contestId
int64 0
1.01k
| index
stringclasses 57
values | name
stringlengths 2
58
| type
stringclasses 2
values | rating
int64 0
3.5k
| tags
listlengths 0
11
| title
stringclasses 522
values | time-limit
stringclasses 8
values | memory-limit
stringclasses 8
values | problem-description
stringlengths 0
7.15k
| input-specification
stringlengths 0
2.05k
| output-specification
stringlengths 0
1.5k
| demo-input
listlengths 0
7
| demo-output
listlengths 0
7
| note
stringlengths 0
5.24k
| points
float64 0
425k
| test_cases
listlengths 0
402
| creationTimeSeconds
int64 1.37B
1.7B
| relativeTimeSeconds
int64 8
2.15B
| programmingLanguage
stringclasses 3
values | verdict
stringclasses 14
values | testset
stringclasses 12
values | passedTestCount
int64 0
1k
| timeConsumedMillis
int64 0
15k
| memoryConsumedBytes
int64 0
805M
| code
stringlengths 3
65.5k
| prompt
stringlengths 262
8.2k
| response
stringlengths 17
65.5k
| score
float64 -1
3.99
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
50
|
A
|
Domino piling
|
PROGRAMMING
| 800
|
[
"greedy",
"math"
] |
A. Domino piling
|
2
|
256
|
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
|
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
|
Output one number — the maximal number of dominoes, which can be placed.
|
[
"2 4\n",
"3 3\n"
] |
[
"4\n",
"4\n"
] |
none
| 500
|
[
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "2 6",
"output": "6"
},
{
"input": "2 7",
"output": "7"
},
{
"input": "2 14",
"output": "14"
},
{
"input": "2 15",
"output": "15"
},
{
"input": "1 4",
"output": "2"
},
{
"input": "2 16",
"output": "16"
},
{
"input": "3 5",
"output": "7"
},
{
"input": "3 6",
"output": "9"
},
{
"input": "3 10",
"output": "15"
},
{
"input": "3 14",
"output": "21"
},
{
"input": "3 15",
"output": "22"
},
{
"input": "3 16",
"output": "24"
},
{
"input": "5 7",
"output": "17"
},
{
"input": "16 16",
"output": "128"
},
{
"input": "15 16",
"output": "120"
},
{
"input": "2 3",
"output": "3"
},
{
"input": "15 15",
"output": "112"
},
{
"input": "14 16",
"output": "112"
},
{
"input": "11 13",
"output": "71"
},
{
"input": "5 16",
"output": "40"
},
{
"input": "8 15",
"output": "60"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "3 4",
"output": "6"
},
{
"input": "4 4",
"output": "8"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "14 15",
"output": "105"
}
] | 1,661,158,630
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 62
| 0
|
M,N=int(input())
print(N)
|
Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
Input Specification:
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
Output Specification:
Output one number — the maximal number of dominoes, which can be placed.
Demo Input:
['2 4\n', '3 3\n']
Demo Output:
['4\n', '4\n']
Note:
none
|
```python
M,N=int(input())
print(N)
```
| -1
|
867
|
A
|
Between the Offices
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Francisco than in the other direction, because it's warmer in San Francisco. You are so busy that you don't remember the number of flights you have made in either direction. However, for each of the last *n* days you know whether you were in San Francisco office or in Seattle office. You always fly at nights, so you never were at both offices on the same day. Given this information, determine if you flew more times from Seattle to San Francisco during the last *n* days, or not.
|
The first line of input contains single integer *n* (2<=≤<=*n*<=≤<=100) — the number of days.
The second line contains a string of length *n* consisting of only capital 'S' and 'F' letters. If the *i*-th letter is 'S', then you were in Seattle office on that day. Otherwise you were in San Francisco. The days are given in chronological order, i.e. today is the last day in this sequence.
|
Print "YES" if you flew more times from Seattle to San Francisco, and "NO" otherwise.
You can print each letter in any case (upper or lower).
|
[
"4\nFSSF\n",
"2\nSF\n",
"10\nFFFFFFFFFF\n",
"10\nSSFFSFFSFF\n"
] |
[
"NO\n",
"YES\n",
"NO\n",
"YES\n"
] |
In the first example you were initially at San Francisco, then flew to Seattle, were there for two days and returned to San Francisco. You made one flight in each direction, so the answer is "NO".
In the second example you just flew from Seattle to San Francisco, so the answer is "YES".
In the third example you stayed the whole period in San Francisco, so the answer is "NO".
In the fourth example if you replace 'S' with ones, and 'F' with zeros, you'll get the first few digits of π in binary representation. Not very useful information though.
| 500
|
[
{
"input": "4\nFSSF",
"output": "NO"
},
{
"input": "2\nSF",
"output": "YES"
},
{
"input": "10\nFFFFFFFFFF",
"output": "NO"
},
{
"input": "10\nSSFFSFFSFF",
"output": "YES"
},
{
"input": "20\nSFSFFFFSSFFFFSSSSFSS",
"output": "NO"
},
{
"input": "20\nSSFFFFFSFFFFFFFFFFFF",
"output": "YES"
},
{
"input": "20\nSSFSFSFSFSFSFSFSSFSF",
"output": "YES"
},
{
"input": "20\nSSSSFSFSSFSFSSSSSSFS",
"output": "NO"
},
{
"input": "100\nFFFSFSFSFSSFSFFSSFFFFFSSSSFSSFFFFSFFFFFSFFFSSFSSSFFFFSSFFSSFSFFSSFSSSFSFFSFSFFSFSFFSSFFSFSSSSFSFSFSS",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFFFFFFFFFFFFFFFSFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFSFFFFFFFFFFFFFFFFFSS",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFFSFFFFFFFFFSFSSFFFFFFFFFFFFFFFFFFFFFFSFFSFFFFFSFFFFFFFFSFFFFFFFFFFFFFSFFFFFFFFSFFFFFFFSF",
"output": "NO"
},
{
"input": "100\nSFFSSFFFFFFSSFFFSSFSFFFFFSSFFFSFFFFFFSFSSSFSFSFFFFSFSSFFFFFFFFSFFFFFSFFFFFSSFFFSFFSFSFFFFSFFSFFFFFFF",
"output": "YES"
},
{
"input": "100\nFFFFSSSSSFFSSSFFFSFFFFFSFSSFSFFSFFSSFFSSFSFFFFFSFSFSFSFFFFFFFFFSFSFFSFFFFSFSFFFFFFFFFFFFSFSSFFSSSSFF",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFSSFFFFSFSFFFSFSSSFSSSSSFSSSSFFSSFFFSFSFSSFFFSSSFFSFSFSSFSFSSFSFFFSFFFFFSSFSFFFSSSFSSSFFS",
"output": "NO"
},
{
"input": "100\nFFFSSSFSFSSSSFSSFSFFSSSFFSSFSSFFSSFFSFSSSSFFFSFFFSFSFSSSFSSFSFSFSFFSSSSSFSSSFSFSFFSSFSFSSFFSSFSFFSFS",
"output": "NO"
},
{
"input": "100\nFFSSSSFSSSFSSSSFSSSFFSFSSFFSSFSSSFSSSFFSFFSSSSSSSSSSSSFSSFSSSSFSFFFSSFFFFFFSFSFSSSSSSFSSSFSFSSFSSFSS",
"output": "NO"
},
{
"input": "100\nSSSFFFSSSSFFSSSSSFSSSSFSSSFSSSSSFSSSSSSSSFSFFSSSFFSSFSSSSFFSSSSSSFFSSSSFSSSSSSFSSSFSSSSSSSFSSSSFSSSS",
"output": "NO"
},
{
"input": "100\nFSSSSSSSSSSSFSSSSSSSSSSSSSSSSFSSSSSSFSSSSSSSSSSSSSFSSFSSSSSFSSFSSSSSSSSSFFSSSSSFSFSSSFFSSSSSSSSSSSSS",
"output": "NO"
},
{
"input": "100\nSSSSSSSSSSSSSFSSSSSSSSSSSSFSSSFSSSSSSSSSSSSSSSSSSSSSSSSSSSSSFSSSSSSSSSSSSSSSSFSFSSSSSSSSSSSSSSSSSSFS",
"output": "NO"
},
{
"input": "100\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS",
"output": "NO"
},
{
"input": "100\nSFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF",
"output": "YES"
},
{
"input": "100\nSFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFSFSFFFFFFFFFFFSFSFFFFFFFFFFFFFSFFFFFFFFFFFFFFFFFFFFFFFFF",
"output": "YES"
},
{
"input": "100\nSFFFFFFFFFFFFSSFFFFSFFFFFFFFFFFFFFFFFFFSFFFSSFFFFSFSFFFSFFFFFFFFFFFFFFFSSFFFFFFFFSSFFFFFFFFFFFFFFSFF",
"output": "YES"
},
{
"input": "100\nSFFSSSFFSFSFSFFFFSSFFFFSFFFFFFFFSFSFFFSFFFSFFFSFFFFSFSFFFFFFFSFFFFFFFFFFSFFSSSFFSSFFFFSFFFFSFFFFSFFF",
"output": "YES"
},
{
"input": "100\nSFFFSFFFFSFFFSSFFFSFSFFFSFFFSSFSFFFFFSFFFFFFFFSFSFSFFSFFFSFSSFSFFFSFSFFSSFSFSSSFFFFFFSSFSFFSFFFFFFFF",
"output": "YES"
},
{
"input": "100\nSSSSFFFFSFFFFFFFSFFFFSFSFFFFSSFFFFFFFFFSFFSSFFFFFFSFSFSSFSSSFFFFFFFSFSFFFSSSFFFFFFFSFFFSSFFFFSSFFFSF",
"output": "YES"
},
{
"input": "100\nSSSFSSFFFSFSSSSFSSFSSSSFSSFFFFFSFFSSSSFFSSSFSSSFSSSSFSSSSFSSSSSSSFSFSSFFFSSFFSFFSSSSFSSFFSFSSFSFFFSF",
"output": "YES"
},
{
"input": "100\nSFFSFSSSSSSSFFSSSFSSSSFSFSSFFFSSSSSSFSSSSFSSFSSSFSSSSSSSFSSFSFFFSSFSSFSFSFSSSSSSSSSSSSFFFFSSSSSFSFFF",
"output": "YES"
},
{
"input": "100\nSSSFSFFSFSFFSSSSSFSSSFSSSFFFSSSSSSSSSFSFSFSSSSFSFSSFFFFFSSSSSSSSSSSSSSSSSSSFFSSSSSFSFSSSSFFSSSSFSSSF",
"output": "YES"
},
{
"input": "100\nSSSFSSSSSSSSSSFSSSSFSSSSSSFSSSSSSFSSSSSSSSSSSSSSFSSSFSSSFSSSSSSSSSSSFSSSSSSFSFSSSSFSSSSSSFSSSSSSSSFF",
"output": "YES"
},
{
"input": "100\nSSSSSSSSSSSSSSSFSFSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSFFSSSSSSSSSFSSSSSSSSSSSSSSSSSF",
"output": "YES"
},
{
"input": "100\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSF",
"output": "YES"
},
{
"input": "2\nSS",
"output": "NO"
}
] | 1,585,566,339
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 109
| 0
|
from sys import stdin,stdout
n=int(stdin.readline())
s=stdin.readline()
if(s[0]=="S" and s[n-1]=="F"):
stdout.write("YES")
else:
stdout.write("NO")
|
Title: Between the Offices
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Francisco than in the other direction, because it's warmer in San Francisco. You are so busy that you don't remember the number of flights you have made in either direction. However, for each of the last *n* days you know whether you were in San Francisco office or in Seattle office. You always fly at nights, so you never were at both offices on the same day. Given this information, determine if you flew more times from Seattle to San Francisco during the last *n* days, or not.
Input Specification:
The first line of input contains single integer *n* (2<=≤<=*n*<=≤<=100) — the number of days.
The second line contains a string of length *n* consisting of only capital 'S' and 'F' letters. If the *i*-th letter is 'S', then you were in Seattle office on that day. Otherwise you were in San Francisco. The days are given in chronological order, i.e. today is the last day in this sequence.
Output Specification:
Print "YES" if you flew more times from Seattle to San Francisco, and "NO" otherwise.
You can print each letter in any case (upper or lower).
Demo Input:
['4\nFSSF\n', '2\nSF\n', '10\nFFFFFFFFFF\n', '10\nSSFFSFFSFF\n']
Demo Output:
['NO\n', 'YES\n', 'NO\n', 'YES\n']
Note:
In the first example you were initially at San Francisco, then flew to Seattle, were there for two days and returned to San Francisco. You made one flight in each direction, so the answer is "NO".
In the second example you just flew from Seattle to San Francisco, so the answer is "YES".
In the third example you stayed the whole period in San Francisco, so the answer is "NO".
In the fourth example if you replace 'S' with ones, and 'F' with zeros, you'll get the first few digits of π in binary representation. Not very useful information though.
|
```python
from sys import stdin,stdout
n=int(stdin.readline())
s=stdin.readline()
if(s[0]=="S" and s[n-1]=="F"):
stdout.write("YES")
else:
stdout.write("NO")
```
| 3
|
|
380
|
C
|
Sereja and Brackets
|
PROGRAMMING
| 2,000
|
[
"data structures",
"schedules"
] | null | null |
Sereja has a bracket sequence *s*1,<=*s*2,<=...,<=*s**n*, or, in other words, a string *s* of length *n*, consisting of characters "(" and ")".
Sereja needs to answer *m* queries, each of them is described by two integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). The answer to the *i*-th query is the length of the maximum correct bracket subsequence of sequence *s**l**i*,<=*s**l**i*<=+<=1,<=...,<=*s**r**i*. Help Sereja answer all queries.
You can find the definitions for a subsequence and a correct bracket sequence in the notes.
|
The first line contains a sequence of characters *s*1,<=*s*2,<=...,<=*s**n* (1<=≤<=*n*<=≤<=106) without any spaces. Each character is either a "(" or a ")". The second line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. Each of the next *m* lines contains a pair of integers. The *i*-th line contains integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the description of the *i*-th query.
|
Print the answer to each question on a single line. Print the answers in the order they go in the input.
|
[
"())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10\n"
] |
[
"0\n0\n2\n10\n4\n6\n6\n"
] |
A subsequence of length |*x*| of string *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">|*s*|</sub> (where |*s*| is the length of string *s*) is string *x* = *s*<sub class="lower-index">*k*<sub class="lower-index">1</sub></sub>*s*<sub class="lower-index">*k*<sub class="lower-index">2</sub></sub>... *s*<sub class="lower-index">*k*<sub class="lower-index">|*x*|</sub></sub> (1 ≤ *k*<sub class="lower-index">1</sub> < *k*<sub class="lower-index">2</sub> < ... < *k*<sub class="lower-index">|*x*|</sub> ≤ |*s*|).
A correct bracket sequence is a bracket sequence that can be transformed into a correct aryphmetic expression by inserting characters "1" and "+" between the characters of the string. For example, bracket sequences "()()", "(())" are correct (the resulting expressions "(1)+(1)", "((1+1)+1)"), and ")(" and "(" are not.
For the third query required sequence will be «()».
For the fourth query required sequence will be «()(())(())».
| 1,500
|
[
{
"input": "())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10",
"output": "0\n0\n2\n10\n4\n6\n6"
},
{
"input": "(((((()((((((((((()((()(((((\n1\n8 15",
"output": "0"
},
{
"input": "((()((())(((((((((()(()(()(((((((((((((((()(()((((((((((((((()(((((((((((((((((((()(((\n39\n28 56\n39 46\n57 63\n29 48\n51 75\n14 72\n5 70\n51 73\n10 64\n31 56\n50 54\n15 78\n78 82\n1 11\n1 70\n1 19\n10 22\n13 36\n3 10\n34 40\n51 76\n64 71\n36 75\n24 71\n1 63\n5 14\n46 67\n32 56\n39 43\n43 56\n61 82\n2 78\n1 21\n10 72\n49 79\n12 14\n53 79\n15 31\n7 47",
"output": "4\n4\n2\n4\n2\n12\n16\n2\n12\n4\n0\n12\n0\n6\n18\n6\n2\n6\n6\n0\n2\n0\n6\n8\n18\n4\n2\n4\n2\n2\n2\n18\n8\n12\n2\n0\n2\n6\n12"
},
{
"input": "))(()))))())())))))())((()()))))()))))))))))))\n9\n26 42\n21 22\n6 22\n7 26\n43 46\n25 27\n32 39\n22 40\n2 45",
"output": "4\n0\n6\n8\n0\n2\n2\n10\n20"
},
{
"input": "(()((((()(())((((((((()((((((()((((\n71\n15 29\n17 18\n5 26\n7 10\n16 31\n26 35\n2 30\n16 24\n2 24\n7 12\n15 18\n12 13\n25 30\n1 30\n12 13\n16 20\n6 35\n20 28\n18 23\n9 31\n12 35\n14 17\n8 16\n3 10\n12 33\n7 19\n2 33\n7 17\n21 27\n10 30\n29 32\n9 28\n18 32\n28 31\n31 33\n4 26\n15 27\n10 17\n8 14\n11 28\n8 23\n17 33\n4 14\n3 6\n6 34\n19 23\n4 21\n16 27\n14 27\n6 19\n31 32\n29 32\n9 17\n1 21\n2 31\n18 29\n16 26\n15 18\n4 5\n13 20\n9 28\n18 30\n1 32\n2 9\n16 24\n1 20\n4 15\n16 23\n19 34\n5 22\n5 23",
"output": "2\n0\n8\n2\n4\n2\n10\n2\n10\n4\n0\n0\n0\n10\n0\n0\n10\n2\n2\n8\n4\n0\n6\n2\n4\n6\n12\n6\n2\n6\n2\n6\n4\n2\n0\n8\n2\n4\n6\n4\n8\n4\n6\n0\n10\n2\n6\n2\n2\n6\n0\n2\n4\n8\n12\n2\n2\n0\n0\n0\n6\n2\n12\n4\n2\n8\n6\n2\n4\n6\n8"
},
{
"input": "(((())((((()()((((((()((()(((((((((((()((\n6\n20 37\n28 32\n12 18\n7 25\n21 33\n4 5",
"output": "4\n0\n2\n6\n4\n2"
},
{
"input": "(((()((((()()()(()))((((()(((()))()((((()))()((())\n24\n37 41\n13 38\n31 34\n14 16\n29 29\n12 46\n1 26\n15 34\n8 47\n11 23\n6 32\n2 22\n9 27\n17 40\n6 15\n4 49\n12 33\n3 48\n22 47\n19 48\n10 27\n23 25\n4 44\n27 48",
"output": "2\n16\n0\n2\n0\n26\n16\n12\n30\n8\n18\n14\n14\n12\n6\n34\n16\n32\n18\n18\n12\n0\n30\n16"
},
{
"input": ")()((((((((((((((((()(((()()(()((((((()(((((((()()))((((())(((((((((()(((((((((\n51\n29 53\n31 69\n54 59\n3 52\n26 46\n14 62\n6 54\n39 56\n17 27\n46 74\n60 72\n18 26\n38 46\n4 27\n22 52\n44 49\n42 77\n2 20\n39 57\n61 70\n33 54\n10 30\n67 70\n46 66\n17 77\n5 52\n33 77\n26 32\n1 72\n40 78\n38 68\n19 47\n30 53\n19 29\n52 71\n1 11\n22 53\n17 42\n2 51\n4 12\n24 76\n22 34\n21 69\n11 69\n36 52\n17 31\n57 58\n54 62\n23 71\n5 46\n51 53",
"output": "12\n14\n4\n18\n6\n22\n18\n8\n4\n12\n2\n4\n2\n4\n16\n2\n14\n2\n8\n2\n10\n6\n2\n10\n24\n18\n16\n4\n26\n14\n14\n10\n12\n6\n6\n2\n16\n10\n18\n0\n22\n6\n20\n22\n10\n8\n2\n4\n22\n10\n0"
},
{
"input": "(\n1\n1 1",
"output": "0"
},
{
"input": ")\n1\n1 1",
"output": "0"
},
{
"input": "()\n1\n1 2",
"output": "2"
},
{
"input": ")(\n1\n1 2",
"output": "0"
}
] | 1,671,219,896
| 2,147,483,647
|
PyPy 3-64
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 12
| 1,000
| 16,179,200
|
from sys import stdin as cin
from sys import stdout as cout
def brafast(bras:list,start, end)->int:
lcount = 0
mx =0
for i in range(start,end):
if bras[i] == '(':
lcount += 1
elif bras[i] == ')' and lcount >0:
lcount -= 1
mx += 1
return mx
def bra():
lines = cin.readlines()
bras = lines[0]
num = lines[1]
bra = 0
res = []
for i in range(2,len(lines)):
nums = lines[i].split()
# while('()' in newbras):
# bra += newbras.count('()')
# newbras = newbras.replace('()', "")
bra = brafast(bras,int(nums[0])-1,int(nums[1]))
res.append(f"{bra*2}")
bra = 0
cout.write("\n".join(res))
if __name__ == "__main__":
bra()
|
Title: Sereja and Brackets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sereja has a bracket sequence *s*1,<=*s*2,<=...,<=*s**n*, or, in other words, a string *s* of length *n*, consisting of characters "(" and ")".
Sereja needs to answer *m* queries, each of them is described by two integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). The answer to the *i*-th query is the length of the maximum correct bracket subsequence of sequence *s**l**i*,<=*s**l**i*<=+<=1,<=...,<=*s**r**i*. Help Sereja answer all queries.
You can find the definitions for a subsequence and a correct bracket sequence in the notes.
Input Specification:
The first line contains a sequence of characters *s*1,<=*s*2,<=...,<=*s**n* (1<=≤<=*n*<=≤<=106) without any spaces. Each character is either a "(" or a ")". The second line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. Each of the next *m* lines contains a pair of integers. The *i*-th line contains integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the description of the *i*-th query.
Output Specification:
Print the answer to each question on a single line. Print the answers in the order they go in the input.
Demo Input:
['())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10\n']
Demo Output:
['0\n0\n2\n10\n4\n6\n6\n']
Note:
A subsequence of length |*x*| of string *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">|*s*|</sub> (where |*s*| is the length of string *s*) is string *x* = *s*<sub class="lower-index">*k*<sub class="lower-index">1</sub></sub>*s*<sub class="lower-index">*k*<sub class="lower-index">2</sub></sub>... *s*<sub class="lower-index">*k*<sub class="lower-index">|*x*|</sub></sub> (1 ≤ *k*<sub class="lower-index">1</sub> < *k*<sub class="lower-index">2</sub> < ... < *k*<sub class="lower-index">|*x*|</sub> ≤ |*s*|).
A correct bracket sequence is a bracket sequence that can be transformed into a correct aryphmetic expression by inserting characters "1" and "+" between the characters of the string. For example, bracket sequences "()()", "(())" are correct (the resulting expressions "(1)+(1)", "((1+1)+1)"), and ")(" and "(" are not.
For the third query required sequence will be «()».
For the fourth query required sequence will be «()(())(())».
|
```python
from sys import stdin as cin
from sys import stdout as cout
def brafast(bras:list,start, end)->int:
lcount = 0
mx =0
for i in range(start,end):
if bras[i] == '(':
lcount += 1
elif bras[i] == ')' and lcount >0:
lcount -= 1
mx += 1
return mx
def bra():
lines = cin.readlines()
bras = lines[0]
num = lines[1]
bra = 0
res = []
for i in range(2,len(lines)):
nums = lines[i].split()
# while('()' in newbras):
# bra += newbras.count('()')
# newbras = newbras.replace('()', "")
bra = brafast(bras,int(nums[0])-1,int(nums[1]))
res.append(f"{bra*2}")
bra = 0
cout.write("\n".join(res))
if __name__ == "__main__":
bra()
```
| 0
|
|
189
|
A
|
Cut Ribbon
|
PROGRAMMING
| 1,300
|
[
"brute force",
"dp"
] | null | null |
Polycarpus has a ribbon, its length is *n*. He wants to cut the ribbon in a way that fulfils the following two conditions:
- After the cutting each ribbon piece should have length *a*, *b* or *c*. - After the cutting the number of ribbon pieces should be maximum.
Help Polycarpus and find the number of ribbon pieces after the required cutting.
|
The first line contains four space-separated integers *n*, *a*, *b* and *c* (1<=≤<=*n*,<=*a*,<=*b*,<=*c*<=≤<=4000) — the length of the original ribbon and the acceptable lengths of the ribbon pieces after the cutting, correspondingly. The numbers *a*, *b* and *c* can coincide.
|
Print a single number — the maximum possible number of ribbon pieces. It is guaranteed that at least one correct ribbon cutting exists.
|
[
"5 5 3 2\n",
"7 5 5 2\n"
] |
[
"2\n",
"2\n"
] |
In the first example Polycarpus can cut the ribbon in such way: the first piece has length 2, the second piece has length 3.
In the second example Polycarpus can cut the ribbon in such way: the first piece has length 5, the second piece has length 2.
| 500
|
[
{
"input": "5 5 3 2",
"output": "2"
},
{
"input": "7 5 5 2",
"output": "2"
},
{
"input": "4 4 4 4",
"output": "1"
},
{
"input": "1 1 1 1",
"output": "1"
},
{
"input": "4000 1 2 3",
"output": "4000"
},
{
"input": "4000 3 4 5",
"output": "1333"
},
{
"input": "10 3 4 5",
"output": "3"
},
{
"input": "100 23 15 50",
"output": "2"
},
{
"input": "3119 3515 1021 7",
"output": "11"
},
{
"input": "918 102 1327 1733",
"output": "9"
},
{
"input": "3164 42 430 1309",
"output": "15"
},
{
"input": "3043 317 1141 2438",
"output": "7"
},
{
"input": "26 1 772 2683",
"output": "26"
},
{
"input": "370 2 1 15",
"output": "370"
},
{
"input": "734 12 6 2",
"output": "367"
},
{
"input": "418 18 14 17",
"output": "29"
},
{
"input": "18 16 28 9",
"output": "2"
},
{
"input": "14 6 2 17",
"output": "7"
},
{
"input": "29 27 18 2",
"output": "2"
},
{
"input": "29 12 7 10",
"output": "3"
},
{
"input": "27 23 4 3",
"output": "9"
},
{
"input": "5 14 5 2",
"output": "1"
},
{
"input": "5 17 26 5",
"output": "1"
},
{
"input": "9 1 10 3",
"output": "9"
},
{
"input": "2 19 15 1",
"output": "2"
},
{
"input": "4 6 4 9",
"output": "1"
},
{
"input": "10 6 2 9",
"output": "5"
},
{
"input": "2 2 9 6",
"output": "1"
},
{
"input": "6 2 4 1",
"output": "6"
},
{
"input": "27 24 5 27",
"output": "1"
},
{
"input": "2683 83 26 2709",
"output": "101"
},
{
"input": "728 412 789 158",
"output": "3"
},
{
"input": "3964 4 2916 176",
"output": "991"
},
{
"input": "3399 2035 2 3334",
"output": "683"
},
{
"input": "3455 244 3301 3",
"output": "991"
},
{
"input": "595 2263 3625 1",
"output": "595"
},
{
"input": "4000 1 1 1",
"output": "4000"
},
{
"input": "3999 2 2 3999",
"output": "1"
},
{
"input": "25 6 8 11",
"output": "3"
},
{
"input": "4000 500 1000 2000",
"output": "8"
},
{
"input": "53 10 11 23",
"output": "5"
},
{
"input": "100 100 1 1",
"output": "100"
},
{
"input": "17 3 4 10",
"output": "5"
},
{
"input": "413 101 102 105",
"output": "4"
},
{
"input": "490 4 49 50",
"output": "111"
},
{
"input": "3999 2 3 3",
"output": "1999"
},
{
"input": "8 3 8 4",
"output": "2"
},
{
"input": "5 1 3 3",
"output": "5"
},
{
"input": "100 3 17 22",
"output": "27"
},
{
"input": "4000 2 3 4",
"output": "2000"
},
{
"input": "4000 3 3 5",
"output": "1332"
},
{
"input": "13 4 6 7",
"output": "2"
},
{
"input": "4000 5 2 2",
"output": "2000"
},
{
"input": "3999 2 2 3",
"output": "1999"
},
{
"input": "4000 33 7 3333",
"output": "564"
},
{
"input": "60 33 20 9",
"output": "4"
},
{
"input": "100 9 11 99",
"output": "10"
},
{
"input": "2009 6 8 9",
"output": "334"
}
] | 1,679,623,423
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 0
|
# Miguel Arriaga y Karla Mondragón
mapOfKnownCuts = {}
MIN_INT = float('-inf')
maxDepth = 0
def ribbonCuts(n, a, b, c):
if n < 0:
return float('-inf')
elif n in mapOfKnownCuts:
return mapOfKnownCuts[n]
else:
optionA = ribbonCuts(n-a, a, b, c)+1
mapOfKnownCuts[n-a] = optionA
optionB = ribbonCuts(n-b, a, b, c)+1
mapOfKnownCuts[n-b] = optionB
optionC = ribbonCuts(n-c, a, b, c)+1
mapOfKnownCuts[n-c] = optionC
mapOfKnownCuts[n] = max(optionA, optionB, optionC)
return mapOfKnownCuts[n]
def main():
n, a, b, c = [int(x) for x in input().split()]
mapOfKnownCuts[0] = 0
print(ribbonCuts(n, a, b, c))
main()
|
Title: Cut Ribbon
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus has a ribbon, its length is *n*. He wants to cut the ribbon in a way that fulfils the following two conditions:
- After the cutting each ribbon piece should have length *a*, *b* or *c*. - After the cutting the number of ribbon pieces should be maximum.
Help Polycarpus and find the number of ribbon pieces after the required cutting.
Input Specification:
The first line contains four space-separated integers *n*, *a*, *b* and *c* (1<=≤<=*n*,<=*a*,<=*b*,<=*c*<=≤<=4000) — the length of the original ribbon and the acceptable lengths of the ribbon pieces after the cutting, correspondingly. The numbers *a*, *b* and *c* can coincide.
Output Specification:
Print a single number — the maximum possible number of ribbon pieces. It is guaranteed that at least one correct ribbon cutting exists.
Demo Input:
['5 5 3 2\n', '7 5 5 2\n']
Demo Output:
['2\n', '2\n']
Note:
In the first example Polycarpus can cut the ribbon in such way: the first piece has length 2, the second piece has length 3.
In the second example Polycarpus can cut the ribbon in such way: the first piece has length 5, the second piece has length 2.
|
```python
# Miguel Arriaga y Karla Mondragón
mapOfKnownCuts = {}
MIN_INT = float('-inf')
maxDepth = 0
def ribbonCuts(n, a, b, c):
if n < 0:
return float('-inf')
elif n in mapOfKnownCuts:
return mapOfKnownCuts[n]
else:
optionA = ribbonCuts(n-a, a, b, c)+1
mapOfKnownCuts[n-a] = optionA
optionB = ribbonCuts(n-b, a, b, c)+1
mapOfKnownCuts[n-b] = optionB
optionC = ribbonCuts(n-c, a, b, c)+1
mapOfKnownCuts[n-c] = optionC
mapOfKnownCuts[n] = max(optionA, optionB, optionC)
return mapOfKnownCuts[n]
def main():
n, a, b, c = [int(x) for x in input().split()]
mapOfKnownCuts[0] = 0
print(ribbonCuts(n, a, b, c))
main()
```
| 0
|
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,655,101,855
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 30
| 124
| 0
|
word=input()
cap=0
small=0
for i in word:
if i.islower():
small+=1
else:
cap+=1
if small>=cap:
print(word.lower())
else:
print(word.upper())
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
word=input()
cap=0
small=0
for i in word:
if i.islower():
small+=1
else:
cap+=1
if small>=cap:
print(word.lower())
else:
print(word.upper())
```
| 3.969
|
931
|
A
|
Friends Meeting
|
PROGRAMMING
| 800
|
[
"brute force",
"greedy",
"implementation",
"math"
] | null | null |
Two friends are on the coordinate axis *Ox* in points with integer coordinates. One of them is in the point *x*1<==<=*a*, another one is in the point *x*2<==<=*b*.
Each of the friends can move by one along the line in any direction unlimited number of times. When a friend moves, the tiredness of a friend changes according to the following rules: the first move increases the tiredness by 1, the second move increases the tiredness by 2, the third — by 3 and so on. For example, if a friend moves first to the left, then to the right (returning to the same point), and then again to the left his tiredness becomes equal to 1<=+<=2<=+<=3<==<=6.
The friends want to meet in a integer point. Determine the minimum total tiredness they should gain, if they meet in the same point.
|
The first line contains a single integer *a* (1<=≤<=*a*<=≤<=1000) — the initial position of the first friend.
The second line contains a single integer *b* (1<=≤<=*b*<=≤<=1000) — the initial position of the second friend.
It is guaranteed that *a*<=≠<=*b*.
|
Print the minimum possible total tiredness if the friends meet in the same point.
|
[
"3\n4\n",
"101\n99\n",
"5\n10\n"
] |
[
"1\n",
"2\n",
"9\n"
] |
In the first example the first friend should move by one to the right (then the meeting happens at point 4), or the second friend should move by one to the left (then the meeting happens at point 3). In both cases, the total tiredness becomes 1.
In the second example the first friend should move by one to the left, and the second friend should move by one to the right. Then they meet in the point 100, and the total tiredness becomes 1 + 1 = 2.
In the third example one of the optimal ways is the following. The first friend should move three times to the right, and the second friend — two times to the left. Thus the friends meet in the point 8, and the total tiredness becomes 1 + 2 + 3 + 1 + 2 = 9.
| 500
|
[
{
"input": "3\n4",
"output": "1"
},
{
"input": "101\n99",
"output": "2"
},
{
"input": "5\n10",
"output": "9"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "1\n1000",
"output": "250000"
},
{
"input": "999\n1000",
"output": "1"
},
{
"input": "1000\n999",
"output": "1"
},
{
"input": "1000\n1",
"output": "250000"
},
{
"input": "2\n1",
"output": "1"
},
{
"input": "2\n999",
"output": "249001"
},
{
"input": "2\n998",
"output": "248502"
},
{
"input": "999\n2",
"output": "249001"
},
{
"input": "998\n2",
"output": "248502"
},
{
"input": "2\n1000",
"output": "249500"
},
{
"input": "1000\n2",
"output": "249500"
},
{
"input": "1\n999",
"output": "249500"
},
{
"input": "999\n1",
"output": "249500"
},
{
"input": "188\n762",
"output": "82656"
},
{
"input": "596\n777",
"output": "8281"
},
{
"input": "773\n70",
"output": "123904"
},
{
"input": "825\n729",
"output": "2352"
},
{
"input": "944\n348",
"output": "89102"
},
{
"input": "352\n445",
"output": "2209"
},
{
"input": "529\n656",
"output": "4096"
},
{
"input": "19\n315",
"output": "22052"
},
{
"input": "138\n370",
"output": "13572"
},
{
"input": "546\n593",
"output": "576"
},
{
"input": "285\n242",
"output": "484"
},
{
"input": "773\n901",
"output": "4160"
},
{
"input": "892\n520",
"output": "34782"
},
{
"input": "864\n179",
"output": "117649"
},
{
"input": "479\n470",
"output": "25"
},
{
"input": "967\n487",
"output": "57840"
},
{
"input": "648\n106",
"output": "73712"
},
{
"input": "58\n765",
"output": "125316"
},
{
"input": "235\n56",
"output": "8100"
},
{
"input": "285\n153",
"output": "4422"
},
{
"input": "943\n13",
"output": "216690"
},
{
"input": "675\n541",
"output": "4556"
},
{
"input": "4\n912",
"output": "206570"
}
] | 1,571,386,275
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 93
| 0
|
n,m,a=input().split()
m=int(m)
n=int(n)
a=int(a)
print(-n//a*(-m//a))
|
Title: Friends Meeting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two friends are on the coordinate axis *Ox* in points with integer coordinates. One of them is in the point *x*1<==<=*a*, another one is in the point *x*2<==<=*b*.
Each of the friends can move by one along the line in any direction unlimited number of times. When a friend moves, the tiredness of a friend changes according to the following rules: the first move increases the tiredness by 1, the second move increases the tiredness by 2, the third — by 3 and so on. For example, if a friend moves first to the left, then to the right (returning to the same point), and then again to the left his tiredness becomes equal to 1<=+<=2<=+<=3<==<=6.
The friends want to meet in a integer point. Determine the minimum total tiredness they should gain, if they meet in the same point.
Input Specification:
The first line contains a single integer *a* (1<=≤<=*a*<=≤<=1000) — the initial position of the first friend.
The second line contains a single integer *b* (1<=≤<=*b*<=≤<=1000) — the initial position of the second friend.
It is guaranteed that *a*<=≠<=*b*.
Output Specification:
Print the minimum possible total tiredness if the friends meet in the same point.
Demo Input:
['3\n4\n', '101\n99\n', '5\n10\n']
Demo Output:
['1\n', '2\n', '9\n']
Note:
In the first example the first friend should move by one to the right (then the meeting happens at point 4), or the second friend should move by one to the left (then the meeting happens at point 3). In both cases, the total tiredness becomes 1.
In the second example the first friend should move by one to the left, and the second friend should move by one to the right. Then they meet in the point 100, and the total tiredness becomes 1 + 1 = 2.
In the third example one of the optimal ways is the following. The first friend should move three times to the right, and the second friend — two times to the left. Thus the friends meet in the point 8, and the total tiredness becomes 1 + 2 + 3 + 1 + 2 = 9.
|
```python
n,m,a=input().split()
m=int(m)
n=int(n)
a=int(a)
print(-n//a*(-m//a))
```
| -1
|
|
265
|
A
|
Colorful Stones (Simplified Edition)
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
|
The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
|
Print the final 1-based position of Liss in a single line.
|
[
"RGB\nRRR\n",
"RRRBGBRBBB\nBBBRR\n",
"BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n"
] |
[
"2\n",
"3\n",
"15\n"
] |
none
| 500
|
[
{
"input": "RGB\nRRR",
"output": "2"
},
{
"input": "RRRBGBRBBB\nBBBRR",
"output": "3"
},
{
"input": "BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB",
"output": "15"
},
{
"input": "G\nRRBBRBRRBR",
"output": "1"
},
{
"input": "RRRRRBRRBRRGRBGGRRRGRBBRBBBBBRGRBGBRRGBBBRBBGBRGBB\nB",
"output": "1"
},
{
"input": "RRGGBRGRBG\nBRRGGBBGGR",
"output": "7"
},
{
"input": "BBRRGBGGRGBRGBRBRBGR\nGGGRBGGGBRRRRGRBGBGRGRRBGRBGBG",
"output": "15"
},
{
"input": "GBRRBGBGBBBBRRRGBGRRRGBGBBBRGR\nRRGBRRGRBBBBBBGRRBBR",
"output": "8"
},
{
"input": "BRGRRGRGRRGBBGBBBRRBBRRBGBBGRGBBGGRGBRBGGGRRRBGGBB\nRGBBGRRBBBRRGRRBRBBRGBBGGGRGBGRRRRBRBGGBRBGGGRGBRR",
"output": "16"
},
{
"input": "GGRGGBRRGRGBRRGGRBBGGRRGBBBGBBBGGRBGGBRBBRGBRRRBRG\nGGRGRRRRRRRRRGBBBBRGBRGRGRRGBBRGGBRBBRBGBRGRRRRGGR",
"output": "18"
},
{
"input": "RBBRBGBBGGGBRRBGBRGRRGGRBBBBGRBGGBRRBGBBRBRGBBGGGG\nBRRGRBGRBGBRGBRBGGBBBGBBRGRBGRGRBGRBGGRRBGBRGRRBBG",
"output": "23"
},
{
"input": "RRGGRRBRGRGBRGBRGBBRGGGBRBGBRGBRGGBRBRGBGRRBBGGRBR\nBRGRBBBGRBGRRGGRRRRRRRRGGGGGGGGBGGGGGGGRGRBBRGRGBR",
"output": "14"
},
{
"input": "RBRBRRRRRGGR\nBBBBRRGGBGRBRGBBRGGGRGGBRRBRBRBGGG",
"output": "12"
},
{
"input": "GGRGGGBRGRGRBBRGGGRBGRRR\nGBBBBGBGBGBBBRGGRGGBGRRGRRRGBGB",
"output": "12"
},
{
"input": "RGRBGBRBBGBRRGGGBBGBRRBGRGBBBBBGRRRGGRBB\nBGR",
"output": "2"
},
{
"input": "R\nB",
"output": "1"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR",
"output": "50"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
},
{
"input": "R\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
}
] | 1,610,202,569
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 19
| 154
| 0
|
s1=input()
s2=input()
j=0
for i in range(len(s2)):
if s2[i]==s1[j]:
j+=1
if j>len(s1)-1:
print(len(s1))
else:
print(j+1)
|
Title: Colorful Stones (Simplified Edition)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
Input Specification:
The input contains two lines. The first line contains the string *s* (1<=≤<=|*s*|<=≤<=50). The second line contains the string *t* (1<=≤<=|*t*|<=≤<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
Output Specification:
Print the final 1-based position of Liss in a single line.
Demo Input:
['RGB\nRRR\n', 'RRRBGBRBBB\nBBBRR\n', 'BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n']
Demo Output:
['2\n', '3\n', '15\n']
Note:
none
|
```python
s1=input()
s2=input()
j=0
for i in range(len(s2)):
if s2[i]==s1[j]:
j+=1
if j>len(s1)-1:
print(len(s1))
else:
print(j+1)
```
| 3
|
|
437
|
A
|
The Child and Homework
|
PROGRAMMING
| 1,300
|
[
"implementation"
] | null | null |
Once upon a time a child got a test consisting of multiple-choice questions as homework. A multiple-choice question consists of four choices: A, B, C and D. Each choice has a description, and the child should find out the only one that is correct.
Fortunately the child knows how to solve such complicated test. The child will follow the algorithm:
- If there is some choice whose description at least twice shorter than all other descriptions, or at least twice longer than all other descriptions, then the child thinks the choice is great. - If there is exactly one great choice then the child chooses it. Otherwise the child chooses C (the child think it is the luckiest choice).
You are given a multiple-choice questions, can you predict child's choose?
|
The first line starts with "A." (without quotes), then followed the description of choice A. The next three lines contains the descriptions of the other choices in the same format. They are given in order: B, C, D. Please note, that the description goes after prefix "X.", so the prefix mustn't be counted in description's length.
Each description is non-empty and consists of at most 100 characters. Each character can be either uppercase English letter or lowercase English letter, or "_".
|
Print a single line with the child's choice: "A", "B", "C" or "D" (without quotes).
|
[
"A.VFleaKing_is_the_author_of_this_problem\nB.Picks_is_the_author_of_this_problem\nC.Picking_is_the_author_of_this_problem\nD.Ftiasch_is_cute\n",
"A.ab\nB.abcde\nC.ab\nD.abc\n",
"A.c\nB.cc\nC.c\nD.c\n"
] |
[
"D\n",
"C\n",
"B\n"
] |
In the first sample, the first choice has length 39, the second one has length 35, the third one has length 37, and the last one has length 15. The choice D (length 15) is twice shorter than all other choices', so it is great choice. There is no other great choices so the child will choose D.
In the second sample, no choice is great, so the child will choose the luckiest choice C.
In the third sample, the choice B (length 2) is twice longer than all other choices', so it is great choice. There is no other great choices so the child will choose B.
| 500
|
[
{
"input": "A.VFleaKing_is_the_author_of_this_problem\nB.Picks_is_the_author_of_this_problem\nC.Picking_is_the_author_of_this_problem\nD.Ftiasch_is_cute",
"output": "D"
},
{
"input": "A.ab\nB.abcde\nC.ab\nD.abc",
"output": "C"
},
{
"input": "A.c\nB.cc\nC.c\nD.c",
"output": "B"
},
{
"input": "A.He_nan_de_yang_guang_zhao_yao_zhe_wo_men_mei_guo_ren_lian_shang_dou_xiao_kai_yan_wahaaaaaaaaaaaaaaaa\nB.Li_bai_li_bai_fei_liu_zhi_xia_san_qian_chi_yi_si_yin_he_luo_jiu_tian_li_bai_li_bai_li_bai_li_bai_shi\nC.Peng_yu_xiang_shi_zai_tai_shen_le_jian_zhi_jiu_shi_ye_jie_du_liu_a_si_mi_da_zhen_shi_tai_shen_le_a_a\nD.Wo_huo_le_si_shi_er_nian_zhen_de_shi_cong_lai_ye_mei_you_jian_guo_zhe_me_biao_zhun_de_yi_bai_ge_zi_a",
"output": "C"
},
{
"input": "A.a___FXIcs_gB____dxFFzst_p_P_Xp_vS__cS_C_ei_\nB.fmnmkS_SeZYx_tSys_d__Exbojv_a_YPEL_BPj__I_aYH\nC._nrPx_j\nD.o_A_UwmNbC_sZ_AXk_Y___i_SN_U_UxrBN_qo_____",
"output": "C"
},
{
"input": "A.G_R__iT_ow_Y__Sm_al__u_____l_ltK\nB.CWRe__h__cbCF\nC._QJ_dVHCL_g_WBsMO__LC____hMNE_DoO__xea_ec\nD.___Zh_",
"output": "D"
},
{
"input": "A.a___FXIcs_gB____dxFFzst_p_P_Xp_vS__cS_C_ei_\nB.fmnmkS_SeZYx_tSys_d__Exbojv_a_YPEL_BPj__I_aYH\nC._nrPx_j\nD.o_A_UwmNbC_sZ_AXk_Y___i_SN_U_UxrBN_qo_____",
"output": "C"
},
{
"input": "A.G_R__iT_ow_Y__Sm_al__u_____l_ltK\nB.CWRe__h__cbCF\nC._QJ_dVHCL_g_WBsMO__LC____hMNE_DoO__xea_ec\nD.___Zh_",
"output": "D"
},
{
"input": "A.ejQ_E_E_G_e_SDjZ__lh_f_K__Z_i_B_U__S__S_EMD_ZEU_Sq\nB.o_JpInEdsrAY_T__D_S\nC.E_Vp_s\nD.a_AU_h",
"output": "A"
},
{
"input": "A.PN_m_P_qgOAMwDyxtbH__Yc__bPOh_wYH___n_Fv_qlZp_\nB._gLeDU__rr_vjrm__O_jl_R__DG___u_XqJjW_\nC.___sHLQzdTzT_tZ_Gs\nD.sZNcVa__M_To_bz_clFi_mH_",
"output": "C"
},
{
"input": "A.bR___cCYJg_Wbt____cxfXfC____c_O_\nB.guM\nC.__bzsH_Of__RjG__u_w_i__PXQL_U_Ow_U_n\nD._nHIuZsu_uU_stRC_k___vD_ZOD_u_z_c_Zf__p_iF_uD_Hdg",
"output": "B"
},
{
"input": "A.x_\nB.__RSiDT_\nC.Ci\nD.KLY_Hc_YN_xXg_DynydumheKTw_PFHo_vqXwm_DY_dA___OS_kG___",
"output": "D"
},
{
"input": "A.yYGJ_C__NYq_\nB.ozMUZ_cKKk_zVUPR_b_g_ygv_HoM__yAxvh__iE\nC.sgHJ___MYP__AWejchRvjSD_o\nD.gkfF_GiOqW_psMT_eS",
"output": "C"
},
{
"input": "A._LYm_nvl_E__RCFZ_IdO\nB.k__qIPO_ivvZyIG__L_\nC.D_SabLm_R___j_HS_t__\nD._adj_R_ngix____GSe_aw__SbOOl_",
"output": "C"
},
{
"input": "A.h_WiYTD_C_h___z_Gn_Th_uNh__g___jm\nB.__HeQaudCJcYfVi__Eg_vryuQrDkb_g__oy_BwX_Mu_\nC._MChdMhQA_UKrf_LGZk_ALTo_mnry_GNNza_X_D_u____ueJb__Y_h__CNUNDfmZATck_ad_XTbG\nD.NV___OoL__GfP_CqhD__RB_____v_T_xi",
"output": "C"
},
{
"input": "A.____JGWsfiU\nB.S_LMq__MpE_oFBs_P\nC.U_Rph_VHpUr____X_jWXbk__ElJTu_Z_wlBpKLTD\nD.p_ysvPNmbrF__",
"output": "C"
},
{
"input": "A.ejQ_E_E_G_e_SDjZ__lh_f_K__Z_i_B_U__S__S_EMD_ZEU_Sq\nB.o_JpInEdsrAY_T__D_S\nC.E_Vp_s\nD.a_AU_h",
"output": "A"
},
{
"input": "A.PN_m_P_qgOAMwDyxtbH__Yc__bPOh_wYH___n_Fv_qlZp_\nB._gLeDU__rr_vjrm__O_jl_R__DG___u_XqJjW_\nC.___sHLQzdTzT_tZ_Gs\nD.sZNcVa__M_To_bz_clFi_mH_",
"output": "C"
},
{
"input": "A.bR___cCYJg_Wbt____cxfXfC____c_O_\nB.guM\nC.__bzsH_Of__RjG__u_w_i__PXQL_U_Ow_U_n\nD._nHIuZsu_uU_stRC_k___vD_ZOD_u_z_c_Zf__p_iF_uD_Hdg",
"output": "B"
},
{
"input": "A.x_\nB.__RSiDT_\nC.Ci\nD.KLY_Hc_YN_xXg_DynydumheKTw_PFHo_vqXwm_DY_dA___OS_kG___",
"output": "D"
},
{
"input": "A.yYGJ_C__NYq_\nB.ozMUZ_cKKk_zVUPR_b_g_ygv_HoM__yAxvh__iE\nC.sgHJ___MYP__AWejchRvjSD_o\nD.gkfF_GiOqW_psMT_eS",
"output": "C"
},
{
"input": "A._LYm_nvl_E__RCFZ_IdO\nB.k__qIPO_ivvZyIG__L_\nC.D_SabLm_R___j_HS_t__\nD._adj_R_ngix____GSe_aw__SbOOl_",
"output": "C"
},
{
"input": "A.h_WiYTD_C_h___z_Gn_Th_uNh__g___jm\nB.__HeQaudCJcYfVi__Eg_vryuQrDkb_g__oy_BwX_Mu_\nC._MChdMhQA_UKrf_LGZk_ALTo_mnry_GNNza_X_D_u____ueJb__Y_h__CNUNDfmZATck_ad_XTbG\nD.NV___OoL__GfP_CqhD__RB_____v_T_xi",
"output": "C"
},
{
"input": "A.____JGWsfiU\nB.S_LMq__MpE_oFBs_P\nC.U_Rph_VHpUr____X_jWXbk__ElJTu_Z_wlBpKLTD\nD.p_ysvPNmbrF__",
"output": "C"
},
{
"input": "A.aaaaaa\nB.aaa\nC.aaa\nD.aaa",
"output": "A"
},
{
"input": "A.aaa\nB.aaaaaa\nC.aaaaaa\nD.aaaaaa",
"output": "A"
},
{
"input": "A.a\nB.b\nC.c\nD.d",
"output": "C"
},
{
"input": "A._\nB.__\nC.____\nD.________",
"output": "C"
},
{
"input": "A.____\nB.________\nC.________\nD._______",
"output": "C"
},
{
"input": "A.h\nB.asdf\nC.asqw\nD.qwertasdfg",
"output": "C"
},
{
"input": "A.aa\nB.aaaaa\nC.aaaaaa\nD.aaaaaaaaaaaaa",
"output": "C"
},
{
"input": "A.ccc\nB.ccccccc\nC.ccc\nD.c",
"output": "C"
},
{
"input": "A.c\nB.ccc\nC.cccccccccccccccccc\nD.cccccc",
"output": "C"
},
{
"input": "A.aa\nB.bb\nC.cc\nD.ddd",
"output": "C"
},
{
"input": "A.QW\nB.WERT\nC.QWER\nD.QWERTYUI",
"output": "C"
}
] | 1,451,065,488
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 1
| 30
| 0
|
A_count = len(input()[2:])
B_count = len(input()[2:])
C_count = len(input()[2:])
D_count = len(input()[2:])
choices = ['A', 'B', 'C', 'D']
choices_len = [A_count, B_count, C_count, D_count]
answer = 'C'
mn_idx, mx_idx = choices_len.index(min(choices_len)), choices_len.index(max(choices_len))
great_mn_choice = choices_len[mn_idx] * 2
great_mx_choice = choices_len[mx_idx]
if all(choices_len[i] >= great_mn_choice for i in range(4) if i != mn_idx):
answer = choices[mn_idx]
elif all(choices_len[i] <= great_mx_choice for i in range(4) if i != mx_idx):
answer = choices[mx_idx]
print(answer)
|
Title: The Child and Homework
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Once upon a time a child got a test consisting of multiple-choice questions as homework. A multiple-choice question consists of four choices: A, B, C and D. Each choice has a description, and the child should find out the only one that is correct.
Fortunately the child knows how to solve such complicated test. The child will follow the algorithm:
- If there is some choice whose description at least twice shorter than all other descriptions, or at least twice longer than all other descriptions, then the child thinks the choice is great. - If there is exactly one great choice then the child chooses it. Otherwise the child chooses C (the child think it is the luckiest choice).
You are given a multiple-choice questions, can you predict child's choose?
Input Specification:
The first line starts with "A." (without quotes), then followed the description of choice A. The next three lines contains the descriptions of the other choices in the same format. They are given in order: B, C, D. Please note, that the description goes after prefix "X.", so the prefix mustn't be counted in description's length.
Each description is non-empty and consists of at most 100 characters. Each character can be either uppercase English letter or lowercase English letter, or "_".
Output Specification:
Print a single line with the child's choice: "A", "B", "C" or "D" (without quotes).
Demo Input:
['A.VFleaKing_is_the_author_of_this_problem\nB.Picks_is_the_author_of_this_problem\nC.Picking_is_the_author_of_this_problem\nD.Ftiasch_is_cute\n', 'A.ab\nB.abcde\nC.ab\nD.abc\n', 'A.c\nB.cc\nC.c\nD.c\n']
Demo Output:
['D\n', 'C\n', 'B\n']
Note:
In the first sample, the first choice has length 39, the second one has length 35, the third one has length 37, and the last one has length 15. The choice D (length 15) is twice shorter than all other choices', so it is great choice. There is no other great choices so the child will choose D.
In the second sample, no choice is great, so the child will choose the luckiest choice C.
In the third sample, the choice B (length 2) is twice longer than all other choices', so it is great choice. There is no other great choices so the child will choose B.
|
```python
A_count = len(input()[2:])
B_count = len(input()[2:])
C_count = len(input()[2:])
D_count = len(input()[2:])
choices = ['A', 'B', 'C', 'D']
choices_len = [A_count, B_count, C_count, D_count]
answer = 'C'
mn_idx, mx_idx = choices_len.index(min(choices_len)), choices_len.index(max(choices_len))
great_mn_choice = choices_len[mn_idx] * 2
great_mx_choice = choices_len[mx_idx]
if all(choices_len[i] >= great_mn_choice for i in range(4) if i != mn_idx):
answer = choices[mn_idx]
elif all(choices_len[i] <= great_mx_choice for i in range(4) if i != mx_idx):
answer = choices[mx_idx]
print(answer)
```
| 0
|
|
733
|
A
|
Grasshopper And the String
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
One day, the Grasshopper was jumping on the lawn and found a piece of paper with a string. Grasshopper became interested what is the minimum jump ability he should have in order to be able to reach the far end of the string, jumping only on vowels of the English alphabet. Jump ability is the maximum possible length of his jump.
Formally, consider that at the begginning the Grasshopper is located directly in front of the leftmost character of the string. His goal is to reach the position right after the rightmost character of the string. In one jump the Grasshopper could jump to the right any distance from 1 to the value of his jump ability.
The following letters are vowels: 'A', 'E', 'I', 'O', 'U' and 'Y'.
|
The first line contains non-empty string consisting of capital English letters. It is guaranteed that the length of the string does not exceed 100.
|
Print single integer *a* — the minimum jump ability of the Grasshopper (in the number of symbols) that is needed to overcome the given string, jumping only on vowels.
|
[
"ABABBBACFEYUKOTT\n",
"AAA\n"
] |
[
"4",
"1"
] |
none
| 500
|
[
{
"input": "ABABBBACFEYUKOTT",
"output": "4"
},
{
"input": "AAA",
"output": "1"
},
{
"input": "A",
"output": "1"
},
{
"input": "B",
"output": "2"
},
{
"input": "AEYUIOAEIYAEOUIYOEIUYEAOIUEOEAYOEIUYAEOUIYEOIKLMJNHGTRWSDZXCVBNMHGFDSXVWRTPPPLKMNBXIUOIUOIUOIUOOIU",
"output": "39"
},
{
"input": "AEYUIOAEIYAEOUIYOEIUYEAOIUEOEAYOEIUYAEOUIYEOIAEYUIOAEIYAEOUIYOEIUYEAOIUEOEAYOEIUYAEOUIYEOI",
"output": "1"
},
{
"input": "KMLPTGFHNBVCDRFGHNMBVXWSQFDCVBNHTJKLPMNFVCKMLPTGFHNBVCDRFGHNMBVXWSQFDCVBNHTJKLPMNFVC",
"output": "85"
},
{
"input": "QWERTYUIOPASDFGHJKLZXCVBNMQWERTYUIOPASDFGHJKLZXCVBNMQWERTYUIOPASDFGHJKLZXCVBNMQWERTYUIOPASDFGHJKLZ",
"output": "18"
},
{
"input": "PKLKBWTXVJ",
"output": "11"
},
{
"input": "CFHFPTGMOKXVLJJZJDQW",
"output": "12"
},
{
"input": "TXULTFSBUBFLRNQORMMULWNVLPWTYJXZBPBGAWNX",
"output": "9"
},
{
"input": "DAIUSEAUEUYUWEIOOEIOUYVYYOPEEWEBZOOOAOXUOIEUKYYOJOYAUYUUIYUXOUJLGIYEIIYUOCUAACRY",
"output": "4"
},
{
"input": "VRPHBNWNWVWBWMFJJDCTJQJDJBKSJRZLVQRVVFLTZFSGCGDXCWQVWWWMFVCQHPKXXVRKTGWGPSMQTPKNDQJHNSKLXPCXDJDQDZZD",
"output": "101"
},
{
"input": "SGDDFCDRDWGPNNFBBZZJSPXFYMZKPRXTCHVJSJJBWZXXQMDZBNKDHRGSRLGLRKPMWXNSXJPNJLDPXBSRCQMHJKPZNTPNTZXNPCJC",
"output": "76"
},
{
"input": "NVTQVNLGWFDBCBKSDLTBGWBMNQZWZQJWNGVCTCQBGWNTYJRDBPZJHXCXFMIXNRGSTXHQPCHNFQPCMDZWJGLJZWMRRFCVLBKDTDSC",
"output": "45"
},
{
"input": "SREZXQFVPQCLRCQGMKXCBRWKYZKWKRMZGXPMKWNMFZTRDPHJFCSXVPPXWKZMZTBFXGNLPLHZIPLFXNRRQFDTLFPKBGCXKTMCFKKT",
"output": "48"
},
{
"input": "ICKJKMVPDNZPLKDSLTPZNRLSQSGHQJQQPJJSNHNWVDLJRLZEJSXZDPHYXGGWXHLCTVQSKWNWGTLJMOZVJNZPVXGVPJKHFVZTGCCX",
"output": "47"
},
{
"input": "XXFPZDRPXLNHGDVCBDKJMKLGUQZXLLWYLOKFZVGXVNPJWZZZNRMQBRJCZTSDRHSNCVDMHKVXCXPCRBWSJCJWDRDPVZZLCZRTDRYA",
"output": "65"
},
{
"input": "HDDRZDKCHHHEDKHZMXQSNQGSGNNSCCPVJFGXGNCEKJMRKSGKAPQWPCWXXWHLSMRGSJWEHWQCSJJSGLQJXGVTBYALWMLKTTJMFPFS",
"output": "28"
},
{
"input": "PXVKJHXVDPWGLHWFWMJPMCCNHCKSHCPZXGIHHNMYNFQBUCKJJTXXJGKRNVRTQFDFMLLGPQKFOVNNLTNDIEXSARRJKGSCZKGGJCBW",
"output": "35"
},
{
"input": "EXNMTTFPJLDHXDQBJJRDRYBZVFFHUDCHCPNFZWXSMZXNFVJGHZWXVBRQFNUIDVLZOVPXQNVMFNBTJDSCKRLNGXPSADTGCAHCBJKL",
"output": "30"
},
{
"input": "NRNLSQQJGIJBCZFTNKJCXMGPARGWXPSHZXOBNSFOLDQVXTVAGJZNLXULHBRDGMNQKQGWMRRDPYCSNFVPUFTFBUBRXVJGNGSPJKLL",
"output": "19"
},
{
"input": "SRHOKCHQQMVZKTCVQXJJCFGYFXGMBZSZFNAFETXILZHPGHBWZRZQFMGSEYRUDVMCIQTXTBTSGFTHRRNGNTHHWWHCTDFHSVARMCMB",
"output": "30"
},
{
"input": "HBSVZHDKGNIRQUBYKYHUPJCEETGFMVBZJTHYHFQPFBVBSMQACYAVWZXSBGNKWXFNMQJFMSCHJVWBZXZGSNBRUHTHAJKVLEXFBOFB",
"output": "34"
},
{
"input": "NXKMUGOPTUQNSRYTKUKSCWCRQSZKKFPYUMDIBJAHJCEKZJVWZAWOLOEFBFXLQDDPNNZKCQHUPBFVDSXSUCVLMZXQROYQYIKPQPWR",
"output": "17"
},
{
"input": "TEHJDICFNOLQVQOAREVAGUAWODOCXJXIHYXFAEPEXRHPKEIIRCRIVASKNTVYUYDMUQKSTSSBYCDVZKDDHTSDWJWACPCLYYOXGCLT",
"output": "15"
},
{
"input": "LCJJUZZFEIUTMSEXEYNOOAIZMORQDOANAMUCYTFRARDCYHOYOPHGGYUNOGNXUAOYSEMXAZOOOFAVHQUBRNGORSPNQWZJYQQUNPEB",
"output": "9"
},
{
"input": "UUOKAOOJBXUTSMOLOOOOSUYYFTAVBNUXYFVOOGCGZYQEOYISIYOUULUAIJUYVVOENJDOCLHOSOHIHDEJOIGZNIXEMEGZACHUAQFW",
"output": "5"
},
{
"input": "OUUBEHXOOURMOAIAEHXCUOIYHUJEVAWYRCIIAGDRIPUIPAIUYAIWJEVYEYYUYBYOGVYESUJCFOJNUAHIOOKBUUHEJFEWPOEOUHYA",
"output": "4"
},
{
"input": "EMNOYEEUIOUHEWZITIAEZNCJUOUAOQEAUYEIHYUSUYUUUIAEDIOOERAEIRBOJIEVOMECOGAIAIUIYYUWYIHIOWVIJEYUEAFYULSE",
"output": "5"
},
{
"input": "BVOYEAYOIEYOREJUYEUOEOYIISYAEOUYAAOIOEOYOOOIEFUAEAAESUOOIIEUAAGAEISIAPYAHOOEYUJHUECGOYEIDAIRTBHOYOYA",
"output": "5"
},
{
"input": "GOIEOAYIEYYOOEOAIAEOOUWYEIOTNYAANAYOOXEEOEAVIOIAAIEOIAUIAIAAUEUAOIAEUOUUZYIYAIEUEGOOOOUEIYAEOSYAEYIO",
"output": "3"
},
{
"input": "AUEAOAYIAOYYIUIOAULIOEUEYAIEYYIUOEOEIEYRIYAYEYAEIIMMAAEAYAAAAEOUICAUAYOUIAOUIAIUOYEOEEYAEYEYAAEAOYIY",
"output": "3"
},
{
"input": "OAIIYEYYAOOEIUOEEIOUOIAEFIOAYETUYIOAAAEYYOYEYOEAUIIUEYAYYIIAOIEEYGYIEAAOOWYAIEYYYIAOUUOAIAYAYYOEUEOY",
"output": "2"
},
{
"input": "EEEAOEOEEIOUUUEUEAAOEOIUYJEYAIYIEIYYEAUOIIYIUOOEUCYEOOOYYYIUUAYIAOEUEIEAOUOIAACAOOUAUIYYEAAAOOUYIAAE",
"output": "2"
},
{
"input": "AYEYIIEUIYOYAYEUEIIIEUYUUAUEUIYAIAAUYONIEYIUIAEUUOUOYYOUUUIUIAEYEOUIIUOUUEOAIUUYAAEOAAEOYUUIYAYRAIII",
"output": "2"
},
{
"input": "YOOAAUUAAAYEUYIUIUYIUOUAEIEEIAUEOAUIIAAIUYEUUOYUIYEAYAAAYUEEOEEAEOEEYYOUAEUYEEAIIYEUEYJOIIYUIOIUOIEE",
"output": "2"
},
{
"input": "UYOIIIAYOOAIUUOOEEUYIOUAEOOEIOUIAIEYOAEAIOOEOOOIUYYUYIAAUIOUYYOOUAUIEYYUOAAUUEAAIEUIAUEUUIAUUOYOAYIU",
"output": "1"
},
{
"input": "ABBABBB",
"output": "4"
},
{
"input": "ABCD",
"output": "4"
},
{
"input": "XXYC",
"output": "3"
},
{
"input": "YYY",
"output": "1"
},
{
"input": "ABABBBBBBB",
"output": "8"
},
{
"input": "YYYY",
"output": "1"
},
{
"input": "YYYYY",
"output": "1"
},
{
"input": "AXXX",
"output": "4"
},
{
"input": "YYYYYYY",
"output": "1"
},
{
"input": "BYYBBB",
"output": "4"
},
{
"input": "YYYYYYYYY",
"output": "1"
},
{
"input": "CAAAAA",
"output": "2"
},
{
"input": "CCCACCCC",
"output": "5"
},
{
"input": "ABABBBACFEYUKOTTTT",
"output": "5"
},
{
"input": "AABBYYYYYYYY",
"output": "3"
},
{
"input": "BYBACYC",
"output": "2"
},
{
"input": "Y",
"output": "1"
},
{
"input": "ABBBBBB",
"output": "7"
},
{
"input": "BACDYDI",
"output": "3"
},
{
"input": "XEXXXXXXXXXXXXXXX",
"output": "16"
},
{
"input": "TTYTT",
"output": "3"
},
{
"input": "AAYBC",
"output": "3"
},
{
"input": "ABABBBACFEYUKOTTTTT",
"output": "6"
},
{
"input": "YYAYY",
"output": "1"
},
{
"input": "YZZY",
"output": "3"
},
{
"input": "YY",
"output": "1"
},
{
"input": "ZZYZZ",
"output": "3"
},
{
"input": "YBBBY",
"output": "4"
},
{
"input": "BBBACCCCCCC",
"output": "8"
},
{
"input": "YBBBBY",
"output": "5"
},
{
"input": "YYYYYYYYYY",
"output": "1"
},
{
"input": "ABABBBBBBBBBBBB",
"output": "13"
}
] | 1,578,828,962
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 70
| 155
| 819,200
|
import re
s = input()
print(len(max(re.split('[AEIOUY]', s), key = len))+1)
|
Title: Grasshopper And the String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day, the Grasshopper was jumping on the lawn and found a piece of paper with a string. Grasshopper became interested what is the minimum jump ability he should have in order to be able to reach the far end of the string, jumping only on vowels of the English alphabet. Jump ability is the maximum possible length of his jump.
