDDDD\nABBBBCCDCDDAD\nABCBBCDCCDADD\nABBBBCCCCDDDD"
},
{
"input": "4 5 3 6",
"output": "6 16\nAAAABBCBCCDCDDAD\nABAABBBBCDCCDDDD\nAABABBCBCCDCDDAD\nABAABBBBCDCCDDDD\nAABABBBBCCDCDDAD\nAAAABBBBCCCCDDDD"
},
{
"input": "2 5 1 17",
"output": "13 17\nAAAAAAAAAAAAAAAAA\nABAAAAAAABAAAAAAA\nAABAAAAAAAAABAAAA\nAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDC\nDCDCDCDCDCDCDCDCC\nCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDD\nDDDDDDDDDDDDDDDDD\nDDADDDDDDDDDDDDDD\nDDDDDDDDDDDDDDDDD"
},
{
"input": "11 4 5 14",
"output": "14 16\nAAAABBBBCCDCDDDD\nABAABBBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABBBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABBBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABCBBCDCCDDDD\nAAAABBCBCCDCDDDD\nABAABCBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABCBBCDCCDADD\nAABABBBBCCDCDDAD\nAAAABBBBCCCCDDDD"
},
{
"input": "19 19 8 10",
"output": "16 19\nAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABA\nBABABABABABABABABAA\nAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBBBBBCBBBCB\nBBCBBBCBCBBBBBCBBBB\nBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCC\nCCCDCCCCCDCCCDCCCDC\nCCCCDCDCCCDCCCDCDCC\nCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDD\nDADADADADADADADADAD\nADADADADADADADADADD\nDDDDDDDDDDDDDDDDDDD"
},
{
"input": "49 49 49 49",
"output": "16 49\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABA\nBABABABABABABABABABABABABABABABABABABABABABABABAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCB\nCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDC..."
},
{
"input": "49 50 50 50",
"output": "16 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBB\nCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCD..."
},
{
"input": "50 50 51 50",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBCBCBBBBBCBBBCBBBCBBBBBBBCBCBBBCBBBBBCBBBB\nCBCBCBCBCBBBBBBBBBBBBBBBBBBBCBCBBBCBCBCBBBCBCBCBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBCBCBBBBBCBBBCBBBCBCBCBCBCBCBCBCBCBCBBBCBBBBBCBCB\nBBBBBCBBBCBBBBBCBBBBBCBBBCBBBCBBBCBB..."
},
{
"input": "15 63 41 45",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABAAABABABABABAAABABAAAAABABAAABABAAAAABAA\nAAAABABABAAABABABABABAAABAAABAAABABABABABAAABAAAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABAAABABABAAABABABABAAAAAAABABAAABAAABAAABAAABABA\nABABAAABAAABABAAABAAAAABAAABABAAABABAAABAAABAAAAAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBCBCBCBCBCBCBCBCBCBBBCBBBCBBBCBCBCBCBCBCBCBCBB\nCBBBCBCBCBCBCBCBCBBBCBCBCBCBCBCBBBBB..."
},
{
"input": "45 36 25 13",
"output": "16 45\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABAAABABABABAAABABABABABAAABABABABABAAAAABAAA\nBABABABABABABAAAAABABABABABABABABABABAAABABAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBBBCBBBBBBBBBBBBBBBCBCBCBBBCBCBBBCB\nCBBBCBCBCBCBBBBBCBBBBBBBBBCBBBCBBBBBCBCBCBCBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCCCCCCCCCCCCCCCCCCCDCCCCCCCCCDCCCCCDCCCCCDCCC\nCCCCCCCCCCCCDCCCDCCCCCDCDCCCCCDCCC..."
},
{
"input": "31 41 59 26",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABAAAAABAAABABABABABABABABAAABABABABABAA\nBABABABABABABAAABABAAABAAABAAABABABABAAABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBCBCBCBBBCBBBCBBBCBBBBBBBCBCBBBCBBBBBCBBBB\nCBCBCBCBCBCBBBBBBBBBBBBBCBBBCBCBBBCBCBCBBBCBCBCBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBCBCBBBBBCBBBCBBBCBCBCBCBCBCBCBCBCBCBBBCBBBBBCBCB\nBCBBBCBBBCBBBCBCBBBBBCBBBCBBBCBCBCBC..."
},
{
"input": "18 90 64 16",
"output": "22 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABAAABAA\nAABABABABAAABABABABABABABAAABABABABABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABABABABABABABABABABABABABABABAAABABABABABABABABA\nABABABABABABABAAABABAAABABABABABABABABABABABAAABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBCBCBCBBBCBBBBBCBCBCBBBCBCBCBBBCBBBCBCBCBCBCBB\nCBCBCBBBCBCBBBCBBBCBCBBBCBCBBBCBCBBB..."
},
{
"input": "77 88 99 1",
"output": "22 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABAAAAABAA\nAABABABABAAABABABABABABABAAABABABABABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABABABABABABABABABABABABAAABABAAABABABABABABABABA\nABABABABABABABAAABABAAABABABABABABABABABABABAAABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBB\nCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCB..."
},
{
"input": "99 100 1 100",
"output": "28 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAABAAABAAABAAABABABABABABAAABABABABABABAAAAABABAA\nAABAAAAAAAAAAABAAABAAABABABAAABABAAABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAAABABABAAAAAAABABABABABAAABABABABABABAAAAAAABABA\nABABABAAABABABAAABABAAABAAABABABABABAAABABABABABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABAAABAAABABAAAAAAABAAAAAAABABAAABAAABAAAAABAA\nBABABABAAABABABABABAAABABABABAAABABAAABABABAAABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA..."
},
{
"input": "100 50 100 49",
"output": "28 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBBBBBCBCBCBBBCBBBBBCBCBBBCBCBCBBBCBCBCBCBBBBBB\nBBBBCBCBCBCBBBCBCBCBCBCBBBCBCBCBCBBBCBCBCBCBCBCBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBCBCBBBBBCBCBCBCBCBCBCBCBCBCBBBCBCBCBBBBBCBCBCBCB\nBCBBBBBCBCBCBBBCBCBBBCBCBCBBBBBCBCBB..."
}
] | 1,530,356,212
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 1
| 93
| 0
|
def main():
(a, A), (b, B), (c, C), (d, D) = sorted(zip(map(int, input().split()), 'ABCD'))
aa = A.join(B * (b - 1)) if b > 1 else A
bb = B.join(A * (a - 1)) if b > 1 else B
cc = C.join(D * (d - 1)) if d > 1 else C
dd = D.join(C * (c - 1)) if d > 1 else D
print(4, len(aa) + len(cc))
print(aa, cc, sep='')
print(A * len(aa), C * len(cc), sep='')
print(B * len(aa), D * len(cc), sep='')
print(bb, B * (len(aa) - len(bb)), D * (len(cc) - len(dd)), dd, sep='')
if __name__ == '__main__':
main()
|
Title: A Mist of Florescence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"I've been here once," Mino exclaims with delight, "it's breathtakingly amazing."
"What is it like?"
"Look, Kanno, you've got your paintbrush, and I've got my words. Have a try, shall we?"
There are four kinds of flowers in the wood, Amaranths, Begonias, Centaureas and Dianthuses.
The wood can be represented by a rectangular grid of $n$ rows and $m$ columns. In each cell of the grid, there is exactly one type of flowers.
According to Mino, the numbers of connected components formed by each kind of flowers are $a$, $b$, $c$ and $d$ respectively. Two cells are considered in the same connected component if and only if a path exists between them that moves between cells sharing common edges and passes only through cells containing the same flowers.
You are to help Kanno depict such a grid of flowers, with $n$ and $m$ arbitrarily chosen under the constraints given below. It can be shown that at least one solution exists under the constraints of this problem.
Note that you can choose arbitrary $n$ and $m$ under the constraints below, they are not given in the input.
Input Specification:
The first and only line of input contains four space-separated integers $a$, $b$, $c$ and $d$ ($1 \leq a, b, c, d \leq 100$) — the required number of connected components of Amaranths, Begonias, Centaureas and Dianthuses, respectively.
Output Specification:
In the first line, output two space-separated integers $n$ and $m$ ($1 \leq n, m \leq 50$) — the number of rows and the number of columns in the grid respectively.
Then output $n$ lines each consisting of $m$ consecutive English letters, representing one row of the grid. Each letter should be among 'A', 'B', 'C' and 'D', representing Amaranths, Begonias, Centaureas and Dianthuses, respectively.
In case there are multiple solutions, print any. You can output each letter in either case (upper or lower).
Demo Input:
['5 3 2 1\n', '50 50 1 1\n', '1 6 4 5\n']
Demo Output:
['4 7\nDDDDDDD\nDABACAD\nDBABACD\nDDDDDDD', '4 50\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nABABABABABABABABABABABABABABABABABABABABABABABABAB\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD', '7 7\nDDDDDDD\nDDDBDBD\nDDCDCDD\nDBDADBD\nDDCDCDD\nDBDBDDD\nDDDDDDD']
Note:
In the first example, each cell of Amaranths, Begonias and Centaureas forms a connected component, while all the Dianthuses form one.
|
```python
def main():
(a, A), (b, B), (c, C), (d, D) = sorted(zip(map(int, input().split()), 'ABCD'))
aa = A.join(B * (b - 1)) if b > 1 else A
bb = B.join(A * (a - 1)) if b > 1 else B
cc = C.join(D * (d - 1)) if d > 1 else C
dd = D.join(C * (c - 1)) if d > 1 else D
print(4, len(aa) + len(cc))
print(aa, cc, sep='')
print(A * len(aa), C * len(cc), sep='')
print(B * len(aa), D * len(cc), sep='')
print(bb, B * (len(aa) - len(bb)), D * (len(cc) - len(dd)), dd, sep='')
if __name__ == '__main__':
main()
```
| 0
|
|
194
|
B
|
Square
|
PROGRAMMING
| 1,200
|
[
"math"
] | null | null |
There is a square painted on a piece of paper, the square's side equals *n* meters. John Doe draws crosses on the square's perimeter. John paints the first cross in the lower left corner of the square. Then John moves along the square's perimeter in the clockwise direction (first upwards, then to the right, then downwards, then to the left and so on). Every time he walks (*n*<=+<=1) meters, he draws a cross (see picture for clarifications).
John Doe stops only when the lower left corner of the square has two crosses. How many crosses will John draw?
|
The first line contains integer *t* (1<=≤<=*t*<=≤<=104) — the number of test cases.
The second line contains *t* space-separated integers *n**i* (1<=≤<=*n**i*<=≤<=109) — the sides of the square for each test sample.
|
For each test sample print on a single line the answer to it, that is, the number of crosses John will draw as he will move along the square of the corresponding size. Print the answers to the samples in the order in which the samples are given in the input.
Please do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
|
[
"3\n4 8 100\n"
] |
[
"17\n33\n401\n"
] |
none
| 1,000
|
[
{
"input": "3\n4 8 100",
"output": "17\n33\n401"
},
{
"input": "8\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 13",
"output": "4000000001\n4000000001\n4000000001\n4000000001\n4000000001\n4000000001\n4000000001\n27"
},
{
"input": "3\n13 17 21",
"output": "27\n35\n43"
}
] | 1,662,196,024
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 8
| 124
| 4,403,200
|
import math
n = int(input())
a = list(map(int,input().split()))
for i in a:
print(1 + ((4 * i * (i + 1)) // math.gcd(4 * i ,i + 1)) // (i + 1))
|
Title: Square
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a square painted on a piece of paper, the square's side equals *n* meters. John Doe draws crosses on the square's perimeter. John paints the first cross in the lower left corner of the square. Then John moves along the square's perimeter in the clockwise direction (first upwards, then to the right, then downwards, then to the left and so on). Every time he walks (*n*<=+<=1) meters, he draws a cross (see picture for clarifications).
John Doe stops only when the lower left corner of the square has two crosses. How many crosses will John draw?
Input Specification:
The first line contains integer *t* (1<=≤<=*t*<=≤<=104) — the number of test cases.
The second line contains *t* space-separated integers *n**i* (1<=≤<=*n**i*<=≤<=109) — the sides of the square for each test sample.
Output Specification:
For each test sample print on a single line the answer to it, that is, the number of crosses John will draw as he will move along the square of the corresponding size. Print the answers to the samples in the order in which the samples are given in the input.
Please do not use the %lld specifier to read or write 64-bit integers in С++. It is preferred to use the cin, cout streams or the %I64d specifier.
Demo Input:
['3\n4 8 100\n']
Demo Output:
['17\n33\n401\n']
Note:
none
|
```python
import math
n = int(input())
a = list(map(int,input().split()))
for i in a:
print(1 + ((4 * i * (i + 1)) // math.gcd(4 * i ,i + 1)) // (i + 1))
```
| 3
|
|
958
|
D1
|
Hyperspace Jump (easy)
|
PROGRAMMING
| 1,400
|
[
"expression parsing",
"math"
] | null | null |
The Rebel fleet is on the run. It consists of *m* ships currently gathered around a single planet. Just a few seconds ago, the vastly more powerful Empire fleet has appeared in the same solar system, and the Rebels will need to escape into hyperspace. In order to spread the fleet, the captain of each ship has independently come up with the coordinate to which that ship will jump. In the obsolete navigation system used by the Rebels, this coordinate is given as the value of an arithmetic expression of the form .
To plan the future of the resistance movement, Princess Heidi needs to know, for each ship, how many ships are going to end up at the same coordinate after the jump. You are her only hope!
|
The first line of the input contains a single integer *m* (1<=≤<=*m*<=≤<=200<=000) – the number of ships. The next *m* lines describe one jump coordinate each, given as an arithmetic expression. An expression has the form (a+b)/c. Namely, it consists of: an opening parenthesis (, a positive integer *a* of up to two decimal digits, a plus sign +, a positive integer *b* of up to two decimal digits, a closing parenthesis ), a slash /, and a positive integer *c* of up to two decimal digits.
|
Print a single line consisting of *m* space-separated integers. The *i*-th integer should be equal to the number of ships whose coordinate is equal to that of the *i*-th ship (including the *i*-th ship itself).
|
[
"4\n(99+98)/97\n(26+4)/10\n(12+33)/15\n(5+1)/7\n"
] |
[
"1 2 2 1 "
] |
In the sample testcase, the second and the third ship will both end up at the coordinate 3.
Note that this problem has only two versions – easy and hard.
| 0
|
[
{
"input": "4\n(99+98)/97\n(26+4)/10\n(12+33)/15\n(5+1)/7",
"output": "1 2 2 1 "
},
{
"input": "10\n(44+98)/19\n(36+58)/47\n(62+74)/68\n(69+95)/82\n(26+32)/29\n(32+46)/39\n(32+24)/28\n(47+61)/54\n(39+13)/26\n(98+98)/98",
"output": "1 9 9 9 9 9 9 9 9 9 "
},
{
"input": "30\n(89+76)/87\n(81+78)/18\n(60+97)/32\n(41+14)/48\n(55+65)/27\n(29+15)/95\n(64+13)/96\n(78+30)/75\n(43+6)/60\n(69+34)/48\n(62+2)/97\n(85+42)/3\n(4+97)/42\n(1+18)/39\n(46+55)/76\n(22+59)/24\n(62+81)/98\n(64+8)/51\n(9+59)/48\n(47+2)/80\n(33+74)/76\n(61+83)/44\n(86+4)/51\n(65+41)/49\n(53+36)/45\n(6+19)/15\n(51+21)/68\n(98+36)/86\n(92+65)/86\n(27+58)/78",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 "
}
] | 1,631,059,369
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 16
| 608
| 19,763,200
|
# _
#####################################################################################################################
def main():
return nShipsWithSameCoordinate(int(input()), {})
def nShipsWithSameCoordinate(nShips, nShipsAt):
ships_Coordinates = list(range(nShips))
for i in ships_Coordinates:
n1, remaining = input()[1:].split('+')
n2, n3 = remaining.split(')/')
coordinate = (int(n1)+int(n2))/int(n3)
if coordinate not in nShipsAt:
nShipsAt[coordinate] = 1
else:
nShipsAt[coordinate] += 1
ships_Coordinates[i] = coordinate
return ' '.join(map(str, (nShipsAt[c] for c in ships_Coordinates)))
if __name__ == '__main__':
print(main())
# main()
# open('output.txt', 'w').write(main())
|
Title: Hyperspace Jump (easy)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Rebel fleet is on the run. It consists of *m* ships currently gathered around a single planet. Just a few seconds ago, the vastly more powerful Empire fleet has appeared in the same solar system, and the Rebels will need to escape into hyperspace. In order to spread the fleet, the captain of each ship has independently come up with the coordinate to which that ship will jump. In the obsolete navigation system used by the Rebels, this coordinate is given as the value of an arithmetic expression of the form .
To plan the future of the resistance movement, Princess Heidi needs to know, for each ship, how many ships are going to end up at the same coordinate after the jump. You are her only hope!
Input Specification:
The first line of the input contains a single integer *m* (1<=≤<=*m*<=≤<=200<=000) – the number of ships. The next *m* lines describe one jump coordinate each, given as an arithmetic expression. An expression has the form (a+b)/c. Namely, it consists of: an opening parenthesis (, a positive integer *a* of up to two decimal digits, a plus sign +, a positive integer *b* of up to two decimal digits, a closing parenthesis ), a slash /, and a positive integer *c* of up to two decimal digits.
Output Specification:
Print a single line consisting of *m* space-separated integers. The *i*-th integer should be equal to the number of ships whose coordinate is equal to that of the *i*-th ship (including the *i*-th ship itself).
Demo Input:
['4\n(99+98)/97\n(26+4)/10\n(12+33)/15\n(5+1)/7\n']
Demo Output:
['1 2 2 1 ']
Note:
In the sample testcase, the second and the third ship will both end up at the coordinate 3.
Note that this problem has only two versions – easy and hard.
|
```python
# _
#####################################################################################################################
def main():
return nShipsWithSameCoordinate(int(input()), {})
def nShipsWithSameCoordinate(nShips, nShipsAt):
ships_Coordinates = list(range(nShips))
for i in ships_Coordinates:
n1, remaining = input()[1:].split('+')
n2, n3 = remaining.split(')/')
coordinate = (int(n1)+int(n2))/int(n3)
if coordinate not in nShipsAt:
nShipsAt[coordinate] = 1
else:
nShipsAt[coordinate] += 1
ships_Coordinates[i] = coordinate
return ' '.join(map(str, (nShipsAt[c] for c in ships_Coordinates)))
if __name__ == '__main__':
print(main())
# main()
# open('output.txt', 'w').write(main())
```
| 3
|
|
519
|
B
|
A and B and Compilation Errors
|
PROGRAMMING
| 1,100
|
[
"data structures",
"implementation",
"sortings"
] | null | null |
A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake.
However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared — the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change.
Can you help B find out exactly what two errors he corrected?
|
The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=105) — the initial number of compilation errors.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the errors the compiler displayed for the first time.
The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 — the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one.
The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 — the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one.
|
Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively.
|
[
"5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n",
"6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n"
] |
[
"8\n123\n",
"1\n3\n"
] |
In the first test sample B first corrects the error number 8, then the error number 123.
In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
| 1,000
|
[
{
"input": "5\n1 5 8 123 7\n123 7 5 1\n5 1 7",
"output": "8\n123"
},
{
"input": "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5",
"output": "1\n3"
},
{
"input": "3\n1 2 3\n3 2\n2",
"output": "1\n3"
},
{
"input": "10\n460626451 802090732 277246428 661369649 388684428 784303821 376287098 656422756 9301599 25720377\n277246428 388684428 661369649 460626451 656422756 802090732 9301599 784303821 376287098\n376287098 802090732 388684428 9301599 656422756 784303821 460626451 277246428",
"output": "25720377\n661369649"
},
{
"input": "3\n796067435 964699482 819602309\n964699482 796067435\n964699482",
"output": "819602309\n796067435"
},
{
"input": "3\n374054998 726316780 902899520\n902899520 726316780\n726316780",
"output": "374054998\n902899520"
},
{
"input": "3\n168638990 939116221 323703261\n168638990 323703261\n168638990",
"output": "939116221\n323703261"
},
{
"input": "3\n77 77 77\n77 77\n77",
"output": "77\n77"
},
{
"input": "3\n84 30 9\n9 84\n9",
"output": "30\n84"
},
{
"input": "6\n5 4 3 3 5 5\n3 5 5 4 3\n3 5 4 3",
"output": "5\n5"
},
{
"input": "4\n1 5 7 8\n1 5 7\n1 5",
"output": "8\n7"
}
] | 1,634,732,943
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 33
| 187
| 19,251,200
|
n = int(input())
A = [int(x) for x in input().split()]
B = [int(x) for x in input().split()]
C = [int(x) for x in input().split()]
print(sum(A)-sum(B))
print(sum(B)-sum(C))
|
Title: A and B and Compilation Errors
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A and B are preparing themselves for programming contests.
B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code.
Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake.
However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared — the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change.
Can you help B find out exactly what two errors he corrected?
Input Specification:
The first line of the input contains integer *n* (3<=≤<=*n*<=≤<=105) — the initial number of compilation errors.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — the errors the compiler displayed for the first time.
The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 — the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one.
The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 — the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one.
Output Specification:
Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively.
Demo Input:
['5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n', '6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n']
Demo Output:
['8\n123\n', '1\n3\n']
Note:
In the first test sample B first corrects the error number 8, then the error number 123.
In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
|
```python
n = int(input())
A = [int(x) for x in input().split()]
B = [int(x) for x in input().split()]
C = [int(x) for x in input().split()]
print(sum(A)-sum(B))
print(sum(B)-sum(C))
```
| 3
|
|
701
|
B
|
Cells Not Under Attack
|
PROGRAMMING
| 1,200
|
[
"data structures",
"math"
] | null | null |
Vasya has the square chessboard of size *n*<=×<=*n* and *m* rooks. Initially the chessboard is empty. Vasya will consequently put the rooks on the board one after another.
The cell of the field is under rook's attack, if there is at least one rook located in the same row or in the same column with this cell. If there is a rook located in the cell, this cell is also under attack.
You are given the positions of the board where Vasya will put rooks. For each rook you have to determine the number of cells which are not under attack after Vasya puts it on the board.
|
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*m*<=≤<=*min*(100<=000,<=*n*2)) — the size of the board and the number of rooks.
Each of the next *m* lines contains integers *x**i* and *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=*n*) — the number of the row and the number of the column where Vasya will put the *i*-th rook. Vasya puts rooks on the board in the order they appear in the input. It is guaranteed that any cell will contain no more than one rook.
|
Print *m* integer, the *i*-th of them should be equal to the number of cells that are not under attack after first *i* rooks are put.
|
[
"3 3\n1 1\n3 1\n2 2\n",
"5 2\n1 5\n5 1\n",
"100000 1\n300 400\n"
] |
[
"4 2 0 \n",
"16 9 \n",
"9999800001 \n"
] |
On the picture below show the state of the board after put each of the three rooks. The cells which painted with grey color is not under the attack.
| 750
|
[
{
"input": "3 3\n1 1\n3 1\n2 2",
"output": "4 2 0 "
},
{
"input": "5 2\n1 5\n5 1",
"output": "16 9 "
},
{
"input": "100000 1\n300 400",
"output": "9999800001 "
},
{
"input": "10 4\n2 8\n1 8\n9 8\n6 9",
"output": "81 72 63 48 "
},
{
"input": "30 30\n3 13\n27 23\n18 24\n18 19\n14 20\n7 10\n27 13\n20 27\n11 1\n21 10\n2 9\n28 12\n29 19\n28 27\n27 29\n30 12\n27 2\n4 5\n8 19\n21 2\n24 27\n14 22\n20 3\n18 3\n23 9\n28 6\n15 12\n2 2\n16 27\n1 14",
"output": "841 784 729 702 650 600 600 552 506 484 441 400 380 380 361 342 324 289 272 272 255 240 225 225 210 196 182 182 168 143 "
},
{
"input": "70 31\n22 39\n33 43\n50 27\n70 9\n20 67\n61 24\n60 4\n60 28\n4 25\n30 29\n46 47\n51 48\n37 5\n14 29\n45 44\n68 35\n52 21\n7 37\n18 43\n44 22\n26 12\n39 37\n51 55\n50 23\n51 16\n16 49\n22 62\n35 45\n56 2\n20 51\n3 37",
"output": "4761 4624 4489 4356 4225 4096 3969 3906 3782 3660 3540 3422 3306 3249 3136 3025 2916 2809 2756 2652 2550 2499 2450 2401 2352 2256 2208 2115 2024 1978 1935 "
},
{
"input": "330 17\n259 262\n146 20\n235 69\n84 74\n131 267\n153 101\n32 232\n214 212\n239 157\n121 156\n10 45\n266 78\n52 258\n109 279\n193 276\n239 142\n321 89",
"output": "108241 107584 106929 106276 105625 104976 104329 103684 103041 102400 101761 101124 100489 99856 99225 98910 98282 "
},
{
"input": "500 43\n176 85\n460 171\n233 260\n73 397\n474 35\n290 422\n309 318\n280 415\n485 169\n106 22\n355 129\n180 301\n205 347\n197 93\n263 318\n336 382\n314 350\n476 214\n367 277\n333 166\n500 376\n236 17\n94 73\n116 204\n166 50\n168 218\n144 369\n340 91\n274 360\n171 360\n41 251\n262 478\n27 163\n151 491\n208 415\n448 386\n293 486\n371 479\n330 435\n220 374\n163 316\n155 158\n26 126",
"output": "249001 248004 247009 246016 245025 244036 243049 242064 241081 240100 239121 238144 237169 236196 235710 234740 233772 232806 231842 230880 229920 228962 228006 227052 226100 225150 224202 223256 222312 221840 220899 219960 219023 218088 217620 216688 215758 214830 213904 212980 212058 211138 210220 "
},
{
"input": "99999 1\n54016 16192",
"output": "9999600004 "
},
{
"input": "99991 9\n80814 65974\n12100 98787\n9390 76191\n5628 47659\n80075 25361\n75330 1630\n38758 99962\n33848 40352\n43732 52281",
"output": "9998000100 9997800121 9997600144 9997400169 9997200196 9997000225 9996800256 9996600289 9996400324 "
},
{
"input": "1 1\n1 1",
"output": "0 "
}
] | 1,658,718,114
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 40
| 1,153
| 28,774,400
|
from collections import defaultdict as dc
n,m=[int(x) for x in input().split()]
ans=n*n
mpr,mpc=dc(lambda:False),dc(lambda:False)
stR,stC=set(),set()
for _ in range(m):
x,y=[int(c) for c in input().split()]
if mpr[x]==False:
ans-=(n-len(stC))
stR.add(x)
mpr[x]=True
if mpc[y]==False:
ans-=(n-len(stR))
stC.add(y)
mpc[y]=True
print(ans,end=' ')
|
Title: Cells Not Under Attack
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has the square chessboard of size *n*<=×<=*n* and *m* rooks. Initially the chessboard is empty. Vasya will consequently put the rooks on the board one after another.