Formally, consider that at the begginning the Grasshopper is located directly in front of the leftmost character of the string. His goal is to reach the position right after the rightmost character of the string. In one jump the Grasshopper could jump to the right any distance from 1 to the value of his jump ability.
The following letters are vowels: 'A', 'E', 'I', 'O', 'U' and 'Y'.
Input Specification:
The first line contains non-empty string consisting of capital English letters. It is guaranteed that the length of the string does not exceed 100.
Output Specification:
Print single integer *a* — the minimum jump ability of the Grasshopper (in the number of symbols) that is needed to overcome the given string, jumping only on vowels.
Demo Input:
['ABABBBACFEYUKOTT\n', 'AAA\n']
Demo Output:
['4', '1']
Note:
none
|
```python
import re
s = input()
print(len(max(re.split('[AEIOUY]', s), key = len))+1)
```
| 3
|
|
71
|
A
|
Way Too Long Words
|
PROGRAMMING
| 800
|
[
"strings"
] |
A. Way Too Long Words
|
1
|
256
|
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation.
This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes.
Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n".
You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
|
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
|
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
|
[
"4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n"
] |
[
"word\nl10n\ni18n\np43s\n"
] |
none
| 500
|
[
{
"input": "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis",
"output": "word\nl10n\ni18n\np43s"
},
{
"input": "5\nabcdefgh\nabcdefghi\nabcdefghij\nabcdefghijk\nabcdefghijklm",
"output": "abcdefgh\nabcdefghi\nabcdefghij\na9k\na11m"
},
{
"input": "3\nnjfngnrurunrgunrunvurn\njfvnjfdnvjdbfvsbdubruvbubvkdb\nksdnvidnviudbvibd",
"output": "n20n\nj27b\nk15d"
},
{
"input": "1\ntcyctkktcctrcyvbyiuhihhhgyvyvyvyvjvytchjckt",
"output": "t41t"
},
{
"input": "24\nyou\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nunofficially\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings",
"output": "you\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nu10y\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "26\na\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz",
"output": "a\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz"
},
{
"input": "1\nabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij",
"output": "a98j"
},
{
"input": "10\ngyartjdxxlcl\nfzsck\nuidwu\nxbymclornemdmtj\nilppyoapitawgje\ncibzc\ndrgbeu\nhezplmsdekhhbo\nfeuzlrimbqbytdu\nkgdco",
"output": "g10l\nfzsck\nuidwu\nx13j\ni13e\ncibzc\ndrgbeu\nh12o\nf13u\nkgdco"
},
{
"input": "20\nlkpmx\nkovxmxorlgwaomlswjxlpnbvltfv\nhykasjxqyjrmybejnmeumzha\ntuevlumpqbbhbww\nqgqsphvrmupxxc\ntrissbaf\nqfgrlinkzvzqdryckaizutd\nzzqtoaxkvwoscyx\noswytrlnhpjvvnwookx\nlpuzqgec\ngyzqfwxggtvpjhzmzmdw\nrlxjgmvdftvrmvbdwudra\nvsntnjpepnvdaxiporggmglhagv\nxlvcqkqgcrbgtgglj\nlyxwxbiszyhlsrgzeedzprbmcpduvq\nyrmqqvrkqskqukzqrwukpsifgtdc\nxpuohcsjhhuhvr\nvvlfrlxpvqejngwrbfbpmqeirxlw\nsvmasocxdvadmaxtrpakysmeaympy\nyuflqboqfdt",
"output": "lkpmx\nk26v\nh22a\nt13w\nq12c\ntrissbaf\nq21d\nz13x\no17x\nlpuzqgec\ng18w\nr19a\nv25v\nx15j\nl28q\ny26c\nx12r\nv26w\ns27y\ny9t"
},
{
"input": "100\nm\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr",
"output": "m\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr"
}
] | 1,693,232,085
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 0
|
name = input()
if len(name) <= 10:
print(name)
else:
print(name[0], end='')
print(len(name) - 2, end='')
print(name[len(name) - 1])
|
Title: Way Too Long Words
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation.
This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes.
Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n".
You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
Output Specification:
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
Demo Input:
['4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n']
Demo Output:
['word\nl10n\ni18n\np43s\n']
Note:
none
|
```python
name = input()
if len(name) <= 10:
print(name)
else:
print(name[0], end='')
print(len(name) - 2, end='')
print(name[len(name) - 1])
```
| 0
|
34
|
B
|
Sale
|
PROGRAMMING
| 900
|
[
"greedy",
"sortings"
] |
B. Sale
|
2
|
256
|
Once Bob got to a sale of old TV sets. There were *n* TV sets at that sale. TV set with index *i* costs *a**i* bellars. Some TV sets have a negative price — their owners are ready to pay Bob if he buys their useless apparatus. Bob can «buy» any TV sets he wants. Though he's very strong, Bob can carry at most *m* TV sets, and he has no desire to go to the sale for the second time. Please, help Bob find out the maximum sum of money that he can earn.
|
The first line contains two space-separated integers *n* and *m* (1<=≤<=*m*<=≤<=*n*<=≤<=100) — amount of TV sets at the sale, and amount of TV sets that Bob can carry. The following line contains *n* space-separated integers *a**i* (<=-<=1000<=≤<=*a**i*<=≤<=1000) — prices of the TV sets.
|
Output the only number — the maximum sum of money that Bob can earn, given that he can carry at most *m* TV sets.
|
[
"5 3\n-6 0 35 -2 4\n",
"4 2\n7 0 0 -7\n"
] |
[
"8\n",
"7\n"
] |
none
| 1,000
|
[
{
"input": "5 3\n-6 0 35 -2 4",
"output": "8"
},
{
"input": "4 2\n7 0 0 -7",
"output": "7"
},
{
"input": "6 6\n756 -611 251 -66 572 -818",
"output": "1495"
},
{
"input": "5 5\n976 437 937 788 518",
"output": "0"
},
{
"input": "5 3\n-2 -2 -2 -2 -2",
"output": "6"
},
{
"input": "5 1\n998 997 985 937 998",
"output": "0"
},
{
"input": "2 2\n-742 -187",
"output": "929"
},
{
"input": "3 3\n522 597 384",
"output": "0"
},
{
"input": "4 2\n-215 -620 192 647",
"output": "835"
},
{
"input": "10 6\n557 605 685 231 910 633 130 838 -564 -85",
"output": "649"
},
{
"input": "20 14\n932 442 960 943 624 624 955 998 631 910 850 517 715 123 1000 155 -10 961 966 59",
"output": "10"
},
{
"input": "30 5\n991 997 996 967 977 999 991 986 1000 965 984 997 998 1000 958 983 974 1000 991 999 1000 978 961 992 990 998 998 978 998 1000",
"output": "0"
},
{
"input": "50 20\n-815 -947 -946 -993 -992 -846 -884 -954 -963 -733 -940 -746 -766 -930 -821 -937 -937 -999 -914 -938 -936 -975 -939 -981 -977 -952 -925 -901 -952 -978 -994 -957 -946 -896 -905 -836 -994 -951 -887 -939 -859 -953 -985 -988 -946 -829 -956 -842 -799 -886",
"output": "19441"
},
{
"input": "88 64\n999 999 1000 1000 999 996 995 1000 1000 999 1000 997 998 1000 999 1000 997 1000 993 998 994 999 998 996 1000 997 1000 1000 1000 997 1000 998 997 1000 1000 998 1000 998 999 1000 996 999 999 999 996 995 999 1000 998 999 1000 999 999 1000 1000 1000 996 1000 1000 1000 997 1000 1000 997 999 1000 1000 1000 1000 1000 999 999 1000 1000 996 999 1000 1000 995 999 1000 996 1000 998 999 999 1000 999",
"output": "0"
},
{
"input": "99 17\n-993 -994 -959 -989 -991 -995 -976 -997 -990 -1000 -996 -994 -999 -995 -1000 -983 -979 -1000 -989 -968 -994 -992 -962 -993 -999 -983 -991 -979 -995 -993 -973 -999 -995 -995 -999 -993 -995 -992 -947 -1000 -999 -998 -982 -988 -979 -993 -963 -988 -980 -990 -979 -976 -995 -999 -981 -988 -998 -999 -970 -1000 -983 -994 -943 -975 -998 -977 -973 -997 -959 -999 -983 -985 -950 -977 -977 -991 -998 -973 -987 -985 -985 -986 -984 -994 -978 -998 -989 -989 -988 -970 -985 -974 -997 -981 -962 -972 -995 -988 -993",
"output": "16984"
},
{
"input": "100 37\n205 19 -501 404 912 -435 -322 -469 -655 880 -804 -470 793 312 -108 586 -642 -928 906 605 -353 -800 745 -440 -207 752 -50 -28 498 -800 -62 -195 602 -833 489 352 536 404 -775 23 145 -512 524 759 651 -461 -427 -557 684 -366 62 592 -563 -811 64 418 -881 -308 591 -318 -145 -261 -321 -216 -18 595 -202 960 -4 219 226 -238 -882 -963 425 970 -434 -160 243 -672 -4 873 8 -633 904 -298 -151 -377 -61 -72 -677 -66 197 -716 3 -870 -30 152 -469 981",
"output": "21743"
},
{
"input": "100 99\n-931 -806 -830 -828 -916 -962 -660 -867 -952 -966 -820 -906 -724 -982 -680 -717 -488 -741 -897 -613 -986 -797 -964 -939 -808 -932 -810 -860 -641 -916 -858 -628 -821 -929 -917 -976 -664 -985 -778 -665 -624 -928 -940 -958 -884 -757 -878 -896 -634 -526 -514 -873 -990 -919 -988 -878 -650 -973 -774 -783 -733 -648 -756 -895 -833 -974 -832 -725 -841 -748 -806 -613 -924 -867 -881 -943 -864 -991 -809 -926 -777 -817 -998 -682 -910 -996 -241 -722 -964 -904 -821 -920 -835 -699 -805 -632 -779 -317 -915 -654",
"output": "81283"
},
{
"input": "100 14\n995 994 745 684 510 737 984 690 979 977 542 933 871 603 758 653 962 997 747 974 773 766 975 770 527 960 841 989 963 865 974 967 950 984 757 685 986 809 982 959 931 880 978 867 805 562 970 900 834 782 616 885 910 608 974 918 576 700 871 980 656 941 978 759 767 840 573 859 841 928 693 853 716 927 976 851 962 962 627 797 707 873 869 988 993 533 665 887 962 880 929 980 877 887 572 790 721 883 848 782",
"output": "0"
},
{
"input": "100 84\n768 946 998 752 931 912 826 1000 991 910 875 962 901 952 958 733 959 908 872 840 923 826 952 980 974 980 947 955 959 822 997 963 966 933 829 923 971 999 926 932 865 984 974 858 994 855 949 941 992 861 951 949 991 711 763 728 935 485 716 907 869 952 960 859 909 963 978 942 968 933 923 909 997 962 687 764 924 774 875 1000 961 951 987 974 848 921 966 859 995 997 974 931 886 941 974 986 906 978 998 823",
"output": "0"
},
{
"input": "100 80\n-795 -994 -833 -930 -974 -980 -950 -940 -788 -927 -583 -956 -945 -949 -809 -974 -957 -736 -967 -908 -975 -961 -986 -983 -963 -771 -952 -847 -751 -741 -982 -959 -925 -931 -839 -937 -880 -914 -858 -998 -812 -911 -862 -965 -943 -984 -738 -920 -950 -998 -909 -998 -781 -901 -677 -940 -985 -951 -675 -952 -967 -949 -882 -641 -969 -937 -975 -993 -913 -941 -807 -851 -832 -960 -939 -943 -895 -929 -528 -880 -823 -930 -888 -862 -948 -966 -962 -857 -799 -969 -833 -998 -952 -878 -946 -971 -976 -974 -723 -992",
"output": "75068"
},
{
"input": "1 1\n0",
"output": "0"
},
{
"input": "1 1\n1",
"output": "0"
},
{
"input": "1 1\n555",
"output": "0"
},
{
"input": "1 1\n-1",
"output": "1"
},
{
"input": "1 1\n-24",
"output": "24"
}
] | 1,652,431,297
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 25
| 186
| 0
|
n, m = map(int, input().split())
a = list(map(int, input().split()))
a = sorted(a)
print(sum(-a[i] for i in range(m) if a[i]<=0))
|
Title: Sale
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Once Bob got to a sale of old TV sets. There were *n* TV sets at that sale. TV set with index *i* costs *a**i* bellars. Some TV sets have a negative price — their owners are ready to pay Bob if he buys their useless apparatus. Bob can «buy» any TV sets he wants. Though he's very strong, Bob can carry at most *m* TV sets, and he has no desire to go to the sale for the second time. Please, help Bob find out the maximum sum of money that he can earn.
Input Specification:
The first line contains two space-separated integers *n* and *m* (1<=≤<=*m*<=≤<=*n*<=≤<=100) — amount of TV sets at the sale, and amount of TV sets that Bob can carry. The following line contains *n* space-separated integers *a**i* (<=-<=1000<=≤<=*a**i*<=≤<=1000) — prices of the TV sets.
Output Specification:
Output the only number — the maximum sum of money that Bob can earn, given that he can carry at most *m* TV sets.
Demo Input:
['5 3\n-6 0 35 -2 4\n', '4 2\n7 0 0 -7\n']
Demo Output:
['8\n', '7\n']
Note:
none
|
```python
n, m = map(int, input().split())
a = list(map(int, input().split()))
a = sorted(a)
print(sum(-a[i] for i in range(m) if a[i]<=0))
```
| 3.9535
|
617
|
A
|
Elephant
|
PROGRAMMING
| 800
|
[
"math"
] | null | null |
An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=><=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house.
|
The first line of the input contains an integer *x* (1<=≤<=*x*<=≤<=1<=000<=000) — The coordinate of the friend's house.
|
Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*.
|
[
"5\n",
"12\n"
] |
[
"1\n",
"3\n"
] |
In the first sample the elephant needs to make one step of length 5 to reach the point *x*.
In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
| 500
|
[
{
"input": "5",
"output": "1"
},
{
"input": "12",
"output": "3"
},
{
"input": "999999",
"output": "200000"
},
{
"input": "41",
"output": "9"
},
{
"input": "1000000",
"output": "200000"
},
{
"input": "1",
"output": "1"
},
{
"input": "2",
"output": "1"
},
{
"input": "3",
"output": "1"
},
{
"input": "4",
"output": "1"
},
{
"input": "534204",
"output": "106841"
},
{
"input": "469569",
"output": "93914"
},
{
"input": "502877",
"output": "100576"
},
{
"input": "942212",
"output": "188443"
},
{
"input": "97",
"output": "20"
},
{
"input": "53",
"output": "11"
},
{
"input": "89",
"output": "18"
},
{
"input": "574",
"output": "115"
},
{
"input": "716",
"output": "144"
},
{
"input": "729",
"output": "146"
},
{
"input": "8901",
"output": "1781"
},
{
"input": "3645",
"output": "729"
},
{
"input": "4426",
"output": "886"
},
{
"input": "46573",
"output": "9315"
},
{
"input": "86380",
"output": "17276"
},
{
"input": "94190",
"output": "18838"
},
{
"input": "999990",
"output": "199998"
},
{
"input": "999991",
"output": "199999"
},
{
"input": "999992",
"output": "199999"
},
{
"input": "999993",
"output": "199999"
},
{
"input": "999994",
"output": "199999"
},
{
"input": "999995",
"output": "199999"
},
{
"input": "999996",
"output": "200000"
},
{
"input": "999997",
"output": "200000"
},
{
"input": "999998",
"output": "200000"
}
] | 1,694,167,832
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 31
| 0
|
x=int(input())
s=0
if x==5:
print(1)
elif x>5:
a=x//5
x=x-(a*5)
s=s+a+1
print(s)
else:
print(x)
|
Title: Elephant
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=><=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house.
Input Specification:
The first line of the input contains an integer *x* (1<=≤<=*x*<=≤<=1<=000<=000) — The coordinate of the friend's house.
Output Specification:
Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*.
Demo Input:
['5\n', '12\n']
Demo Output:
['1\n', '3\n']
Note:
In the first sample the elephant needs to make one step of length 5 to reach the point *x*.
In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
|
```python
x=int(input())
s=0
if x==5:
print(1)
elif x>5:
a=x//5
x=x-(a*5)
s=s+a+1
print(s)
else:
print(x)
```
| 0
|
|
476
|
B
|
Dreamoon and WiFi
|
PROGRAMMING
| 1,300
|
[
"bitmasks",
"brute force",
"combinatorics",
"dp",
"math",
"probabilities"
] | null | null |
Dreamoon is standing at the position 0 on a number line. Drazil is sending a list of commands through Wi-Fi to Dreamoon's smartphone and Dreamoon follows them.
Each command is one of the following two types:
1. Go 1 unit towards the positive direction, denoted as '+' 1. Go 1 unit towards the negative direction, denoted as '-'
But the Wi-Fi condition is so poor that Dreamoon's smartphone reports some of the commands can't be recognized and Dreamoon knows that some of them might even be wrong though successfully recognized. Dreamoon decides to follow every recognized command and toss a fair coin to decide those unrecognized ones (that means, he moves to the 1 unit to the negative or positive direction with the same probability 0.5).
You are given an original list of commands sent by Drazil and list received by Dreamoon. What is the probability that Dreamoon ends in the position originally supposed to be final by Drazil's commands?
|
The first line contains a string *s*1 — the commands Drazil sends to Dreamoon, this string consists of only the characters in the set {'+', '-'}.
The second line contains a string *s*2 — the commands Dreamoon's smartphone recognizes, this string consists of only the characters in the set {'+', '-', '?'}. '?' denotes an unrecognized command.
Lengths of two strings are equal and do not exceed 10.
|
Output a single real number corresponding to the probability. The answer will be considered correct if its relative or absolute error doesn't exceed 10<=-<=9.
|
[
"++-+-\n+-+-+\n",
"+-+-\n+-??\n",
"+++\n??-\n"
] |
[
"1.000000000000\n",
"0.500000000000\n",
"0.000000000000\n"
] |
For the first sample, both *s*<sub class="lower-index">1</sub> and *s*<sub class="lower-index">2</sub> will lead Dreamoon to finish at the same position + 1.
For the second sample, *s*<sub class="lower-index">1</sub> will lead Dreamoon to finish at position 0, while there are four possibilites for *s*<sub class="lower-index">2</sub>: {"+-++", "+-+-", "+--+", "+---"} with ending position {+2, 0, 0, -2} respectively. So there are 2 correct cases out of 4, so the probability of finishing at the correct position is 0.5.
For the third sample, *s*<sub class="lower-index">2</sub> could only lead us to finish at positions {+1, -1, -3}, so the probability to finish at the correct position + 3 is 0.
| 1,500
|
[
{
"input": "++-+-\n+-+-+",
"output": "1.000000000000"
},
{
"input": "+-+-\n+-??",
"output": "0.500000000000"
},
{
"input": "+++\n??-",
"output": "0.000000000000"
},
{
"input": "++++++++++\n+++??++?++",
"output": "0.125000000000"
},
{
"input": "--+++---+-\n??????????",
"output": "0.205078125000"
},
{
"input": "+--+++--+-\n??????????",
"output": "0.246093750000"
},
{
"input": "+\n+",
"output": "1.000000000000"
},
{
"input": "-\n?",
"output": "0.500000000000"
},
{
"input": "+\n-",
"output": "0.000000000000"
},
{
"input": "-\n-",
"output": "1.000000000000"
},
{
"input": "-\n+",
"output": "0.000000000000"
},
{
"input": "+\n?",
"output": "0.500000000000"
},
{
"input": "++++++++++\n++++++++++",
"output": "1.000000000000"
},
{
"input": "++++++++++\n++++-+++++",
"output": "0.000000000000"
},
{
"input": "----------\n++++++++++",
"output": "0.000000000000"
},
{
"input": "++++++++++\n++++??++++",
"output": "0.250000000000"
},
{
"input": "----------\n+++?++++-+",
"output": "0.000000000000"
},
{
"input": "++++++++++\n++++++++?+",
"output": "0.500000000000"
},
{
"input": "--++++--+\n?-+?-??+-",
"output": "0.250000000000"
},
{
"input": "----------\n??????????",
"output": "0.000976562500"
},
{
"input": "+--++\n+--+-",
"output": "0.000000000000"
},
{
"input": "-----++---\n????????+?",
"output": "0.017578125000"
},
{
"input": "------+--+\n??????????",
"output": "0.043945312500"
},
{
"input": "---++--\n???????",
"output": "0.164062500000"
},
{
"input": "-----++\n???????",
"output": "0.164062500000"
},
{
"input": "+---+--\n???????",
"output": "0.164062500000"
},
{
"input": "---+-+\n??????",
"output": "0.234375000000"
},
{
"input": "+++-+\n---++",
"output": "0.000000000000"
},
{
"input": "++-+--+\n?-?+??+",
"output": "0.375000000000"
},
{
"input": "----+++--\n-+?+++?--",
"output": "0.000000000000"
},
{
"input": "+-----\n+?----",
"output": "0.500000000000"
}
] | 1,682,933,304
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 46
| 0
|
def fac(cnt,n):
ans = 1
for i in range(1,n+1):
ans *= (cnt-i+1)
ans /= i*1
return ans
s1 = str(input())
s2 = str(input())
pos1 = 0
pos2 = 0
neg1 = 0
neg2 = 0
i =0
cnt = 0
while i<len(s1):
if s1[i] == '+':
pos1 += 1
if s2[i] == '-':
neg2 += 1
elif s2[i] == '+':
pos2 += 1
else:
cnt += 1
i += 1
else:
neg1 += 1
if s2[i] == '-':
neg2 += 1
elif s2[i] == '+':
pos2 += 1
else:
cnt += 1
i += 1
if pos2>pos1 or neg2>neg1:
print(0)
elif (pos1 == pos2) and (neg1 == neg2):
print(1)
else:
pos1 -=pos2
neg1 -=neg2
ans = 1
ans *= fac(cnt,pos1)
ans = ans/(2**cnt)
print('{0:.12f}'.format(ans))
|
Title: Dreamoon and WiFi
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dreamoon is standing at the position 0 on a number line. Drazil is sending a list of commands through Wi-Fi to Dreamoon's smartphone and Dreamoon follows them.
Each command is one of the following two types:
1. Go 1 unit towards the positive direction, denoted as '+' 1. Go 1 unit towards the negative direction, denoted as '-'
But the Wi-Fi condition is so poor that Dreamoon's smartphone reports some of the commands can't be recognized and Dreamoon knows that some of them might even be wrong though successfully recognized. Dreamoon decides to follow every recognized command and toss a fair coin to decide those unrecognized ones (that means, he moves to the 1 unit to the negative or positive direction with the same probability 0.5).
You are given an original list of commands sent by Drazil and list received by Dreamoon. What is the probability that Dreamoon ends in the position originally supposed to be final by Drazil's commands?
Input Specification:
The first line contains a string *s*1 — the commands Drazil sends to Dreamoon, this string consists of only the characters in the set {'+', '-'}.
The second line contains a string *s*2 — the commands Dreamoon's smartphone recognizes, this string consists of only the characters in the set {'+', '-', '?'}. '?' denotes an unrecognized command.
Lengths of two strings are equal and do not exceed 10.
Output Specification:
Output a single real number corresponding to the probability. The answer will be considered correct if its relative or absolute error doesn't exceed 10<=-<=9.
Demo Input:
['++-+-\n+-+-+\n', '+-+-\n+-??\n', '+++\n??-\n']
Demo Output:
['1.000000000000\n', '0.500000000000\n', '0.000000000000\n']
Note:
For the first sample, both *s*<sub class="lower-index">1</sub> and *s*<sub class="lower-index">2</sub> will lead Dreamoon to finish at the same position + 1.
For the second sample, *s*<sub class="lower-index">1</sub> will lead Dreamoon to finish at position 0, while there are four possibilites for *s*<sub class="lower-index">2</sub>: {"+-++", "+-+-", "+--+", "+---"} with ending position {+2, 0, 0, -2} respectively. So there are 2 correct cases out of 4, so the probability of finishing at the correct position is 0.5.
For the third sample, *s*<sub class="lower-index">2</sub> could only lead us to finish at positions {+1, -1, -3}, so the probability to finish at the correct position + 3 is 0.
|
```python
def fac(cnt,n):
ans = 1
for i in range(1,n+1):
ans *= (cnt-i+1)
ans /= i*1
return ans
s1 = str(input())
s2 = str(input())
pos1 = 0
pos2 = 0
neg1 = 0
neg2 = 0
i =0
cnt = 0
while i<len(s1):
if s1[i] == '+':
pos1 += 1
if s2[i] == '-':
neg2 += 1
elif s2[i] == '+':
pos2 += 1
else:
cnt += 1
i += 1
else:
neg1 += 1
if s2[i] == '-':
neg2 += 1
elif s2[i] == '+':
pos2 += 1
else:
cnt += 1
i += 1
if pos2>pos1 or neg2>neg1:
print(0)
elif (pos1 == pos2) and (neg1 == neg2):
print(1)
else:
pos1 -=pos2
neg1 -=neg2
ans = 1
ans *= fac(cnt,pos1)
ans = ans/(2**cnt)
print('{0:.12f}'.format(ans))
```
| 3
|
|
703
|
A
|
Mishka and Game
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Mishka is a little polar bear. As known, little bears loves spending their free time playing dice for chocolates. Once in a wonderful sunny morning, walking around blocks of ice, Mishka met her friend Chris, and they started playing the game.
Rules of the game are very simple: at first number of rounds *n* is defined. In every round each of the players throws a cubical dice with distinct numbers from 1 to 6 written on its faces. Player, whose value after throwing the dice is greater, wins the round. In case if player dice values are equal, no one of them is a winner.
In average, player, who won most of the rounds, is the winner of the game. In case if two players won the same number of rounds, the result of the game is draw.
Mishka is still very little and can't count wins and losses, so she asked you to watch their game and determine its result. Please help her!
|
The first line of the input contains single integer *n* *n* (1<=≤<=*n*<=≤<=100) — the number of game rounds.
The next *n* lines contains rounds description. *i*-th of them contains pair of integers *m**i* and *c**i* (1<=≤<=*m**i*,<=<=*c**i*<=≤<=6) — values on dice upper face after Mishka's and Chris' throws in *i*-th round respectively.
|
If Mishka is the winner of the game, print "Mishka" (without quotes) in the only line.
If Chris is the winner of the game, print "Chris" (without quotes) in the only line.
If the result of the game is draw, print "Friendship is magic!^^" (without quotes) in the only line.
|
[
"3\n3 5\n2 1\n4 2\n",
"2\n6 1\n1 6\n",
"3\n1 5\n3 3\n2 2\n"
] |
[
"Mishka",
"Friendship is magic!^^",
"Chris"
] |
In the first sample case Mishka loses the first round, but wins second and third rounds and thus she is the winner of the game.
In the second sample case Mishka wins the first round, Chris wins the second round, and the game ends with draw with score 1:1.
In the third sample case Chris wins the first round, but there is no winner of the next two rounds. The winner of the game is Chris.
| 500
|
[
{
"input": "3\n3 5\n2 1\n4 2",
"output": "Mishka"
},
{
"input": "2\n6 1\n1 6",
"output": "Friendship is magic!^^"
},
{
"input": "3\n1 5\n3 3\n2 2",
"output": "Chris"
},
{
"input": "6\n4 1\n4 2\n5 3\n5 1\n5 3\n4 1",
"output": "Mishka"
},
{
"input": "8\n2 4\n1 4\n1 5\n2 6\n2 5\n2 5\n2 4\n2 5",
"output": "Chris"
},
{
"input": "8\n4 1\n2 6\n4 2\n2 5\n5 2\n3 5\n5 2\n1 5",
"output": "Friendship is magic!^^"
},
{
"input": "9\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n1 3",
"output": "Mishka"
},
{
"input": "9\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "9\n1 2\n1 2\n1 2\n1 2\n1 2\n6 1\n6 1\n6 1\n6 1",
"output": "Chris"
},
{
"input": "9\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "10\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n1 4",
"output": "Mishka"
},
{
"input": "10\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "10\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n6 1\n6 1\n6 1\n6 1",
"output": "Chris"
},
{
"input": "10\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "100\n2 4\n6 6\n3 2\n1 5\n5 2\n1 5\n1 5\n3 1\n6 5\n4 3\n1 1\n5 1\n3 3\n2 4\n1 5\n3 4\n5 1\n5 5\n2 5\n2 1\n4 3\n6 5\n1 1\n2 1\n1 3\n1 1\n6 4\n4 6\n6 4\n2 1\n2 5\n6 2\n3 4\n5 5\n1 4\n4 6\n3 4\n1 6\n5 1\n4 3\n3 4\n2 2\n1 2\n2 3\n1 3\n4 4\n5 5\n4 5\n4 4\n3 1\n4 5\n2 3\n2 6\n6 5\n6 1\n6 6\n2 3\n6 4\n3 3\n2 5\n4 4\n3 1\n2 4\n6 1\n3 2\n1 3\n5 4\n6 6\n2 5\n5 1\n1 1\n2 5\n6 5\n3 6\n5 6\n4 3\n3 4\n3 4\n6 5\n5 2\n4 2\n1 1\n3 1\n2 6\n1 6\n1 2\n6 1\n3 4\n1 6\n3 1\n5 3\n1 3\n5 6\n2 1\n6 4\n3 1\n1 6\n6 3\n3 3\n4 3",
"output": "Chris"
},
{
"input": "100\n4 1\n3 4\n4 6\n4 5\n6 5\n5 3\n6 2\n6 3\n5 2\n4 5\n1 5\n5 4\n1 4\n4 5\n4 6\n1 6\n4 4\n5 1\n6 4\n6 4\n4 6\n2 3\n6 2\n4 6\n1 4\n2 3\n4 3\n1 3\n6 2\n3 1\n3 4\n2 6\n4 5\n5 4\n2 2\n2 5\n4 1\n2 2\n3 3\n1 4\n5 6\n6 4\n4 2\n6 1\n5 5\n4 1\n2 1\n6 4\n4 4\n4 3\n5 3\n4 5\n5 3\n3 5\n6 3\n1 1\n3 4\n6 3\n6 1\n5 1\n2 4\n4 3\n2 2\n5 5\n1 5\n5 3\n4 6\n1 4\n6 3\n4 3\n2 4\n3 2\n2 4\n3 4\n6 2\n5 6\n1 2\n1 5\n5 5\n2 6\n5 1\n1 6\n5 3\n3 5\n2 6\n4 6\n6 2\n3 1\n5 5\n6 1\n3 6\n4 4\n1 1\n4 6\n5 3\n4 2\n5 1\n3 3\n2 1\n1 4",
"output": "Mishka"
},
{
"input": "100\n6 3\n4 5\n4 3\n5 4\n5 1\n6 3\n4 2\n4 6\n3 1\n2 4\n2 2\n4 6\n5 3\n5 5\n4 2\n6 2\n2 3\n4 4\n6 4\n3 5\n2 4\n2 2\n5 2\n3 5\n2 4\n4 4\n3 5\n6 5\n1 3\n1 6\n2 2\n2 4\n3 2\n5 4\n1 6\n3 4\n4 1\n1 5\n1 4\n5 3\n2 2\n4 5\n6 3\n4 4\n1 1\n4 1\n2 4\n4 1\n4 5\n5 3\n1 1\n1 6\n5 6\n6 6\n4 2\n4 3\n3 4\n3 6\n3 4\n6 5\n3 4\n5 4\n5 1\n5 3\n5 1\n1 2\n2 6\n3 4\n6 5\n4 3\n1 1\n5 5\n5 1\n3 3\n5 2\n1 3\n6 6\n5 6\n1 4\n4 4\n1 4\n3 6\n6 5\n3 3\n3 6\n1 5\n1 2\n3 6\n3 6\n4 1\n5 2\n1 2\n5 2\n3 3\n4 4\n4 2\n6 2\n5 4\n6 1\n6 3",
"output": "Mishka"
},
{
"input": "8\n4 1\n6 2\n4 1\n5 3\n4 1\n5 3\n6 2\n5 3",
"output": "Mishka"
},
{
"input": "5\n3 6\n3 5\n3 5\n1 6\n3 5",
"output": "Chris"
},
{
"input": "4\n4 1\n2 4\n5 3\n3 6",
"output": "Friendship is magic!^^"
},
{
"input": "6\n6 3\n5 1\n6 3\n4 3\n4 3\n5 2",
"output": "Mishka"
},
{
"input": "7\n3 4\n1 4\n2 5\n1 6\n1 6\n1 5\n3 4",
"output": "Chris"
},
{
"input": "6\n6 2\n2 5\n5 2\n3 6\n4 3\n1 6",
"output": "Friendship is magic!^^"
},
{
"input": "8\n6 1\n5 3\n4 3\n4 1\n5 1\n4 2\n4 2\n4 1",
"output": "Mishka"
},
{
"input": "9\n2 5\n2 5\n1 4\n2 6\n2 4\n2 5\n2 6\n1 5\n2 5",
"output": "Chris"
},
{
"input": "4\n6 2\n2 4\n4 2\n3 6",
"output": "Friendship is magic!^^"
},
{
"input": "9\n5 2\n4 1\n4 1\n5 1\n6 2\n6 1\n5 3\n6 1\n6 2",
"output": "Mishka"
},
{
"input": "8\n2 4\n3 6\n1 6\n1 6\n2 4\n3 4\n3 6\n3 4",
"output": "Chris"
},
{
"input": "6\n5 3\n3 6\n6 2\n1 6\n5 1\n3 5",
"output": "Friendship is magic!^^"
},
{
"input": "6\n5 2\n5 1\n6 1\n5 2\n4 2\n5 1",
"output": "Mishka"
},
{
"input": "5\n1 4\n2 5\n3 4\n2 6\n3 4",
"output": "Chris"
},
{
"input": "4\n6 2\n3 4\n5 1\n1 6",
"output": "Friendship is magic!^^"
},
{
"input": "93\n4 3\n4 1\n4 2\n5 2\n5 3\n6 3\n4 3\n6 2\n6 3\n5 1\n4 2\n4 2\n5 1\n6 2\n6 3\n6 1\n4 1\n6 2\n5 3\n4 3\n4 1\n4 2\n5 2\n6 3\n5 2\n5 2\n6 3\n5 1\n6 2\n5 2\n4 1\n5 2\n5 1\n4 1\n6 1\n5 2\n4 3\n5 3\n5 3\n5 1\n4 3\n4 3\n4 2\n4 1\n6 2\n6 1\n4 1\n5 2\n5 2\n6 2\n5 3\n5 1\n6 2\n5 1\n6 3\n5 2\n6 2\n6 2\n4 2\n5 2\n6 1\n6 3\n6 3\n5 1\n5 1\n4 1\n5 1\n4 3\n5 3\n6 3\n4 1\n4 3\n6 1\n6 1\n4 2\n6 2\n4 2\n5 2\n4 1\n5 2\n4 1\n5 1\n5 2\n5 1\n4 1\n6 3\n6 2\n4 3\n4 1\n5 2\n4 3\n5 2\n5 1",
"output": "Mishka"
},
{
"input": "11\n1 6\n1 6\n2 4\n2 5\n3 4\n1 5\n1 6\n1 5\n1 6\n2 6\n3 4",
"output": "Chris"
},
{
"input": "70\n6 1\n3 6\n4 3\n2 5\n5 2\n1 4\n6 2\n1 6\n4 3\n1 4\n5 3\n2 4\n5 3\n1 6\n5 1\n3 5\n4 2\n2 4\n5 1\n3 5\n6 2\n1 5\n4 2\n2 5\n5 3\n1 5\n4 2\n1 4\n5 2\n2 6\n4 3\n1 5\n6 2\n3 4\n4 2\n3 5\n6 3\n3 4\n5 1\n1 4\n4 2\n1 4\n6 3\n2 6\n5 2\n1 6\n6 1\n2 6\n5 3\n1 5\n5 1\n1 6\n4 1\n1 5\n4 2\n2 4\n5 1\n2 5\n6 3\n1 4\n6 3\n3 6\n5 1\n1 4\n5 3\n3 5\n4 2\n3 4\n6 2\n1 4",
"output": "Friendship is magic!^^"
},
{
"input": "59\n4 1\n5 3\n6 1\n4 2\n5 1\n4 3\n6 1\n5 1\n4 3\n4 3\n5 2\n5 3\n4 1\n6 2\n5 1\n6 3\n6 3\n5 2\n5 2\n6 1\n4 1\n6 1\n4 3\n5 3\n5 3\n4 3\n4 2\n4 2\n6 3\n6 3\n6 1\n4 3\n5 1\n6 2\n6 1\n4 1\n6 1\n5 3\n4 2\n5 1\n6 2\n6 2\n4 3\n5 3\n4 3\n6 3\n5 2\n5 2\n4 3\n5 1\n5 3\n6 1\n6 3\n6 3\n4 3\n5 2\n5 2\n5 2\n4 3",
"output": "Mishka"
},
{
"input": "42\n1 5\n1 6\n1 6\n1 4\n2 5\n3 6\n1 6\n3 4\n2 5\n2 5\n2 4\n1 4\n3 4\n2 4\n2 6\n1 5\n3 6\n2 6\n2 6\n3 5\n1 4\n1 5\n2 6\n3 6\n1 4\n3 4\n2 4\n1 6\n3 4\n2 4\n2 6\n1 6\n1 4\n1 6\n1 6\n2 4\n1 5\n1 6\n2 5\n3 6\n3 5\n3 4",
"output": "Chris"
},
{
"input": "78\n4 3\n3 5\n4 3\n1 5\n5 1\n1 5\n4 3\n1 4\n6 3\n1 5\n4 1\n2 4\n4 3\n2 4\n5 1\n3 6\n4 2\n3 6\n6 3\n3 4\n4 3\n3 6\n5 3\n1 5\n4 1\n2 6\n4 2\n2 4\n4 1\n3 5\n5 2\n3 6\n4 3\n2 4\n6 3\n1 6\n4 3\n3 5\n6 3\n2 6\n4 1\n2 4\n6 2\n1 6\n4 2\n1 4\n4 3\n1 4\n4 3\n2 4\n6 2\n3 5\n6 1\n3 6\n5 3\n1 6\n6 1\n2 6\n4 2\n1 5\n6 2\n2 6\n6 3\n2 4\n4 2\n3 5\n6 1\n2 5\n5 3\n2 6\n5 1\n3 6\n4 3\n3 6\n6 3\n2 5\n6 1\n2 6",
"output": "Friendship is magic!^^"
},
{
"input": "76\n4 1\n5 2\n4 3\n5 2\n5 3\n5 2\n6 1\n4 2\n6 2\n5 3\n4 2\n6 2\n4 1\n4 2\n5 1\n5 1\n6 2\n5 2\n5 3\n6 3\n5 2\n4 3\n6 3\n6 1\n4 3\n6 2\n6 1\n4 1\n6 1\n5 3\n4 1\n5 3\n4 2\n5 2\n4 3\n6 1\n6 2\n5 2\n6 1\n5 3\n4 3\n5 1\n5 3\n4 3\n5 1\n5 1\n4 1\n4 1\n4 1\n4 3\n5 3\n6 3\n6 3\n5 2\n6 2\n6 3\n5 1\n6 3\n5 3\n6 1\n5 3\n4 1\n5 3\n6 1\n4 2\n6 2\n4 3\n4 1\n6 2\n4 3\n5 3\n5 2\n5 3\n5 1\n6 3\n5 2",
"output": "Mishka"
},
{
"input": "84\n3 6\n3 4\n2 5\n2 4\n1 6\n3 4\n1 5\n1 6\n3 5\n1 6\n2 4\n2 6\n2 6\n2 4\n3 5\n1 5\n3 6\n3 6\n3 4\n3 4\n2 6\n1 6\n1 6\n3 5\n3 4\n1 6\n3 4\n3 5\n2 4\n2 5\n2 5\n3 5\n1 6\n3 4\n2 6\n2 6\n3 4\n3 4\n2 5\n2 5\n2 4\n3 4\n2 5\n3 4\n3 4\n2 6\n2 6\n1 6\n2 4\n1 5\n3 4\n2 5\n2 5\n3 4\n2 4\n2 6\n2 6\n1 4\n3 5\n3 5\n2 4\n2 5\n3 4\n1 5\n1 5\n2 6\n1 5\n3 5\n2 4\n2 5\n3 4\n2 6\n1 6\n2 5\n3 5\n3 5\n3 4\n2 5\n2 6\n3 4\n1 6\n2 5\n2 6\n1 4",
"output": "Chris"
},
{
"input": "44\n6 1\n1 6\n5 2\n1 4\n6 2\n2 5\n5 3\n3 6\n5 2\n1 6\n4 1\n2 4\n6 1\n3 4\n6 3\n3 6\n4 3\n2 4\n6 1\n3 4\n6 1\n1 6\n4 1\n3 5\n6 1\n3 6\n4 1\n1 4\n4 2\n2 6\n6 1\n2 4\n6 2\n1 4\n6 2\n2 4\n5 2\n3 6\n6 3\n2 6\n5 3\n3 4\n5 3\n2 4",
"output": "Friendship is magic!^^"
},
{
"input": "42\n5 3\n5 1\n5 2\n4 1\n6 3\n6 1\n6 2\n4 1\n4 3\n4 1\n5 1\n5 3\n5 1\n4 1\n4 2\n6 1\n6 3\n5 1\n4 1\n4 1\n6 3\n4 3\n6 3\n5 2\n6 1\n4 1\n5 3\n4 3\n5 2\n6 3\n6 1\n5 1\n4 2\n4 3\n5 2\n5 3\n6 3\n5 2\n5 1\n5 3\n6 2\n6 1",
"output": "Mishka"
},
{
"input": "50\n3 6\n2 6\n1 4\n1 4\n1 4\n2 5\n3 4\n3 5\n2 6\n1 6\n3 5\n1 5\n2 6\n2 4\n2 4\n3 5\n1 6\n1 5\n1 5\n1 4\n3 5\n1 6\n3 5\n1 4\n1 5\n1 4\n3 6\n1 6\n1 4\n1 4\n1 4\n1 5\n3 6\n1 6\n1 6\n2 4\n1 5\n2 6\n2 5\n3 5\n3 6\n3 4\n2 4\n2 6\n3 4\n2 5\n3 6\n3 5\n2 4\n2 4",
"output": "Chris"
},
{
"input": "86\n6 3\n2 4\n6 3\n3 5\n6 3\n1 5\n5 2\n2 4\n4 3\n2 6\n4 1\n2 6\n5 2\n1 4\n5 1\n2 4\n4 1\n1 4\n6 2\n3 5\n4 2\n2 4\n6 2\n1 5\n5 3\n2 5\n5 1\n1 6\n6 1\n1 4\n4 3\n3 4\n5 2\n2 4\n5 3\n2 5\n4 3\n3 4\n4 1\n1 5\n6 3\n3 4\n4 3\n3 4\n4 1\n3 4\n5 1\n1 6\n4 2\n1 6\n5 1\n2 4\n5 1\n3 6\n4 1\n1 5\n5 2\n1 4\n4 3\n2 5\n5 1\n1 5\n6 2\n2 6\n4 2\n2 4\n4 1\n2 5\n5 3\n3 4\n5 1\n3 4\n6 3\n3 4\n4 3\n2 6\n6 2\n2 5\n5 2\n3 5\n4 2\n3 6\n6 2\n3 4\n4 2\n2 4",
"output": "Friendship is magic!^^"
},
{
"input": "84\n6 1\n6 3\n6 3\n4 1\n4 3\n4 2\n6 3\n5 3\n6 1\n6 3\n4 3\n5 2\n5 3\n5 1\n6 2\n6 2\n6 1\n4 1\n6 3\n5 2\n4 1\n5 3\n6 3\n4 2\n6 2\n6 3\n4 3\n4 1\n4 3\n5 1\n5 1\n5 1\n4 1\n6 1\n4 3\n6 2\n5 1\n5 1\n6 2\n5 2\n4 1\n6 1\n6 1\n6 3\n6 2\n4 3\n6 3\n6 2\n5 2\n5 1\n4 3\n6 2\n4 1\n6 2\n6 1\n5 2\n5 1\n6 2\n6 1\n5 3\n5 2\n6 1\n6 3\n5 2\n6 1\n6 3\n4 3\n5 1\n6 3\n6 1\n5 3\n4 3\n5 2\n5 1\n6 2\n5 3\n6 1\n5 1\n4 1\n5 1\n5 1\n5 2\n5 2\n5 1",
"output": "Mishka"
},
{
"input": "92\n1 5\n2 4\n3 5\n1 6\n2 5\n1 6\n3 6\n1 6\n2 4\n3 4\n3 4\n3 6\n1 5\n2 5\n1 5\n1 5\n2 6\n2 4\n3 6\n1 4\n1 6\n2 6\n3 4\n2 6\n2 6\n1 4\n3 5\n2 5\n2 6\n1 5\n1 4\n1 5\n3 6\n3 5\n2 5\n1 5\n3 5\n3 6\n2 6\n2 6\n1 5\n3 4\n2 4\n3 6\n2 5\n1 5\n2 4\n1 4\n2 6\n2 6\n2 6\n1 5\n3 6\n3 6\n2 5\n1 4\n2 4\n3 4\n1 5\n2 5\n2 4\n2 5\n3 5\n3 4\n3 6\n2 6\n3 5\n1 4\n3 4\n1 6\n3 6\n2 6\n1 4\n3 6\n3 6\n2 5\n2 6\n1 6\n2 6\n3 5\n2 5\n3 6\n2 5\n2 6\n1 5\n2 4\n1 4\n2 4\n1 5\n2 5\n2 5\n2 6",
"output": "Chris"
},
{
"input": "20\n5 1\n1 4\n4 3\n1 5\n4 2\n3 6\n6 2\n1 6\n4 1\n1 4\n5 2\n3 4\n5 1\n1 6\n5 1\n2 6\n6 3\n2 5\n6 2\n2 4",
"output": "Friendship is magic!^^"
},
{
"input": "100\n4 3\n4 3\n4 2\n4 3\n4 1\n4 3\n5 2\n5 2\n6 2\n4 2\n5 1\n4 2\n5 2\n6 1\n4 1\n6 3\n5 3\n5 1\n5 1\n5 1\n5 3\n6 1\n6 1\n4 1\n5 2\n5 2\n6 1\n6 3\n4 2\n4 1\n5 3\n4 1\n5 3\n5 1\n6 3\n6 3\n6 1\n5 2\n5 3\n5 3\n6 1\n4 1\n6 2\n6 1\n6 2\n6 3\n4 3\n4 3\n6 3\n4 2\n4 2\n5 3\n5 2\n5 2\n4 3\n5 3\n5 2\n4 2\n5 1\n4 2\n5 1\n5 3\n6 3\n5 3\n5 3\n4 2\n4 1\n4 2\n4 3\n6 3\n4 3\n6 2\n6 1\n5 3\n5 2\n4 1\n6 1\n5 2\n6 2\n4 2\n6 3\n4 3\n5 1\n6 3\n5 2\n4 3\n5 3\n5 3\n4 3\n6 3\n4 3\n4 1\n5 1\n6 2\n6 3\n5 3\n6 1\n6 3\n5 3\n6 1",
"output": "Mishka"
},
{
"input": "100\n1 5\n1 4\n1 5\n2 4\n2 6\n3 6\n3 5\n1 5\n2 5\n3 6\n3 5\n1 6\n1 4\n1 5\n1 6\n2 6\n1 5\n3 5\n3 4\n2 6\n2 6\n2 5\n3 4\n1 6\n1 4\n2 4\n1 5\n1 6\n3 5\n1 6\n2 6\n3 5\n1 6\n3 4\n3 5\n1 6\n3 6\n2 4\n2 4\n3 5\n2 6\n1 5\n3 5\n3 6\n2 4\n2 4\n2 6\n3 4\n3 4\n1 5\n1 4\n2 5\n3 4\n1 4\n2 6\n2 5\n2 4\n2 4\n2 5\n1 5\n1 6\n1 5\n1 5\n1 5\n1 6\n3 4\n2 4\n3 5\n3 5\n1 6\n3 5\n1 5\n1 6\n3 6\n3 4\n1 5\n3 5\n3 6\n1 4\n3 6\n1 5\n3 5\n3 6\n3 5\n1 4\n3 4\n2 4\n2 4\n2 5\n3 6\n3 5\n1 5\n2 4\n1 4\n3 4\n1 5\n3 4\n3 6\n3 5\n3 4",
"output": "Chris"
},
{
"input": "100\n4 3\n3 4\n5 1\n2 5\n5 3\n1 5\n6 3\n2 4\n5 2\n2 6\n5 2\n1 5\n6 3\n1 5\n6 3\n3 4\n5 2\n1 5\n6 1\n1 5\n4 2\n3 5\n6 3\n2 6\n6 3\n1 4\n6 2\n3 4\n4 1\n3 6\n5 1\n2 4\n5 1\n3 4\n6 2\n3 5\n4 1\n2 6\n4 3\n2 6\n5 2\n3 6\n6 2\n3 5\n4 3\n1 5\n5 3\n3 6\n4 2\n3 4\n6 1\n3 4\n5 2\n2 6\n5 2\n2 4\n6 2\n3 6\n4 3\n2 4\n4 3\n2 6\n4 2\n3 4\n6 3\n2 4\n6 3\n3 5\n5 2\n1 5\n6 3\n3 6\n4 3\n1 4\n5 2\n1 6\n4 1\n2 5\n4 1\n2 4\n4 2\n2 5\n6 1\n2 4\n6 3\n1 5\n4 3\n2 6\n6 3\n2 6\n5 3\n1 5\n4 1\n1 5\n6 2\n2 5\n5 1\n3 6\n4 3\n3 4",
"output": "Friendship is magic!^^"
},
{
"input": "99\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n1 3",
"output": "Mishka"
},
{
"input": "99\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "99\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1",
"output": "Chris"
},
{
"input": "99\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "100\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n2 1\n2 1\n2 1\n1 4",
"output": "Mishka"
},
{
"input": "100\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "100\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1\n6 1",
"output": "Chris"
},
{
"input": "100\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n2 1\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6\n1 6",
"output": "Mishka"
},
{
"input": "84\n6 2\n1 5\n6 2\n2 3\n5 5\n1 2\n3 4\n3 4\n6 5\n6 4\n2 5\n4 1\n1 2\n1 1\n1 4\n2 5\n5 6\n6 3\n2 4\n5 5\n2 6\n3 4\n5 1\n3 3\n5 5\n4 6\n4 6\n2 4\n4 1\n5 2\n2 2\n3 6\n3 3\n4 6\n1 1\n2 4\n6 5\n5 2\n6 5\n5 5\n2 5\n6 4\n1 1\n6 2\n3 6\n6 5\n4 4\n1 5\n5 6\n4 4\n3 5\n6 1\n3 4\n1 5\n4 6\n4 6\n4 1\n3 6\n6 2\n1 1\n4 5\n5 4\n5 3\n3 4\n6 4\n1 1\n5 2\n6 5\n6 1\n2 2\n2 4\n3 3\n4 6\n1 3\n6 6\n5 2\n1 6\n6 2\n6 6\n4 1\n3 6\n6 4\n2 3\n3 4",
"output": "Chris"
},
{
"input": "70\n3 4\n2 3\n2 3\n6 5\n6 6\n4 3\n2 3\n3 1\n3 5\n5 6\n1 6\n2 5\n5 3\n2 5\n4 6\n5 1\n6 1\n3 1\n3 3\n5 3\n2 1\n3 3\n6 4\n6 3\n4 3\n4 5\n3 5\n5 5\n5 2\n1 6\n3 4\n5 2\n2 4\n1 6\n4 3\n4 3\n6 2\n1 3\n1 5\n6 1\n3 1\n1 1\n1 3\n2 2\n3 2\n6 4\n1 1\n4 4\n3 1\n4 5\n4 2\n6 3\n4 4\n3 2\n1 2\n2 6\n3 3\n1 5\n1 1\n6 5\n2 2\n3 1\n5 4\n5 2\n6 4\n6 3\n6 6\n6 3\n3 3\n5 4",
"output": "Mishka"
},
{
"input": "56\n6 4\n3 4\n6 1\n3 3\n1 4\n2 3\n1 5\n2 5\n1 5\n5 5\n2 3\n1 1\n3 2\n3 5\n4 6\n4 4\n5 2\n4 3\n3 1\n3 6\n2 3\n3 4\n5 6\n5 2\n5 6\n1 5\n1 5\n4 1\n6 3\n2 2\n2 1\n5 5\n2 1\n4 1\n5 4\n2 5\n4 1\n6 2\n3 4\n4 2\n6 4\n5 4\n4 2\n4 3\n6 2\n6 2\n3 1\n1 4\n3 6\n5 1\n5 5\n3 6\n6 4\n2 3\n6 5\n3 3",
"output": "Mishka"
},
{
"input": "94\n2 4\n6 4\n1 6\n1 4\n5 1\n3 3\n4 3\n6 1\n6 5\n3 2\n2 3\n5 1\n5 3\n1 2\n4 3\n3 2\n2 3\n4 6\n1 3\n6 3\n1 1\n3 2\n4 3\n1 5\n4 6\n3 2\n6 3\n1 6\n1 1\n1 2\n3 5\n1 3\n3 5\n4 4\n4 2\n1 4\n4 5\n1 3\n1 2\n1 1\n5 4\n5 5\n6 1\n2 1\n2 6\n6 6\n4 2\n3 6\n1 6\n6 6\n1 5\n3 2\n1 2\n4 4\n6 4\n4 1\n1 5\n3 3\n1 3\n3 4\n4 4\n1 1\n2 5\n4 5\n3 1\n3 1\n3 6\n3 2\n1 4\n1 6\n6 3\n2 4\n1 1\n2 2\n2 2\n2 1\n5 4\n1 2\n6 6\n2 2\n3 3\n6 3\n6 3\n1 6\n2 3\n2 4\n2 3\n6 6\n2 6\n6 3\n3 5\n1 4\n1 1\n3 5",
"output": "Chris"
},
{
"input": "81\n4 2\n1 2\n2 3\n4 5\n6 2\n1 6\n3 6\n3 4\n4 6\n4 4\n3 5\n4 6\n3 6\n3 5\n3 1\n1 3\n5 3\n3 4\n1 1\n4 1\n1 2\n6 1\n1 3\n6 5\n4 5\n4 2\n4 5\n6 2\n1 2\n2 6\n5 2\n1 5\n2 4\n4 3\n5 4\n1 2\n5 3\n2 6\n6 4\n1 1\n1 3\n3 1\n3 1\n6 5\n5 5\n6 1\n6 6\n5 2\n1 3\n1 4\n2 3\n5 5\n3 1\n3 1\n4 4\n1 6\n6 4\n2 2\n4 6\n4 4\n2 6\n2 4\n2 4\n4 1\n1 6\n1 4\n1 3\n6 5\n5 1\n1 3\n5 1\n1 4\n3 5\n2 6\n1 3\n5 6\n3 5\n4 4\n5 5\n5 6\n4 3",
"output": "Chris"
},
{
"input": "67\n6 5\n3 6\n1 6\n5 3\n5 4\n5 1\n1 6\n1 1\n3 2\n4 4\n3 1\n4 1\n1 5\n5 3\n3 3\n6 4\n2 4\n2 2\n4 3\n1 4\n1 4\n6 1\n1 2\n2 2\n5 1\n6 2\n3 5\n5 5\n2 2\n6 5\n6 2\n4 4\n3 1\n4 2\n6 6\n6 4\n5 1\n2 2\n4 5\n5 5\n4 6\n1 5\n6 3\n4 4\n1 5\n6 4\n3 6\n3 4\n1 6\n2 4\n2 1\n2 5\n6 5\n6 4\n4 1\n3 2\n1 2\n5 1\n5 6\n1 5\n3 5\n3 1\n5 3\n3 2\n5 1\n4 6\n6 6",
"output": "Mishka"
},
{
"input": "55\n6 6\n6 5\n2 2\n2 2\n6 4\n5 5\n6 5\n5 3\n1 3\n2 2\n5 6\n3 3\n3 3\n6 5\n3 5\n5 5\n1 2\n1 1\n4 6\n1 2\n5 5\n6 2\n6 3\n1 2\n5 1\n1 3\n3 3\n4 4\n2 5\n1 1\n5 3\n4 3\n2 2\n4 5\n5 6\n4 5\n6 3\n1 6\n6 4\n3 6\n1 6\n5 2\n6 3\n2 3\n5 5\n4 3\n3 1\n4 2\n1 1\n2 5\n5 3\n2 2\n6 3\n4 5\n2 2",
"output": "Mishka"
},
{
"input": "92\n2 3\n1 3\n2 6\n5 1\n5 5\n3 2\n5 6\n2 5\n3 1\n3 6\n4 5\n2 5\n1 2\n2 3\n6 5\n3 6\n4 4\n6 2\n4 5\n4 4\n5 1\n6 1\n3 4\n3 5\n6 6\n3 2\n6 4\n2 2\n3 5\n6 4\n6 3\n6 6\n3 4\n3 3\n6 1\n5 4\n6 2\n2 6\n5 6\n1 4\n4 6\n6 3\n3 1\n4 1\n6 6\n3 5\n6 3\n6 1\n1 6\n3 2\n6 6\n4 3\n3 4\n1 3\n3 5\n5 3\n6 5\n4 3\n5 5\n4 1\n1 5\n6 4\n2 3\n2 3\n1 5\n1 2\n5 2\n4 3\n3 6\n5 5\n5 4\n1 4\n3 3\n1 6\n5 6\n5 4\n5 3\n1 1\n6 2\n5 5\n2 5\n4 3\n6 6\n5 1\n1 1\n4 6\n4 6\n3 1\n6 4\n2 4\n2 2\n2 1",
"output": "Chris"
},
{
"input": "79\n5 3\n4 6\n3 6\n2 1\n5 2\n2 3\n4 4\n6 2\n2 5\n1 6\n6 6\n2 6\n3 3\n4 5\n6 2\n2 1\n1 5\n5 1\n2 1\n2 6\n5 3\n6 2\n2 6\n2 3\n1 5\n4 4\n6 3\n5 2\n3 2\n1 3\n1 3\n6 3\n2 6\n3 6\n5 3\n4 5\n6 1\n3 5\n3 5\n6 5\n1 5\n4 2\n6 2\n2 3\n4 6\n3 6\n2 5\n4 4\n1 1\n4 6\n2 6\n6 4\n3 2\n4 1\n1 2\n6 4\n5 6\n1 4\n2 2\n5 4\n3 2\n1 2\n2 4\n2 5\n2 1\n3 6\n3 3\n1 1\n2 2\n4 4\n4 5\n3 3\n5 3\n6 2\n4 5\n6 5\n2 5\n5 6\n2 2",
"output": "Chris"
},
{
"input": "65\n1 1\n5 1\n2 2\n5 4\n4 5\n2 5\n3 2\n5 6\n6 3\n1 1\n6 1\n1 5\n1 1\n5 2\n6 4\n1 6\n1 1\n4 3\n2 3\n5 6\n4 4\n6 2\n1 3\n4 3\n1 3\n6 3\n3 5\n4 2\n4 1\n6 1\n3 2\n2 6\n3 2\n3 5\n6 3\n4 3\n1 5\n2 6\n1 3\n4 1\n4 1\n2 5\n2 5\n6 2\n5 3\n3 1\n3 3\n5 1\n2 4\n5 3\n3 3\n1 1\n6 3\n3 3\n5 1\n1 6\n4 5\n6 6\n5 5\n2 5\n4 1\n2 2\n1 4\n1 6\n6 5",
"output": "Mishka"
},
{
"input": "1\n1 1",
"output": "Friendship is magic!^^"
}
] | 1,670,816,221
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 69
| 46
| 0
|
a = int(input())
l = []
d = []
m = 0
c = 0
z = 0
for x in range(0, a):
r = input()
w = r.split()
l.append(w[0])
d.append(w[1])
for y in range(0, a):
if l[y] > d[y]:
m += 1
elif l[y] < d[y]:
c += 1
else:
z += 1
if m > c:
print("Mishka")
elif m < c:
print("Chris")
else:
print("Friendship is magic!^^")
|
Title: Mishka and Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mishka is a little polar bear. As known, little bears loves spending their free time playing dice for chocolates. Once in a wonderful sunny morning, walking around blocks of ice, Mishka met her friend Chris, and they started playing the game.
Rules of the game are very simple: at first number of rounds *n* is defined. In every round each of the players throws a cubical dice with distinct numbers from 1 to 6 written on its faces. Player, whose value after throwing the dice is greater, wins the round. In case if player dice values are equal, no one of them is a winner.
In average, player, who won most of the rounds, is the winner of the game. In case if two players won the same number of rounds, the result of the game is draw.
Mishka is still very little and can't count wins and losses, so she asked you to watch their game and determine its result. Please help her!
Input Specification:
The first line of the input contains single integer *n* *n* (1<=≤<=*n*<=≤<=100) — the number of game rounds.
The next *n* lines contains rounds description. *i*-th of them contains pair of integers *m**i* and *c**i* (1<=≤<=*m**i*,<=<=*c**i*<=≤<=6) — values on dice upper face after Mishka's and Chris' throws in *i*-th round respectively.
Output Specification:
If Mishka is the winner of the game, print "Mishka" (without quotes) in the only line.
If Chris is the winner of the game, print "Chris" (without quotes) in the only line.
If the result of the game is draw, print "Friendship is magic!^^" (without quotes) in the only line.
Demo Input:
['3\n3 5\n2 1\n4 2\n', '2\n6 1\n1 6\n', '3\n1 5\n3 3\n2 2\n']
Demo Output:
['Mishka', 'Friendship is magic!^^', 'Chris']
Note:
In the first sample case Mishka loses the first round, but wins second and third rounds and thus she is the winner of the game.
In the second sample case Mishka wins the first round, Chris wins the second round, and the game ends with draw with score 1:1.
In the third sample case Chris wins the first round, but there is no winner of the next two rounds. The winner of the game is Chris.
|
```python
a = int(input())
l = []
d = []
m = 0
c = 0
z = 0
for x in range(0, a):
r = input()
w = r.split()
l.append(w[0])
d.append(w[1])
for y in range(0, a):
if l[y] > d[y]:
m += 1
elif l[y] < d[y]:
c += 1
else:
z += 1
if m > c:
print("Mishka")
elif m < c:
print("Chris")
else:
print("Friendship is magic!^^")
```
| 3
|
|
799
|
A
|
Carrot Cakes
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] | null | null |
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
|
The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
|
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
|
[
"8 6 4 5\n",
"8 6 4 6\n",
"10 3 11 4\n",
"4 2 1 4\n"
] |
[
"YES\n",
"NO\n",
"NO\n",
"YES\n"
] |
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
| 500
|
[
{
"input": "8 6 4 5",
"output": "YES"
},
{
"input": "8 6 4 6",
"output": "NO"
},
{
"input": "10 3 11 4",
"output": "NO"
},
{
"input": "4 2 1 4",
"output": "YES"
},
{
"input": "28 17 16 26",
"output": "NO"
},
{
"input": "60 69 9 438",
"output": "NO"
},
{
"input": "599 97 54 992",
"output": "YES"
},
{
"input": "11 22 18 17",
"output": "NO"
},
{
"input": "1 13 22 11",
"output": "NO"
},
{
"input": "1 1 1 1",
"output": "NO"
},
{
"input": "3 1 1 1",
"output": "YES"
},
{
"input": "1000 1000 1000 1000",
"output": "NO"
},
{
"input": "1000 1000 1 1",
"output": "YES"
},
{
"input": "1000 1000 1 400",
"output": "YES"
},
{
"input": "1000 1000 1 1000",
"output": "YES"
},
{
"input": "1000 1000 1 999",
"output": "YES"
},
{
"input": "53 11 3 166",
"output": "YES"
},
{
"input": "313 2 3 385",
"output": "NO"
},
{
"input": "214 9 9 412",
"output": "NO"
},
{
"input": "349 9 5 268",
"output": "YES"
},
{
"input": "611 16 8 153",
"output": "YES"
},
{
"input": "877 13 3 191",
"output": "YES"
},
{
"input": "340 9 9 10",
"output": "YES"
},
{
"input": "31 8 2 205",
"output": "NO"
},
{
"input": "519 3 2 148",
"output": "YES"
},
{
"input": "882 2 21 219",
"output": "NO"
},
{
"input": "982 13 5 198",
"output": "YES"
},
{
"input": "428 13 6 272",
"output": "YES"
},
{
"input": "436 16 14 26",
"output": "YES"
},
{
"input": "628 10 9 386",
"output": "YES"
},
{
"input": "77 33 18 31",
"output": "YES"
},
{
"input": "527 36 4 8",
"output": "YES"
},
{
"input": "128 18 2 169",
"output": "YES"
},
{
"input": "904 4 2 288",
"output": "YES"
},
{
"input": "986 4 3 25",
"output": "YES"
},
{
"input": "134 8 22 162",
"output": "NO"
},
{
"input": "942 42 3 69",
"output": "YES"
},
{
"input": "894 4 9 4",
"output": "YES"
},
{
"input": "953 8 10 312",
"output": "YES"
},
{
"input": "43 8 1 121",
"output": "YES"
},
{
"input": "12 13 19 273",
"output": "NO"
},
{
"input": "204 45 10 871",
"output": "YES"
},
{
"input": "342 69 50 425",
"output": "NO"
},
{
"input": "982 93 99 875",
"output": "NO"
},
{
"input": "283 21 39 132",
"output": "YES"
},
{
"input": "1000 45 83 686",
"output": "NO"
},
{
"input": "246 69 36 432",
"output": "NO"
},
{
"input": "607 93 76 689",
"output": "NO"
},
{
"input": "503 21 24 435",
"output": "NO"
},
{
"input": "1000 45 65 989",
"output": "NO"
},
{
"input": "30 21 2 250",
"output": "YES"
},
{
"input": "1000 49 50 995",
"output": "NO"
},
{
"input": "383 69 95 253",
"output": "YES"
},
{
"input": "393 98 35 999",
"output": "YES"
},
{
"input": "1000 22 79 552",
"output": "NO"
},
{
"input": "268 294 268 154",
"output": "NO"
},
{
"input": "963 465 706 146",
"output": "YES"
},
{
"input": "304 635 304 257",
"output": "NO"
},
{
"input": "4 2 1 6",
"output": "NO"
},
{
"input": "1 51 10 50",
"output": "NO"
},
{
"input": "5 5 4 4",
"output": "YES"
},
{
"input": "3 2 1 1",
"output": "YES"
},
{
"input": "3 4 3 3",
"output": "NO"
},
{
"input": "7 3 4 1",
"output": "YES"
},
{
"input": "101 10 1 1000",
"output": "NO"
},
{
"input": "5 1 1 1",
"output": "YES"
},
{
"input": "5 10 5 5",
"output": "NO"
},
{
"input": "19 1 7 1",
"output": "YES"
},
{
"input": "763 572 745 262",
"output": "YES"
},
{
"input": "1 2 1 1",
"output": "NO"
},
{
"input": "5 1 1 3",
"output": "YES"
},
{
"input": "170 725 479 359",
"output": "NO"
},
{
"input": "6 2 1 7",
"output": "YES"
},
{
"input": "6 2 5 1",
"output": "YES"
},
{
"input": "1 2 2 1",
"output": "NO"
},
{
"input": "24 2 8 3",
"output": "YES"
},
{
"input": "7 3 3 3",
"output": "YES"
},
{
"input": "5 2 2 2",
"output": "YES"
},
{
"input": "3 2 1 2",
"output": "YES"
},
{
"input": "1000 2 200 8",
"output": "NO"
},
{
"input": "3 100 2 100",
"output": "NO"
},
{
"input": "2 999 1 1000",
"output": "NO"
},
{
"input": "2 1 1 1",
"output": "NO"
},
{
"input": "2 3 5 1",
"output": "NO"
},
{
"input": "100 1 5 1",
"output": "YES"
},
{
"input": "7 2 3 3",
"output": "YES"
},
{
"input": "4 1 1 3",
"output": "NO"
},
{
"input": "3 2 2 1",
"output": "YES"
},
{
"input": "1 1 1 2",
"output": "NO"
},
{
"input": "91 8 7 13",
"output": "YES"
},
{
"input": "3 1 2 1",
"output": "NO"
},
{
"input": "5 3 2 3",
"output": "YES"
},
{
"input": "9 6 6 3",
"output": "YES"
}
] | 1,644,951,475
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 6
| 31
| 0
|
n,t,k,d= map (int,input().split())
v1=0
v2=d
ck=0
while ck<n :
v1+=t
ck+=k
if v1>=d and ck<n :
v2+=t
ck+=k
if (n//k)*t <= v2 :
print('NO')
else :
print('YES')
|
Title: Carrot Cakes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
Input Specification:
The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
Output Specification:
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
Demo Input:
['8 6 4 5\n', '8 6 4 6\n', '10 3 11 4\n', '4 2 1 4\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n', 'YES\n']
Note:
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
|
```python
n,t,k,d= map (int,input().split())
v1=0
v2=d
ck=0
while ck<n :
v1+=t
ck+=k
if v1>=d and ck<n :
v2+=t
ck+=k
if (n//k)*t <= v2 :
print('NO')
else :
print('YES')
```
| 0
|
|
625
|
B
|
War of the Corporations
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms",
"greedy",
"strings"
] | null | null |
A long time ago, in a galaxy far far away two giant IT-corporations Pineapple and Gogol continue their fierce competition. Crucial moment is just around the corner: Gogol is ready to release it's new tablet Lastus 3000.
This new device is equipped with specially designed artificial intelligence (AI). Employees of Pineapple did their best to postpone the release of Lastus 3000 as long as possible. Finally, they found out, that the name of the new artificial intelligence is similar to the name of the phone, that Pineapple released 200 years ago. As all rights on its name belong to Pineapple, they stand on changing the name of Gogol's artificial intelligence.
Pineapple insists, that the name of their phone occurs in the name of AI as a substring. Because the name of technology was already printed on all devices, the Gogol's director decided to replace some characters in AI name with "#". As this operation is pretty expensive, you should find the minimum number of characters to replace with "#", such that the name of AI doesn't contain the name of the phone as a substring.
Substring is a continuous subsequence of a string.
|
The first line of the input contains the name of AI designed by Gogol, its length doesn't exceed 100<=000 characters. Second line contains the name of the phone released by Pineapple 200 years ago, its length doesn't exceed 30. Both string are non-empty and consist of only small English letters.
|
Print the minimum number of characters that must be replaced with "#" in order to obtain that the name of the phone doesn't occur in the name of AI as a substring.
|
[
"intellect\ntell\n",
"google\napple\n",
"sirisiri\nsir\n"
] |
[
"1",
"0",
"2"
] |
In the first sample AI's name may be replaced with "int#llect".
In the second sample Gogol can just keep things as they are.
In the third sample one of the new possible names of AI may be "s#ris#ri".
| 750
|
[
{
"input": "intellect\ntell",
"output": "1"
},
{
"input": "google\napple",
"output": "0"
},
{
"input": "sirisiri\nsir",
"output": "2"
},
{
"input": "sirisiri\nsiri",
"output": "2"
},
{
"input": "aaaaaaa\naaaa",
"output": "1"
},
{
"input": "bbbbbb\nbb",
"output": "3"
},
{
"input": "abc\nabcabc",
"output": "0"
},
{
"input": "kek\nkekekek",
"output": "0"
},
{
"input": "aaaaa\naaa",
"output": "1"
},
{
"input": "abcdabcv\nabcd",
"output": "1"
},
{
"input": "abcabcabczabcabcabcz\ncab",
"output": "4"
},
{
"input": "aatopotopotopotaa\ntopot",
"output": "2"
},
{
"input": "abcabcabcabcabcabcabcabcabcabc\nabcabcabcabcabcabcabcabcabcabc",
"output": "1"
},
{
"input": "sosossosos\nsos",
"output": "2"
},
{
"input": "sosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosos\nsos",
"output": "20"
},
{
"input": "tatatx\ntatx",
"output": "1"
},
{
"input": "sxxsxxsxxd\nsxxsxxd",
"output": "1"
}
] | 1,506,539,948
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 56
| 77
| 2,355,200
|
# this is from codeforces problem
import re
string = input().strip()
sub = input().strip()
regex = r'%s'%sub
print(len(re.findall(regex, string)))
|
Title: War of the Corporations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A long time ago, in a galaxy far far away two giant IT-corporations Pineapple and Gogol continue their fierce competition. Crucial moment is just around the corner: Gogol is ready to release it's new tablet Lastus 3000.
This new device is equipped with specially designed artificial intelligence (AI). Employees of Pineapple did their best to postpone the release of Lastus 3000 as long as possible. Finally, they found out, that the name of the new artificial intelligence is similar to the name of the phone, that Pineapple released 200 years ago. As all rights on its name belong to Pineapple, they stand on changing the name of Gogol's artificial intelligence.
Pineapple insists, that the name of their phone occurs in the name of AI as a substring. Because the name of technology was already printed on all devices, the Gogol's director decided to replace some characters in AI name with "#". As this operation is pretty expensive, you should find the minimum number of characters to replace with "#", such that the name of AI doesn't contain the name of the phone as a substring.
Substring is a continuous subsequence of a string.
Input Specification:
The first line of the input contains the name of AI designed by Gogol, its length doesn't exceed 100<=000 characters. Second line contains the name of the phone released by Pineapple 200 years ago, its length doesn't exceed 30. Both string are non-empty and consist of only small English letters.
Output Specification:
Print the minimum number of characters that must be replaced with "#" in order to obtain that the name of the phone doesn't occur in the name of AI as a substring.
Demo Input:
['intellect\ntell\n', 'google\napple\n', 'sirisiri\nsir\n']
Demo Output:
['1', '0', '2']
Note:
In the first sample AI's name may be replaced with "int#llect".
In the second sample Gogol can just keep things as they are.
In the third sample one of the new possible names of AI may be "s#ris#ri".
|
```python
# this is from codeforces problem
import re
string = input().strip()
sub = input().strip()
regex = r'%s'%sub
print(len(re.findall(regex, string)))
```
| 3
|
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,682,320,320
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 92
| 0
|
word = input()
Upper = "QWERTYUIOPASDFGHJKLZXCVBNM"
Lower = "qwertyuiopasdfghjklzxcvbnm"
capital = 0
small = 0
for c in word :
if c in Upper :
capital += 1
if c in Lower :
small += 1
if small >= capital :
word = word.lower()
else :
word = word.upper()
print(word)
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
word = input()
Upper = "QWERTYUIOPASDFGHJKLZXCVBNM"
Lower = "qwertyuiopasdfghjklzxcvbnm"
capital = 0
small = 0
for c in word :
if c in Upper :
capital += 1
if c in Lower :
small += 1
if small >= capital :
word = word.lower()
else :
word = word.upper()
print(word)
```
| 3.977
|
863
|
D
|
Yet Another Array Queries Problem
|
PROGRAMMING
| 1,800
|
[
"data structures",
"implementation"
] | null | null |
You are given an array *a* of size *n*, and *q* queries to it. There are queries of two types:
- 1 *l**i* *r**i* — perform a cyclic shift of the segment [*l**i*,<=*r**i*] to the right. That is, for every *x* such that *l**i*<=≤<=*x*<=<<=*r**i* new value of *a**x*<=+<=1 becomes equal to old value of *a**x*, and new value of *a**l**i* becomes equal to old value of *a**r**i*; - 2 *l**i* *r**i* — reverse the segment [*l**i*,<=*r**i*].
There are *m* important indices in the array *b*1, *b*2, ..., *b**m*. For each *i* such that 1<=≤<=*i*<=≤<=*m* you have to output the number that will have index *b**i* in the array after all queries are performed.
|
The first line contains three integer numbers *n*, *q* and *m* (1<=≤<=*n*,<=*q*<=≤<=2·105, 1<=≤<=*m*<=≤<=100).
The second line contains *n* integer numbers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109).
Then *q* lines follow. *i*-th of them contains three integer numbers *t**i*, *l**i*, *r**i*, where *t**i* is the type of *i*-th query, and [*l**i*,<=*r**i*] is the segment where this query is performed (1<=≤<=*t**i*<=≤<=2, 1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*).
The last line contains *m* integer numbers *b*1, *b*2, ..., *b**m* (1<=≤<=*b**i*<=≤<=*n*) — important indices of the array.
|
Print *m* numbers, *i*-th of which is equal to the number at index *b**i* after all queries are done.
|
[
"6 3 5\n1 2 3 4 5 6\n2 1 3\n2 3 6\n1 1 6\n2 2 1 5 3\n"
] |
[
"3 3 1 5 2 \n"
] |
none
| 0
|
[
{
"input": "6 3 5\n1 2 3 4 5 6\n2 1 3\n2 3 6\n1 1 6\n2 2 1 5 3",
"output": "3 3 1 5 2 "
},
{
"input": "5 2 5\n64 3 4 665 2\n1 1 3\n2 1 5\n1 2 3 4 5",
"output": "2 665 3 64 4 "
},
{
"input": "1 1 1\n474812122\n2 1 1\n1",
"output": "474812122 "
}
] | 1,507,856,896
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 46
| 0
|
n,q,m = map(int, input().split())
data = list(map(int, input().split()))
print(data)
|
Title: Yet Another Array Queries Problem
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an array *a* of size *n*, and *q* queries to it. There are queries of two types:
- 1 *l**i* *r**i* — perform a cyclic shift of the segment [*l**i*,<=*r**i*] to the right. That is, for every *x* such that *l**i*<=≤<=*x*<=<<=*r**i* new value of *a**x*<=+<=1 becomes equal to old value of *a**x*, and new value of *a**l**i* becomes equal to old value of *a**r**i*; - 2 *l**i* *r**i* — reverse the segment [*l**i*,<=*r**i*].
There are *m* important indices in the array *b*1, *b*2, ..., *b**m*. For each *i* such that 1<=≤<=*i*<=≤<=*m* you have to output the number that will have index *b**i* in the array after all queries are performed.
Input Specification:
The first line contains three integer numbers *n*, *q* and *m* (1<=≤<=*n*,<=*q*<=≤<=2·105, 1<=≤<=*m*<=≤<=100).
The second line contains *n* integer numbers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109).
Then *q* lines follow. *i*-th of them contains three integer numbers *t**i*, *l**i*, *r**i*, where *t**i* is the type of *i*-th query, and [*l**i*,<=*r**i*] is the segment where this query is performed (1<=≤<=*t**i*<=≤<=2, 1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*).
The last line contains *m* integer numbers *b*1, *b*2, ..., *b**m* (1<=≤<=*b**i*<=≤<=*n*) — important indices of the array.
Output Specification:
Print *m* numbers, *i*-th of which is equal to the number at index *b**i* after all queries are done.
Demo Input:
['6 3 5\n1 2 3 4 5 6\n2 1 3\n2 3 6\n1 1 6\n2 2 1 5 3\n']
Demo Output:
['3 3 1 5 2 \n']
Note:
none
|
```python
n,q,m = map(int, input().split())
data = list(map(int, input().split()))
print(data)
```
| 0
|
|
560
|
A
|
Currency System in Geraldion
|
PROGRAMMING
| 1,000
|
[
"implementation",
"sortings"
] | null | null |
A magic island Geraldion, where Gerald lives, has its own currency system. It uses banknotes of several values. But the problem is, the system is not perfect and sometimes it happens that Geraldionians cannot express a certain sum of money with any set of banknotes. Of course, they can use any number of banknotes of each value. Such sum is called unfortunate. Gerald wondered: what is the minimum unfortunate sum?
|
The first line contains number *n* (1<=≤<=*n*<=≤<=1000) — the number of values of the banknotes that used in Geraldion.
The second line contains *n* distinct space-separated numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=106) — the values of the banknotes.
|
Print a single line — the minimum unfortunate sum. If there are no unfortunate sums, print <=-<=1.
|
[
"5\n1 2 3 4 5\n"
] |
[
"-1\n"
] |
none
| 500
|
[
{
"input": "5\n1 2 3 4 5",
"output": "-1"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "10\n371054 506438 397130 1 766759 208409 769264 549213 641270 771837",
"output": "-1"
},
{
"input": "10\n635370 154890 909382 220996 276501 716105 538714 140162 171960 271264",
"output": "1"
},
{
"input": "50\n110876 835020 859879 999908 712969 788264 287153 921820 330355 499311 209594 484829 296329 940051 174081 931503 1 780512 390075 97866 124255 950067 697612 244256 782385 789882 37608 82153 399889 598867 416717 377988 535636 511221 792568 683271 131077 290194 496712 330720 587436 563481 645817 942562 654093 980561 382937 48293 582608 116156",
"output": "-1"
},
{
"input": "50\n474421 421097 217233 156339 27075 733996 281778 863492 184707 956857 288561 70997 393786 337382 663642 131184 637 273801 799870 295017 392338 842567 161819 297705 102013 930684 375703 838048 154915 138503 629056 256591 893619 19263 787927 684541 320265 841090 421423 490879 394582 493952 619247 633202 612928 50907 276653 407819 489945 153173",
"output": "1"
},
{
"input": "1\n1",
"output": "-1"
},
{
"input": "1\n1000000",
"output": "1"
},
{
"input": "2\n3 2",
"output": "1"
},
{
"input": "2\n2 3",
"output": "1"
}
] | 1,573,051,069
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 16
| 109
| 0
|
n=int(input())
x=input().split()
x=[int(i) for i in x]
if 1 in x:
print(-1)
else:
print(1)
|
Title: Currency System in Geraldion
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A magic island Geraldion, where Gerald lives, has its own currency system. It uses banknotes of several values. But the problem is, the system is not perfect and sometimes it happens that Geraldionians cannot express a certain sum of money with any set of banknotes. Of course, they can use any number of banknotes of each value. Such sum is called unfortunate. Gerald wondered: what is the minimum unfortunate sum?
Input Specification:
The first line contains number *n* (1<=≤<=*n*<=≤<=1000) — the number of values of the banknotes that used in Geraldion.
The second line contains *n* distinct space-separated numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=106) — the values of the banknotes.
Output Specification:
Print a single line — the minimum unfortunate sum. If there are no unfortunate sums, print <=-<=1.
Demo Input:
['5\n1 2 3 4 5\n']
Demo Output:
['-1\n']
Note:
none
|
```python
n=int(input())
x=input().split()
x=[int(i) for i in x]
if 1 in x:
print(-1)
else:
print(1)
```
| 3
|
|
608
|
B
|
Hamming Distance Sum
|
PROGRAMMING
| 1,500
|
[
"combinatorics",
"strings"
] | null | null |
Genos needs your help. He was asked to solve the following programming problem by Saitama:
The length of some string *s* is denoted |*s*|. The Hamming distance between two strings *s* and *t* of equal length is defined as , where *s**i* is the *i*-th character of *s* and *t**i* is the *i*-th character of *t*. For example, the Hamming distance between string "0011" and string "0110" is |0<=-<=0|<=+<=|0<=-<=1|<=+<=|1<=-<=1|<=+<=|1<=-<=0|<==<=0<=+<=1<=+<=0<=+<=1<==<=2.
Given two binary strings *a* and *b*, find the sum of the Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|.
|
The first line of the input contains binary string *a* (1<=≤<=|*a*|<=≤<=200<=000).
The second line of the input contains binary string *b* (|*a*|<=≤<=|*b*|<=≤<=200<=000).
Both strings are guaranteed to consist of characters '0' and '1' only.
|
Print a single integer — the sum of Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|.
|
[
"01\n00111\n",
"0011\n0110\n"
] |
[
"3\n",
"2\n"
] |
For the first sample case, there are four contiguous substrings of *b* of length |*a*|: "00", "01", "11", and "11". The distance between "01" and "00" is |0 - 0| + |1 - 0| = 1. The distance between "01" and "01" is |0 - 0| + |1 - 1| = 0. The distance between "01" and "11" is |0 - 1| + |1 - 1| = 1. Last distance counts twice, as there are two occurrences of string "11". The sum of these edit distances is 1 + 0 + 1 + 1 = 3.
The second sample case is described in the statement.
| 1,000
|
[
{
"input": "01\n00111",
"output": "3"
},
{
"input": "0011\n0110",
"output": "2"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "1\n0",
"output": "1"
},
{
"input": "0\n1",
"output": "1"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "1001101001101110101101000\n01111000010011111111110010001101000100011110101111",
"output": "321"
},
{
"input": "1110010001000101001011111\n00011011000000100001010000010100110011010001111010",
"output": "316"
}
] | 1,658,773,283
| 2,147,483,647
|
PyPy 3-64
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 8
| 2,000
| 22,732,800
|
# Dictionary == Hash Collision
from sys import stdin
from bisect import bisect_left as bl, bisect_right as br
from collections import defaultdict, Counter, deque
def input():
return stdin.readline().strip()
def read(default=int):
return list(map(default, input().split()))
def solve():
a = list(map(int, list(input())))
b = list(map(int, list(input())))
r = len(a) - 1
d = deque([0] + b[:len(a) - 1])
ans = 0
while r < len(b):
d.popleft()
d.append(b[r])
r += 1
for x, y in zip(a, d):
ans += abs(x - y)
return ans
# t = int(input())
t = 1
for test in range(t):
print(solve())
|
Title: Hamming Distance Sum
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Genos needs your help. He was asked to solve the following programming problem by Saitama:
The length of some string *s* is denoted |*s*|. The Hamming distance between two strings *s* and *t* of equal length is defined as , where *s**i* is the *i*-th character of *s* and *t**i* is the *i*-th character of *t*. For example, the Hamming distance between string "0011" and string "0110" is |0<=-<=0|<=+<=|0<=-<=1|<=+<=|1<=-<=1|<=+<=|1<=-<=0|<==<=0<=+<=1<=+<=0<=+<=1<==<=2.
Given two binary strings *a* and *b*, find the sum of the Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|.
Input Specification:
The first line of the input contains binary string *a* (1<=≤<=|*a*|<=≤<=200<=000).
The second line of the input contains binary string *b* (|*a*|<=≤<=|*b*|<=≤<=200<=000).
Both strings are guaranteed to consist of characters '0' and '1' only.
Output Specification:
Print a single integer — the sum of Hamming distances between *a* and all contiguous substrings of *b* of length |*a*|.
Demo Input:
['01\n00111\n', '0011\n0110\n']
Demo Output:
['3\n', '2\n']
Note:
For the first sample case, there are four contiguous substrings of *b* of length |*a*|: "00", "01", "11", and "11". The distance between "01" and "00" is |0 - 0| + |1 - 0| = 1. The distance between "01" and "01" is |0 - 0| + |1 - 1| = 0. The distance between "01" and "11" is |0 - 1| + |1 - 1| = 1. Last distance counts twice, as there are two occurrences of string "11". The sum of these edit distances is 1 + 0 + 1 + 1 = 3.
The second sample case is described in the statement.
|
```python
# Dictionary == Hash Collision
from sys import stdin
from bisect import bisect_left as bl, bisect_right as br
from collections import defaultdict, Counter, deque
def input():
return stdin.readline().strip()
def read(default=int):
return list(map(default, input().split()))
def solve():
a = list(map(int, list(input())))
b = list(map(int, list(input())))
r = len(a) - 1
d = deque([0] + b[:len(a) - 1])
ans = 0
while r < len(b):
d.popleft()
d.append(b[r])
r += 1
for x, y in zip(a, d):
ans += abs(x - y)
return ans
# t = int(input())
t = 1
for test in range(t):
print(solve())
```
| 0
|
|
354
|
A
|
Vasya and Robot
|
PROGRAMMING
| 1,500
|
[
"brute force",
"greedy",
"math"
] | null | null |
Vasya has *n* items lying in a line. The items are consecutively numbered by numbers from 1 to *n* in such a way that the leftmost item has number 1, the rightmost item has number *n*. Each item has a weight, the *i*-th item weights *w**i* kilograms.
Vasya needs to collect all these items, however he won't do it by himself. He uses his brand new robot. The robot has two different arms — the left one and the right one. The robot can consecutively perform the following actions:
1. Take the leftmost item with the left hand and spend *w**i*<=·<=*l* energy units (*w**i* is a weight of the leftmost item, *l* is some parameter). If the previous action was the same (left-hand), then the robot spends extra *Q**l* energy units; 1. Take the rightmost item with the right hand and spend *w**j*<=·<=*r* energy units (*w**j* is a weight of the rightmost item, *r* is some parameter). If the previous action was the same (right-hand), then the robot spends extra *Q**r* energy units;
Naturally, Vasya wants to program the robot in a way that the robot spends as little energy as possible. He asked you to solve this problem. Your task is to find the minimum number of energy units robot spends to collect all items.
|
The first line contains five integers *n*,<=*l*,<=*r*,<=*Q**l*,<=*Q**r* (1<=≤<=*n*<=≤<=105;<=1<=≤<=*l*,<=*r*<=≤<=100;<=1<=≤<=*Q**l*,<=*Q**r*<=≤<=104).
The second line contains *n* integers *w*1,<=*w*2,<=...,<=*w**n* (1<=≤<=*w**i*<=≤<=100).
|
In the single line print a single number — the answer to the problem.
|
[
"3 4 4 19 1\n42 3 99\n",
"4 7 2 3 9\n1 2 3 4\n"
] |
[
"576\n",
"34\n"
] |
Consider the first sample. As *l* = *r*, we can take an item in turns: first from the left side, then from the right one and last item from the left. In total the robot spends 4·42 + 4·99 + 4·3 = 576 energy units.
The second sample. The optimal solution is to take one item from the right, then one item from the left and two items from the right. In total the robot spends (2·4) + (7·1) + (2·3) + (2·2 + 9) = 34 energy units.
| 500
|
[
{
"input": "3 4 4 19 1\n42 3 99",
"output": "576"
},
{
"input": "4 7 2 3 9\n1 2 3 4",
"output": "34"
},
{
"input": "2 100 100 10000 10000\n100 100",
"output": "20000"
},
{
"input": "2 3 4 5 6\n1 2",
"output": "11"
},
{
"input": "1 78 94 369 10000\n93",
"output": "7254"
},
{
"input": "1 94 78 369 10000\n93",
"output": "7254"
},
{
"input": "5 1 100 1 10000\n1 2 3 4 5",
"output": "19"
},
{
"input": "5 100 1 10000 1\n1 2 3 4 5",
"output": "19"
},
{
"input": "5 1 100 10000 1\n1 2 3 4 5",
"output": "906"
},
{
"input": "5 100 1 1 10000\n1 2 3 4 5",
"output": "312"
},
{
"input": "6 32 47 965 897\n7 4 1 3 5 4",
"output": "948"
},
{
"input": "7 3 13 30 978\n1 2 3 4 5 1 7",
"output": "199"
},
{
"input": "7 13 3 978 30\n7 1 5 4 3 2 1",
"output": "199"
}
] | 1,381,679,389
| 1,189
|
Python 3
|
OK
|
TESTS
| 23
| 249
| 5,734,400
|
#!/usr/bin/python3
import sys
n, l, r, ql, qr = map(int, sys.stdin.readline().strip().split())
w = [int(x) for x in sys.stdin.readline().strip().split()]
s = [0]
for i in range(0, n):
s.append(s[-1] + w[i])
def cost(left):
right = n - left
diff = left - right
bonus = 0
if diff > 0: # left part is larger
bonus = ql * (diff - 1)
elif diff < 0: # right part is larger
bonus = qr * (-diff - 1)
return bonus + l * s[left] + r * (s[n] - s[left])
best = cost(0)
for left in range(1, n+1):
c = cost(left)
if c < best:
best = c
print(best)
|
Title: Vasya and Robot
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has *n* items lying in a line. The items are consecutively numbered by numbers from 1 to *n* in such a way that the leftmost item has number 1, the rightmost item has number *n*. Each item has a weight, the *i*-th item weights *w**i* kilograms.
Vasya needs to collect all these items, however he won't do it by himself. He uses his brand new robot. The robot has two different arms — the left one and the right one. The robot can consecutively perform the following actions:
1. Take the leftmost item with the left hand and spend *w**i*<=·<=*l* energy units (*w**i* is a weight of the leftmost item, *l* is some parameter). If the previous action was the same (left-hand), then the robot spends extra *Q**l* energy units; 1. Take the rightmost item with the right hand and spend *w**j*<=·<=*r* energy units (*w**j* is a weight of the rightmost item, *r* is some parameter). If the previous action was the same (right-hand), then the robot spends extra *Q**r* energy units;
Naturally, Vasya wants to program the robot in a way that the robot spends as little energy as possible. He asked you to solve this problem. Your task is to find the minimum number of energy units robot spends to collect all items.
Input Specification:
The first line contains five integers *n*,<=*l*,<=*r*,<=*Q**l*,<=*Q**r* (1<=≤<=*n*<=≤<=105;<=1<=≤<=*l*,<=*r*<=≤<=100;<=1<=≤<=*Q**l*,<=*Q**r*<=≤<=104).
The second line contains *n* integers *w*1,<=*w*2,<=...,<=*w**n* (1<=≤<=*w**i*<=≤<=100).
Output Specification:
In the single line print a single number — the answer to the problem.
Demo Input:
['3 4 4 19 1\n42 3 99\n', '4 7 2 3 9\n1 2 3 4\n']
Demo Output:
['576\n', '34\n']
Note:
Consider the first sample. As *l* = *r*, we can take an item in turns: first from the left side, then from the right one and last item from the left. In total the robot spends 4·42 + 4·99 + 4·3 = 576 energy units.
The second sample. The optimal solution is to take one item from the right, then one item from the left and two items from the right. In total the robot spends (2·4) + (7·1) + (2·3) + (2·2 + 9) = 34 energy units.
|
```python
#!/usr/bin/python3
import sys
n, l, r, ql, qr = map(int, sys.stdin.readline().strip().split())
w = [int(x) for x in sys.stdin.readline().strip().split()]
s = [0]
for i in range(0, n):
s.append(s[-1] + w[i])
def cost(left):
right = n - left
diff = left - right
bonus = 0
if diff > 0: # left part is larger
bonus = ql * (diff - 1)
elif diff < 0: # right part is larger
bonus = qr * (-diff - 1)
return bonus + l * s[left] + r * (s[n] - s[left])
best = cost(0)
for left in range(1, n+1):
c = cost(left)
if c < best:
best = c
print(best)
```
| 3
|
|
977
|
A
|
Wrong Subtraction
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Little girl Tanya is learning how to decrease a number by one, but she does it wrong with a number consisting of two or more digits. Tanya subtracts one from a number by the following algorithm:
- if the last digit of the number is non-zero, she decreases the number by one; - if the last digit of the number is zero, she divides the number by 10 (i.e. removes the last digit).
You are given an integer number $n$. Tanya will subtract one from it $k$ times. Your task is to print the result after all $k$ subtractions.
It is guaranteed that the result will be positive integer number.
|
The first line of the input contains two integer numbers $n$ and $k$ ($2 \le n \le 10^9$, $1 \le k \le 50$) — the number from which Tanya will subtract and the number of subtractions correspondingly.
|
Print one integer number — the result of the decreasing $n$ by one $k$ times.
It is guaranteed that the result will be positive integer number.
|
[
"512 4\n",
"1000000000 9\n"
] |
[
"50\n",
"1\n"
] |
The first example corresponds to the following sequence: $512 \rightarrow 511 \rightarrow 510 \rightarrow 51 \rightarrow 50$.
| 0
|
[
{
"input": "512 4",
"output": "50"
},
{
"input": "1000000000 9",
"output": "1"
},
{
"input": "131203 11",
"output": "12"
},
{
"input": "999999999 50",
"output": "9999"
},
{
"input": "999999999 49",
"output": "99990"
},
{
"input": "131203 9",
"output": "130"
},
{
"input": "900000000 16",
"output": "1"
},
{
"input": "909090909 50",
"output": "3"
},
{
"input": "1001 2",
"output": "100"
},
{
"input": "5 2",
"output": "3"
},
{
"input": "2 1",
"output": "1"
}
] | 1,699,107,682
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
#include <bits/stdc++.h>
using namespace std;
#define REP(i,a,b) for (int i = a; i <= b; ++i)
#define SPEED ios::sync_with_stdio(0); cin.tie(0);
int main() {
SPEED;
int n, k; cin >> n >> k;
REP(i, 1, k) {
if (n%10 == 0) n/= 10;
else n--;
}
cout << n;
return 0;
}
|
Title: Wrong Subtraction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little girl Tanya is learning how to decrease a number by one, but she does it wrong with a number consisting of two or more digits. Tanya subtracts one from a number by the following algorithm:
- if the last digit of the number is non-zero, she decreases the number by one; - if the last digit of the number is zero, she divides the number by 10 (i.e. removes the last digit).
You are given an integer number $n$. Tanya will subtract one from it $k$ times. Your task is to print the result after all $k$ subtractions.
It is guaranteed that the result will be positive integer number.
Input Specification:
The first line of the input contains two integer numbers $n$ and $k$ ($2 \le n \le 10^9$, $1 \le k \le 50$) — the number from which Tanya will subtract and the number of subtractions correspondingly.
Output Specification:
Print one integer number — the result of the decreasing $n$ by one $k$ times.
It is guaranteed that the result will be positive integer number.
Demo Input:
['512 4\n', '1000000000 9\n']
Demo Output:
['50\n', '1\n']
Note:
The first example corresponds to the following sequence: $512 \rightarrow 511 \rightarrow 510 \rightarrow 51 \rightarrow 50$.
|
```python
#include <bits/stdc++.h>
using namespace std;
#define REP(i,a,b) for (int i = a; i <= b; ++i)
#define SPEED ios::sync_with_stdio(0); cin.tie(0);
int main() {
SPEED;
int n, k; cin >> n >> k;
REP(i, 1, k) {
if (n%10 == 0) n/= 10;
else n--;
}
cout << n;
return 0;
}
```
| -1
|
|
999
|
A
|
Mishka and Contest
|
PROGRAMMING
| 800
|
[
"brute force",
"implementation"
] | null | null |
Mishka started participating in a programming contest. There are $n$ problems in the contest. Mishka's problem-solving skill is equal to $k$.
Mishka arranges all problems from the contest into a list. Because of his weird principles, Mishka only solves problems from one of the ends of the list. Every time, he chooses which end (left or right) he will solve the next problem from. Thus, each problem Mishka solves is either the leftmost or the rightmost problem in the list.
Mishka cannot solve a problem with difficulty greater than $k$. When Mishka solves the problem, it disappears from the list, so the length of the list decreases by $1$. Mishka stops when he is unable to solve any problem from any end of the list.
How many problems can Mishka solve?
|
The first line of input contains two integers $n$ and $k$ ($1 \le n, k \le 100$) — the number of problems in the contest and Mishka's problem-solving skill.
The second line of input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the difficulty of the $i$-th problem. The problems are given in order from the leftmost to the rightmost in the list.
|
Print one integer — the maximum number of problems Mishka can solve.
|
[
"8 4\n4 2 3 1 5 1 6 4\n",
"5 2\n3 1 2 1 3\n",
"5 100\n12 34 55 43 21\n"
] |
[
"5\n",
"0\n",
"5\n"
] |
In the first example, Mishka can solve problems in the following order: $[4, 2, 3, 1, 5, 1, 6, 4] \rightarrow [2, 3, 1, 5, 1, 6, 4] \rightarrow [2, 3, 1, 5, 1, 6] \rightarrow [3, 1, 5, 1, 6] \rightarrow [1, 5, 1, 6] \rightarrow [5, 1, 6]$, so the number of solved problems will be equal to $5$.
In the second example, Mishka can't solve any problem because the difficulties of problems from both ends are greater than $k$.
In the third example, Mishka's solving skill is so amazing that he can solve all the problems.
| 0
|
[
{
"input": "8 4\n4 2 3 1 5 1 6 4",
"output": "5"
},
{
"input": "5 2\n3 1 2 1 3",
"output": "0"
},
{
"input": "5 100\n12 34 55 43 21",
"output": "5"
},
{
"input": "100 100\n44 47 36 83 76 94 86 69 31 2 22 77 37 51 10 19 25 78 53 25 1 29 48 95 35 53 22 72 49 86 60 38 13 91 89 18 54 19 71 2 25 33 65 49 53 5 95 90 100 68 25 5 87 48 45 72 34 14 100 44 94 75 80 26 25 7 57 82 49 73 55 43 42 60 34 8 51 11 71 41 81 23 20 89 12 72 68 26 96 92 32 63 13 47 19 9 35 56 79 62",
"output": "100"
},
{
"input": "100 99\n84 82 43 4 71 3 30 92 15 47 76 43 2 17 76 4 1 33 24 96 44 98 75 99 59 11 73 27 67 17 8 88 69 41 44 22 91 48 4 46 42 21 21 67 85 51 57 84 11 100 100 59 39 72 89 82 74 19 98 14 37 97 20 78 38 52 44 83 19 83 69 32 56 6 93 13 98 80 80 2 33 71 11 15 55 51 98 58 16 91 39 32 83 58 77 79 88 81 17 98",
"output": "98"
},
{
"input": "100 69\n80 31 12 89 16 35 8 28 39 12 32 51 42 67 64 53 17 88 63 97 29 41 57 28 51 33 82 75 93 79 57 86 32 100 83 82 99 33 1 27 86 22 65 15 60 100 42 37 38 85 26 43 90 62 91 13 1 92 16 20 100 19 28 30 23 6 5 69 24 22 9 1 10 14 28 14 25 9 32 8 67 4 39 7 10 57 15 7 8 35 62 6 53 59 62 13 24 7 53 2",
"output": "39"
},
{
"input": "100 2\n2 2 2 2 1 1 1 2 1 2 2 2 1 2 2 2 2 1 2 1 2 1 1 1 2 1 2 1 2 1 1 2 2 2 2 2 1 2 1 2 1 1 2 1 2 1 1 2 1 2 1 2 2 1 2 1 2 1 1 2 1 2 2 1 1 2 2 2 1 1 2 1 1 2 2 2 1 1 1 2 2 2 1 2 1 2 1 1 1 1 1 1 1 1 1 1 1 2 2 16",
"output": "99"
},
{
"input": "100 3\n86 53 82 40 2 20 59 2 46 63 75 49 24 81 70 22 9 9 93 72 47 23 29 77 78 51 17 59 19 71 35 3 20 60 70 9 11 96 71 94 91 19 88 93 50 49 72 19 53 30 38 67 62 71 81 86 5 26 5 32 63 98 1 97 22 32 87 65 96 55 43 85 56 37 56 67 12 100 98 58 77 54 18 20 33 53 21 66 24 64 42 71 59 32 51 69 49 79 10 1",
"output": "1"
},
{
"input": "13 7\n1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "13"
},
{
"input": "1 5\n4",
"output": "1"
},
{
"input": "3 2\n1 4 1",
"output": "2"
},
{
"input": "1 2\n100",
"output": "0"
},
{
"input": "7 4\n4 2 3 4 4 2 3",
"output": "7"
},
{
"input": "1 2\n1",
"output": "1"
},
{
"input": "1 2\n15",
"output": "0"
},
{
"input": "2 1\n1 1",
"output": "2"
},
{
"input": "5 3\n3 4 3 2 1",
"output": "4"
},
{
"input": "1 1\n2",
"output": "0"
},
{
"input": "1 5\n1",
"output": "1"
},
{
"input": "6 6\n7 1 1 1 1 1",
"output": "5"
},
{
"input": "5 5\n6 5 5 5 5",
"output": "4"
},
{
"input": "1 4\n2",
"output": "1"
},
{
"input": "9 4\n1 2 1 2 4 2 1 2 1",
"output": "9"
},
{
"input": "1 1\n1",
"output": "1"
},
{
"input": "1 10\n5",
"output": "1"
},
{
"input": "5 5\n1 1 1 1 1",
"output": "5"
},
{
"input": "100 10\n2 5 1 10 10 2 7 7 9 4 1 8 1 1 8 4 7 9 10 5 7 9 5 6 7 2 7 5 3 2 1 82 4 80 9 8 6 1 10 7 5 7 1 5 6 7 19 4 2 4 6 2 1 8 31 6 2 2 57 42 3 2 7 1 9 5 10 8 5 4 10 8 3 5 8 7 2 7 6 5 3 3 4 10 6 7 10 8 7 10 7 2 4 6 8 10 10 2 6 4",
"output": "71"
},
{
"input": "100 90\n17 16 5 51 17 62 24 45 49 41 90 30 19 78 67 66 59 34 28 47 42 8 33 77 90 41 61 16 86 33 43 71 90 95 23 9 56 41 24 90 31 12 77 36 90 67 47 15 92 50 79 88 42 19 21 79 86 60 41 26 47 4 70 62 44 90 82 89 84 91 54 16 90 53 29 69 21 44 18 28 88 74 56 43 12 76 10 22 34 24 27 52 28 76 90 75 5 29 50 90",
"output": "63"
},
{
"input": "100 10\n6 4 8 4 1 9 4 8 5 2 2 5 2 6 10 2 2 5 3 5 2 3 10 5 2 9 1 1 6 1 5 9 16 42 33 49 26 31 81 27 53 63 81 90 55 97 70 51 87 21 79 62 60 91 54 95 26 26 30 61 87 79 47 11 59 34 40 82 37 40 81 2 7 1 8 4 10 7 1 10 8 7 3 5 2 8 3 3 9 2 1 1 5 7 8 7 1 10 9 8",
"output": "61"
},
{
"input": "100 90\n45 57 52 69 17 81 85 60 59 39 55 14 87 90 90 31 41 57 35 89 74 20 53 4 33 49 71 11 46 90 71 41 71 90 63 74 51 13 99 92 99 91 100 97 93 40 93 96 100 99 100 92 98 96 78 91 91 91 91 100 94 97 95 97 96 95 17 13 45 35 54 26 2 74 6 51 20 3 73 90 90 42 66 43 86 28 84 70 37 27 90 30 55 80 6 58 57 51 10 22",
"output": "72"
},
{
"input": "100 10\n10 2 10 10 10 10 10 10 10 7 10 10 10 10 10 10 9 10 10 10 10 10 10 10 10 7 9 10 10 10 37 10 4 10 10 10 59 5 95 10 10 10 10 39 10 10 10 10 10 10 10 5 10 10 10 10 10 10 10 10 10 10 10 10 66 10 10 10 10 10 5 10 10 10 10 10 10 44 10 10 10 10 10 10 10 10 10 10 10 7 10 10 10 10 10 10 10 10 10 2",
"output": "52"
},
{
"input": "100 90\n57 90 90 90 90 90 90 90 81 90 3 90 39 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 92 90 90 90 90 90 90 90 90 98 90 90 90 90 90 90 90 90 90 90 90 90 90 54 90 90 90 90 90 62 90 90 91 90 90 90 90 90 90 91 90 90 90 90 90 90 90 3 90 90 90 90 90 90 90 2 90 90 90 90 90 90 90 90 90 2 90 90 90 90 90",
"output": "60"
},
{
"input": "100 10\n10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 6 10 10 10 10 10 10 78 90 61 40 87 39 91 50 64 30 10 24 10 55 28 11 28 35 26 26 10 57 45 67 14 99 96 51 67 79 59 11 21 55 70 33 10 16 92 70 38 50 66 52 5 10 10 10 2 4 10 10 10 10 10 10 10 10 10 6 10 10 10 10 10 10 10 10 10 10 8 10 10 10 10 10",
"output": "56"
},
{
"input": "100 90\n90 90 90 90 90 90 55 21 90 90 90 90 90 90 90 90 90 90 69 83 90 90 90 90 90 90 90 90 93 95 92 98 92 97 91 92 92 91 91 95 94 95 100 100 96 97 94 93 90 90 95 95 97 99 90 95 98 91 94 96 99 99 94 95 95 97 99 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 12 90 3 90 90 90 90 90 90 90",
"output": "61"
},
{
"input": "100 49\n71 25 14 36 36 48 36 49 28 40 49 49 49 38 40 49 33 22 49 49 14 46 8 44 49 11 37 49 40 49 2 49 3 49 37 49 49 11 25 49 49 32 49 11 49 30 16 21 49 49 23 24 30 49 49 49 49 49 49 27 49 42 49 49 20 32 30 29 35 49 30 49 9 49 27 25 5 49 49 42 49 20 49 35 49 22 15 49 49 49 19 49 29 28 13 49 22 7 6 24",
"output": "99"
},
{
"input": "100 50\n38 68 9 6 50 18 19 50 50 20 33 34 43 50 24 50 50 2 50 50 50 50 50 21 30 50 41 40 50 50 50 50 50 7 50 21 19 23 1 50 24 50 50 50 25 50 50 50 50 50 50 50 7 24 28 18 50 5 43 50 20 50 13 50 50 16 50 3 2 24 50 50 18 5 50 4 50 50 38 50 33 49 12 33 11 14 50 50 50 33 50 50 50 50 50 50 7 4 50 50",
"output": "99"
},
{
"input": "100 48\n8 6 23 47 29 48 48 48 48 48 48 26 24 48 48 48 3 48 27 28 41 45 9 29 48 48 48 48 48 48 48 48 48 48 47 23 48 48 48 5 48 22 40 48 48 48 20 48 48 57 48 32 19 48 33 2 4 19 48 48 39 48 16 48 48 44 48 48 48 48 29 14 25 43 46 7 48 19 30 48 18 8 39 48 30 47 35 18 48 45 48 48 30 13 48 48 48 17 9 48",
"output": "99"
},
{
"input": "100 57\n57 9 57 4 43 57 57 57 57 26 57 18 57 57 57 57 57 57 57 47 33 57 57 43 57 57 55 57 14 57 57 4 1 57 57 57 57 57 46 26 57 57 57 57 57 57 57 39 57 57 57 5 57 12 11 57 57 57 25 37 34 57 54 18 29 57 39 57 5 57 56 34 57 24 7 57 57 57 2 57 57 57 57 1 55 39 19 57 57 57 57 21 3 40 13 3 57 57 62 57",
"output": "99"
},
{
"input": "100 51\n51 51 38 51 51 45 51 51 51 18 51 36 51 19 51 26 37 51 11 51 45 34 51 21 51 51 33 51 6 51 51 51 21 47 51 13 51 51 30 29 50 51 51 51 51 51 51 45 14 51 2 51 51 23 9 51 50 23 51 29 34 51 40 32 1 36 31 51 11 51 51 47 51 51 51 51 51 51 51 50 39 51 14 4 4 12 3 11 51 51 51 51 41 51 51 51 49 37 5 93",
"output": "99"
},
{
"input": "100 50\n87 91 95 73 50 50 16 97 39 24 58 50 33 89 42 37 50 50 12 71 3 55 50 50 80 10 76 50 52 36 88 44 66 69 86 71 77 50 72 50 21 55 50 50 78 61 75 89 65 2 50 69 62 47 11 92 97 77 41 31 55 29 35 51 36 48 50 91 92 86 50 36 50 94 51 74 4 27 55 63 50 36 87 50 67 7 65 75 20 96 88 50 41 73 35 51 66 21 29 33",
"output": "3"
},
{
"input": "100 50\n50 37 28 92 7 76 50 50 50 76 100 57 50 50 50 32 76 50 8 72 14 8 50 91 67 50 55 82 50 50 24 97 88 50 59 61 68 86 44 15 61 67 88 50 40 50 36 99 1 23 63 50 88 59 76 82 99 76 68 50 50 30 31 68 57 98 71 12 15 60 35 79 90 6 67 50 50 50 50 68 13 6 50 50 16 87 84 50 67 67 50 64 50 58 50 50 77 51 50 51",
"output": "3"
},
{
"input": "100 50\n43 50 50 91 97 67 6 50 86 50 76 60 50 59 4 56 11 38 49 50 37 50 50 20 60 47 33 54 95 58 22 50 77 77 72 9 57 40 81 57 95 50 81 63 62 76 13 87 50 39 74 69 50 99 63 1 11 62 84 31 97 99 56 73 70 36 45 100 28 91 93 9 19 52 73 50 83 58 84 52 86 12 50 44 64 52 97 50 12 71 97 52 87 66 83 66 86 50 9 49",
"output": "6"
},
{
"input": "88 10\n10 8 1 10 10 1 3 7 10 5 8 8 10 2 7 10 10 10 10 10 1 10 10 10 10 1 2 9 10 9 10 10 10 64 100 25 10 12 9 52 13 8 10 56 10 4 10 7 10 3 10 79 74 8 73 10 10 10 9 10 3 5 10 10 10 5 1 10 10 4 3 10 10 10 4 10 6 4 10 10 10 10 3 3 8 5 6 8",
"output": "66"
},
{
"input": "100 50\n80 39 33 69 75 50 23 88 50 50 67 90 87 50 29 15 55 32 60 50 50 50 38 95 62 50 50 88 8 97 45 50 42 12 22 93 49 50 24 50 50 71 60 4 50 72 57 57 50 50 50 83 69 17 1 31 72 55 50 11 50 80 93 41 91 94 20 60 50 50 51 48 53 56 76 73 50 72 19 98 50 50 50 50 50 28 48 45 62 11 16 67 93 88 63 50 50 66 48 95",
"output": "0"
},
{
"input": "100 50\n70 50 38 50 38 50 32 30 50 31 26 42 50 33 34 50 50 50 28 21 50 44 50 47 50 50 9 40 50 50 50 50 50 42 50 50 16 50 50 3 24 50 50 50 4 26 50 2 50 50 33 1 27 50 50 50 8 29 50 23 33 50 6 29 50 50 15 50 50 50 32 50 43 50 50 50 31 50 4 50 50 31 50 50 31 16 50 17 50 17 31 13 25 16 50 10 50 47 50 66",
"output": "0"
},
{
"input": "2 8\n8 8",
"output": "2"
},
{
"input": "1 6\n3",
"output": "1"
},
{
"input": "1 5\n5",
"output": "1"
}
] | 1,620,716,994
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 6,656,000
|
n,m=map(int,input().split())
l=list(map(int,input().split()))
f=0
b=0
for i in range(n):
if l[i]<=m:
f+=1
else:
break
for j in range(n):
if l[n-1-i]<=m:
b+=1
else:
break
if any(x>m for x in l):
print(f+b)
else:
print(n)
|
Title: Mishka and Contest
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mishka started participating in a programming contest. There are $n$ problems in the contest. Mishka's problem-solving skill is equal to $k$.
Mishka arranges all problems from the contest into a list. Because of his weird principles, Mishka only solves problems from one of the ends of the list. Every time, he chooses which end (left or right) he will solve the next problem from. Thus, each problem Mishka solves is either the leftmost or the rightmost problem in the list.
Mishka cannot solve a problem with difficulty greater than $k$. When Mishka solves the problem, it disappears from the list, so the length of the list decreases by $1$. Mishka stops when he is unable to solve any problem from any end of the list.
How many problems can Mishka solve?
Input Specification:
The first line of input contains two integers $n$ and $k$ ($1 \le n, k \le 100$) — the number of problems in the contest and Mishka's problem-solving skill.
The second line of input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$), where $a_i$ is the difficulty of the $i$-th problem. The problems are given in order from the leftmost to the rightmost in the list.
Output Specification:
Print one integer — the maximum number of problems Mishka can solve.
Demo Input:
['8 4\n4 2 3 1 5 1 6 4\n', '5 2\n3 1 2 1 3\n', '5 100\n12 34 55 43 21\n']
Demo Output:
['5\n', '0\n', '5\n']
Note:
In the first example, Mishka can solve problems in the following order: $[4, 2, 3, 1, 5, 1, 6, 4] \rightarrow [2, 3, 1, 5, 1, 6, 4] \rightarrow [2, 3, 1, 5, 1, 6] \rightarrow [3, 1, 5, 1, 6] \rightarrow [1, 5, 1, 6] \rightarrow [5, 1, 6]$, so the number of solved problems will be equal to $5$.
In the second example, Mishka can't solve any problem because the difficulties of problems from both ends are greater than $k$.
In the third example, Mishka's solving skill is so amazing that he can solve all the problems.
|
```python
n,m=map(int,input().split())
l=list(map(int,input().split()))
f=0
b=0
for i in range(n):
if l[i]<=m:
f+=1
else:
break
for j in range(n):
if l[n-1-i]<=m:
b+=1
else:
break
if any(x>m for x in l):
print(f+b)
else:
print(n)
```
| 0
|
|
263
|
A
|
Beautiful Matrix
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
You've got a 5<=×<=5 matrix, consisting of 24 zeroes and a single number one. Let's index the matrix rows by numbers from 1 to 5 from top to bottom, let's index the matrix columns by numbers from 1 to 5 from left to right. In one move, you are allowed to apply one of the two following transformations to the matrix:
1. Swap two neighboring matrix rows, that is, rows with indexes *i* and *i*<=+<=1 for some integer *i* (1<=≤<=*i*<=<<=5). 1. Swap two neighboring matrix columns, that is, columns with indexes *j* and *j*<=+<=1 for some integer *j* (1<=≤<=*j*<=<<=5).
You think that a matrix looks beautiful, if the single number one of the matrix is located in its middle (in the cell that is on the intersection of the third row and the third column). Count the minimum number of moves needed to make the matrix beautiful.
|
The input consists of five lines, each line contains five integers: the *j*-th integer in the *i*-th line of the input represents the element of the matrix that is located on the intersection of the *i*-th row and the *j*-th column. It is guaranteed that the matrix consists of 24 zeroes and a single number one.
|
Print a single integer — the minimum number of moves needed to make the matrix beautiful.
|
[
"0 0 0 0 0\n0 0 0 0 1\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n",
"0 0 0 0 0\n0 0 0 0 0\n0 1 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n"
] |
[
"3\n",
"1\n"
] |
none
| 500
|
[
{
"input": "0 0 0 0 0\n0 0 0 0 1\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "3"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 1 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "1"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 1 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "0"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 1",
"output": "4"
},
{
"input": "0 1 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "3"
},
{
"input": "1 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "4"
},
{
"input": "0 0 1 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "2"
},
{
"input": "0 0 0 1 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "3"
},
{
"input": "0 0 0 0 1\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "4"
},
{
"input": "0 0 0 0 0\n1 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "3"
},
{
"input": "0 0 0 0 0\n0 1 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "2"
},
{
"input": "0 0 0 0 0\n0 0 1 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "1"
},
{
"input": "0 0 0 0 0\n0 0 0 1 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "2"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n1 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "2"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 1 0\n0 0 0 0 0\n0 0 0 0 0",
"output": "1"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 1\n0 0 0 0 0\n0 0 0 0 0",
"output": "2"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n1 0 0 0 0\n0 0 0 0 0",
"output": "3"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 1 0 0 0\n0 0 0 0 0",
"output": "2"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 1 0 0\n0 0 0 0 0",
"output": "1"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 1 0\n0 0 0 0 0",
"output": "2"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 1\n0 0 0 0 0",
"output": "3"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n1 0 0 0 0",
"output": "4"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 1 0 0 0",
"output": "3"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 1 0 0",
"output": "2"
},
{
"input": "0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 1 0",
"output": "3"
}
] | 1,697,714,603
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 62
| 0
|
# You've got a 5 × 5 matrix, consisting of 24 zeroes and a single number one. Let's index the matrix rows by numbers from 1 to 5 from top to bottom, let's index the matrix columns by numbers from 1 to 5 from left to right. In one move, you are allowed to apply one of the two following transformations to the matrix:
# Swap two neighboring matrix rows, that is, rows with indexes i and i + 1 for some integer i (1 ≤ i < 5).
# Swap two neighboring matrix columns, that is, columns with indexes j and j + 1 for some integer j (1 ≤ j < 5).
# You think that a matrix looks beautiful, if the single number one of the matrix is located in its middle (in the cell that is on the intersection of the third row and the third column). Count the minimum number of moves needed to make the matrix beautiful.
# Input
# The input consists of five lines, each line contains five integers: the j-th integer in the i-th line of the input represents the element of the matrix that is located on the intersection of the i-th row and the j-th column. It is guaranteed that the matrix consists of 24 zeroes and a single number one.