The cell of the field is under rook's attack, if there is at least one rook located in the same row or in the same column with this cell. If there is a rook located in the cell, this cell is also under attack.
You are given the positions of the board where Vasya will put rooks. For each rook you have to determine the number of cells which are not under attack after Vasya puts it on the board.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*m*<=≤<=*min*(100<=000,<=*n*2)) — the size of the board and the number of rooks.
Each of the next *m* lines contains integers *x**i* and *y**i* (1<=≤<=*x**i*,<=*y**i*<=≤<=*n*) — the number of the row and the number of the column where Vasya will put the *i*-th rook. Vasya puts rooks on the board in the order they appear in the input. It is guaranteed that any cell will contain no more than one rook.
Output Specification:
Print *m* integer, the *i*-th of them should be equal to the number of cells that are not under attack after first *i* rooks are put.
Demo Input:
['3 3\n1 1\n3 1\n2 2\n', '5 2\n1 5\n5 1\n', '100000 1\n300 400\n']
Demo Output:
['4 2 0 \n', '16 9 \n', '9999800001 \n']
Note:
On the picture below show the state of the board after put each of the three rooks. The cells which painted with grey color is not under the attack.
|
```python
from collections import defaultdict as dc
n,m=[int(x) for x in input().split()]
ans=n*n
mpr,mpc=dc(lambda:False),dc(lambda:False)
stR,stC=set(),set()
for _ in range(m):
x,y=[int(c) for c in input().split()]
if mpr[x]==False:
ans-=(n-len(stC))
stR.add(x)
mpr[x]=True
if mpc[y]==False:
ans-=(n-len(stR))
stC.add(y)
mpc[y]=True
print(ans,end=' ')
```
| 3
|
|
424
|
B
|
Megacity
|
PROGRAMMING
| 1,200
|
[
"binary search",
"greedy",
"implementation",
"sortings"
] | null | null |
The administration of the Tomsk Region firmly believes that it's time to become a megacity (that is, get population of one million). Instead of improving the demographic situation, they decided to achieve its goal by expanding the boundaries of the city.
The city of Tomsk can be represented as point on the plane with coordinates (0; 0). The city is surrounded with *n* other locations, the *i*-th one has coordinates (*x**i*, *y**i*) with the population of *k**i* people. You can widen the city boundaries to a circle of radius *r*. In such case all locations inside the circle and on its border are included into the city.
Your goal is to write a program that will determine the minimum radius *r*, to which is necessary to expand the boundaries of Tomsk, so that it becomes a megacity.
|
The first line of the input contains two integers *n* and *s* (1<=≤<=*n*<=≤<=103; 1<=≤<=*s*<=<<=106) — the number of locatons around Tomsk city and the population of the city. Then *n* lines follow. The *i*-th line contains three integers — the *x**i* and *y**i* coordinate values of the *i*-th location and the number *k**i* of people in it (1<=≤<=*k**i*<=<<=106). Each coordinate is an integer and doesn't exceed 104 in its absolute value.
It is guaranteed that no two locations are at the same point and no location is at point (0; 0).
|
In the output, print "-1" (without the quotes), if Tomsk won't be able to become a megacity. Otherwise, in the first line print a single real number — the minimum radius of the circle that the city needs to expand to in order to become a megacity.
The answer is considered correct if the absolute or relative error don't exceed 10<=-<=6.
|
[
"4 999998\n1 1 1\n2 2 1\n3 3 1\n2 -2 1\n",
"4 999998\n1 1 2\n2 2 1\n3 3 1\n2 -2 1\n",
"2 1\n1 1 999997\n2 2 1\n"
] |
[
"2.8284271\n",
"1.4142136\n",
"-1"
] |
none
| 1,000
|
[
{
"input": "4 999998\n1 1 1\n2 2 1\n3 3 1\n2 -2 1",
"output": "2.8284271"
},
{
"input": "4 999998\n1 1 2\n2 2 1\n3 3 1\n2 -2 1",
"output": "1.4142136"
},
{
"input": "2 1\n1 1 999997\n2 2 1",
"output": "-1"
},
{
"input": "4 999998\n3 3 10\n-3 3 10\n3 -3 10\n-3 -3 10",
"output": "4.2426407"
},
{
"input": "15 95473\n-9 6 199715\n0 -8 110607\n0 2 6621\n-3 -2 59894\n-10 -8 175440\n-2 0 25814\n10 -4 68131\n7 1 9971\n6 7 821\n6 5 20208\n6 2 68468\n0 7 37427\n1 -3 13337\n-10 7 113041\n-6 -2 44028",
"output": "12.8062485"
},
{
"input": "20 93350\n13 -28 486\n26 -26 48487\n5 -23 143368\n-23 -25 10371\n-2 -7 75193\n0 -8 3\n-6 -11 5015\n-19 -18 315278\n28 -15 45801\n21 8 4590\n-4 -28 12926\n-16 17 9405\n-28 -23 222092\n1 -10 1857\n14 -28 35170\n-4 -22 22036\n-2 -10 1260\n-1 12 375745\n-19 -24 38845\n10 -25 9256",
"output": "26.1725047"
},
{
"input": "30 505231\n-18 16 88130\n-10 16 15693\n16 -32 660\n-27 17 19042\n30 -37 6680\n36 19 299674\n-45 21 3300\n11 27 76\n-49 -34 28649\n-1 11 31401\n25 42 20858\n-40 6 455660\n-29 43 105001\n-38 10 6042\n19 -45 65551\n20 -9 148533\n-5 -24 393442\n-43 2 8577\n-39 18 97059\n12 28 39189\n35 23 28178\n40 -34 51687\n23 41 219028\n21 -44 927\n47 8 13206\n33 41 97342\n10 18 24895\n0 12 288\n0 -44 1065\n-25 43 44231",
"output": "24.5153013"
},
{
"input": "2 500000\n936 1000 500000\n961 976 500000",
"output": "1369.7065379"
},
{
"input": "10 764008\n959 32 23049\n-513 797 38979\n-603 -838 24916\n598 -430 25414\n-280 -624 18714\n330 891 21296\n-347 -68 27466\n650 -842 30125\n-314 889 35394\n275 969 5711",
"output": "1063.7029661"
},
{
"input": "30 295830\n1 -4 24773\n4 3 26175\n-2 -3 14789\n2 -1 46618\n-2 -2 52997\n-3 0 517\n-2 0 18173\n-4 -3 54465\n2 4 63579\n4 -4 41821\n2 2 11018\n0 4 42856\n0 -1 51885\n-3 4 57137\n3 0 4688\n0 2 60137\n-4 4 33484\n-1 3 66196\n3 -1 53634\n0 -2 41630\n-2 1 54606\n2 -2 2978\n2 -3 23733\n1 -2 35248\n-3 -3 15124\n-2 -4 26518\n4 0 28151\n4 -1 18348\n3 3 16914\n-4 2 26013",
"output": "4.4721360"
},
{
"input": "10 511500\n-5129 -3858 76954\n1296 1130 36126\n1219 6732 102003\n-8026 -178 4150\n-3261 1342 105429\n7965 -3013 62561\n5607 8963 53539\n-9044 -3999 16509\n1406 4103 115667\n-3716 2522 110626",
"output": "6841.4753526"
},
{
"input": "20 39342\n2 0 36476\n-3 1 136925\n1 3 31234\n0 -3 23785\n-1 3 77700\n-3 -1 50490\n-1 -3 13965\n-3 2 121093\n3 0 118933\n-3 0 125552\n-3 3 54779\n-2 0 96250\n1 2 142643\n2 2 23848\n0 2 29845\n0 -2 80462\n-1 1 91852\n-1 2 26526\n0 -1 136272\n1 1 108999",
"output": "3.0000000"
},
{
"input": "2 1\n1 0 1\n0 1 999999",
"output": "1.0000000"
},
{
"input": "2 999997\n1 1 1\n1 2 1",
"output": "-1"
}
] | 1,494,159,715
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 61
| 0
|
'''input
2 1
1 1 999997
2 2 1
'''
n, s = map(int, input().split())
l = {}
for _ in range(n):
a, b, k = map(int, input().split())
l[(a**2+b**2)**0.5] = k
for x in sorted(l):
s += l[x]
if s >= 1000000:
print(x)
break
else:
print(-1)
|
Title: Megacity
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The administration of the Tomsk Region firmly believes that it's time to become a megacity (that is, get population of one million). Instead of improving the demographic situation, they decided to achieve its goal by expanding the boundaries of the city.
The city of Tomsk can be represented as point on the plane with coordinates (0; 0). The city is surrounded with *n* other locations, the *i*-th one has coordinates (*x**i*, *y**i*) with the population of *k**i* people. You can widen the city boundaries to a circle of radius *r*. In such case all locations inside the circle and on its border are included into the city.
Your goal is to write a program that will determine the minimum radius *r*, to which is necessary to expand the boundaries of Tomsk, so that it becomes a megacity.
Input Specification:
The first line of the input contains two integers *n* and *s* (1<=≤<=*n*<=≤<=103; 1<=≤<=*s*<=<<=106) — the number of locatons around Tomsk city and the population of the city. Then *n* lines follow. The *i*-th line contains three integers — the *x**i* and *y**i* coordinate values of the *i*-th location and the number *k**i* of people in it (1<=≤<=*k**i*<=<<=106). Each coordinate is an integer and doesn't exceed 104 in its absolute value.
It is guaranteed that no two locations are at the same point and no location is at point (0; 0).
Output Specification:
In the output, print "-1" (without the quotes), if Tomsk won't be able to become a megacity. Otherwise, in the first line print a single real number — the minimum radius of the circle that the city needs to expand to in order to become a megacity.
The answer is considered correct if the absolute or relative error don't exceed 10<=-<=6.
Demo Input:
['4 999998\n1 1 1\n2 2 1\n3 3 1\n2 -2 1\n', '4 999998\n1 1 2\n2 2 1\n3 3 1\n2 -2 1\n', '2 1\n1 1 999997\n2 2 1\n']
Demo Output:
['2.8284271\n', '1.4142136\n', '-1']
Note:
none
|
```python
'''input
2 1
1 1 999997
2 2 1
'''
n, s = map(int, input().split())
l = {}
for _ in range(n):
a, b, k = map(int, input().split())
l[(a**2+b**2)**0.5] = k
for x in sorted(l):
s += l[x]
if s >= 1000000:
print(x)
break
else:
print(-1)
```
| 0
|
|
287
|
A
|
IQ Test
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] | null | null |
In the city of Ultima Thule job applicants are often offered an IQ test.
The test is as follows: the person gets a piece of squared paper with a 4<=×<=4 square painted on it. Some of the square's cells are painted black and others are painted white. Your task is to repaint at most one cell the other color so that the picture has a 2<=×<=2 square, completely consisting of cells of the same color. If the initial picture already has such a square, the person should just say so and the test will be completed.
Your task is to write a program that determines whether it is possible to pass the test. You cannot pass the test if either repainting any cell or no action doesn't result in a 2<=×<=2 square, consisting of cells of the same color.
|
Four lines contain four characters each: the *j*-th character of the *i*-th line equals "." if the cell in the *i*-th row and the *j*-th column of the square is painted white, and "#", if the cell is black.
|
Print "YES" (without the quotes), if the test can be passed and "NO" (without the quotes) otherwise.
|
[
"####\n.#..\n####\n....\n",
"####\n....\n####\n....\n"
] |
[
"YES\n",
"NO\n"
] |
In the first test sample it is enough to repaint the first cell in the second row. After such repainting the required 2 × 2 square is on the intersection of the 1-st and 2-nd row with the 1-st and 2-nd column.
| 500
|
[
{
"input": "###.\n...#\n###.\n...#",
"output": "NO"
},
{
"input": ".##.\n#..#\n.##.\n#..#",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n.#.#\n#.#.",
"output": "NO"
},
{
"input": "##..\n..##\n##..\n..##",
"output": "NO"
},
{
"input": "#.#.\n#.#.\n.#.#\n.#.#",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n#.#.\n#.#.",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n#.#.\n.#.#",
"output": "NO"
},
{
"input": "#.#.\n#.#.\n#.#.\n#.#.",
"output": "NO"
},
{
"input": ".#.#\n.#.#\n.#.#\n.#.#",
"output": "NO"
},
{
"input": "#..#\n.##.\n####\n####",
"output": "YES"
},
{
"input": "#.#.\n.###\n#.#.\n.###",
"output": "YES"
},
{
"input": "#..#\n.##.\n.##.\n#..#",
"output": "YES"
},
{
"input": ".##.\n.#..\n##.#\n#..#",
"output": "YES"
},
{
"input": ".##.\n##..\n#..#\n..##",
"output": "YES"
},
{
"input": "##..\n##..\n..##\n..##",
"output": "YES"
},
{
"input": ".#..\n###.\n.#.#\n..#.",
"output": "YES"
},
{
"input": "###.\n###.\n...#\n...#",
"output": "YES"
},
{
"input": "#.##\n##.#\n#.##\n##.#",
"output": "YES"
},
{
"input": ".#.#\n#.#.\n.#.#\n#.##",
"output": "YES"
},
{
"input": "##..\n..##\n##..\n...#",
"output": "YES"
},
{
"input": ".#..\n..##\n##..\n..##",
"output": "YES"
},
{
"input": "##..\n...#\n##..\n...#",
"output": "YES"
},
{
"input": ".#..\n..#.\n.#..\n..#.",
"output": "YES"
},
{
"input": "....\n....\n....\n.#.#",
"output": "YES"
},
{
"input": "....\n....\n....\n...#",
"output": "YES"
}
] | 1,664,231,601
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 23
| 62
| 0
|
#!/usr/bin/python3
import sys
sq = []
for i, line in enumerate(sys.stdin.readlines()):
sq.append([c == '#' for c in line.strip()])
def thing(sq):
for i in range(3):
for j in range(3):
c = 0
if sq[i][j] == sq[i][j+1]:
c += 1
if sq[i][j] == sq[i+1][j]:
c += 1
if sq[i][j] == sq[i+1][j+1]:
c += 1
if c >= 2:
return "YES"
return "NO"
#for c in cases:
print(thing(sq))
|
Title: IQ Test
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In the city of Ultima Thule job applicants are often offered an IQ test.
The test is as follows: the person gets a piece of squared paper with a 4<=×<=4 square painted on it. Some of the square's cells are painted black and others are painted white. Your task is to repaint at most one cell the other color so that the picture has a 2<=×<=2 square, completely consisting of cells of the same color. If the initial picture already has such a square, the person should just say so and the test will be completed.
Your task is to write a program that determines whether it is possible to pass the test. You cannot pass the test if either repainting any cell or no action doesn't result in a 2<=×<=2 square, consisting of cells of the same color.
Input Specification:
Four lines contain four characters each: the *j*-th character of the *i*-th line equals "." if the cell in the *i*-th row and the *j*-th column of the square is painted white, and "#", if the cell is black.
Output Specification:
Print "YES" (without the quotes), if the test can be passed and "NO" (without the quotes) otherwise.
Demo Input:
['####\n.#..\n####\n....\n', '####\n....\n####\n....\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first test sample it is enough to repaint the first cell in the second row. After such repainting the required 2 × 2 square is on the intersection of the 1-st and 2-nd row with the 1-st and 2-nd column.
|
```python
#!/usr/bin/python3
import sys
sq = []
for i, line in enumerate(sys.stdin.readlines()):
sq.append([c == '#' for c in line.strip()])
def thing(sq):
for i in range(3):
for j in range(3):
c = 0
if sq[i][j] == sq[i][j+1]:
c += 1
if sq[i][j] == sq[i+1][j]:
c += 1
if sq[i][j] == sq[i+1][j+1]:
c += 1
if c >= 2:
return "YES"
return "NO"
#for c in cases:
print(thing(sq))
```
| 0
|
|
262
|
A
|
Roma and Lucky Numbers
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers.
Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Roma's got *n* positive integers. He wonders, how many of those integers have not more than *k* lucky digits? Help him, write the program that solves the problem.
|
The first line contains two integers *n*, *k* (1<=≤<=*n*,<=*k*<=≤<=100). The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the numbers that Roma has.
The numbers in the lines are separated by single spaces.
|
In a single line print a single integer — the answer to the problem.
|
[
"3 4\n1 2 4\n",
"3 2\n447 44 77\n"
] |
[
"3\n",
"2\n"
] |
In the first sample all numbers contain at most four lucky digits, so the answer is 3.
In the second sample number 447 doesn't fit in, as it contains more than two lucky digits. All other numbers are fine, so the answer is 2.
| 500
|
[
{
"input": "3 4\n1 2 4",
"output": "3"
},
{
"input": "3 2\n447 44 77",
"output": "2"
},
{
"input": "2 2\n507978501 180480073",
"output": "2"
},
{
"input": "9 6\n655243746 167613748 1470546 57644035 176077477 56984809 44677 215706823 369042089",
"output": "9"
},
{
"input": "6 100\n170427799 37215529 675016434 168544291 683447134 950090227",
"output": "6"
},
{
"input": "4 2\n194041605 706221269 69909135 257655784",
"output": "3"
},
{
"input": "4 2\n9581849 67346651 530497 272158241",
"output": "4"
},
{
"input": "3 47\n378261451 163985731 230342101",
"output": "3"
},
{
"input": "2 3\n247776868 480572137",
"output": "1"
},
{
"input": "7 77\n366496749 549646417 278840199 119255907 33557677 379268590 150378796",
"output": "7"
},
{
"input": "40 31\n32230963 709031779 144328646 513494529 36547831 416998222 84161665 318773941 170724397 553666286 368402971 48581613 31452501 368026285 47903381 939151438 204145360 189920160 288159400 133145006 314295423 450219949 160203213 358403181 478734385 29331901 31051111 110710191 567314089 139695685 111511396 87708701 317333277 103301481 110400517 634446253 481551313 39202255 105948 738066085",
"output": "40"
},
{
"input": "1 8\n55521105",
"output": "1"
},
{
"input": "49 3\n34644511 150953622 136135827 144208961 359490601 86708232 719413689 188605873 64330753 488776302 104482891 63360106 437791390 46521319 70778345 339141601 136198441 292941209 299339510 582531183 555958105 437904637 74219097 439816011 236010407 122674666 438442529 186501223 63932449 407678041 596993853 92223251 849265278 480265849 30983497 330283357 186901672 20271344 794252593 123774176 27851201 52717531 479907210 196833889 149331196 82147847 255966471 278600081 899317843",
"output": "44"
},
{
"input": "26 2\n330381357 185218042 850474297 483015466 296129476 1205865 538807493 103205601 160403321 694220263 416255901 7245756 507755361 88187633 91426751 1917161 58276681 59540376 576539745 595950717 390256887 105690055 607818885 28976353 488947089 50643601",
"output": "22"
},
{
"input": "38 1\n194481717 126247087 815196361 106258801 381703249 283859137 15290101 40086151 213688513 577996947 513899717 371428417 107799271 11136651 5615081 323386401 381128815 34217126 17709913 520702093 201694245 570931849 169037023 417019726 282437316 7417126 271667553 11375851 185087449 410130883 383045677 5764771 905017051 328584026 215330671 299553233 15838255 234532105",
"output": "20"
},
{
"input": "44 9\n683216389 250581469 130029957 467020047 188395565 206237982 63257361 68314981 732878407 563579660 199133851 53045209 665723851 16273169 10806790 556633156 350593410 474645249 478790761 708234243 71841230 18090541 19836685 146373571 17947452 534010506 46933264 377035021 311636557 75193963 54321761 12759959 71120181 548816939 23608621 31876417 107672995 72575155 369667956 20574379 210596751 532163173 75726739 853719629",
"output": "44"
},
{
"input": "8 6\n204157376 10514197 65483881 347219841 263304577 296402721 11739011 229776191",
"output": "8"
},
{
"input": "38 29\n333702889 680931737 61137217 203030505 68728281 11414209 642645708 590904616 3042901 607198177 189041074 700764043 813035201 198341461 126403544 401436841 420826465 45046581 20249976 46978855 46397957 706610773 24701041 57954481 51603266 593109701 385569073 178982291 582152863 287317968 1474090 34825141 432421977 130257781 151516903 540852403 548392 117246529",
"output": "38"
},
{
"input": "19 3\n562569697 549131571 50676718 84501863 74567295 702372009 365895280 451459937 40378543 167666701 158635641 53639293 442332661 825055617 100109161 326616021 862332843 533271196 4791547",
"output": "18"
},
{
"input": "1 1\n44",
"output": "0"
},
{
"input": "1 1\n4",
"output": "1"
},
{
"input": "10 3\n444 447 774 777 7777 4447 4 7 7 4",
"output": "8"
}
] | 1,633,442,097
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 1
| 154
| 20,172,800
|
q='01235689'
n,m=map(int,input().split())
a=list(map(int,input().split()))
s=0
f=0
for i in a:
for j in range(0,i+1):
if str(j) not in q:
s+=1
if s<=m:
f+=1
s=0
print(f)
|
Title: Roma and Lucky Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Roma (a popular Russian name that means 'Roman') loves the Little Lvov Elephant's lucky numbers.
Let us remind you that lucky numbers are positive integers whose decimal representation only contains lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Roma's got *n* positive integers. He wonders, how many of those integers have not more than *k* lucky digits? Help him, write the program that solves the problem.
Input Specification:
The first line contains two integers *n*, *k* (1<=≤<=*n*,<=*k*<=≤<=100). The second line contains *n* integers *a**i* (1<=≤<=*a**i*<=≤<=109) — the numbers that Roma has.
The numbers in the lines are separated by single spaces.
Output Specification:
In a single line print a single integer — the answer to the problem.
Demo Input:
['3 4\n1 2 4\n', '3 2\n447 44 77\n']
Demo Output:
['3\n', '2\n']
Note:
In the first sample all numbers contain at most four lucky digits, so the answer is 3.
In the second sample number 447 doesn't fit in, as it contains more than two lucky digits. All other numbers are fine, so the answer is 2.
|
```python
q='01235689'
n,m=map(int,input().split())
a=list(map(int,input().split()))
s=0
f=0
for i in a:
for j in range(0,i+1):
if str(j) not in q:
s+=1
if s<=m:
f+=1
s=0
print(f)
```
| 0
|
|
919
|
B
|
Perfect Number
|
PROGRAMMING
| 1,100
|
[
"binary search",
"brute force",
"dp",
"implementation",
"number theory"
] | null | null |
We consider a positive integer perfect, if and only if the sum of its digits is exactly $10$. Given a positive integer $k$, your task is to find the $k$-th smallest perfect positive integer.
|
A single line with a positive integer $k$ ($1 \leq k \leq 10\,000$).
|
A single number, denoting the $k$-th smallest perfect integer.
|
[
"1\n",
"2\n"
] |
[
"19\n",
"28\n"
] |
The first perfect integer is $19$ and the second one is $28$.
| 750
|
[
{
"input": "1",
"output": "19"
},
{
"input": "2",
"output": "28"
},
{
"input": "13",
"output": "136"
},
{
"input": "101",
"output": "1432"
},
{
"input": "1023",
"output": "100270"
},
{
"input": "9999",
"output": "10800010"
},
{
"input": "10000",
"output": "10800100"
},
{
"input": "2333",
"output": "310060"
},
{
"input": "9139",
"output": "10134010"
},
{
"input": "9859",
"output": "10422001"
},
{
"input": "5987",
"output": "2221201"
},
{
"input": "3",
"output": "37"
},
{
"input": "4",
"output": "46"
},
{
"input": "5",
"output": "55"
},
{
"input": "7",
"output": "73"
},
{
"input": "9",
"output": "91"
},
{
"input": "10",
"output": "109"
},
{
"input": "15",
"output": "154"
},
{
"input": "51",
"output": "613"
},
{
"input": "99",
"output": "1414"
},
{
"input": "138",
"output": "2224"
},
{
"input": "233",
"output": "5050"
},
{
"input": "666",
"output": "27100"
},
{
"input": "1234",
"output": "110206"
},
{
"input": "3567",
"output": "1033003"
},
{
"input": "4445",
"output": "1221301"
},
{
"input": "5689",
"output": "2114002"
},
{
"input": "6666",
"output": "3102004"
},
{
"input": "7777",
"output": "5300200"
},
{
"input": "8888",
"output": "10110061"
},
{
"input": "9411",
"output": "10214200"
},
{
"input": "5539",
"output": "2101114"
},
{
"input": "6259",
"output": "2511100"
},
{
"input": "2387",
"output": "312220"
},
{
"input": "8515",
"output": "10030114"
}
] | 1,675,766,261
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 15
| 0
|
t=int(input())
for i in range(t):
n=input()
for i in range(1,10001):
if int(n)+i==10:
print(n+str(i))
break
|
Title: Perfect Number
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
We consider a positive integer perfect, if and only if the sum of its digits is exactly $10$. Given a positive integer $k$, your task is to find the $k$-th smallest perfect positive integer.
Input Specification:
A single line with a positive integer $k$ ($1 \leq k \leq 10\,000$).