# Output
# Print a single integer — the minimum number of moves needed to make the matrix beautiful.
# Ready questions properly , just asking how many move it will take , not the implementation
def beautiful_matrix(matrix):
# to bring to 3x3 or as in python 2x2
# first check the position of 1 in matrix
location = None
for i in range(len(matrix)):
for j in range(len(matrix[i])):
if matrix[i][j] == 1:
location = (i, j)
break
# column count
# 0,0->0,1->0,2->1,2->2,2
return abs(2-location[0])+abs(2-location[1])
matrix = [
[0, 0, 0, 0, 0],
[0, 0, 0, 0, 1],
[0, 1, 0, 0, 0],
[0, 0, 0, 0, 0],
[0, 0, 0, 0, 0]
]
beautiful_matrix(matrix)
|
Title: Beautiful Matrix
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got a 5<=×<=5 matrix, consisting of 24 zeroes and a single number one. Let's index the matrix rows by numbers from 1 to 5 from top to bottom, let's index the matrix columns by numbers from 1 to 5 from left to right. In one move, you are allowed to apply one of the two following transformations to the matrix:
1. Swap two neighboring matrix rows, that is, rows with indexes *i* and *i*<=+<=1 for some integer *i* (1<=≤<=*i*<=<<=5). 1. Swap two neighboring matrix columns, that is, columns with indexes *j* and *j*<=+<=1 for some integer *j* (1<=≤<=*j*<=<<=5).
You think that a matrix looks beautiful, if the single number one of the matrix is located in its middle (in the cell that is on the intersection of the third row and the third column). Count the minimum number of moves needed to make the matrix beautiful.
Input Specification:
The input consists of five lines, each line contains five integers: the *j*-th integer in the *i*-th line of the input represents the element of the matrix that is located on the intersection of the *i*-th row and the *j*-th column. It is guaranteed that the matrix consists of 24 zeroes and a single number one.
Output Specification:
Print a single integer — the minimum number of moves needed to make the matrix beautiful.
Demo Input:
['0 0 0 0 0\n0 0 0 0 1\n0 0 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n', '0 0 0 0 0\n0 0 0 0 0\n0 1 0 0 0\n0 0 0 0 0\n0 0 0 0 0\n']
Demo Output:
['3\n', '1\n']
Note:
none
|
```python
# You've got a 5 × 5 matrix, consisting of 24 zeroes and a single number one. Let's index the matrix rows by numbers from 1 to 5 from top to bottom, let's index the matrix columns by numbers from 1 to 5 from left to right. In one move, you are allowed to apply one of the two following transformations to the matrix:
# Swap two neighboring matrix rows, that is, rows with indexes i and i + 1 for some integer i (1 ≤ i < 5).
# Swap two neighboring matrix columns, that is, columns with indexes j and j + 1 for some integer j (1 ≤ j < 5).
# You think that a matrix looks beautiful, if the single number one of the matrix is located in its middle (in the cell that is on the intersection of the third row and the third column). Count the minimum number of moves needed to make the matrix beautiful.
# Input
# The input consists of five lines, each line contains five integers: the j-th integer in the i-th line of the input represents the element of the matrix that is located on the intersection of the i-th row and the j-th column. It is guaranteed that the matrix consists of 24 zeroes and a single number one.
# Output
# Print a single integer — the minimum number of moves needed to make the matrix beautiful.
# Ready questions properly , just asking how many move it will take , not the implementation
def beautiful_matrix(matrix):
# to bring to 3x3 or as in python 2x2
# first check the position of 1 in matrix
location = None
for i in range(len(matrix)):
for j in range(len(matrix[i])):
if matrix[i][j] == 1:
location = (i, j)
break
# column count
# 0,0->0,1->0,2->1,2->2,2
return abs(2-location[0])+abs(2-location[1])
matrix = [
[0, 0, 0, 0, 0],
[0, 0, 0, 0, 1],
[0, 1, 0, 0, 0],
[0, 0, 0, 0, 0],
[0, 0, 0, 0, 0]
]
beautiful_matrix(matrix)
```
| 0
|
|
285
|
C
|
Building Permutation
|
PROGRAMMING
| 1,200
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
Permutation *p* is an ordered set of integers *p*1,<=<=*p*2,<=<=...,<=<=*p**n*, consisting of *n* distinct positive integers, each of them doesn't exceed *n*. We'll denote the *i*-th element of permutation *p* as *p**i*. We'll call number *n* the size or the length of permutation *p*1,<=<=*p*2,<=<=...,<=<=*p**n*.
You have a sequence of integers *a*1,<=*a*2,<=...,<=*a**n*. In one move, you are allowed to decrease or increase any number by one. Count the minimum number of moves, needed to build a permutation from this sequence.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=3·105) — the size of the sought permutation. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=109<=≤<=*a**i*<=≤<=109).
|
Print a single number — the minimum number of moves.
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specifier.
|
[
"2\n3 0\n",
"3\n-1 -1 2\n"
] |
[
"2\n",
"6\n"
] |
In the first sample you should decrease the first number by one and then increase the second number by one. The resulting permutation is (2, 1).
In the second sample you need 6 moves to build permutation (1, 3, 2).
| 1,500
|
[
{
"input": "2\n3 0",
"output": "2"
},
{
"input": "3\n-1 -1 2",
"output": "6"
},
{
"input": "5\n-3 5 -3 3 3",
"output": "10"
},
{
"input": "10\n9 6 -2 4 1 1 1 9 6 2",
"output": "18"
},
{
"input": "9\n2 0 0 6 5 4 1 9 3",
"output": "15"
},
{
"input": "100\n-77 57 -95 -23 53 -28 82 -83 38 -73 85 28 25 6 -43 4 -10 -30 -9 -92 14 34 -93 61 36 -100 90 -68 28 16 100 -3 97 30 36 -55 62 -62 53 74 -50 -23 67 11 22 -30 -19 83 7 84 43 90 -65 -75 -15 97 90 15 66 2 13 -91 91 -44 46 51 51 -58 95 77 20 30 76 79 91 60 76 2 82 42 -93 94 -57 88 65 -95 -66 100 -9 33 -67 54 -99 97 53 13 54 66 60 -48",
"output": "3459"
}
] | 1,587,565,890
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 33
| 483
| 25,292,800
|
n=int(input())
l=[int(i) for i in input().split()]
l.sort()
count=0
p=[i for i in range(1,n+1)]
for i in range(n):
count+=abs(p[i]-l[i])
print(count)
|
Title: Building Permutation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Permutation *p* is an ordered set of integers *p*1,<=<=*p*2,<=<=...,<=<=*p**n*, consisting of *n* distinct positive integers, each of them doesn't exceed *n*. We'll denote the *i*-th element of permutation *p* as *p**i*. We'll call number *n* the size or the length of permutation *p*1,<=<=*p*2,<=<=...,<=<=*p**n*.
You have a sequence of integers *a*1,<=*a*2,<=...,<=*a**n*. In one move, you are allowed to decrease or increase any number by one. Count the minimum number of moves, needed to build a permutation from this sequence.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=3·105) — the size of the sought permutation. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=109<=≤<=*a**i*<=≤<=109).
Output Specification:
Print a single number — the minimum number of moves.
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams or the %I64d specifier.
Demo Input:
['2\n3 0\n', '3\n-1 -1 2\n']
Demo Output:
['2\n', '6\n']
Note:
In the first sample you should decrease the first number by one and then increase the second number by one. The resulting permutation is (2, 1).
In the second sample you need 6 moves to build permutation (1, 3, 2).
|
```python
n=int(input())
l=[int(i) for i in input().split()]
l.sort()
count=0
p=[i for i in range(1,n+1)]
for i in range(n):
count+=abs(p[i]-l[i])
print(count)
```
| 3
|
|
709
|
A
|
Juicer
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Kolya is going to make fresh orange juice. He has *n* oranges of sizes *a*1,<=*a*2,<=...,<=*a**n*. Kolya will put them in the juicer in the fixed order, starting with orange of size *a*1, then orange of size *a*2 and so on. To be put in the juicer the orange must have size not exceeding *b*, so if Kolya sees an orange that is strictly greater he throws it away and continues with the next one.
The juicer has a special section to collect waste. It overflows if Kolya squeezes oranges of the total size strictly greater than *d*. When it happens Kolya empties the waste section (even if there are no more oranges) and continues to squeeze the juice. How many times will he have to empty the waste section?
|
The first line of the input contains three integers *n*, *b* and *d* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*b*<=≤<=*d*<=≤<=1<=000<=000) — the number of oranges, the maximum size of the orange that fits in the juicer and the value *d*, which determines the condition when the waste section should be emptied.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1<=000<=000) — sizes of the oranges listed in the order Kolya is going to try to put them in the juicer.
|
Print one integer — the number of times Kolya will have to empty the waste section.
|
[
"2 7 10\n5 6\n",
"1 5 10\n7\n",
"3 10 10\n5 7 7\n",
"1 1 1\n1\n"
] |
[
"1\n",
"0\n",
"1\n",
"0\n"
] |
In the first sample, Kolya will squeeze the juice from two oranges and empty the waste section afterwards.
In the second sample, the orange won't fit in the juicer so Kolya will have no juice at all.
| 500
|
[
{
"input": "2 7 10\n5 6",
"output": "1"
},
{
"input": "1 5 10\n7",
"output": "0"
},
{
"input": "3 10 10\n5 7 7",
"output": "1"
},
{
"input": "1 1 1\n1",
"output": "0"
},
{
"input": "2 951637 951638\n44069 951637",
"output": "1"
},
{
"input": "50 100 129\n55 130 91 19 116 3 63 52 104 76 75 27 151 99 149 147 39 148 84 9 132 49 40 112 124 141 144 93 36 32 146 74 48 38 150 55 94 32 107 69 77 81 33 57 62 98 78 127 154 126",
"output": "12"
},
{
"input": "100 1000 1083\n992 616 818 359 609 783 263 989 501 929 362 394 919 1081 870 830 1097 975 62 346 531 367 323 457 707 360 949 334 867 116 478 417 961 963 1029 114 867 1008 988 916 983 1077 959 942 572 961 579 318 721 337 488 717 111 70 416 685 987 130 353 107 61 191 827 849 106 815 211 953 111 398 889 860 801 71 375 320 395 1059 116 222 931 444 582 74 677 655 88 173 686 491 661 186 114 832 615 814 791 464 517 850",
"output": "36"
},
{
"input": "2 6 8\n2 1",
"output": "0"
},
{
"input": "5 15 16\n7 11 5 12 8",
"output": "2"
},
{
"input": "15 759966 759967\n890397 182209 878577 548548 759966 812923 759966 860479 200595 381358 299175 339368 759966 907668 69574",
"output": "4"
},
{
"input": "5 234613 716125\n642626 494941 234613 234613 234613",
"output": "0"
},
{
"input": "50 48547 567054\n529808 597004 242355 559114 78865 537318 631455 733020 655072 645093 309010 855034 306058 625046 524574 834944 27330 664392 443637 821584 338013 490702 289520 675471 885846 258814 134220 571301 84875 94132 200425 928833 375166 521232 317961 175315 947093 89971 322071 174033 48547 998535 954205 704114 943163 438900 48547 538422 48547 48547",
"output": "0"
},
{
"input": "5 10 20\n10 10 10 10 1",
"output": "1"
},
{
"input": "5 10 11\n10 10 10 10 1",
"output": "2"
},
{
"input": "3 10 10\n4 3 3",
"output": "0"
},
{
"input": "3 5 5\n5 5 5",
"output": "1"
},
{
"input": "3 4 14\n5 5 5",
"output": "0"
},
{
"input": "2 7 10\n1234 1234",
"output": "0"
},
{
"input": "1 5 6\n10",
"output": "0"
},
{
"input": "3 4 6\n1 2 3",
"output": "0"
},
{
"input": "5 10 12\n13 13 13 13 13",
"output": "0"
},
{
"input": "3 4 5\n5 7 9",
"output": "0"
},
{
"input": "3 10 100\n5 5 5",
"output": "0"
},
{
"input": "5 1 2\n2 2 2 2 2",
"output": "0"
},
{
"input": "5 5 5\n5 5 5 5 5",
"output": "2"
},
{
"input": "2 2 5\n5 5",
"output": "0"
},
{
"input": "3 1 4\n2 2 2",
"output": "0"
}
] | 1,636,706,948
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 4,505,600
|
n, b, d = input().split()
oranges = input().split()
n = int(n)
b = int(b)
d = int(d)
squeezes = 0
waste = 0
a = 0
for orange in oranges:
if int(orange) < b:
squeezes = squeezes + 1
if squeezes > d:
waste = waste + 1
squeezes = 0
if waste > d:
a += 1
waste = 0
print(waste)
|
Title: Juicer
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kolya is going to make fresh orange juice. He has *n* oranges of sizes *a*1,<=*a*2,<=...,<=*a**n*. Kolya will put them in the juicer in the fixed order, starting with orange of size *a*1, then orange of size *a*2 and so on. To be put in the juicer the orange must have size not exceeding *b*, so if Kolya sees an orange that is strictly greater he throws it away and continues with the next one.
The juicer has a special section to collect waste. It overflows if Kolya squeezes oranges of the total size strictly greater than *d*. When it happens Kolya empties the waste section (even if there are no more oranges) and continues to squeeze the juice. How many times will he have to empty the waste section?
Input Specification:
The first line of the input contains three integers *n*, *b* and *d* (1<=≤<=*n*<=≤<=100<=000, 1<=≤<=*b*<=≤<=*d*<=≤<=1<=000<=000) — the number of oranges, the maximum size of the orange that fits in the juicer and the value *d*, which determines the condition when the waste section should be emptied.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1<=000<=000) — sizes of the oranges listed in the order Kolya is going to try to put them in the juicer.
Output Specification:
Print one integer — the number of times Kolya will have to empty the waste section.
Demo Input:
['2 7 10\n5 6\n', '1 5 10\n7\n', '3 10 10\n5 7 7\n', '1 1 1\n1\n']
Demo Output:
['1\n', '0\n', '1\n', '0\n']
Note:
In the first sample, Kolya will squeeze the juice from two oranges and empty the waste section afterwards.
In the second sample, the orange won't fit in the juicer so Kolya will have no juice at all.
|
```python
n, b, d = input().split()
oranges = input().split()
n = int(n)
b = int(b)
d = int(d)
squeezes = 0
waste = 0
a = 0
for orange in oranges:
if int(orange) < b:
squeezes = squeezes + 1
if squeezes > d:
waste = waste + 1
squeezes = 0
if waste > d:
a += 1
waste = 0
print(waste)
```
| 0
|
|
760
|
A
|
Petr and a calendar
|
PROGRAMMING
| 800
|
[
"implementation",
"math"
] | null | null |
Petr wants to make a calendar for current month. For this purpose he draws a table in which columns correspond to weeks (a week is seven consequent days from Monday to Sunday), rows correspond to weekdays, and cells contain dates. For example, a calendar for January 2017 should look like on the picture:
Petr wants to know how many columns his table should have given the month and the weekday of the first date of that month? Assume that the year is non-leap.
|
The only line contain two integers *m* and *d* (1<=≤<=*m*<=≤<=12, 1<=≤<=*d*<=≤<=7) — the number of month (January is the first month, December is the twelfth) and the weekday of the first date of this month (1 is Monday, 7 is Sunday).
|
Print single integer: the number of columns the table should have.
|
[
"1 7\n",
"1 1\n",
"11 6\n"
] |
[
"6\n",
"5\n",
"5\n"
] |
The first example corresponds to the January 2017 shown on the picture in the statements.
In the second example 1-st January is Monday, so the whole month fits into 5 columns.
In the third example 1-st November is Saturday and 5 columns is enough.
| 500
|
[
{
"input": "1 7",
"output": "6"
},
{
"input": "1 1",
"output": "5"
},
{
"input": "11 6",
"output": "5"
},
{
"input": "2 7",
"output": "5"
},
{
"input": "2 1",
"output": "4"
},
{
"input": "8 6",
"output": "6"
},
{
"input": "1 1",
"output": "5"
},
{
"input": "1 2",
"output": "5"
},
{
"input": "1 3",
"output": "5"
},
{
"input": "1 4",
"output": "5"
},
{
"input": "1 5",
"output": "5"
},
{
"input": "1 6",
"output": "6"
},
{
"input": "1 7",
"output": "6"
},
{
"input": "2 1",
"output": "4"
},
{
"input": "2 2",
"output": "5"
},
{
"input": "2 3",
"output": "5"
},
{
"input": "2 4",
"output": "5"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "2 6",
"output": "5"
},
{
"input": "2 7",
"output": "5"
},
{
"input": "3 1",
"output": "5"
},
{
"input": "3 2",
"output": "5"
},
{
"input": "3 3",
"output": "5"
},
{
"input": "3 4",
"output": "5"
},
{
"input": "3 5",
"output": "5"
},
{
"input": "3 6",
"output": "6"
},
{
"input": "3 7",
"output": "6"
},
{
"input": "4 1",
"output": "5"
},
{
"input": "4 2",
"output": "5"
},
{
"input": "4 3",
"output": "5"
},
{
"input": "4 4",
"output": "5"
},
{
"input": "4 5",
"output": "5"
},
{
"input": "4 6",
"output": "5"
},
{
"input": "4 7",
"output": "6"
},
{
"input": "5 1",
"output": "5"
},
{
"input": "5 2",
"output": "5"
},
{
"input": "5 3",
"output": "5"
},
{
"input": "5 4",
"output": "5"
},
{
"input": "5 5",
"output": "5"
},
{
"input": "5 6",
"output": "6"
},
{
"input": "5 7",
"output": "6"
},
{
"input": "6 1",
"output": "5"
},
{
"input": "6 2",
"output": "5"
},
{
"input": "6 3",
"output": "5"
},
{
"input": "6 4",
"output": "5"
},
{
"input": "6 5",
"output": "5"
},
{
"input": "6 6",
"output": "5"
},
{
"input": "6 7",
"output": "6"
},
{
"input": "7 1",
"output": "5"
},
{
"input": "7 2",
"output": "5"
},
{
"input": "7 3",
"output": "5"
},
{
"input": "7 4",
"output": "5"
},
{
"input": "7 5",
"output": "5"
},
{
"input": "7 6",
"output": "6"
},
{
"input": "7 7",
"output": "6"
},
{
"input": "8 1",
"output": "5"
},
{
"input": "8 2",
"output": "5"
},
{
"input": "8 3",
"output": "5"
},
{
"input": "8 4",
"output": "5"
},
{
"input": "8 5",
"output": "5"
},
{
"input": "8 6",
"output": "6"
},
{
"input": "8 7",
"output": "6"
},
{
"input": "9 1",
"output": "5"
},
{
"input": "9 2",
"output": "5"
},
{
"input": "9 3",
"output": "5"
},
{
"input": "9 4",
"output": "5"
},
{
"input": "9 5",
"output": "5"
},
{
"input": "9 6",
"output": "5"
},
{
"input": "9 7",
"output": "6"
},
{
"input": "10 1",
"output": "5"
},
{
"input": "10 2",
"output": "5"
},
{
"input": "10 3",
"output": "5"
},
{
"input": "10 4",
"output": "5"
},
{
"input": "10 5",
"output": "5"
},
{
"input": "10 6",
"output": "6"
},
{
"input": "10 7",
"output": "6"
},
{
"input": "11 1",
"output": "5"
},
{
"input": "11 2",
"output": "5"
},
{
"input": "11 3",
"output": "5"
},
{
"input": "11 4",
"output": "5"
},
{
"input": "11 5",
"output": "5"
},
{
"input": "11 6",
"output": "5"
},
{
"input": "11 7",
"output": "6"
},
{
"input": "12 1",
"output": "5"
},
{
"input": "12 2",
"output": "5"
},
{
"input": "12 3",
"output": "5"
},
{
"input": "12 4",
"output": "5"
},
{
"input": "12 5",
"output": "5"
},
{
"input": "12 6",
"output": "6"
},
{
"input": "12 7",
"output": "6"
},
{
"input": "1 4",
"output": "5"
},
{
"input": "1 5",
"output": "5"
},
{
"input": "9 7",
"output": "6"
},
{
"input": "2 6",
"output": "5"
},
{
"input": "1 6",
"output": "6"
},
{
"input": "2 2",
"output": "5"
},
{
"input": "4 7",
"output": "6"
},
{
"input": "12 6",
"output": "6"
},
{
"input": "12 3",
"output": "5"
},
{
"input": "3 6",
"output": "6"
},
{
"input": "9 6",
"output": "5"
},
{
"input": "7 6",
"output": "6"
},
{
"input": "11 7",
"output": "6"
},
{
"input": "6 6",
"output": "5"
}
] | 1,488,537,192
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 104
| 62
| 4,608,000
|
a,b=map(int,input().split())
x=1
if a==1 or a==3 or a==5 or a==7 or a==8 or a==10 or a==12:
m=31-(abs(b-8))
if m%7>=1:
print(x+m//7+1)
else:
print(x+m//7)
if a==4 or a==6 or a==9 or a==11:
m=30-(abs(b-8))
if m%7>=1:
print(x+m//7+1)
else:
print(x+m//7)
if a==2:
m=28-(abs(b-8))
if m%7>=1:
print(x+m//7+1)
else:
print(x+m//7)
|
Title: Petr and a calendar
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petr wants to make a calendar for current month. For this purpose he draws a table in which columns correspond to weeks (a week is seven consequent days from Monday to Sunday), rows correspond to weekdays, and cells contain dates. For example, a calendar for January 2017 should look like on the picture:
Petr wants to know how many columns his table should have given the month and the weekday of the first date of that month? Assume that the year is non-leap.
Input Specification:
The only line contain two integers *m* and *d* (1<=≤<=*m*<=≤<=12, 1<=≤<=*d*<=≤<=7) — the number of month (January is the first month, December is the twelfth) and the weekday of the first date of this month (1 is Monday, 7 is Sunday).
Output Specification:
Print single integer: the number of columns the table should have.
Demo Input:
['1 7\n', '1 1\n', '11 6\n']
Demo Output:
['6\n', '5\n', '5\n']
Note:
The first example corresponds to the January 2017 shown on the picture in the statements.
In the second example 1-st January is Monday, so the whole month fits into 5 columns.
In the third example 1-st November is Saturday and 5 columns is enough.
|
```python
a,b=map(int,input().split())
x=1
if a==1 or a==3 or a==5 or a==7 or a==8 or a==10 or a==12:
m=31-(abs(b-8))
if m%7>=1:
print(x+m//7+1)
else:
print(x+m//7)
if a==4 or a==6 or a==9 or a==11:
m=30-(abs(b-8))
if m%7>=1:
print(x+m//7+1)
else:
print(x+m//7)
if a==2:
m=28-(abs(b-8))
if m%7>=1:
print(x+m//7+1)
else:
print(x+m//7)
```
| 3
|
|
253
|
B
|
Physics Practical
|
PROGRAMMING
| 1,400
|
[
"binary search",
"dp",
"sortings",
"two pointers"
] | null | null |
One day Vasya was on a physics practical, performing the task on measuring the capacitance. He followed the teacher's advice and did as much as *n* measurements, and recorded the results in the notebook. After that he was about to show the results to the teacher, but he remembered that at the last lesson, the teacher had made his friend Petya redo the experiment because the largest and the smallest results differed by more than two times. Vasya is lazy, and he does not want to redo the experiment. He wants to do the task and go home play computer games. So he decided to cheat: before Vasya shows the measurements to the teacher, he will erase some of them, so as to make the largest and the smallest results of the remaining measurements differ in no more than two times. In other words, if the remaining measurements have the smallest result *x*, and the largest result *y*, then the inequality *y*<=≤<=2·*x* must fulfill. Of course, to avoid the teacher's suspicion, Vasya wants to remove as few measurement results as possible from his notes.
Help Vasya, find what minimum number of measurement results he will have to erase from his notes so that the largest and the smallest of the remaining results of the measurements differed in no more than two times.
|
The first line contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of measurements Vasya made. The second line contains *n* integers *c*1,<=*c*2,<=...,<=*c**n* (1<=≤<=*c**i*<=≤<=5000) — the results of the measurements. The numbers on the second line are separated by single spaces.
|
Print a single integer — the minimum number of results Vasya will have to remove.
|
[
"6\n4 5 3 8 3 7\n",
"4\n4 3 2 4\n"
] |
[
"2\n",
"0\n"
] |
In the first sample you can remove the fourth and the sixth measurement results (values 8 and 7). Then the maximum of the remaining values will be 5, and the minimum one will be 3. Or else, you can remove the third and fifth results (both equal 3). After that the largest remaining result will be 8, and the smallest one will be 4.
| 1,000
|
[
{
"input": "6\n4 5 3 8 3 7",
"output": "2"
},
{
"input": "4\n4 3 2 4",
"output": "0"
},
{
"input": "6\n5 6 4 9 4 8",
"output": "1"
},
{
"input": "4\n5 4 1 5",
"output": "1"
},
{
"input": "2\n3 2",
"output": "0"
},
{
"input": "10\n39 9 18 13 6 16 47 15 1 24",
"output": "5"
},
{
"input": "20\n43 49 46 46 40 41 49 49 48 30 35 36 33 34 42 38 40 46 50 45",
"output": "0"
},
{
"input": "30\n6 1 26 13 16 30 16 23 9 1 5 14 7 2 17 22 21 23 16 3 5 17 22 10 1 24 4 30 8 18",
"output": "15"
},
{
"input": "50\n3 61 16 13 13 12 3 8 14 16 1 32 8 23 29 7 28 13 8 5 9 2 3 2 29 13 1 2 18 29 28 4 13 3 14 9 20 26 1 19 13 7 8 22 7 5 13 14 10 23",
"output": "29"
},
{
"input": "10\n135 188 160 167 179 192 195 192 193 191",
"output": "0"
},
{
"input": "15\n2 19 19 22 15 24 6 36 20 3 18 27 20 1 10",
"output": "6"
},
{
"input": "25\n8 1 2 1 2 5 3 4 2 6 3 3 4 1 6 1 6 1 4 5 2 9 1 2 1",
"output": "13"
},
{
"input": "40\n4784 4824 4707 4343 4376 4585 4917 4848 3748 4554 3390 4944 4845 3922 4617 4606 4815 4698 4595 4942 4327 4983 4833 4507 3721 4863 4633 4553 4991 4922 4733 4396 4747 4724 4886 4226 4025 4928 4990 4792",
"output": "0"
},
{
"input": "60\n1219 19 647 1321 21 242 677 901 10 165 434 978 448 163 919 517 1085 10 516 920 653 1363 62 98 629 928 998 1335 1448 85 357 432 1298 561 663 182 2095 801 59 208 765 1653 642 645 1378 221 911 749 347 849 43 1804 62 73 613 143 860 297 278 148",
"output": "37"
},
{
"input": "100\n4204 4719 4688 3104 4012 4927 4696 4614 4826 4792 3891 4672 4914 4740 4968 3879 4424 4755 3856 3837 4965 4939 4030 4941 4504 4668 4908 4608 3660 4822 4846 3945 4539 4819 4895 3746 4324 4233 4135 4956 4983 4546 4673 4617 3533 4851 4868 4838 4998 4769 4899 4578 3841 4974 4627 4990 4524 4939 4469 4233 4434 4339 4446 4979 4354 4912 4558 4609 4436 3883 4379 4927 4824 4819 4984 4660 4874 3732 4853 4268 4761 4402 4642 4577 4635 4564 4113 4896 4943 4122 4413 4597 3768 4731 4669 4958 4548 4263 4657 3651",
"output": "0"
},
{
"input": "100\n1354 1797 588 3046 1290 745 217 907 113 381 523 935 791 415 92 1597 1739 1774 240 27 1262 2498 52 1339 1031 1355 2036 230 489 7 69 877 530 2664 1230 940 2712 2651 3410 480 332 699 957 2257 1877 1940 452 1652 1216 3144 236 165 1109 888 1649 346 24 183 1061 1226 2694 3225 2021 1145 907 1671 1599 3395 942 1959 555 1281 675 1125 1386 732 1081 326 256 26 1009 1772 2687 1173 491 709 390 992 519 203 1029 1381 846 1515 705 2859 282 147 1824 299",
"output": "63"
},
{
"input": "100\n2794 2201 4935 564 2876 4472 4196 2571 2260 1479 1451 3497 245 2805 4834 3872 4294 1299 937 2983 1458 3278 1098 2990 4447 4337 4388 947 3708 3382 3694 4562 3827 2312 3760 1181 2830 1256 1054 1583 2094 931 86 2526 998 3420 2248 3461 3662 1715 5 4123 1051 545 3704 1084 1916 695 794 121 1000 1611 3674 1910 4795 2805 825 2392 3551 1148 3738 4650 791 288 1064 2011 2991 2116 2179 3333 1303 498 1610 3092 1935 3450 3524 2624 1596 2801 2290 2297 2327 1602 4779 3135 1231 4203 3283 3580",
"output": "51"
},
{
"input": "2\n1 5",
"output": "1"
}
] | 1,614,423,408
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 9
| 1,000
| 6,963,200
|
fin = open ('input.txt', 'r')
fout = open ('output.txt', 'w')
raw_lines = fin.readlines()
n = int(raw_lines[0].strip())
arr = list(map(int, raw_lines[1].strip().split()))
def how_many(arr, l, r):
i = l + 1
left_del = 0
while i <= r:
if 2 * arr[l] < arr[i]:
left_del = r - i + 1
break
i = i + 1
j = r-1
right_del = 0
while j >= l:
if 2 * arr[j] < arr[r]:
right_del = j - l + 1
break
j = j - 1
return (left_del, right_del)
arr.sort()
left = 0
right = len(arr) - 1
count = 0
while 2 * arr[left] < arr[right]:
left_del, right_del = how_many(arr, left, right)
if left_del >= right_del:
left = left + 1
else:
right = right - 1
count = count + 1
# print(count)
fout.write (str(count) + '\n')
fout.close()
# print(min(rm_ls, rm_rs))
|
Title: Physics Practical
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Vasya was on a physics practical, performing the task on measuring the capacitance. He followed the teacher's advice and did as much as *n* measurements, and recorded the results in the notebook. After that he was about to show the results to the teacher, but he remembered that at the last lesson, the teacher had made his friend Petya redo the experiment because the largest and the smallest results differed by more than two times. Vasya is lazy, and he does not want to redo the experiment. He wants to do the task and go home play computer games. So he decided to cheat: before Vasya shows the measurements to the teacher, he will erase some of them, so as to make the largest and the smallest results of the remaining measurements differ in no more than two times. In other words, if the remaining measurements have the smallest result *x*, and the largest result *y*, then the inequality *y*<=≤<=2·*x* must fulfill. Of course, to avoid the teacher's suspicion, Vasya wants to remove as few measurement results as possible from his notes.
Help Vasya, find what minimum number of measurement results he will have to erase from his notes so that the largest and the smallest of the remaining results of the measurements differed in no more than two times.
Input Specification:
The first line contains integer *n* (2<=≤<=*n*<=≤<=105) — the number of measurements Vasya made. The second line contains *n* integers *c*1,<=*c*2,<=...,<=*c**n* (1<=≤<=*c**i*<=≤<=5000) — the results of the measurements. The numbers on the second line are separated by single spaces.
Output Specification:
Print a single integer — the minimum number of results Vasya will have to remove.
Demo Input:
['6\n4 5 3 8 3 7\n', '4\n4 3 2 4\n']
Demo Output:
['2\n', '0\n']
Note:
In the first sample you can remove the fourth and the sixth measurement results (values 8 and 7). Then the maximum of the remaining values will be 5, and the minimum one will be 3. Or else, you can remove the third and fifth results (both equal 3). After that the largest remaining result will be 8, and the smallest one will be 4.
|
```python
fin = open ('input.txt', 'r')
fout = open ('output.txt', 'w')
raw_lines = fin.readlines()
n = int(raw_lines[0].strip())
arr = list(map(int, raw_lines[1].strip().split()))
def how_many(arr, l, r):
i = l + 1
left_del = 0
while i <= r:
if 2 * arr[l] < arr[i]:
left_del = r - i + 1
break
i = i + 1
j = r-1
right_del = 0
while j >= l:
if 2 * arr[j] < arr[r]:
right_del = j - l + 1
break
j = j - 1
return (left_del, right_del)
arr.sort()
left = 0
right = len(arr) - 1
count = 0
while 2 * arr[left] < arr[right]:
left_del, right_del = how_many(arr, left, right)
if left_del >= right_del:
left = left + 1
else:
right = right - 1
count = count + 1
# print(count)
fout.write (str(count) + '\n')
fout.close()
# print(min(rm_ls, rm_rs))
```
| 0
|
|
46
|
A
|
Ball Game
|
PROGRAMMING
| 800
|
[
"brute force",
"implementation"
] |
A. Ball Game
|
2
|
256
|
A kindergarten teacher Natalia Pavlovna has invented a new ball game. This game not only develops the children's physique, but also teaches them how to count.
The game goes as follows. Kids stand in circle. Let's agree to think of the children as numbered with numbers from 1 to *n* clockwise and the child number 1 is holding the ball. First the first child throws the ball to the next one clockwise, i.e. to the child number 2. Then the child number 2 throws the ball to the next but one child, i.e. to the child number 4, then the fourth child throws the ball to the child that stands two children away from him, i.e. to the child number 7, then the ball is thrown to the child who stands 3 children away from the child number 7, then the ball is thrown to the child who stands 4 children away from the last one, and so on. It should be mentioned that when a ball is thrown it may pass the beginning of the circle. For example, if *n*<==<=5, then after the third throw the child number 2 has the ball again. Overall, *n*<=-<=1 throws are made, and the game ends.
The problem is that not all the children get the ball during the game. If a child doesn't get the ball, he gets very upset and cries until Natalia Pavlovna gives him a candy. That's why Natalia Pavlovna asks you to help her to identify the numbers of the children who will get the ball after each throw.
|
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) which indicates the number of kids in the circle.
|
In the single line print *n*<=-<=1 numbers which are the numbers of children who will get the ball after each throw. Separate the numbers by spaces.
|
[
"10\n",
"3\n"
] |
[
"2 4 7 1 6 2 9 7 6\n",
"2 1\n"
] |
none
| 0
|
[
{
"input": "10",
"output": "2 4 7 1 6 2 9 7 6"
},
{
"input": "3",
"output": "2 1"
},
{
"input": "4",
"output": "2 4 3"
},
{
"input": "5",
"output": "2 4 2 1"
},
{
"input": "6",
"output": "2 4 1 5 4"
},
{
"input": "7",
"output": "2 4 7 4 2 1"
},
{
"input": "8",
"output": "2 4 7 3 8 6 5"
},
{
"input": "9",
"output": "2 4 7 2 7 4 2 1"
},
{
"input": "2",
"output": "2"
},
{
"input": "11",
"output": "2 4 7 11 5 11 7 4 2 1"
},
{
"input": "12",
"output": "2 4 7 11 4 10 5 1 10 8 7"
},
{
"input": "13",
"output": "2 4 7 11 3 9 3 11 7 4 2 1"
},
{
"input": "20",
"output": "2 4 7 11 16 2 9 17 6 16 7 19 12 6 1 17 14 12 11"
},
{
"input": "25",
"output": "2 4 7 11 16 22 4 12 21 6 17 4 17 6 21 12 4 22 16 11 7 4 2 1"
},
{
"input": "30",
"output": "2 4 7 11 16 22 29 7 16 26 7 19 2 16 1 17 4 22 11 1 22 14 7 1 26 22 19 17 16"
},
{
"input": "35",
"output": "2 4 7 11 16 22 29 2 11 21 32 9 22 1 16 32 14 32 16 1 22 9 32 21 11 2 29 22 16 11 7 4 2 1"
},
{
"input": "40",
"output": "2 4 7 11 16 22 29 37 6 16 27 39 12 26 1 17 34 12 31 11 32 14 37 21 6 32 19 7 36 26 17 9 2 36 31 27 24 22 21"
},
{
"input": "45",
"output": "2 4 7 11 16 22 29 37 1 11 22 34 2 16 31 2 19 37 11 31 7 29 7 31 11 37 19 2 31 16 2 34 22 11 1 37 29 22 16 11 7 4 2 1"
},
{
"input": "50",
"output": "2 4 7 11 16 22 29 37 46 6 17 29 42 6 21 37 4 22 41 11 32 4 27 1 26 2 29 7 36 16 47 29 12 46 31 17 4 42 31 21 12 4 47 41 36 32 29 27 26"
},
{
"input": "55",
"output": "2 4 7 11 16 22 29 37 46 1 12 24 37 51 11 27 44 7 26 46 12 34 2 26 51 22 49 22 51 26 2 34 12 46 26 7 44 27 11 51 37 24 12 1 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "60",
"output": "2 4 7 11 16 22 29 37 46 56 7 19 32 46 1 17 34 52 11 31 52 14 37 1 26 52 19 47 16 46 17 49 22 56 31 7 44 22 1 41 22 4 47 31 16 2 49 37 26 16 7 59 52 46 41 37 34 32 31"
},
{
"input": "65",
"output": "2 4 7 11 16 22 29 37 46 56 2 14 27 41 56 7 24 42 61 16 37 59 17 41 1 27 54 17 46 11 42 9 42 11 46 17 54 27 1 41 17 59 37 16 61 42 24 7 56 41 27 14 2 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "70",
"output": "2 4 7 11 16 22 29 37 46 56 67 9 22 36 51 67 14 32 51 1 22 44 67 21 46 2 29 57 16 46 7 39 2 36 1 37 4 42 11 51 22 64 37 11 56 32 9 57 36 16 67 49 32 16 1 57 44 32 21 11 2 64 57 51 46 42 39 37 36"
},
{
"input": "75",
"output": "2 4 7 11 16 22 29 37 46 56 67 4 17 31 46 62 4 22 41 61 7 29 52 1 26 52 4 32 61 16 47 4 37 71 31 67 29 67 31 71 37 4 47 16 61 32 4 52 26 1 52 29 7 61 41 22 4 62 46 31 17 4 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "80",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 12 26 41 57 74 12 31 51 72 14 37 61 6 32 59 7 36 66 17 49 2 36 71 27 64 22 61 21 62 24 67 31 76 42 9 57 26 76 47 19 72 46 21 77 54 32 11 71 52 34 17 1 66 52 39 27 16 6 77 69 62 56 51 47 44 42 41"
},
{
"input": "85",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 7 21 36 52 69 2 21 41 62 84 22 46 71 12 39 67 11 41 72 19 52 1 36 72 24 62 16 56 12 54 12 56 16 62 24 72 36 1 52 19 72 41 11 67 39 12 71 46 22 84 62 41 21 2 69 52 36 21 7 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "90",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 2 16 31 47 64 82 11 31 52 74 7 31 56 82 19 47 76 16 47 79 22 56 1 37 74 22 61 11 52 4 47 1 46 2 49 7 56 16 67 29 82 46 11 67 34 2 61 31 2 64 37 11 76 52 29 7 76 56 37 19 2 76 61 47 34 22 11 1 82 74 67 61 56 52 49 47 46"
},
{
"input": "95",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 11 26 42 59 77 1 21 42 64 87 16 41 67 94 27 56 86 22 54 87 26 61 2 39 77 21 61 7 49 92 41 86 37 84 37 86 41 92 49 7 61 21 77 39 2 61 26 87 54 22 86 56 27 94 67 41 16 87 64 42 21 1 77 59 42 26 11 92 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "96",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 10 25 41 58 76 95 19 40 62 85 13 38 64 91 23 52 82 17 49 82 20 55 91 32 70 13 53 94 40 83 31 76 26 73 25 74 28 79 35 88 46 5 61 22 80 43 7 68 34 1 65 34 4 71 43 16 86 61 37 14 88 67 47 28 10 89 73 58 44 31 19 8 94 85 77 70 64 59 55 52 50 49"
},
{
"input": "97",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 9 24 40 57 75 94 17 38 60 83 10 35 61 88 19 48 78 12 44 77 14 49 85 25 63 5 45 86 31 74 21 66 15 62 13 62 15 66 21 74 31 86 45 5 63 25 85 49 14 77 44 12 78 48 19 88 61 35 10 83 60 38 17 94 75 57 40 24 9 92 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "98",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 8 23 39 56 74 93 15 36 58 81 7 32 58 85 15 44 74 7 39 72 8 43 79 18 56 95 37 78 22 65 11 56 4 51 1 50 2 53 7 60 16 71 29 86 46 7 67 30 92 57 23 88 56 25 93 64 36 9 81 56 32 9 85 64 44 25 7 88 72 57 43 30 18 7 95 86 78 71 65 60 56 53 51 50"
},
{
"input": "99",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 7 22 38 55 73 92 13 34 56 79 4 29 55 82 11 40 70 2 34 67 2 37 73 11 49 88 29 70 13 56 1 46 92 40 88 38 88 40 92 46 1 56 13 70 29 88 49 11 73 37 2 67 34 2 70 40 11 82 55 29 4 79 56 34 13 92 73 55 38 22 7 92 79 67 56 46 37 29 22 16 11 7 4 2 1"
},
{
"input": "100",
"output": "2 4 7 11 16 22 29 37 46 56 67 79 92 6 21 37 54 72 91 11 32 54 77 1 26 52 79 7 36 66 97 29 62 96 31 67 4 42 81 21 62 4 47 91 36 82 29 77 26 76 27 79 32 86 41 97 54 12 71 31 92 54 17 81 46 12 79 47 16 86 57 29 2 76 51 27 4 82 61 41 22 4 87 71 56 42 29 17 6 96 87 79 72 66 61 57 54 52 51"
}
] | 1,636,385,898
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 6
| 124
| 4,505,600
|
n=int(input())
lst=[]
res=1
i=1
while i<n:
if res+i<=n:
lst.append(res+i)
else:
lst.append((res+i)%n)
res+=i
i+=1
for i in lst:
print(i,end=' ')
|
Title: Ball Game
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A kindergarten teacher Natalia Pavlovna has invented a new ball game. This game not only develops the children's physique, but also teaches them how to count.
The game goes as follows. Kids stand in circle. Let's agree to think of the children as numbered with numbers from 1 to *n* clockwise and the child number 1 is holding the ball. First the first child throws the ball to the next one clockwise, i.e. to the child number 2. Then the child number 2 throws the ball to the next but one child, i.e. to the child number 4, then the fourth child throws the ball to the child that stands two children away from him, i.e. to the child number 7, then the ball is thrown to the child who stands 3 children away from the child number 7, then the ball is thrown to the child who stands 4 children away from the last one, and so on. It should be mentioned that when a ball is thrown it may pass the beginning of the circle. For example, if *n*<==<=5, then after the third throw the child number 2 has the ball again. Overall, *n*<=-<=1 throws are made, and the game ends.
The problem is that not all the children get the ball during the game. If a child doesn't get the ball, he gets very upset and cries until Natalia Pavlovna gives him a candy. That's why Natalia Pavlovna asks you to help her to identify the numbers of the children who will get the ball after each throw.
Input Specification:
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) which indicates the number of kids in the circle.
Output Specification:
In the single line print *n*<=-<=1 numbers which are the numbers of children who will get the ball after each throw. Separate the numbers by spaces.
Demo Input:
['10\n', '3\n']
Demo Output:
['2 4 7 1 6 2 9 7 6\n', '2 1\n']
Note:
none
|
```python
n=int(input())
lst=[]
res=1
i=1
while i<n:
if res+i<=n:
lst.append(res+i)
else:
lst.append((res+i)%n)
res+=i
i+=1
for i in lst:
print(i,end=' ')
```
| 0
|
378
|
A
|
Playing with Dice
|
PROGRAMMING
| 800
|
[
"brute force"
] | null | null |
Two players are playing a game. First each of them writes an integer from 1 to 6, and then a dice is thrown. The player whose written number got closer to the number on the dice wins. If both payers have the same difference, it's a draw.
The first player wrote number *a*, the second player wrote number *b*. How many ways to throw a dice are there, at which the first player wins, or there is a draw, or the second player wins?
|
The single line contains two integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=6) — the numbers written on the paper by the first and second player, correspondingly.
|
Print three integers: the number of ways to throw the dice at which the first player wins, the game ends with a draw or the second player wins, correspondingly.
|
[
"2 5\n",
"2 4\n"
] |
[
"3 0 3\n",
"2 1 3\n"
] |
The dice is a standard cube-shaped six-sided object with each side containing a number from 1 to 6, and where all numbers on all sides are distinct.
You can assume that number *a* is closer to number *x* than number *b*, if |*a* - *x*| < |*b* - *x*|.
| 500
|
[
{
"input": "2 5",
"output": "3 0 3"
},
{
"input": "2 4",
"output": "2 1 3"
},
{
"input": "5 3",
"output": "2 1 3"
},
{
"input": "1 6",
"output": "3 0 3"
},
{
"input": "5 1",
"output": "3 1 2"
},
{
"input": "6 3",
"output": "2 0 4"
},
{
"input": "2 3",
"output": "2 0 4"
},
{
"input": "5 6",
"output": "5 0 1"
},
{
"input": "4 4",
"output": "0 6 0"
},
{
"input": "1 1",
"output": "0 6 0"
},
{
"input": "6 4",
"output": "1 1 4"
},
{
"input": "1 4",
"output": "2 0 4"
},
{
"input": "5 5",
"output": "0 6 0"
},
{
"input": "4 5",
"output": "4 0 2"
},
{
"input": "4 3",
"output": "3 0 3"
},
{
"input": "1 5",
"output": "2 1 3"
},
{
"input": "6 5",
"output": "1 0 5"
},
{
"input": "2 2",
"output": "0 6 0"
},
{
"input": "1 3",
"output": "1 1 4"
},
{
"input": "3 6",
"output": "4 0 2"
},
{
"input": "3 1",
"output": "4 1 1"
},
{
"input": "3 2",
"output": "4 0 2"
},
{
"input": "3 5",
"output": "3 1 2"
},
{
"input": "3 3",
"output": "0 6 0"
},
{
"input": "6 2",
"output": "2 1 3"
},
{
"input": "4 1",
"output": "4 0 2"
},
{
"input": "5 2",
"output": "3 0 3"
},
{
"input": "4 2",
"output": "3 1 2"
},
{
"input": "2 1",
"output": "5 0 1"
},
{
"input": "6 1",
"output": "3 0 3"
},
{
"input": "4 6",
"output": "4 1 1"
},
{
"input": "2 6",
"output": "3 1 2"
},
{
"input": "3 4",
"output": "3 0 3"
},
{
"input": "1 2",
"output": "1 0 5"
},
{
"input": "6 6",
"output": "0 6 0"
},
{
"input": "5 4",
"output": "2 0 4"
},
{
"input": "3 3",
"output": "0 6 0"
},
{
"input": "1 1",
"output": "0 6 0"
}
] | 1,606,135,518
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 38
| 139
| 0
|
a,b = map(int,input().split())
c1 = 0
c2 = 0
c3 = 0
for i in range(1,7):
if abs(i-a)<abs(i-b):
c1+=1
elif abs(i-b)<abs(i-a):
c2+=1
else:
c3+=1
print(str(c1)+' '+str(c3)+' '+str(c2))
|
Title: Playing with Dice
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two players are playing a game. First each of them writes an integer from 1 to 6, and then a dice is thrown. The player whose written number got closer to the number on the dice wins. If both payers have the same difference, it's a draw.
The first player wrote number *a*, the second player wrote number *b*. How many ways to throw a dice are there, at which the first player wins, or there is a draw, or the second player wins?
Input Specification:
The single line contains two integers *a* and *b* (1<=≤<=*a*,<=*b*<=≤<=6) — the numbers written on the paper by the first and second player, correspondingly.
Output Specification:
Print three integers: the number of ways to throw the dice at which the first player wins, the game ends with a draw or the second player wins, correspondingly.
Demo Input:
['2 5\n', '2 4\n']
Demo Output:
['3 0 3\n', '2 1 3\n']
Note:
The dice is a standard cube-shaped six-sided object with each side containing a number from 1 to 6, and where all numbers on all sides are distinct.
You can assume that number *a* is closer to number *x* than number *b*, if |*a* - *x*| < |*b* - *x*|.
|
```python
a,b = map(int,input().split())
c1 = 0
c2 = 0
c3 = 0
for i in range(1,7):
if abs(i-a)<abs(i-b):
c1+=1
elif abs(i-b)<abs(i-a):
c2+=1
else:
c3+=1
print(str(c1)+' '+str(c3)+' '+str(c2))
```
| 3
|
|
9
|
A
|
Die Roll
|
PROGRAMMING
| 800
|
[
"math",
"probabilities"
] |
A. Die Roll
|
1
|
64
|
Yakko, Wakko and Dot, world-famous animaniacs, decided to rest from acting in cartoons, and take a leave to travel a bit. Yakko dreamt to go to Pennsylvania, his Motherland and the Motherland of his ancestors. Wakko thought about Tasmania, its beaches, sun and sea. Dot chose Transylvania as the most mysterious and unpredictable place.
But to their great regret, the leave turned to be very short, so it will be enough to visit one of the three above named places. That's why Yakko, as the cleverest, came up with a truly genius idea: let each of the three roll an ordinary six-sided die, and the one with the highest amount of points will be the winner, and will take the other two to the place of his/her dreams.
Yakko thrown a die and got Y points, Wakko — W points. It was Dot's turn. But she didn't hurry. Dot wanted to know for sure what were her chances to visit Transylvania.
It is known that Yakko and Wakko are true gentlemen, that's why if they have the same amount of points with Dot, they will let Dot win.
|
The only line of the input file contains two natural numbers Y and W — the results of Yakko's and Wakko's die rolls.
|
Output the required probability in the form of irreducible fraction in format «A/B», where A — the numerator, and B — the denominator. If the required probability equals to zero, output «0/1». If the required probability equals to 1, output «1/1».
|
[
"4 2\n"
] |
[
"1/2\n"
] |
Dot will go to Transylvania, if she is lucky to roll 4, 5 or 6 points.
| 0
|
[
{
"input": "4 2",
"output": "1/2"
},
{
"input": "1 1",
"output": "1/1"
},
{
"input": "1 2",
"output": "5/6"
},
{
"input": "1 3",
"output": "2/3"
},
{
"input": "1 4",
"output": "1/2"
},
{
"input": "1 5",
"output": "1/3"
},
{
"input": "1 6",
"output": "1/6"
},
{
"input": "2 1",
"output": "5/6"
},
{
"input": "2 2",
"output": "5/6"
},
{
"input": "2 3",
"output": "2/3"
},
{
"input": "2 4",
"output": "1/2"
},
{
"input": "2 5",
"output": "1/3"
},
{
"input": "2 6",
"output": "1/6"
},
{
"input": "3 1",
"output": "2/3"
},
{
"input": "3 2",
"output": "2/3"
},
{
"input": "3 3",
"output": "2/3"
},
{
"input": "3 4",
"output": "1/2"
},
{
"input": "3 5",
"output": "1/3"
},
{
"input": "3 6",
"output": "1/6"
},
{
"input": "4 1",
"output": "1/2"
},
{
"input": "4 3",
"output": "1/2"
},
{
"input": "4 4",
"output": "1/2"
},
{
"input": "4 5",
"output": "1/3"
},
{
"input": "4 6",
"output": "1/6"
},
{
"input": "5 1",
"output": "1/3"
},
{
"input": "5 2",
"output": "1/3"
},
{
"input": "5 3",
"output": "1/3"
},
{
"input": "5 4",
"output": "1/3"
},
{
"input": "5 5",
"output": "1/3"
},
{
"input": "5 6",
"output": "1/6"
},
{
"input": "6 1",
"output": "1/6"
},
{
"input": "6 2",
"output": "1/6"
},
{
"input": "6 3",
"output": "1/6"
},
{
"input": "6 4",
"output": "1/6"
},
{
"input": "6 5",
"output": "1/6"
},
{
"input": "6 6",
"output": "1/6"
}
] | 1,619,235,993
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 36
| 154
| 0
|
val = input().split()
data = [int(x) for x in val]
num = 7 - max(data)
denom = 6
for i in range(2,num+1):
if num%i==0 and denom%i==0:
num/=i
denom/=i
print('{0}/{1}'.format(int(num),int(denom)))
|
Title: Die Roll
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
Yakko, Wakko and Dot, world-famous animaniacs, decided to rest from acting in cartoons, and take a leave to travel a bit. Yakko dreamt to go to Pennsylvania, his Motherland and the Motherland of his ancestors. Wakko thought about Tasmania, its beaches, sun and sea. Dot chose Transylvania as the most mysterious and unpredictable place.
But to their great regret, the leave turned to be very short, so it will be enough to visit one of the three above named places. That's why Yakko, as the cleverest, came up with a truly genius idea: let each of the three roll an ordinary six-sided die, and the one with the highest amount of points will be the winner, and will take the other two to the place of his/her dreams.
Yakko thrown a die and got Y points, Wakko — W points. It was Dot's turn. But she didn't hurry. Dot wanted to know for sure what were her chances to visit Transylvania.
It is known that Yakko and Wakko are true gentlemen, that's why if they have the same amount of points with Dot, they will let Dot win.
Input Specification:
The only line of the input file contains two natural numbers Y and W — the results of Yakko's and Wakko's die rolls.
Output Specification:
Output the required probability in the form of irreducible fraction in format «A/B», where A — the numerator, and B — the denominator. If the required probability equals to zero, output «0/1». If the required probability equals to 1, output «1/1».
Demo Input:
['4 2\n']
Demo Output:
['1/2\n']
Note:
Dot will go to Transylvania, if she is lucky to roll 4, 5 or 6 points.
|
```python
val = input().split()
data = [int(x) for x in val]
num = 7 - max(data)
denom = 6
for i in range(2,num+1):
if num%i==0 and denom%i==0:
num/=i
denom/=i
print('{0}/{1}'.format(int(num),int(denom)))
```
| 3.923
|
729
|
A
|
Interview with Oleg
|
PROGRAMMING
| 900
|
[
"implementation",
"strings"
] | null | null |
Polycarp has interviewed Oleg and has written the interview down without punctuation marks and spaces to save time. Thus, the interview is now a string *s* consisting of *n* lowercase English letters.
There is a filler word ogo in Oleg's speech. All words that can be obtained from ogo by adding go several times to the end of it are also considered to be fillers. For example, the words ogo, ogogo, ogogogo are fillers, but the words go, og, ogog, ogogog and oggo are not fillers.
The fillers have maximal size, for example, for ogogoo speech we can't consider ogo a filler and goo as a normal phrase. We should consider ogogo as a filler here.
To print the interview, Polycarp has to replace each of the fillers with three asterisks. Note that a filler word is replaced with exactly three asterisks regardless of its length.
Polycarp has dealt with this problem in no time. Can you do the same? The clock is ticking!
|
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the length of the interview.
The second line contains the string *s* of length *n*, consisting of lowercase English letters.
|
Print the interview text after the replacement of each of the fillers with "***". It is allowed for the substring "***" to have several consecutive occurences.
|
[
"7\naogogob\n",
"13\nogogmgogogogo\n",
"9\nogoogoogo\n"
] |
[
"a***b\n",
"***gmg***\n",
"*********\n"
] |
The first sample contains one filler word ogogo, so the interview for printing is "a***b".
The second sample contains two fillers ogo and ogogogo. Thus, the interview is transformed to "***gmg***".
| 500
|
[
{
"input": "7\naogogob",
"output": "a***b"
},
{
"input": "13\nogogmgogogogo",
"output": "***gmg***"
},
{
"input": "9\nogoogoogo",
"output": "*********"
},
{
"input": "32\nabcdefogoghijklmnogoopqrstuvwxyz",
"output": "abcdef***ghijklmn***opqrstuvwxyz"
},
{
"input": "100\nggogogoooggogooggoggogggggogoogoggooooggooggoooggogoooggoggoogggoogoggogggoooggoggoggogggogoogggoooo",
"output": "gg***oogg***oggoggoggggg******ggooooggooggooogg***ooggoggoogggo***ggogggoooggoggoggoggg***ogggoooo"
},
{
"input": "10\nogooggoggo",
"output": "***oggoggo"
},
{
"input": "20\nooggooogooogooogooog",
"output": "ooggoo***o***o***oog"
},
{
"input": "30\ngoggogoooggooggggoggoggoogoggo",
"output": "gogg***ooggooggggoggoggo***ggo"
},
{
"input": "40\nogggogooggoogoogggogooogogggoogggooggooo",
"output": "oggg***oggo***oggg***o***gggoogggooggooo"
},
{
"input": "50\noggggogoogggggggoogogggoooggooogoggogooogogggogooo",
"output": "ogggg***ogggggggo***gggoooggoo***gg***o***ggg***oo"
},
{
"input": "60\nggoooogoggogooogogooggoogggggogogogggggogggogooogogogggogooo",
"output": "ggooo***gg***o***oggooggggg***gggggoggg***o***ggg***oo"
},
{
"input": "70\ngogoooggggoggoggggggoggggoogooogogggggooogggogoogoogoggogggoggogoooooo",
"output": "g***ooggggoggoggggggoggggo***o***gggggoooggg*********ggogggogg***ooooo"
},
{
"input": "80\nooogoggoooggogogoggooooogoogogooogoggggogggggogoogggooogooooooggoggoggoggogoooog",
"output": "oo***ggooogg***ggoooo******o***ggggoggggg***ogggoo***oooooggoggoggogg***ooog"
},
{
"input": "90\nooogoggggooogoggggoooogggggooggoggoggooooooogggoggogggooggggoooooogoooogooggoooogggggooooo",
"output": "oo***ggggoo***ggggoooogggggooggoggoggooooooogggoggogggooggggooooo***oo***oggoooogggggooooo"
},
{
"input": "100\ngooogoggooggggoggoggooooggogoogggoogogggoogogoggogogogoggogggggogggggoogggooogogoggoooggogoooooogogg",
"output": "goo***ggooggggoggoggoooogg***ogggo***gggo***gg***ggogggggogggggoogggoo***ggooogg***oooo***gg"
},
{
"input": "100\ngoogoogggogoooooggoogooogoogoogogoooooogooogooggggoogoggogooogogogoogogooooggoggogoooogooooooggogogo",
"output": "go***oggg***ooooggo***o*********oooo***o***oggggo***gg***o******oooggogg***oo***ooooogg***"
},
{
"input": "100\ngoogoggggogggoooggoogoogogooggoggooggggggogogggogogggoogogggoogoggoggogooogogoooogooggggogggogggoooo",
"output": "go***ggggogggoooggo******oggoggoogggggg***ggg***gggo***gggo***ggogg***o***oo***oggggogggogggoooo"
},
{
"input": "100\nogogogogogoggogogogogogogoggogogogoogoggoggooggoggogoogoooogogoogggogogogogogoggogogogogogogogogogoe",
"output": "***gg***gg******ggoggooggogg******oo***oggg***gg***e"
},
{
"input": "5\nogoga",
"output": "***ga"
},
{
"input": "1\no",
"output": "o"
},
{
"input": "100\nogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogog",
"output": "***g"
},
{
"input": "99\nogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogogo",
"output": "***"
},
{
"input": "5\nggggg",
"output": "ggggg"
},
{
"input": "6\ngoogoo",
"output": "go***o"
},
{
"input": "7\nooogooo",
"output": "oo***oo"
},
{
"input": "8\ngggggggg",
"output": "gggggggg"
},
{
"input": "9\nogggogggg",
"output": "ogggogggg"
},
{
"input": "10\nogogoggogo",
"output": "***gg***"
},
{
"input": "11\noooggooggog",
"output": "oooggooggog"
},
{
"input": "12\nogggooooggog",
"output": "ogggooooggog"
},
{
"input": "13\nogoggogogooog",
"output": "***gg***oog"
},
{
"input": "15\nggooogoooggoggg",
"output": "ggoo***ooggoggg"
},
{
"input": "14\noogooooggooggo",
"output": "o***oooggooggo"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "1\ng",
"output": "g"
},
{
"input": "1\nz",
"output": "z"
},
{
"input": "46\nsdfkogogogogergergogogergerogogogogoergoegogog",
"output": "sdfk***gergerg***gerger***ergoeg***g"
},
{
"input": "86\ngdfggogogodfogogdofgoodfogodgodgfogoogdodhbofgobgbgfogoogdfogogogogogoogggsgfosogodgon",
"output": "gdfgg***df***gdofgoodf***dgodgf***ogdodhbofgobgbgf***ogdf***ogggsgfos***dgon"
},
{
"input": "83\nergegergoogogogerogoerorogroeorgefxcfgzdgawofqpwzxcvbnmsdfkfpweoriqgtogooggsdgogoog",
"output": "ergegergo***ger***erorogroeorgefxcfgzdgawofqpwzxcvbnmsdfkfpweoriqgt***oggsdg***og"
},
{
"input": "2\nog",
"output": "og"
},
{
"input": "4\nogog",
"output": "***g"
},
{
"input": "4\nogoo",
"output": "***o"
},
{
"input": "29\naaaogogogogogogogogogogogobbb",
"output": "aaa***bbb"
},
{
"input": "11\nogogogogogo",
"output": "***"
},
{
"input": "9\nogogogogo",
"output": "***"
},
{
"input": "3\nogo",
"output": "***"
},
{
"input": "15\nogogogogogogogo",
"output": "***"
},
{
"input": "25\nogogogogogogogogogogogogo",
"output": "***"
}
] | 1,570,099,601
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
t=int(input())
n=input()
print(n.replace("ogo","*")
|
Title: Interview with Oleg
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarp has interviewed Oleg and has written the interview down without punctuation marks and spaces to save time. Thus, the interview is now a string *s* consisting of *n* lowercase English letters.
There is a filler word ogo in Oleg's speech. All words that can be obtained from ogo by adding go several times to the end of it are also considered to be fillers. For example, the words ogo, ogogo, ogogogo are fillers, but the words go, og, ogog, ogogog and oggo are not fillers.
The fillers have maximal size, for example, for ogogoo speech we can't consider ogo a filler and goo as a normal phrase. We should consider ogogo as a filler here.
To print the interview, Polycarp has to replace each of the fillers with three asterisks. Note that a filler word is replaced with exactly three asterisks regardless of its length.
Polycarp has dealt with this problem in no time. Can you do the same? The clock is ticking!
Input Specification:
The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=100) — the length of the interview.
The second line contains the string *s* of length *n*, consisting of lowercase English letters.
Output Specification:
Print the interview text after the replacement of each of the fillers with "***". It is allowed for the substring "***" to have several consecutive occurences.
Demo Input:
['7\naogogob\n', '13\nogogmgogogogo\n', '9\nogoogoogo\n']
Demo Output:
['a***b\n', '***gmg***\n', '*********\n']
Note:
The first sample contains one filler word ogogo, so the interview for printing is "a***b".
The second sample contains two fillers ogo and ogogogo. Thus, the interview is transformed to "***gmg***".
|
```python
t=int(input())
n=input()
print(n.replace("ogo","*")
```
| -1
|
|
1
|
A
|
Theatre Square
|
PROGRAMMING
| 1,000
|
[
"math"
] |
A. Theatre Square
|
1
|
256
|
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
|
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
|
Write the needed number of flagstones.
|
[
"6 6 4\n"
] |
[
"4\n"
] |
none
| 0
|
[
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,681,477,831
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 5
| 46
| 0
|
x=input().split(" ")
x=[int(num) for num in x]
m=int(x[0])
n=int(x[1])
a=int(x[2])
width=int(m/a)
height=int(n/a)
if width%a>0:
width+=1
if height%a>0:
height+=1
print((width)*(height))
|
Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none
|
```python
x=input().split(" ")
x=[int(num) for num in x]
m=int(x[0])
n=int(x[1])
a=int(x[2])
width=int(m/a)
height=int(n/a)
if width%a>0:
width+=1
if height%a>0:
height+=1
print((width)*(height))
```
| 0
|
379
|
A
|
New Year Candles
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is smart, so he can make *b* went out candles into a new candle. As a result, this new candle can be used like any other new candle.
Now Vasily wonders: for how many hours can his candles light up the room if he acts optimally well? Help him find this number.
|
The single line contains two integers, *a* and *b* (1<=≤<=*a*<=≤<=1000; 2<=≤<=*b*<=≤<=1000).
|
Print a single integer — the number of hours Vasily can light up the room for.
|
[
"4 2\n",
"6 3\n"
] |
[
"7\n",
"8\n"
] |
Consider the first sample. For the first four hours Vasily lights up new candles, then he uses four burned out candles to make two new ones and lights them up. When these candles go out (stop burning), Vasily can make another candle. Overall, Vasily can light up the room for 7 hours.
| 500
|
[
{
"input": "4 2",
"output": "7"
},
{
"input": "6 3",
"output": "8"
},
{
"input": "1000 1000",
"output": "1001"
},
{
"input": "123 5",
"output": "153"
},
{
"input": "1000 2",
"output": "1999"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "1 4",
"output": "1"
},
{
"input": "2 2",
"output": "3"
},
{
"input": "3 2",
"output": "5"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "999 2",
"output": "1997"
},
{
"input": "1000 3",
"output": "1499"
},
{
"input": "1000 4",
"output": "1333"
},
{
"input": "1 1000",
"output": "1"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "80 970",
"output": "80"
},
{
"input": "10 4",
"output": "13"
},
{
"input": "4 3",
"output": "5"
},
{
"input": "91 5",
"output": "113"
},
{
"input": "777 17",
"output": "825"
},
{
"input": "100 4",
"output": "133"
},
{
"input": "5 3",
"output": "7"
},
{
"input": "6 4",
"output": "7"
},
{
"input": "26 8",
"output": "29"
},
{
"input": "9 4",
"output": "11"
},
{
"input": "20 3",
"output": "29"
},
{
"input": "17 3",
"output": "25"
}
] | 1,686,057,142
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 31
| 0
|
a,b=map(int,input().split())
c=a
s=a
while c>0:
c=int(c/b)
s+=c
print(s)
|
Title: New Year Candles
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasily the Programmer loves romance, so this year he decided to illuminate his room with candles.
Vasily has *a* candles.When Vasily lights up a new candle, it first burns for an hour and then it goes out. Vasily is smart, so he can make *b* went out candles into a new candle. As a result, this new candle can be used like any other new candle.
Now Vasily wonders: for how many hours can his candles light up the room if he acts optimally well? Help him find this number.
Input Specification:
The single line contains two integers, *a* and *b* (1<=≤<=*a*<=≤<=1000; 2<=≤<=*b*<=≤<=1000).
Output Specification:
Print a single integer — the number of hours Vasily can light up the room for.
Demo Input:
['4 2\n', '6 3\n']
Demo Output:
['7\n', '8\n']
Note:
Consider the first sample. For the first four hours Vasily lights up new candles, then he uses four burned out candles to make two new ones and lights them up. When these candles go out (stop burning), Vasily can make another candle. Overall, Vasily can light up the room for 7 hours.
|
```python
a,b=map(int,input().split())
c=a
s=a
while c>0:
c=int(c/b)
s+=c
print(s)
```
| 0
|
|
386
|
A
|
Second-Price Auction
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
In this problem we consider a special type of an auction, which is called the second-price auction. As in regular auction *n* bidders place a bid which is price a bidder ready to pay. The auction is closed, that is, each bidder secretly informs the organizer of the auction price he is willing to pay. After that, the auction winner is the participant who offered the highest price. However, he pay not the price he offers, but the highest price among the offers of other participants (hence the name: the second-price auction).
Write a program that reads prices offered by bidders and finds the winner and the price he will pay. Consider that all of the offered prices are different.
|
The first line of the input contains *n* (2<=≤<=*n*<=≤<=1000) — number of bidders. The second line contains *n* distinct integer numbers *p*1,<=*p*2,<=... *p**n*, separated by single spaces (1<=≤<=*p**i*<=≤<=10000), where *p**i* stands for the price offered by the *i*-th bidder.
|
The single output line should contain two integers: index of the winner and the price he will pay. Indices are 1-based.
|
[
"2\n5 7\n",
"3\n10 2 8\n",
"6\n3 8 2 9 4 14\n"
] |
[
"2 5\n",
"1 8\n",
"6 9\n"
] |
none
| 500
|
[
{
"input": "2\n5 7",
"output": "2 5"
},
{
"input": "3\n10 2 8",
"output": "1 8"
},
{
"input": "6\n3 8 2 9 4 14",
"output": "6 9"
},
{
"input": "4\n4707 7586 4221 5842",
"output": "2 5842"
},
{
"input": "5\n3304 4227 4869 6937 6002",
"output": "4 6002"
},
{
"input": "6\n5083 3289 7708 5362 9031 7458",
"output": "5 7708"
},
{
"input": "7\n9038 6222 3392 1706 3778 1807 2657",
"output": "1 6222"
},
{
"input": "8\n7062 2194 4481 3864 7470 1814 8091 733",
"output": "7 7470"
},
{
"input": "9\n2678 5659 9199 2628 7906 7496 4524 2663 3408",
"output": "3 7906"
},
{
"input": "2\n3458 1504",
"output": "1 1504"
},
{
"input": "50\n9237 3904 407 9052 6657 9229 9752 3888 7732 2512 4614 1055 2355 7108 6506 6849 2529 8862 159 8630 7906 7941 960 8470 333 8659 54 9475 3163 5625 6393 6814 2656 3388 169 7918 4881 8468 9983 6281 6340 280 5108 2996 101 7617 3313 8172 326 1991",
"output": "39 9752"
},
{
"input": "100\n2515 3324 7975 6171 4240 1217 4829 5203 8603 6900 3031 4699 4732 6070 4221 3228 6497 7359 9130 4346 4619 1109 3945 5442 3271 16 9711 2045 6410 2301 3406 8125 6003 1892 1260 9661 3940 6692 4708 7027 4930 6925 1979 5361 4263 3144 867 8639 6230 5562 9714 3676 4231 3347 4733 4920 4881 3431 1059 7313 8912 3038 9308 72 9583 7009 3034 7425 2398 6141 3245 2495 2933 6710 8289 9806 1226 8393 7349 6462 1618 9613 3546 6012 2964 9995 1578 210 2123 4874 1252 8625 348 8020 803 7244 9080 5088 706 2602",
"output": "86 9806"
},
{
"input": "2\n2 1",
"output": "1 1"
},
{
"input": "2\n1 2",
"output": "2 1"
},
{
"input": "3\n10 20 30",
"output": "3 20"
},
{
"input": "3\n10 30 20",
"output": "2 20"
},
{
"input": "3\n20 10 30",
"output": "3 20"
},
{
"input": "3\n20 30 10",
"output": "2 20"
},
{
"input": "3\n30 10 20",
"output": "1 20"
},
{
"input": "3\n30 20 10",
"output": "1 20"
},
{
"input": "2\n1 10000",
"output": "2 1"
},
{
"input": "2\n10000 999",
"output": "1 999"
},
{
"input": "3\n3 4 1",
"output": "2 3"
},
{
"input": "6\n1 2 24 6 5 7",
"output": "3 7"
}
] | 1,585,582,998
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 42
| 109
| 307,200
|
n = int(input())
array = list(map(int,input().split()))
array2 = []
for x in array:
array2.append(x)
array.sort()
win = array[-2]
index = array2.index(array[-1]) + 1
print(index,win)
|
Title: Second-Price Auction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In this problem we consider a special type of an auction, which is called the second-price auction. As in regular auction *n* bidders place a bid which is price a bidder ready to pay. The auction is closed, that is, each bidder secretly informs the organizer of the auction price he is willing to pay. After that, the auction winner is the participant who offered the highest price. However, he pay not the price he offers, but the highest price among the offers of other participants (hence the name: the second-price auction).
Write a program that reads prices offered by bidders and finds the winner and the price he will pay. Consider that all of the offered prices are different.
Input Specification:
The first line of the input contains *n* (2<=≤<=*n*<=≤<=1000) — number of bidders. The second line contains *n* distinct integer numbers *p*1,<=*p*2,<=... *p**n*, separated by single spaces (1<=≤<=*p**i*<=≤<=10000), where *p**i* stands for the price offered by the *i*-th bidder.
Output Specification:
The single output line should contain two integers: index of the winner and the price he will pay. Indices are 1-based.
Demo Input:
['2\n5 7\n', '3\n10 2 8\n', '6\n3 8 2 9 4 14\n']
Demo Output:
['2 5\n', '1 8\n', '6 9\n']
Note:
none
|
```python
n = int(input())
array = list(map(int,input().split()))
array2 = []
for x in array:
array2.append(x)
array.sort()
win = array[-2]
index = array2.index(array[-1]) + 1
print(index,win)
```
| 3
|
|
32
|
D
|
Constellation
|
PROGRAMMING
| 1,600
|
[
"implementation"
] |
D. Constellation
|
2
|
256
|
A star map in Berland is a checked field *n*<=×<=*m* squares. In each square there is or there is not a star. The favourite constellation of all Berland's astronomers is the constellation of the Cross. This constellation can be formed by any 5 stars so, that for some integer *x* (radius of the constellation) the following is true:
- the 2nd is on the same vertical line as the 1st, but *x* squares up - the 3rd is on the same vertical line as the 1st, but *x* squares down - the 4th is on the same horizontal line as the 1st, but *x* squares left - the 5th is on the same horizontal line as the 1st, but *x* squares right
Such constellations can be very numerous, that's why they are numbered with integers from 1 on the following principle: when two constellations are compared, the one with a smaller radius gets a smaller index; if their radii are equal — the one, whose central star if higher than the central star of the other one; if their central stars are at the same level — the one, whose central star is to the left of the central star of the other one.
Your task is to find the constellation with index *k* by the given Berland's star map.
|
The first line contains three integers *n*, *m* and *k* (1<=≤<=*n*,<=*m*<=≤<=300,<=1<=≤<=*k*<=≤<=3·107) — height and width of the map and index of the required constellation respectively. The upper-left corner has coordinates (1,<=1), and the lower-right — (*n*,<=*m*). Then there follow *n* lines, *m* characters each — description of the map. *j*-th character in *i*-th line is «*», if there is a star in the corresponding square, and «.» if this square is empty.
|
If the number of the constellations is less than *k*, output -1. Otherwise output 5 lines, two integers each — coordinates of the required constellation. Output the stars in the following order: central, upper, lower, left, right.
|
[
"5 6 1\n....*.\n...***\n....*.\n..*...\n.***..\n",
"5 6 2\n....*.\n...***\n....*.\n..*...\n.***..\n",
"7 7 2\n...*...\n.......\n...*...\n*.***.*\n...*...\n.......\n...*...\n"
] |
[
"2 5\n1 5\n3 5\n2 4\n2 6\n",
"-1\n",
"4 4\n1 4\n7 4\n4 1\n4 7\n"
] |
none
| 2,000
|
[
{
"input": "5 6 1\n....*.\n...***\n....*.\n..*...\n.***..",
"output": "2 5\n1 5\n3 5\n2 4\n2 6"
},
{
"input": "5 6 2\n....*.\n...***\n....*.\n..*...\n.***..",
"output": "-1"
},
{
"input": "5 5 1\n.....\n.....\n.*..*\n*.*..\n....*",
"output": "-1"
},
{
"input": "5 5 3\n*.***\n.****\n..***\n*.***\n.**.*",
"output": "3 4\n2 4\n4 4\n3 3\n3 5"
},
{
"input": "10 10 6\n.*..**.**.\n**********\n****.*****\n**.***....\n***.******\n****.**..*\n**.**.****\n****.**..*\n..**.**.*.\n.*.*..***.",
"output": "5 2\n4 2\n6 2\n5 1\n5 3"
},
{
"input": "10 10 59\n**.*******\n********.*\n***.******\n**.*******\n*******.**\n**********\n**.**.****\n.*********\n*****.****\n*********.",
"output": "6 5\n3 5\n9 5\n6 2\n6 8"
},
{
"input": "10 10 40\n**********\n**********\n**********\n**********\n**********\n**********\n**********\n**********\n**********\n**********",
"output": "6 9\n5 9\n7 9\n6 8\n6 10"
}
] | 1,648,726,250
| 2,147,483,647
|
PyPy 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 33
| 2,000
| 95,027,200
|
n,m,k=map(int,input().split())
l=[]
for i in range(n):
l+=[input()]
q=set()
for i in range(n):
for j in range(m):
if l[i][j]=="*":
r=1
while r:
if i+r<n and i-r>-1 and j+r<m and j-r>-1:
if l[i+r][j]=="*"and l[i-r][j]=="*"and l[i][j+r]=="*"and l[i][j-r]=="*":
q.add((r,i+1,j+1))
else:break
r+=1
if len(q)<k:
print(-1)
else:
r,x,y=sorted(q)[k-1]
print(x,y)
print(x-r,y)
print(x+r,y)
print(x,y-r)
print(x,y+r)
|
Title: Constellation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A star map in Berland is a checked field *n*<=×<=*m* squares. In each square there is or there is not a star. The favourite constellation of all Berland's astronomers is the constellation of the Cross. This constellation can be formed by any 5 stars so, that for some integer *x* (radius of the constellation) the following is true:
- the 2nd is on the same vertical line as the 1st, but *x* squares up - the 3rd is on the same vertical line as the 1st, but *x* squares down - the 4th is on the same horizontal line as the 1st, but *x* squares left - the 5th is on the same horizontal line as the 1st, but *x* squares right
Such constellations can be very numerous, that's why they are numbered with integers from 1 on the following principle: when two constellations are compared, the one with a smaller radius gets a smaller index; if their radii are equal — the one, whose central star if higher than the central star of the other one; if their central stars are at the same level — the one, whose central star is to the left of the central star of the other one.
Your task is to find the constellation with index *k* by the given Berland's star map.
Input Specification:
The first line contains three integers *n*, *m* and *k* (1<=≤<=*n*,<=*m*<=≤<=300,<=1<=≤<=*k*<=≤<=3·107) — height and width of the map and index of the required constellation respectively. The upper-left corner has coordinates (1,<=1), and the lower-right — (*n*,<=*m*). Then there follow *n* lines, *m* characters each — description of the map. *j*-th character in *i*-th line is «*», if there is a star in the corresponding square, and «.» if this square is empty.
Output Specification:
If the number of the constellations is less than *k*, output -1. Otherwise output 5 lines, two integers each — coordinates of the required constellation. Output the stars in the following order: central, upper, lower, left, right.
Demo Input:
['5 6 1\n....*.\n...***\n....*.\n..*...\n.***..\n', '5 6 2\n....*.\n...***\n....*.\n..*...\n.***..\n', '7 7 2\n...*...\n.......\n...*...\n*.***.*\n...*...\n.......\n...*...\n']
Demo Output:
['2 5\n1 5\n3 5\n2 4\n2 6\n', '-1\n', '4 4\n1 4\n7 4\n4 1\n4 7\n']
Note:
none
|
```python
n,m,k=map(int,input().split())
l=[]
for i in range(n):
l+=[input()]
q=set()
for i in range(n):
for j in range(m):
if l[i][j]=="*":
r=1
while r:
if i+r<n and i-r>-1 and j+r<m and j-r>-1:
if l[i+r][j]=="*"and l[i-r][j]=="*"and l[i][j+r]=="*"and l[i][j-r]=="*":
q.add((r,i+1,j+1))
else:break
r+=1
if len(q)<k:
print(-1)
else:
r,x,y=sorted(q)[k-1]
print(x,y)
print(x-r,y)
print(x+r,y)
print(x,y-r)
print(x,y+r)
```
| 0
|
260
|
A
|
Adding Digits
|
PROGRAMMING
| 1,400
|
[
"implementation",
"math"
] | null | null |
Vasya has got two number: *a* and *b*. However, Vasya finds number *a* too short. So he decided to repeat the operation of lengthening number *a* *n* times.
One operation of lengthening a number means adding exactly one digit to the number (in the decimal notation) to the right provided that the resulting number is divisible by Vasya's number *b*. If it is impossible to obtain the number which is divisible by *b*, then the lengthening operation cannot be performed.
Your task is to help Vasya and print the number he can get after applying the lengthening operation to number *a* *n* times.
|
The first line contains three integers: *a*,<=*b*,<=*n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=105).
|
In a single line print the integer without leading zeros, which Vasya can get when he applies the lengthening operations to number *a* *n* times. If no such number exists, then print number -1. If there are multiple possible answers, print any of them.
|
[
"5 4 5\n",
"12 11 1\n",
"260 150 10\n"
] |
[
"524848\n",
"121\n",
"-1\n"
] |
none
| 500
|
[
{
"input": "5 4 5",
"output": "524848"
},
{
"input": "12 11 1",
"output": "121"
},
{
"input": "260 150 10",
"output": "-1"
},
{
"input": "78843 5684 42717",
"output": "-1"
},
{
"input": "93248 91435 1133",
"output": "-1"
},
{
"input": "100000 10 64479",
"output": "1000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99999 21 73839",
"output": "9999990000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99991 623 36438",
"output": "9999150000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99999 334 94854",
"output": "9999960000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99252 9827 84849",
"output": "9925270000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99313 9833 10561",
"output": "9931330000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "94885 55815 11417",
"output": "9488550000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99492 58525 53481",
"output": "9949250000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99858 28531 79193",
"output": "9985850000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "99136 47208 42607",
"output": "9913680000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "63270 19953 5555",
"output": "-1"
},
{
"input": "10240 128 100000",
"output": "1024000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "12 11 3",
"output": "12100"
},
{
"input": "14 12 99998",
"output": "1440000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000..."
},
{
"input": "1 11 3",
"output": "1100"
},
{
"input": "3 40 1",
"output": "-1"
},
{
"input": "150 100 10",
"output": "1500000000000"
},
{
"input": "5 10 1",
"output": "50"
},
{
"input": "1 15 10",
"output": "15000000000"
},
{
"input": "3 13 2",
"output": "390"
}
] | 1,562,908,985
| 2,147,483,647
|
PyPy 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 16
| 2,000
| 9,113,600
|
inp = list(map(int,input().split()))
a=inp[0]
b=inp[1]
n=inp[2]
k=0
while((10*a+k)%b!=0 and k<10):
k+=1
if(k!=10):
s=10*a+k
count=2
while(count<=n):
s=s*10
count+=1
print (s)
else:
print (-1)
|
Title: Adding Digits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has got two number: *a* and *b*. However, Vasya finds number *a* too short. So he decided to repeat the operation of lengthening number *a* *n* times.
One operation of lengthening a number means adding exactly one digit to the number (in the decimal notation) to the right provided that the resulting number is divisible by Vasya's number *b*. If it is impossible to obtain the number which is divisible by *b*, then the lengthening operation cannot be performed.
Your task is to help Vasya and print the number he can get after applying the lengthening operation to number *a* *n* times.
Input Specification:
The first line contains three integers: *a*,<=*b*,<=*n* (1<=≤<=*a*,<=*b*,<=*n*<=≤<=105).
Output Specification:
In a single line print the integer without leading zeros, which Vasya can get when he applies the lengthening operations to number *a* *n* times. If no such number exists, then print number -1. If there are multiple possible answers, print any of them.
Demo Input:
['5 4 5\n', '12 11 1\n', '260 150 10\n']
Demo Output:
['524848\n', '121\n', '-1\n']
Note:
none
|
```python
inp = list(map(int,input().split()))
a=inp[0]
b=inp[1]
n=inp[2]
k=0
while((10*a+k)%b!=0 and k<10):
k+=1
if(k!=10):
s=10*a+k
count=2
while(count<=n):
s=s*10
count+=1
print (s)
else:
print (-1)
```
| 0
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
A factory produces thimbles in bulk. Typically, it can produce up to *a* thimbles a day. However, some of the machinery is defective, so it can currently only produce *b* thimbles each day. The factory intends to choose a *k*-day period to do maintenance and construction; it cannot produce any thimbles during this time, but will be restored to its full production of *a* thimbles per day after the *k* days are complete.
Initially, no orders are pending. The factory receives updates of the form *d**i*, *a**i*, indicating that *a**i* new orders have been placed for the *d**i*-th day. Each order requires a single thimble to be produced on precisely the specified day. The factory may opt to fill as many or as few of the orders in a single batch as it likes.
As orders come in, the factory owner would like to know the maximum number of orders he will be able to fill if he starts repairs on a given day *p**i*. Help the owner answer his questions.
|
The first line contains five integers *n*, *k*, *a*, *b*, and *q* (1<=≤<=*k*<=≤<=*n*<=≤<=200<=000, 1<=≤<=*b*<=<<=*a*<=≤<=10 000, 1<=≤<=*q*<=≤<=200<=000) — the number of days, the length of the repair time, the production rates of the factory, and the number of updates, respectively.
The next *q* lines contain the descriptions of the queries. Each query is of one of the following two forms:
- 1 *d**i* *a**i* (1<=≤<=*d**i*<=≤<=*n*, 1<=≤<=*a**i*<=≤<=10 000), representing an update of *a**i* orders on day *d**i*, or - 2 *p**i* (1<=≤<=*p**i*<=≤<=*n*<=-<=*k*<=+<=1), representing a question: at the moment, how many orders could be filled if the factory decided to commence repairs on day *p**i*?
It's guaranteed that the input will contain at least one query of the second type.
|
For each query of the second type, print a line containing a single integer — the maximum number of orders that the factory can fill over all *n* days.
|
[
"5 2 2 1 8\n1 1 2\n1 5 3\n1 2 1\n2 2\n1 4 2\n1 3 2\n2 1\n2 3\n",
"5 4 10 1 6\n1 1 5\n1 5 5\n1 3 2\n1 5 2\n2 1\n2 2\n"
] |
[
"3\n6\n4\n",
"7\n1\n"
] |
Consider the first sample.
We produce up to 1 thimble a day currently and will produce up to 2 thimbles a day after repairs. Repairs take 2 days.
For the first question, we are able to fill 1 order on day 1, no orders on days 2 and 3 since we are repairing, no orders on day 4 since no thimbles have been ordered for that day, and 2 orders for day 5 since we are limited to our production capacity, for a total of 3 orders filled.
For the third question, we are able to fill 1 order on day 1, 1 order on day 2, and 2 orders on day 5, for a total of 4 orders.
| 0
|
[
{
"input": "5 2 2 1 8\n1 1 2\n1 5 3\n1 2 1\n2 2\n1 4 2\n1 3 2\n2 1\n2 3",
"output": "3\n6\n4"
},
{
"input": "5 4 10 1 6\n1 1 5\n1 5 5\n1 3 2\n1 5 2\n2 1\n2 2",
"output": "7\n1"
},
{
"input": "1 1 2 1 1\n2 1",
"output": "0"
}
] | 1,692,643,194
| 1,434
|
PyPy 3-64
|
OK
|
TESTS
| 42
| 498
| 43,827,200
|
import sys
input = sys.stdin.buffer.readline
class SegmentTree:
def __init__(self, data, default=0, func=lambda a, b: a+b):
"""initialize the segment tree with data"""
self._default = default
self._func = func
self._len = len(data)
self._size = _size = 1 << (self._len - 1).bit_length()
self.data = [default] * (2 * _size)
self.data[_size:_size + self._len] = data
for i in reversed(range(_size)):
self.data[i] = func(self.data[i + i], self.data[i + i + 1])
def __delitem__(self, idx):
self[idx] = self._default
def __getitem__(self, idx):
return self.data[idx + self._size]
def __setitem__(self, idx, value):
idx += self._size
self.data[idx] = value
idx >>= 1
while idx:
self.data[idx] = self._func(self.data[2 * idx], self.data[2 * idx + 1])
idx >>= 1
def __len__(self):
return self._len
def query(self, start, stop):
"""func of data[start, stop)"""
start += self._size
stop += self._size
res_left = res_right = self._default
while start < stop:
if start & 1:
res_left = self._func(res_left, self.data[start])
start += 1
if stop & 1:
stop -= 1
res_right = self._func(self.data[stop], res_right)
start >>= 1
stop >>= 1
return self._func(res_left, res_right)
def __repr__(self):
return "SegmentTree({0})".format(self.data)
def process(n, k, a, b, Queries):
days = [0 for i in range(n+1)]
S_b = SegmentTree(data=days)
S_a = SegmentTree(data=days)
for query in Queries:
if query[0]==1:
di, ai = query[1], query[2]
S_a[di] = min(S_a[di]+ai, a)
S_b[di] = min(S_b[di]+ai, b)
else:
pi = query[1]
entry = S_b.query(1, pi)+S_a.query(pi+k, n+1)
sys.stdout.write(f'{entry}\n')
n, k, a, b, q = [int(x) for x in input().split()]
Queries = []
for i in range(q):
query = [int(x) for x in input().split()]
Queries.append(query)
process(n, k, a, b, Queries)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A factory produces thimbles in bulk. Typically, it can produce up to *a* thimbles a day. However, some of the machinery is defective, so it can currently only produce *b* thimbles each day. The factory intends to choose a *k*-day period to do maintenance and construction; it cannot produce any thimbles during this time, but will be restored to its full production of *a* thimbles per day after the *k* days are complete.
Initially, no orders are pending. The factory receives updates of the form *d**i*, *a**i*, indicating that *a**i* new orders have been placed for the *d**i*-th day. Each order requires a single thimble to be produced on precisely the specified day. The factory may opt to fill as many or as few of the orders in a single batch as it likes.
As orders come in, the factory owner would like to know the maximum number of orders he will be able to fill if he starts repairs on a given day *p**i*. Help the owner answer his questions.
Input Specification:
The first line contains five integers *n*, *k*, *a*, *b*, and *q* (1<=≤<=*k*<=≤<=*n*<=≤<=200<=000, 1<=≤<=*b*<=<<=*a*<=≤<=10 000, 1<=≤<=*q*<=≤<=200<=000) — the number of days, the length of the repair time, the production rates of the factory, and the number of updates, respectively.
The next *q* lines contain the descriptions of the queries. Each query is of one of the following two forms:
- 1 *d**i* *a**i* (1<=≤<=*d**i*<=≤<=*n*, 1<=≤<=*a**i*<=≤<=10 000), representing an update of *a**i* orders on day *d**i*, or - 2 *p**i* (1<=≤<=*p**i*<=≤<=*n*<=-<=*k*<=+<=1), representing a question: at the moment, how many orders could be filled if the factory decided to commence repairs on day *p**i*?
It's guaranteed that the input will contain at least one query of the second type.
Output Specification:
For each query of the second type, print a line containing a single integer — the maximum number of orders that the factory can fill over all *n* days.
Demo Input:
['5 2 2 1 8\n1 1 2\n1 5 3\n1 2 1\n2 2\n1 4 2\n1 3 2\n2 1\n2 3\n', '5 4 10 1 6\n1 1 5\n1 5 5\n1 3 2\n1 5 2\n2 1\n2 2\n']
Demo Output:
['3\n6\n4\n', '7\n1\n']
Note:
Consider the first sample.
We produce up to 1 thimble a day currently and will produce up to 2 thimbles a day after repairs. Repairs take 2 days.
For the first question, we are able to fill 1 order on day 1, no orders on days 2 and 3 since we are repairing, no orders on day 4 since no thimbles have been ordered for that day, and 2 orders for day 5 since we are limited to our production capacity, for a total of 3 orders filled.
For the third question, we are able to fill 1 order on day 1, 1 order on day 2, and 2 orders on day 5, for a total of 4 orders.
|
```python
import sys
input = sys.stdin.buffer.readline
class SegmentTree:
def __init__(self, data, default=0, func=lambda a, b: a+b):
"""initialize the segment tree with data"""
self._default = default
self._func = func
self._len = len(data)
self._size = _size = 1 << (self._len - 1).bit_length()
self.data = [default] * (2 * _size)
self.data[_size:_size + self._len] = data
for i in reversed(range(_size)):
self.data[i] = func(self.data[i + i], self.data[i + i + 1])
def __delitem__(self, idx):
self[idx] = self._default
def __getitem__(self, idx):
return self.data[idx + self._size]
def __setitem__(self, idx, value):
idx += self._size
self.data[idx] = value
idx >>= 1
while idx:
self.data[idx] = self._func(self.data[2 * idx], self.data[2 * idx + 1])
idx >>= 1
def __len__(self):
return self._len
def query(self, start, stop):
"""func of data[start, stop)"""
start += self._size
stop += self._size
res_left = res_right = self._default
while start < stop:
if start & 1:
res_left = self._func(res_left, self.data[start])
start += 1
if stop & 1:
stop -= 1
res_right = self._func(self.data[stop], res_right)
start >>= 1
stop >>= 1
return self._func(res_left, res_right)
def __repr__(self):
return "SegmentTree({0})".format(self.data)
def process(n, k, a, b, Queries):
days = [0 for i in range(n+1)]
S_b = SegmentTree(data=days)
S_a = SegmentTree(data=days)
for query in Queries:
if query[0]==1:
di, ai = query[1], query[2]
S_a[di] = min(S_a[di]+ai, a)
S_b[di] = min(S_b[di]+ai, b)
else:
pi = query[1]
entry = S_b.query(1, pi)+S_a.query(pi+k, n+1)
sys.stdout.write(f'{entry}\n')
n, k, a, b, q = [int(x) for x in input().split()]
Queries = []
for i in range(q):
query = [int(x) for x in input().split()]
Queries.append(query)
process(n, k, a, b, Queries)
```
| 3
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
There are *n* points on a straight line, and the *i*-th point among them is located at *x**i*. All these coordinates are distinct.
Determine the number *m* — the smallest number of points you should add on the line to make the distances between all neighboring points equal.
|
The first line contains a single integer *n* (3<=≤<=*n*<=≤<=100<=000) — the number of points.
The second line contains a sequence of integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109) — the coordinates of the points. All these coordinates are distinct. The points can be given in an arbitrary order.
|
Print a single integer *m* — the smallest number of points you should add on the line to make the distances between all neighboring points equal.
|
[
"3\n-5 10 5\n",
"6\n100 200 400 300 600 500\n",
"4\n10 9 0 -1\n"
] |
[
"1\n",
"0\n",
"8\n"
] |
In the first example you can add one point with coordinate 0.
In the second example the distances between all neighboring points are already equal, so you shouldn't add anything.
| 0
|
[
{
"input": "3\n-5 10 5",
"output": "1"
},
{
"input": "6\n100 200 400 300 600 500",
"output": "0"
},
{
"input": "4\n10 9 0 -1",
"output": "8"
},
{
"input": "3\n1 4 7",
"output": "0"
},
{
"input": "3\n1 4 6",
"output": "3"
},
{
"input": "3\n1 2 6",
"output": "3"
},
{
"input": "3\n1 3 6",
"output": "3"
},
{
"input": "4\n1 2 3 4",
"output": "0"
},
{
"input": "3\n-1000000000 -999999999 1000000000",
"output": "1999999998"
},
{
"input": "3\n-1000000000 999999999 1000000000",
"output": "1999999998"
},
{
"input": "3\n-1000000000 -999999998 1000000000",
"output": "999999998"
},
{
"input": "3\n-1000000000 999999998 1000000000",
"output": "999999998"
},
{
"input": "3\n422800963 4663162 694989823",
"output": "230108885"
},
{
"input": "5\n-268968800 -435386086 -484420288 579138544 945328473",
"output": "204249819"
},
{
"input": "10\n711183437 845779129 -106125616 -481773790 66231250 -183390793 -711197523 -196001897 -440633306 -873649505",
"output": "156311685"
},
{
"input": "3\n300000002 -799999998 -599999998",
"output": "9"
},
{
"input": "5\n-166282087 234698547 -853072571 644571043 444292437",
"output": "3533"
},
{
"input": "7\n996073710 -246878649 34663194 35526441 634003254 -704646201 -905166147",
"output": "15411"
},
{
"input": "3\n-1000000000 1 1000000000",
"output": "1999999998"
},
{
"input": "5\n-1000000000 1000000000 1 2 -30000",
"output": "1999999996"
},
{
"input": "3\n422800963 0 1000000000",
"output": "999999998"
},
{
"input": "3\n1000000000 500000001 -500000001",
"output": "1499999999"
}
] | 1,521,355,598
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 62
| 7,065,600
|
def gcd(a, b):
return a if b == 0 else gcd(b, a % b)
n = int(input())
data = list(map(int, input().split()))
data.sort()
d = data[0]
prev = data[0]
for index in range(1, n):
d = gcd(d, data[index] - prev)
prev = data[index]
ans = 0
prev = data[0]
for index in range(1, n):
ans += (data[index] - prev) // d - 1
prev = data[index]
print(ans)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* points on a straight line, and the *i*-th point among them is located at *x**i*. All these coordinates are distinct.
Determine the number *m* — the smallest number of points you should add on the line to make the distances between all neighboring points equal.
Input Specification:
The first line contains a single integer *n* (3<=≤<=*n*<=≤<=100<=000) — the number of points.
The second line contains a sequence of integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≤<=*x**i*<=≤<=109) — the coordinates of the points. All these coordinates are distinct. The points can be given in an arbitrary order.
Output Specification:
Print a single integer *m* — the smallest number of points you should add on the line to make the distances between all neighboring points equal.
Demo Input:
['3\n-5 10 5\n', '6\n100 200 400 300 600 500\n', '4\n10 9 0 -1\n']
Demo Output:
['1\n', '0\n', '8\n']
Note:
In the first example you can add one point with coordinate 0.
In the second example the distances between all neighboring points are already equal, so you shouldn't add anything.
|
```python
def gcd(a, b):
return a if b == 0 else gcd(b, a % b)
n = int(input())
data = list(map(int, input().split()))
data.sort()
d = data[0]
prev = data[0]
for index in range(1, n):
d = gcd(d, data[index] - prev)
prev = data[index]
ans = 0
prev = data[0]
for index in range(1, n):
ans += (data[index] - prev) // d - 1
prev = data[index]
print(ans)
```
| 0
|
|
49
|
A
|
Sleuth
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Sleuth
|
2
|
256
|
Vasya plays the sleuth with his friends. The rules of the game are as follows: those who play for the first time, that is Vasya is the sleuth, he should investigate a "crime" and find out what is happening. He can ask any questions whatsoever that can be answered with "Yes" or "No". All the rest agree beforehand to answer the questions like that: if the question’s last letter is a vowel, they answer "Yes" and if the last letter is a consonant, they answer "No". Of course, the sleuth knows nothing about it and his task is to understand that.
Unfortunately, Vasya is not very smart. After 5 hours of endless stupid questions everybody except Vasya got bored. That’s why Vasya’s friends ask you to write a program that would give answers instead of them.
The English alphabet vowels are: A, E, I, O, U, Y
The English alphabet consonants are: B, C, D, F, G, H, J, K, L, M, N, P, Q, R, S, T, V, W, X, Z
|
The single line contains a question represented by a non-empty line consisting of large and small Latin letters, spaces and a question mark. The line length does not exceed 100. It is guaranteed that the question mark occurs exactly once in the line — as the last symbol and that the line contains at least one letter.
|
Print answer for the question in a single line: YES if the answer is "Yes", NO if the answer is "No".
Remember that in the reply to the question the last letter, not the last character counts. I. e. the spaces and the question mark do not count as letters.
|
[
"Is it a melon?\n",
"Is it an apple?\n",
"Is it a banana ?\n",
"Is it an apple and a banana simultaneouSLY?\n"
] |
[
"NO\n",
"YES\n",
"YES\n",
"YES\n"
] |
none
| 500
|
[
{
"input": "Is it a melon?",
"output": "NO"
},
{
"input": "Is it an apple?",
"output": "YES"
},
{
"input": " Is it a banana ?",
"output": "YES"
},
{
"input": "Is it an apple and a banana simultaneouSLY?",
"output": "YES"
},
{
"input": "oHtSbDwzHb?",
"output": "NO"
},
{
"input": "sZecYdUvZHrXx?",
"output": "NO"
},
{
"input": "uMtXK?",
"output": "NO"
},
{
"input": "U?",
"output": "YES"
},
{
"input": "aqFDkCUKeHMyvZFcAyWlMUSQTFomtaWjoKLVyxLCw vcufPBFbaljOuHWiDCROYTcmbgzbaqHXKPOYEbuEtRqqoxBbOETCsQzhw?",
"output": "NO"
},
{
"input": "dJcNqQiFXzcbsj fItCpBLyXOnrSBPebwyFHlxUJHqCUzzCmcAvMiKL NunwOXnKeIxUZmBVwiCUfPkjRAkTPbkYCmwRRnDSLaz?",
"output": "NO"
},
{
"input": "gxzXbdcAQMuFKuuiPohtMgeypr wpDIoDSyOYTdvylcg SoEBZjnMHHYZGEqKgCgBeTbyTwyGuPZxkxsnSczotBdYyfcQsOVDVC?",
"output": "NO"
},
{
"input": "FQXBisXaJFMiHFQlXjixBDMaQuIbyqSBKGsBfTmBKCjszlGVZxEOqYYqRTUkGpSDDAoOXyXcQbHcPaegeOUBNeSD JiKOdECPOF?",
"output": "NO"
},
{
"input": "YhCuZnrWUBEed?",
"output": "NO"
},
{
"input": "hh?",
"output": "NO"
},
{
"input": "whU?",
"output": "YES"
},
{
"input": "fgwg?",
"output": "NO"
},
{
"input": "GlEmEPKrYcOnBNJUIFjszWUyVdvWw DGDjoCMtRJUburkPToCyDrOtMr?",
"output": "NO"
},
{
"input": "n?",
"output": "NO"
},
{
"input": "BueDOlxgzeNlxrzRrMbKiQdmGujEKmGxclvaPpTuHmTqBp?",
"output": "NO"
},
{
"input": "iehvZNQXDGCuVmJPOEysLyUryTdfaIxIuTzTadDbqRQGoCLXkxnyfWSGoLXebNnQQNTqAQJebbyYvHOfpUnXeWdjx?",
"output": "NO"
},
{
"input": " J ?",
"output": "NO"
},
{
"input": " j ?",
"output": "NO"
},
{
"input": " o ?",
"output": "YES"
},
{
"input": " T ?",
"output": "NO"
},
{
"input": " q ?",
"output": "NO"
},
{
"input": " j ?",
"output": "NO"
},
{
"input": " c ?",
"output": "NO"
},
{
"input": " B ?",
"output": "NO"
},
{
"input": "LuhxDHVwMPTtUIUMIQTuQETgXCOQPsfdFlyHvpfOVedjUTpGLAZGOHloIjJJtOLAlHPivzA?",
"output": "YES"
},
{
"input": "wmztmzFfwbGyOmNHENUFMTsFEMWYA?",
"output": "YES"
},
{
"input": "wGsfZCSwN PEUhNUrLfABrxA?",
"output": "YES"
},
{
"input": "mCDHENXjYbgMdBimAdPnewaHfpGWowjWrVAdvWczjw iDcUbyzMsmsnwbviiKiAyGVA?",
"output": "YES"
},
{
"input": "ARIWnwqFqxsQXsXXzHqvFjxOCttAGPUzDtWzsenPYdNXuFOIUGYZsLLK IaoxiyjBBRThoelwdPTkuCQfcBLUEJpCPIrVZlvUWA?",
"output": "YES"
},
{
"input": " PslvVpgpN BXkMFBEVXsyZFIQbBEFxGkYTeXKrOdcmhbiTUatYRUoYAayrchqbksswIlfIjerZPqptvCGnMUhyrQSvwltRhFzA?",
"output": "YES"
},
{
"input": "HpBkttwSjBXDmyleGiRWNUMPaAIE uzTrp KJDzaUiCdsMYOoWKHoUhWUoecCPmACymMUUbGav UMRpCytPETwNFAObZJA?",
"output": "YES"
}
] | 1,607,533,360
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 35
| 280
| 0
|
s = input()
s1 = s.lower()
for i in range(len(s1)-1,-1,-1):
if ord(s1[i]) in range(97,123):
ch = s1[i]
break
if ch in ('a','e','i','o','u','y'):
print('YES')
else:
print('NO')
|
Title: Sleuth
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya plays the sleuth with his friends. The rules of the game are as follows: those who play for the first time, that is Vasya is the sleuth, he should investigate a "crime" and find out what is happening. He can ask any questions whatsoever that can be answered with "Yes" or "No". All the rest agree beforehand to answer the questions like that: if the question’s last letter is a vowel, they answer "Yes" and if the last letter is a consonant, they answer "No". Of course, the sleuth knows nothing about it and his task is to understand that.
Unfortunately, Vasya is not very smart. After 5 hours of endless stupid questions everybody except Vasya got bored. That’s why Vasya’s friends ask you to write a program that would give answers instead of them.
The English alphabet vowels are: A, E, I, O, U, Y
The English alphabet consonants are: B, C, D, F, G, H, J, K, L, M, N, P, Q, R, S, T, V, W, X, Z
Input Specification:
The single line contains a question represented by a non-empty line consisting of large and small Latin letters, spaces and a question mark. The line length does not exceed 100. It is guaranteed that the question mark occurs exactly once in the line — as the last symbol and that the line contains at least one letter.
Output Specification:
Print answer for the question in a single line: YES if the answer is "Yes", NO if the answer is "No".
Remember that in the reply to the question the last letter, not the last character counts. I. e. the spaces and the question mark do not count as letters.
Demo Input:
['Is it a melon?\n', 'Is it an apple?\n', 'Is it a banana ?\n', 'Is it an apple and a banana simultaneouSLY?\n']
Demo Output:
['NO\n', 'YES\n', 'YES\n', 'YES\n']
Note:
none
|
```python
s = input()
s1 = s.lower()
for i in range(len(s1)-1,-1,-1):
if ord(s1[i]) in range(97,123):
ch = s1[i]
break
if ch in ('a','e','i','o','u','y'):
print('YES')
else:
print('NO')
```
| 3.93
|
23
|
E
|
Tree
|
PROGRAMMING
| 2,500
|
[
"dp"
] |
E. Tree
|
2
|
256
|
Recently Bob invented a new game with a tree (we should remind you, that a tree is a connected graph without cycles): he deletes any (possibly, zero) amount of edges of the tree, and counts the product of sizes of the connected components left after the deletion. Your task is to find out the maximum number that Bob can get in his new game for a given tree.
|
The first input line contains integer number *n* (1<=≤<=*n*<=≤<=700) — amount of vertices in the tree. The following *n*<=-<=1 lines contain the description of the edges. Each line contains the pair of vertices' indexes, joined by an edge, *a**i*, *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*). It's guaranteed that the graph described in the input is a tree.
|
Output the only number — the maximum product of sizes of the connected components, that Bob can get after deleting some of the tree's edges.
|
[
"5\n1 2\n2 3\n3 4\n4 5\n",
"8\n1 2\n1 3\n2 4\n2 5\n3 6\n3 7\n6 8\n",
"3\n1 2\n1 3\n"
] |
[
"6",
"18",
"3"
] |
none
| 0
|
[
{
"input": "5\n1 2\n2 3\n3 4\n4 5",
"output": "6"
},
{
"input": "8\n1 2\n1 3\n2 4\n2 5\n3 6\n3 7\n6 8",
"output": "18"
},
{
"input": "3\n1 2\n1 3",
"output": "3"
},
{
"input": "5\n3 2\n1 5\n4 5\n5 3",
"output": "6"
},
{
"input": "5\n2 1\n3 4\n3 5\n5 2",
"output": "6"
},
{
"input": "5\n1 4\n4 5\n4 3\n4 2",
"output": "5"
},
{
"input": "5\n2 3\n3 4\n3 5\n3 1",
"output": "5"
},
{
"input": "10\n4 8\n10 2\n6 3\n10 9\n2 3\n4 1\n7 10\n2 1\n5 1",
"output": "36"
},
{
"input": "15\n4 6\n15 1\n3 8\n15 2\n13 11\n9 10\n14 4\n9 12\n11 6\n8 10\n4 5\n2 11\n7 8\n8 4",
"output": "243"
},
{
"input": "50\n45 39\n18 12\n13 6\n48 45\n46 36\n46 8\n40 36\n29 28\n2 18\n43 26\n25 14\n43 31\n13 30\n12 35\n38 42\n20 5\n7 35\n10 50\n27 13\n1 41\n24 21\n25 5\n7 31\n15 45\n32 25\n43 23\n4 50\n46 11\n40 14\n37 21\n50 2\n41 42\n43 30\n14 22\n36 48\n8 24\n49 20\n19 26\n32 10\n35 29\n1 6\n34 33\n29 3\n6 9\n34 39\n5 47\n16 9\n31 44\n33 17",
"output": "68024448"
},
{
"input": "10\n8 10\n5 7\n1 6\n4 9\n3 8\n8 9\n2 3\n5 8\n8 1",
"output": "32"
},
{
"input": "5\n1 5\n4 3\n2 4\n4 1",
"output": "6"
},
{
"input": "1",
"output": "1"
},
{
"input": "2\n2 1",
"output": "2"
},
{
"input": "3\n1 2\n2 3",
"output": "3"
}
] | 1,562,142,549
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 11
| 2,000
| 3,174,400
|
maxn = 710
to = [[] for i in range(maxn)]
dp = [[0 for i in range(maxn)] for i in range(maxn)]
n = int(input())
tmp = [0 for i in range(maxn)]
def dfs(now, f):
dp[now][0] = dp[now][1] = 1
for i in to[now]:
if i != f:
dfs(i, now)
for j in range(n + 1):
tmp[j] = dp[now][j]
for j in range(n + 1):
for k in range(0, j + 1):
dp[now][j] = max(dp[now][j], tmp[j - k] * dp[i][k])
for i in range(1, n + 1):
dp[now][0] = max(dp[now][0], dp[now][i] * i)
for i in range(1, n):
u, v = map(int, input().split(' '))
to[u].append(v)
to[v].append(u)
dfs(1, 0)
print(dp[1][0])
|
Title: Tree
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Recently Bob invented a new game with a tree (we should remind you, that a tree is a connected graph without cycles): he deletes any (possibly, zero) amount of edges of the tree, and counts the product of sizes of the connected components left after the deletion. Your task is to find out the maximum number that Bob can get in his new game for a given tree.
Input Specification:
The first input line contains integer number *n* (1<=≤<=*n*<=≤<=700) — amount of vertices in the tree. The following *n*<=-<=1 lines contain the description of the edges. Each line contains the pair of vertices' indexes, joined by an edge, *a**i*, *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*). It's guaranteed that the graph described in the input is a tree.
Output Specification:
Output the only number — the maximum product of sizes of the connected components, that Bob can get after deleting some of the tree's edges.
Demo Input:
['5\n1 2\n2 3\n3 4\n4 5\n', '8\n1 2\n1 3\n2 4\n2 5\n3 6\n3 7\n6 8\n', '3\n1 2\n1 3\n']
Demo Output:
['6', '18', '3']
Note:
none
|
```python
maxn = 710
to = [[] for i in range(maxn)]
dp = [[0 for i in range(maxn)] for i in range(maxn)]
n = int(input())
tmp = [0 for i in range(maxn)]
def dfs(now, f):
dp[now][0] = dp[now][1] = 1
for i in to[now]:
if i != f:
dfs(i, now)
for j in range(n + 1):
tmp[j] = dp[now][j]
for j in range(n + 1):
for k in range(0, j + 1):
dp[now][j] = max(dp[now][j], tmp[j - k] * dp[i][k])
for i in range(1, n + 1):
dp[now][0] = max(dp[now][0], dp[now][i] * i)
for i in range(1, n):
u, v = map(int, input().split(' '))
to[u].append(v)
to[v].append(u)
dfs(1, 0)
print(dp[1][0])
```
| 0
|
21
|
C
|
Stripe 2
|
PROGRAMMING
| 2,000
|
[
"binary search",
"dp",
"sortings"
] |
C. Stripe 2
|
1
|
64
|
Once Bob took a paper stripe of n squares (the height of the stripe is 1 square). In each square he wrote an integer number, possibly negative. He became interested in how many ways exist to cut this stripe into three pieces so that the sum of numbers from each piece is equal to the sum of numbers from any other piece, and each piece contains positive integer amount of squares. Would you help Bob solve this problem?
|
The first input line contains integer *n* (1<=≤<=*n*<=≤<=105) — amount of squares in the stripe. The second line contains n space-separated numbers — they are the numbers written in the squares of the stripe. These numbers are integer and do not exceed 10000 in absolute value.
|
Output the amount of ways to cut the stripe into three non-empty pieces so that the sum of numbers from each piece is equal to the sum of numbers from any other piece. Don't forget that it's allowed to cut the stripe along the squares' borders only.
|
[
"4\n1 2 3 3\n",
"5\n1 2 3 4 5\n"
] |
[
"1\n",
"0\n"
] |
none
| 1,500
|
[
{
"input": "1\n-3",
"output": "0"
},
{
"input": "2\n0 0",
"output": "0"
},
{
"input": "3\n0 0 0",
"output": "1"
},
{
"input": "4\n-2 3 3 2",
"output": "0"
},
{
"input": "5\n-6 3 -1 2 -7",
"output": "0"
},
{
"input": "6\n2 3 -3 0 -3 1",
"output": "0"
},
{
"input": "7\n-1 1 -3 4 3 0 2",
"output": "0"
},
{
"input": "8\n2 0 0 2 -1 3 4 5",
"output": "0"
},
{
"input": "9\n-5 -2 1 1 5 0 -4 4 0",
"output": "3"
},
{
"input": "10\n-1 5 2 3 1 5 0 2 2 5",
"output": "0"
},
{
"input": "100\n3 0 -5 2 -3 -1 -1 0 -2 -5 -4 2 1 2 -2 -1 -1 -4 3 -1 -3 -1 5 0 -4 -4 -1 0 -2 -2 0 1 -1 -2 -1 -5 -4 -2 3 1 -3 0 -1 1 0 -1 2 0 -2 -1 -3 1 -2 2 3 2 -3 -5 2 2 -2 -2 1 2 -2 -1 3 0 -4 7 -2 2 1 4 -9 -1 -2 -1 0 -1 0 -2 -2 -1 1 1 -4 2 -3 -3 7 1 1 -3 -7 0 -2 0 5 -2",
"output": "5"
}
] | 1,631,011,777
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 35
| 155
| 30,617,600
|
n,num,ways,q = int(input()),0,0,0
s = list(map(int,input().split()))
sums = sum(s)
for i in range(n):
num += s[i]
if num * 3 == sums * 2 and 0 < i < n - 1:
ways += q
if num * 3 == sums:
q += 1
print(ways)
|
Title: Stripe 2
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
Once Bob took a paper stripe of n squares (the height of the stripe is 1 square). In each square he wrote an integer number, possibly negative. He became interested in how many ways exist to cut this stripe into three pieces so that the sum of numbers from each piece is equal to the sum of numbers from any other piece, and each piece contains positive integer amount of squares. Would you help Bob solve this problem?
Input Specification:
The first input line contains integer *n* (1<=≤<=*n*<=≤<=105) — amount of squares in the stripe. The second line contains n space-separated numbers — they are the numbers written in the squares of the stripe. These numbers are integer and do not exceed 10000 in absolute value.
Output Specification:
Output the amount of ways to cut the stripe into three non-empty pieces so that the sum of numbers from each piece is equal to the sum of numbers from any other piece. Don't forget that it's allowed to cut the stripe along the squares' borders only.
Demo Input:
['4\n1 2 3 3\n', '5\n1 2 3 4 5\n']
Demo Output:
['1\n', '0\n']
Note:
none
|
```python
n,num,ways,q = int(input()),0,0,0
s = list(map(int,input().split()))
sums = sum(s)
for i in range(n):
num += s[i]
if num * 3 == sums * 2 and 0 < i < n - 1:
ways += q
if num * 3 == sums:
q += 1
print(ways)
```
| 3.694381
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
You are given several queries. In the *i*-th query you are given a single positive integer *n**i*. You are to represent *n**i* as a sum of maximum possible number of composite summands and print this maximum number, or print -1, if there are no such splittings.
An integer greater than 1 is composite, if it is not prime, i.e. if it has positive divisors not equal to 1 and the integer itself.
|
The first line contains single integer *q* (1<=≤<=*q*<=≤<=105) — the number of queries.
*q* lines follow. The (*i*<=+<=1)-th line contains single integer *n**i* (1<=≤<=*n**i*<=≤<=109) — the *i*-th query.
|
For each query print the maximum possible number of summands in a valid splitting to composite summands, or -1, if there are no such splittings.
|
[
"1\n12\n",
"2\n6\n8\n",
"3\n1\n2\n3\n"
] |
[
"3\n",
"1\n2\n",
"-1\n-1\n-1\n"
] |
12 = 4 + 4 + 4 = 4 + 8 = 6 + 6 = 12, but the first splitting has the maximum possible number of summands.
8 = 4 + 4, 6 can't be split into several composite summands.
1, 2, 3 are less than any composite number, so they do not have valid splittings.
| 0
|
[
{
"input": "1\n12",
"output": "3"
},
{
"input": "2\n6\n8",
"output": "1\n2"
},
{
"input": "3\n1\n2\n3",
"output": "-1\n-1\n-1"
},
{
"input": "6\n1\n2\n3\n5\n7\n11",
"output": "-1\n-1\n-1\n-1\n-1\n-1"
},
{
"input": "3\n4\n6\n9",
"output": "1\n1\n1"
},
{
"input": "20\n8\n13\n20\n12\n9\n16\n4\n19\n7\n15\n10\n6\n14\n11\n3\n2\n5\n17\n18\n1",
"output": "2\n2\n5\n3\n1\n4\n1\n3\n-1\n2\n2\n1\n3\n-1\n-1\n-1\n-1\n3\n4\n-1"
},
{
"input": "100\n611\n513\n544\n463\n38\n778\n347\n317\n848\n664\n382\n108\n718\n33\n334\n876\n234\n22\n944\n305\n159\n245\n513\n691\n639\n135\n308\n324\n813\n459\n304\n116\n331\n993\n184\n224\n853\n769\n121\n687\n93\n930\n751\n308\n485\n914\n400\n695\n95\n981\n175\n972\n121\n654\n242\n610\n617\n999\n237\n548\n742\n767\n613\n172\n223\n391\n102\n907\n673\n116\n230\n355\n189\n552\n399\n493\n903\n201\n985\n459\n776\n641\n693\n919\n253\n540\n427\n394\n655\n101\n461\n854\n417\n249\n66\n380\n213\n906\n212\n528",
"output": "151\n127\n136\n114\n9\n194\n85\n78\n212\n166\n95\n27\n179\n7\n83\n219\n58\n5\n236\n75\n38\n60\n127\n171\n158\n32\n77\n81\n202\n113\n76\n29\n81\n247\n46\n56\n212\n191\n29\n170\n22\n232\n186\n77\n120\n228\n100\n172\n22\n244\n42\n243\n29\n163\n60\n152\n153\n248\n58\n137\n185\n190\n152\n43\n54\n96\n25\n225\n167\n29\n57\n87\n46\n138\n98\n122\n224\n49\n245\n113\n194\n159\n172\n228\n62\n135\n105\n98\n162\n24\n114\n213\n103\n61\n16\n95\n52\n226\n53\n132"
},
{
"input": "1\n10000001",
"output": "2499999"
}
] | 1,508,060,128
| 5,428
|
Python 3
|
OK
|
TESTS
| 20
| 1,232
| 0
|
dp=[-1,-1,-1,-1,1,-1,1,-1,2,1,2,-1]
for i in range(int(input())):
a=int(input())
if a<12:
print(dp[a])
else:
ans=a//4
if a%2==0:
print(ans)
else:
print(ans-1)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given several queries. In the *i*-th query you are given a single positive integer *n**i*. You are to represent *n**i* as a sum of maximum possible number of composite summands and print this maximum number, or print -1, if there are no such splittings.
An integer greater than 1 is composite, if it is not prime, i.e. if it has positive divisors not equal to 1 and the integer itself.
Input Specification:
The first line contains single integer *q* (1<=≤<=*q*<=≤<=105) — the number of queries.
*q* lines follow. The (*i*<=+<=1)-th line contains single integer *n**i* (1<=≤<=*n**i*<=≤<=109) — the *i*-th query.
Output Specification:
For each query print the maximum possible number of summands in a valid splitting to composite summands, or -1, if there are no such splittings.
Demo Input:
['1\n12\n', '2\n6\n8\n', '3\n1\n2\n3\n']
Demo Output:
['3\n', '1\n2\n', '-1\n-1\n-1\n']
Note:
12 = 4 + 4 + 4 = 4 + 8 = 6 + 6 = 12, but the first splitting has the maximum possible number of summands.
8 = 4 + 4, 6 can't be split into several composite summands.
1, 2, 3 are less than any composite number, so they do not have valid splittings.
|
```python
dp=[-1,-1,-1,-1,1,-1,1,-1,2,1,2,-1]
for i in range(int(input())):
a=int(input())
if a<12:
print(dp[a])
else:
ans=a//4
if a%2==0:
print(ans)
else:
print(ans-1)
```
| 3
|
|
705
|
A
|
Hulk
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Dr. Bruce Banner hates his enemies (like others don't). As we all know, he can barely talk when he turns into the incredible Hulk. That's why he asked you to help him to express his feelings.
Hulk likes the Inception so much, and like that his feelings are complicated. They have *n* layers. The first layer is hate, second one is love, third one is hate and so on...
For example if *n*<==<=1, then his feeling is "I hate it" or if *n*<==<=2 it's "I hate that I love it", and if *n*<==<=3 it's "I hate that I love that I hate it" and so on.
Please help Dr. Banner.
|
The only line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of layers of love and hate.
|
Print Dr.Banner's feeling in one line.
|
[
"1\n",
"2\n",
"3\n"
] |
[
"I hate it\n",
"I hate that I love it\n",
"I hate that I love that I hate it\n"
] |
none
| 500
|
[
{
"input": "1",
"output": "I hate it"
},
{
"input": "2",
"output": "I hate that I love it"
},
{
"input": "3",
"output": "I hate that I love that I hate it"
},
{
"input": "4",
"output": "I hate that I love that I hate that I love it"
},
{
"input": "5",
"output": "I hate that I love that I hate that I love that I hate it"
},
{
"input": "10",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love it"
},
{
"input": "18",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love it"
},
{
"input": "19",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate it"
},
{
"input": "76",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "77",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "81",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "82",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "85",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "86",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "100",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "99",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "98",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "33",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate it"
},
{
"input": "34",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love it"
},
{
"input": "57",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
},
{
"input": "100",
"output": "I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate that I love that I hate ..."
}
] | 1,693,318,556
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 21
| 46
| 0
|
color = int(input())
sentence = ""
for i in range(color):
if i % 2 == 0:
sentence += 'I hate that '
else:
sentence += 'I love that '
sentence = sentence.split(' ')
sentence[-2] = 'it '
print(' '.join(sentence))
|
Title: Hulk
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dr. Bruce Banner hates his enemies (like others don't). As we all know, he can barely talk when he turns into the incredible Hulk. That's why he asked you to help him to express his feelings.
Hulk likes the Inception so much, and like that his feelings are complicated. They have *n* layers. The first layer is hate, second one is love, third one is hate and so on...
For example if *n*<==<=1, then his feeling is "I hate it" or if *n*<==<=2 it's "I hate that I love it", and if *n*<==<=3 it's "I hate that I love that I hate it" and so on.
Please help Dr. Banner.
Input Specification:
The only line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of layers of love and hate.
Output Specification:
Print Dr.Banner's feeling in one line.
Demo Input:
['1\n', '2\n', '3\n']
Demo Output:
['I hate it\n', 'I hate that I love it\n', 'I hate that I love that I hate it\n']
Note:
none
|
```python
color = int(input())
sentence = ""
for i in range(color):
if i % 2 == 0:
sentence += 'I hate that '
else:
sentence += 'I love that '
sentence = sentence.split(' ')
sentence[-2] = 'it '
print(' '.join(sentence))
```
| 3
|
|
137
|
A
|
Postcards and photos
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Polycarpus has postcards and photos hung in a row on the wall. He decided to put them away to the closet and hang on the wall a famous painter's picture. Polycarpus does it like that: he goes from the left to the right and removes the objects consecutively. As Polycarpus doesn't want any mix-ups to happen, he will not carry in his hands objects of two different types. In other words, Polycarpus can't carry both postcards and photos simultaneously. Sometimes he goes to the closet and puts the objects there, thus leaving his hands free. Polycarpus must put all the postcards and photos to the closet. He cannot skip objects. What minimum number of times he should visit the closet if he cannot carry more than 5 items?
|
The only line of the input data contains a non-empty string consisting of letters "С" and "P" whose length does not exceed 100 characters. If the *i*-th character in the string is the letter "С", that means that the *i*-th object (the numbering goes from the left to the right) on Polycarpus' wall is a postcard. And if the *i*-th character is the letter "P", than the *i*-th object on the wall is a photo.
|
Print the only number — the minimum number of times Polycarpus has to visit the closet.
|
[
"CPCPCPC\n",
"CCCCCCPPPPPP\n",
"CCCCCCPPCPPPPPPPPPP\n",
"CCCCCCCCCC\n"
] |
[
"7\n",
"4\n",
"6\n",
"2\n"
] |
In the first sample Polycarpus needs to take one item to the closet 7 times.
In the second sample Polycarpus can first take 3 postcards to the closet; then 3 more. He can take the 6 photos that are left in the similar way, going to the closet twice.
In the third sample Polycarpus can visit the closet twice, both times carrying 3 postcards. Then he can take there 2 photos at once, then one postcard and finally, he can carry the last 10 photos if he visits the closet twice.