Output Specification:
A single number, denoting the $k$-th smallest perfect integer.
Demo Input:
['1\n', '2\n']
Demo Output:
['19\n', '28\n']
Note:
The first perfect integer is $19$ and the second one is $28$.
|
```python
t=int(input())
for i in range(t):
n=input()
for i in range(1,10001):
if int(n)+i==10:
print(n+str(i))
break
```
| -1
|
|
888
|
B
|
Buggy Robot
|
PROGRAMMING
| 1,000
|
[
"greedy"
] | null | null |
Ivan has a robot which is situated on an infinite grid. Initially the robot is standing in the starting cell (0,<=0). The robot can process commands. There are four types of commands it can perform:
- U — move from the cell (*x*,<=*y*) to (*x*,<=*y*<=+<=1); - D — move from (*x*,<=*y*) to (*x*,<=*y*<=-<=1); - L — move from (*x*,<=*y*) to (*x*<=-<=1,<=*y*); - R — move from (*x*,<=*y*) to (*x*<=+<=1,<=*y*).
Ivan entered a sequence of *n* commands, and the robot processed it. After this sequence the robot ended up in the starting cell (0,<=0), but Ivan doubts that the sequence is such that after performing it correctly the robot ends up in the same cell. He thinks that some commands were ignored by robot. To acknowledge whether the robot is severely bugged, he needs to calculate the maximum possible number of commands that were performed correctly. Help Ivan to do the calculations!
|
The first line contains one number *n* — the length of sequence of commands entered by Ivan (1<=≤<=*n*<=≤<=100).
The second line contains the sequence itself — a string consisting of *n* characters. Each character can be U, D, L or R.
|
Print the maximum possible number of commands from the sequence the robot could perform to end up in the starting cell.
|
[
"4\nLDUR\n",
"5\nRRRUU\n",
"6\nLLRRRR\n"
] |
[
"4\n",
"0\n",
"4\n"
] |
none
| 0
|
[
{
"input": "4\nLDUR",
"output": "4"
},
{
"input": "5\nRRRUU",
"output": "0"
},
{
"input": "6\nLLRRRR",
"output": "4"
},
{
"input": "88\nLLUUULRDRRURDDLURRLRDRLLRULRUUDDLLLLRRDDURDURRLDURRLDRRRUULDDLRRRDDRRLUULLURDURUDDDDDLDR",
"output": "76"
},
{
"input": "89\nLDLLLDRDUDURRRRRUDULDDDLLUDLRLRLRLDLDUULRDUDLRRDLUDLURRDDRRDLDUDUUURUUUDRLUDUDLURDLDLLDDU",
"output": "80"
},
{
"input": "90\nRRRDUULLLRDUUDDRLDLRLUDURDRDUUURUURDDRRRURLDDDUUDRLLLULURDRDRURLDRRRRUULDULDDLLLRRLRDLLLLR",
"output": "84"
},
{
"input": "91\nRLDRLRRLLDLULULLURULLRRULUDUULLUDULDUULURUDRUDUURDULDUDDUUUDRRUUDLLRULRULURLDRDLDRURLLLRDDD",
"output": "76"
},
{
"input": "92\nRLRDDLULRLLUURRDDDLDDDLDDUURRRULLRDULDULLLUUULDUDLRLRRDRDRDDULDRLUDRDULDRURUDUULLRDRRLLDRLRR",
"output": "86"
},
{
"input": "93\nRLLURLULRURDDLUURLUDDRDLUURLRDLRRRDUULLRDRRLRLDURRDLLRDDLLLDDDLDRRURLLDRUDULDDRRULRRULRLDRDLR",
"output": "84"
},
{
"input": "94\nRDULDDDLULRDRUDRUUDUUDRRRULDRRUDURUULRDUUDLULLLUDURRDRDLUDRULRRRULUURUDDDDDUDLLRDLDRLLRUUURLUL",
"output": "86"
},
{
"input": "95\nRDLUUULLUURDDRLDLLRRRULRLRDULULRULRUDURLULDDDRLURLDRULDUDUUULLRDDURUULULLDDLDRDRLLLURLRDLLDDDDU",
"output": "86"
},
{
"input": "96\nRDDRLRLLDDULRLRURUDLRLDUDRURLLUUDLLURDLRRUURDRRUDRURLLDLLRDURDURLRLUDURULLLRDUURULUUULRRURRDLURL",
"output": "84"
},
{
"input": "97\nRURDDLRLLRULUDURDLRLLUUDURRLLUDLLLDUDRUULDRUUURURULRDLDRRLLUUUDLLLDDLLLLRLLDUDRRDLLUDLRURUDULRLUR",
"output": "82"
},
{
"input": "98\nRUDURLULLDDLLRDLLRDDLLLLRLDDDDRRRDDRRURLDRLLRUUUDLUUUDDDUDRUURLURUUDUUDRULRRULLRRLRULLULDLUURLULRD",
"output": "92"
},
{
"input": "99\nRRULLDULRRDRULLDUDRUDDDRLLUUDRDDUDURLDDRUUDRRUUURRRURDDLDUURDLRLURRDDLUDDLUDURDRUDDURLURURLRUDRURLD",
"output": "86"
},
{
"input": "100\nUDRLRRLLRRLRRRDDLLDDDLULLDDLURUURUULUDDDRDDLLRDLLUURLRDRLRRLRLLLULDUDDUURRLRDULDRDURRRRRRULDRRDLDRRL",
"output": "88"
},
{
"input": "1\nU",
"output": "0"
},
{
"input": "5\nUUULD",
"output": "2"
},
{
"input": "1\nD",
"output": "0"
},
{
"input": "5\nURLUL",
"output": "2"
},
{
"input": "5\nDDDRU",
"output": "2"
},
{
"input": "2\nLR",
"output": "2"
},
{
"input": "8\nDDRDLDUR",
"output": "4"
},
{
"input": "6\nLLLLUD",
"output": "2"
},
{
"input": "13\nRRRLLLLLLLLLL",
"output": "6"
}
] | 1,624,716,266
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 25
| 62
| 0
|
n=int(input())
s=input()
a,b,c,d=0,0,0,0
for i in range(n):
if s[i]=='L':
a+=1
elif s[i]=='R':
b+=1
elif s[i]=='U':
c+=1
else:
d+=1
print(2*(min(a,b)+min(c,d)))
|
Title: Buggy Robot
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Ivan has a robot which is situated on an infinite grid. Initially the robot is standing in the starting cell (0,<=0). The robot can process commands. There are four types of commands it can perform:
- U — move from the cell (*x*,<=*y*) to (*x*,<=*y*<=+<=1); - D — move from (*x*,<=*y*) to (*x*,<=*y*<=-<=1); - L — move from (*x*,<=*y*) to (*x*<=-<=1,<=*y*); - R — move from (*x*,<=*y*) to (*x*<=+<=1,<=*y*).
Ivan entered a sequence of *n* commands, and the robot processed it. After this sequence the robot ended up in the starting cell (0,<=0), but Ivan doubts that the sequence is such that after performing it correctly the robot ends up in the same cell. He thinks that some commands were ignored by robot. To acknowledge whether the robot is severely bugged, he needs to calculate the maximum possible number of commands that were performed correctly. Help Ivan to do the calculations!
Input Specification:
The first line contains one number *n* — the length of sequence of commands entered by Ivan (1<=≤<=*n*<=≤<=100).
The second line contains the sequence itself — a string consisting of *n* characters. Each character can be U, D, L or R.
Output Specification:
Print the maximum possible number of commands from the sequence the robot could perform to end up in the starting cell.
Demo Input:
['4\nLDUR\n', '5\nRRRUU\n', '6\nLLRRRR\n']
Demo Output:
['4\n', '0\n', '4\n']
Note:
none
|
```python
n=int(input())
s=input()
a,b,c,d=0,0,0,0
for i in range(n):
if s[i]=='L':
a+=1
elif s[i]=='R':
b+=1
elif s[i]=='U':
c+=1
else:
d+=1
print(2*(min(a,b)+min(c,d)))
```
| 3
|
|
44
|
E
|
Anfisa the Monkey
|
PROGRAMMING
| 1,400
|
[
"dp"
] |
E. Anfisa the Monkey
|
2
|
256
|
Anfisa the monkey learns to type. She is yet unfamiliar with the "space" key and can only type in lower-case Latin letters. Having typed for a fairly long line, Anfisa understood that it would be great to divide what she has written into *k* lines not shorter than *a* and not longer than *b*, for the text to resemble human speech more. Help Anfisa.
|
The first line contains three integers *k*, *a* and *b* (1<=≤<=*k*<=≤<=200, 1<=≤<=*a*<=≤<=*b*<=≤<=200). The second line contains a sequence of lowercase Latin letters — the text typed by Anfisa. It is guaranteed that the given line is not empty and its length does not exceed 200 symbols.
|
Print *k* lines, each of which contains no less than *a* and no more than *b* symbols — Anfisa's text divided into lines. It is not allowed to perform any changes in the text, such as: deleting or adding symbols, changing their order, etc. If the solution is not unique, print any of them. If there is no solution, print "No solution" (without quotes).
|
[
"3 2 5\nabrakadabra\n",
"4 1 2\nabrakadabra\n"
] |
[
"ab\nrakad\nabra\n",
"No solution\n"
] |
none
| 0
|
[
{
"input": "3 2 5\nabrakadabra",
"output": "abra\nkada\nbra"
},
{
"input": "4 1 2\nabrakadabra",
"output": "No solution"
},
{
"input": "3 1 2\nvgnfpo",
"output": "vg\nnf\npo"
},
{
"input": "5 3 4\nvrrdnhazvexzjfv",
"output": "vrr\ndnh\nazv\nexz\njfv"
},
{
"input": "10 12 15\nctxgddcfdtllmpuxsjkubuqpldznulsilueakbwwlzgeyudyrjachmitfdcgyzszoejphrubpxzpdtgexaqpxgnoxwfjoikljudnoucirussumyhetfwgaoxfbugfiyjmp",
"output": "ctxgddcfdtllm\npuxsjkubuqpld\nznulsilueakbw\nwlzgeyudyrjac\nhmitfdcgyzszo\nejphrubpxzpdt\ngexaqpxgnoxwf\njoikljudnouci\nrussumyhetfwg\naoxfbugfiyjmp"
},
{
"input": "10 20 30\nbvdqvlxiyogiyimdlwdyxsummjgqxaxsucfeuegleetybsylpnepkqzbutibtlgqrbjbwqnvkysxftmsjqkczoploxoqfuwyrufzwwsxpcqfuckjainpphpbvvtllgkljnnoibsvwnxvaksxjrffakpoxwkhjjjemqatbfkmmlmjhhroetlqvfaumctbicqkuxaabpsh",
"output": "bvdqvlxiyogiyimdlwdy\nxsummjgqxaxsucfeuegl\neetybsylpnepkqzbutib\ntlgqrbjbwqnvkysxftms\njqkczoploxoqfuwyrufz\nwwsxpcqfuckjainpphpb\nvvtllgkljnnoibsvwnxv\naksxjrffakpoxwkhjjje\nmqatbfkmmlmjhhroetlq\nvfaumctbicqkuxaabpsh"
},
{
"input": "10 1 200\nolahgjusovchbowjxtwzvjakrktyjqcgkqmcxknjchzxcvbnkbakwnxdouebomyhjsrfsicmzsgdweabbuipbzrhuqfpynybaohzquqbbsqpoaskccszzsmnfleevtasmjuwqgcqtvysohvyutqipnvuhjumwwyytkeuebbncxsnpavwdkoxyycqrhcidf",
"output": "olahgjusovchbowjxtw\nzvjakrktyjqcgkqmcxk\nnjchzxcvbnkbakwnxdo\nuebomyhjsrfsicmzsgd\nweabbuipbzrhuqfpyny\nbaohzquqbbsqpoaskcc\nszzsmnfleevtasmjuwq\ngcqtvysohvyutqipnvu\nhjumwwyytkeuebbncxs\nnpavwdkoxyycqrhcidf"
},
{
"input": "30 3 6\nebdgacrmhfldirwrcfadurngearrfyjiqkmfqmgzpnzcpprkjyeuuppzvmibzzwyouhxclcgqtjhjmucypqnhdaqke",
"output": "ebd\ngac\nrmh\nfld\nirw\nrcf\nadu\nrng\near\nrfy\njiq\nkmf\nqmg\nzpn\nzcp\nprk\njye\nuup\npzv\nmib\nzzw\nyou\nhxc\nlcg\nqtj\nhjm\nucy\npqn\nhda\nqke"
},
{
"input": "200 1 200\nlycjpjrpkgxrkfvutlcwglghxadttpihmlpphwfttegfpimjxintjdxgqfhzrmxfcfojnxruhyfynlzgpxjeobjyxarsfxaqeogxfzvdlwsimupkwujudtfenryulzvsiazneyibqtweeuxpzrbumqqswjasliyjnnzfzuvthhzcsgfljikkajqkpjftztrzpjneaxqg",
"output": "l\ny\nc\nj\np\nj\nr\np\nk\ng\nx\nr\nk\nf\nv\nu\nt\nl\nc\nw\ng\nl\ng\nh\nx\na\nd\nt\nt\np\ni\nh\nm\nl\np\np\nh\nw\nf\nt\nt\ne\ng\nf\np\ni\nm\nj\nx\ni\nn\nt\nj\nd\nx\ng\nq\nf\nh\nz\nr\nm\nx\nf\nc\nf\no\nj\nn\nx\nr\nu\nh\ny\nf\ny\nn\nl\nz\ng\np\nx\nj\ne\no\nb\nj\ny\nx\na\nr\ns\nf\nx\na\nq\ne\no\ng\nx\nf\nz\nv\nd\nl\nw\ns\ni\nm\nu\np\nk\nw\nu\nj\nu\nd\nt\nf\ne\nn\nr\ny\nu\nl\nz\nv\ns\ni\na\nz\nn\ne\ny\ni\nb\nq\nt\nw\ne\ne\nu\nx\np\nz\nr\nb\nu\nm\nq\nq\ns\nw\nj\na\ns\nl\ni\ny\nj\nn\nn\nz\nf\nz\nu\nv\nt\nh\nh\nz..."
},
{
"input": "15 3 4\naronayjutjdhjcelgexgalnyiruevjelvcvzaihgbwwrc",
"output": "aro\nnay\njut\njdh\njce\nlge\nxga\nlny\niru\nevj\nelv\ncvz\naih\ngbw\nwrc"
},
{
"input": "7 3 4\nweoghhroclwslkfcsszplh",
"output": "weog\nhhr\nocl\nwsl\nkfc\nssz\nplh"
},
{
"input": "12 2 5\nozgscnrddhejkhllokmafxcuorxryhvqnkikauclhfbddfoxl",
"output": "ozgsc\nnrdd\nhejk\nhllo\nkmaf\nxcuo\nrxry\nhvqn\nkika\nuclh\nfbdd\nfoxl"
},
{
"input": "3 1 2\nfpos",
"output": "fp\no\ns"
},
{
"input": "5 3 4\nvrrdnhazvexzjfvs",
"output": "vrrd\nnha\nzve\nxzj\nfvs"
},
{
"input": "10 12 15\nllmpuxsjkubuqpldznulsilueakbwwlzgeyudyrjachmitfdcgyzszoejphrubpxzpdtgexaqpxgnoxwfjoikljudnoucirussumyhetfwgaoxfbugfiyjmpm",
"output": "llmpuxsjkubuq\npldznulsilue\nakbwwlzgeyud\nyrjachmitfdc\ngyzszoejphru\nbpxzpdtgexaq\npxgnoxwfjoik\nljudnoucirus\nsumyhetfwgao\nxfbugfiyjmpm"
},
{
"input": "10 20 30\nvdqvlxiyogiyimdlwdyxsummjgqxaxsucfeuegleetybsylpnepkqzbutibtlgqrbjbwqnvkysxftmsjqkczoploxoqfuwyrufzwwsxpcqfuckjainpphpbvvtllgkljnnoibsvwnxvaksxjrffakpoxwkhjjjemqatbfkmmlmjhhroetlqvfaumctbicqkuxaabpshu",
"output": "vdqvlxiyogiyimdlwdyx\nsummjgqxaxsucfeuegle\netybsylpnepkqzbutibt\nlgqrbjbwqnvkysxftmsj\nqkczoploxoqfuwyrufzw\nwsxpcqfuckjainpphpbv\nvtllgkljnnoibsvwnxva\nksxjrffakpoxwkhjjjem\nqatbfkmmlmjhhroetlqv\nfaumctbicqkuxaabpshu"
},
{
"input": "10 1 200\nolahgjusovchbowjxtwzvjakrktyjqcgkqmcxknjchzxcvbnkbakwnxdouebomyhjsrfsicmzsgdweabbuipbzrhuqfpynybaohzquqbbsqpoaskccszzsmnfleevtasmjuwqgcqtvysohvyutqipnvuhjumwwyytkeuebbncxsnpavwdkoxyycqrhcidfd",
"output": "olahgjusovchbowjxtwz\nvjakrktyjqcgkqmcxkn\njchzxcvbnkbakwnxdou\nebomyhjsrfsicmzsgdw\neabbuipbzrhuqfpynyb\naohzquqbbsqpoaskccs\nzzsmnfleevtasmjuwqg\ncqtvysohvyutqipnvuh\njumwwyytkeuebbncxsn\npavwdkoxyycqrhcidfd"
},
{
"input": "30 3 6\nhstvoyuksbbsbgatemzmvbhbjdmnzpluefgzlcqgfsmkdydadsonaryzskleebdgacrmhfldirwrcfadurngearrfyjiqkmfqmgzpnzcpprkjyeuuppzvmibzzwyouhxclcgqtjhjmucypqnhdaqkea",
"output": "hstvoy\nuksbb\nsbgat\nemzmv\nbhbjd\nmnzpl\nuefgz\nlcqgf\nsmkdy\ndadso\nnaryz\nsklee\nbdgac\nrmhfl\ndirwr\ncfadu\nrngea\nrrfyj\niqkmf\nqmgzp\nnzcpp\nrkjye\nuuppz\nvmibz\nzwyou\nhxclc\ngqtjh\njmucy\npqnhd\naqkea"
},
{
"input": "200 1 200\nycjpjrpkgxrkfvutlcwglghxadttpihmlpphwfttegfpimjxintjdxgqfhzrmxfcfojnxruhyfynlzgpxjeobjyxarsfxaqeogxfzvdlwsimupkwujudtfenryulzvsiazneyibqtweeuxpzrbumqqswjasliyjnnzfzuvthhzcsgfljikkajqkpjftztrzpjneaxqgn",
"output": "y\nc\nj\np\nj\nr\np\nk\ng\nx\nr\nk\nf\nv\nu\nt\nl\nc\nw\ng\nl\ng\nh\nx\na\nd\nt\nt\np\ni\nh\nm\nl\np\np\nh\nw\nf\nt\nt\ne\ng\nf\np\ni\nm\nj\nx\ni\nn\nt\nj\nd\nx\ng\nq\nf\nh\nz\nr\nm\nx\nf\nc\nf\no\nj\nn\nx\nr\nu\nh\ny\nf\ny\nn\nl\nz\ng\np\nx\nj\ne\no\nb\nj\ny\nx\na\nr\ns\nf\nx\na\nq\ne\no\ng\nx\nf\nz\nv\nd\nl\nw\ns\ni\nm\nu\np\nk\nw\nu\nj\nu\nd\nt\nf\ne\nn\nr\ny\nu\nl\nz\nv\ns\ni\na\nz\nn\ne\ny\ni\nb\nq\nt\nw\ne\ne\nu\nx\np\nz\nr\nb\nu\nm\nq\nq\ns\nw\nj\na\ns\nl\ni\ny\nj\nn\nn\nz\nf\nz\nu\nv\nt\nh\nh\nz\nc..."
},
{
"input": "15 3 4\naronayjutjdhjcelgexgalnyiruevjelvcvzaihgbwwrcq",
"output": "aron\nayj\nutj\ndhj\ncel\ngex\ngal\nnyi\nrue\nvje\nlvc\nvza\nihg\nbww\nrcq"
},
{
"input": "200 1 10\njtlykeyfekfrzbpzrhvrxagzywzlsktyzoriwiyatoetikfnhyhlrhuogyhjrxdmlqvpfsmqiqkivtodligzerymdtnqahuprhbfefbjwuavmpkurtfzmwediq",
"output": "No solution"
},
{
"input": "15 2 3\ndplkzxpsxodehcj",
"output": "No solution"
},
{
"input": "100 100 200\nximcxraplfjygtrpxrgjhqagrojixizlogaqfvwvqjaiqvcimelxtmtcsqluvcrdzhihgmwhywfgxmzmikdqdytfrlpzqmvhaexrtflwacsuxhkuzbukgvbdcmwpcvxwznupsmmryxwexlevjlonpipuxjgagxtcgqjdczrnmktgcaagmiumnbcxuafmysisahaqnngc",
"output": "No solution"
},
{
"input": "7 2 3\nggzkinj",
"output": "No solution"
},
{
"input": "17 2 4\npgyujupquzenuldnt",
"output": "No solution"
},
{
"input": "100 1 1\nratfdjnvjmaqgcttjtenixeocyxrtuwhpmejhpxjcqhzjsujqolgcccmvnpoomkrforsdtvhgrcpakibozhgqotcrctzozhggrufk",
"output": "No solution"
},
{
"input": "50 2 3\nizlszyucwjarrrgxzbfzyoxapozmunxuygfjynslcjnxitimjjklucjowtkccbnfsuwtyroxirhxzosbyhvnrroaxryhcvvcjvwfcpvnpdaqwzaiuzycyrtvkgkjfbdqnzrmritaonptpvncdifushrquywzykybhjdplbmsrgibpknxkxkqqywmkeljpxrrmufpkubv",
"output": "No solution"
},
{
"input": "15 2 5\nkddainaviqrjsesrhhdnbuisennbgcxseeyxqtmautpoobtpfigcpgagcixmyzsntmgzwmiczsfp",
"output": "No solution"
},
{
"input": "3 1 50\nhcdonseimahtfmtejvxebwctfkjsrcqjrunpcofrapijvwmmbbbrohkskjomeknlwkdxscybxkintcaynwyjfaghwcofpsbwruzqqqkhyndbxbdpgqokjqitznnnrfuaciriqmyuvktpdxewkrycjefkmjwglhoggpgvztvqndbhiajryxqlrqdb",
"output": "No solution"
},
{
"input": "5 1 30\nxmuatgstrlkerxzezenrauupxiskpfugncncatcgtffhuwzojuapgrevnwzfkpyzbzljbzwvfoeuqhinyravsfqrjmgidjoszvkkhxrdstmydvbertvzltpipmcuakzqflldztzdjqlicvadgpicqio",
"output": "No solution"
},
{
"input": "5 2 3\nabacababb",
"output": "No solution"
},
{
"input": "5 6 6\nabacabadabacabaabacabadabacab",
"output": "No solution"
}
] | 1,652,239,891
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 32
| 92
| 0
|
k,a,b = map(int,input().split())
qo = input()
def find(word,a,b):
rs = len(word)
cs = rs/k
if cs < a or cs > b:
print("No solution")
exit(0)
for i in range(k):
length = len(word)
index = round(length/(k-i))
print(word[:index])
word = word[index:]
find(qo,a,b)
|
Title: Anfisa the Monkey
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Anfisa the monkey learns to type. She is yet unfamiliar with the "space" key and can only type in lower-case Latin letters. Having typed for a fairly long line, Anfisa understood that it would be great to divide what she has written into *k* lines not shorter than *a* and not longer than *b*, for the text to resemble human speech more. Help Anfisa.
Input Specification:
The first line contains three integers *k*, *a* and *b* (1<=≤<=*k*<=≤<=200, 1<=≤<=*a*<=≤<=*b*<=≤<=200). The second line contains a sequence of lowercase Latin letters — the text typed by Anfisa. It is guaranteed that the given line is not empty and its length does not exceed 200 symbols.
Output Specification:
Print *k* lines, each of which contains no less than *a* and no more than *b* symbols — Anfisa's text divided into lines. It is not allowed to perform any changes in the text, such as: deleting or adding symbols, changing their order, etc. If the solution is not unique, print any of them. If there is no solution, print "No solution" (without quotes).
Demo Input:
['3 2 5\nabrakadabra\n', '4 1 2\nabrakadabra\n']
Demo Output:
['ab\nrakad\nabra\n', 'No solution\n']
Note:
none
|
```python
k,a,b = map(int,input().split())
qo = input()
def find(word,a,b):
rs = len(word)
cs = rs/k
if cs < a or cs > b:
print("No solution")
exit(0)
for i in range(k):
length = len(word)
index = round(length/(k-i))
print(word[:index])
word = word[index:]
find(qo,a,b)
```
| 3.977
|
6
|
A
|
Triangle
|
PROGRAMMING
| 900
|
[
"brute force",
"geometry"
] |
A. Triangle
|
2
|
64
|
Johnny has a younger sister Anne, who is very clever and smart. As she came home from the kindergarten, she told his brother about the task that her kindergartener asked her to solve. The task was just to construct a triangle out of four sticks of different colours. Naturally, one of the sticks is extra. It is not allowed to break the sticks or use their partial length. Anne has perfectly solved this task, now she is asking Johnny to do the same.