In the fourth sample Polycarpus can visit the closet twice and take there all 10 postcards (5 items during each go).
| 500
|
[
{
"input": "CPCPCPC",
"output": "7"
},
{
"input": "CCCCCCPPPPPP",
"output": "4"
},
{
"input": "CCCCCCPPCPPPPPPPPPP",
"output": "6"
},
{
"input": "CCCCCCCCCC",
"output": "2"
},
{
"input": "CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC",
"output": "20"
},
{
"input": "CPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCPCP",
"output": "100"
},
{
"input": "CCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPPCCCCCCPPPPPP",
"output": "28"
},
{
"input": "P",
"output": "1"
},
{
"input": "C",
"output": "1"
},
{
"input": "PC",
"output": "2"
},
{
"input": "PPPPP",
"output": "1"
},
{
"input": "PPPP",
"output": "1"
},
{
"input": "CCCCCCCCCC",
"output": "2"
},
{
"input": "CP",
"output": "2"
},
{
"input": "CPCCPCPPPC",
"output": "7"
},
{
"input": "PPCPCCPCPPCCPPPPPPCP",
"output": "12"
},
{
"input": "PCPCCPCPPCCPCPCCPPPPPCPCPCPCCC",
"output": "20"
},
{
"input": "CCPPPPPCPCCPPPCCPPCPCCPCPPCPPCCCPPCPPPCC",
"output": "21"
},
{
"input": "CPPCCCCCCPCCCCPCCPCPPPCPCCCCCCCPCCPPCCCPCCCCCPPCCC",
"output": "23"
},
{
"input": "PPCCCCPPCCPPPCCCCPPPPPCPPPCPPPCCCPCCCPCPPPCPCCCPCCPPCCPPPPPC",
"output": "26"
},
{
"input": "PPCPPCCCCCPCCCPCCPCCCCPPPCCCCPCPCCPCPCPCPPPPCCPPPPPPPCPCPPPCPCPCPCPPPC",
"output": "39"
},
{
"input": "CCPCPPPPCPPPPCCCCPCCPCPCCPPCPCCCPPCCCCPCCCPCPCCPPPCPPPCPCPPPPPCPCCPCCPPCCCPCPPPC",
"output": "43"
},
{
"input": "CCPPCPCPCPPCCCPCPPPCCCCCPCPPCCCPPCPCPPPPCPPCPPPPCCCPCCPCPPPCPCPPCCCPCCCCCCPCCCCPCCPPPPCCPP",
"output": "47"
},
{
"input": "PPCPPPPCCCCPPPPCPPPPPPPPCPCPPCCPPPPPPPPCPPPPCCCCPPPPCPPCPCPPPCCPPCPPCCCPCPPCCCCCCPCPCPCPPCPCPCPPPCCC",
"output": "49"
},
{
"input": "CCPCCCPPCPPCPCCCPCPPCPPCPPCCCCCCCPCPPCPCCPCCPCPCPCCCPCCCPPPCCPCCPPCCCCCPPPPCPCPPCPCPCCPCPPP",
"output": "53"
},
{
"input": "PCPCPPPPCPCPPPCPPCCCPCPCPCPPCPPPPCCPPPCPPPCPPPPCCPPCCCPCCPCCCCPCCPCPPCPCCCPCPPCP",
"output": "47"
},
{
"input": "PCCPPCCCPPCPPCC",
"output": "8"
},
{
"input": "CCCPPPPPPCCCCPCCPCCCCCCPCCCPPPCPC",
"output": "15"
},
{
"input": "CPPCCPPCCPPPCCCPPPPCPPPPPPPCCPCPCCPPPPCCCPPCCPCCPPCCCPCCPCPPPPCCPP",
"output": "31"
},
{
"input": "CCCCCPPPCCPCPCCPPPPCPCCCPCPPCPCPPPPPCCPCPCPC",
"output": "25"
},
{
"input": "PPPPPPPPPCPCP",
"output": "6"
},
{
"input": "PPPCPCPCCCPPCPCCPPPPCCCPCCP",
"output": "15"
},
{
"input": "PCPCCPCPPPPPPCPCCPCPCPCCPPPCPCPCPPCPPCCPCPCCCPCCCPPCPCPCCPCPPPPCCCCCCPPCCPCCCCCPCCCCPPPCPCCCCCPCPCP",
"output": "59"
},
{
"input": "PCCPCPPCCCCCPCCCPCCCPPCCCCCPPPCCPPPPPPPPCPPPCCPPCPPCPCP",
"output": "26"
},
{
"input": "CPCPCCPPPPCCPPCPPCPPCCCCCCPCCPPPCPPCPCCCCCCPCPCCCCCPCCCCCCPCCPPCCP",
"output": "35"
},
{
"input": "PPCCCCCCPP",
"output": "4"
},
{
"input": "CCCCCCCCCCCCPPCCCCPP",
"output": "6"
},
{
"input": "PPPPPPPPPPPCCCCCCCCCCCCCCCCCCP",
"output": "8"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCPPPPCCCC",
"output": "10"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCPPPC",
"output": "12"
},
{
"input": "CCCCCCCCCPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCCCCCCCCCCCCPPPPPCC",
"output": "13"
},
{
"input": "CCCCCCCCCCCCCCCCCCCCCCCCCPPPCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC",
"output": "15"
},
{
"input": "CCCCCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCPPPPPPPCCPPP",
"output": "18"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCCCCCCCCCCCCCCCPPPPPPPPPPPPPPPPPPP",
"output": "19"
},
{
"input": "PPPPPPPPPPPPPPPPPPPPPPPCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCPPPPPCCCPPPPCCCCCPCC",
"output": "23"
}
] | 1,594,442,116
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 1
| 156
| 6,656,000
|
s = input()
a = 0
t = 1
for i in range(1,len(s)):
if s[i-1]==s[i]:
t = t-1
t = t+1
else:
a = a+ (t+4//5)
t = 1
a = a+ (t+4//5)
print(a)
|
Title: Postcards and photos
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus has postcards and photos hung in a row on the wall. He decided to put them away to the closet and hang on the wall a famous painter's picture. Polycarpus does it like that: he goes from the left to the right and removes the objects consecutively. As Polycarpus doesn't want any mix-ups to happen, he will not carry in his hands objects of two different types. In other words, Polycarpus can't carry both postcards and photos simultaneously. Sometimes he goes to the closet and puts the objects there, thus leaving his hands free. Polycarpus must put all the postcards and photos to the closet. He cannot skip objects. What minimum number of times he should visit the closet if he cannot carry more than 5 items?
Input Specification:
The only line of the input data contains a non-empty string consisting of letters "С" and "P" whose length does not exceed 100 characters. If the *i*-th character in the string is the letter "С", that means that the *i*-th object (the numbering goes from the left to the right) on Polycarpus' wall is a postcard. And if the *i*-th character is the letter "P", than the *i*-th object on the wall is a photo.
Output Specification:
Print the only number — the minimum number of times Polycarpus has to visit the closet.
Demo Input:
['CPCPCPC\n', 'CCCCCCPPPPPP\n', 'CCCCCCPPCPPPPPPPPPP\n', 'CCCCCCCCCC\n']
Demo Output:
['7\n', '4\n', '6\n', '2\n']
Note:
In the first sample Polycarpus needs to take one item to the closet 7 times.
In the second sample Polycarpus can first take 3 postcards to the closet; then 3 more. He can take the 6 photos that are left in the similar way, going to the closet twice.
In the third sample Polycarpus can visit the closet twice, both times carrying 3 postcards. Then he can take there 2 photos at once, then one postcard and finally, he can carry the last 10 photos if he visits the closet twice.
In the fourth sample Polycarpus can visit the closet twice and take there all 10 postcards (5 items during each go).
|
```python
s = input()
a = 0
t = 1
for i in range(1,len(s)):
if s[i-1]==s[i]:
t = t-1
t = t+1
else:
a = a+ (t+4//5)
t = 1
a = a+ (t+4//5)
print(a)
```
| 0
|
|
645
|
A
|
Amity Assessment
|
PROGRAMMING
| 1,200
|
[
"brute force",
"constructive algorithms",
"implementation"
] | null | null |
Bessie the cow and her best friend Elsie each received a sliding puzzle on Pi Day. Their puzzles consist of a 2<=×<=2 grid and three tiles labeled 'A', 'B', and 'C'. The three tiles sit on top of the grid, leaving one grid cell empty. To make a move, Bessie or Elsie can slide a tile adjacent to the empty cell into the empty cell as shown below:
In order to determine if they are truly Best Friends For Life (BFFLs), Bessie and Elsie would like to know if there exists a sequence of moves that takes their puzzles to the same configuration (moves can be performed in both puzzles). Two puzzles are considered to be in the same configuration if each tile is on top of the same grid cell in both puzzles. Since the tiles are labeled with letters, rotations and reflections are not allowed.
|
The first two lines of the input consist of a 2<=×<=2 grid describing the initial configuration of Bessie's puzzle. The next two lines contain a 2<=×<=2 grid describing the initial configuration of Elsie's puzzle. The positions of the tiles are labeled 'A', 'B', and 'C', while the empty cell is labeled 'X'. It's guaranteed that both puzzles contain exactly one tile with each letter and exactly one empty position.
|
Output "YES"(without quotes) if the puzzles can reach the same configuration (and Bessie and Elsie are truly BFFLs). Otherwise, print "NO" (without quotes).
|
[
"AB\nXC\nXB\nAC\n",
"AB\nXC\nAC\nBX\n"
] |
[
"YES\n",
"NO\n"
] |
The solution to the first sample is described by the image. All Bessie needs to do is slide her 'A' tile down.
In the second sample, the two puzzles can never be in the same configuration. Perhaps Bessie and Elsie are not meant to be friends after all...
| 500
|
[
{
"input": "AB\nXC\nXB\nAC",
"output": "YES"
},
{
"input": "AB\nXC\nAC\nBX",
"output": "NO"
},
{
"input": "XC\nBA\nCB\nAX",
"output": "NO"
},
{
"input": "AB\nXC\nAX\nCB",
"output": "YES"
},
{
"input": "CB\nAX\nXA\nBC",
"output": "YES"
},
{
"input": "BC\nXA\nBA\nXC",
"output": "NO"
},
{
"input": "CA\nXB\nBA\nCX",
"output": "NO"
},
{
"input": "CA\nXB\nAC\nBX",
"output": "NO"
},
{
"input": "CB\nAX\nCX\nAB",
"output": "YES"
},
{
"input": "AX\nCB\nBC\nXA",
"output": "YES"
},
{
"input": "CA\nXB\nBA\nXC",
"output": "NO"
},
{
"input": "CX\nAB\nAX\nCB",
"output": "NO"
},
{
"input": "AB\nXC\nAB\nCX",
"output": "YES"
},
{
"input": "XC\nBA\nXC\nAB",
"output": "NO"
},
{
"input": "BA\nXC\nAC\nXB",
"output": "YES"
},
{
"input": "AX\nBC\nAC\nBX",
"output": "YES"
},
{
"input": "XC\nBA\nCB\nXA",
"output": "NO"
},
{
"input": "CB\nAX\nXC\nBA",
"output": "NO"
},
{
"input": "AX\nCB\nBC\nAX",
"output": "YES"
},
{
"input": "AB\nXC\nBX\nAC",
"output": "YES"
},
{
"input": "XA\nCB\nBA\nCX",
"output": "NO"
},
{
"input": "CX\nBA\nBX\nAC",
"output": "YES"
},
{
"input": "AB\nXC\nXC\nAB",
"output": "NO"
},
{
"input": "BA\nCX\nAC\nBX",
"output": "YES"
},
{
"input": "XA\nCB\nAB\nXC",
"output": "YES"
},
{
"input": "XC\nBA\nAC\nBX",
"output": "NO"
},
{
"input": "CA\nBX\nBA\nXC",
"output": "NO"
},
{
"input": "AX\nBC\nCA\nXB",
"output": "NO"
},
{
"input": "BC\nAX\nXC\nBA",
"output": "YES"
},
{
"input": "XB\nAC\nBX\nAC",
"output": "YES"
},
{
"input": "CX\nBA\nAX\nBC",
"output": "NO"
},
{
"input": "XB\nCA\nXC\nBA",
"output": "NO"
},
{
"input": "BX\nCA\nXB\nCA",
"output": "YES"
},
{
"input": "XB\nAC\nXC\nAB",
"output": "NO"
},
{
"input": "CX\nBA\nCX\nBA",
"output": "YES"
},
{
"input": "XB\nAC\nCA\nBX",
"output": "YES"
},
{
"input": "BA\nXC\nBC\nAX",
"output": "NO"
},
{
"input": "AC\nXB\nCX\nBA",
"output": "NO"
},
{
"input": "XB\nCA\nCX\nBA",
"output": "NO"
},
{
"input": "AB\nCX\nXA\nBC",
"output": "NO"
},
{
"input": "CX\nAB\nXB\nAC",
"output": "NO"
},
{
"input": "BC\nAX\nAC\nBX",
"output": "NO"
},
{
"input": "XA\nBC\nCB\nAX",
"output": "YES"
},
{
"input": "XC\nAB\nCB\nAX",
"output": "YES"
},
{
"input": "CX\nBA\nCX\nAB",
"output": "NO"
},
{
"input": "CA\nBX\nXC\nBA",
"output": "YES"
},
{
"input": "CX\nBA\nBA\nXC",
"output": "NO"
},
{
"input": "CA\nBX\nCB\nXA",
"output": "NO"
},
{
"input": "CB\nAX\nBC\nAX",
"output": "NO"
},
{
"input": "CB\nAX\nBC\nXA",
"output": "NO"
},
{
"input": "AC\nXB\nCB\nXA",
"output": "YES"
},
{
"input": "AB\nCX\nXB\nAC",
"output": "YES"
},
{
"input": "CX\nBA\nXB\nAC",
"output": "YES"
},
{
"input": "BX\nAC\nAB\nXC",
"output": "YES"
},
{
"input": "CX\nAB\nXC\nBA",
"output": "NO"
},
{
"input": "XB\nAC\nCX\nAB",
"output": "NO"
},
{
"input": "CB\nAX\nXB\nAC",
"output": "NO"
},
{
"input": "CB\nAX\nCA\nXB",
"output": "NO"
},
{
"input": "XC\nBA\nBA\nXC",
"output": "NO"
},
{
"input": "AC\nBX\nCB\nAX",
"output": "YES"
},
{
"input": "CA\nBX\nAC\nXB",
"output": "NO"
},
{
"input": "BX\nAC\nCX\nBA",
"output": "YES"
},
{
"input": "XB\nCA\nAX\nCB",
"output": "NO"
},
{
"input": "CB\nXA\nBC\nXA",
"output": "NO"
},
{
"input": "AX\nCB\nCX\nAB",
"output": "NO"
},
{
"input": "BC\nAX\nXC\nAB",
"output": "NO"
},
{
"input": "XB\nCA\nBC\nXA",
"output": "NO"
},
{
"input": "XB\nAC\nCX\nBA",
"output": "YES"
},
{
"input": "BC\nXA\nCB\nXA",
"output": "NO"
},
{
"input": "AX\nCB\nAX\nBC",
"output": "NO"
},
{
"input": "CA\nBX\nBX\nCA",
"output": "NO"
},
{
"input": "BA\nXC\nXB\nAC",
"output": "NO"
},
{
"input": "XA\nBC\nBX\nAC",
"output": "NO"
},
{
"input": "BX\nCA\nAC\nBX",
"output": "YES"
},
{
"input": "XB\nAC\nXC\nBA",
"output": "YES"
},
{
"input": "XB\nAC\nAB\nXC",
"output": "YES"
},
{
"input": "BA\nCX\nCX\nBA",
"output": "NO"
},
{
"input": "CA\nXB\nXB\nCA",
"output": "NO"
},
{
"input": "BA\nCX\nBA\nXC",
"output": "YES"
},
{
"input": "BA\nCX\nAB\nCX",
"output": "NO"
},
{
"input": "BX\nCA\nXA\nBC",
"output": "YES"
},
{
"input": "XC\nBA\nBX\nCA",
"output": "NO"
},
{
"input": "XC\nAB\nBC\nXA",
"output": "NO"
},
{
"input": "BC\nXA\nXC\nAB",
"output": "NO"
},
{
"input": "BX\nCA\nXB\nAC",
"output": "NO"
},
{
"input": "BA\nXC\nCA\nXB",
"output": "NO"
},
{
"input": "CX\nBA\nAC\nXB",
"output": "NO"
},
{
"input": "AB\nCX\nAC\nBX",
"output": "NO"
},
{
"input": "BC\nXA\nBX\nCA",
"output": "NO"
},
{
"input": "XA\nBC\nCX\nAB",
"output": "YES"
},
{
"input": "AX\nBC\nAX\nCB",
"output": "NO"
},
{
"input": "CB\nAX\nCA\nBX",
"output": "NO"
},
{
"input": "CB\nAX\nBA\nXC",
"output": "YES"
},
{
"input": "AB\nCX\nXC\nBA",
"output": "YES"
},
{
"input": "AC\nXB\nBA\nCX",
"output": "YES"
},
{
"input": "AX\nCB\nCB\nAX",
"output": "NO"
},
{
"input": "CX\nBA\nCA\nXB",
"output": "YES"
},
{
"input": "AC\nBX\nAB\nXC",
"output": "NO"
},
{
"input": "XA\nCB\nXA\nBC",
"output": "NO"
},
{
"input": "XC\nBA\nCA\nBX",
"output": "YES"
},
{
"input": "XA\nBC\nXB\nCA",
"output": "YES"
},
{
"input": "CA\nBX\nCB\nAX",
"output": "NO"
}
] | 1,653,086,029
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 102
| 46
| 0
|
l1=str()
s=str(input())
l1=s.replace("X","")
s=str(input())
s=s.replace("X","")
l1+=s[::-1]
l2=str()
s=str(input())
l2=s.replace("X","")
s=str(input())
s=s.replace("X","")
l2+=s[::-1]
l1=3*l1
if l2 in l1:
print("YES")
else: print("NO")
|
Title: Amity Assessment
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bessie the cow and her best friend Elsie each received a sliding puzzle on Pi Day. Their puzzles consist of a 2<=×<=2 grid and three tiles labeled 'A', 'B', and 'C'. The three tiles sit on top of the grid, leaving one grid cell empty. To make a move, Bessie or Elsie can slide a tile adjacent to the empty cell into the empty cell as shown below:
In order to determine if they are truly Best Friends For Life (BFFLs), Bessie and Elsie would like to know if there exists a sequence of moves that takes their puzzles to the same configuration (moves can be performed in both puzzles). Two puzzles are considered to be in the same configuration if each tile is on top of the same grid cell in both puzzles. Since the tiles are labeled with letters, rotations and reflections are not allowed.
Input Specification:
The first two lines of the input consist of a 2<=×<=2 grid describing the initial configuration of Bessie's puzzle. The next two lines contain a 2<=×<=2 grid describing the initial configuration of Elsie's puzzle. The positions of the tiles are labeled 'A', 'B', and 'C', while the empty cell is labeled 'X'. It's guaranteed that both puzzles contain exactly one tile with each letter and exactly one empty position.
Output Specification:
Output "YES"(without quotes) if the puzzles can reach the same configuration (and Bessie and Elsie are truly BFFLs). Otherwise, print "NO" (without quotes).
Demo Input:
['AB\nXC\nXB\nAC\n', 'AB\nXC\nAC\nBX\n']
Demo Output:
['YES\n', 'NO\n']
Note:
The solution to the first sample is described by the image. All Bessie needs to do is slide her 'A' tile down.
In the second sample, the two puzzles can never be in the same configuration. Perhaps Bessie and Elsie are not meant to be friends after all...
|
```python
l1=str()
s=str(input())
l1=s.replace("X","")
s=str(input())
s=s.replace("X","")
l1+=s[::-1]
l2=str()
s=str(input())
l2=s.replace("X","")
s=str(input())
s=s.replace("X","")
l2+=s[::-1]
l1=3*l1
if l2 in l1:
print("YES")
else: print("NO")
```
| 3
|
|
79
|
B
|
Colorful Field
|
PROGRAMMING
| 1,400
|
[
"implementation",
"sortings"
] |
B. Colorful Field
|
2
|
256
|
Fox Ciel saw a large field while she was on a bus. The field was a *n*<=×<=*m* rectangle divided into 1<=×<=1 cells. Some cells were wasteland, and other each cell contained crop plants: either carrots or kiwis or grapes.
After seeing the field carefully, Ciel found that the crop plants of each cell were planted in following procedure:
- Assume that the rows are numbered 1 to *n* from top to bottom and the columns are numbered 1 to *m* from left to right, and a cell in row *i* and column *j* is represented as (*i*,<=*j*). - First, each field is either cultivated or waste. Crop plants will be planted in the cultivated cells in the order of (1,<=1)<=→<=...<=→<=(1,<=*m*)<=→<=(2,<=1)<=→<=...<=→<=(2,<=*m*)<=→<=...<=→<=(*n*,<=1)<=→<=...<=→<=(*n*,<=*m*). Waste cells will be ignored. - Crop plants (either carrots or kiwis or grapes) will be planted in each cell one after another cyclically. Carrots will be planted in the first cell, then kiwis in the second one, grapes in the third one, carrots in the forth one, kiwis in the fifth one, and so on.
The following figure will show you the example of this procedure. Here, a white square represents a cultivated cell, and a black square represents a waste cell.
Now she is wondering how to determine the crop plants in some certain cells.
|
In the first line there are four positive integers *n*,<=*m*,<=*k*,<=*t* (1<=≤<=*n*<=≤<=4·104,<=1<=≤<=*m*<=≤<=4·104,<=1<=≤<=*k*<=≤<=103,<=1<=≤<=*t*<=≤<=103), each of which represents the height of the field, the width of the field, the number of waste cells and the number of queries that ask the kind of crop plants in a certain cell.
Following each *k* lines contains two integers *a*,<=*b* (1<=≤<=*a*<=≤<=*n*,<=1<=≤<=*b*<=≤<=*m*), which denotes a cell (*a*,<=*b*) is waste. It is guaranteed that the same cell will not appear twice in this section.
Following each *t* lines contains two integers *i*,<=*j* (1<=≤<=*i*<=≤<=*n*,<=1<=≤<=*j*<=≤<=*m*), which is a query that asks you the kind of crop plants of a cell (*i*,<=*j*).
|
For each query, if the cell is waste, print Waste. Otherwise, print the name of crop plants in the cell: either Carrots or Kiwis or Grapes.
|
[
"4 5 5 6\n4 3\n1 3\n3 3\n2 5\n3 2\n1 3\n1 4\n2 3\n2 4\n1 1\n1 1\n"
] |
[
"Waste\nGrapes\nCarrots\nKiwis\nCarrots\nCarrots\n"
] |
The sample corresponds to the figure in the statement.
| 1,000
|
[
{
"input": "4 5 5 6\n4 3\n1 3\n3 3\n2 5\n3 2\n1 3\n1 4\n2 3\n2 4\n1 1\n1 1",
"output": "Waste\nGrapes\nCarrots\nKiwis\nCarrots\nCarrots"
},
{
"input": "2 3 2 2\n1 1\n2 2\n2 1\n2 2",
"output": "Grapes\nWaste"
},
{
"input": "31 31 31 4\n4 9\n16 27\n11 29\n8 28\n11 2\n10 7\n22 6\n1 25\n14 8\n9 7\n9 1\n2 3\n5 2\n21 16\n20 19\n23 14\n27 6\n25 21\n14 1\n18 14\n7 2\n19 12\n30 27\n4 27\n24 12\n25 20\n26 22\n21 17\n11 6\n5 28\n28 24\n17 30\n2 5\n30 10\n4 21",
"output": "Kiwis\nCarrots\nGrapes\nGrapes"
},
{
"input": "39898 39898 3 1\n4567 8901\n12345 23456\n24680 35679\n29292 12121",
"output": "Grapes"
},
{
"input": "1 1 1 1\n1 1\n1 1",
"output": "Waste"
},
{
"input": "1 2 1 2\n1 1\n1 2\n1 1",
"output": "Carrots\nWaste"
},
{
"input": "1 6 3 12\n1 2\n1 4\n1 6\n1 1\n1 2\n1 6\n1 2\n1 5\n1 3\n1 4\n1 5\n1 5\n1 4\n1 6\n1 3",
"output": "Carrots\nWaste\nWaste\nWaste\nGrapes\nKiwis\nWaste\nGrapes\nGrapes\nWaste\nWaste\nKiwis"
},
{
"input": "1 10 1 3\n1 5\n1 5\n1 5\n1 5",
"output": "Waste\nWaste\nWaste"
},
{
"input": "5 5 1 3\n2 2\n2 2\n2 2\n2 2",
"output": "Waste\nWaste\nWaste"
},
{
"input": "3 3 3 5\n1 1\n2 2\n3 3\n1 1\n2 2\n2 2\n2 2\n3 3",
"output": "Waste\nWaste\nWaste\nWaste\nWaste"
},
{
"input": "1 10 2 4\n1 9\n1 5\n1 5\n1 6\n1 9\n1 10",
"output": "Waste\nKiwis\nWaste\nKiwis"
},
{
"input": "5 2 2 1\n3 2\n4 2\n5 2",
"output": "Kiwis"
}
] | 1,601,825,768
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 29
| 654
| 307,200
|
n,m,k,t=map(int,input().split())
waste=[]
val=['Carrots','Kiwis','Grapes']
for i in range(k):
a=list(map(int,input().split()))
waste.append(a)
for i in range(t):
q=list(map(int,input().split()))
if q in waste:
print('Waste')
else:
s=0
for i in waste:
if i <q:
s=s+1
res=(q[0]-1)*m+q[1]-1-s
print(val[res%3])
|
Title: Colorful Field
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Fox Ciel saw a large field while she was on a bus. The field was a *n*<=×<=*m* rectangle divided into 1<=×<=1 cells. Some cells were wasteland, and other each cell contained crop plants: either carrots or kiwis or grapes.
After seeing the field carefully, Ciel found that the crop plants of each cell were planted in following procedure:
- Assume that the rows are numbered 1 to *n* from top to bottom and the columns are numbered 1 to *m* from left to right, and a cell in row *i* and column *j* is represented as (*i*,<=*j*). - First, each field is either cultivated or waste. Crop plants will be planted in the cultivated cells in the order of (1,<=1)<=→<=...<=→<=(1,<=*m*)<=→<=(2,<=1)<=→<=...<=→<=(2,<=*m*)<=→<=...<=→<=(*n*,<=1)<=→<=...<=→<=(*n*,<=*m*). Waste cells will be ignored. - Crop plants (either carrots or kiwis or grapes) will be planted in each cell one after another cyclically. Carrots will be planted in the first cell, then kiwis in the second one, grapes in the third one, carrots in the forth one, kiwis in the fifth one, and so on.
The following figure will show you the example of this procedure. Here, a white square represents a cultivated cell, and a black square represents a waste cell.
Now she is wondering how to determine the crop plants in some certain cells.
Input Specification:
In the first line there are four positive integers *n*,<=*m*,<=*k*,<=*t* (1<=≤<=*n*<=≤<=4·104,<=1<=≤<=*m*<=≤<=4·104,<=1<=≤<=*k*<=≤<=103,<=1<=≤<=*t*<=≤<=103), each of which represents the height of the field, the width of the field, the number of waste cells and the number of queries that ask the kind of crop plants in a certain cell.
Following each *k* lines contains two integers *a*,<=*b* (1<=≤<=*a*<=≤<=*n*,<=1<=≤<=*b*<=≤<=*m*), which denotes a cell (*a*,<=*b*) is waste. It is guaranteed that the same cell will not appear twice in this section.
Following each *t* lines contains two integers *i*,<=*j* (1<=≤<=*i*<=≤<=*n*,<=1<=≤<=*j*<=≤<=*m*), which is a query that asks you the kind of crop plants of a cell (*i*,<=*j*).
Output Specification:
For each query, if the cell is waste, print Waste. Otherwise, print the name of crop plants in the cell: either Carrots or Kiwis or Grapes.
Demo Input:
['4 5 5 6\n4 3\n1 3\n3 3\n2 5\n3 2\n1 3\n1 4\n2 3\n2 4\n1 1\n1 1\n']
Demo Output:
['Waste\nGrapes\nCarrots\nKiwis\nCarrots\nCarrots\n']
Note:
The sample corresponds to the figure in the statement.
|
```python
n,m,k,t=map(int,input().split())
waste=[]
val=['Carrots','Kiwis','Grapes']
for i in range(k):
a=list(map(int,input().split()))
waste.append(a)
for i in range(t):
q=list(map(int,input().split()))
if q in waste:
print('Waste')
else:
s=0
for i in waste:
if i <q:
s=s+1
res=(q[0]-1)*m+q[1]-1-s
print(val[res%3])
```
| 3.835928
|
540
|
A
|
Combination Lock
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Scrooge McDuck keeps his most treasured savings in a home safe with a combination lock. Each time he wants to put there the treasures that he's earned fair and square, he has to open the lock.
The combination lock is represented by *n* rotating disks with digits from 0 to 9 written on them. Scrooge McDuck has to turn some disks so that the combination of digits on the disks forms a secret combination. In one move, he can rotate one disk one digit forwards or backwards. In particular, in one move he can go from digit 0 to digit 9 and vice versa. What minimum number of actions does he need for that?
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of disks on the combination lock.
The second line contains a string of *n* digits — the original state of the disks.
The third line contains a string of *n* digits — Scrooge McDuck's combination that opens the lock.
|
Print a single integer — the minimum number of moves Scrooge McDuck needs to open the lock.
|
[
"5\n82195\n64723\n"
] |
[
"13\n"
] |
In the sample he needs 13 moves:
- 1 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/b8967f65a723782358b93eff9ce69f336817cf70.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 2 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/07fa58573ece0d32c4d555e498d2b24d2f70f36a.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 3 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/cc2275d9252aae35a6867c6a5b4ba7596e9a7626.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 4 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/b100aea470fcaaab4e9529b234ba0d7875943c10.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 5 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/eb2cbe4324cebca65b85816262a85e473cd65967.png" style="max-width: 100.0%;max-height: 100.0%;"/>
| 500
|
[
{
"input": "5\n82195\n64723",
"output": "13"
},
{
"input": "12\n102021090898\n010212908089",
"output": "16"
},
{
"input": "1\n8\n1",
"output": "3"
},
{
"input": "2\n83\n57",
"output": "7"
},
{
"input": "10\n0728592530\n1362615763",
"output": "27"
},
{
"input": "100\n4176196363694273682807653052945037727131821799902563705176501742060696655282954944720643131654235909\n3459912084922154505910287499879975659298239371519889866585472674423008837878123067103005344986554746",
"output": "245"
},
{
"input": "1\n8\n1",
"output": "3"
},
{
"input": "2\n83\n57",
"output": "7"
},
{
"input": "3\n607\n684",
"output": "5"
},
{
"input": "4\n0809\n0636",
"output": "8"
},
{
"input": "5\n84284\n08941",
"output": "16"
},
{
"input": "25\n8037856825987124762280548\n9519431339078678836940020",
"output": "72"
},
{
"input": "125\n23269567683904664184142384849516523616863461607751021071772615078579713054027902974007001544768640273491193035874486891541257\n47635110303703399505805044019026243695451609639556649012447370081552870340011971572363458960190590266459684717415349529509024",
"output": "305"
},
{
"input": "5\n84284\n08941",
"output": "16"
},
{
"input": "25\n8037856825987124762285484\n9519431339078678836940202",
"output": "74"
},
{
"input": "125\n23269567689466418414238845152168634610771021717726157879713054270294007001544768647391193035874486891412573389247025830678706\n47635110307339950580504010224954516093956649124473708152870340117152363458960190596659684717415349529090241694059599629136831",
"output": "357"
},
{
"input": "5\n84284\n08941",
"output": "16"
},
{
"input": "25\n8378525987476228048406972\n9194339078883694020217816",
"output": "55"
},
{
"input": "125\n23269576839046618414238484916523616863461607750210717761078579713054027902974007015447686027349193035874486891541257338624472\n47635103037033950580504401926243695451609639556490124437081552870340011971572363489601905026645984717415349529509024169604599",
"output": "274"
},
{
"input": "1\n0\n0",
"output": "0"
},
{
"input": "1\n7\n7",
"output": "0"
},
{
"input": "1\n0\n5",
"output": "5"
},
{
"input": "1\n2\n7",
"output": "5"
},
{
"input": "1\n7\n9",
"output": "2"
},
{
"input": "1\n9\n7",
"output": "2"
},
{
"input": "1\n2\n9",
"output": "3"
},
{
"input": "1\n9\n2",
"output": "3"
},
{
"input": "25\n3164978461316464614169874\n9413979197249127496597357",
"output": "66"
},
{
"input": "4\n9999\n9999",
"output": "0"
},
{
"input": "2\n11\n11",
"output": "0"
}
] | 1,608,445,023
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 1
| 93
| 307,200
|
import sys
def input(): return sys.stdin.readline().strip()
def iinput(): return int(input())
def rinput(): return map(int, sys.stdin.readline().strip().split())
def get_list(): return list(map(int, sys.stdin.readline().strip().split()))
n=iinput()
a=iinput()
a1=[int(d) for d in str(a)]
b=iinput()
b1=[int(d) for d in str(b)]
if(len(a1)!=n):
for i in range(n-len(a1)):
a1.append(0)
a1 = a1[len(a1)-n:] + a1[:-len(a1)-n]
if(len(b1)!=n):
for i in range(n-len(b1)):
b1.append(0)
b1 = b1[len(b1)-n:] + b1[:-len(b1)-n]
h=[]
for i in range(n):
s=a1[i]-b1[i]
if(s<0):
s=-s
s1=9-max(a1[i],b1[i])+min(a1[i],b1[i])+1
if(s1<0):
s1=-s1
h.append(min(s,s1))
print(sum(h))
|
Title: Combination Lock
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Scrooge McDuck keeps his most treasured savings in a home safe with a combination lock. Each time he wants to put there the treasures that he's earned fair and square, he has to open the lock.
The combination lock is represented by *n* rotating disks with digits from 0 to 9 written on them. Scrooge McDuck has to turn some disks so that the combination of digits on the disks forms a secret combination. In one move, he can rotate one disk one digit forwards or backwards. In particular, in one move he can go from digit 0 to digit 9 and vice versa. What minimum number of actions does he need for that?
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of disks on the combination lock.
The second line contains a string of *n* digits — the original state of the disks.
The third line contains a string of *n* digits — Scrooge McDuck's combination that opens the lock.
Output Specification:
Print a single integer — the minimum number of moves Scrooge McDuck needs to open the lock.
Demo Input:
['5\n82195\n64723\n']
Demo Output:
['13\n']
Note:
In the sample he needs 13 moves:
- 1 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/b8967f65a723782358b93eff9ce69f336817cf70.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 2 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/07fa58573ece0d32c4d555e498d2b24d2f70f36a.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 3 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/cc2275d9252aae35a6867c6a5b4ba7596e9a7626.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 4 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/b100aea470fcaaab4e9529b234ba0d7875943c10.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 5 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/eb2cbe4324cebca65b85816262a85e473cd65967.png" style="max-width: 100.0%;max-height: 100.0%;"/>
|
```python
import sys
def input(): return sys.stdin.readline().strip()
def iinput(): return int(input())
def rinput(): return map(int, sys.stdin.readline().strip().split())
def get_list(): return list(map(int, sys.stdin.readline().strip().split()))
n=iinput()
a=iinput()
a1=[int(d) for d in str(a)]
b=iinput()
b1=[int(d) for d in str(b)]
if(len(a1)!=n):
for i in range(n-len(a1)):
a1.append(0)
a1 = a1[len(a1)-n:] + a1[:-len(a1)-n]
if(len(b1)!=n):
for i in range(n-len(b1)):
b1.append(0)
b1 = b1[len(b1)-n:] + b1[:-len(b1)-n]
h=[]
for i in range(n):
s=a1[i]-b1[i]
if(s<0):
s=-s
s1=9-max(a1[i],b1[i])+min(a1[i],b1[i])+1
if(s1<0):
s1=-s1
h.append(min(s,s1))
print(sum(h))
```
| 0
|
|
844
|
A
|
Diversity
|
PROGRAMMING
| 1,000
|
[
"greedy",
"implementation",
"strings"
] | null | null |
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
|
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
|
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
|
[
"yandex\n6\n",
"yahoo\n5\n",
"google\n7\n"
] |
[
"0\n",
"1\n",
"impossible\n"
] |
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
| 500
|
[
{
"input": "yandex\n6",
"output": "0"
},
{
"input": "yahoo\n5",
"output": "1"
},
{
"input": "google\n7",
"output": "impossible"
},
{
"input": "a\n1",
"output": "0"
},
{
"input": "z\n2",
"output": "impossible"
},
{
"input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26",
"output": "14"
},
{
"input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26",
"output": "12"
},
{
"input": "a\n3",
"output": "impossible"
},
{
"input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1",
"output": "0"
},
{
"input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4",
"output": "1"
},
{
"input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20",
"output": "18"
},
{
"input": "swmkwaruyv\n5",
"output": "0"
},
{
"input": "tnbqpsuhkczmejirvyfdolxwga\n22",
"output": "0"
},
{
"input": "abcde\n3",
"output": "0"
},
{
"input": "abb\n1",
"output": "0"
},
{
"input": "aaaa\n1",
"output": "0"
},
{
"input": "abcde\n2",
"output": "0"
},
{
"input": "yandex\n4",
"output": "0"
},
{
"input": "aaabbbccc\n1",
"output": "0"
},
{
"input": "abcd\n2",
"output": "0"
},
{
"input": "asdfgh\n2",
"output": "0"
},
{
"input": "aab\n1",
"output": "0"
},
{
"input": "mynameissako\n5",
"output": "0"
},
{
"input": "abcde\n1",
"output": "0"
},
{
"input": "abcd\n3",
"output": "0"
},
{
"input": "abcdef\n2",
"output": "0"
},
{
"input": "abcdefg\n4",
"output": "0"
},
{
"input": "abc\n1",
"output": "0"
},
{
"input": "asdafjsgljdllgjdgkl\n5",
"output": "0"
},
{
"input": "yaay\n3",
"output": "1"
},
{
"input": "yaay\n4",
"output": "2"
},
{
"input": "zzzzzz\n2",
"output": "1"
}
] | 1,643,990,525
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 41
| 31
| 0
|
s = input()
l1=len(s)
k = int(input())
s1 = set(s)
l=len(s1)
if(k<=l):
print("0")
elif(k>l and k<=l1):
print(k-l)
else:
print("impossible")
|
Title: Diversity
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
Input Specification:
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≤<=|*s*|<=≤<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=≤<=*k*<=≤<=26).
Output Specification:
Print single line with a minimum number of necessary changes, or the word «impossible» (without quotes) if it is impossible.
Demo Input:
['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n']
Demo Output:
['0\n', '1\n', 'impossible\n']
Note:
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
|
```python
s = input()
l1=len(s)
k = int(input())
s1 = set(s)
l=len(s1)
if(k<=l):
print("0")
elif(k>l and k<=l1):
print(k-l)
else:
print("impossible")
```
| 3
|
|
1
|
A
|
Theatre Square
|
PROGRAMMING
| 1,000
|
[
"math"
] |
A. Theatre Square
|
1
|
256
|
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
|
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
|
Write the needed number of flagstones.
|
[
"6 6 4\n"
] |
[
"4\n"
] |
none
| 0
|
[
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,691,330,260
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
a,m,n=gets.split.map &:to_i;p -a/n*(-m/n)
|
Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none
|
```python
a,m,n=gets.split.map &:to_i;p -a/n*(-m/n)
```
| -1
|
32
|
B
|
Borze
|
PROGRAMMING
| 800
|
[
"expression parsing",
"implementation"
] |
B. Borze
|
2
|
256
|
Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary number given its representation in Borze alphabet.
|
The first line contains a number in Borze code. The length of the string is between 1 and 200 characters. It's guaranteed that the given string is a valid Borze code of some ternary number (this number can have leading zeroes).
|
Output the decoded ternary number. It can have leading zeroes.
|
[
".-.--\n",
"--.\n",
"-..-.--\n"
] |
[
"012",
"20",
"1012"
] |
none
| 1,000
|
[
{
"input": ".-.--",
"output": "012"
},
{
"input": "--.",
"output": "20"
},
{
"input": "-..-.--",
"output": "1012"
},
{
"input": "---..",
"output": "210"
},
{
"input": "..--.---..",
"output": "0020210"
},
{
"input": "-.....----.",
"output": "10000220"
},
{
"input": ".",
"output": "0"
},
{
"input": "-.",
"output": "1"
},
{
"input": "--",
"output": "2"
},
{
"input": "..",
"output": "00"
},
{
"input": "--.",
"output": "20"
},
{
"input": ".--.",
"output": "020"
},
{
"input": ".-.-..",
"output": "0110"
},
{
"input": "----.-.",
"output": "2201"
},
{
"input": "-..--.-.",
"output": "10201"
},
{
"input": "..--..--.",
"output": "0020020"
},
{
"input": "-.-.---.--..-..-.-.-..-..-.--.",
"output": "112120010111010120"
},
{
"input": "---.-.-.------..-..-..-..-.-..-.--.-.-..-.-.-----..-.-.",
"output": "21112220010101011012011011221011"
},
{
"input": "-.-..--.-.-.-.-.-..-.-.-.---------.--.---..--...--.-----.-.-.-...--.-.-.---.------.--..-.--.-----.-...-..------",
"output": "11020111110111222212021020002022111100201121222020012022110010222"
},
{
"input": "-.-..-.--.---..---.-..---.-...-.-.----..-.---.-.---..-.--.---.-.-------.---.--....----.-.---.---.---.----.-----..---.-.-.-.-----.--.-------.-..",
"output": "110120210211021100112200121121012021122212120000220121212122022102111122120222110"
},
{
"input": ".-..-.-.---.-----.--.---...-.--.-.-....-..",
"output": "01011212212021001201100010"
},
{
"input": ".------.-.---..--...-..-..-.-.-.--.--.-..-.--...-.-.---.-.-.------..--..-.---..----.-..-.--.---.-.----.-.---...-.-.-.-----.-.-.---.---.-.....-.-...-----.-...-.---.-..-.-----.--...---.-.-..-.--.-.---..",
"output": "022201210200010101112020101200011211122200200121022010120211220121001112211121211000011002211001211012212000211101201210"
},
{
"input": ".-.--.---.-----.-.-----.-.-..-----..-..----..--.-.--.----..---.---..-.-.-----..-------.----..----.-..---...-----..-..-----...-..-.-.-----....---..---..-.-----...-.--...--.-.---.-.-.-.-.-...---..----.",
"output": "01202122112211102210102200201202200212101122102221220022010210022101022100101122100021021012210012000201211111100210220"
},
{
"input": "..-.-.-.---.-.-.-..-.-..-.-.---.-------.---..-----.---....-.---.--.--.-.---.---------.-..---.-.-.--..---.---.-.---.-.-..-.-..-.-.-.----.--.-....--------.-.---..----.------.-.-.--.--.-----.-----.----",
"output": "0011121111011011212221210221210001212020121222211021112002121121110110111220201000222201210220222011202022122122"
},
{
"input": "-..-------.------.-..--.-.-..--.-.-..-----..-.-.-..-..-..--.---..-----..---..-..--.-..-.-.---...-.....-------.---.-----.-...-.-...-.-.---.---.-----.--.--...-.--..-.-..-...-.-.-.-.---..---.-..-.-.-.-..",
"output": "102221222010201102011022101110101020210221021010201011210010000222121221100110011212122120200012001101001111210211011110"
},
{
"input": ".-.----.-.--..-.-.-.-..----..-.-...--.-.---.---.-------..-.--..-......--.------.--.----.--...-.--.--..-----..-.....--.--.-.-.------..--------.----------..-.---.----.---.-..--..-.....-..------.--.",
"output": "012201200111102200110020121212221012001000002022202022020001202002210100002020112220022220222220012122021102001000010222020"
},
{
"input": "------.-----.-....--.-.----.-.---.-.-..---.-.---.-----..-...-.-.---..-.-.-..-.-.-...-.-.-.----..--.------.----.-..-.--...-.-------...-.-..-.-.--.--.---..--..--------.--.-.-.---.-.-.-...----.--..-.--..",
"output": "222022110002012201211102112122101001121011101110011122002022202201012000122210011011202021020022220201121111002202001200"
},
{
"input": "-.---...----...--.--...-.--.----",
"output": "121002200020200012022"
},
{
"input": "--.--.--.---.--.-.---.-.-..-..--.-..---.-.....-..---.-----.--...-.-.-------.-.--.-.----.-..-.------.",
"output": "202020212012111010201021100001021221200011222112012201012220"
}
] | 1,652,464,757
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 60
| 0
|
s=input()
s2=str("inf")
for i in range(len(s)):
if s[i]==".":
s2+="0"
if s[i]=="-" and s[i+1]==".":
s2+="1"
++i
if s[i]=="-" and s[i+1]=="-":
s2+="2"
++i
|
Title: Borze
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary number given its representation in Borze alphabet.
Input Specification:
The first line contains a number in Borze code. The length of the string is between 1 and 200 characters. It's guaranteed that the given string is a valid Borze code of some ternary number (this number can have leading zeroes).
Output Specification:
Output the decoded ternary number. It can have leading zeroes.
Demo Input:
['.-.--\n', '--.\n', '-..-.--\n']
Demo Output:
['012', '20', '1012']
Note:
none
|
```python
s=input()
s2=str("inf")
for i in range(len(s)):
if s[i]==".":
s2+="0"
if s[i]=="-" and s[i+1]==".":
s2+="1"
++i
if s[i]=="-" and s[i+1]=="-":
s2+="2"
++i
```
| -1
|
707
|
A
|
Brain's Photos
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such).
Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour!
As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white.
Photo can be represented as a matrix sized *n*<=×<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors:
- 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black)
The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored.
|
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of photo pixel matrix rows and columns respectively.
Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'.
|
Print the "#Black&White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line.
|
[
"2 2\nC M\nY Y\n",
"3 2\nW W\nW W\nB B\n",
"1 1\nW\n"
] |
[
"#Color",
"#Black&White",
"#Black&White"
] |
none
| 500
|
[
{
"input": "2 2\nC M\nY Y",
"output": "#Color"
},
{
"input": "3 2\nW W\nW W\nB B",
"output": "#Black&White"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "2 3\nW W W\nB G Y",
"output": "#Color"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "5 5\nW G B Y M\nG B Y M C\nB Y M C W\nY M C W G\nM C W G B",
"output": "#Color"
},
{
"input": "1 6\nC M Y W G B",
"output": "#Color"
},
{
"input": "1 3\nW G B",
"output": "#Black&White"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "5 5\nW G B W G\nG B W G B\nB W G B W\nW G B W G\nG B W G B",
"output": "#Black&White"
},
{
"input": "2 3\nW W W\nB G C",
"output": "#Color"
},
{
"input": "2 3\nW W W\nB G M",
"output": "#Color"
},
{
"input": "3 3\nC B W\nB Y M\nB B W",
"output": "#Color"
},
{
"input": "1 3\nW C W",
"output": "#Color"
},
{
"input": "3 3\nB W B\nB C W\nB W W",
"output": "#Color"
},
{
"input": "1 2\nW Y",
"output": "#Color"
},
{
"input": "1 1\nG",
"output": "#Black&White"
},
{
"input": "1 3\nB G W",
"output": "#Black&White"
},
{
"input": "2 2\nW W\nB C",
"output": "#Color"
},
{
"input": "1 1\nM",
"output": "#Color"
},
{
"input": "1 2\nW C",
"output": "#Color"
},
{
"input": "2 3\nW W M\nW W M",
"output": "#Color"
},
{
"input": "3 2\nW W\nW W\nB C",
"output": "#Color"
},
{
"input": "2 3\nW W C\nW W W",
"output": "#Color"
},
{
"input": "1 3\nG G G",
"output": "#Black&White"
},
{
"input": "1 1\nC",
"output": "#Color"
},
{
"input": "1 2\nC W",
"output": "#Color"
},
{
"input": "1 3\nW W C",
"output": "#Color"
},
{
"input": "2 2\nW B\nB G",
"output": "#Black&White"
},
{
"input": "2 2\nB B\nY Y",
"output": "#Color"
},
{
"input": "2 2\nG G\nC C",
"output": "#Color"
},
{
"input": "1 2\nB C",
"output": "#Color"
},
{
"input": "1 4\nG G G C",
"output": "#Color"
},
{
"input": "1 1\nB",
"output": "#Black&White"
},
{
"input": "2 1\nY\nB",
"output": "#Color"
}
] | 1,685,156,216
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 50
| 61
| 1,536,000
|
def solve(n, m):
color = ['C', 'M', 'Y']
for i in range(n):
l = input().split()
for j in l:
if(j in color):
return "#Color"
return "#Black&White"
# for _ in range(int(input())):
n, m = map(int, input().split())
print(solve(n, m))
|
Title: Brain's Photos
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such).
Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour!
As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white.
Photo can be represented as a matrix sized *n*<=×<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors:
- 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black)
The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of photo pixel matrix rows and columns respectively.
Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'.
Output Specification:
Print the "#Black&White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line.
Demo Input:
['2 2\nC M\nY Y\n', '3 2\nW W\nW W\nB B\n', '1 1\nW\n']
Demo Output:
['#Color', '#Black&White', '#Black&White']
Note:
none
|
```python
def solve(n, m):
color = ['C', 'M', 'Y']
for i in range(n):
l = input().split()
for j in l:
if(j in color):
return "#Color"
return "#Black&White"
# for _ in range(int(input())):
n, m = map(int, input().split())
print(solve(n, m))
```
| 3
|
|
157
|
B
|
Trace
|
PROGRAMMING
| 1,000
|
[
"geometry",
"sortings"
] | null | null |
One day, as Sherlock Holmes was tracking down one very important criminal, he found a wonderful painting on the wall. This wall could be represented as a plane. The painting had several concentric circles that divided the wall into several parts. Some parts were painted red and all the other were painted blue. Besides, any two neighboring parts were painted different colors, that is, the red and the blue color were alternating, i. e. followed one after the other. The outer area of the wall (the area that lied outside all circles) was painted blue. Help Sherlock Holmes determine the total area of red parts of the wall.
Let us remind you that two circles are called concentric if their centers coincide. Several circles are called concentric if any two of them are concentric.
|
The first line contains the single integer *n* (1<=≤<=*n*<=≤<=100). The second line contains *n* space-separated integers *r**i* (1<=≤<=*r**i*<=≤<=1000) — the circles' radii. It is guaranteed that all circles are different.
|
Print the single real number — total area of the part of the wall that is painted red. The answer is accepted if absolute or relative error doesn't exceed 10<=-<=4.
|
[
"1\n1\n",
"3\n1 4 2\n"
] |
[
"3.1415926536\n",
"40.8407044967\n"
] |
In the first sample the picture is just one circle of radius 1. Inner part of the circle is painted red. The area of the red part equals π × 1<sup class="upper-index">2</sup> = π.
In the second sample there are three circles of radii 1, 4 and 2. Outside part of the second circle is painted blue. Part between the second and the third circles is painted red. Part between the first and the third is painted blue. And, finally, the inner part of the first circle is painted red. Overall there are two red parts: the ring between the second and the third circles and the inner part of the first circle. Total area of the red parts is equal (π × 4<sup class="upper-index">2</sup> - π × 2<sup class="upper-index">2</sup>) + π × 1<sup class="upper-index">2</sup> = π × 12 + π = 13π
| 1,000
|
[
{
"input": "1\n1",
"output": "3.1415926536"
},
{
"input": "3\n1 4 2",
"output": "40.8407044967"
},
{
"input": "4\n4 1 3 2",
"output": "31.4159265359"
},
{
"input": "4\n100 10 2 1",
"output": "31111.1920484997"
},
{
"input": "10\n10 9 8 7 6 5 4 3 2 1",
"output": "172.7875959474"
},
{
"input": "1\n1000",
"output": "3141592.6535897931"
},
{
"input": "8\n8 1 7 2 6 3 5 4",
"output": "113.0973355292"
},
{
"input": "100\n1000 999 998 997 996 995 994 993 992 991 990 989 988 987 986 985 984 983 982 981 980 979 978 977 976 975 974 973 972 971 970 969 968 967 966 965 964 963 962 961 960 959 958 957 956 955 954 953 952 951 950 949 948 947 946 945 944 943 942 941 940 939 938 937 936 935 934 933 932 931 930 929 928 927 926 925 924 923 922 921 920 919 918 917 916 915 914 913 912 911 910 909 908 907 906 905 904 903 902 901",
"output": "298608.3817237098"
},
{
"input": "6\n109 683 214 392 678 10",
"output": "397266.9574170437"
},
{
"input": "2\n151 400",
"output": "431023.3704798660"
},
{
"input": "6\n258 877 696 425 663 934",
"output": "823521.3902487604"
},
{
"input": "9\n635 707 108 234 52 180 910 203 782",
"output": "1100144.9065826489"
},
{
"input": "8\n885 879 891 428 522 176 135 983",
"output": "895488.9947571954"
},
{
"input": "3\n269 918 721",
"output": "1241695.6467754442"
},
{
"input": "7\n920 570 681 428 866 935 795",
"output": "1469640.1849419588"
},
{
"input": "2\n517 331",
"output": "495517.1260654109"
},
{
"input": "2\n457 898",
"output": "1877274.3981158488"
},
{
"input": "8\n872 704 973 612 183 274 739 253",
"output": "1780774.0965755312"
},
{
"input": "74\n652 446 173 457 760 847 670 25 196 775 998 279 656 809 883 148 969 884 792 502 641 800 663 938 362 339 545 608 107 184 834 666 149 458 864 72 199 658 618 987 126 723 806 643 689 958 626 904 944 415 427 498 628 331 636 261 281 276 478 220 513 595 510 384 354 561 469 462 799 449 747 109 903 456",
"output": "1510006.5089479341"
},
{
"input": "76\n986 504 673 158 87 332 124 218 714 235 212 122 878 370 938 81 686 323 386 348 410 468 875 107 50 960 82 834 234 663 651 422 794 633 294 771 945 607 146 913 950 858 297 88 882 725 247 872 645 749 799 987 115 394 380 382 971 429 593 426 652 353 351 233 868 598 889 116 71 376 916 464 414 976 138 903",
"output": "1528494.7817143100"
},
{
"input": "70\n12 347 748 962 514 686 192 159 990 4 10 788 602 542 946 215 523 727 799 717 955 796 529 465 897 103 181 515 495 153 710 179 747 145 16 585 943 998 923 708 156 399 770 547 775 285 9 68 713 722 570 143 913 416 663 624 925 218 64 237 797 138 942 213 188 818 780 840 480 758",
"output": "1741821.4892636713"
},
{
"input": "26\n656 508 45 189 561 366 96 486 547 386 703 570 780 689 264 26 11 74 466 76 421 48 982 886 215 650",
"output": "1818821.9252031571"
},
{
"input": "52\n270 658 808 249 293 707 700 78 791 167 92 772 807 502 830 991 945 102 968 376 556 578 326 980 688 368 280 853 646 256 666 638 424 737 321 996 925 405 199 680 953 541 716 481 727 143 577 919 892 355 346 298",
"output": "1272941.9273080483"
},
{
"input": "77\n482 532 200 748 692 697 171 863 586 547 301 149 326 812 147 698 303 691 527 805 681 387 619 947 598 453 167 799 840 508 893 688 643 974 998 341 804 230 538 669 271 404 477 759 943 596 949 235 880 160 151 660 832 82 969 539 708 889 258 81 224 655 790 144 462 582 646 256 445 52 456 920 67 819 631 484 534",
"output": "2045673.1891262225"
},
{
"input": "27\n167 464 924 575 775 97 944 390 297 315 668 296 533 829 851 406 702 366 848 512 71 197 321 900 544 529 116",
"output": "1573959.9105970615"
},
{
"input": "38\n488 830 887 566 720 267 583 102 65 200 884 220 263 858 510 481 316 804 754 568 412 166 374 869 356 977 145 421 500 58 664 252 745 70 381 927 670 772",
"output": "1479184.3434235646"
},
{
"input": "64\n591 387 732 260 840 397 563 136 571 876 831 953 799 493 579 13 559 872 53 678 256 232 969 993 847 14 837 365 547 997 604 199 834 529 306 443 739 49 19 276 343 835 904 588 900 870 439 576 975 955 518 117 131 347 800 83 432 882 869 709 32 950 314 450",
"output": "1258248.6984672088"
},
{
"input": "37\n280 281 169 68 249 389 977 101 360 43 448 447 368 496 125 507 747 392 338 270 916 150 929 428 118 266 589 470 774 852 263 644 187 817 808 58 637",
"output": "1495219.0323274869"
},
{
"input": "97\n768 569 306 968 437 779 227 561 412 60 44 807 234 645 169 858 580 396 343 145 842 723 416 80 456 247 81 150 297 116 760 964 312 558 101 850 549 650 299 868 121 435 579 705 118 424 302 812 970 397 659 565 916 183 933 459 6 593 518 717 326 305 744 470 75 981 824 221 294 324 194 293 251 446 481 215 338 861 528 829 921 945 540 89 450 178 24 460 990 392 148 219 934 615 932 340 937",
"output": "1577239.7333274092"
},
{
"input": "94\n145 703 874 425 277 652 239 496 458 658 339 842 564 699 893 352 625 980 432 121 798 872 499 859 850 721 414 825 543 843 304 111 342 45 219 311 50 748 465 902 781 822 504 985 919 656 280 310 917 438 464 527 491 713 906 329 635 777 223 810 501 535 156 252 806 112 971 719 103 443 165 98 579 554 244 996 221 560 301 51 977 422 314 858 528 772 448 626 185 194 536 66 577 677",
"output": "1624269.3753516484"
},
{
"input": "97\n976 166 649 81 611 927 480 231 998 711 874 91 969 521 531 414 993 790 317 981 9 261 437 332 173 573 904 777 882 990 658 878 965 64 870 896 271 732 431 53 761 943 418 602 708 949 930 130 512 240 363 458 673 319 131 784 224 48 919 126 208 212 911 59 677 535 450 273 479 423 79 807 336 18 72 290 724 28 123 605 287 228 350 897 250 392 885 655 746 417 643 114 813 378 355 635 905",
"output": "1615601.7212203942"
},
{
"input": "91\n493 996 842 9 748 178 1 807 841 519 796 998 84 670 778 143 707 208 165 893 154 943 336 150 761 881 434 112 833 55 412 682 552 945 758 189 209 600 354 325 440 844 410 20 136 665 88 791 688 17 539 821 133 236 94 606 483 446 429 60 960 476 915 134 137 852 754 908 276 482 117 252 297 903 981 203 829 811 471 135 188 667 710 393 370 302 874 872 551 457 692",
"output": "1806742.5014501044"
},
{
"input": "95\n936 736 17 967 229 607 589 291 242 244 29 698 800 566 630 667 90 416 11 94 812 838 668 520 678 111 490 823 199 973 681 676 683 721 262 896 682 713 402 691 874 44 95 704 56 322 822 887 639 433 406 35 988 61 176 496 501 947 440 384 372 959 577 370 754 802 1 945 427 116 746 408 308 391 397 730 493 183 203 871 831 862 461 565 310 344 504 378 785 137 279 123 475 138 415",
"output": "1611115.5269110680"
},
{
"input": "90\n643 197 42 218 582 27 66 704 195 445 641 675 285 639 503 686 242 327 57 955 848 287 819 992 756 749 363 48 648 736 580 117 752 921 923 372 114 313 202 337 64 497 399 25 883 331 24 871 917 8 517 486 323 529 325 92 891 406 864 402 263 773 931 253 625 31 17 271 140 131 232 586 893 525 846 54 294 562 600 801 214 55 768 683 389 738 314 284 328 804",
"output": "1569819.2914796301"
},
{
"input": "98\n29 211 984 75 333 96 840 21 352 168 332 433 130 944 215 210 620 442 363 877 91 491 513 955 53 82 351 19 998 706 702 738 770 453 344 117 893 590 723 662 757 16 87 546 312 669 568 931 224 374 927 225 751 962 651 587 361 250 256 240 282 600 95 64 384 589 813 783 39 918 412 648 506 283 886 926 443 173 946 241 310 33 622 565 261 360 547 339 943 367 354 25 479 743 385 485 896 741",
"output": "2042921.1539616778"
},
{
"input": "93\n957 395 826 67 185 4 455 880 683 654 463 84 258 878 553 592 124 585 9 133 20 609 43 452 725 125 801 537 700 685 771 155 566 376 19 690 383 352 174 208 177 416 304 1000 533 481 87 509 358 233 681 22 507 659 36 859 952 259 138 271 594 779 576 782 119 69 608 758 283 616 640 523 710 751 34 106 774 92 874 568 864 660 998 992 474 679 180 409 15 297 990 689 501",
"output": "1310703.8710041976"
},
{
"input": "97\n70 611 20 30 904 636 583 262 255 501 604 660 212 128 199 138 545 576 506 528 12 410 77 888 783 972 431 188 338 485 148 793 907 678 281 922 976 680 252 724 253 920 177 361 721 798 960 572 99 622 712 466 608 49 612 345 266 751 63 594 40 695 532 789 520 930 825 929 48 59 405 135 109 735 508 186 495 772 375 587 201 324 447 610 230 947 855 318 856 956 313 810 931 175 668 183 688",
"output": "1686117.9099228707"
},
{
"input": "96\n292 235 391 180 840 172 218 997 166 287 329 20 886 325 400 471 182 356 448 337 417 319 58 106 366 764 393 614 90 831 924 314 667 532 64 874 3 434 350 352 733 795 78 640 967 63 47 879 635 272 145 569 468 792 153 761 770 878 281 467 209 208 298 37 700 18 334 93 5 750 412 779 523 517 360 649 447 328 311 653 57 578 767 460 647 663 50 670 151 13 511 580 625 907 227 89",
"output": "1419726.5608617242"
},
{
"input": "100\n469 399 735 925 62 153 707 723 819 529 200 624 57 708 245 384 889 11 639 638 260 419 8 142 403 298 204 169 887 388 241 983 885 267 643 943 417 237 452 562 6 839 149 742 832 896 100 831 712 754 679 743 135 222 445 680 210 955 220 63 960 487 514 824 481 584 441 997 795 290 10 45 510 678 844 503 407 945 850 84 858 934 500 320 936 663 736 592 161 670 606 465 864 969 293 863 868 393 899 744",
"output": "1556458.0979239127"
},
{
"input": "100\n321 200 758 415 190 710 920 992 873 898 814 259 359 66 971 210 838 545 663 652 684 277 36 756 963 459 335 484 462 982 532 423 131 703 307 229 391 938 253 847 542 975 635 928 220 980 222 567 557 181 366 824 900 180 107 979 112 564 525 413 300 422 876 615 737 343 902 8 654 628 469 913 967 785 893 314 909 215 912 262 20 709 363 915 997 954 986 454 596 124 74 159 660 550 787 418 895 786 293 50",
"output": "1775109.8050211088"
},
{
"input": "100\n859 113 290 762 701 63 188 431 810 485 671 673 99 658 194 227 511 435 941 212 551 124 89 222 42 321 657 815 898 171 216 482 707 567 724 491 414 942 820 351 48 653 685 312 586 24 20 627 602 498 533 173 463 262 621 466 119 299 580 964 510 987 40 698 521 998 847 651 746 215 808 563 785 837 631 772 404 923 682 244 232 214 390 350 968 771 517 900 70 543 934 554 681 368 642 575 891 728 478 317",
"output": "1447969.4788174964"
},
{
"input": "100\n941 283 349 457 52 837 299 284 796 305 893 624 101 972 738 204 121 70 17 704 836 791 95 111 162 952 472 724 733 580 878 177 705 804 11 211 463 417 288 409 410 485 896 755 921 267 164 656 505 765 539 439 535 19 991 689 220 474 114 944 884 144 926 849 486 566 117 35 749 499 797 303 362 905 690 890 976 66 590 183 234 683 39 297 769 787 376 541 571 759 495 200 261 352 73 493 831 442 273 339",
"output": "1597889.4218394549"
},
{
"input": "100\n110 868 147 888 291 282 916 542 917 337 235 595 498 621 814 249 261 713 445 666 142 275 319 49 900 543 333 606 487 670 620 769 852 258 230 867 603 491 714 839 879 37 21 74 590 190 397 506 499 967 152 862 200 107 145 23 614 167 857 475 79 598 270 906 626 116 89 59 651 846 723 201 50 699 522 408 634 132 226 414 824 764 513 586 526 238 556 162 667 173 684 415 527 743 10 442 552 274 350 822",
"output": "1567230.6191330721"
},
{
"input": "100\n901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000",
"output": "298608.3817237098"
}
] | 1,677,280,601
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 44
| 186
| 0
|
import math
n = int(input())
arr = [int(x) for x in input().split()]
arr = [x ** 2 for x in sorted(arr)[::-1]]
if(len(arr) % 2 == 1):
arr = arr + [0]
total = 0
for i in range(0, len(arr), 2):
total += (arr[i] - arr[i+1])
print(math.pi * total)
|
Title: Trace
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day, as Sherlock Holmes was tracking down one very important criminal, he found a wonderful painting on the wall. This wall could be represented as a plane. The painting had several concentric circles that divided the wall into several parts. Some parts were painted red and all the other were painted blue. Besides, any two neighboring parts were painted different colors, that is, the red and the blue color were alternating, i. e. followed one after the other. The outer area of the wall (the area that lied outside all circles) was painted blue. Help Sherlock Holmes determine the total area of red parts of the wall.