The boy answered that he would cope with it without any difficulty. However, after a while he found out that different tricky things can occur. It can happen that it is impossible to construct a triangle of a positive area, but it is possible to construct a degenerate triangle. It can be so, that it is impossible to construct a degenerate triangle even. As Johnny is very lazy, he does not want to consider such a big amount of cases, he asks you to help him.
|
The first line of the input contains four space-separated positive integer numbers not exceeding 100 — lengthes of the sticks.
|
Output TRIANGLE if it is possible to construct a non-degenerate triangle. Output SEGMENT if the first case cannot take place and it is possible to construct a degenerate triangle. Output IMPOSSIBLE if it is impossible to construct any triangle. Remember that you are to use three sticks. It is not allowed to break the sticks or use their partial length.
|
[
"4 2 1 3\n",
"7 2 2 4\n",
"3 5 9 1\n"
] |
[
"TRIANGLE\n",
"SEGMENT\n",
"IMPOSSIBLE\n"
] |
none
| 0
|
[
{
"input": "4 2 1 3",
"output": "TRIANGLE"
},
{
"input": "7 2 2 4",
"output": "SEGMENT"
},
{
"input": "3 5 9 1",
"output": "IMPOSSIBLE"
},
{
"input": "3 1 5 1",
"output": "IMPOSSIBLE"
},
{
"input": "10 10 10 10",
"output": "TRIANGLE"
},
{
"input": "11 5 6 11",
"output": "TRIANGLE"
},
{
"input": "1 1 1 1",
"output": "TRIANGLE"
},
{
"input": "10 20 30 40",
"output": "TRIANGLE"
},
{
"input": "45 25 5 15",
"output": "IMPOSSIBLE"
},
{
"input": "20 5 8 13",
"output": "TRIANGLE"
},
{
"input": "10 30 7 20",
"output": "SEGMENT"
},
{
"input": "3 2 3 2",
"output": "TRIANGLE"
},
{
"input": "70 10 100 30",
"output": "SEGMENT"
},
{
"input": "4 8 16 2",
"output": "IMPOSSIBLE"
},
{
"input": "3 3 3 10",
"output": "TRIANGLE"
},
{
"input": "1 5 5 5",
"output": "TRIANGLE"
},
{
"input": "13 25 12 1",
"output": "SEGMENT"
},
{
"input": "10 100 7 3",
"output": "SEGMENT"
},
{
"input": "50 1 50 100",
"output": "TRIANGLE"
},
{
"input": "50 1 100 49",
"output": "SEGMENT"
},
{
"input": "49 51 100 1",
"output": "SEGMENT"
},
{
"input": "5 11 2 25",
"output": "IMPOSSIBLE"
},
{
"input": "91 50 9 40",
"output": "IMPOSSIBLE"
},
{
"input": "27 53 7 97",
"output": "IMPOSSIBLE"
},
{
"input": "51 90 24 8",
"output": "IMPOSSIBLE"
},
{
"input": "3 5 1 1",
"output": "IMPOSSIBLE"
},
{
"input": "13 49 69 15",
"output": "IMPOSSIBLE"
},
{
"input": "16 99 9 35",
"output": "IMPOSSIBLE"
},
{
"input": "27 6 18 53",
"output": "IMPOSSIBLE"
},
{
"input": "57 88 17 8",
"output": "IMPOSSIBLE"
},
{
"input": "95 20 21 43",
"output": "IMPOSSIBLE"
},
{
"input": "6 19 32 61",
"output": "IMPOSSIBLE"
},
{
"input": "100 21 30 65",
"output": "IMPOSSIBLE"
},
{
"input": "85 16 61 9",
"output": "IMPOSSIBLE"
},
{
"input": "5 6 19 82",
"output": "IMPOSSIBLE"
},
{
"input": "1 5 1 3",
"output": "IMPOSSIBLE"
},
{
"input": "65 10 36 17",
"output": "IMPOSSIBLE"
},
{
"input": "81 64 9 7",
"output": "IMPOSSIBLE"
},
{
"input": "11 30 79 43",
"output": "IMPOSSIBLE"
},
{
"input": "1 1 5 3",
"output": "IMPOSSIBLE"
},
{
"input": "21 94 61 31",
"output": "IMPOSSIBLE"
},
{
"input": "49 24 9 74",
"output": "IMPOSSIBLE"
},
{
"input": "11 19 5 77",
"output": "IMPOSSIBLE"
},
{
"input": "52 10 19 71",
"output": "SEGMENT"
},
{
"input": "2 3 7 10",
"output": "SEGMENT"
},
{
"input": "1 2 6 3",
"output": "SEGMENT"
},
{
"input": "2 6 1 8",
"output": "SEGMENT"
},
{
"input": "1 2 4 1",
"output": "SEGMENT"
},
{
"input": "4 10 6 2",
"output": "SEGMENT"
},
{
"input": "2 10 7 3",
"output": "SEGMENT"
},
{
"input": "5 2 3 9",
"output": "SEGMENT"
},
{
"input": "6 1 4 10",
"output": "SEGMENT"
},
{
"input": "10 6 4 1",
"output": "SEGMENT"
},
{
"input": "3 2 9 1",
"output": "SEGMENT"
},
{
"input": "22 80 29 7",
"output": "SEGMENT"
},
{
"input": "2 6 3 9",
"output": "SEGMENT"
},
{
"input": "3 1 2 1",
"output": "SEGMENT"
},
{
"input": "3 4 7 1",
"output": "SEGMENT"
},
{
"input": "8 4 3 1",
"output": "SEGMENT"
},
{
"input": "2 8 3 5",
"output": "SEGMENT"
},
{
"input": "4 1 2 1",
"output": "SEGMENT"
},
{
"input": "8 1 3 2",
"output": "SEGMENT"
},
{
"input": "6 2 1 8",
"output": "SEGMENT"
},
{
"input": "3 3 3 6",
"output": "TRIANGLE"
},
{
"input": "3 6 3 3",
"output": "TRIANGLE"
},
{
"input": "4 10 4 4",
"output": "TRIANGLE"
},
{
"input": "1 1 2 1",
"output": "TRIANGLE"
},
{
"input": "3 3 3 6",
"output": "TRIANGLE"
},
{
"input": "5 4 5 5",
"output": "TRIANGLE"
},
{
"input": "8 7 8 8",
"output": "TRIANGLE"
},
{
"input": "3 3 3 1",
"output": "TRIANGLE"
},
{
"input": "1 1 6 6",
"output": "TRIANGLE"
},
{
"input": "1 9 1 9",
"output": "TRIANGLE"
},
{
"input": "7 2 2 7",
"output": "TRIANGLE"
},
{
"input": "7 2 3 2",
"output": "TRIANGLE"
},
{
"input": "4 4 10 10",
"output": "TRIANGLE"
},
{
"input": "7 7 10 7",
"output": "TRIANGLE"
},
{
"input": "4 4 4 5",
"output": "TRIANGLE"
},
{
"input": "1 10 9 2",
"output": "TRIANGLE"
},
{
"input": "1 8 2 7",
"output": "TRIANGLE"
},
{
"input": "4 3 2 8",
"output": "TRIANGLE"
},
{
"input": "5 9 5 3",
"output": "TRIANGLE"
},
{
"input": "4 10 3 5",
"output": "TRIANGLE"
}
] | 1,588,192,028
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 83
| 218
| 0
|
sides=[int(i) for i in input().split()] ## insert 3 varibles
sides.sort() ## sorting method High - low
if sides[0]+sides[1]>sides[2]:
print("TRIANGLE")
elif sides[1]+sides[2]>sides[3]: ## basically checking for triangle properties
print("TRIANGLE")
elif sides[0]+sides[1]==sides[2] or sides[1]+sides[2]==sides[3]:
print("SEGMENT")
else:
print("IMPOSSIBLE")
|
Title: Triangle
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
Johnny has a younger sister Anne, who is very clever and smart. As she came home from the kindergarten, she told his brother about the task that her kindergartener asked her to solve. The task was just to construct a triangle out of four sticks of different colours. Naturally, one of the sticks is extra. It is not allowed to break the sticks or use their partial length. Anne has perfectly solved this task, now she is asking Johnny to do the same.
The boy answered that he would cope with it without any difficulty. However, after a while he found out that different tricky things can occur. It can happen that it is impossible to construct a triangle of a positive area, but it is possible to construct a degenerate triangle. It can be so, that it is impossible to construct a degenerate triangle even. As Johnny is very lazy, he does not want to consider such a big amount of cases, he asks you to help him.
Input Specification:
The first line of the input contains four space-separated positive integer numbers not exceeding 100 — lengthes of the sticks.
Output Specification:
Output TRIANGLE if it is possible to construct a non-degenerate triangle. Output SEGMENT if the first case cannot take place and it is possible to construct a degenerate triangle. Output IMPOSSIBLE if it is impossible to construct any triangle. Remember that you are to use three sticks. It is not allowed to break the sticks or use their partial length.
Demo Input:
['4 2 1 3\n', '7 2 2 4\n', '3 5 9 1\n']
Demo Output:
['TRIANGLE\n', 'SEGMENT\n', 'IMPOSSIBLE\n']
Note:
none
|
```python
sides=[int(i) for i in input().split()] ## insert 3 varibles
sides.sort() ## sorting method High - low
if sides[0]+sides[1]>sides[2]:
print("TRIANGLE")
elif sides[1]+sides[2]>sides[3]: ## basically checking for triangle properties
print("TRIANGLE")
elif sides[0]+sides[1]==sides[2] or sides[1]+sides[2]==sides[3]:
print("SEGMENT")
else:
print("IMPOSSIBLE")
```
| 3.9455
|
122
|
A
|
Lucky Division
|
PROGRAMMING
| 1,000
|
[
"brute force",
"number theory"
] | null | null |
Petya loves lucky numbers. Everybody knows that lucky numbers are positive integers whose decimal representation contains only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Petya calls a number almost lucky if it could be evenly divided by some lucky number. Help him find out if the given number *n* is almost lucky.
|
The single line contains an integer *n* (1<=≤<=*n*<=≤<=1000) — the number that needs to be checked.
|
In the only line print "YES" (without the quotes), if number *n* is almost lucky. Otherwise, print "NO" (without the quotes).
|
[
"47\n",
"16\n",
"78\n"
] |
[
"YES\n",
"YES\n",
"NO\n"
] |
Note that all lucky numbers are almost lucky as any number is evenly divisible by itself.
In the first sample 47 is a lucky number. In the second sample 16 is divisible by 4.
| 500
|
[
{
"input": "47",
"output": "YES"
},
{
"input": "16",
"output": "YES"
},
{
"input": "78",
"output": "NO"
},
{
"input": "48",
"output": "YES"
},
{
"input": "100",
"output": "YES"
},
{
"input": "107",
"output": "NO"
},
{
"input": "77",
"output": "YES"
},
{
"input": "477",
"output": "YES"
},
{
"input": "480",
"output": "YES"
},
{
"input": "1",
"output": "NO"
},
{
"input": "3",
"output": "NO"
},
{
"input": "4",
"output": "YES"
},
{
"input": "49",
"output": "YES"
},
{
"input": "56",
"output": "YES"
},
{
"input": "124",
"output": "YES"
},
{
"input": "1000",
"output": "YES"
},
{
"input": "999",
"output": "NO"
},
{
"input": "298",
"output": "NO"
},
{
"input": "274",
"output": "NO"
},
{
"input": "998",
"output": "NO"
},
{
"input": "42",
"output": "YES"
},
{
"input": "788",
"output": "YES"
},
{
"input": "70",
"output": "YES"
},
{
"input": "444",
"output": "YES"
},
{
"input": "777",
"output": "YES"
},
{
"input": "799",
"output": "YES"
},
{
"input": "25",
"output": "NO"
},
{
"input": "882",
"output": "YES"
},
{
"input": "88",
"output": "YES"
},
{
"input": "11",
"output": "NO"
},
{
"input": "2",
"output": "NO"
},
{
"input": "7",
"output": "YES"
},
{
"input": "8",
"output": "YES"
},
{
"input": "94",
"output": "YES"
},
{
"input": "477",
"output": "YES"
},
{
"input": "141",
"output": "YES"
}
] | 1,697,741,269
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 25
| 124
| 0
|
n = int(input())
if (('4' in str(n) and '7' in str(n) and (len(str(n)) == str(n).count('4') + str(n).count('7')))) or ((n % 4 == 0) or (n % 7 == 0)):
print('YES')
else:
print('NO')
|
Title: Lucky Division
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya loves lucky numbers. Everybody knows that lucky numbers are positive integers whose decimal representation contains only the lucky digits 4 and 7. For example, numbers 47, 744, 4 are lucky and 5, 17, 467 are not.
Petya calls a number almost lucky if it could be evenly divided by some lucky number. Help him find out if the given number *n* is almost lucky.
Input Specification:
The single line contains an integer *n* (1<=≤<=*n*<=≤<=1000) — the number that needs to be checked.
Output Specification:
In the only line print "YES" (without the quotes), if number *n* is almost lucky. Otherwise, print "NO" (without the quotes).
Demo Input:
['47\n', '16\n', '78\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n']
Note:
Note that all lucky numbers are almost lucky as any number is evenly divisible by itself.
In the first sample 47 is a lucky number. In the second sample 16 is divisible by 4.
|
```python
n = int(input())
if (('4' in str(n) and '7' in str(n) and (len(str(n)) == str(n).count('4') + str(n).count('7')))) or ((n % 4 == 0) or (n % 7 == 0)):
print('YES')
else:
print('NO')
```
| 0
|
|
835
|
A
|
Key races
|
PROGRAMMING
| 800
|
[
"math"
] | null | null |
Two boys decided to compete in text typing on the site "Key races". During the competition, they have to type a text consisting of *s* characters. The first participant types one character in *v*1 milliseconds and has ping *t*1 milliseconds. The second participant types one character in *v*2 milliseconds and has ping *t*2 milliseconds.
If connection ping (delay) is *t* milliseconds, the competition passes for a participant as follows:
1. Exactly after *t* milliseconds after the start of the competition the participant receives the text to be entered. 1. Right after that he starts to type it. 1. Exactly *t* milliseconds after he ends typing all the text, the site receives information about it.
The winner is the participant whose information on the success comes earlier. If the information comes from both participants at the same time, it is considered that there is a draw.
Given the length of the text and the information about participants, determine the result of the game.
|
The first line contains five integers *s*, *v*1, *v*2, *t*1, *t*2 (1<=≤<=*s*,<=*v*1,<=*v*2,<=*t*1,<=*t*2<=≤<=1000) — the number of characters in the text, the time of typing one character for the first participant, the time of typing one character for the the second participant, the ping of the first participant and the ping of the second participant.
|
If the first participant wins, print "First". If the second participant wins, print "Second". In case of a draw print "Friendship".
|
[
"5 1 2 1 2\n",
"3 3 1 1 1\n",
"4 5 3 1 5\n"
] |
[
"First\n",
"Second\n",
"Friendship\n"
] |
In the first example, information on the success of the first participant comes in 7 milliseconds, of the second participant — in 14 milliseconds. So, the first wins.
In the second example, information on the success of the first participant comes in 11 milliseconds, of the second participant — in 5 milliseconds. So, the second wins.
In the third example, information on the success of the first participant comes in 22 milliseconds, of the second participant — in 22 milliseconds. So, it is be a draw.
| 500
|
[
{
"input": "5 1 2 1 2",
"output": "First"
},
{
"input": "3 3 1 1 1",
"output": "Second"
},
{
"input": "4 5 3 1 5",
"output": "Friendship"
},
{
"input": "1000 1000 1000 1000 1000",
"output": "Friendship"
},
{
"input": "1 1 1 1 1",
"output": "Friendship"
},
{
"input": "8 8 1 1 1",
"output": "Second"
},
{
"input": "15 14 32 65 28",
"output": "First"
},
{
"input": "894 197 325 232 902",
"output": "First"
},
{
"input": "1 2 8 8 5",
"output": "Friendship"
},
{
"input": "37 261 207 1 1000",
"output": "Friendship"
},
{
"input": "29 344 406 900 1",
"output": "Friendship"
},
{
"input": "1 2 8 9 8",
"output": "First"
},
{
"input": "2 9 8 8 9",
"output": "Friendship"
},
{
"input": "213 480 811 134 745",
"output": "First"
},
{
"input": "2 313 856 964 421",
"output": "Friendship"
},
{
"input": "1 10 2 6 10",
"output": "Friendship"
},
{
"input": "2 7 6 2 3",
"output": "Friendship"
},
{
"input": "637 324 69 612 998",
"output": "Second"
},
{
"input": "13 849 819 723 918",
"output": "Friendship"
},
{
"input": "9 5 7 8 7",
"output": "First"
},
{
"input": "6 5 7 10 4",
"output": "Friendship"
},
{
"input": "61 464 623 89 548",
"output": "First"
},
{
"input": "641 31 29 161 802",
"output": "Friendship"
},
{
"input": "3 3 1 6 9",
"output": "Friendship"
},
{
"input": "2 3 9 8 2",
"output": "Friendship"
},
{
"input": "485 117 368 567 609",
"output": "First"
},
{
"input": "4 202 512 995 375",
"output": "Friendship"
},
{
"input": "424 41 41 909 909",
"output": "Friendship"
},
{
"input": "884 913 263 641 265",
"output": "Second"
},
{
"input": "12 462 8 311 327",
"output": "Second"
},
{
"input": "436 306 266 493 580",
"output": "Second"
},
{
"input": "69 1 2 1 2",
"output": "First"
}
] | 1,638,556,566
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 46
| 0
|
a,b,c,d,e =map(int,input().split())
p = (b*a) +d +1
q = (c*a) +e +1
if p<q:
print("First")
elif p>q :
print("Second")
else:
print("Friendship")
|
Title: Key races
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two boys decided to compete in text typing on the site "Key races". During the competition, they have to type a text consisting of *s* characters. The first participant types one character in *v*1 milliseconds and has ping *t*1 milliseconds. The second participant types one character in *v*2 milliseconds and has ping *t*2 milliseconds.
If connection ping (delay) is *t* milliseconds, the competition passes for a participant as follows:
1. Exactly after *t* milliseconds after the start of the competition the participant receives the text to be entered. 1. Right after that he starts to type it. 1. Exactly *t* milliseconds after he ends typing all the text, the site receives information about it.
The winner is the participant whose information on the success comes earlier. If the information comes from both participants at the same time, it is considered that there is a draw.
Given the length of the text and the information about participants, determine the result of the game.
Input Specification:
The first line contains five integers *s*, *v*1, *v*2, *t*1, *t*2 (1<=≤<=*s*,<=*v*1,<=*v*2,<=*t*1,<=*t*2<=≤<=1000) — the number of characters in the text, the time of typing one character for the first participant, the time of typing one character for the the second participant, the ping of the first participant and the ping of the second participant.
Output Specification:
If the first participant wins, print "First". If the second participant wins, print "Second". In case of a draw print "Friendship".
Demo Input:
['5 1 2 1 2\n', '3 3 1 1 1\n', '4 5 3 1 5\n']
Demo Output:
['First\n', 'Second\n', 'Friendship\n']
Note:
In the first example, information on the success of the first participant comes in 7 milliseconds, of the second participant — in 14 milliseconds. So, the first wins.
In the second example, information on the success of the first participant comes in 11 milliseconds, of the second participant — in 5 milliseconds. So, the second wins.
In the third example, information on the success of the first participant comes in 22 milliseconds, of the second participant — in 22 milliseconds. So, it is be a draw.
|
```python
a,b,c,d,e =map(int,input().split())
p = (b*a) +d +1
q = (c*a) +e +1
if p<q:
print("First")
elif p>q :
print("Second")
else:
print("Friendship")
```
| 0
|
|
186
|
A
|
Comparing Strings
|
PROGRAMMING
| 1,100
|
[
"implementation",
"strings"
] | null | null |
Some dwarves that are finishing the StUDY (State University for Dwarven Youngsters) Bachelor courses, have been told "no genome, no degree". That means that all dwarves should write a thesis on genome. Dwarven genome is far from simple. It is represented by a string that consists of lowercase Latin letters.
Dwarf Misha has already chosen the subject for his thesis: determining by two dwarven genomes, whether they belong to the same race. Two dwarves belong to the same race if we can swap two characters in the first dwarf's genome and get the second dwarf's genome as a result. Help Dwarf Misha and find out whether two gnomes belong to the same race or not.
|
The first line contains the first dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The second line contains the second dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The number of letters in each genome doesn't exceed 105. It is guaranteed that the strings that correspond to the genomes are different. The given genomes may have different length.
|
Print "YES", if the dwarves belong to the same race. Otherwise, print "NO".
|
[
"ab\nba\n",
"aa\nab\n"
] |
[
"YES\n",
"NO\n"
] |
- First example: you can simply swap two letters in string "ab". So we get "ba". - Second example: we can't change string "aa" into string "ab", because "aa" does not contain letter "b".
| 500
|
[
{
"input": "ab\nba",
"output": "YES"
},
{
"input": "aa\nab",
"output": "NO"
},
{
"input": "a\nza",
"output": "NO"
},
{
"input": "vvea\nvvae",
"output": "YES"
},
{
"input": "rtfabanpc\natfabrnpc",
"output": "YES"
},
{
"input": "mt\ntm",
"output": "YES"
},
{
"input": "qxolmbkkt\naovlajmlf",
"output": "NO"
},
{
"input": "b\ng",
"output": "NO"
},
{
"input": "ab\naba",
"output": "NO"
},
{
"input": "ba\na",
"output": "NO"
},
{
"input": "a\nab",
"output": "NO"
},
{
"input": "a\naa",
"output": "NO"
},
{
"input": "a\nz",
"output": "NO"
},
{
"input": "aabb\nbbaa",
"output": "NO"
},
{
"input": "ab\nbd",
"output": "NO"
},
{
"input": "bac\ndae",
"output": "NO"
},
{
"input": "abc\nakl",
"output": "NO"
},
{
"input": "cb\naa",
"output": "NO"
},
{
"input": "abaab\naabba",
"output": "NO"
},
{
"input": "aab\naaa",
"output": "NO"
},
{
"input": "abcde\nedcba",
"output": "NO"
},
{
"input": "abab\nbaba",
"output": "NO"
},
{
"input": "ab\nbac",
"output": "NO"
},
{
"input": "abcd\naqcb",
"output": "NO"
},
{
"input": "abc\nbad",
"output": "NO"
},
{
"input": "ab\nca",
"output": "NO"
},
{
"input": "abc\nab",
"output": "NO"
},
{
"input": "ab\nbae",
"output": "NO"
},
{
"input": "aaaabcccca\naaaadccccb",
"output": "NO"
},
{
"input": "acaa\nabca",
"output": "NO"
},
{
"input": "aba\naab",
"output": "YES"
},
{
"input": "ah\nla",
"output": "NO"
},
{
"input": "aab\naa",
"output": "NO"
},
{
"input": "abab\nabcd",
"output": "NO"
},
{
"input": "ed\nab",
"output": "NO"
}
] | 1,656,241,331
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 53
| 154
| 32,665,600
|
# author: violist
# created: 26.06.2022 12:53:28
import sys
from collections import defaultdict
input = sys.stdin.readline
a = input()[:-1]
b = input()[:-1]
if (len(a) != len(b)):
print("NO")
sys.exit()
n = len(a)
cnt = 0
for i in range(n):
if (a[i] != b[i]):
cnt += 1
x, y = defaultdict(lambda : 0), defaultdict(lambda : 0)
for i in range(n):
x[a[i]] += 1
y[b[i]] += 1
x = sorted(x.items(), key = lambda x : x[0])
y = sorted(y.items(), key = lambda x : x[0])
if (cnt > 2 or x != y):
print("NO")
else:
print("YES")
|
Title: Comparing Strings
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Some dwarves that are finishing the StUDY (State University for Dwarven Youngsters) Bachelor courses, have been told "no genome, no degree". That means that all dwarves should write a thesis on genome. Dwarven genome is far from simple. It is represented by a string that consists of lowercase Latin letters.
Dwarf Misha has already chosen the subject for his thesis: determining by two dwarven genomes, whether they belong to the same race. Two dwarves belong to the same race if we can swap two characters in the first dwarf's genome and get the second dwarf's genome as a result. Help Dwarf Misha and find out whether two gnomes belong to the same race or not.
Input Specification:
The first line contains the first dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The second line contains the second dwarf's genome: a non-empty string, consisting of lowercase Latin letters.
The number of letters in each genome doesn't exceed 105. It is guaranteed that the strings that correspond to the genomes are different. The given genomes may have different length.
Output Specification:
Print "YES", if the dwarves belong to the same race. Otherwise, print "NO".
Demo Input:
['ab\nba\n', 'aa\nab\n']
Demo Output:
['YES\n', 'NO\n']
Note:
- First example: you can simply swap two letters in string "ab". So we get "ba". - Second example: we can't change string "aa" into string "ab", because "aa" does not contain letter "b".
|
```python
# author: violist
# created: 26.06.2022 12:53:28
import sys
from collections import defaultdict
input = sys.stdin.readline
a = input()[:-1]
b = input()[:-1]
if (len(a) != len(b)):
print("NO")
sys.exit()
n = len(a)
cnt = 0
for i in range(n):
if (a[i] != b[i]):
cnt += 1
x, y = defaultdict(lambda : 0), defaultdict(lambda : 0)
for i in range(n):
x[a[i]] += 1
y[b[i]] += 1
x = sorted(x.items(), key = lambda x : x[0])
y = sorted(y.items(), key = lambda x : x[0])
if (cnt > 2 or x != y):
print("NO")
else:
print("YES")
```
| 3
|
|
976
|
E
|
Well played!
|
PROGRAMMING
| 2,100
|
[
"greedy",
"sortings"
] | null | null |
Recently Max has got himself into popular CCG "BrainStone". As "BrainStone" is a pretty intellectual game, Max has to solve numerous hard problems during the gameplay. Here is one of them:
Max owns *n* creatures, *i*-th of them can be described with two numbers — its health *hp**i* and its damage *dmg**i*. Max also has two types of spells in stock:
1. Doubles health of the creature (*hp**i* := *hp**i*·2); 1. Assigns value of health of the creature to its damage (*dmg**i* := *hp**i*).
Spell of first type can be used no more than *a* times in total, of the second type — no more than *b* times in total. Spell can be used on a certain creature multiple times. Spells can be used in arbitrary order. It isn't necessary to use all the spells.
Max is really busy preparing for his final exams, so he asks you to determine what is the maximal total damage of all creatures he can achieve if he uses spells in most optimal way.
|
The first line contains three integers *n*, *a*, *b* (1<=≤<=*n*<=≤<=2·105, 0<=≤<=*a*<=≤<=20, 0<=≤<=*b*<=≤<=2·105) — the number of creatures, spells of the first type and spells of the second type, respectively.
The *i*-th of the next *n* lines contain two number *hp**i* and *dmg**i* (1<=≤<=*hp**i*,<=*dmg**i*<=≤<=109) — description of the *i*-th creature.
|
Print single integer — maximum total damage creatures can deal.
|
[
"2 1 1\n10 15\n6 1\n",
"3 0 3\n10 8\n7 11\n5 2\n"
] |
[
"27\n",
"26\n"
] |
In the first example Max should use the spell of the first type on the second creature, then the spell of the second type on the same creature. Then total damage will be equal to 15 + 6·2 = 27.
In the second example Max should use the spell of the second type on the first creature, then the spell of the second type on the third creature. Total damage will be equal to 10 + 11 + 5 = 26.
| 0
|
[
{
"input": "2 1 1\n10 15\n6 1",
"output": "27"
},
{
"input": "3 0 3\n10 8\n7 11\n5 2",
"output": "26"
},
{
"input": "1 0 0\n2 1",
"output": "1"
},
{
"input": "1 0 200000\n1 2",
"output": "2"
},
{
"input": "7 5 7\n29 25\n84 28\n34 34\n14 76\n85 9\n40 57\n99 88",
"output": "3533"
},
{
"input": "7 6 7\n11 75\n61 90\n22 14\n100 36\n29 48\n69 52\n16 3",
"output": "6720"
},
{
"input": "7 8 7\n88 29\n30 44\n14 1\n83 95\n73 88\n10 42\n29 26",
"output": "22840"
},
{
"input": "12 7 7\n78 189\n614 271\n981 510\n37 762\n803 106\n78 369\n787 54\n768 159\n238 111\n107 54\n207 72\n485 593",
"output": "130952"
},
{
"input": "12 20 4\n852 935\n583 820\n969 197\n219 918\n547 842\n615 163\n704 377\n326 482\n183 833\n884 994\n886 581\n909 450",
"output": "1016078777"
},
{
"input": "2 13 2\n208637 682633\n393097 724045",
"output": "3220933257"
},
{
"input": "1 0 200000\n42 1",
"output": "42"
},
{
"input": "1 6 200000\n42 1",
"output": "2688"
},
{
"input": "1 0 200000\n1 42",
"output": "42"
},
{
"input": "1 6 200000\n1 42",
"output": "64"
},
{
"input": "3 1 1\n10 9\n8 6\n7 5",
"output": "31"
},
{
"input": "1 1 0\n10 1",
"output": "1"
},
{
"input": "1 1 0\n3 4",
"output": "4"
},
{
"input": "3 20 0\n1 5\n5 1\n5 1",
"output": "7"
},
{
"input": "2 5 1\n10 1\n20 20",
"output": "641"
},
{
"input": "3 20 0\n3 2\n4 3\n5 4",
"output": "9"
},
{
"input": "2 1 0\n10 15\n6 1",
"output": "16"
},
{
"input": "5 10 0\n20 1\n22 1\n30 1\n30 5\n40 6",
"output": "14"
},
{
"input": "1 20 0\n1 5",
"output": "5"
},
{
"input": "2 3 14\n28 5\n32 47",
"output": "284"
},
{
"input": "3 1 2\n20 10\n5 1\n25 25",
"output": "71"
},
{
"input": "2 3 3\n28 5\n32 47",
"output": "284"
},
{
"input": "2 2 1\n10 15\n6 1",
"output": "41"
},
{
"input": "2 1 2\n20 1\n22 23",
"output": "64"
},
{
"input": "10 7 2\n8 6\n5 5\n3 7\n7 7\n3 8\n6 1\n10 9\n4 6\n9 5\n7 9",
"output": "1339"
},
{
"input": "3 8 1\n6 6\n7 9\n2 5",
"output": "1803"
},
{
"input": "10 4 4\n5 5\n8 1\n10 10\n3 1\n7 10\n1 7\n8 7\n5 9\n3 3\n1 1",
"output": "214"
},
{
"input": "4 8 3\n1 6\n10 10\n4 8\n9 4",
"output": "2583"
},
{
"input": "8 18 1\n8 6\n6 8\n1 7\n7 2\n5 1\n10 5\n8 3\n9 3",
"output": "2621470"
},
{
"input": "2 11 1\n1 4\n1 5",
"output": "2053"
},
{
"input": "2 19 2\n9 3\n7 2",
"output": "4718599"
},
{
"input": "5 13 0\n4 4\n8 10\n1 8\n3 9\n4 6",
"output": "37"
},
{
"input": "5 8 0\n10 7\n6 6\n6 5\n7 9\n10 7",
"output": "34"
},
{
"input": "5 20 2\n1 10\n7 8\n10 1\n6 5\n2 1",
"output": "10485785"
},
{
"input": "2 1 0\n5 6\n8 8",
"output": "14"
},
{
"input": "7 3 5\n2 6\n5 9\n5 5\n4 10\n5 7\n7 8\n3 10",
"output": "103"
},
{
"input": "10 9 0\n620118469 704168608\n528098892 341451371\n15150469 449838744\n960504540 722185004\n271837337 344050133\n940943201 419522619\n85569623 788965215\n161962866 563795701\n943389281 445744350\n610994199 473866838",
"output": "5253588583"
},
{
"input": "10 11 1\n7 3\n9 4\n1 5\n10 3\n6 1\n10 7\n8 5\n7 6\n1 4\n9 9",
"output": "20524"
},
{
"input": "2 1 200000\n44 42\n1000 1001",
"output": "2044"
},
{
"input": "5 12 2\n5 9\n8 9\n4 1\n2 5\n1 8",
"output": "32794"
},
{
"input": "4 8 1\n9 9\n7 6\n2 4\n6 10",
"output": "2324"
},
{
"input": "2 1 1\n292725479 742903381\n239450691 307356865",
"output": "1221804763"
}
] | 1,657,747,272
| 2,147,483,647
|
PyPy 3-64
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 9
| 1,000
| 16,281,600
|
from sys import stdin,exit
def select(arr, left, right, k):
while True:
if left == right:
return left
pivotIndex = pivot(arr, left, right)
pivotIndex = partition(arr, left, right, pivotIndex, k)
if k == pivotIndex:
return k
elif k < pivotIndex:
right = pivotIndex - 1
else:
left = pivotIndex + 1
def pivot(arr, left, right):
# for 5 or less elements just get median
if right - left < 5:
return partition5(arr, left, right)
# otherwise move the medians of five-element subgroups to the first n/5 positions
for i in range(left,right,5):
# get the median position of the i'th five-element subgroup
subRight = i + 4
if subRight > right:
subRight = right
median5 = partition5(arr, i, subRight)
arr[median5],arr[left+(i-left)//5] = arr[left+(i-left)//5], arr[median5]
# compute the median of the n/5 medians-of-five
mid = (right - left) / 10 + left + 1
return select(arr, left, left + (right - left) // 5, mid)
def partition(arr, left, right, pivotIndex, k):
pivotValue = arr[pivotIndex]
arr[pivotIndex],arr[right] = arr[right],arr[pivotIndex] # Move pivot to end
storeIndex = left
# Move all elements smaller than the pivot to the left of the pivot
for i in range(left,right):
if arr[i] < pivotValue:
arr[storeIndex],arr[i]=arr[i],arr[storeIndex]
storeIndex+=1
#Move all elements equal to the pivot right after
#the smaller elements
storeIndexEq = storeIndex
for i in range(storeIndex, right):
if arr[i] == pivotValue:
arr[storeIndex],arr[i]=arr[i],arr[storeIndex]
storeIndex+=1
arr[right],arr[storeIndex]=arr[storeIndex],arr[right] # Move pivot to its final place
# Return location of pivot considering the desired location n
if k < storeIndex:
return storeIndex # k is in the group of smaller elements
if k <= storeIndexEq:
return k # n is in the group equal to pivot
return storeIndexEq # k is in the group of larger elements
def partition5(arr, left, right):
i = left + 1
while i <= right:
j = i
while j > left and arr[j-1] > arr[j]:
arr[j-1],arr[j]=arr[j],arr[j-1]
j = j - 1
i = i + 1
return (left + right)// 2
#Parsea una línea
def parser():
return map(int, stdin.readline().split())
#Recibiendo los valores de n, a y b
n,a,b=parser()
#Máximo de hechizos de tipo 2 que tiene sentido utilizar
b=min(b,n)
#Inicializando las listas de vida y daño
hp=[]
dmg=[]
#Recibiendo los parámetros de las criaturas
for creature in range(n):
h,d=parser()
hp.append(h)
dmg.append(d)
#Si no hay hechizos de tipo 2 solo se pueden usar los daños de las criaturas
if b==0:
print(sum(dmg))
exit()
#Arreglo con los valores de dmg[i]-hp[i]. Se hace así porque se quiere el orden descendente y el algoritmo trabaja con orden ascendente
arr=[(dmg[i]-hp[i],i) for i in range(n)]
#obteniendo la b-ésima criatura y la diferencia correspondiente
minnor_difference,chosen_creature=arr[select(arr,0,len(arr)-1,b-1)]
minnor_difference*=-1
#Inicializando el daño total
max_damage=0
#Recorriendo las criaturas
for i in range(n):
#Si su diferencia es mayor que la de la b-ésima criatura es una de las b primeras
if hp[i]-dmg[i] > minnor_difference:
#Ver si es mejor utilizar un hechizo de tipo 2 o no
max_damage+=max(hp[i],dmg[i])
#Si su diferencia es igual que la de la b-ésima criatura comparar por índice
elif hp[i]-dmg[i] == minnor_difference:
#Si el índice es mayor entonces es una de las n-b últimas criaturas
if i > chosen_creature:
#Aporta su daño
max_damage+=dmg[i]
#En caso contrario es una de las b primeras
else:
#Ver si es mejor utilizar un hechizo de tipo 2 o no
max_damage+=max(hp[i],dmg[i])
#Es una de las b últimas criaturas
else:
#Aporta su daño
max_damage+=dmg[i]
#Guardar el valor auxiliar de la solución óptima del primer subproblema
aux=max_damage
#Restar lo aportado por la b-ésima criatura y sumar su daño
change=max(hp[chosen_creature],dmg[chosen_creature])-dmg[chosen_creature]
#Recorriendo las criaturas para ver a cuál aplicar los hechizos tipo 1
#Quedarse con el máximo valor entre lo antes calculado y lo calculado actualmente
for i in range(n):
#Si su diferencia es mayor que la de la b-ésima criatura es una de las b primeras
if hp[i]-dmg[i] > minnor_difference:
#Restar daño aportado anteriormente y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-max(hp[i],dmg[i])+hp[i]*2**a)
#Si su diferencia es igual que la de la b-ésima criatura comparar por índice
elif hp[i]-dmg[i] == minnor_difference:
#Si el índice es mayor entonces es una de las n-b últimas criaturas
if i > chosen_creature:
#Restar el daño aportado por la b-ésima criatura y sumar su daño. Luego restar el daño aportado por la criatura actual y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-change-dmg[i]+hp[i]*2**a)
#En caso contrario es una de las b primeras
else:
#Restar daño aportado anteriormente y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-max(hp[i],dmg[i])+hp[i]*2**a)
#Es una de las n-b últimas criaturas
else:
#Restar el daño aportado por la b-ésima criatura y sumar su daño. Luego restar el daño aportado por la criatura actual y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-change-dmg[i]+hp[i]*2**a)
#Imprimir el máximo daño total
print(max_damage)
|
Title: Well played!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently Max has got himself into popular CCG "BrainStone". As "BrainStone" is a pretty intellectual game, Max has to solve numerous hard problems during the gameplay. Here is one of them:
Max owns *n* creatures, *i*-th of them can be described with two numbers — its health *hp**i* and its damage *dmg**i*. Max also has two types of spells in stock:
1. Doubles health of the creature (*hp**i* := *hp**i*·2); 1. Assigns value of health of the creature to its damage (*dmg**i* := *hp**i*).
Spell of first type can be used no more than *a* times in total, of the second type — no more than *b* times in total. Spell can be used on a certain creature multiple times. Spells can be used in arbitrary order. It isn't necessary to use all the spells.
Max is really busy preparing for his final exams, so he asks you to determine what is the maximal total damage of all creatures he can achieve if he uses spells in most optimal way.
Input Specification:
The first line contains three integers *n*, *a*, *b* (1<=≤<=*n*<=≤<=2·105, 0<=≤<=*a*<=≤<=20, 0<=≤<=*b*<=≤<=2·105) — the number of creatures, spells of the first type and spells of the second type, respectively.
The *i*-th of the next *n* lines contain two number *hp**i* and *dmg**i* (1<=≤<=*hp**i*,<=*dmg**i*<=≤<=109) — description of the *i*-th creature.
Output Specification:
Print single integer — maximum total damage creatures can deal.
Demo Input:
['2 1 1\n10 15\n6 1\n', '3 0 3\n10 8\n7 11\n5 2\n']
Demo Output:
['27\n', '26\n']
Note:
In the first example Max should use the spell of the first type on the second creature, then the spell of the second type on the same creature. Then total damage will be equal to 15 + 6·2 = 27.
In the second example Max should use the spell of the second type on the first creature, then the spell of the second type on the third creature. Total damage will be equal to 10 + 11 + 5 = 26.
|
```python
from sys import stdin,exit
def select(arr, left, right, k):
while True:
if left == right:
return left
pivotIndex = pivot(arr, left, right)
pivotIndex = partition(arr, left, right, pivotIndex, k)
if k == pivotIndex:
return k
elif k < pivotIndex:
right = pivotIndex - 1
else:
left = pivotIndex + 1
def pivot(arr, left, right):
# for 5 or less elements just get median
if right - left < 5:
return partition5(arr, left, right)
# otherwise move the medians of five-element subgroups to the first n/5 positions
for i in range(left,right,5):
# get the median position of the i'th five-element subgroup
subRight = i + 4
if subRight > right:
subRight = right
median5 = partition5(arr, i, subRight)
arr[median5],arr[left+(i-left)//5] = arr[left+(i-left)//5], arr[median5]
# compute the median of the n/5 medians-of-five
mid = (right - left) / 10 + left + 1
return select(arr, left, left + (right - left) // 5, mid)
def partition(arr, left, right, pivotIndex, k):
pivotValue = arr[pivotIndex]
arr[pivotIndex],arr[right] = arr[right],arr[pivotIndex] # Move pivot to end
storeIndex = left
# Move all elements smaller than the pivot to the left of the pivot
for i in range(left,right):
if arr[i] < pivotValue:
arr[storeIndex],arr[i]=arr[i],arr[storeIndex]
storeIndex+=1
#Move all elements equal to the pivot right after
#the smaller elements
storeIndexEq = storeIndex
for i in range(storeIndex, right):
if arr[i] == pivotValue:
arr[storeIndex],arr[i]=arr[i],arr[storeIndex]
storeIndex+=1
arr[right],arr[storeIndex]=arr[storeIndex],arr[right] # Move pivot to its final place
# Return location of pivot considering the desired location n
if k < storeIndex:
return storeIndex # k is in the group of smaller elements
if k <= storeIndexEq:
return k # n is in the group equal to pivot
return storeIndexEq # k is in the group of larger elements
def partition5(arr, left, right):
i = left + 1
while i <= right:
j = i
while j > left and arr[j-1] > arr[j]:
arr[j-1],arr[j]=arr[j],arr[j-1]
j = j - 1
i = i + 1
return (left + right)// 2
#Parsea una línea
def parser():
return map(int, stdin.readline().split())
#Recibiendo los valores de n, a y b
n,a,b=parser()
#Máximo de hechizos de tipo 2 que tiene sentido utilizar
b=min(b,n)
#Inicializando las listas de vida y daño
hp=[]
dmg=[]
#Recibiendo los parámetros de las criaturas
for creature in range(n):
h,d=parser()
hp.append(h)
dmg.append(d)
#Si no hay hechizos de tipo 2 solo se pueden usar los daños de las criaturas
if b==0:
print(sum(dmg))
exit()
#Arreglo con los valores de dmg[i]-hp[i]. Se hace así porque se quiere el orden descendente y el algoritmo trabaja con orden ascendente
arr=[(dmg[i]-hp[i],i) for i in range(n)]
#obteniendo la b-ésima criatura y la diferencia correspondiente
minnor_difference,chosen_creature=arr[select(arr,0,len(arr)-1,b-1)]
minnor_difference*=-1
#Inicializando el daño total
max_damage=0
#Recorriendo las criaturas
for i in range(n):
#Si su diferencia es mayor que la de la b-ésima criatura es una de las b primeras
if hp[i]-dmg[i] > minnor_difference:
#Ver si es mejor utilizar un hechizo de tipo 2 o no
max_damage+=max(hp[i],dmg[i])
#Si su diferencia es igual que la de la b-ésima criatura comparar por índice
elif hp[i]-dmg[i] == minnor_difference:
#Si el índice es mayor entonces es una de las n-b últimas criaturas
if i > chosen_creature:
#Aporta su daño
max_damage+=dmg[i]
#En caso contrario es una de las b primeras
else:
#Ver si es mejor utilizar un hechizo de tipo 2 o no
max_damage+=max(hp[i],dmg[i])
#Es una de las b últimas criaturas
else:
#Aporta su daño
max_damage+=dmg[i]
#Guardar el valor auxiliar de la solución óptima del primer subproblema
aux=max_damage
#Restar lo aportado por la b-ésima criatura y sumar su daño
change=max(hp[chosen_creature],dmg[chosen_creature])-dmg[chosen_creature]
#Recorriendo las criaturas para ver a cuál aplicar los hechizos tipo 1
#Quedarse con el máximo valor entre lo antes calculado y lo calculado actualmente
for i in range(n):
#Si su diferencia es mayor que la de la b-ésima criatura es una de las b primeras
if hp[i]-dmg[i] > minnor_difference:
#Restar daño aportado anteriormente y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-max(hp[i],dmg[i])+hp[i]*2**a)
#Si su diferencia es igual que la de la b-ésima criatura comparar por índice
elif hp[i]-dmg[i] == minnor_difference:
#Si el índice es mayor entonces es una de las n-b últimas criaturas
if i > chosen_creature:
#Restar el daño aportado por la b-ésima criatura y sumar su daño. Luego restar el daño aportado por la criatura actual y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-change-dmg[i]+hp[i]*2**a)
#En caso contrario es una de las b primeras
else:
#Restar daño aportado anteriormente y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-max(hp[i],dmg[i])+hp[i]*2**a)
#Es una de las n-b últimas criaturas
else:
#Restar el daño aportado por la b-ésima criatura y sumar su daño. Luego restar el daño aportado por la criatura actual y sumar el daño que causará con los hechizos de tipo 1
max_damage=max(max_damage,aux-change-dmg[i]+hp[i]*2**a)
#Imprimir el máximo daño total
print(max_damage)
```
| 0
|
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,639,563,155
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 30
| 216
| 0
|
inp = input()
count = {'l': 0, 'u': 0}
for i in inp:
if i.isupper():
count['u'] += 1
else:
count['l'] += 1
if count['u'] > count['l']:
print(inp.upper())
else:
print(inp.lower())
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
inp = input()
count = {'l': 0, 'u': 0}
for i in inp:
if i.isupper():
count['u'] += 1
else:
count['l'] += 1
if count['u'] > count['l']:
print(inp.upper())
else:
print(inp.lower())
```
| 3.946
|
989
|
C
|
A Mist of Florescence
|
PROGRAMMING
| 1,800
|
[
"constructive algorithms",
"graphs"
] | null | null |
"I've been here once," Mino exclaims with delight, "it's breathtakingly amazing."
"What is it like?"
"Look, Kanno, you've got your paintbrush, and I've got my words. Have a try, shall we?"
There are four kinds of flowers in the wood, Amaranths, Begonias, Centaureas and Dianthuses.
The wood can be represented by a rectangular grid of $n$ rows and $m$ columns. In each cell of the grid, there is exactly one type of flowers.
According to Mino, the numbers of connected components formed by each kind of flowers are $a$, $b$, $c$ and $d$ respectively. Two cells are considered in the same connected component if and only if a path exists between them that moves between cells sharing common edges and passes only through cells containing the same flowers.
You are to help Kanno depict such a grid of flowers, with $n$ and $m$ arbitrarily chosen under the constraints given below. It can be shown that at least one solution exists under the constraints of this problem.
Note that you can choose arbitrary $n$ and $m$ under the constraints below, they are not given in the input.
|
The first and only line of input contains four space-separated integers $a$, $b$, $c$ and $d$ ($1 \leq a, b, c, d \leq 100$) — the required number of connected components of Amaranths, Begonias, Centaureas and Dianthuses, respectively.
|
In the first line, output two space-separated integers $n$ and $m$ ($1 \leq n, m \leq 50$) — the number of rows and the number of columns in the grid respectively.
Then output $n$ lines each consisting of $m$ consecutive English letters, representing one row of the grid. Each letter should be among 'A', 'B', 'C' and 'D', representing Amaranths, Begonias, Centaureas and Dianthuses, respectively.
In case there are multiple solutions, print any. You can output each letter in either case (upper or lower).
|
[
"5 3 2 1\n",
"50 50 1 1\n",
"1 6 4 5\n"
] |
[
"4 7\nDDDDDDD\nDABACAD\nDBABACD\nDDDDDDD",
"4 50\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nABABABABABABABABABABABABABABABABABABABABABABABABAB\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD",
"7 7\nDDDDDDD\nDDDBDBD\nDDCDCDD\nDBDADBD\nDDCDCDD\nDBDBDDD\nDDDDDDD"
] |
In the first example, each cell of Amaranths, Begonias and Centaureas forms a connected component, while all the Dianthuses form one.
| 1,500
|
[
{
"input": "5 3 2 1",
"output": "5 13\nAABABBBBCDDAD\nABAABBBBCDADD\nAAAABBBBCDDAD\nAAAABCBBCDADD\nAAAABBBBCDDDD"
},
{
"input": "50 50 1 1",
"output": "10 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD\nDADADADADADADADADADADADADADADADADADADADADADADADADD\nADADADADADADADADADADADADADADADADADADADADADADADADAD\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD..."
},
{
"input": "1 6 4 5",
"output": "6 13\nAABABBCBCCDCD\nABAABBBBCCCCD\nAABABBCBCCDCD\nABAABCBBCDCCD\nAABABBBBCCDCD\nAAAABBBBCCCCD"
},
{
"input": "1 1 1 1",
"output": "2 4\nABCD\nABCD"
},
{
"input": "4 8 16 32",
"output": "16 32\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABAAAAAAABAAAAAAAAAAAAAAABABAAAA\nBAAAAAAAAAAABAAAAAAAAAAABAAAAAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBBBBBCBCBCBCBCBBBCBCBBBBBBBBBB\nCBCBBBBBBBBBCBBBCBBBCBBBBBCBBBCB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCC\nDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDC\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD\nADDDDDDDDDDDDDDDADDDDDDDDDDD..."
},
{
"input": "1 1 1 50",
"output": "7 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCC\nDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDC\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD"
},
{
"input": "19 58 20 18",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABAAABABABABABAAABABAAAAABABAAABABAAAAABAA\nAAAABABABAAABABABABABAAABAAABAAABAAAAAAABAAAAAAAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABAAABABABAAABABABABAAAAAAABABAAABAAABAAABAAABABA\nABABAAABAAABABAAABAAAAABAAABABAAABAAAAABAAABAAAAAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBBBBBCBBBCBCBBBBBBBBBCBBBCBBBBBBBBBBBCBCBB\nBBBBCBCBCBCBBBBBCBBBBBCBCBCBBBCBBBBB..."
},
{
"input": "100 100 100 100",
"output": "40 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAABAAABAAABAAABABABABABABAAABABABABABABAAAAABABAA\nAABAAAAAAAAAAABAAABAAABABABAAABABAAABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAAABABABAAAAAAABABABABABAAABABABABABABAAAAAAABABA\nABABABAAABABABAAABABAAABAAABABABABABAAABABABABABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABAAABAAABABAAAAAAABAAAAAAABABAAABAAABAAAAABAA\nBABABABAAABABABABABAAABABABABAAABABAAABABABAAABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA..."
},
{
"input": "1 1 1 2",
"output": "2 7\nABCCDCD\nABCCCCD"
},
{
"input": "1 1 3 1",
"output": "3 7\nABBCBCD\nABCBBCD\nABBBBCD"
},
{
"input": "1 4 1 1",
"output": "4 7\nAABABCD\nABAABCD\nAABABCD\nAAAABCD"
},
{
"input": "5 1 1 1",
"output": "5 7\nABCDDAD\nABCDADD\nABCDDAD\nABCDADD\nABCDDDD"
},
{
"input": "1 4 7 3",
"output": "7 13\nAAAABBCBCCDCD\nABAABCBBCCCCD\nAAAABBCBCCCCD\nABAABCBBCCCCD\nAABABBCBCCCCD\nAAAABCBBCDCCD\nAAAABBBBCCCCD"
},
{
"input": "6 2 5 1",
"output": "6 13\nAAAABBCBCDDAD\nAAAABBBBCDADD\nAAAABBCBCDDAD\nAAAABCBBCDADD\nAABABBCBCDDAD\nAAAABBBBCDDDD"
},
{
"input": "1 5 6 3",
"output": "6 13\nAAAABBCBCCCCD\nABAABCBBCCCCD\nAABABBCBCCCCD\nABAABCBBCDCCD\nAABABBCBCCDCD\nAAAABBBBCCCCD"
},
{
"input": "4 1 4 5",
"output": "5 13\nABBCBCCDCDDAD\nABCBBCDCCDDDD\nABBBBCCDCDDAD\nABCBBCDCCDADD\nABBBBCCCCDDDD"
},
{
"input": "4 5 3 6",
"output": "6 16\nAAAABBCBCCDCDDAD\nABAABBBBCDCCDDDD\nAABABBCBCCDCDDAD\nABAABBBBCDCCDDDD\nAABABBBBCCDCDDAD\nAAAABBBBCCCCDDDD"
},
{
"input": "2 5 1 17",
"output": "13 17\nAAAAAAAAAAAAAAAAA\nABAAAAAAABAAAAAAA\nAABAAAAAAAAABAAAA\nAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDC\nDCDCDCDCDCDCDCDCC\nCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDD\nDDDDDDDDDDDDDDDDD\nDDADDDDDDDDDDDDDD\nDDDDDDDDDDDDDDDDD"
},
{
"input": "11 4 5 14",
"output": "14 16\nAAAABBBBCCDCDDDD\nABAABBBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABBBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABBBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABCBBCDCCDDDD\nAAAABBCBCCDCDDDD\nABAABCBBCDCCDADD\nAAAABBBBCCDCDDAD\nAAAABCBBCDCCDADD\nAABABBBBCCDCDDAD\nAAAABBBBCCCCDDDD"
},
{
"input": "19 19 8 10",
"output": "16 19\nAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABA\nBABABABABABABABABAA\nAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBBBBBCBBBCB\nBBCBBBCBCBBBBBCBBBB\nBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCC\nCCCDCCCCCDCCCDCCCDC\nCCCCDCDCCCDCCCDCDCC\nCCCCCCCCCCCCCCCCCCC\nDDDDDDDDDDDDDDDDDDD\nDADADADADADADADADAD\nADADADADADADADADADD\nDDDDDDDDDDDDDDDDDDD"
},
{
"input": "49 49 49 49",
"output": "16 49\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABA\nBABABABABABABABABABABABABABABABABABABABABABABABAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCB\nCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDC..."