Let us remind you that two circles are called concentric if their centers coincide. Several circles are called concentric if any two of them are concentric.
Input Specification:
The first line contains the single integer *n* (1<=≤<=*n*<=≤<=100). The second line contains *n* space-separated integers *r**i* (1<=≤<=*r**i*<=≤<=1000) — the circles' radii. It is guaranteed that all circles are different.
Output Specification:
Print the single real number — total area of the part of the wall that is painted red. The answer is accepted if absolute or relative error doesn't exceed 10<=-<=4.
Demo Input:
['1\n1\n', '3\n1 4 2\n']
Demo Output:
['3.1415926536\n', '40.8407044967\n']
Note:
In the first sample the picture is just one circle of radius 1. Inner part of the circle is painted red. The area of the red part equals π × 1<sup class="upper-index">2</sup> = π.
In the second sample there are three circles of radii 1, 4 and 2. Outside part of the second circle is painted blue. Part between the second and the third circles is painted red. Part between the first and the third is painted blue. And, finally, the inner part of the first circle is painted red. Overall there are two red parts: the ring between the second and the third circles and the inner part of the first circle. Total area of the red parts is equal (π × 4<sup class="upper-index">2</sup> - π × 2<sup class="upper-index">2</sup>) + π × 1<sup class="upper-index">2</sup> = π × 12 + π = 13π
|
```python
import math
n = int(input())
arr = [int(x) for x in input().split()]
arr = [x ** 2 for x in sorted(arr)[::-1]]
if(len(arr) % 2 == 1):
arr = arr + [0]
total = 0
for i in range(0, len(arr), 2):
total += (arr[i] - arr[i+1])
print(math.pi * total)
```
| 3
|
|
812
|
A
|
Sagheer and Crossroads
|
PROGRAMMING
| 1,200
|
[
"implementation"
] | null | null |
Sagheer is walking in the street when he comes to an intersection of two roads. Each road can be represented as two parts where each part has 3 lanes getting into the intersection (one for each direction) and 3 lanes getting out of the intersection, so we have 4 parts in total. Each part has 4 lights, one for each lane getting into the intersection (*l* — left, *s* — straight, *r* — right) and a light *p* for a pedestrian crossing.
An accident is possible if a car can hit a pedestrian. This can happen if the light of a pedestrian crossing of some part and the light of a lane that can get to or from that same part are green at the same time.
Now, Sagheer is monitoring the configuration of the traffic lights. Your task is to help him detect whether an accident is possible.
|
The input consists of four lines with each line describing a road part given in a counter-clockwise order.
Each line contains four integers *l*, *s*, *r*, *p* — for the left, straight, right and pedestrian lights, respectively. The possible values are 0 for red light and 1 for green light.
|
On a single line, print "YES" if an accident is possible, and "NO" otherwise.
|
[
"1 0 0 1\n0 1 0 0\n0 0 1 0\n0 0 0 1\n",
"0 1 1 0\n1 0 1 0\n1 1 0 0\n0 0 0 1\n",
"1 0 0 0\n0 0 0 1\n0 0 0 0\n1 0 1 0\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
In the first example, some accidents are possible because cars of part 1 can hit pedestrians of parts 1 and 4. Also, cars of parts 2 and 3 can hit pedestrians of part 4.
In the second example, no car can pass the pedestrian crossing of part 4 which is the only green pedestrian light. So, no accident can occur.
| 500
|
[
{
"input": "1 0 0 1\n0 1 0 0\n0 0 1 0\n0 0 0 1",
"output": "YES"
},
{
"input": "0 1 1 0\n1 0 1 0\n1 1 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "1 0 0 0\n0 0 0 1\n0 0 0 0\n1 0 1 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 1\n0 0 0 1\n0 0 0 1",
"output": "NO"
},
{
"input": "1 1 1 0\n0 1 0 1\n1 1 1 0\n1 1 1 1",
"output": "YES"
},
{
"input": "0 1 1 0\n0 1 0 0\n1 0 0 1\n1 0 0 0",
"output": "YES"
},
{
"input": "1 0 0 0\n0 1 0 0\n1 1 0 0\n0 1 1 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 1 0 1\n1 0 1 1\n1 1 1 0",
"output": "YES"
},
{
"input": "1 1 0 0\n0 1 0 1\n1 1 1 0\n0 0 1 1",
"output": "YES"
},
{
"input": "0 1 0 0\n0 0 0 0\n1 0 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 1 0\n0 0 0 0\n1 1 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 1 0\n0 1 0 1\n1 0 1 0\n0 0 1 0",
"output": "YES"
},
{
"input": "1 1 1 0\n0 1 0 1\n1 1 1 1\n0 0 0 1",
"output": "YES"
},
{
"input": "0 0 1 0\n0 0 0 0\n0 0 0 1\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 1\n0 0 0 1\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 0 0\n0 1 0 1\n1 0 1 1\n0 0 0 1",
"output": "YES"
},
{
"input": "1 1 0 0\n0 1 0 0\n1 1 1 0\n1 0 1 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 1\n0 0 0 1",
"output": "NO"
},
{
"input": "1 0 1 0\n1 1 0 0\n1 1 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 1 0\n1 1 0 0\n1 0 1 0\n1 0 0 0",
"output": "NO"
},
{
"input": "0 0 1 0\n1 0 0 0\n0 0 0 1\n0 0 0 1",
"output": "NO"
},
{
"input": "0 1 1 0\n1 1 0 1\n1 0 0 1\n1 1 1 0",
"output": "YES"
},
{
"input": "1 0 0 0\n1 1 0 0\n1 1 0 1\n0 0 1 0",
"output": "YES"
},
{
"input": "0 0 0 0\n1 1 0 0\n0 0 0 1\n0 0 1 0",
"output": "NO"
},
{
"input": "0 1 0 0\n0 0 0 1\n0 1 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 1 0 0\n1 1 0 1\n1 0 0 1\n1 1 0 1",
"output": "YES"
},
{
"input": "1 0 0 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 1 0 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 1 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n1 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n0 1 0 0\n0 0 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 1\n0 0 1 0\n0 0 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 1\n0 0 0 0\n1 0 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 1\n0 0 0 0\n0 1 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n0 0 0 0\n0 0 1 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 1\n0 0 0 0\n0 0 0 0\n1 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 1\n0 0 0 0\n0 0 0 0\n0 1 0 0",
"output": "NO"
},
{
"input": "0 0 0 1\n0 0 0 0\n0 0 0 0\n0 0 1 0",
"output": "YES"
},
{
"input": "1 0 0 0\n0 0 0 1\n0 0 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 1 0 0\n0 0 0 1\n0 0 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 1 0\n0 0 0 1\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n1 0 0 1\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 1 0 1\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 1 1\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 1\n1 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 1\n0 1 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 1\n0 0 1 0\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 1\n0 0 0 0\n1 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 1\n0 0 0 0\n0 1 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 1\n0 0 0 0\n0 0 1 0",
"output": "NO"
},
{
"input": "1 0 0 0\n0 0 0 0\n0 0 0 1\n0 0 0 0",
"output": "NO"
},
{
"input": "0 1 0 0\n0 0 0 0\n0 0 0 1\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 1 0\n0 0 0 0\n0 0 0 1\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 0\n1 0 0 0\n0 0 0 1\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 1 0 0\n0 0 0 1\n0 0 0 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 1 0\n0 0 0 1\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n1 0 0 1\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 1 0 1\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 1 1\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 1\n1 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 1\n0 1 0 0",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 1\n0 0 1 0",
"output": "NO"
},
{
"input": "1 0 0 0\n0 0 0 0\n0 0 0 0\n0 0 0 1",
"output": "YES"
},
{
"input": "0 1 0 0\n0 0 0 0\n0 0 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 1 0\n0 0 0 0\n0 0 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 0 0\n1 0 0 0\n0 0 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 0 0\n0 1 0 0\n0 0 0 0\n0 0 0 1",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 1 0\n0 0 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 0\n1 0 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 1 0 0\n0 0 0 1",
"output": "NO"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 1 0\n0 0 0 1",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 0\n1 0 0 1",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 0\n0 1 0 1",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 0\n0 0 1 1",
"output": "YES"
},
{
"input": "0 0 0 0\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "NO"
},
{
"input": "1 1 1 1\n1 1 1 1\n1 1 1 1\n1 1 1 1",
"output": "YES"
},
{
"input": "1 0 0 0\n0 1 0 0\n0 0 1 0\n0 0 0 1",
"output": "YES"
},
{
"input": "1 1 1 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "1 0 0 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 1 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 1 0 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n1 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 1 0 0\n0 0 0 0\n0 0 0 1\n0 0 0 0",
"output": "YES"
},
{
"input": "0 1 1 0\n1 0 1 0\n1 1 1 0\n0 0 0 1",
"output": "YES"
},
{
"input": "1 1 0 1\n0 0 0 0\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "1 1 1 0\n1 1 1 0\n1 1 1 0\n0 0 0 1",
"output": "YES"
},
{
"input": "1 0 0 0\n0 0 0 0\n0 0 0 0\n0 0 0 1",
"output": "YES"
},
{
"input": "0 0 0 1\n0 0 0 0\n0 1 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n0 0 1 1\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n0 1 1 1\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n0 1 0 1\n0 0 0 0\n0 0 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n0 0 0 1\n0 0 0 0\n0 1 0 0",
"output": "YES"
},
{
"input": "0 0 0 1\n0 0 0 1\n1 0 0 0\n0 0 0 0",
"output": "YES"
}
] | 1,496,327,008
| 508
|
Python 3
|
CHALLENGED
|
CHALLENGES
| 7
| 46
| 0
|
sv = [0 for i in range(4)]
for i in range(4):
sv[i] = [int(i) for i in input().split()]
a = "NO"
for el in sv:
if el[3] == 1:
if el[0] == 1 or el[1] == 1 or el[2] == 1:
a = "YES"
print(a)
|
Title: Sagheer and Crossroads
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sagheer is walking in the street when he comes to an intersection of two roads. Each road can be represented as two parts where each part has 3 lanes getting into the intersection (one for each direction) and 3 lanes getting out of the intersection, so we have 4 parts in total. Each part has 4 lights, one for each lane getting into the intersection (*l* — left, *s* — straight, *r* — right) and a light *p* for a pedestrian crossing.
An accident is possible if a car can hit a pedestrian. This can happen if the light of a pedestrian crossing of some part and the light of a lane that can get to or from that same part are green at the same time.
Now, Sagheer is monitoring the configuration of the traffic lights. Your task is to help him detect whether an accident is possible.
Input Specification:
The input consists of four lines with each line describing a road part given in a counter-clockwise order.
Each line contains four integers *l*, *s*, *r*, *p* — for the left, straight, right and pedestrian lights, respectively. The possible values are 0 for red light and 1 for green light.
Output Specification:
On a single line, print "YES" if an accident is possible, and "NO" otherwise.
Demo Input:
['1 0 0 1\n0 1 0 0\n0 0 1 0\n0 0 0 1\n', '0 1 1 0\n1 0 1 0\n1 1 0 0\n0 0 0 1\n', '1 0 0 0\n0 0 0 1\n0 0 0 0\n1 0 1 0\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
In the first example, some accidents are possible because cars of part 1 can hit pedestrians of parts 1 and 4. Also, cars of parts 2 and 3 can hit pedestrians of part 4.
In the second example, no car can pass the pedestrian crossing of part 4 which is the only green pedestrian light. So, no accident can occur.
|
```python
sv = [0 for i in range(4)]
for i in range(4):
sv[i] = [int(i) for i in input().split()]
a = "NO"
for el in sv:
if el[3] == 1:
if el[0] == 1 or el[1] == 1 or el[2] == 1:
a = "YES"
print(a)
```
| -1
|
|
903
|
B
|
The Modcrab
|
PROGRAMMING
| 1,200
|
[
"greedy",
"implementation"
] | null | null |
Vova is again playing some computer game, now an RPG. In the game Vova's character received a quest: to slay the fearsome monster called Modcrab.
After two hours of playing the game Vova has tracked the monster and analyzed its tactics. The Modcrab has *h*2 health points and an attack power of *a*2. Knowing that, Vova has decided to buy a lot of strong healing potions and to prepare for battle.
Vova's character has *h*1 health points and an attack power of *a*1. Also he has a large supply of healing potions, each of which increases his current amount of health points by *c*1 when Vova drinks a potion. All potions are identical to each other. It is guaranteed that *c*1<=><=*a*2.
The battle consists of multiple phases. In the beginning of each phase, Vova can either attack the monster (thus reducing its health by *a*1) or drink a healing potion (it increases Vova's health by *c*1; Vova's health can exceed *h*1). Then, if the battle is not over yet, the Modcrab attacks Vova, reducing his health by *a*2. The battle ends when Vova's (or Modcrab's) health drops to 0 or lower. It is possible that the battle ends in a middle of a phase after Vova's attack.
Of course, Vova wants to win the fight. But also he wants to do it as fast as possible. So he wants to make up a strategy that will allow him to win the fight after the minimum possible number of phases.
Help Vova to make up a strategy! You may assume that Vova never runs out of healing potions, and that he can always win.
|
The first line contains three integers *h*1, *a*1, *c*1 (1<=≤<=*h*1,<=*a*1<=≤<=100, 2<=≤<=*c*1<=≤<=100) — Vova's health, Vova's attack power and the healing power of a potion.
The second line contains two integers *h*2, *a*2 (1<=≤<=*h*2<=≤<=100, 1<=≤<=*a*2<=<<=*c*1) — the Modcrab's health and his attack power.
|
In the first line print one integer *n* denoting the minimum number of phases required to win the battle.
Then print *n* lines. *i*-th line must be equal to HEAL if Vova drinks a potion in *i*-th phase, or STRIKE if he attacks the Modcrab.
The strategy must be valid: Vova's character must not be defeated before slaying the Modcrab, and the monster's health must be 0 or lower after Vova's last action.
If there are multiple optimal solutions, print any of them.
|
[
"10 6 100\n17 5\n",
"11 6 100\n12 5\n"
] |
[
"4\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE\n",
"2\nSTRIKE\nSTRIKE\n"
] |
In the first example Vova's character must heal before or after his first attack. Otherwise his health will drop to zero in 2 phases while he needs 3 strikes to win.
In the second example no healing needed, two strikes are enough to get monster to zero health and win with 6 health left.
| 0
|
[
{
"input": "10 6 100\n17 5",
"output": "4\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "11 6 100\n12 5",
"output": "2\nSTRIKE\nSTRIKE"
},
{
"input": "25 27 91\n10 87",
"output": "1\nSTRIKE"
},
{
"input": "79 4 68\n9 65",
"output": "21\nSTRIKE\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "9 1 20\n4 19",
"output": "53\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "1 1 100\n100 99",
"output": "9901\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nH..."
},
{
"input": "6 6 100\n12 5",
"output": "2\nSTRIKE\nSTRIKE"
},
{
"input": "9 76 78\n86 69",
"output": "9\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "62 21 10\n47 2",
"output": "3\nSTRIKE\nSTRIKE\nSTRIKE"
},
{
"input": "50 1 2\n70 1",
"output": "90\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEA..."
},
{
"input": "4 1 2\n10 1",
"output": "16\nSTRIKE\nSTRIKE\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "1 1 2\n3 1",
"output": "5\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "14 5 2\n99 1",
"output": "26\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "20 1 5\n8 4",
"output": "17\nSTRIKE\nSTRIKE\nSTRIKE\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "12 12 19\n83 8",
"output": "11\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE\nHEAL\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE"
},
{
"input": "5 12 11\n4 2",
"output": "1\nSTRIKE"
},
{
"input": "34 14 18\n74 14",
"output": "16\nSTRIKE\nSTRIKE\nHEAL\nHEAL\nHEAL\nSTRIKE\nHEAL\nHEAL\nHEAL\nSTRIKE\nHEAL\nHEAL\nHEAL\nHEAL\nSTRIKE\nSTRIKE"
}
] | 1,630,953,069
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 61
| 7,987,200
|
from sys import stdin
from collections import deque,Counter,defaultdict,OrderedDict
import sys
import math,os
import operator
import random
from fractions import Fraction
import functools
import bisect
import itertools
from heapq import *
import time
import copy
'''
79-65 68
9-4 65
14 68
5 65
14+68 4 68
5 65
17 4 68
1 65
17+68 4 68
1 65
17+3 4 68
-3 65
'''
h1,a1,c1 = map(int,input().split())
h2,a2 = map(int,input().split())
answer = []
while h2>0:
if h2-a1<0:
answer.append("STRIKE")
break
if h1<=a2:
h1+=c1
h1-=a2
answer.append("HEAL")
continue
h2-=a1
h1-=a2
answer.append("STRIKE")
print(h1,h2)
print(h1,h2)
print(len(answer))
for i in answer:
print(i)
|
Title: The Modcrab
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vova is again playing some computer game, now an RPG. In the game Vova's character received a quest: to slay the fearsome monster called Modcrab.
After two hours of playing the game Vova has tracked the monster and analyzed its tactics. The Modcrab has *h*2 health points and an attack power of *a*2. Knowing that, Vova has decided to buy a lot of strong healing potions and to prepare for battle.
Vova's character has *h*1 health points and an attack power of *a*1. Also he has a large supply of healing potions, each of which increases his current amount of health points by *c*1 when Vova drinks a potion. All potions are identical to each other. It is guaranteed that *c*1<=><=*a*2.
The battle consists of multiple phases. In the beginning of each phase, Vova can either attack the monster (thus reducing its health by *a*1) or drink a healing potion (it increases Vova's health by *c*1; Vova's health can exceed *h*1). Then, if the battle is not over yet, the Modcrab attacks Vova, reducing his health by *a*2. The battle ends when Vova's (or Modcrab's) health drops to 0 or lower. It is possible that the battle ends in a middle of a phase after Vova's attack.
Of course, Vova wants to win the fight. But also he wants to do it as fast as possible. So he wants to make up a strategy that will allow him to win the fight after the minimum possible number of phases.
Help Vova to make up a strategy! You may assume that Vova never runs out of healing potions, and that he can always win.
Input Specification:
The first line contains three integers *h*1, *a*1, *c*1 (1<=≤<=*h*1,<=*a*1<=≤<=100, 2<=≤<=*c*1<=≤<=100) — Vova's health, Vova's attack power and the healing power of a potion.
The second line contains two integers *h*2, *a*2 (1<=≤<=*h*2<=≤<=100, 1<=≤<=*a*2<=<<=*c*1) — the Modcrab's health and his attack power.
Output Specification:
In the first line print one integer *n* denoting the minimum number of phases required to win the battle.
Then print *n* lines. *i*-th line must be equal to HEAL if Vova drinks a potion in *i*-th phase, or STRIKE if he attacks the Modcrab.
The strategy must be valid: Vova's character must not be defeated before slaying the Modcrab, and the monster's health must be 0 or lower after Vova's last action.
If there are multiple optimal solutions, print any of them.
Demo Input:
['10 6 100\n17 5\n', '11 6 100\n12 5\n']
Demo Output:
['4\nSTRIKE\nHEAL\nSTRIKE\nSTRIKE\n', '2\nSTRIKE\nSTRIKE\n']
Note:
In the first example Vova's character must heal before or after his first attack. Otherwise his health will drop to zero in 2 phases while he needs 3 strikes to win.
In the second example no healing needed, two strikes are enough to get monster to zero health and win with 6 health left.
|
```python
from sys import stdin
from collections import deque,Counter,defaultdict,OrderedDict
import sys
import math,os
import operator
import random
from fractions import Fraction
import functools
import bisect
import itertools
from heapq import *
import time
import copy
'''
79-65 68
9-4 65
14 68
5 65
14+68 4 68
5 65
17 4 68
1 65
17+68 4 68
1 65
17+3 4 68
-3 65
'''
h1,a1,c1 = map(int,input().split())
h2,a2 = map(int,input().split())
answer = []
while h2>0:
if h2-a1<0:
answer.append("STRIKE")
break
if h1<=a2:
h1+=c1
h1-=a2
answer.append("HEAL")
continue
h2-=a1
h1-=a2
answer.append("STRIKE")
print(h1,h2)
print(h1,h2)
print(len(answer))
for i in answer:
print(i)
```
| 0
|
|
34
|
A
|
Reconnaissance 2
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Reconnaissance 2
|
2
|
256
|
*n* soldiers stand in a circle. For each soldier his height *a**i* is known. A reconnaissance unit can be made of such two neighbouring soldiers, whose heights difference is minimal, i.e. |*a**i*<=-<=*a**j*| is minimal. So each of them will be less noticeable with the other. Output any pair of soldiers that can form a reconnaissance unit.
|
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of soldiers. Then follow the heights of the soldiers in their order in the circle — *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1000). The soldier heights are given in clockwise or counterclockwise direction.
|
Output two integers — indexes of neighbouring soldiers, who should form a reconnaissance unit. If there are many optimum solutions, output any of them. Remember, that the soldiers stand in a circle.
|
[
"5\n10 12 13 15 10\n",
"4\n10 20 30 40\n"
] |
[
"5 1\n",
"1 2\n"
] |
none
| 500
|
[
{
"input": "5\n10 12 13 15 10",
"output": "5 1"
},
{
"input": "4\n10 20 30 40",
"output": "1 2"
},
{
"input": "6\n744 359 230 586 944 442",
"output": "2 3"
},
{
"input": "5\n826 747 849 687 437",
"output": "1 2"
},
{
"input": "5\n999 999 993 969 999",
"output": "1 2"
},
{
"input": "5\n4 24 6 1 15",
"output": "3 4"
},
{
"input": "2\n511 32",
"output": "1 2"
},
{
"input": "3\n907 452 355",
"output": "2 3"
},
{
"input": "4\n303 872 764 401",
"output": "4 1"
},
{
"input": "10\n684 698 429 694 956 812 594 170 937 764",
"output": "1 2"
},
{
"input": "20\n646 840 437 946 640 564 936 917 487 752 844 734 468 969 674 646 728 642 514 695",
"output": "7 8"
},
{
"input": "30\n996 999 998 984 989 1000 996 993 1000 983 992 999 999 1000 979 992 987 1000 996 1000 1000 989 981 996 995 999 999 989 999 1000",
"output": "12 13"
},
{
"input": "50\n93 27 28 4 5 78 59 24 19 134 31 128 118 36 90 32 32 1 44 32 33 13 31 10 12 25 38 50 25 12 4 22 28 53 48 83 4 25 57 31 71 24 8 7 28 86 23 80 101 58",
"output": "16 17"
},
{
"input": "88\n1000 1000 1000 1000 1000 998 998 1000 1000 1000 1000 999 999 1000 1000 1000 999 1000 997 999 997 1000 999 998 1000 999 1000 1000 1000 999 1000 999 999 1000 1000 999 1000 999 1000 1000 998 1000 1000 1000 998 998 1000 1000 999 1000 1000 1000 1000 1000 1000 1000 998 1000 1000 1000 999 1000 1000 999 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 998 1000 1000 1000 998 1000 1000 998 1000 999 1000 1000 1000 1000",
"output": "1 2"
},
{
"input": "99\n4 4 21 6 5 3 13 2 6 1 3 4 1 3 1 9 11 1 6 17 4 5 20 4 1 9 5 11 3 4 14 1 3 3 1 4 3 5 27 1 1 2 10 7 11 4 19 7 11 6 11 13 3 1 10 7 2 1 16 1 9 4 29 13 2 12 14 2 21 1 9 8 26 12 12 5 2 14 7 8 8 8 9 4 12 2 6 6 7 16 8 14 2 10 20 15 3 7 4",
"output": "1 2"
},
{
"input": "100\n713 572 318 890 577 657 646 146 373 783 392 229 455 871 20 593 573 336 26 381 280 916 907 732 820 713 111 840 570 446 184 711 481 399 788 647 492 15 40 530 549 506 719 782 126 20 778 996 712 761 9 74 812 418 488 175 103 585 900 3 604 521 109 513 145 708 990 361 682 827 791 22 596 780 596 385 450 643 158 496 876 975 319 783 654 895 891 361 397 81 682 899 347 623 809 557 435 279 513 438",
"output": "86 87"
},
{
"input": "100\n31 75 86 68 111 27 22 22 26 30 54 163 107 75 160 122 14 23 17 26 27 20 43 58 59 71 21 148 9 32 43 91 133 286 132 70 90 156 84 14 77 93 23 18 13 72 18 131 33 28 72 175 30 86 249 20 14 208 28 57 63 199 6 10 24 30 62 267 43 479 60 28 138 1 45 3 19 47 7 166 116 117 50 140 28 14 95 85 93 43 61 15 2 70 10 51 7 95 9 25",
"output": "7 8"
},
{
"input": "100\n896 898 967 979 973 709 961 968 806 967 896 967 826 975 936 903 986 856 851 931 852 971 786 837 949 978 686 936 952 909 965 749 908 916 943 973 983 975 939 886 964 928 960 976 907 788 994 773 949 871 947 980 945 985 726 981 887 943 907 990 931 874 840 867 948 951 961 904 888 901 976 967 994 921 828 970 972 722 755 970 860 855 914 869 714 899 969 978 898 862 642 939 904 936 819 934 884 983 955 964",
"output": "1 2"
},
{
"input": "100\n994 927 872 970 815 986 952 996 965 1000 877 986 978 999 950 990 936 997 993 960 921 860 895 869 943 998 983 968 973 953 999 990 995 871 853 979 973 963 953 938 997 989 993 964 960 973 946 975 1000 962 920 746 989 957 904 965 920 979 966 961 1000 993 975 952 846 971 991 979 985 969 984 973 956 1000 952 778 983 974 956 927 995 997 980 997 1000 970 960 970 988 983 947 904 935 972 1000 863 992 996 932 967",
"output": "81 82"
},
{
"input": "100\n48 108 63 21 27 8 49 21 75 8 24 42 149 18 8 28 21 18 25 35 59 70 59 33 40 1 67 34 120 82 4 115 72 87 3 15 15 63 37 12 40 27 83 14 38 20 14 58 93 10 31 3 39 6 197 77 54 16 31 146 9 49 14 8 77 82 5 11 80 116 8 61 50 24 7 103 29 11 3 3 1 12 46 24 21 131 39 29 36 2 107 40 16 99 31 41 29 48 17 17",
"output": "36 37"
}
] | 1,572,820,108
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 20
| 248
| 0
|
n = int(input())
x = list(map(int, input().split()))
x.append(x[0])
minDif = 10000
ans = []
for i in range(1, n + 1):
if abs(x[i] - x[i - 1]) < minDif:
ans = [i, i + 1]
if i == n:
ans = [1, n]
minDif = abs(x[i] - x[i - 1])
print(*ans)
|
Title: Reconnaissance 2
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
*n* soldiers stand in a circle. For each soldier his height *a**i* is known. A reconnaissance unit can be made of such two neighbouring soldiers, whose heights difference is minimal, i.e. |*a**i*<=-<=*a**j*| is minimal. So each of them will be less noticeable with the other. Output any pair of soldiers that can form a reconnaissance unit.
Input Specification:
The first line contains integer *n* (2<=≤<=*n*<=≤<=100) — amount of soldiers. Then follow the heights of the soldiers in their order in the circle — *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1000). The soldier heights are given in clockwise or counterclockwise direction.
Output Specification:
Output two integers — indexes of neighbouring soldiers, who should form a reconnaissance unit. If there are many optimum solutions, output any of them. Remember, that the soldiers stand in a circle.
Demo Input:
['5\n10 12 13 15 10\n', '4\n10 20 30 40\n']
Demo Output:
['5 1\n', '1 2\n']
Note:
none
|
```python
n = int(input())
x = list(map(int, input().split()))
x.append(x[0])
minDif = 10000
ans = []
for i in range(1, n + 1):
if abs(x[i] - x[i - 1]) < minDif:
ans = [i, i + 1]
if i == n:
ans = [1, n]
minDif = abs(x[i] - x[i - 1])
print(*ans)
```
| 3.938
|
17
|
A
|
Noldbach problem
|
PROGRAMMING
| 1,000
|
[
"brute force",
"math",
"number theory"
] |
A. Noldbach problem
|
2
|
64
|
Nick is interested in prime numbers. Once he read about Goldbach problem. It states that every even integer greater than 2 can be expressed as the sum of two primes. That got Nick's attention and he decided to invent a problem of his own and call it Noldbach problem. Since Nick is interested only in prime numbers, Noldbach problem states that at least *k* prime numbers from 2 to *n* inclusively can be expressed as the sum of three integer numbers: two neighboring prime numbers and 1. For example, 19 = 7 + 11 + 1, or 13 = 5 + 7 + 1.
Two prime numbers are called neighboring if there are no other prime numbers between them.
You are to help Nick, and find out if he is right or wrong.
|
The first line of the input contains two integers *n* (2<=≤<=*n*<=≤<=1000) and *k* (0<=≤<=*k*<=≤<=1000).
|
Output YES if at least *k* prime numbers from 2 to *n* inclusively can be expressed as it was described above. Otherwise output NO.
|
[
"27 2\n",
"45 7\n"
] |
[
"YES",
"NO"
] |
In the first sample the answer is YES since at least two numbers can be expressed as it was described (for example, 13 and 19). In the second sample the answer is NO since it is impossible to express 7 prime numbers from 2 to 45 in the desired form.
| 0
|
[
{
"input": "27 2",
"output": "YES"
},
{
"input": "45 7",
"output": "NO"
},
{
"input": "2 0",
"output": "YES"
},
{
"input": "15 1",
"output": "YES"
},
{
"input": "17 1",
"output": "YES"
},
{
"input": "34 5",
"output": "NO"
},
{
"input": "37 4",
"output": "YES"
},
{
"input": "43 5",
"output": "YES"
},
{
"input": "47 7",
"output": "NO"
},
{
"input": "50 5",
"output": "YES"
},
{
"input": "57 6",
"output": "YES"
},
{
"input": "60 8",
"output": "NO"
},
{
"input": "62 7",
"output": "YES"
},
{
"input": "76 9",
"output": "NO"
},
{
"input": "69 7",
"output": "YES"
},
{
"input": "113 10",
"output": "YES"
},
{
"input": "141 11",
"output": "YES"
},
{
"input": "207 16",
"output": "NO"
},
{
"input": "231 18",
"output": "NO"
},
{
"input": "296 19",
"output": "YES"
},
{
"input": "332 20",
"output": "YES"
},
{
"input": "378 24",
"output": "NO"
},
{
"input": "428 23",
"output": "YES"
},
{
"input": "497 27",
"output": "NO"
},
{
"input": "640 32",
"output": "YES"
},
{
"input": "798 35",
"output": "YES"
},
{
"input": "802 35",
"output": "YES"
},
{
"input": "864 40",
"output": "NO"
},
{
"input": "953 44",
"output": "NO"
},
{
"input": "995 44",
"output": "YES"
},
{
"input": "1000 44",
"output": "YES"
},
{
"input": "1000 0",
"output": "YES"
},
{
"input": "1000 1000",
"output": "NO"
},
{
"input": "2 1000",
"output": "NO"
},
{
"input": "2 0",
"output": "YES"
}
] | 1,635,594,071
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 35
| 124
| 4,505,600
|
import math
def isprime(k):
for i in range (2, int(math.sqrt(k)+1)):
if(k%i==0):
return 0
return 1
n,k = map(int, input().split())
count = 0
lis = []
for i in range(2, n+1):
if(isprime(i)):
lis.append(i)
for i in range (0, len(lis)-1):
if((lis[i]+lis[i+1]+1) in lis):
count += 1
if(count >=k):
print("YES")
else:
print("NO")
|
Title: Noldbach problem
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
Nick is interested in prime numbers. Once he read about Goldbach problem. It states that every even integer greater than 2 can be expressed as the sum of two primes. That got Nick's attention and he decided to invent a problem of his own and call it Noldbach problem. Since Nick is interested only in prime numbers, Noldbach problem states that at least *k* prime numbers from 2 to *n* inclusively can be expressed as the sum of three integer numbers: two neighboring prime numbers and 1. For example, 19 = 7 + 11 + 1, or 13 = 5 + 7 + 1.
Two prime numbers are called neighboring if there are no other prime numbers between them.
You are to help Nick, and find out if he is right or wrong.
Input Specification:
The first line of the input contains two integers *n* (2<=≤<=*n*<=≤<=1000) and *k* (0<=≤<=*k*<=≤<=1000).
Output Specification:
Output YES if at least *k* prime numbers from 2 to *n* inclusively can be expressed as it was described above. Otherwise output NO.
Demo Input:
['27 2\n', '45 7\n']
Demo Output:
['YES', 'NO']
Note:
In the first sample the answer is YES since at least two numbers can be expressed as it was described (for example, 13 and 19). In the second sample the answer is NO since it is impossible to express 7 prime numbers from 2 to 45 in the desired form.
|
```python
import math
def isprime(k):
for i in range (2, int(math.sqrt(k)+1)):
if(k%i==0):
return 0
return 1
n,k = map(int, input().split())
count = 0
lis = []
for i in range(2, n+1):
if(isprime(i)):
lis.append(i)
for i in range (0, len(lis)-1):
if((lis[i]+lis[i+1]+1) in lis):
count += 1
if(count >=k):
print("YES")
else:
print("NO")
```
| 3.935431
|
499
|
A
|
Watching a movie
|
PROGRAMMING
| 1,000
|
[
"greedy",
"implementation"
] | null | null |
You have decided to watch the best moments of some movie. There are two buttons on your player:
1. Watch the current minute of the movie. By pressing this button, you watch the current minute of the movie and the player automatically proceeds to the next minute of the movie. 1. Skip exactly *x* minutes of the movie (*x* is some fixed positive integer). If the player is now at the *t*-th minute of the movie, then as a result of pressing this button, it proceeds to the minute (*t*<=+<=*x*).
Initially the movie is turned on in the player on the first minute, and you want to watch exactly *n* best moments of the movie, the *i*-th best moment starts at the *l**i*-th minute and ends at the *r**i*-th minute (more formally, the *i*-th best moment consists of minutes: *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i*).
Determine, what is the minimum number of minutes of the movie you have to watch if you want to watch all the best moments?
|
The first line contains two space-separated integers *n*, *x* (1<=≤<=*n*<=≤<=50, 1<=≤<=*x*<=≤<=105) — the number of the best moments of the movie and the value of *x* for the second button.
The following *n* lines contain the descriptions of the best moments of the movie, the *i*-th line of the description contains two integers separated by a space *l**i*, *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=105).
It is guaranteed that for all integers *i* from 2 to *n* the following condition holds: *r**i*<=-<=1<=<<=*l**i*.
|
Output a single number — the answer to the problem.
|
[
"2 3\n5 6\n10 12\n",
"1 1\n1 100000\n"
] |
[
"6\n",
"100000\n"
] |
In the first sample, the player was initially standing on the first minute. As the minutes from the 1-st to the 4-th one don't contain interesting moments, we press the second button. Now we can not press the second button and skip 3 more minutes, because some of them contain interesting moments. Therefore, we watch the movie from the 4-th to the 6-th minute, after that the current time is 7. Similarly, we again skip 3 minutes and then watch from the 10-th to the 12-th minute of the movie. In total, we watch 6 minutes of the movie.
In the second sample, the movie is very interesting, so you'll have to watch all 100000 minutes of the movie.
| 500
|
[
{
"input": "2 3\n5 6\n10 12",
"output": "6"
},
{
"input": "1 1\n1 100000",
"output": "100000"
},
{
"input": "10 1\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "53974"
},
{
"input": "10 3\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "53983"
},
{
"input": "10 10\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "54038"
},
{
"input": "10 1000\n2156 3497\n4784 7775\n14575 31932\n33447 35902\n36426 47202\n48772 60522\n63982 68417\n78537 79445\n90081 90629\n94325 95728",
"output": "58728"
},
{
"input": "12 14\n2156 3497\n4784 7775\n14575 23857\n29211 30739\n31932 33447\n35902 36426\n47202 48772\n60522 63982\n68417 78537\n79445 86918\n90081 90629\n94325 95728",
"output": "41870"
},
{
"input": "12 17\n2156 3497\n4784 7775\n14575 23857\n29211 30739\n31932 33447\n35902 36426\n47202 48772\n60522 63982\n68417 78537\n79445 86918\n90081 90629\n94325 95728",
"output": "41872"
},
{
"input": "18 111\n1449 2156\n3497 4784\n7775 14575\n23857 24593\n29211 30739\n31932 33447\n35902 36426\n36991 38506\n39679 47202\n48772 60016\n60522 61868\n63340 63982\n68417 78537\n79445 86568\n86918 87940\n90081 90310\n90629 94325\n95728 96263",
"output": "58967"
},
{
"input": "1 1\n14575 60522",
"output": "45948"
},
{
"input": "1 10\n14575 60522",
"output": "45952"
},
{
"input": "2 10\n14575 36426\n60522 79445",
"output": "40785"
},
{
"input": "3 1\n14575 36426\n48772 60522\n79445 90081",
"output": "44240"
},
{
"input": "1 100000\n1 100000",
"output": "100000"
},
{
"input": "1 2\n2 100000",
"output": "100000"
},
{
"input": "1 3\n4 100000",
"output": "99997"
},
{
"input": "2 100\n5 6\n7 7",
"output": "7"
},
{
"input": "1 10000\n500 600",
"output": "600"
},
{
"input": "2 3\n1 3\n4 8",
"output": "8"
},
{
"input": "3 1\n1 2\n3 4\n6 7",
"output": "6"
},
{
"input": "1 1\n1 1",
"output": "1"
},
{
"input": "1 3\n5 6",
"output": "3"
},
{
"input": "1 5\n7 10",
"output": "5"
},
{
"input": "1 100\n5 6",
"output": "6"
},
{
"input": "1 2\n1 1",
"output": "1"
},
{
"input": "1 100000\n100000 100000",
"output": "100000"
},
{
"input": "2 3\n1 1\n5 6",
"output": "3"
}
] | 1,623,452,371
| 2,147,483,647
|
PyPy 3
|
WRONG_ANSWER
|
TESTS
| 2
| 77
| 0
|
from math import floor, ceil
cases, k = map(int, input().split())
ans = 0
cur_time = 0
for _ in range(cases):
l, r = map(int, input().split())
if r <= cur_time:
continue
l = max(l, cur_time)
time = ceil((r-l+1)/k) * k
# print(time)
ans += time
cur_time = l + time -1
# print(ans)
# print(cur_time)
print(ans)
|
Title: Watching a movie
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have decided to watch the best moments of some movie. There are two buttons on your player:
1. Watch the current minute of the movie. By pressing this button, you watch the current minute of the movie and the player automatically proceeds to the next minute of the movie. 1. Skip exactly *x* minutes of the movie (*x* is some fixed positive integer). If the player is now at the *t*-th minute of the movie, then as a result of pressing this button, it proceeds to the minute (*t*<=+<=*x*).
Initially the movie is turned on in the player on the first minute, and you want to watch exactly *n* best moments of the movie, the *i*-th best moment starts at the *l**i*-th minute and ends at the *r**i*-th minute (more formally, the *i*-th best moment consists of minutes: *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i*).
Determine, what is the minimum number of minutes of the movie you have to watch if you want to watch all the best moments?
Input Specification:
The first line contains two space-separated integers *n*, *x* (1<=≤<=*n*<=≤<=50, 1<=≤<=*x*<=≤<=105) — the number of the best moments of the movie and the value of *x* for the second button.
The following *n* lines contain the descriptions of the best moments of the movie, the *i*-th line of the description contains two integers separated by a space *l**i*, *r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=105).
It is guaranteed that for all integers *i* from 2 to *n* the following condition holds: *r**i*<=-<=1<=<<=*l**i*.
Output Specification:
Output a single number — the answer to the problem.
Demo Input:
['2 3\n5 6\n10 12\n', '1 1\n1 100000\n']
Demo Output:
['6\n', '100000\n']
Note:
In the first sample, the player was initially standing on the first minute. As the minutes from the 1-st to the 4-th one don't contain interesting moments, we press the second button. Now we can not press the second button and skip 3 more minutes, because some of them contain interesting moments. Therefore, we watch the movie from the 4-th to the 6-th minute, after that the current time is 7. Similarly, we again skip 3 minutes and then watch from the 10-th to the 12-th minute of the movie. In total, we watch 6 minutes of the movie.
In the second sample, the movie is very interesting, so you'll have to watch all 100000 minutes of the movie.
|
```python
from math import floor, ceil
cases, k = map(int, input().split())
ans = 0
cur_time = 0
for _ in range(cases):
l, r = map(int, input().split())
if r <= cur_time:
continue
l = max(l, cur_time)
time = ceil((r-l+1)/k) * k
# print(time)
ans += time
cur_time = l + time -1
# print(ans)
# print(cur_time)
print(ans)
```
| 0
|
|
467
|
A
|
George and Accommodation
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
George has recently entered the BSUCP (Berland State University for Cool Programmers). George has a friend Alex who has also entered the university. Now they are moving into a dormitory.
George and Alex want to live in the same room. The dormitory has *n* rooms in total. At the moment the *i*-th room has *p**i* people living in it and the room can accommodate *q**i* people in total (*p**i*<=≤<=*q**i*). Your task is to count how many rooms has free place for both George and Alex.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of rooms.
The *i*-th of the next *n* lines contains two integers *p**i* and *q**i* (0<=≤<=*p**i*<=≤<=*q**i*<=≤<=100) — the number of people who already live in the *i*-th room and the room's capacity.
|
Print a single integer — the number of rooms where George and Alex can move in.
|
[
"3\n1 1\n2 2\n3 3\n",
"3\n1 10\n0 10\n10 10\n"
] |
[
"0\n",
"2\n"
] |
none
| 500
|
[
{
"input": "3\n1 1\n2 2\n3 3",
"output": "0"
},
{
"input": "3\n1 10\n0 10\n10 10",
"output": "2"
},
{
"input": "2\n36 67\n61 69",
"output": "2"
},
{
"input": "3\n21 71\n10 88\n43 62",
"output": "3"
},
{
"input": "3\n1 2\n2 3\n3 4",
"output": "0"
},
{
"input": "10\n0 10\n0 20\n0 30\n0 40\n0 50\n0 60\n0 70\n0 80\n0 90\n0 100",
"output": "10"
},
{
"input": "13\n14 16\n30 31\n45 46\n19 20\n15 17\n66 67\n75 76\n95 97\n29 30\n37 38\n0 2\n36 37\n8 9",
"output": "4"
},
{
"input": "19\n66 67\n97 98\n89 91\n67 69\n67 68\n18 20\n72 74\n28 30\n91 92\n27 28\n75 77\n17 18\n74 75\n28 30\n16 18\n90 92\n9 11\n22 24\n52 54",
"output": "12"
},
{
"input": "15\n55 57\n95 97\n57 59\n34 36\n50 52\n96 98\n39 40\n13 15\n13 14\n74 76\n47 48\n56 58\n24 25\n11 13\n67 68",
"output": "10"
},
{
"input": "17\n68 69\n47 48\n30 31\n52 54\n41 43\n33 35\n38 40\n56 58\n45 46\n92 93\n73 74\n61 63\n65 66\n37 39\n67 68\n77 78\n28 30",
"output": "8"
},
{
"input": "14\n64 66\n43 44\n10 12\n76 77\n11 12\n25 27\n87 88\n62 64\n39 41\n58 60\n10 11\n28 29\n57 58\n12 14",
"output": "7"
},
{
"input": "38\n74 76\n52 54\n78 80\n48 49\n40 41\n64 65\n28 30\n6 8\n49 51\n68 70\n44 45\n57 59\n24 25\n46 48\n49 51\n4 6\n63 64\n76 78\n57 59\n18 20\n63 64\n71 73\n88 90\n21 22\n89 90\n65 66\n89 91\n96 98\n42 44\n1 1\n74 76\n72 74\n39 40\n75 76\n29 30\n48 49\n87 89\n27 28",
"output": "22"
},
{
"input": "100\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0",
"output": "0"
},
{
"input": "26\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2\n1 2",
"output": "0"
},
{
"input": "68\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2\n0 2",
"output": "68"
},
{
"input": "7\n0 1\n1 5\n2 4\n3 5\n4 6\n5 6\n6 8",
"output": "5"
},
{
"input": "1\n0 0",
"output": "0"
},
{
"input": "1\n100 100",
"output": "0"
},
{
"input": "44\n0 8\n1 11\n2 19\n3 5\n4 29\n5 45\n6 6\n7 40\n8 19\n9 22\n10 18\n11 26\n12 46\n13 13\n14 27\n15 48\n16 25\n17 20\n18 29\n19 27\n20 45\n21 39\n22 29\n23 39\n24 42\n25 37\n26 52\n27 36\n28 43\n29 35\n30 38\n31 70\n32 47\n33 38\n34 61\n35 71\n36 51\n37 71\n38 59\n39 77\n40 70\n41 80\n42 77\n43 73",
"output": "42"
},
{
"input": "3\n1 3\n2 7\n8 9",
"output": "2"
},
{
"input": "53\n0 1\n1 2\n2 3\n3 4\n4 5\n5 6\n6 7\n7 8\n8 9\n9 10\n10 11\n11 12\n12 13\n13 14\n14 15\n15 16\n16 17\n17 18\n18 19\n19 20\n20 21\n21 22\n22 23\n23 24\n24 25\n25 26\n26 27\n27 28\n28 29\n29 30\n30 31\n31 32\n32 33\n33 34\n34 35\n35 36\n36 37\n37 38\n38 39\n39 40\n40 41\n41 42\n42 43\n43 44\n44 45\n45 46\n46 47\n47 48\n48 49\n49 50\n50 51\n51 52\n52 53",
"output": "0"
},
{
"input": "55\n0 0\n1 1\n2 2\n3 3\n4 4\n5 5\n6 6\n7 7\n8 8\n9 9\n10 10\n11 11\n12 12\n13 13\n14 14\n15 15\n16 16\n17 17\n18 18\n19 19\n20 20\n21 21\n22 22\n23 23\n24 24\n25 25\n26 26\n27 27\n28 28\n29 29\n30 30\n31 31\n32 32\n33 33\n34 34\n35 35\n36 36\n37 37\n38 38\n39 39\n40 40\n41 41\n42 42\n43 43\n44 44\n45 45\n46 46\n47 47\n48 48\n49 49\n50 50\n51 51\n52 52\n53 53\n54 54",
"output": "0"
},
{
"input": "51\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 62\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 73\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 82\n55 68\n55 70\n55 63\n55 55\n55 55\n55 55\n55 75\n55 75\n55 55\n55 55\n55 55\n55 55\n55 55\n55 55\n55 73\n55 55\n55 82\n55 99\n55 60",
"output": "12"
},
{
"input": "14\n1 1\n1 1\n1 55\n1 16\n1 1\n1 1\n1 55\n1 62\n1 53\n1 26\n1 1\n1 36\n1 2\n1 3",
"output": "8"
}
] | 1,693,762,192
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 27
| 46
| 0
|
import sys
n = int(input())
arr = []
counter = 0
for i in range(n):
arr.append([int(i) for i in sys.stdin.readline().split()])
for i in range(len(arr)):
if arr[i][1] - arr[i][0] >= 2:
counter += 1
print(counter)
|
Title: George and Accommodation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
George has recently entered the BSUCP (Berland State University for Cool Programmers). George has a friend Alex who has also entered the university. Now they are moving into a dormitory.
George and Alex want to live in the same room. The dormitory has *n* rooms in total. At the moment the *i*-th room has *p**i* people living in it and the room can accommodate *q**i* people in total (*p**i*<=≤<=*q**i*). Your task is to count how many rooms has free place for both George and Alex.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of rooms.
The *i*-th of the next *n* lines contains two integers *p**i* and *q**i* (0<=≤<=*p**i*<=≤<=*q**i*<=≤<=100) — the number of people who already live in the *i*-th room and the room's capacity.
Output Specification:
Print a single integer — the number of rooms where George and Alex can move in.
Demo Input:
['3\n1 1\n2 2\n3 3\n', '3\n1 10\n0 10\n10 10\n']
Demo Output:
['0\n', '2\n']
Note:
none
|
```python
import sys
n = int(input())
arr = []
counter = 0
for i in range(n):
arr.append([int(i) for i in sys.stdin.readline().split()])
for i in range(len(arr)):
if arr[i][1] - arr[i][0] >= 2:
counter += 1
print(counter)
```
| 3
|
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,638,711,207
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 62
| 0
|
s = input()
ln = len(s)
h=e=l=l2=o=0
for i in range(ln):
if h==0 and s[i] == 'h':
h = i+1
if h>0 and e==0 and s[i] == 'e':
e = i+1
if e>0 and l==0 and s[i] == 'l':
l = i+1
if l>0 and l2==0 and i>=l and s[i]=='l':
l2 = i+1
if l2>0 and o==0 and s[i]=='o':
o = i+1
break
if h<e<l<l2<o:
print("YES")
else:
print("NO")
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
s = input()
ln = len(s)
h=e=l=l2=o=0
for i in range(ln):
if h==0 and s[i] == 'h':
h = i+1
if h>0 and e==0 and s[i] == 'e':
e = i+1
if e>0 and l==0 and s[i] == 'l':
l = i+1
if l>0 and l2==0 and i>=l and s[i]=='l':
l2 = i+1
if l2>0 and o==0 and s[i]=='o':
o = i+1
break
if h<e<l<l2<o:
print("YES")
else:
print("NO")
```
| 3.969
|
998
|
B
|
Cutting
|
PROGRAMMING
| 1,200
|
[
"dp",
"greedy",
"sortings"
] | null | null |
There are a lot of things which could be cut — trees, paper, "the rope". In this problem you are going to cut a sequence of integers.
There is a sequence of integers, which contains the equal number of even and odd numbers. Given a limited budget, you need to make maximum possible number of cuts such that each resulting segment will have the same number of odd and even integers.
Cuts separate a sequence to continuous (contiguous) segments. You may think about each cut as a break between two adjacent elements in a sequence. So after cutting each element belongs to exactly one segment. Say, $[4, 1, 2, 3, 4, 5, 4, 4, 5, 5]$ $\to$ two cuts $\to$ $[4, 1 | 2, 3, 4, 5 | 4, 4, 5, 5]$. On each segment the number of even elements should be equal to the number of odd elements.
The cost of the cut between $x$ and $y$ numbers is $|x - y|$ bitcoins. Find the maximum possible number of cuts that can be made while spending no more than $B$ bitcoins.
|
First line of the input contains an integer $n$ ($2 \le n \le 100$) and an integer $B$ ($1 \le B \le 100$) — the number of elements in the sequence and the number of bitcoins you have.
Second line contains $n$ integers: $a_1$, $a_2$, ..., $a_n$ ($1 \le a_i \le 100$) — elements of the sequence, which contains the equal number of even and odd numbers
|
Print the maximum possible number of cuts which can be made while spending no more than $B$ bitcoins.
|
[
"6 4\n1 2 5 10 15 20\n",
"4 10\n1 3 2 4\n",
"6 100\n1 2 3 4 5 6\n"
] |
[
"1\n",
"0\n",
"2\n"
] |
In the first sample the optimal answer is to split sequence between $2$ and $5$. Price of this cut is equal to $3$ bitcoins.
In the second sample it is not possible to make even one cut even with unlimited number of bitcoins.
In the third sample the sequence should be cut between $2$ and $3$, and between $4$ and $5$. The total price of the cuts is $1 + 1 = 2$ bitcoins.
| 1,000
|
[
{
"input": "6 4\n1 2 5 10 15 20",
"output": "1"
},
{
"input": "4 10\n1 3 2 4",
"output": "0"
},
{
"input": "6 100\n1 2 3 4 5 6",
"output": "2"
},
{
"input": "2 100\n13 78",
"output": "0"
},
{
"input": "10 1\n56 56 98 2 11 64 97 41 95 53",
"output": "0"
},
{
"input": "10 100\n94 65 24 47 29 98 20 65 6 17",
"output": "2"
},
{
"input": "100 1\n35 6 19 84 49 64 36 91 50 65 21 86 20 89 10 52 50 24 98 74 11 48 58 98 51 85 1 29 44 83 9 97 68 41 83 57 1 57 46 42 87 2 32 50 3 57 17 77 22 100 36 27 3 34 55 8 90 61 34 20 15 39 43 46 60 60 14 23 4 22 75 51 98 23 69 22 99 57 63 30 79 7 16 8 34 84 13 47 93 40 48 25 93 1 80 6 82 93 6 21",
"output": "0"
},
{
"input": "100 10\n3 20 3 29 90 69 2 30 70 28 71 99 22 99 34 70 87 48 3 92 71 61 26 90 14 38 51 81 16 33 49 71 14 52 50 95 65 16 80 57 87 47 29 14 40 31 74 15 87 76 71 61 30 91 44 10 87 48 84 12 77 51 25 68 49 38 79 8 7 9 39 19 48 40 15 53 29 4 60 86 76 84 6 37 45 71 46 38 80 68 94 71 64 72 41 51 71 60 79 7",
"output": "2"
},
{
"input": "100 100\n60 83 82 16 17 7 89 6 83 100 85 41 72 44 23 28 64 84 3 23 33 52 93 30 81 38 67 25 26 97 94 78 41 74 74 17 53 51 54 17 20 81 95 76 42 16 16 56 74 69 30 9 82 91 32 13 47 45 97 40 56 57 27 28 84 98 91 5 61 20 3 43 42 26 83 40 34 100 5 63 62 61 72 5 32 58 93 79 7 18 50 43 17 24 77 73 87 74 98 2",
"output": "11"
},
{
"input": "100 100\n70 54 10 72 81 84 56 15 27 19 43 100 49 44 52 33 63 40 95 17 58 2 51 39 22 18 82 1 16 99 32 29 24 94 9 98 5 37 47 14 42 73 41 31 79 64 12 6 53 26 68 67 89 13 90 4 21 93 46 74 75 88 66 57 23 7 25 48 92 62 30 8 50 61 38 87 71 34 97 28 80 11 60 91 3 35 86 96 36 20 59 65 83 45 76 77 78 69 85 55",
"output": "3"
},
{
"input": "100 100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100",
"output": "49"
},
{
"input": "10 10\n94 32 87 13 4 22 85 81 18 95",
"output": "1"
},
{
"input": "10 50\n40 40 9 3 64 96 67 19 21 30",
"output": "1"
},
{
"input": "100 50\n13 31 29 86 46 10 2 87 94 2 28 31 29 15 64 3 94 71 37 76 9 91 89 38 12 46 53 33 58 11 98 4 37 72 30 52 6 86 40 98 28 6 34 80 61 47 45 69 100 47 91 64 87 41 67 58 88 75 13 81 36 58 66 29 10 27 54 83 44 15 11 33 49 36 61 18 89 26 87 1 99 19 57 21 55 84 20 74 14 43 15 51 2 76 22 92 43 14 72 77",
"output": "3"
},
{
"input": "100 1\n78 52 95 76 96 49 53 59 77 100 64 11 9 48 15 17 44 46 21 54 39 68 43 4 32 28 73 6 16 62 72 84 65 86 98 75 33 45 25 3 91 82 2 92 63 88 7 50 97 93 14 22 20 42 60 55 80 85 29 34 56 71 83 38 26 47 90 70 51 41 40 31 37 12 35 99 67 94 1 87 57 8 61 19 23 79 36 18 66 74 5 27 81 69 24 58 13 10 89 30",
"output": "0"
},
{
"input": "100 10\n19 55 91 50 31 23 60 84 38 1 22 51 27 76 28 98 11 44 61 63 15 93 52 3 66 16 53 36 18 62 35 85 78 37 73 64 87 74 46 26 82 69 49 33 83 89 56 67 71 25 39 94 96 17 21 6 47 68 34 42 57 81 13 10 54 2 48 80 20 77 4 5 59 30 90 95 45 75 8 88 24 41 40 14 97 32 7 9 65 70 100 99 72 58 92 29 79 12 86 43",
"output": "0"
},
{
"input": "100 50\n2 4 82 12 47 63 52 91 87 45 53 1 17 25 64 50 9 13 22 54 21 30 43 24 38 33 68 11 41 78 99 23 28 18 58 67 79 10 71 56 49 61 26 29 59 20 90 74 5 75 89 8 39 95 72 42 66 98 44 32 88 35 92 3 97 55 65 51 77 27 81 76 84 69 73 85 19 46 62 100 60 37 7 36 57 6 14 83 40 48 16 70 96 15 31 93 80 86 94 34",
"output": "1"
},
{
"input": "100 1\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100",
"output": "1"
},
{
"input": "100 10\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100",
"output": "10"
},
{
"input": "100 50\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100",
"output": "49"
},
{
"input": "100 30\n2 1 2 2 2 2 1 1 1 2 1 1 2 2 1 2 1 2 2 2 2 1 2 1 2 1 1 2 1 1 2 2 2 1 1 2 1 2 2 2 1 1 1 1 1 2 1 1 1 1 1 2 2 2 2 1 2 1 1 1 2 2 2 2 1 2 2 1 1 1 1 2 2 2 1 2 2 1 2 1 1 2 2 2 1 2 2 1 2 1 1 2 1 1 1 1 2 1 1 2",
"output": "11"
},
{
"input": "100 80\n1 1 1 2 2 1 1 2 1 1 1 1 2 2 2 1 2 2 2 2 1 1 2 2 1 1 1 1 2 2 2 1 1 1 1 1 1 1 2 2 2 2 1 2 2 1 2 1 1 1 1 2 2 1 2 2 1 2 2 2 2 2 1 1 2 2 2 2 2 2 1 1 2 1 1 1 2 1 1 2 1 2 1 2 2 1 1 2 1 1 1 1 2 2 2 1 2 2 1 2",
"output": "12"
},
{
"input": "100 30\n100 99 100 99 99 100 100 99 100 99 99 100 100 100 99 99 99 100 99 99 99 99 100 99 99 100 100 99 100 99 99 99 100 99 100 100 99 100 100 100 100 100 99 99 100 99 99 100 99 100 99 99 100 100 99 100 99 99 100 99 100 100 100 100 99 99 99 100 99 100 99 100 100 100 99 100 100 100 99 100 99 99 100 100 100 100 99 99 99 100 99 100 100 99 99 99 100 100 99 99",
"output": "14"
},
{
"input": "100 80\n99 100 100 100 99 99 99 99 100 99 99 99 99 99 99 99 99 100 100 99 99 99 99 99 100 99 100 99 100 100 100 100 100 99 100 100 99 99 100 100 100 100 100 99 100 99 100 99 99 99 100 99 99 99 99 99 99 99 99 100 99 100 100 99 99 99 99 100 100 100 99 100 100 100 100 100 99 100 100 100 100 100 100 100 100 99 99 99 99 100 99 100 100 100 100 100 99 100 99 100",
"output": "4"
},
{
"input": "100 30\n100 100 39 39 39 100 100 39 39 100 39 39 100 39 100 39 100 100 100 100 100 39 100 100 100 39 39 39 100 39 100 100 39 39 100 39 39 39 100 100 39 100 39 100 39 39 100 100 39 100 39 100 39 39 39 100 39 100 39 39 39 100 39 39 100 100 39 39 39 100 100 39 39 39 100 100 100 100 39 100 100 100 39 39 100 39 100 100 39 100 39 100 39 39 100 39 39 100 100 100",
"output": "5"
},
{
"input": "100 80\n39 100 39 100 100 100 100 39 39 100 100 39 39 100 39 39 39 39 100 39 39 39 39 100 100 100 100 39 100 39 39 100 100 39 39 100 39 100 39 100 100 39 39 100 39 39 39 100 39 100 39 100 100 100 100 100 100 100 39 100 39 100 100 100 39 39 39 39 39 100 100 100 39 100 100 100 100 39 100 100 39 39 100 39 39 39 100 39 100 39 39 100 100 39 100 39 39 39 100 39",
"output": "6"
},
{
"input": "4 1\n1 2 3 4",
"output": "1"
},
{
"input": "4 1\n1 2 1 2",
"output": "1"
},
{
"input": "4 4\n1 2 6 7",
"output": "1"
},
{
"input": "4 8\n1 2 10 11",
"output": "1"
},
{
"input": "6 2\n1 2 3 4 5 6",
"output": "2"
},
{
"input": "6 1\n1 2 1 2 1 2",
"output": "1"
},
{
"input": "6 4\n1 2 4 5 7 8",
"output": "2"
},
{
"input": "6 3\n1 2 5 10 15 20",
"output": "1"
}
] | 1,645,560,292
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 46
| 0
|
def main():
n, b = map(int, input().split())
arr = list(map(int, input().split()))
even_counter, odd_counter = 0, 0
temp_list = []
for i in range(n - 1):
if arr[i] % 2 == 0:
even_counter += 1
else:
odd_counter += 1
if even_counter == odd_counter and even_counter != 0:
temp_list.append((i, abs(arr[i] - arr[i + 1])))
temp_list.sort(key=lambda x: x[1])
counter = 0
s = 0
for element in temp_list:
s += element[1]
if s > b:
break
else:
counter += 1
print(counter)
if __name__ == "__main__":
main()
|
Title: Cutting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are a lot of things which could be cut — trees, paper, "the rope". In this problem you are going to cut a sequence of integers.