},
{
"input": "49 50 50 50",
"output": "16 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBB\nCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCD..."
},
{
"input": "50 50 51 50",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBCBCBBBBBCBBBCBBBCBBBBBBBCBCBBBCBBBBBCBBBB\nCBCBCBCBCBBBBBBBBBBBBBBBBBBBCBCBBBCBCBCBBBCBCBCBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBCBCBBBBBCBBBCBBBCBCBCBCBCBCBCBCBCBCBBBCBBBBBCBCB\nBBBBBCBBBCBBBBBCBBBBBCBBBCBBBCBBBCBB..."
},
{
"input": "15 63 41 45",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABAAABABABABABAAABABAAAAABABAAABABAAAAABAA\nAAAABABABAAABABABABABAAABAAABAAABABABABABAAABAAAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABAAABABABAAABABABABAAAAAAABABAAABAAABAAABAAABABA\nABABAAABAAABABAAABAAAAABAAABABAAABABAAABAAABAAAAAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBCBCBCBCBCBCBCBCBCBBBCBBBCBBBCBCBCBCBCBCBCBCBB\nCBBBCBCBCBCBCBCBCBBBCBCBCBCBCBCBBBBB..."
},
{
"input": "45 36 25 13",
"output": "16 45\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABAAABABABABAAABABABABABAAABABABABABAAAAABAAA\nBABABABABABABAAAAABABABABABABABABABABAAABABAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBBBCBBBBBBBBBBBBBBBCBCBCBBBCBCBBBCB\nCBBBCBCBCBCBBBBBCBBBBBBBBBCBBBCBBBBBCBCBCBCBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nCCCCCCCCCCCCCCCCCCCDCCCCCCCCCDCCCCCDCCCCCDCCC\nCCCCCCCCCCCCDCCCDCCCCCDCDCCCCCDCCC..."
},
{
"input": "31 41 59 26",
"output": "19 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABAAAAABAAABABABABABABABABAAABABABABABAA\nBABABABABABABAAABABAAABAAABAAABABABABAAABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBCBBBBBCBCBCBBBCBBBCBBBCBBBBBBBCBCBBBCBBBBBCBBBB\nCBCBCBCBCBCBBBBBBBBBBBBBCBBBCBCBBBCBCBCBBBCBCBCBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBCBCBBBBBCBBBCBBBCBCBCBCBCBCBCBCBCBCBBBCBBBBBCBCB\nBCBBBCBBBCBBBCBCBBBBBCBBBCBBBCBCBCBC..."
},
{
"input": "18 90 64 16",
"output": "22 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABAAABAA\nAABABABABAAABABABABABABABAAABABABABABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABABABABABABABABABABABABABABABAAABABABABABABABABA\nABABABABABABABAAABABAAABABABABABABABABABABABAAABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBCBCBCBBBCBBBBBCBCBCBBBCBCBCBBBCBBBCBCBCBCBCBB\nCBCBCBBBCBCBBBCBBBCBCBBBCBCBBBCBCBBB..."
},
{
"input": "77 88 99 1",
"output": "22 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABAAAAABAA\nAABABABABAAABABABABABABABAAABABABABABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAABABABABABABABABABABABABAAABABAAABABABABABABABABA\nABABABABABABABAAABABAAABABABABABABABABABABABAAABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBB\nCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCBCB..."
},
{
"input": "99 100 1 100",
"output": "28 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAABAAABAAABAAABABABABABABAAABABABABABABAAAAABABAA\nAABAAAAAAAAAAABAAABAAABABABAAABABAAABABABABABABAAA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nAAAABABABAAAAAAABABABABABAAABABABABABABAAAAAAABABA\nABABABAAABABABAAABABAAABAAABABABABABAAABABABABABAB\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABAAABAAABABAAAAAAABAAAAAAABABAAABAAABAAAAABAA\nBABABABAAABABABABABAAABABABABAAABABAAABABABAAABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA..."
},
{
"input": "100 50 100 49",
"output": "28 50\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nABABABABABABABABABABABABABABABABABABABABABABABABAA\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBCBCBBBBBCBCBCBBBCBBBBBCBCBBBCBCBCBBBCBCBCBCBBBBBB\nBBBBCBCBCBCBBBCBCBCBCBCBBBCBCBCBCBBBCBCBCBCBCBCBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBCBCBBBBBCBCBCBCBCBCBCBCBCBCBBBCBCBCBBBBBCBCBCBCB\nBCBBBBBCBCBCBBBCBCBBBCBCBCBBBBBCBCBB..."
}
] | 1,528,780,746
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 92
| 0
|
quotas = [int(x) - 1 for x in input().split()]
grid = [['a'] * 50 for _ in range(12)] + \
[['b'] * 50 for _ in range(12)] + \
[['c'] * 50 for _ in range(12)] + \
[['d'] * 50 for _ in range(12)]
def poke(row, f_idx):
for i in range(row + 1, row + 12, 2):
for j in range(1, 50, 2):
if quotas[f_idx] > 0:
grid[i][j] = chr(ord('a') + f_idx)
quotas[f_idx] -= 1
poke(0, 3)
poke(12, 2)
poke(24, 1)
poke(36, 0)
print('48 50')
print('\n'.join([''.join(row) for row in grid]))
|
Title: A Mist of Florescence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"I've been here once," Mino exclaims with delight, "it's breathtakingly amazing."
"What is it like?"
"Look, Kanno, you've got your paintbrush, and I've got my words. Have a try, shall we?"
There are four kinds of flowers in the wood, Amaranths, Begonias, Centaureas and Dianthuses.
The wood can be represented by a rectangular grid of $n$ rows and $m$ columns. In each cell of the grid, there is exactly one type of flowers.
According to Mino, the numbers of connected components formed by each kind of flowers are $a$, $b$, $c$ and $d$ respectively. Two cells are considered in the same connected component if and only if a path exists between them that moves between cells sharing common edges and passes only through cells containing the same flowers.
You are to help Kanno depict such a grid of flowers, with $n$ and $m$ arbitrarily chosen under the constraints given below. It can be shown that at least one solution exists under the constraints of this problem.
Note that you can choose arbitrary $n$ and $m$ under the constraints below, they are not given in the input.
Input Specification:
The first and only line of input contains four space-separated integers $a$, $b$, $c$ and $d$ ($1 \leq a, b, c, d \leq 100$) — the required number of connected components of Amaranths, Begonias, Centaureas and Dianthuses, respectively.
Output Specification:
In the first line, output two space-separated integers $n$ and $m$ ($1 \leq n, m \leq 50$) — the number of rows and the number of columns in the grid respectively.
Then output $n$ lines each consisting of $m$ consecutive English letters, representing one row of the grid. Each letter should be among 'A', 'B', 'C' and 'D', representing Amaranths, Begonias, Centaureas and Dianthuses, respectively.
In case there are multiple solutions, print any. You can output each letter in either case (upper or lower).
Demo Input:
['5 3 2 1\n', '50 50 1 1\n', '1 6 4 5\n']
Demo Output:
['4 7\nDDDDDDD\nDABACAD\nDBABACD\nDDDDDDD', '4 50\nCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC\nABABABABABABABABABABABABABABABABABABABABABABABABAB\nBABABABABABABABABABABABABABABABABABABABABABABABABA\nDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD', '7 7\nDDDDDDD\nDDDBDBD\nDDCDCDD\nDBDADBD\nDDCDCDD\nDBDBDDD\nDDDDDDD']
Note:
In the first example, each cell of Amaranths, Begonias and Centaureas forms a connected component, while all the Dianthuses form one.
|
```python
quotas = [int(x) - 1 for x in input().split()]
grid = [['a'] * 50 for _ in range(12)] + \
[['b'] * 50 for _ in range(12)] + \
[['c'] * 50 for _ in range(12)] + \
[['d'] * 50 for _ in range(12)]
def poke(row, f_idx):
for i in range(row + 1, row + 12, 2):
for j in range(1, 50, 2):
if quotas[f_idx] > 0:
grid[i][j] = chr(ord('a') + f_idx)
quotas[f_idx] -= 1
poke(0, 3)
poke(12, 2)
poke(24, 1)
poke(36, 0)
print('48 50')
print('\n'.join([''.join(row) for row in grid]))
```
| 3
|
|
50
|
A
|
Domino piling
|
PROGRAMMING
| 800
|
[
"greedy",
"math"
] |
A. Domino piling
|
2
|
256
|
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
|
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
|
Output one number — the maximal number of dominoes, which can be placed.
|
[
"2 4\n",
"3 3\n"
] |
[
"4\n",
"4\n"
] |
none
| 500
|
[
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "2 6",
"output": "6"
},
{
"input": "2 7",
"output": "7"
},
{
"input": "2 14",
"output": "14"
},
{
"input": "2 15",
"output": "15"
},
{
"input": "1 4",
"output": "2"
},
{
"input": "2 16",
"output": "16"
},
{
"input": "3 5",
"output": "7"
},
{
"input": "3 6",
"output": "9"
},
{
"input": "3 10",
"output": "15"
},
{
"input": "3 14",
"output": "21"
},
{
"input": "3 15",
"output": "22"
},
{
"input": "3 16",
"output": "24"
},
{
"input": "5 7",
"output": "17"
},
{
"input": "16 16",
"output": "128"
},
{
"input": "15 16",
"output": "120"
},
{
"input": "2 3",
"output": "3"
},
{
"input": "15 15",
"output": "112"
},
{
"input": "14 16",
"output": "112"
},
{
"input": "11 13",
"output": "71"
},
{
"input": "5 16",
"output": "40"
},
{
"input": "8 15",
"output": "60"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "3 4",
"output": "6"
},
{
"input": "4 4",
"output": "8"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "14 15",
"output": "105"
}
] | 1,656,041,217
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 35
| 92
| 0
|
n=input().split()
print(int(int(n[0])*int(n[1])/2))
|
Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
Input Specification:
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
Output Specification:
Output one number — the maximal number of dominoes, which can be placed.
Demo Input:
['2 4\n', '3 3\n']
Demo Output:
['4\n', '4\n']
Note:
none
|
```python
n=input().split()
print(int(int(n[0])*int(n[1])/2))
```
| 3.977
|
29
|
A
|
Spit Problem
|
PROGRAMMING
| 1,000
|
[
"brute force"
] |
A. Spit Problem
|
2
|
256
|
In a Berland's zoo there is an enclosure with camels. It is known that camels like to spit. Bob watched these interesting animals for the whole day and registered in his notepad where each animal spitted. Now he wants to know if in the zoo there are two camels, which spitted at each other. Help him to solve this task.
The trajectory of a camel's spit is an arc, i.e. if the camel in position *x* spits *d* meters right, he can hit only the camel in position *x*<=+<=*d*, if such a camel exists.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the amount of camels in the zoo. Each of the following *n* lines contains two integers *x**i* and *d**i* (<=-<=104<=≤<=*x**i*<=≤<=104,<=1<=≤<=|*d**i*|<=≤<=2·104) — records in Bob's notepad. *x**i* is a position of the *i*-th camel, and *d**i* is a distance at which the *i*-th camel spitted. Positive values of *d**i* correspond to the spits right, negative values correspond to the spits left. No two camels may stand in the same position.
|
If there are two camels, which spitted at each other, output YES. Otherwise, output NO.
|
[
"2\n0 1\n1 -1\n",
"3\n0 1\n1 1\n2 -2\n",
"5\n2 -10\n3 10\n0 5\n5 -5\n10 1\n"
] |
[
"YES\n",
"NO\n",
"YES\n"
] |
none
| 500
|
[
{
"input": "2\n0 1\n1 -1",
"output": "YES"
},
{
"input": "3\n0 1\n1 1\n2 -2",
"output": "NO"
},
{
"input": "5\n2 -10\n3 10\n0 5\n5 -5\n10 1",
"output": "YES"
},
{
"input": "10\n-9897 -1144\n-4230 -6350\n2116 -3551\n-3635 4993\n3907 -9071\n-2362 4120\n-6542 984\n5807 3745\n7594 7675\n-5412 -6872",
"output": "NO"
},
{
"input": "11\n-1536 3809\n-2406 -8438\n-1866 395\n5636 -490\n-6867 -7030\n7525 3575\n-6796 2908\n3884 4629\n-2862 -6122\n-8984 6122\n7137 -326",
"output": "YES"
},
{
"input": "12\n-9765 1132\n-1382 -215\n-9405 7284\n-2040 3947\n-9360 3150\n6425 9386\n806 -2278\n-2121 -7284\n5663 -1608\n-8377 9297\n6245 708\n8470 6024",
"output": "YES"
},
{
"input": "15\n8122 -9991\n-4068 -3386\n8971 3731\n3458 5161\n-8700 7562\n2691 8735\n-1510 -3892\n5183 -3753\n-7018 6637\n-7454 3386\n-818 -6377\n6771 -8647\n-7357 -1246\n-6186 1922\n9889 -3627",
"output": "YES"
},
{
"input": "20\n-5264 6424\n-3664 -7459\n-2780 -9859\n-3317 6842\n5681 -8092\n1555 1904\n-6684 1414\n6593 -1253\n-5708 -1202\n335 1733\n-926 7579\n3459 -1904\n-4486 4006\n6201 3616\n2847 -5255\n8438 7057\n8171 6042\n-9102 3545\n7731 -233\n6264 6563",
"output": "YES"
},
{
"input": "30\n-398 -1774\n313 -6974\n2346 -4657\n8552 -9647\n-5265 1538\n8195 4864\n-5641 -5219\n-1394 8563\n-1190 1992\n-4669 -1156\n7574 256\n9206 -2414\n4140 -549\n-294 2169\n7029 -2871\n3808 -9799\n3141 5690\n4648 -2680\n-5990 9800\n-2299 1697\n6077 -7177\n-400 -9724\n-4644 -2392\n-2198 -9531\n-2105 9386\n-8165 -4201\n-1589 -7916\n2518 -7840\n4173 -6949\n-3368 -9943",
"output": "NO"
}
] | 1,611,567,177
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 124
| 307,200
|
def geti(a):
return int(float(a))
n=geti(input())
x=[]
d=[]
tmp=''
for i in range(0,n):
tmp=input().split()
x.append(geti(tmp[0]))
d.append(geti(tmp[1]))
import sys
for i in range(0,n):
for j in range(i+1,n):
if x[i]+d[i]==x[j] and x[j]+d[j]==x[i]:
print('YES')
sys.exit()
break
print('NO')
|
Title: Spit Problem
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
In a Berland's zoo there is an enclosure with camels. It is known that camels like to spit. Bob watched these interesting animals for the whole day and registered in his notepad where each animal spitted. Now he wants to know if in the zoo there are two camels, which spitted at each other. Help him to solve this task.
The trajectory of a camel's spit is an arc, i.e. if the camel in position *x* spits *d* meters right, he can hit only the camel in position *x*<=+<=*d*, if such a camel exists.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100) — the amount of camels in the zoo. Each of the following *n* lines contains two integers *x**i* and *d**i* (<=-<=104<=≤<=*x**i*<=≤<=104,<=1<=≤<=|*d**i*|<=≤<=2·104) — records in Bob's notepad. *x**i* is a position of the *i*-th camel, and *d**i* is a distance at which the *i*-th camel spitted. Positive values of *d**i* correspond to the spits right, negative values correspond to the spits left. No two camels may stand in the same position.
Output Specification:
If there are two camels, which spitted at each other, output YES. Otherwise, output NO.
Demo Input:
['2\n0 1\n1 -1\n', '3\n0 1\n1 1\n2 -2\n', '5\n2 -10\n3 10\n0 5\n5 -5\n10 1\n']
Demo Output:
['YES\n', 'NO\n', 'YES\n']
Note:
none
|
```python
def geti(a):
return int(float(a))
n=geti(input())
x=[]
d=[]
tmp=''
for i in range(0,n):
tmp=input().split()
x.append(geti(tmp[0]))
d.append(geti(tmp[1]))
import sys
for i in range(0,n):
for j in range(i+1,n):
if x[i]+d[i]==x[j] and x[j]+d[j]==x[i]:
print('YES')
sys.exit()
break
print('NO')
```
| 3.968428
|
580
|
A
|
Kefa and First Steps
|
PROGRAMMING
| 900
|
[
"brute force",
"dp",
"implementation"
] | null | null |
Kefa decided to make some money doing business on the Internet for exactly *n* days. He knows that on the *i*-th day (1<=≤<=*i*<=≤<=*n*) he makes *a**i* money. Kefa loves progress, that's why he wants to know the length of the maximum non-decreasing subsegment in sequence *a**i*. Let us remind you that the subsegment of the sequence is its continuous fragment. A subsegment of numbers is called non-decreasing if all numbers in it follow in the non-decreasing order.
Help Kefa cope with this task!
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (1<=≤<=*a**i*<=≤<=109).
|
Print a single integer — the length of the maximum non-decreasing subsegment of sequence *a*.
|
[
"6\n2 2 1 3 4 1\n",
"3\n2 2 9\n"
] |
[
"3",
"3"
] |
In the first test the maximum non-decreasing subsegment is the numbers from the third to the fifth one.
In the second test the maximum non-decreasing subsegment is the numbers from the first to the third one.
| 750
|
[
{
"input": "6\n2 2 1 3 4 1",
"output": "3"
},
{
"input": "3\n2 2 9",
"output": "3"
},
{
"input": "5\n10 100 111 1 2",
"output": "3"
},
{
"input": "10\n1 2 3 4 1 2 3 4 5 6",
"output": "6"
},
{
"input": "50\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "50"
},
{
"input": "100\n1 838 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 605 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 27 533 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 835 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 992",
"output": "42"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n1 1",
"output": "2"
},
{
"input": "6\n5 4 3 2 1 2",
"output": "2"
},
{
"input": "9\n1 2 3 4 5 6 7 8 9",
"output": "9"
},
{
"input": "7\n99 100 1 2 3 4 5",
"output": "5"
},
{
"input": "5\n3 3 1 2 3",
"output": "3"
},
{
"input": "1\n100",
"output": "1"
},
{
"input": "1\n5",
"output": "1"
}
] | 1,689,535,175
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 28
| 77
| 13,516,800
|
n=int(input())
a1=list(map(int,input().split()))
k=1
c=1
for i in range(1,n):
if a1[i]>=a1[i-1]:
k+=1
else:
c=max(k,c)
k=1
c=max(k,c)
print(c)
|
Title: Kefa and First Steps
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kefa decided to make some money doing business on the Internet for exactly *n* days. He knows that on the *i*-th day (1<=≤<=*i*<=≤<=*n*) he makes *a**i* money. Kefa loves progress, that's why he wants to know the length of the maximum non-decreasing subsegment in sequence *a**i*. Let us remind you that the subsegment of the sequence is its continuous fragment. A subsegment of numbers is called non-decreasing if all numbers in it follow in the non-decreasing order.
Help Kefa cope with this task!
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print a single integer — the length of the maximum non-decreasing subsegment of sequence *a*.
Demo Input:
['6\n2 2 1 3 4 1\n', '3\n2 2 9\n']
Demo Output:
['3', '3']
Note:
In the first test the maximum non-decreasing subsegment is the numbers from the third to the fifth one.
In the second test the maximum non-decreasing subsegment is the numbers from the first to the third one.
|
```python
n=int(input())
a1=list(map(int,input().split()))
k=1
c=1
for i in range(1,n):
if a1[i]>=a1[i-1]:
k+=1
else:
c=max(k,c)
k=1
c=max(k,c)
print(c)
```
| 3
|
|
281
|
A
|
Word Capitalization
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] | null | null |
Capitalization is writing a word with its first letter as a capital letter. Your task is to capitalize the given word.
Note, that during capitalization all the letters except the first one remains unchanged.
|
A single line contains a non-empty word. This word consists of lowercase and uppercase English letters. The length of the word will not exceed 103.
|
Output the given word after capitalization.
|
[
"ApPLe\n",
"konjac\n"
] |
[
"ApPLe\n",
"Konjac\n"
] |
none
| 500
|
[
{
"input": "ApPLe",
"output": "ApPLe"
},
{
"input": "konjac",
"output": "Konjac"
},
{
"input": "a",
"output": "A"
},
{
"input": "A",
"output": "A"
},
{
"input": "z",
"output": "Z"
},
{
"input": "ABACABA",
"output": "ABACABA"
},
{
"input": "xYaPxPxHxGePfGtQySlNrLxSjDtNnTaRaEpAhPaQpWnDzMqGgRgEwJxGiBdZnMtHxFbObCaGiCeZkUqIgBhHtNvAqAlHpMnQhNeQbMyZrCdElVwHtKrPpJjIaHuIlYwHaRkAkUpPlOhNlBtXwDsKzPyHrPiUwNlXtTaPuMwTqYtJySgFoXvLiHbQwMjSvXsQfKhVlOxGdQkWjBhEyQvBjPoFkThNeRhTuIzFjInJtEfPjOlOsJpJuLgLzFnZmKvFgFrNsOnVqFcNiMfCqTpKnVyLwNqFiTySpWeTdFnWuTwDkRjVxNyQvTrOoEiExYiFaIrLoFmJfZcDkHuWjYfCeEqCvEsZiWnJaEmFbMjDvYwEeJeGcKbVbChGsIzNlExHzHiTlHcSaKxLuZxX",
"output": "XYaPxPxHxGePfGtQySlNrLxSjDtNnTaRaEpAhPaQpWnDzMqGgRgEwJxGiBdZnMtHxFbObCaGiCeZkUqIgBhHtNvAqAlHpMnQhNeQbMyZrCdElVwHtKrPpJjIaHuIlYwHaRkAkUpPlOhNlBtXwDsKzPyHrPiUwNlXtTaPuMwTqYtJySgFoXvLiHbQwMjSvXsQfKhVlOxGdQkWjBhEyQvBjPoFkThNeRhTuIzFjInJtEfPjOlOsJpJuLgLzFnZmKvFgFrNsOnVqFcNiMfCqTpKnVyLwNqFiTySpWeTdFnWuTwDkRjVxNyQvTrOoEiExYiFaIrLoFmJfZcDkHuWjYfCeEqCvEsZiWnJaEmFbMjDvYwEeJeGcKbVbChGsIzNlExHzHiTlHcSaKxLuZxX"
},
{
"input": "rZhIcQlXpNcPgXrOjTiOlMoTgXgIhCfMwZfWoFzGhEkQlOoMjIuShPlZfWkNnMyQfYdUhVgQuSmYoElEtZpDyHtOxXgCpWbZqSbYnPqBcNqRtPgCnJnAyIvNsAhRbNeVlMwZyRyJnFgIsCnSbOdLvUyIeOzQvRpMoMoHfNhHwKvTcHuYnYySfPmAiNwAiWdZnWlLvGfBbRbRrCrBqIgIdWkWiBsNyYkKdNxZdGaToSsDnXpRaGrKxBpQsCzBdQgZzBkGeHgGxNrIyQlSzWsTmSnZwOcHqQpNcQvJlPvKaPiQaMaYsQjUeCqQdCjPgUbDmWiJmNiXgExLqOcCtSwSePnUxIuZfIfBeWbEiVbXnUsPwWyAiXyRbZgKwOqFfCtQuKxEmVeRlAkOeXkO",
"output": "RZhIcQlXpNcPgXrOjTiOlMoTgXgIhCfMwZfWoFzGhEkQlOoMjIuShPlZfWkNnMyQfYdUhVgQuSmYoElEtZpDyHtOxXgCpWbZqSbYnPqBcNqRtPgCnJnAyIvNsAhRbNeVlMwZyRyJnFgIsCnSbOdLvUyIeOzQvRpMoMoHfNhHwKvTcHuYnYySfPmAiNwAiWdZnWlLvGfBbRbRrCrBqIgIdWkWiBsNyYkKdNxZdGaToSsDnXpRaGrKxBpQsCzBdQgZzBkGeHgGxNrIyQlSzWsTmSnZwOcHqQpNcQvJlPvKaPiQaMaYsQjUeCqQdCjPgUbDmWiJmNiXgExLqOcCtSwSePnUxIuZfIfBeWbEiVbXnUsPwWyAiXyRbZgKwOqFfCtQuKxEmVeRlAkOeXkO"
},
{
"input": "hDgZlUmLhYbLkLcNcKeOwJwTePbOvLaRvNzQbSbLsPeHqLhUqWtUbNdQfQqFfXeJqJwWuOrFnDdZiPxIkDyVmHbHvXfIlFqSgAcSyWbOlSlRuPhWdEpEzEeLnXwCtWuVcHaUeRgCiYsIvOaIgDnFuDbRnMoCmPrZfLeFpSjQaTfHgZwZvAzDuSeNwSoWuJvLqKqAuUxFaCxFfRcEjEsJpOfCtDiVrBqNsNwPuGoRgPzRpLpYnNyQxKaNnDnYiJrCrVcHlOxPiPcDbEgKfLwBjLhKcNeMgJhJmOiJvPfOaPaEuGqWvRbErKrIpDkEoQnKwJnTlStLyNsHyOjZfKoIjXwUvRrWpSyYhRpQdLqGmErAiNcGqAqIrTeTiMuPmCrEkHdBrLyCxPtYpRqD",
"output": "HDgZlUmLhYbLkLcNcKeOwJwTePbOvLaRvNzQbSbLsPeHqLhUqWtUbNdQfQqFfXeJqJwWuOrFnDdZiPxIkDyVmHbHvXfIlFqSgAcSyWbOlSlRuPhWdEpEzEeLnXwCtWuVcHaUeRgCiYsIvOaIgDnFuDbRnMoCmPrZfLeFpSjQaTfHgZwZvAzDuSeNwSoWuJvLqKqAuUxFaCxFfRcEjEsJpOfCtDiVrBqNsNwPuGoRgPzRpLpYnNyQxKaNnDnYiJrCrVcHlOxPiPcDbEgKfLwBjLhKcNeMgJhJmOiJvPfOaPaEuGqWvRbErKrIpDkEoQnKwJnTlStLyNsHyOjZfKoIjXwUvRrWpSyYhRpQdLqGmErAiNcGqAqIrTeTiMuPmCrEkHdBrLyCxPtYpRqD"
},
{
"input": "qUdLgGrJeGmIzIeZrCjUtBpYfRvNdXdRpGsThIsEmJjTiMqEwRxBeBaSxEuWrNvExKePjPnXhPzBpWnHiDhTvZhBuIjDnZpTcEkCvRkAcTmMuXhGgErWgFyGyToOyVwYlCuQpTfJkVdWmFyBqQhJjYtXrBbFdHzDlGsFbHmHbFgXgFhIyDhZyEqEiEwNxSeByBwLiVeSnCxIdHbGjOjJrZeVkOzGeMmQrJkVyGhDtCzOlPeAzGrBlWwEnAdUfVaIjNrRyJjCnHkUvFuKuKeKbLzSbEmUcXtVkZzXzKlOrPgQiDmCcCvIyAdBwOeUuLbRmScNcWxIkOkJuIsBxTrIqXhDzLcYdVtPgZdZfAxTmUtByGiTsJkSySjXdJvEwNmSmNoWsChPdAzJrBoW",
"output": "QUdLgGrJeGmIzIeZrCjUtBpYfRvNdXdRpGsThIsEmJjTiMqEwRxBeBaSxEuWrNvExKePjPnXhPzBpWnHiDhTvZhBuIjDnZpTcEkCvRkAcTmMuXhGgErWgFyGyToOyVwYlCuQpTfJkVdWmFyBqQhJjYtXrBbFdHzDlGsFbHmHbFgXgFhIyDhZyEqEiEwNxSeByBwLiVeSnCxIdHbGjOjJrZeVkOzGeMmQrJkVyGhDtCzOlPeAzGrBlWwEnAdUfVaIjNrRyJjCnHkUvFuKuKeKbLzSbEmUcXtVkZzXzKlOrPgQiDmCcCvIyAdBwOeUuLbRmScNcWxIkOkJuIsBxTrIqXhDzLcYdVtPgZdZfAxTmUtByGiTsJkSySjXdJvEwNmSmNoWsChPdAzJrBoW"
},
{
"input": "kHbApGoBcLmIwUlXkVgUmWzYeLoDbGaOkWbIuXoRwMfKuOoMzAoXrBoTvYxGrMbRjDuRxAbGsTnErIiHnHoLeRnTbFiRfDdOkNlWiAcOsChLdLqFqXlDpDoDtPxXqAmSvYgPvOcCpOlWtOjYwFkGkHuCaHwZcFdOfHjBmIxTeSiHkWjXyFcCtOlSuJsZkDxUgPeZkJwMmNpErUlBcGuMlJwKkWnOzFeFiSiPsEvMmQiCsYeHlLuHoMgBjFoZkXlObDkSoQcVyReTmRsFzRhTuIvCeBqVsQdQyTyZjStGrTyDcEcAgTgMiIcVkLbZbGvWeHtXwEqWkXfTcPyHhHjYwIeVxLyVmHmMkUsGiHmNnQuMsXaFyPpVqNrBhOiWmNkBbQuHvQdOjPjKiZcL",
"output": "KHbApGoBcLmIwUlXkVgUmWzYeLoDbGaOkWbIuXoRwMfKuOoMzAoXrBoTvYxGrMbRjDuRxAbGsTnErIiHnHoLeRnTbFiRfDdOkNlWiAcOsChLdLqFqXlDpDoDtPxXqAmSvYgPvOcCpOlWtOjYwFkGkHuCaHwZcFdOfHjBmIxTeSiHkWjXyFcCtOlSuJsZkDxUgPeZkJwMmNpErUlBcGuMlJwKkWnOzFeFiSiPsEvMmQiCsYeHlLuHoMgBjFoZkXlObDkSoQcVyReTmRsFzRhTuIvCeBqVsQdQyTyZjStGrTyDcEcAgTgMiIcVkLbZbGvWeHtXwEqWkXfTcPyHhHjYwIeVxLyVmHmMkUsGiHmNnQuMsXaFyPpVqNrBhOiWmNkBbQuHvQdOjPjKiZcL"
},
{
"input": "aHmRbLgNuWkLxLnWvUbYwTeZeYiOlLhTuOvKfLnVmCiPcMkSgVrYjZiLuRjCiXhAnVzVcTlVeJdBvPdDfFvHkTuIhCdBjEsXbVmGcLrPfNvRdFsZkSdNpYsJeIhIcNqSoLkOjUlYlDmXsOxPbQtIoUxFjGnRtBhFaJvBeEzHsAtVoQbAfYjJqReBiKeUwRqYrUjPjBoHkOkPzDwEwUgTxQxAvKzUpMhKyOhPmEhYhItQwPeKsKaKlUhGuMcTtSwFtXfJsDsFlTtOjVvVfGtBtFlQyIcBaMsPaJlPqUcUvLmReZiFbXxVtRhTzJkLkAjVqTyVuFeKlTyQgUzMsXjOxQnVfTaWmThEnEoIhZeZdStBkKeLpAhJnFoJvQyGwDiStLjEwGfZwBuWsEfC",
"output": "AHmRbLgNuWkLxLnWvUbYwTeZeYiOlLhTuOvKfLnVmCiPcMkSgVrYjZiLuRjCiXhAnVzVcTlVeJdBvPdDfFvHkTuIhCdBjEsXbVmGcLrPfNvRdFsZkSdNpYsJeIhIcNqSoLkOjUlYlDmXsOxPbQtIoUxFjGnRtBhFaJvBeEzHsAtVoQbAfYjJqReBiKeUwRqYrUjPjBoHkOkPzDwEwUgTxQxAvKzUpMhKyOhPmEhYhItQwPeKsKaKlUhGuMcTtSwFtXfJsDsFlTtOjVvVfGtBtFlQyIcBaMsPaJlPqUcUvLmReZiFbXxVtRhTzJkLkAjVqTyVuFeKlTyQgUzMsXjOxQnVfTaWmThEnEoIhZeZdStBkKeLpAhJnFoJvQyGwDiStLjEwGfZwBuWsEfC"
},
{
"input": "sLlZkDiDmEdNaXuUuJwHqYvRtOdGfTiTpEpAoSqAbJaChOiCvHgSwZwEuPkMmXiLcKdXqSsEyViEbZpZsHeZpTuXoGcRmOiQfBfApPjDqSqElWeSeOhUyWjLyNoRuYeGfGwNqUsQoTyVvWeNgNdZfDxGwGfLsDjIdInSqDlMuNvFaHbScZkTlVwNcJpEjMaPaOtFgJjBjOcLlLmDnQrShIrJhOcUmPnZhTxNeClQsZaEaVaReLyQpLwEqJpUwYhLiRzCzKfOoFeTiXzPiNbOsZaZaLgCiNnMkBcFwGgAwPeNyTxJcCtBgXcToKlWaWcBaIvBpNxPeClQlWeQqRyEtAkJdBtSrFdDvAbUlKyLdCuTtXxFvRcKnYnWzVdYqDeCmOqPxUaFjQdTdCtN",
"output": "SLlZkDiDmEdNaXuUuJwHqYvRtOdGfTiTpEpAoSqAbJaChOiCvHgSwZwEuPkMmXiLcKdXqSsEyViEbZpZsHeZpTuXoGcRmOiQfBfApPjDqSqElWeSeOhUyWjLyNoRuYeGfGwNqUsQoTyVvWeNgNdZfDxGwGfLsDjIdInSqDlMuNvFaHbScZkTlVwNcJpEjMaPaOtFgJjBjOcLlLmDnQrShIrJhOcUmPnZhTxNeClQsZaEaVaReLyQpLwEqJpUwYhLiRzCzKfOoFeTiXzPiNbOsZaZaLgCiNnMkBcFwGgAwPeNyTxJcCtBgXcToKlWaWcBaIvBpNxPeClQlWeQqRyEtAkJdBtSrFdDvAbUlKyLdCuTtXxFvRcKnYnWzVdYqDeCmOqPxUaFjQdTdCtN"
},
{
"input": "iRuStKvVhJdJbQwRoIuLiVdTpKaOqKfYlYwAzIpPtUwUtMeKyCaOlXmVrKwWeImYmVuXdLkRlHwFxKqZbZtTzNgOzDbGqTfZnKmUzAcIjDcEmQgYyFbEfWzRpKvCkDmAqDiIiRcLvMxWaJqCgYqXgIcLdNaZlBnXtJyKaMnEaWfXfXwTbDnAiYnWqKbAtDpYdUbZrCzWgRnHzYxFgCdDbOkAgTqBuLqMeStHcDxGnVhSgMzVeTaZoTfLjMxQfRuPcFqVlRyYdHyOdJsDoCeWrUuJyIiAqHwHyVpEeEoMaJwAoUfPtBeJqGhMaHiBjKwAlXoZpUsDhHgMxBkVbLcEvNtJbGnPsUwAvXrAkTlXwYvEnOpNeWyIkRnEnTrIyAcLkRgMyYcKrGiDaAyE",
"output": "IRuStKvVhJdJbQwRoIuLiVdTpKaOqKfYlYwAzIpPtUwUtMeKyCaOlXmVrKwWeImYmVuXdLkRlHwFxKqZbZtTzNgOzDbGqTfZnKmUzAcIjDcEmQgYyFbEfWzRpKvCkDmAqDiIiRcLvMxWaJqCgYqXgIcLdNaZlBnXtJyKaMnEaWfXfXwTbDnAiYnWqKbAtDpYdUbZrCzWgRnHzYxFgCdDbOkAgTqBuLqMeStHcDxGnVhSgMzVeTaZoTfLjMxQfRuPcFqVlRyYdHyOdJsDoCeWrUuJyIiAqHwHyVpEeEoMaJwAoUfPtBeJqGhMaHiBjKwAlXoZpUsDhHgMxBkVbLcEvNtJbGnPsUwAvXrAkTlXwYvEnOpNeWyIkRnEnTrIyAcLkRgMyYcKrGiDaAyE"
},
{
"input": "cRtJkOxHzUbJcDdHzJtLbVmSoWuHoTkVrPqQaVmXeBrHxJbQfNrQbAaMrEhVdQnPxNyCjErKxPoEdWkVrBbDeNmEgBxYiBtWdAfHiLuSwIxJuHpSkAxPoYdNkGoLySsNhUmGoZhDzAfWhJdPlJzQkZbOnMtTkClIoCqOlIcJcMlGjUyOiEmHdYfIcPtTgQhLlLcPqQjAnQnUzHpCaQsCnYgQsBcJrQwBnWsIwFfSfGuYgTzQmShFpKqEeRlRkVfMuZbUsDoFoPrNuNwTtJqFkRiXxPvKyElDzLoUnIwAaBaOiNxMpEvPzSpGpFhMtGhGdJrFnZmNiMcUfMtBnDuUnXqDcMsNyGoLwLeNnLfRsIwRfBtXkHrFcPsLdXaAoYaDzYnZuQeVcZrElWmP",
"output": "CRtJkOxHzUbJcDdHzJtLbVmSoWuHoTkVrPqQaVmXeBrHxJbQfNrQbAaMrEhVdQnPxNyCjErKxPoEdWkVrBbDeNmEgBxYiBtWdAfHiLuSwIxJuHpSkAxPoYdNkGoLySsNhUmGoZhDzAfWhJdPlJzQkZbOnMtTkClIoCqOlIcJcMlGjUyOiEmHdYfIcPtTgQhLlLcPqQjAnQnUzHpCaQsCnYgQsBcJrQwBnWsIwFfSfGuYgTzQmShFpKqEeRlRkVfMuZbUsDoFoPrNuNwTtJqFkRiXxPvKyElDzLoUnIwAaBaOiNxMpEvPzSpGpFhMtGhGdJrFnZmNiMcUfMtBnDuUnXqDcMsNyGoLwLeNnLfRsIwRfBtXkHrFcPsLdXaAoYaDzYnZuQeVcZrElWmP"
},
{
"input": "wVaCsGxZrBbFnTbKsCoYlAvUkIpBaYpYmJkMlPwCaFvUkDxAiJgIqWsFqZlFvTtAnGzEwXbYiBdFfFxRiDoUkLmRfAwOlKeOlKgXdUnVqLkTuXtNdQpBpXtLvZxWoBeNePyHcWmZyRiUkPlRqYiQdGeXwOhHbCqVjDcEvJmBkRwWnMqPjXpUsIyXqGjHsEsDwZiFpIbTkQaUlUeFxMwJzSaHdHnDhLaLdTuYgFuJsEcMmDvXyPjKsSeBaRwNtPuOuBtNeOhQdVgKzPzOdYtPjPfDzQzHoWcYjFbSvRgGdGsCmGnQsErToBkCwGeQaCbBpYkLhHxTbUvRnJpZtXjKrHdRiUmUbSlJyGaLnWsCrJbBnSjFaZrIzIrThCmGhQcMsTtOxCuUcRaEyPaG",
"output": "WVaCsGxZrBbFnTbKsCoYlAvUkIpBaYpYmJkMlPwCaFvUkDxAiJgIqWsFqZlFvTtAnGzEwXbYiBdFfFxRiDoUkLmRfAwOlKeOlKgXdUnVqLkTuXtNdQpBpXtLvZxWoBeNePyHcWmZyRiUkPlRqYiQdGeXwOhHbCqVjDcEvJmBkRwWnMqPjXpUsIyXqGjHsEsDwZiFpIbTkQaUlUeFxMwJzSaHdHnDhLaLdTuYgFuJsEcMmDvXyPjKsSeBaRwNtPuOuBtNeOhQdVgKzPzOdYtPjPfDzQzHoWcYjFbSvRgGdGsCmGnQsErToBkCwGeQaCbBpYkLhHxTbUvRnJpZtXjKrHdRiUmUbSlJyGaLnWsCrJbBnSjFaZrIzIrThCmGhQcMsTtOxCuUcRaEyPaG"
},
{
"input": "kEiLxLmPjGzNoGkJdBlAfXhThYhMsHmZoZbGyCvNiUoLoZdAxUbGyQiEfXvPzZzJrPbEcMpHsMjIkRrVvDvQtHuKmXvGpQtXbPzJpFjJdUgWcPdFxLjLtXgVpEiFhImHnKkGiWnZbJqRjCyEwHsNbYfYfTyBaEuKlCtWnOqHmIgGrFmQiYrBnLiFcGuZxXlMfEuVoCxPkVrQvZoIpEhKsYtXrPxLcSfQqXsWaDgVlOnAzUvAhOhMrJfGtWcOwQfRjPmGhDyAeXrNqBvEiDfCiIvWxPjTwPlXpVsMjVjUnCkXgBuWnZaDyJpWkCfBrWnHxMhJgItHdRqNrQaEeRjAuUwRkUdRhEeGlSqVqGmOjNcUhFfXjCmWzBrGvIuZpRyWkWiLyUwFpYjNmNfV",
"output": "KEiLxLmPjGzNoGkJdBlAfXhThYhMsHmZoZbGyCvNiUoLoZdAxUbGyQiEfXvPzZzJrPbEcMpHsMjIkRrVvDvQtHuKmXvGpQtXbPzJpFjJdUgWcPdFxLjLtXgVpEiFhImHnKkGiWnZbJqRjCyEwHsNbYfYfTyBaEuKlCtWnOqHmIgGrFmQiYrBnLiFcGuZxXlMfEuVoCxPkVrQvZoIpEhKsYtXrPxLcSfQqXsWaDgVlOnAzUvAhOhMrJfGtWcOwQfRjPmGhDyAeXrNqBvEiDfCiIvWxPjTwPlXpVsMjVjUnCkXgBuWnZaDyJpWkCfBrWnHxMhJgItHdRqNrQaEeRjAuUwRkUdRhEeGlSqVqGmOjNcUhFfXjCmWzBrGvIuZpRyWkWiLyUwFpYjNmNfV"
},
{
"input": "eIhDoLmDeReKqXsHcVgFxUqNfScAiQnFrTlCgSuTtXiYvBxKaPaGvUeYfSgHqEaWcHxKpFaSlCxGqAmNeFcIzFcZsBiVoZhUjXaDaIcKoBzYdIlEnKfScRqSkYpPtVsVhXsBwUsUfAqRoCkBxWbHgDiCkRtPvUwVgDjOzObYwNiQwXlGnAqEkHdSqLgUkOdZiWaHqQnOhUnDhIzCiQtVcJlGoRfLuVlFjWqSuMsLgLwOdZvKtWdRuRqDoBoInKqPbJdXpIqLtFlMlDaWgSiKbFpCxOnQeNeQzXeKsBzIjCyPxCmBnYuHzQoYxZgGzSgGtZiTeQmUeWlNzZeKiJbQmEjIiDhPeSyZlNdHpZnIkPdJzSeJpPiXxToKyBjJfPwNzZpWzIzGySqPxLtI",
"output": "EIhDoLmDeReKqXsHcVgFxUqNfScAiQnFrTlCgSuTtXiYvBxKaPaGvUeYfSgHqEaWcHxKpFaSlCxGqAmNeFcIzFcZsBiVoZhUjXaDaIcKoBzYdIlEnKfScRqSkYpPtVsVhXsBwUsUfAqRoCkBxWbHgDiCkRtPvUwVgDjOzObYwNiQwXlGnAqEkHdSqLgUkOdZiWaHqQnOhUnDhIzCiQtVcJlGoRfLuVlFjWqSuMsLgLwOdZvKtWdRuRqDoBoInKqPbJdXpIqLtFlMlDaWgSiKbFpCxOnQeNeQzXeKsBzIjCyPxCmBnYuHzQoYxZgGzSgGtZiTeQmUeWlNzZeKiJbQmEjIiDhPeSyZlNdHpZnIkPdJzSeJpPiXxToKyBjJfPwNzZpWzIzGySqPxLtI"
},
{
"input": "uOoQzIeTwYeKpJtGoUdNiXbPgEwVsZkAnJcArHxIpEnEhZwQhZvAiOuLeMkVqLeDsAyKeYgFxGmRoLaRsZjAeXgNfYhBkHeDrHdPuTuYhKmDlAvYzYxCdYgYfVaYlGeVqTeSfBxQePbQrKsTaIkGzMjFrQlJuYaMxWpQkLdEcDsIiMnHnDtThRvAcKyGwBsHqKdXpJfIeTeZtYjFbMeUoXoXzGrShTwSwBpQlKeDrZdCjRqNtXoTsIzBkWbMsObTtDvYaPhUeLeHqHeMpZmTaCcIqXzAmGnPfNdDaFhOqWqDrWuFiBpRjZrQmAdViOuMbFfRyXyWfHgRkGpPnDrEqQcEmHcKpEvWlBrOtJbUaXbThJaSxCbVoGvTmHvZrHvXpCvLaYbRiHzYuQyX",
"output": "UOoQzIeTwYeKpJtGoUdNiXbPgEwVsZkAnJcArHxIpEnEhZwQhZvAiOuLeMkVqLeDsAyKeYgFxGmRoLaRsZjAeXgNfYhBkHeDrHdPuTuYhKmDlAvYzYxCdYgYfVaYlGeVqTeSfBxQePbQrKsTaIkGzMjFrQlJuYaMxWpQkLdEcDsIiMnHnDtThRvAcKyGwBsHqKdXpJfIeTeZtYjFbMeUoXoXzGrShTwSwBpQlKeDrZdCjRqNtXoTsIzBkWbMsObTtDvYaPhUeLeHqHeMpZmTaCcIqXzAmGnPfNdDaFhOqWqDrWuFiBpRjZrQmAdViOuMbFfRyXyWfHgRkGpPnDrEqQcEmHcKpEvWlBrOtJbUaXbThJaSxCbVoGvTmHvZrHvXpCvLaYbRiHzYuQyX"
},
{
"input": "lZqBqKeGvNdSeYuWxRiVnFtYbKuJwQtUcKnVtQhAlOeUzMaAuTaEnDdPfDcNyHgEoBmYjZyFePeJrRiKyAzFnBfAuGiUyLrIeLrNhBeBdVcEeKgCcBrQzDsPwGcNnZvTsEaYmFfMeOmMdNuZbUtDoQoNcGwDqEkEjIdQaPwAxJbXeNxOgKgXoEbZiIsVkRrNpNyAkLeHkNfEpLuQvEcMbIoGaDzXbEtNsLgGfOkZaFiUsOvEjVeCaMcZqMzKeAdXxJsVeCrZaFpJtZxInQxFaSmGgSsVyGeLlFgFqTpIbAvPkIfJrVcJeBxSdEvPyVwIjHpYrLrKqLnAmCuGmPoZrSbOtGaLaTmBmSuUyAmAsRiMqOtRjJhPhAfXaJnTpLbFqPmJgFcBxImTqIiJ",
"output": "LZqBqKeGvNdSeYuWxRiVnFtYbKuJwQtUcKnVtQhAlOeUzMaAuTaEnDdPfDcNyHgEoBmYjZyFePeJrRiKyAzFnBfAuGiUyLrIeLrNhBeBdVcEeKgCcBrQzDsPwGcNnZvTsEaYmFfMeOmMdNuZbUtDoQoNcGwDqEkEjIdQaPwAxJbXeNxOgKgXoEbZiIsVkRrNpNyAkLeHkNfEpLuQvEcMbIoGaDzXbEtNsLgGfOkZaFiUsOvEjVeCaMcZqMzKeAdXxJsVeCrZaFpJtZxInQxFaSmGgSsVyGeLlFgFqTpIbAvPkIfJrVcJeBxSdEvPyVwIjHpYrLrKqLnAmCuGmPoZrSbOtGaLaTmBmSuUyAmAsRiMqOtRjJhPhAfXaJnTpLbFqPmJgFcBxImTqIiJ"
},
{
"input": "P",
"output": "P"
},
{
"input": "Xyzzy",
"output": "Xyzzy"
},
{
"input": "Zzz",
"output": "Zzz"
},
{
"input": "Zp",
"output": "Zp"
}
] | 1,699,204,525
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 62
| 0
|
q=input()
print(q.title())
|
Title: Word Capitalization
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Capitalization is writing a word with its first letter as a capital letter. Your task is to capitalize the given word.
Note, that during capitalization all the letters except the first one remains unchanged.
Input Specification:
A single line contains a non-empty word. This word consists of lowercase and uppercase English letters. The length of the word will not exceed 103.
Output Specification:
Output the given word after capitalization.
Demo Input:
['ApPLe\n', 'konjac\n']
Demo Output:
['ApPLe\n', 'Konjac\n']
Note:
none
|
```python
q=input()
print(q.title())
```
| 0
|
|
381
|
A
|
Sereja and Dima
|
PROGRAMMING
| 800
|
[
"greedy",
"implementation",
"two pointers"
] | null | null |
Sereja and Dima play a game. The rules of the game are very simple. The players have *n* cards in a row. Each card contains a number, all numbers on the cards are distinct. The players take turns, Sereja moves first. During his turn a player can take one card: either the leftmost card in a row, or the rightmost one. The game ends when there is no more cards. The player who has the maximum sum of numbers on his cards by the end of the game, wins.
Sereja and Dima are being greedy. Each of them chooses the card with the larger number during his move.
Inna is a friend of Sereja and Dima. She knows which strategy the guys are using, so she wants to determine the final score, given the initial state of the game. Help her.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the number of cards on the table. The second line contains space-separated numbers on the cards from left to right. The numbers on the cards are distinct integers from 1 to 1000.
|
On a single line, print two integers. The first number is the number of Sereja's points at the end of the game, the second number is the number of Dima's points at the end of the game.
|
[
"4\n4 1 2 10\n",
"7\n1 2 3 4 5 6 7\n"
] |
[
"12 5\n",
"16 12\n"
] |
In the first sample Sereja will take cards with numbers 10 and 2, so Sereja's sum is 12. Dima will take cards with numbers 4 and 1, so Dima's sum is 5.
| 500
|
[
{
"input": "4\n4 1 2 10",
"output": "12 5"
},
{
"input": "7\n1 2 3 4 5 6 7",
"output": "16 12"
},
{
"input": "42\n15 29 37 22 16 5 26 31 6 32 19 3 45 36 33 14 25 20 48 7 42 11 24 28 9 18 8 21 47 17 38 40 44 4 35 1 43 39 41 27 12 13",
"output": "613 418"
},
{
"input": "43\n32 1 15 48 38 26 25 14 20 44 11 30 3 42 49 19 18 46 5 45 10 23 34 9 29 41 2 52 6 17 35 4 50 22 33 51 7 28 47 13 39 37 24",
"output": "644 500"
},
{
"input": "1\n3",
"output": "3 0"
},
{
"input": "45\n553 40 94 225 415 471 126 190 647 394 515 303 189 159 308 6 139 132 326 78 455 75 85 295 135 613 360 614 351 228 578 259 258 591 444 29 33 463 561 174 368 183 140 168 646",
"output": "6848 6568"
},
{
"input": "44\n849 373 112 307 479 608 856 769 526 82 168 143 573 762 115 501 688 36 214 450 396 496 236 309 287 786 397 43 811 141 745 846 350 270 276 677 420 459 403 722 267 54 394 727",
"output": "9562 9561"
},
{
"input": "35\n10 15 18 1 28 16 2 33 6 22 23 4 9 25 35 8 7 26 3 20 30 14 31 19 27 32 11 5 29 24 21 34 13 17 12",
"output": "315 315"
},
{
"input": "17\n580 376 191 496 73 44 520 357 483 149 81 178 514 300 216 598 304",
"output": "3238 2222"
},
{
"input": "30\n334 443 223 424 168 549 189 303 429 559 516 220 459 134 344 346 316 446 209 148 487 526 69 286 102 366 518 280 392 325",
"output": "5246 4864"
},
{
"input": "95\n122 29 188 265 292 287 183 225 222 187 155 256 64 148 173 278 218 136 290 17 31 130 2 87 57 283 255 280 68 166 174 142 102 39 116 206 288 154 26 78 296 172 184 232 77 91 277 8 249 186 94 93 207 251 257 195 101 299 193 124 293 65 58 35 24 302 220 189 252 125 27 284 247 182 141 103 198 97 234 83 281 216 85 180 267 236 109 143 149 239 79 300 191 244 71",
"output": "8147 7807"
},
{
"input": "1\n1",
"output": "1 0"
}
] | 1,674,904,864
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 34
| 62
| 0
|
import sys, math
inputt = lambda: sys.stdin.readline().strip()
ints = lambda: list(map(int, input().split()))
printn = lambda x: sys.stdout.write(x+'\n')
printnn = lambda x: sys.stdout.write(x)
n=int(input())
a = ints()
b, c = 0, 0
for i in range(n//2):
b+=max(a[0], a[-1])
a.remove(max(a[0], a[-1]))
c+=max(a[0], a[-1])
a.remove(max(a[0], a[-1]))
if a!=[]: b+=a[0]
print(b, c)
|
Title: Sereja and Dima
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sereja and Dima play a game. The rules of the game are very simple. The players have *n* cards in a row. Each card contains a number, all numbers on the cards are distinct. The players take turns, Sereja moves first. During his turn a player can take one card: either the leftmost card in a row, or the rightmost one. The game ends when there is no more cards. The player who has the maximum sum of numbers on his cards by the end of the game, wins.
Sereja and Dima are being greedy. Each of them chooses the card with the larger number during his move.
Inna is a friend of Sereja and Dima. She knows which strategy the guys are using, so she wants to determine the final score, given the initial state of the game. Help her.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=1000) — the number of cards on the table. The second line contains space-separated numbers on the cards from left to right. The numbers on the cards are distinct integers from 1 to 1000.
Output Specification:
On a single line, print two integers. The first number is the number of Sereja's points at the end of the game, the second number is the number of Dima's points at the end of the game.
Demo Input:
['4\n4 1 2 10\n', '7\n1 2 3 4 5 6 7\n']
Demo Output:
['12 5\n', '16 12\n']
Note:
In the first sample Sereja will take cards with numbers 10 and 2, so Sereja's sum is 12. Dima will take cards with numbers 4 and 1, so Dima's sum is 5.
|
```python
import sys, math
inputt = lambda: sys.stdin.readline().strip()
ints = lambda: list(map(int, input().split()))
printn = lambda x: sys.stdout.write(x+'\n')
printnn = lambda x: sys.stdout.write(x)
n=int(input())
a = ints()
b, c = 0, 0
for i in range(n//2):
b+=max(a[0], a[-1])
a.remove(max(a[0], a[-1]))
c+=max(a[0], a[-1])
a.remove(max(a[0], a[-1]))
if a!=[]: b+=a[0]
print(b, c)
```
| 3
|
|
632
|
C
|
The Smallest String Concatenation
|
PROGRAMMING
| 1,700
|
[
"sortings",
"strings"
] | null | null |
You're given a list of *n* strings *a*1,<=*a*2,<=...,<=*a**n*. You'd like to concatenate them together in some order such that the resulting string would be lexicographically smallest.
Given the list of strings, output the lexicographically smallest concatenation.
|
The first line contains integer *n* — the number of strings (1<=≤<=*n*<=≤<=5·104).
Each of the next *n* lines contains one string *a**i* (1<=≤<=|*a**i*|<=≤<=50) consisting of only lowercase English letters. The sum of string lengths will not exceed 5·104.
|
Print the only string *a* — the lexicographically smallest string concatenation.
|
[
"4\nabba\nabacaba\nbcd\ner\n",
"5\nx\nxx\nxxa\nxxaa\nxxaaa\n",
"3\nc\ncb\ncba\n"
] |
[
"abacabaabbabcder\n",
"xxaaaxxaaxxaxxx\n",
"cbacbc\n"
] |
none
| 0
|
[
{
"input": "4\nabba\nabacaba\nbcd\ner",
"output": "abacabaabbabcder"
},
{
"input": "5\nx\nxx\nxxa\nxxaa\nxxaaa",
"output": "xxaaaxxaaxxaxxx"
},
{
"input": "3\nc\ncb\ncba",
"output": "cbacbc"
},
{
"input": "10\naba\nabaaca\naba\nacaaaabbac\nabaacac\nb\ncabbcccaab\nbaacbb\nbcab\ncc",
"output": "abaabaabaacaabaacacacaaaabbacbaacbbbbcabcabbcccaabcc"
},
{
"input": "13\nclgknjjojyuvdtv\nclgknjjojyuvdtvzxz\nclgknjjojyuvdtvzxzxradqhm\ngvzpnckalbaubfviyhijosiixvxaydxagvymq\nclgknjjojyuvdtvjgcwarwvgilcctdiytmvmvfxxkezymt\nbvwzpuut\nclgknjjojyuvdtvjgcwarwvgilcctdiytmvmvfxxkezymth\nclgknjjojyuvdtvjgcwarwvgilcctdiytmvmvfxxkezymtlkdl\nrbwvaayhhunlvmwexvkmqbquypsnjbdkkeytthekttywypud\nqlvkfkshkxyrfefigtngifxsuhpjgkb\nlhxtkfjrrwcvzuamizotupjqckaq\nenngvhxvpaoiyhctddyscasyqtilvbvgfphayykjeoylcvmjz\nxkazwk",
"output": "bvwzpuutclgknjjojyuvdtvclgknjjojyuvdtvjgcwarwvgilcctdiytmvmvfxxkezymtclgknjjojyuvdtvjgcwarwvgilcctdiytmvmvfxxkezymthclgknjjojyuvdtvjgcwarwvgilcctdiytmvmvfxxkezymtlkdlclgknjjojyuvdtvzxzclgknjjojyuvdtvzxzxradqhmenngvhxvpaoiyhctddyscasyqtilvbvgfphayykjeoylcvmjzgvzpnckalbaubfviyhijosiixvxaydxagvymqlhxtkfjrrwcvzuamizotupjqckaqqlvkfkshkxyrfefigtngifxsuhpjgkbrbwvaayhhunlvmwexvkmqbquypsnjbdkkeytthekttywypudxkazwk"
}
] | 1,630,511,512
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 7
| 3,000
| 7,577,600
|
n = int(input())
a = []
for i in range(n):
a.append(input())
for i in range(0,n):
for j in range(i+1,n):
if(a[i]+a[j]>a[j]+a[i]):
s=a[i]
a[i]=a[j]
a[j]=s
print("".join(a))
|
Title: The Smallest String Concatenation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You're given a list of *n* strings *a*1,<=*a*2,<=...,<=*a**n*. You'd like to concatenate them together in some order such that the resulting string would be lexicographically smallest.
Given the list of strings, output the lexicographically smallest concatenation.
Input Specification:
The first line contains integer *n* — the number of strings (1<=≤<=*n*<=≤<=5·104).
Each of the next *n* lines contains one string *a**i* (1<=≤<=|*a**i*|<=≤<=50) consisting of only lowercase English letters. The sum of string lengths will not exceed 5·104.
Output Specification:
Print the only string *a* — the lexicographically smallest string concatenation.
Demo Input:
['4\nabba\nabacaba\nbcd\ner\n', '5\nx\nxx\nxxa\nxxaa\nxxaaa\n', '3\nc\ncb\ncba\n']
Demo Output:
['abacabaabbabcder\n', 'xxaaaxxaaxxaxxx\n', 'cbacbc\n']
Note:
none
|
```python
n = int(input())
a = []
for i in range(n):
a.append(input())
for i in range(0,n):
for j in range(i+1,n):
if(a[i]+a[j]>a[j]+a[i]):
s=a[i]
a[i]=a[j]
a[j]=s
print("".join(a))
```
| 0
|
|
740
|
B
|
Alyona and flowers
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms"
] | null | null |
Little Alyona is celebrating Happy Birthday! Her mother has an array of *n* flowers. Each flower has some mood, the mood of *i*-th flower is *a**i*. The mood can be positive, zero or negative.
Let's define a subarray as a segment of consecutive flowers. The mother suggested some set of subarrays. Alyona wants to choose several of the subarrays suggested by her mother. After that, each of the flowers will add to the girl's happiness its mood multiplied by the number of chosen subarrays the flower is in.
For example, consider the case when the mother has 5 flowers, and their moods are equal to 1,<=<=-<=2,<=1,<=3,<=<=-<=4. Suppose the mother suggested subarrays (1,<=<=-<=2), (3,<=<=-<=4), (1,<=3), (1,<=<=-<=2,<=1,<=3). Then if the girl chooses the third and the fourth subarrays then:
- the first flower adds 1·1<==<=1 to the girl's happiness, because he is in one of chosen subarrays, - the second flower adds (<=-<=2)·1<==<=<=-<=2, because he is in one of chosen subarrays, - the third flower adds 1·2<==<=2, because he is in two of chosen subarrays, - the fourth flower adds 3·2<==<=6, because he is in two of chosen subarrays, - the fifth flower adds (<=-<=4)·0<==<=0, because he is in no chosen subarrays.
Thus, in total 1<=+<=(<=-<=2)<=+<=2<=+<=6<=+<=0<==<=7 is added to the girl's happiness. Alyona wants to choose such subarrays from those suggested by the mother that the value added to her happiness would be as large as possible. Help her do this!
Alyona can choose any number of the subarrays, even 0 or all suggested by her mother.
|
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of flowers and the number of subarrays suggested by the mother.
The second line contains the flowers moods — *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=100<=≤<=*a**i*<=≤<=100).
The next *m* lines contain the description of the subarrays suggested by the mother. The *i*-th of these lines contain two integers *l**i* and *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) denoting the subarray *a*[*l**i*],<=*a*[*l**i*<=+<=1],<=...,<=*a*[*r**i*].
Each subarray can encounter more than once.
|
Print single integer — the maximum possible value added to the Alyona's happiness.
|
[
"5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4\n",
"4 3\n1 2 3 4\n1 3\n2 4\n1 1\n",
"2 2\n-1 -2\n1 1\n1 2\n"
] |
[
"7\n",
"16\n",
"0\n"
] |
The first example is the situation described in the statements.
In the second example Alyona should choose all subarrays.
The third example has answer 0 because Alyona can choose none of the subarrays.
| 1,000
|
[
{
"input": "5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4",
"output": "7"
},
{
"input": "4 3\n1 2 3 4\n1 3\n2 4\n1 1",
"output": "16"
},
{
"input": "2 2\n-1 -2\n1 1\n1 2",
"output": "0"
},
{
"input": "5 6\n1 1 1 -1 0\n2 4\n1 3\n4 5\n1 5\n1 4\n4 5",
"output": "8"
},
{
"input": "8 3\n5 -4 -2 5 3 -4 -2 6\n3 8\n4 6\n2 3",
"output": "10"
},
{
"input": "10 10\n0 0 0 0 0 0 0 0 0 0\n5 9\n1 9\n5 7\n3 8\n1 6\n1 9\n1 6\n6 9\n1 10\n3 8",
"output": "0"
},
{
"input": "3 6\n0 0 0\n1 1\n1 1\n1 3\n3 3\n2 3\n1 2",
"output": "0"
},
{
"input": "3 3\n1 -1 3\n1 2\n2 3\n1 3",
"output": "5"
},
{
"input": "6 8\n0 6 -5 8 -3 -2\n6 6\n2 3\n5 6\n4 6\n3 4\n2 5\n3 3\n5 6",
"output": "13"
},
{
"input": "10 4\n6 5 5 -1 0 5 0 -3 5 -4\n3 6\n4 9\n1 6\n1 4",
"output": "50"
},
{
"input": "9 1\n-1 -1 -1 -1 2 -1 2 0 0\n2 5",
"output": "0"
},
{
"input": "3 8\n3 4 4\n1 2\n1 3\n2 3\n1 2\n2 2\n1 1\n2 3\n1 3",
"output": "59"
},
{
"input": "3 8\n6 7 -1\n1 1\n1 3\n2 2\n1 3\n1 3\n1 1\n2 3\n2 3",
"output": "67"
},
{
"input": "53 7\n-43 57 92 97 85 -29 28 -8 -37 -47 51 -53 -95 -50 -39 -87 43 36 60 -95 93 8 67 -22 -78 -46 99 93 27 -72 -84 77 96 -47 1 -12 21 -98 -34 -88 57 -43 5 -15 20 -66 61 -29 30 -85 52 53 82\n15 26\n34 43\n37 41\n22 34\n19 43\n2 15\n13 35",
"output": "170"
},
{
"input": "20 42\n61 86 5 -87 -33 51 -79 17 -3 65 -42 74 -94 40 -35 22 58 81 -75 5\n3 6\n12 13\n3 16\n3 16\n5 7\n5 16\n2 15\n6 18\n4 18\n10 17\n14 16\n4 15\n4 11\n13 20\n5 6\n5 15\n16 17\n3 14\n9 10\n5 19\n5 14\n2 4\n17 20\n10 11\n5 18\n10 11\n1 14\n1 6\n1 10\n8 16\n11 14\n12 20\n11 13\n4 5\n2 13\n1 5\n11 15\n1 18\n3 8\n8 20\n1 4\n10 13",
"output": "1502"
},
{
"input": "64 19\n-47 13 19 51 -25 72 38 32 54 7 -49 -50 -59 73 45 -87 -15 -72 -32 -10 -7 47 -34 35 48 -73 79 25 -80 -34 4 77 60 30 61 -25 23 17 -73 -73 69 29 -50 -55 53 15 -33 7 -46 -5 85 -86 77 -51 87 -69 -64 -24 -64 29 -20 -58 11 -26\n6 53\n13 28\n15 47\n20 52\n12 22\n6 49\n31 54\n2 39\n32 49\n27 64\n22 63\n33 48\n49 58\n39 47\n6 29\n21 44\n24 59\n20 24\n39 54",
"output": "804"
},
{
"input": "1 10\n-46\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1",
"output": "0"
},
{
"input": "10 7\n44 18 9 -22 -23 7 -25 -2 15 35\n6 8\n6 7\n3 3\n2 6\n9 10\n2 2\n1 5",
"output": "103"
},
{
"input": "4 3\n10 -2 68 35\n4 4\n1 1\n1 3",
"output": "121"
},
{
"input": "3 6\n27 -31 -81\n2 3\n2 3\n1 1\n1 2\n1 2\n2 2",
"output": "27"
},
{
"input": "7 3\n-24 -12 16 -43 -30 31 16\n3 6\n3 4\n1 7",
"output": "0"
},
{
"input": "10 7\n-33 -24 -86 -20 5 -91 38 -12 -90 -67\n7 8\n7 10\n4 7\n1 3\n6 10\n6 6\n3 5",
"output": "26"
},
{
"input": "4 4\n95 35 96 -27\n3 4\n3 3\n4 4\n3 3",
"output": "261"
},
{
"input": "7 7\n-33 26 -25 44 -20 -50 33\n4 6\n4 4\n3 7\n5 7\n1 4\n2 5\n4 6",
"output": "81"
},
{
"input": "5 3\n-35 -39 93 59 -4\n2 2\n2 3\n2 5",
"output": "163"
},
{
"input": "3 7\n0 0 0\n1 2\n1 2\n2 3\n3 3\n1 3\n1 2\n2 3",
"output": "0"
},
{
"input": "8 2\n17 32 30 -6 -39 -15 33 74\n6 6\n8 8",
"output": "74"
},
{
"input": "8 1\n-20 -15 21 -21 1 -12 -7 9\n4 7",
"output": "0"
},
{
"input": "7 9\n-23 -4 -44 -47 -35 47 25\n1 6\n3 5\n4 7\n6 7\n2 4\n2 3\n2 7\n1 2\n5 5",
"output": "72"
},
{
"input": "8 8\n0 6 -25 -15 29 -24 31 23\n2 8\n5 5\n3 3\n2 8\n6 6\n3 6\n3 4\n2 4",
"output": "79"
},
{
"input": "4 3\n-39 -63 9 -16\n1 4\n1 3\n2 4",
"output": "0"
},
{
"input": "9 1\n-3 -13 -13 -19 -4 -11 8 -11 -3\n9 9",
"output": "0"
},
{
"input": "9 6\n25 18 -62 0 33 62 -23 4 -15\n7 9\n2 3\n1 4\n2 6\n1 6\n2 3",
"output": "127"
},
{
"input": "4 5\n-12 39 8 -12\n1 4\n3 4\n1 3\n1 3\n2 3",
"output": "140"
},
{
"input": "3 9\n-9 7 3\n1 2\n1 1\n1 3\n1 2\n2 3\n1 3\n2 2\n1 2\n3 3",
"output": "22"
},
{
"input": "10 7\n0 4 3 3 -2 -2 -4 -2 -3 -2\n5 6\n1 10\n2 10\n7 10\n1 1\n6 7\n3 4",
"output": "6"
},
{
"input": "86 30\n16 -12 11 16 8 14 7 -29 18 30 -32 -10 20 29 -14 -21 23 -19 -15 17 -2 25 -22 2 26 15 -7 -12 -4 -28 21 -4 -2 22 28 -32 9 -20 23 38 -21 21 37 -13 -30 25 31 6 18 29 29 29 27 38 -15 -32 32 -7 -8 -33 -11 24 23 -19 -36 -36 -18 9 -1 32 -34 -26 1 -1 -16 -14 17 -17 15 -24 38 5 -27 -12 8 -38\n60 66\n29 48\n32 51\n38 77\n17 79\n23 74\n39 50\n14 29\n26 76\n9 76\n2 67\n23 48\n17 68\n33 75\n59 78\n46 78\n9 69\n16 83\n18 21\n17 34\n24 61\n15 79\n4 31\n62 63\n46 76\n79 82\n25 39\n5 81\n19 77\n26 71",
"output": "3076"
},
{
"input": "33 17\n11 6 -19 14 23 -23 21 15 29 19 13 -18 -19 20 16 -10 26 -22 3 17 13 -10 19 22 -5 21 12 6 28 -13 -27 25 6\n4 17\n12 16\n9 17\n25 30\n31 32\n4 28\n11 24\n16 19\n3 27\n7 17\n1 16\n15 28\n30 33\n9 31\n14 30\n13 23\n27 27",
"output": "1366"
},
{
"input": "16 44\n32 23 -27 -2 -10 -42 32 -14 -13 4 9 -2 19 35 16 22\n6 12\n8 11\n13 15\n12 12\n3 10\n9 13\n7 15\n2 11\n1 13\n5 6\n9 14\n3 16\n10 13\n3 15\n6 10\n14 16\n4 5\n7 10\n5 14\n1 16\n2 5\n1 6\n9 10\n4 7\n4 12\n2 5\n7 10\n7 9\n2 8\n9 10\n4 10\n7 12\n10 11\n6 6\n15 15\n8 12\n9 10\n3 3\n4 15\n10 12\n7 16\n4 14\n14 16\n5 6",
"output": "777"
},
{
"input": "63 24\n-23 -46 0 33 24 13 39 -6 -4 49 19 -18 -11 -38 0 -3 -33 -17 -4 -44 -22 -12 -16 42 16 -10 7 37 -6 16 -41 -18 -20 51 -49 28 -14 -22 -37 -7 -50 31 -41 -47 18 -8 -39 -29 35 -32 14 -29 44 -29 -19 -25 -47 -8 16 11 20 12 38\n21 61\n35 61\n29 61\n21 34\n12 48\n32 33\n9 27\n4 42\n4 60\n37 61\n19 44\n46 60\n51 53\n31 34\n23 32\n5 29\n43 59\n7 31\n29 48\n15 50\n19 51\n7 28\n17 41\n1 62",
"output": "82"
},
{
"input": "6 51\n45 -33 -17 -48 2 2\n2 5\n1 1\n1 3\n5 5\n4 6\n1 2\n2 3\n3 4\n1 6\n4 6\n3 5\n1 5\n2 2\n2 6\n4 6\n1 5\n1 5\n1 5\n1 6\n6 6\n3 5\n6 6\n1 6\n3 4\n3 3\n2 4\n3 3\n1 4\n2 4\n5 6\n4 5\n2 4\n1 5\n1 2\n4 5\n1 5\n5 6\n2 2\n3 4\n1 3\n1 2\n2 5\n3 6\n4 6\n3 4\n2 4\n1 4\n1 1\n4 6\n3 5\n1 4",
"output": "140"
},
{
"input": "3 5\n2 -1 3\n2 3\n2 3\n2 3\n2 3\n1 2",
"output": "9"
},
{
"input": "4 30\n1 1 1 1\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4",
"output": "120"
}
] | 1,647,186,268
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 1
| 77
| 0
|
def heyBoy(tempArr,l,r,arr):
freqArr=tempArr[::]
if(r+1<len(arr)):
freqArr[r+1]-=1
arr[l]+=1
numbers=0
happ=0
for i in range(len(arr)):
numbers+=freqArr[i]
happ+=freqArr[i]*numbers
return happ,freqArr
n,q=map(int,input().split())
arr=list(map(int,input().split()))
freqArr=[0]*len(arr)
maxHappy=0
for i in range(q):
l,r=map(int,input().split())
happy,freqTempArr=heyBoy(freqArr,l-1,r-1,arr)
# print(happy)
if(happy>maxHappy):
maxHappy=happy
freqArr=freqTempArr
print(maxHappy)
|
Title: Alyona and flowers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Alyona is celebrating Happy Birthday! Her mother has an array of *n* flowers. Each flower has some mood, the mood of *i*-th flower is *a**i*. The mood can be positive, zero or negative.
Let's define a subarray as a segment of consecutive flowers. The mother suggested some set of subarrays. Alyona wants to choose several of the subarrays suggested by her mother. After that, each of the flowers will add to the girl's happiness its mood multiplied by the number of chosen subarrays the flower is in.
For example, consider the case when the mother has 5 flowers, and their moods are equal to 1,<=<=-<=2,<=1,<=3,<=<=-<=4. Suppose the mother suggested subarrays (1,<=<=-<=2), (3,<=<=-<=4), (1,<=3), (1,<=<=-<=2,<=1,<=3). Then if the girl chooses the third and the fourth subarrays then:
- the first flower adds 1·1<==<=1 to the girl's happiness, because he is in one of chosen subarrays, - the second flower adds (<=-<=2)·1<==<=<=-<=2, because he is in one of chosen subarrays, - the third flower adds 1·2<==<=2, because he is in two of chosen subarrays, - the fourth flower adds 3·2<==<=6, because he is in two of chosen subarrays, - the fifth flower adds (<=-<=4)·0<==<=0, because he is in no chosen subarrays.
Thus, in total 1<=+<=(<=-<=2)<=+<=2<=+<=6<=+<=0<==<=7 is added to the girl's happiness. Alyona wants to choose such subarrays from those suggested by the mother that the value added to her happiness would be as large as possible. Help her do this!
Alyona can choose any number of the subarrays, even 0 or all suggested by her mother.
Input Specification:
The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of flowers and the number of subarrays suggested by the mother.
The second line contains the flowers moods — *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=100<=≤<=*a**i*<=≤<=100).
The next *m* lines contain the description of the subarrays suggested by the mother. The *i*-th of these lines contain two integers *l**i* and *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) denoting the subarray *a*[*l**i*],<=*a*[*l**i*<=+<=1],<=...,<=*a*[*r**i*].
Each subarray can encounter more than once.
Output Specification:
Print single integer — the maximum possible value added to the Alyona's happiness.
Demo Input:
['5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4\n', '4 3\n1 2 3 4\n1 3\n2 4\n1 1\n', '2 2\n-1 -2\n1 1\n1 2\n']
Demo Output:
['7\n', '16\n', '0\n']
Note:
The first example is the situation described in the statements.
In the second example Alyona should choose all subarrays.
The third example has answer 0 because Alyona can choose none of the subarrays.
|
```python
def heyBoy(tempArr,l,r,arr):
freqArr=tempArr[::]
if(r+1<len(arr)):
freqArr[r+1]-=1
arr[l]+=1
numbers=0
happ=0
for i in range(len(arr)):
numbers+=freqArr[i]
happ+=freqArr[i]*numbers
return happ,freqArr
n,q=map(int,input().split())
arr=list(map(int,input().split()))
freqArr=[0]*len(arr)
maxHappy=0
for i in range(q):
l,r=map(int,input().split())
happy,freqTempArr=heyBoy(freqArr,l-1,r-1,arr)
# print(happy)
if(happy>maxHappy):
maxHappy=happy
freqArr=freqTempArr
print(maxHappy)
```
| 0
|
Subsets and Splits
Successful Python Submissions
Retrieves all records from the train dataset where the verdict is 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Retrieves records of users with a rating of 1600 or higher and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a rating above 2000 and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a 'OK' verdict, providing a basic overview of a specific category within the dataset.