There is a sequence of integers, which contains the equal number of even and odd numbers. Given a limited budget, you need to make maximum possible number of cuts such that each resulting segment will have the same number of odd and even integers.
Cuts separate a sequence to continuous (contiguous) segments. You may think about each cut as a break between two adjacent elements in a sequence. So after cutting each element belongs to exactly one segment. Say, $[4, 1, 2, 3, 4, 5, 4, 4, 5, 5]$ $\to$ two cuts $\to$ $[4, 1 | 2, 3, 4, 5 | 4, 4, 5, 5]$. On each segment the number of even elements should be equal to the number of odd elements.
The cost of the cut between $x$ and $y$ numbers is $|x - y|$ bitcoins. Find the maximum possible number of cuts that can be made while spending no more than $B$ bitcoins.
Input Specification:
First line of the input contains an integer $n$ ($2 \le n \le 100$) and an integer $B$ ($1 \le B \le 100$) — the number of elements in the sequence and the number of bitcoins you have.
Second line contains $n$ integers: $a_1$, $a_2$, ..., $a_n$ ($1 \le a_i \le 100$) — elements of the sequence, which contains the equal number of even and odd numbers
Output Specification:
Print the maximum possible number of cuts which can be made while spending no more than $B$ bitcoins.
Demo Input:
['6 4\n1 2 5 10 15 20\n', '4 10\n1 3 2 4\n', '6 100\n1 2 3 4 5 6\n']
Demo Output:
['1\n', '0\n', '2\n']
Note:
In the first sample the optimal answer is to split sequence between $2$ and $5$. Price of this cut is equal to $3$ bitcoins.
In the second sample it is not possible to make even one cut even with unlimited number of bitcoins.
In the third sample the sequence should be cut between $2$ and $3$, and between $4$ and $5$. The total price of the cuts is $1 + 1 = 2$ bitcoins.
|
```python
def main():
n, b = map(int, input().split())
arr = list(map(int, input().split()))
even_counter, odd_counter = 0, 0
temp_list = []
for i in range(n - 1):
if arr[i] % 2 == 0:
even_counter += 1
else:
odd_counter += 1
if even_counter == odd_counter and even_counter != 0:
temp_list.append((i, abs(arr[i] - arr[i + 1])))
temp_list.sort(key=lambda x: x[1])
counter = 0
s = 0
for element in temp_list:
s += element[1]
if s > b:
break
else:
counter += 1
print(counter)
if __name__ == "__main__":
main()
```
| 3
|
|
50
|
A
|
Domino piling
|
PROGRAMMING
| 800
|
[
"greedy",
"math"
] |
A. Domino piling
|
2
|
256
|
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
|
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
|
Output one number — the maximal number of dominoes, which can be placed.
|
[
"2 4\n",
"3 3\n"
] |
[
"4\n",
"4\n"
] |
none
| 500
|
[
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "2 6",
"output": "6"
},
{
"input": "2 7",
"output": "7"
},
{
"input": "2 14",
"output": "14"
},
{
"input": "2 15",
"output": "15"
},
{
"input": "1 4",
"output": "2"
},
{
"input": "2 16",
"output": "16"
},
{
"input": "3 5",
"output": "7"
},
{
"input": "3 6",
"output": "9"
},
{
"input": "3 10",
"output": "15"
},
{
"input": "3 14",
"output": "21"
},
{
"input": "3 15",
"output": "22"
},
{
"input": "3 16",
"output": "24"
},
{
"input": "5 7",
"output": "17"
},
{
"input": "16 16",
"output": "128"
},
{
"input": "15 16",
"output": "120"
},
{
"input": "2 3",
"output": "3"
},
{
"input": "15 15",
"output": "112"
},
{
"input": "14 16",
"output": "112"
},
{
"input": "11 13",
"output": "71"
},
{
"input": "5 16",
"output": "40"
},
{
"input": "8 15",
"output": "60"
},
{
"input": "2 2",
"output": "2"
},
{
"input": "3 4",
"output": "6"
},
{
"input": "4 4",
"output": "8"
},
{
"input": "1 1",
"output": "0"
},
{
"input": "1 2",
"output": "1"
},
{
"input": "1 3",
"output": "1"
},
{
"input": "14 15",
"output": "105"
}
] | 1,674,231,902
| 2,147,483,647
|
Python 3
|
COMPILATION_ERROR
|
TESTS
| 0
| 0
| 0
|
M = int(input())
N = int(input())
if M=1 and N=1 :
print(0)
else :
print((M*N)//2)
|
Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers two squares.
2. No two dominoes overlap.
3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board.
Find the maximum number of dominoes, which can be placed under these restrictions.
Input Specification:
In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16).
Output Specification:
Output one number — the maximal number of dominoes, which can be placed.
Demo Input:
['2 4\n', '3 3\n']
Demo Output:
['4\n', '4\n']
Note:
none
|
```python
M = int(input())
N = int(input())
if M=1 and N=1 :
print(0)
else :
print((M*N)//2)
```
| -1
|
731
|
A
|
Night at the Museum
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] | null | null |
Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition.
Embosser is a special devise that allows to "print" the text of a plastic tape. Text is printed sequentially, character by character. The device consists of a wheel with a lowercase English letters written in a circle, static pointer to the current letter and a button that print the chosen letter. At one move it's allowed to rotate the alphabetic wheel one step clockwise or counterclockwise. Initially, static pointer points to letter 'a'. Other letters are located as shown on the picture:
After Grigoriy add new item to the base he has to print its name on the plastic tape and attach it to the corresponding exhibit. It's not required to return the wheel to its initial position with pointer on the letter 'a'.
Our hero is afraid that some exhibits may become alive and start to attack him, so he wants to print the names as fast as possible. Help him, for the given string find the minimum number of rotations of the wheel required to print it.
|
The only line of input contains the name of some exhibit — the non-empty string consisting of no more than 100 characters. It's guaranteed that the string consists of only lowercase English letters.
|
Print one integer — the minimum number of rotations of the wheel, required to print the name given in the input.
|
[
"zeus\n",
"map\n",
"ares\n"
] |
[
"18\n",
"35\n",
"34\n"
] |
To print the string from the first sample it would be optimal to perform the following sequence of rotations:
1. from 'a' to 'z' (1 rotation counterclockwise), 1. from 'z' to 'e' (5 clockwise rotations), 1. from 'e' to 'u' (10 rotations counterclockwise), 1. from 'u' to 's' (2 counterclockwise rotations).
| 500
|
[
{
"input": "zeus",
"output": "18"
},
{
"input": "map",
"output": "35"
},
{
"input": "ares",
"output": "34"
},
{
"input": "l",
"output": "11"
},
{
"input": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv",
"output": "99"
},
{
"input": "gngvi",
"output": "44"
},
{
"input": "aaaaa",
"output": "0"
},
{
"input": "a",
"output": "0"
},
{
"input": "z",
"output": "1"
},
{
"input": "vyadeehhikklnoqrs",
"output": "28"
},
{
"input": "jjiihhhhgggfedcccbazyxx",
"output": "21"
},
{
"input": "fyyptqqxuciqvwdewyppjdzur",
"output": "117"
},
{
"input": "fqcnzmzmbobmancqcoalzmanaobpdse",
"output": "368"
},
{
"input": "zzzzzaaaaaaazzzzzzaaaaaaazzzzzzaaaazzzza",
"output": "8"
},
{
"input": "aucnwhfixuruefkypvrvnvznwtjgwlghoqtisbkhuwxmgzuljvqhmnwzisnsgjhivnjmbknptxatdkelhzkhsuxzrmlcpeoyukiy",
"output": "644"
},
{
"input": "sssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss",
"output": "8"
},
{
"input": "nypjygrdtpzpigzyrisqeqfriwgwlengnezppgttgtndbrryjdl",
"output": "421"
},
{
"input": "pnllnnmmmmoqqqqqrrtssssuuvtsrpopqoonllmonnnpppopnonoopooqpnopppqppqstuuuwwwwvxzxzzaa",
"output": "84"
},
{
"input": "btaoahqgxnfsdmzsjxgvdwjukcvereqeskrdufqfqgzqfsftdqcthtkcnaipftcnco",
"output": "666"
},
{
"input": "eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeerrrrrrrrrrrrrrrrwwwwwwwwww",
"output": "22"
},
{
"input": "uyknzcrwjyzmscqucclvacmorepdgmnyhmakmmnygqwglrxkxhkpansbmruwxdeoprxzmpsvwackopujxbbkpwyeggsvjykpxh",
"output": "643"
},
{
"input": "gzwpooohffcxwtpjgfzwtooiccxsrrokezutoojdzwsrmmhecaxwrojcbyrqlfdwwrliiib",
"output": "245"
},
{
"input": "dbvnkktasjdwqsrzfwwtmjgbcxggdxsoeilecihduypktkkbwfbruxzzhlttrssicgdwqruddwrlbtxgmhdbatzvdxbbro",
"output": "468"
},
{
"input": "mdtvowlktxzzbuaeiuebfeorgbdczauxsovbucactkvyvemsknsjfhifqgycqredzchipmkvzbxdjkcbyukomjlzvxzoswumned",
"output": "523"
},
{
"input": "kkkkkkkaaaaxxaaaaaaaxxxxxxxxaaaaaaxaaaaaaaaaakkkkkkkkkaaaaaaannnnnxxxxkkkkkkkkaannnnnnna",
"output": "130"
},
{
"input": "dffiknqqrsvwzcdgjkmpqtuwxadfhkkkmpqrtwxyadfggjmpppsuuwyyzcdgghhknnpsvvvwwwyabccffiloqruwwyyzabeeehh",
"output": "163"
},
{
"input": "qpppmmkjihgecbyvvsppnnnkjiffeebaaywutrrqpmkjhgddbzzzywtssssqnmmljheddbbaxvusrqonmlifedbbzyywwtqnkheb",
"output": "155"
},
{
"input": "wvvwwwvvwxxxyyyxxwwvwwvuttttttuvvwxxwxxyxxwwwwwvvuttssrssstsssssrqpqqppqrssrsrrssrssssrrsrqqrrqpppqp",
"output": "57"
},
{
"input": "dqcpcobpcobnznamznamzlykxkxlxlylzmaobnaobpbnanbpcoaobnboaoboanzlymzmykylymylzlylymanboanaocqdqesfrfs",
"output": "1236"
},
{
"input": "nnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaaaaaaaaaakkkkkkkkkkkkkkkkkkkkkkaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxx",
"output": "49"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "0"
},
{
"input": "cgilqsuwzaffilptwwbgmnttyyejkorxzflqvzbddhmnrvxchijpuwaeiimosxyycejlpquuwbfkpvbgijkqvxybdjjjptxcfkqt",
"output": "331"
},
{
"input": "ufsepwgtzgtgjssxaitgpailuvgqweoppszjwhoxdhhhpwwdorwfrdjwcdekxiktwziqwbkvbknrtvajpyeqbjvhiikxxaejjpte",
"output": "692"
},
{
"input": "uhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuh",
"output": "1293"
},
{
"input": "vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvgggggggggggggggggggggggggggggggggggggggggggggggggg",
"output": "16"
},
{
"input": "lyidmjyzbszgiwkxhhpnnthfwcvvstueionspfrvqgkvngmwyhezlosrpdnbvtcjjxxsykixwnepbumaacdzadlqhnjlcejovple",
"output": "616"
},
{
"input": "etzqqbaveffalkdguunfmyyrzkccnxmlluxeasqmopxzfvlkbhipqdwjgrttoemruohgwukfisdhznqyvhswbbypoxgtxyappcrl",
"output": "605"
},
{
"input": "lizussgedcbdjhrbeskhgatyozvwwekanlggcstijrniivupmcoofbaxfqrxddyzzptwxcftlhajsmmkkriarrqtkoauhcqefyud",
"output": "549"
},
{
"input": "dvjuvgfdogpknmbowlsfjzcimnygbtjiucyeeroqwhmzwpjqxlbjkqawrdtmvxbiqufllfuqibxvmtdrwaqkjblxqjpwzmhwqore",
"output": "688"
},
{
"input": "eeycuijtbgynmiczjfslwobmnkpgodfgvujvduyfeqchuaoktqrrairkkmmsjahltfcxwtpzzyddxrqfxabfoocmpuviinrjitsc",
"output": "604"
},
{
"input": "cgglnakewwvzoytaghksebrhjdbcdegssuzilrcppayxtgxopybbwshvyqnzhdsifkuwghourmeottrgjwdqpihbklvfzxpomqsa",
"output": "572"
},
{
"input": "aexullmxncckzryymfnuugdklaffevabqqztelpvojecljnhqldazdcaamubpenwxikysxxjjctvbndprsolzehywmgnvkgqvrfp",
"output": "609"
},
{
"input": "psnoieutsvvcwfhtnnphhxkwigzsbzyjmdiyl",
"output": "223"
},
{
"input": "aa",
"output": "0"
}
] | 1,649,584,625
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 46
| 0
|
states = input()
from_A = {
'a' : 0,
'b' : 1,
'z' : 1,
'y' : 2,
'c' : 2,
'd' : 3,
'x' : 3,
'e' : 4,
'w' : 4,
'f' : 5,
'v' : 5,
'g' : 6,
'u' : 6,
'h' : 7,
't' : 7,
's' : 8,
'i' : 8,
'r' : 9,
'j' : 9,
'q' : 10,
'k' : 10,
'p' : 11,
'l' : 11,
'o' : 12,
'm' : 12,
'n' : 13
}
initial_state = 'a'
num_roatations = 0
fst_half = 'abcdefghijklm'
scnd_half = 'nopqrstuvwxyz'
num_roatations += from_A[states[0]]
current_state = states[0]
for state in states:
if state == states[0]:
continue
else:
if (state in fst_half and current_state in scnd_half) or (state in scnd_half and current_state in fst_half):
num_roatations += (from_A[state] + from_A[current_state])
#print('state1 : ', from_A[state])
else:
num_roatations += abs(from_A[state] - from_A[current_state])
#print('state2 : ', from_A[state])
#print(state, current_state)
current_state = state
print(num_roatations)
# for state in states:
# num_roatations += (from_A[state] + from_A[initial_state])
# initial_state = state
# print(num_roatations)
|
Title: Night at the Museum
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition.
Embosser is a special devise that allows to "print" the text of a plastic tape. Text is printed sequentially, character by character. The device consists of a wheel with a lowercase English letters written in a circle, static pointer to the current letter and a button that print the chosen letter. At one move it's allowed to rotate the alphabetic wheel one step clockwise or counterclockwise. Initially, static pointer points to letter 'a'. Other letters are located as shown on the picture:
After Grigoriy add new item to the base he has to print its name on the plastic tape and attach it to the corresponding exhibit. It's not required to return the wheel to its initial position with pointer on the letter 'a'.
Our hero is afraid that some exhibits may become alive and start to attack him, so he wants to print the names as fast as possible. Help him, for the given string find the minimum number of rotations of the wheel required to print it.
Input Specification:
The only line of input contains the name of some exhibit — the non-empty string consisting of no more than 100 characters. It's guaranteed that the string consists of only lowercase English letters.
Output Specification:
Print one integer — the minimum number of rotations of the wheel, required to print the name given in the input.
Demo Input:
['zeus\n', 'map\n', 'ares\n']
Demo Output:
['18\n', '35\n', '34\n']
Note:
To print the string from the first sample it would be optimal to perform the following sequence of rotations:
1. from 'a' to 'z' (1 rotation counterclockwise), 1. from 'z' to 'e' (5 clockwise rotations), 1. from 'e' to 'u' (10 rotations counterclockwise), 1. from 'u' to 's' (2 counterclockwise rotations).
|
```python
states = input()
from_A = {
'a' : 0,
'b' : 1,
'z' : 1,
'y' : 2,
'c' : 2,
'd' : 3,
'x' : 3,
'e' : 4,
'w' : 4,
'f' : 5,
'v' : 5,
'g' : 6,
'u' : 6,
'h' : 7,
't' : 7,
's' : 8,
'i' : 8,
'r' : 9,
'j' : 9,
'q' : 10,
'k' : 10,
'p' : 11,
'l' : 11,
'o' : 12,
'm' : 12,
'n' : 13
}
initial_state = 'a'
num_roatations = 0
fst_half = 'abcdefghijklm'
scnd_half = 'nopqrstuvwxyz'
num_roatations += from_A[states[0]]
current_state = states[0]
for state in states:
if state == states[0]:
continue
else:
if (state in fst_half and current_state in scnd_half) or (state in scnd_half and current_state in fst_half):
num_roatations += (from_A[state] + from_A[current_state])
#print('state1 : ', from_A[state])
else:
num_roatations += abs(from_A[state] - from_A[current_state])
#print('state2 : ', from_A[state])
#print(state, current_state)
current_state = state
print(num_roatations)
# for state in states:
# num_roatations += (from_A[state] + from_A[initial_state])
# initial_state = state
# print(num_roatations)
```
| 0
|
|
82
|
A
|
Double Cola
|
PROGRAMMING
| 1,100
|
[
"implementation",
"math"
] |
A. Double Cola
|
1
|
256
|
Sheldon, Leonard, Penny, Rajesh and Howard are in the queue for a "Double Cola" drink vending machine; there are no other people in the queue. The first one in the queue (Sheldon) buys a can, drinks it and doubles! The resulting two Sheldons go to the end of the queue. Then the next in the queue (Leonard) buys a can, drinks it and gets to the end of the queue as two Leonards, and so on. This process continues ad infinitum.
For example, Penny drinks the third can of cola and the queue will look like this: Rajesh, Howard, Sheldon, Sheldon, Leonard, Leonard, Penny, Penny.
Write a program that will print the name of a man who will drink the *n*-th can.
Note that in the very beginning the queue looks like that: Sheldon, Leonard, Penny, Rajesh, Howard. The first person is Sheldon.
|
The input data consist of a single integer *n* (1<=≤<=*n*<=≤<=109).
It is guaranteed that the pretests check the spelling of all the five names, that is, that they contain all the five possible answers.
|
Print the single line — the name of the person who drinks the *n*-th can of cola. The cans are numbered starting from 1. Please note that you should spell the names like this: "Sheldon", "Leonard", "Penny", "Rajesh", "Howard" (without the quotes). In that order precisely the friends are in the queue initially.
|
[
"1\n",
"6\n",
"1802\n"
] |
[
"Sheldon\n",
"Sheldon\n",
"Penny\n"
] |
none
| 500
|
[
{
"input": "1",
"output": "Sheldon"
},
{
"input": "6",
"output": "Sheldon"
},
{
"input": "1802",
"output": "Penny"
},
{
"input": "1",
"output": "Sheldon"
},
{
"input": "2",
"output": "Leonard"
},
{
"input": "3",
"output": "Penny"
},
{
"input": "4",
"output": "Rajesh"
},
{
"input": "5",
"output": "Howard"
},
{
"input": "10",
"output": "Penny"
},
{
"input": "534",
"output": "Rajesh"
},
{
"input": "5033",
"output": "Howard"
},
{
"input": "10010",
"output": "Howard"
},
{
"input": "500000000",
"output": "Penny"
},
{
"input": "63",
"output": "Rajesh"
},
{
"input": "841",
"output": "Leonard"
},
{
"input": "3667",
"output": "Penny"
},
{
"input": "38614",
"output": "Howard"
},
{
"input": "282798",
"output": "Rajesh"
},
{
"input": "9266286",
"output": "Rajesh"
},
{
"input": "27385966",
"output": "Leonard"
},
{
"input": "121580142",
"output": "Penny"
},
{
"input": "5",
"output": "Howard"
},
{
"input": "300",
"output": "Howard"
},
{
"input": "1745",
"output": "Leonard"
},
{
"input": "8302",
"output": "Rajesh"
},
{
"input": "184518",
"output": "Sheldon"
},
{
"input": "1154414",
"output": "Rajesh"
},
{
"input": "28643950",
"output": "Leonard"
},
{
"input": "159222638",
"output": "Howard"
},
{
"input": "24",
"output": "Penny"
},
{
"input": "505",
"output": "Penny"
},
{
"input": "4425",
"output": "Rajesh"
},
{
"input": "12079",
"output": "Sheldon"
},
{
"input": "469726",
"output": "Penny"
},
{
"input": "3961838",
"output": "Penny"
},
{
"input": "57710446",
"output": "Leonard"
},
{
"input": "80719470",
"output": "Howard"
},
{
"input": "1000000000",
"output": "Penny"
},
{
"input": "999999999",
"output": "Penny"
},
{
"input": "999999998",
"output": "Penny"
},
{
"input": "5",
"output": "Howard"
}
] | 1,607,868,426
| 2,147,483,647
|
PyPy 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 0
| 1,000
| 2,150,400
|
n = int(input())
names = ['']*5
names[0] = 'Sheldon'
names[1] = 'Leonard'
names[2] = 'Penny'
names[3] = 'Rajesh'
names[4] = 'Howard'
while len(names) != n:
name = names.pop(0)
names.append(name)
names.append(name)
print(names[n-1])
|
Title: Double Cola
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Sheldon, Leonard, Penny, Rajesh and Howard are in the queue for a "Double Cola" drink vending machine; there are no other people in the queue. The first one in the queue (Sheldon) buys a can, drinks it and doubles! The resulting two Sheldons go to the end of the queue. Then the next in the queue (Leonard) buys a can, drinks it and gets to the end of the queue as two Leonards, and so on. This process continues ad infinitum.
For example, Penny drinks the third can of cola and the queue will look like this: Rajesh, Howard, Sheldon, Sheldon, Leonard, Leonard, Penny, Penny.
Write a program that will print the name of a man who will drink the *n*-th can.
Note that in the very beginning the queue looks like that: Sheldon, Leonard, Penny, Rajesh, Howard. The first person is Sheldon.
Input Specification:
The input data consist of a single integer *n* (1<=≤<=*n*<=≤<=109).
It is guaranteed that the pretests check the spelling of all the five names, that is, that they contain all the five possible answers.
Output Specification:
Print the single line — the name of the person who drinks the *n*-th can of cola. The cans are numbered starting from 1. Please note that you should spell the names like this: "Sheldon", "Leonard", "Penny", "Rajesh", "Howard" (without the quotes). In that order precisely the friends are in the queue initially.
Demo Input:
['1\n', '6\n', '1802\n']
Demo Output:
['Sheldon\n', 'Sheldon\n', 'Penny\n']
Note:
none
|
```python
n = int(input())
names = ['']*5
names[0] = 'Sheldon'
names[1] = 'Leonard'
names[2] = 'Penny'
names[3] = 'Rajesh'
names[4] = 'Howard'
while len(names) != n:
name = names.pop(0)
names.append(name)
names.append(name)
print(names[n-1])
```
| 0
|
312
|
B
|
Archer
|
PROGRAMMING
| 1,300
|
[
"math",
"probabilities"
] | null | null |
SmallR is an archer. SmallR is taking a match of archer with Zanoes. They try to shoot in the target in turns, and SmallR shoots first. The probability of shooting the target each time is for SmallR while for Zanoes. The one who shoots in the target first should be the winner.
Output the probability that SmallR will win the match.
|
A single line contains four integers .
|
Print a single real number, the probability that SmallR will win the match.
The answer will be considered correct if the absolute or relative error doesn't exceed 10<=-<=6.
|
[
"1 2 1 2\n"
] |
[
"0.666666666667"
] |
none
| 1,000
|
[
{
"input": "1 2 1 2",
"output": "0.666666666667"
},
{
"input": "1 3 1 3",
"output": "0.600000000000"
},
{
"input": "1 3 2 3",
"output": "0.428571428571"
},
{
"input": "3 4 3 4",
"output": "0.800000000000"
},
{
"input": "1 2 10 11",
"output": "0.523809523810"
},
{
"input": "4 5 4 5",
"output": "0.833333333333"
},
{
"input": "466 701 95 721",
"output": "0.937693791148"
},
{
"input": "268 470 444 885",
"output": "0.725614009325"
},
{
"input": "632 916 713 821",
"output": "0.719292895126"
},
{
"input": "269 656 918 992",
"output": "0.428937461623"
},
{
"input": "71 657 187 695",
"output": "0.310488463257"
},
{
"input": "435 852 973 978",
"output": "0.511844133157"
},
{
"input": "518 816 243 359",
"output": "0.719734031025"
},
{
"input": "882 962 311 811",
"output": "0.966386645447"
},
{
"input": "684 774 580 736",
"output": "0.906051574446"
},
{
"input": "486 868 929 999",
"output": "0.577723252958"
},
{
"input": "132 359 996 998",
"output": "0.368154532345"
},
{
"input": "933 977 266 450",
"output": "0.972879407907"
},
{
"input": "298 833 615 872",
"output": "0.441270817024"
},
{
"input": "34 554 14 958",
"output": "0.817324099167"
},
{
"input": "836 934 800 905",
"output": "0.906105535462"
},
{
"input": "482 815 69 509",
"output": "0.914365577772"
},
{
"input": "284 423 137 521",
"output": "0.885974839378"
},
{
"input": "648 881 486 703",
"output": "0.800911421248"
},
{
"input": "450 885 755 836",
"output": "0.533901011176"
},
{
"input": "533 773 823 998",
"output": "0.729222130525"
},
{
"input": "897 957 92 898",
"output": "0.993193806364"
},
{
"input": "699 925 441 928",
"output": "0.866816866175"
},
{
"input": "64 704 148 603",
"output": "0.289486317811"
},
{
"input": "719 735 626 990",
"output": "0.986124079764"
},
{
"input": "1 1000 1 1000",
"output": "0.500250125063"
}
] | 1,695,682,118
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 31
| 62
| 1,433,600
|
a, b, c, d = map(int, input().split())
ans = 0
for k in range(10000):
ans += a/b * (((1 - a/b) * (1 - c/d)) ** k)
print(ans)
#нам нужно до определенной точности
|
Title: Archer
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
SmallR is an archer. SmallR is taking a match of archer with Zanoes. They try to shoot in the target in turns, and SmallR shoots first. The probability of shooting the target each time is for SmallR while for Zanoes. The one who shoots in the target first should be the winner.
Output the probability that SmallR will win the match.
Input Specification:
A single line contains four integers .
Output Specification:
Print a single real number, the probability that SmallR will win the match.
The answer will be considered correct if the absolute or relative error doesn't exceed 10<=-<=6.
Demo Input:
['1 2 1 2\n']
Demo Output:
['0.666666666667']
Note:
none
|
```python
a, b, c, d = map(int, input().split())
ans = 0
for k in range(10000):
ans += a/b * (((1 - a/b) * (1 - c/d)) ** k)
print(ans)
#нам нужно до определенной точности
```
| 3
|
|
459
|
B
|
Pashmak and Flowers
|
PROGRAMMING
| 1,300
|
[
"combinatorics",
"implementation",
"sortings"
] | null | null |
Pashmak decided to give Parmida a pair of flowers from the garden. There are *n* flowers in the garden and the *i*-th of them has a beauty number *b**i*. Parmida is a very strange girl so she doesn't want to have the two most beautiful flowers necessarily. She wants to have those pairs of flowers that their beauty difference is maximal possible!
Your task is to write a program which calculates two things:
1. The maximum beauty difference of flowers that Pashmak can give to Parmida. 1. The number of ways that Pashmak can pick the flowers. Two ways are considered different if and only if there is at least one flower that is chosen in the first way and not chosen in the second way.
|
The first line of the input contains *n* (2<=≤<=*n*<=≤<=2·105). In the next line there are *n* space-separated integers *b*1, *b*2, ..., *b**n* (1<=≤<=*b**i*<=≤<=109).
|
The only line of output should contain two integers. The maximum beauty difference and the number of ways this may happen, respectively.
|
[
"2\n1 2\n",
"3\n1 4 5\n",
"5\n3 1 2 3 1\n"
] |
[
"1 1",
"4 1",
"2 4"
] |
In the third sample the maximum beauty difference is 2 and there are 4 ways to do this:
1. choosing the first and the second flowers; 1. choosing the first and the fifth flowers; 1. choosing the fourth and the second flowers; 1. choosing the fourth and the fifth flowers.
| 500
|
[
{
"input": "2\n1 2",
"output": "1 1"
},
{
"input": "3\n1 4 5",
"output": "4 1"
},
{
"input": "5\n3 1 2 3 1",
"output": "2 4"
},
{
"input": "2\n1 1",
"output": "0 1"
},
{
"input": "3\n1 1 1",
"output": "0 3"
},
{
"input": "4\n1 1 1 1",
"output": "0 6"
},
{
"input": "5\n1 1 1 1 1",
"output": "0 10"
},
{
"input": "5\n2 2 2 2 2",
"output": "0 10"
},
{
"input": "10\n2 2 2 2 2 2 2 2 2 2",
"output": "0 45"
},
{
"input": "3\n2 2 2",
"output": "0 3"
},
{
"input": "3\n3 3 3",
"output": "0 3"
},
{
"input": "2\n10000000 100000000",
"output": "90000000 1"
},
{
"input": "5\n5 5 5 5 5",
"output": "0 10"
},
{
"input": "5\n3 3 3 3 3",
"output": "0 10"
},
{
"input": "6\n1 1 1 1 1 1",
"output": "0 15"
},
{
"input": "2\n5 6",
"output": "1 1"
},
{
"input": "10\n1 1 1 1 1 1 1 1 1 1",
"output": "0 45"
},
{
"input": "10\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000 1000000000",
"output": "0 45"
},
{
"input": "4\n4 4 4 4",
"output": "0 6"
},
{
"input": "7\n1 1 1 1 1 1 1",
"output": "0 21"
},
{
"input": "11\n1 1 1 1 1 1 1 1 1 1 1",
"output": "0 55"
},
{
"input": "8\n8 8 8 8 8 8 8 8",
"output": "0 28"
},
{
"input": "2\n3 2",
"output": "1 1"
}
] | 1,673,761,357
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 30
| 0
|
def C(n,k):
if k>n:
return 0
if k==0:
return 1
return C(n-1,k-1)+C(n-1,k)
input()
b=list(map(int,input().split()))
b.sort()
diff=b[-1]-b[0]
M=b.count(b[0])
m=b.count(b[-1])
if M>m:
ways=M*m
else:
ways=C(2,m)
print(
diff,
ways
)
|
Title: Pashmak and Flowers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak decided to give Parmida a pair of flowers from the garden. There are *n* flowers in the garden and the *i*-th of them has a beauty number *b**i*. Parmida is a very strange girl so she doesn't want to have the two most beautiful flowers necessarily. She wants to have those pairs of flowers that their beauty difference is maximal possible!
Your task is to write a program which calculates two things:
1. The maximum beauty difference of flowers that Pashmak can give to Parmida. 1. The number of ways that Pashmak can pick the flowers. Two ways are considered different if and only if there is at least one flower that is chosen in the first way and not chosen in the second way.
Input Specification:
The first line of the input contains *n* (2<=≤<=*n*<=≤<=2·105). In the next line there are *n* space-separated integers *b*1, *b*2, ..., *b**n* (1<=≤<=*b**i*<=≤<=109).
Output Specification:
The only line of output should contain two integers. The maximum beauty difference and the number of ways this may happen, respectively.
Demo Input:
['2\n1 2\n', '3\n1 4 5\n', '5\n3 1 2 3 1\n']
Demo Output:
['1 1', '4 1', '2 4']
Note:
In the third sample the maximum beauty difference is 2 and there are 4 ways to do this:
1. choosing the first and the second flowers; 1. choosing the first and the fifth flowers; 1. choosing the fourth and the second flowers; 1. choosing the fourth and the fifth flowers.
|
```python
def C(n,k):
if k>n:
return 0
if k==0:
return 1
return C(n-1,k-1)+C(n-1,k)
input()
b=list(map(int,input().split()))
b.sort()
diff=b[-1]-b[0]
M=b.count(b[0])
m=b.count(b[-1])
if M>m:
ways=M*m
else:
ways=C(2,m)
print(
diff,
ways
)
```
| 0
|
|
591
|
A
|
Wizards' Duel
|
PROGRAMMING
| 900
|
[
"implementation",
"math"
] | null | null |
Harry Potter and He-Who-Must-Not-Be-Named engaged in a fight to the death once again. This time they are located at opposite ends of the corridor of length *l*. Two opponents simultaneously charge a deadly spell in the enemy. We know that the impulse of Harry's magic spell flies at a speed of *p* meters per second, and the impulse of You-Know-Who's magic spell flies at a speed of *q* meters per second.
The impulses are moving through the corridor toward each other, and at the time of the collision they turn round and fly back to those who cast them without changing their original speeds. Then, as soon as the impulse gets back to it's caster, the wizard reflects it and sends again towards the enemy, without changing the original speed of the impulse.
Since Harry has perfectly mastered the basics of magic, he knows that after the second collision both impulses will disappear, and a powerful explosion will occur exactly in the place of their collision. However, the young wizard isn't good at math, so he asks you to calculate the distance from his position to the place of the second meeting of the spell impulses, provided that the opponents do not change positions during the whole fight.
|
The first line of the input contains a single integer *l* (1<=≤<=*l*<=≤<=1<=000) — the length of the corridor where the fight takes place.
The second line contains integer *p*, the third line contains integer *q* (1<=≤<=*p*,<=*q*<=≤<=500) — the speeds of magical impulses for Harry Potter and He-Who-Must-Not-Be-Named, respectively.
|
Print a single real number — the distance from the end of the corridor, where Harry is located, to the place of the second meeting of the spell impulses. Your answer will be considered correct if its absolute or relative error will not exceed 10<=-<=4.
Namely: let's assume that your answer equals *a*, and the answer of the jury is *b*. The checker program will consider your answer correct if .
|
[
"100\n50\n50\n",
"199\n60\n40\n"
] |
[
"50\n",
"119.4\n"
] |
In the first sample the speeds of the impulses are equal, so both of their meetings occur exactly in the middle of the corridor.
| 500
|
[
{
"input": "100\n50\n50",
"output": "50"
},
{
"input": "199\n60\n40",
"output": "119.4"
},
{
"input": "1\n1\n1",
"output": "0.5"
},
{
"input": "1\n1\n500",
"output": "0.001996007984"
},
{
"input": "1\n500\n1",
"output": "0.998003992"
},
{
"input": "1\n500\n500",
"output": "0.5"
},
{
"input": "1000\n1\n1",
"output": "500"
},
{
"input": "1000\n1\n500",
"output": "1.996007984"
},
{
"input": "1000\n500\n1",
"output": "998.003992"
},
{
"input": "1000\n500\n500",
"output": "500"
},
{
"input": "101\n11\n22",
"output": "33.66666667"
},
{
"input": "987\n1\n3",
"output": "246.75"
},
{
"input": "258\n25\n431",
"output": "14.14473684"
},
{
"input": "979\n39\n60",
"output": "385.6666667"
},
{
"input": "538\n479\n416",
"output": "287.9351955"
},
{
"input": "583\n112\n248",
"output": "181.3777778"
},
{
"input": "978\n467\n371",
"output": "545.0190931"
},
{
"input": "980\n322\n193",
"output": "612.7378641"
},
{
"input": "871\n401\n17",
"output": "835.576555"
},
{
"input": "349\n478\n378",
"output": "194.885514"
},
{
"input": "425\n458\n118",
"output": "337.9340278"
},
{
"input": "919\n323\n458",
"output": "380.0729834"
},
{
"input": "188\n59\n126",
"output": "59.95675676"
},
{
"input": "644\n428\n484",
"output": "302.2280702"
},
{
"input": "253\n80\n276",
"output": "56.85393258"
},
{
"input": "745\n152\n417",
"output": "199.0158172"
},
{
"input": "600\n221\n279",
"output": "265.2"
},
{
"input": "690\n499\n430",
"output": "370.6243272"
},
{
"input": "105\n68\n403",
"output": "15.15923567"
},
{
"input": "762\n462\n371",
"output": "422.6218487"
},
{
"input": "903\n460\n362",
"output": "505.3284672"
},
{
"input": "886\n235\n95",
"output": "630.9393939"
},
{
"input": "655\n203\n18",
"output": "601.6515837"
},
{
"input": "718\n29\n375",
"output": "51.53960396"
},
{
"input": "296\n467\n377",
"output": "163.7819905"
},
{
"input": "539\n61\n56",
"output": "281.017094"
},
{
"input": "133\n53\n124",
"output": "39.82485876"
},
{
"input": "998\n224\n65",
"output": "773.5363322"
},
{
"input": "961\n173\n47",
"output": "755.6954545"
},
{
"input": "285\n468\n62",
"output": "251.6603774"
},
{
"input": "496\n326\n429",
"output": "214.1668874"
},
{
"input": "627\n150\n285",
"output": "216.2068966"
},
{
"input": "961\n443\n50",
"output": "863.535497"
},
{
"input": "623\n422\n217",
"output": "411.4334898"
},
{
"input": "678\n295\n29",
"output": "617.3148148"
}
] | 1,478,088,236
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 45
| 109
| 0
|
l=int(input())
p=int(input())
q=int(input())
x=1.0*(p*l)/(p+q)
print(x)
|
Title: Wizards' Duel
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Harry Potter and He-Who-Must-Not-Be-Named engaged in a fight to the death once again. This time they are located at opposite ends of the corridor of length *l*. Two opponents simultaneously charge a deadly spell in the enemy. We know that the impulse of Harry's magic spell flies at a speed of *p* meters per second, and the impulse of You-Know-Who's magic spell flies at a speed of *q* meters per second.
The impulses are moving through the corridor toward each other, and at the time of the collision they turn round and fly back to those who cast them without changing their original speeds. Then, as soon as the impulse gets back to it's caster, the wizard reflects it and sends again towards the enemy, without changing the original speed of the impulse.
Since Harry has perfectly mastered the basics of magic, he knows that after the second collision both impulses will disappear, and a powerful explosion will occur exactly in the place of their collision. However, the young wizard isn't good at math, so he asks you to calculate the distance from his position to the place of the second meeting of the spell impulses, provided that the opponents do not change positions during the whole fight.
Input Specification:
The first line of the input contains a single integer *l* (1<=≤<=*l*<=≤<=1<=000) — the length of the corridor where the fight takes place.
The second line contains integer *p*, the third line contains integer *q* (1<=≤<=*p*,<=*q*<=≤<=500) — the speeds of magical impulses for Harry Potter and He-Who-Must-Not-Be-Named, respectively.
Output Specification:
Print a single real number — the distance from the end of the corridor, where Harry is located, to the place of the second meeting of the spell impulses. Your answer will be considered correct if its absolute or relative error will not exceed 10<=-<=4.
Namely: let's assume that your answer equals *a*, and the answer of the jury is *b*. The checker program will consider your answer correct if .
Demo Input:
['100\n50\n50\n', '199\n60\n40\n']
Demo Output:
['50\n', '119.4\n']
Note:
In the first sample the speeds of the impulses are equal, so both of their meetings occur exactly in the middle of the corridor.
|
```python
l=int(input())
p=int(input())
q=int(input())
x=1.0*(p*l)/(p+q)
print(x)
```
| 3
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
The Little Elephant loves playing with arrays. He has array *a*, consisting of *n* positive integers, indexed from 1 to *n*. Let's denote the number with index *i* as *a**i*.
Additionally the Little Elephant has *m* queries to the array, each query is characterised by a pair of integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*). For each query *l**j*,<=*r**j* the Little Elephant has to count, how many numbers *x* exist, such that number *x* occurs exactly *x* times among numbers *a**l**j*,<=*a**l**j*<=+<=1,<=...,<=*a**r**j*.
Help the Little Elephant to count the answers to all queries.
|
The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=105) — the size of array *a* and the number of queries to it. The next line contains *n* space-separated positive integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109). Next *m* lines contain descriptions of queries, one per line. The *j*-th of these lines contains the description of the *j*-th query as two space-separated integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*).
|
In *m* lines print *m* integers — the answers to the queries. The *j*-th line should contain the answer to the *j*-th query.
|
[
"7 2\n3 1 2 2 3 3 7\n1 7\n3 4\n"
] |
[
"3\n1\n"
] |
none
| 0
|
[
{
"input": "7 2\n3 1 2 2 3 3 7\n1 7\n3 4",
"output": "3\n1"
},
{
"input": "6 6\n1 2 2 3 3 3\n1 2\n2 2\n1 3\n2 4\n4 6\n1 6",
"output": "1\n0\n2\n1\n1\n3"
},
{
"input": "1 2\n1\n1 1\n1 1",
"output": "1\n1"
},
{
"input": "1 1\n1000000000\n1 1",
"output": "0"
}
] | 1,682,792,506
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 46
| 0
|
def calculo(x,y,z):
arr=x[y-1:z]
vis=[]
cont=0
for i in arr:
if i not in vis:
cont+=ocur(arr,i)
vis.append(i)
return cont
def ocur(arr,u):
c=int(u)
for i in arr:
if int(i) ==int(u):
c-=1
if c==0:
return 1
return 0
if __name__ == '__main__':
t=list(input().replace(' ',''))
t[0]=int(t[0])
t[1] = int(t[1])
a=list(input().replace(' ',''))
s=[]
while(t[1]>0):
con=list(input().replace(' ',''))
s.append(calculo(a,int(con[0]),int(con[1])))
t[1]-=1
for i in s:
print(i)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant loves playing with arrays. He has array *a*, consisting of *n* positive integers, indexed from 1 to *n*. Let's denote the number with index *i* as *a**i*.
Additionally the Little Elephant has *m* queries to the array, each query is characterised by a pair of integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*). For each query *l**j*,<=*r**j* the Little Elephant has to count, how many numbers *x* exist, such that number *x* occurs exactly *x* times among numbers *a**l**j*,<=*a**l**j*<=+<=1,<=...,<=*a**r**j*.
Help the Little Elephant to count the answers to all queries.
Input Specification:
The first line contains two space-separated integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=105) — the size of array *a* and the number of queries to it. The next line contains *n* space-separated positive integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109). Next *m* lines contain descriptions of queries, one per line. The *j*-th of these lines contains the description of the *j*-th query as two space-separated integers *l**j* and *r**j* (1<=≤<=*l**j*<=≤<=*r**j*<=≤<=*n*).
Output Specification:
In *m* lines print *m* integers — the answers to the queries. The *j*-th line should contain the answer to the *j*-th query.
Demo Input:
['7 2\n3 1 2 2 3 3 7\n1 7\n3 4\n']
Demo Output:
['3\n1\n']
Note:
none
|
```python
def calculo(x,y,z):
arr=x[y-1:z]
vis=[]
cont=0
for i in arr:
if i not in vis:
cont+=ocur(arr,i)
vis.append(i)
return cont
def ocur(arr,u):
c=int(u)
for i in arr:
if int(i) ==int(u):
c-=1
if c==0:
return 1
return 0
if __name__ == '__main__':
t=list(input().replace(' ',''))
t[0]=int(t[0])
t[1] = int(t[1])
a=list(input().replace(' ',''))
s=[]
while(t[1]>0):
con=list(input().replace(' ',''))
s.append(calculo(a,int(con[0]),int(con[1])))
t[1]-=1
for i in s:
print(i)
```
| 0
|
|
1,006
|
C
|
Three Parts of the Array
|
PROGRAMMING
| 1,200
|
[
"binary search",
"data structures",
"two pointers"
] | null | null |
You are given an array $d_1, d_2, \dots, d_n$ consisting of $n$ integer numbers.
Your task is to split this array into three parts (some of which may be empty) in such a way that each element of the array belongs to exactly one of the three parts, and each of the parts forms a consecutive contiguous subsegment (possibly, empty) of the original array.
Let the sum of elements of the first part be $sum_1$, the sum of elements of the second part be $sum_2$ and the sum of elements of the third part be $sum_3$. Among all possible ways to split the array you have to choose a way such that $sum_1 = sum_3$ and $sum_1$ is maximum possible.
More formally, if the first part of the array contains $a$ elements, the second part of the array contains $b$ elements and the third part contains $c$ elements, then:
$$sum_1 = \sum\limits_{1 \le i \le a}d_i,$$ $$sum_2 = \sum\limits_{a + 1 \le i \le a + b}d_i,$$ $$sum_3 = \sum\limits_{a + b + 1 \le i \le a + b + c}d_i.$$
The sum of an empty array is $0$.
Your task is to find a way to split the array such that $sum_1 = sum_3$ and $sum_1$ is maximum possible.
|
The first line of the input contains one integer $n$ ($1 \le n \le 2 \cdot 10^5$) — the number of elements in the array $d$.
The second line of the input contains $n$ integers $d_1, d_2, \dots, d_n$ ($1 \le d_i \le 10^9$) — the elements of the array $d$.
|
Print a single integer — the maximum possible value of $sum_1$, considering that the condition $sum_1 = sum_3$ must be met.
Obviously, at least one valid way to split the array exists (use $a=c=0$ and $b=n$).
|
[
"5\n1 3 1 1 4\n",
"5\n1 3 2 1 4\n",
"3\n4 1 2\n"
] |
[
"5\n",
"4\n",
"0\n"
] |
In the first example there is only one possible splitting which maximizes $sum_1$: $[1, 3, 1], [~], [1, 4]$.
In the second example the only way to have $sum_1=4$ is: $[1, 3], [2, 1], [4]$.
In the third example there is only one way to split the array: $[~], [4, 1, 2], [~]$.
| 0
|
[
{
"input": "5\n1 3 1 1 4",
"output": "5"
},
{
"input": "5\n1 3 2 1 4",
"output": "4"
},
{
"input": "3\n4 1 2",
"output": "0"
},
{
"input": "1\n1000000000",
"output": "0"
},
{
"input": "2\n1 1",
"output": "1"
},
{
"input": "5\n1 3 5 4 5",
"output": "9"
}
] | 1,624,628,907
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 27
| 296
| 19,251,200
|
n=int(input())
a=list(map(int,input().strip().split(" ")))
i=0
j=n-1
si=a[i]
sj=a[n-1]
ans=0
while(i<j):
if(si==sj):
ans=max(ans,si)
i+=1
j-=1
si+=a[i]
sj+=a[j]
elif(si>sj):
j-=1
sj+=a[j]
elif(si<sj):
i+=1
si+=a[i]
print(ans)
|
Title: Three Parts of the Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given an array $d_1, d_2, \dots, d_n$ consisting of $n$ integer numbers.
Your task is to split this array into three parts (some of which may be empty) in such a way that each element of the array belongs to exactly one of the three parts, and each of the parts forms a consecutive contiguous subsegment (possibly, empty) of the original array.
Let the sum of elements of the first part be $sum_1$, the sum of elements of the second part be $sum_2$ and the sum of elements of the third part be $sum_3$. Among all possible ways to split the array you have to choose a way such that $sum_1 = sum_3$ and $sum_1$ is maximum possible.
More formally, if the first part of the array contains $a$ elements, the second part of the array contains $b$ elements and the third part contains $c$ elements, then:
$$sum_1 = \sum\limits_{1 \le i \le a}d_i,$$ $$sum_2 = \sum\limits_{a + 1 \le i \le a + b}d_i,$$ $$sum_3 = \sum\limits_{a + b + 1 \le i \le a + b + c}d_i.$$
The sum of an empty array is $0$.
Your task is to find a way to split the array such that $sum_1 = sum_3$ and $sum_1$ is maximum possible.
Input Specification:
The first line of the input contains one integer $n$ ($1 \le n \le 2 \cdot 10^5$) — the number of elements in the array $d$.
The second line of the input contains $n$ integers $d_1, d_2, \dots, d_n$ ($1 \le d_i \le 10^9$) — the elements of the array $d$.
Output Specification:
Print a single integer — the maximum possible value of $sum_1$, considering that the condition $sum_1 = sum_3$ must be met.
Obviously, at least one valid way to split the array exists (use $a=c=0$ and $b=n$).
Demo Input:
['5\n1 3 1 1 4\n', '5\n1 3 2 1 4\n', '3\n4 1 2\n']
Demo Output:
['5\n', '4\n', '0\n']
Note:
In the first example there is only one possible splitting which maximizes $sum_1$: $[1, 3, 1], [~], [1, 4]$.
In the second example the only way to have $sum_1=4$ is: $[1, 3], [2, 1], [4]$.
In the third example there is only one way to split the array: $[~], [4, 1, 2], [~]$.
|
```python
n=int(input())
a=list(map(int,input().strip().split(" ")))
i=0
j=n-1
si=a[i]
sj=a[n-1]
ans=0
while(i<j):
if(si==sj):
ans=max(ans,si)
i+=1
j-=1
si+=a[i]
sj+=a[j]
elif(si>sj):
j-=1
sj+=a[j]
elif(si<sj):
i+=1
si+=a[i]
print(ans)
```
| 3
|
|
580
|
A
|
Kefa and First Steps
|
PROGRAMMING
| 900
|
[
"brute force",
"dp",
"implementation"
] | null | null |
Kefa decided to make some money doing business on the Internet for exactly *n* days. He knows that on the *i*-th day (1<=≤<=*i*<=≤<=*n*) he makes *a**i* money. Kefa loves progress, that's why he wants to know the length of the maximum non-decreasing subsegment in sequence *a**i*. Let us remind you that the subsegment of the sequence is its continuous fragment. A subsegment of numbers is called non-decreasing if all numbers in it follow in the non-decreasing order.
Help Kefa cope with this task!
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (1<=≤<=*a**i*<=≤<=109).
|
Print a single integer — the length of the maximum non-decreasing subsegment of sequence *a*.
|
[
"6\n2 2 1 3 4 1\n",
"3\n2 2 9\n"
] |
[
"3",
"3"
] |
In the first test the maximum non-decreasing subsegment is the numbers from the third to the fifth one.
In the second test the maximum non-decreasing subsegment is the numbers from the first to the third one.
| 750
|
[
{
"input": "6\n2 2 1 3 4 1",
"output": "3"
},
{
"input": "3\n2 2 9",
"output": "3"
},
{
"input": "5\n10 100 111 1 2",
"output": "3"
},
{
"input": "10\n1 2 3 4 1 2 3 4 5 6",
"output": "6"
},
{
"input": "50\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "50"
},
{
"input": "100\n1 838 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 605 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 27 533 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 835 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1 992",
"output": "42"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "2\n1 1",
"output": "2"
},
{
"input": "6\n5 4 3 2 1 2",
"output": "2"
},
{
"input": "9\n1 2 3 4 5 6 7 8 9",
"output": "9"
},
{
"input": "7\n99 100 1 2 3 4 5",
"output": "5"
},
{
"input": "5\n3 3 1 2 3",
"output": "3"
},
{
"input": "1\n100",
"output": "1"
},
{
"input": "1\n5",
"output": "1"
}
] | 1,692,409,027
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 31
| 0
|
num = int(input())
chars = input().split(" ")
numbers = []
total_len = 0
for i in chars:
numbers.append(int(i))
total_len = 1
total_lens = []
for i in range(len(numbers) - 1):
temp = numbers[i]
sec = numbers[i + 1]
if sec >= temp:
total_len += 1
else:
total_lens.append(total_len + 1)
total_len = 0
full_len = total_len
if len(total_lens) == 0:
print(full_len)
else:
print(max(total_lens))
|
Title: Kefa and First Steps
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Kefa decided to make some money doing business on the Internet for exactly *n* days. He knows that on the *i*-th day (1<=≤<=*i*<=≤<=*n*) he makes *a**i* money. Kefa loves progress, that's why he wants to know the length of the maximum non-decreasing subsegment in sequence *a**i*. Let us remind you that the subsegment of the sequence is its continuous fragment. A subsegment of numbers is called non-decreasing if all numbers in it follow in the non-decreasing order.
Help Kefa cope with this task!
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105).
The second line contains *n* integers *a*1,<=<=*a*2,<=<=...,<=<=*a**n* (1<=≤<=*a**i*<=≤<=109).
Output Specification:
Print a single integer — the length of the maximum non-decreasing subsegment of sequence *a*.
Demo Input:
['6\n2 2 1 3 4 1\n', '3\n2 2 9\n']
Demo Output:
['3', '3']
Note:
In the first test the maximum non-decreasing subsegment is the numbers from the third to the fifth one.
In the second test the maximum non-decreasing subsegment is the numbers from the first to the third one.
|
```python
num = int(input())
chars = input().split(" ")
numbers = []
total_len = 0
for i in chars:
numbers.append(int(i))
total_len = 1
total_lens = []
for i in range(len(numbers) - 1):
temp = numbers[i]
sec = numbers[i + 1]
if sec >= temp:
total_len += 1
else:
total_lens.append(total_len + 1)
total_len = 0
full_len = total_len
if len(total_lens) == 0:
print(full_len)
else:
print(max(total_lens))
```
| 0
|
|
463
|
B
|
Caisa and Pylons
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation",
"math"
] | null | null |
Caisa solved the problem with the sugar and now he is on the way back to home.
Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=><=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time.
Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game?
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons.
|
Print a single number representing the minimum number of dollars paid by Caisa.
|
[
"5\n3 4 3 2 4\n",
"3\n4 4 4\n"
] |
[
"4\n",
"4\n"
] |
In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
| 1,000
|
[
{
"input": "5\n3 4 3 2 4",
"output": "4"
},
{
"input": "3\n4 4 4",
"output": "4"
},
{
"input": "99\n1401 2019 1748 3785 3236 3177 3443 3772 2138 1049 353 908 310 2388 1322 88 2160 2783 435 2248 1471 706 2468 2319 3156 3506 2794 1999 1983 2519 2597 3735 537 344 3519 3772 3872 2961 3895 2010 10 247 3269 671 2986 942 758 1146 77 1545 3745 1547 2250 2565 217 1406 2070 3010 3404 404 1528 2352 138 2065 3047 3656 2188 2919 2616 2083 1280 2977 2681 548 4000 1667 1489 1109 3164 1565 2653 3260 3463 903 1824 3679 2308 245 2689 2063 648 568 766 785 2984 3812 440 1172 2730",
"output": "4000"
},
{
"input": "68\n477 1931 3738 3921 2306 1823 3328 2057 661 3993 2967 3520 171 1739 1525 1817 209 3475 1902 2666 518 3283 3412 3040 3383 2331 1147 1460 1452 1800 1327 2280 82 1416 2200 2388 3238 1879 796 250 1872 114 121 2042 1853 1645 211 2061 1472 2464 726 1989 1746 489 1380 1128 2819 2527 2939 622 678 265 2902 1111 2032 1453 3850 1621",
"output": "3993"
},
{
"input": "30\n30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "30"
},
{
"input": "3\n3 2 1",
"output": "3"
},
{
"input": "1\n69",
"output": "69"
}
] | 1,595,795,366
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 2
| 93
| 6,656,000
|
def pylons(n,array):
s=0
h=0
for i in range(n):
if h>=array[i]:
h+=h-array[i]
else:
s+=array[i]-h
h=array[i]
return s
n=int(input())
array=list(map(int,input().split(" ")))
print(pylons(n,array))
|
Title: Caisa and Pylons
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Caisa solved the problem with the sugar and now he is on the way back to home.
Caisa is playing a mobile game during his path. There are (*n*<=+<=1) pylons numbered from 0 to *n* in this game. The pylon with number 0 has zero height, the pylon with number *i* (*i*<=><=0) has height *h**i*. The goal of the game is to reach *n*-th pylon, and the only move the player can do is to jump from the current pylon (let's denote its number as *k*) to the next one (its number will be *k*<=+<=1). When the player have made such a move, its energy increases by *h**k*<=-<=*h**k*<=+<=1 (if this value is negative the player loses energy). The player must have non-negative amount of energy at any moment of the time.
Initially Caisa stand at 0 pylon and has 0 energy. The game provides a special opportunity: one can pay a single dollar and increase the height of anyone pylon by one. Caisa may use that opportunity several times, but he doesn't want to spend too much money. What is the minimal amount of money he must paid to reach the goal of the game?
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105). The next line contains *n* integers *h*1, *h*2,<=..., *h**n* (1<=<=≤<=<=*h**i*<=<=≤<=<=105) representing the heights of the pylons.
Output Specification:
Print a single number representing the minimum number of dollars paid by Caisa.
Demo Input:
['5\n3 4 3 2 4\n', '3\n4 4 4\n']
Demo Output:
['4\n', '4\n']
Note:
In the first sample he can pay 4 dollars and increase the height of pylon with number 0 by 4 units. Then he can safely pass to the last pylon.
|
```python
def pylons(n,array):
s=0
h=0
for i in range(n):
if h>=array[i]:
h+=h-array[i]
else:
s+=array[i]-h
h=array[i]
return s
n=int(input())
array=list(map(int,input().split(" ")))
print(pylons(n,array))
```
| 0
|
|
34
|
B
|
Sale
|
PROGRAMMING
| 900
|
[
"greedy",
"sortings"
] |
B. Sale
|
2
|
256
|
Once Bob got to a sale of old TV sets. There were *n* TV sets at that sale. TV set with index *i* costs *a**i* bellars. Some TV sets have a negative price — their owners are ready to pay Bob if he buys their useless apparatus. Bob can «buy» any TV sets he wants. Though he's very strong, Bob can carry at most *m* TV sets, and he has no desire to go to the sale for the second time. Please, help Bob find out the maximum sum of money that he can earn.
|
The first line contains two space-separated integers *n* and *m* (1<=≤<=*m*<=≤<=*n*<=≤<=100) — amount of TV sets at the sale, and amount of TV sets that Bob can carry. The following line contains *n* space-separated integers *a**i* (<=-<=1000<=≤<=*a**i*<=≤<=1000) — prices of the TV sets.
|
Output the only number — the maximum sum of money that Bob can earn, given that he can carry at most *m* TV sets.
|
[
"5 3\n-6 0 35 -2 4\n",
"4 2\n7 0 0 -7\n"
] |
[
"8\n",
"7\n"
] |
none
| 1,000
|
[
{
"input": "5 3\n-6 0 35 -2 4",
"output": "8"
},
{
"input": "4 2\n7 0 0 -7",
"output": "7"
},
{
"input": "6 6\n756 -611 251 -66 572 -818",
"output": "1495"
},
{
"input": "5 5\n976 437 937 788 518",
"output": "0"
},
{
"input": "5 3\n-2 -2 -2 -2 -2",
"output": "6"
},
{
"input": "5 1\n998 997 985 937 998",
"output": "0"
},
{
"input": "2 2\n-742 -187",
"output": "929"
},
{
"input": "3 3\n522 597 384",
"output": "0"
},
{
"input": "4 2\n-215 -620 192 647",
"output": "835"
},
{
"input": "10 6\n557 605 685 231 910 633 130 838 -564 -85",
"output": "649"
},
{
"input": "20 14\n932 442 960 943 624 624 955 998 631 910 850 517 715 123 1000 155 -10 961 966 59",
"output": "10"
},
{
"input": "30 5\n991 997 996 967 977 999 991 986 1000 965 984 997 998 1000 958 983 974 1000 991 999 1000 978 961 992 990 998 998 978 998 1000",
"output": "0"
},
{
"input": "50 20\n-815 -947 -946 -993 -992 -846 -884 -954 -963 -733 -940 -746 -766 -930 -821 -937 -937 -999 -914 -938 -936 -975 -939 -981 -977 -952 -925 -901 -952 -978 -994 -957 -946 -896 -905 -836 -994 -951 -887 -939 -859 -953 -985 -988 -946 -829 -956 -842 -799 -886",
"output": "19441"
},
{
"input": "88 64\n999 999 1000 1000 999 996 995 1000 1000 999 1000 997 998 1000 999 1000 997 1000 993 998 994 999 998 996 1000 997 1000 1000 1000 997 1000 998 997 1000 1000 998 1000 998 999 1000 996 999 999 999 996 995 999 1000 998 999 1000 999 999 1000 1000 1000 996 1000 1000 1000 997 1000 1000 997 999 1000 1000 1000 1000 1000 999 999 1000 1000 996 999 1000 1000 995 999 1000 996 1000 998 999 999 1000 999",
"output": "0"
},
{
"input": "99 17\n-993 -994 -959 -989 -991 -995 -976 -997 -990 -1000 -996 -994 -999 -995 -1000 -983 -979 -1000 -989 -968 -994 -992 -962 -993 -999 -983 -991 -979 -995 -993 -973 -999 -995 -995 -999 -993 -995 -992 -947 -1000 -999 -998 -982 -988 -979 -993 -963 -988 -980 -990 -979 -976 -995 -999 -981 -988 -998 -999 -970 -1000 -983 -994 -943 -975 -998 -977 -973 -997 -959 -999 -983 -985 -950 -977 -977 -991 -998 -973 -987 -985 -985 -986 -984 -994 -978 -998 -989 -989 -988 -970 -985 -974 -997 -981 -962 -972 -995 -988 -993",
"output": "16984"
},
{
"input": "100 37\n205 19 -501 404 912 -435 -322 -469 -655 880 -804 -470 793 312 -108 586 -642 -928 906 605 -353 -800 745 -440 -207 752 -50 -28 498 -800 -62 -195 602 -833 489 352 536 404 -775 23 145 -512 524 759 651 -461 -427 -557 684 -366 62 592 -563 -811 64 418 -881 -308 591 -318 -145 -261 -321 -216 -18 595 -202 960 -4 219 226 -238 -882 -963 425 970 -434 -160 243 -672 -4 873 8 -633 904 -298 -151 -377 -61 -72 -677 -66 197 -716 3 -870 -30 152 -469 981",
"output": "21743"
},
{
"input": "100 99\n-931 -806 -830 -828 -916 -962 -660 -867 -952 -966 -820 -906 -724 -982 -680 -717 -488 -741 -897 -613 -986 -797 -964 -939 -808 -932 -810 -860 -641 -916 -858 -628 -821 -929 -917 -976 -664 -985 -778 -665 -624 -928 -940 -958 -884 -757 -878 -896 -634 -526 -514 -873 -990 -919 -988 -878 -650 -973 -774 -783 -733 -648 -756 -895 -833 -974 -832 -725 -841 -748 -806 -613 -924 -867 -881 -943 -864 -991 -809 -926 -777 -817 -998 -682 -910 -996 -241 -722 -964 -904 -821 -920 -835 -699 -805 -632 -779 -317 -915 -654",
"output": "81283"
},
{
"input": "100 14\n995 994 745 684 510 737 984 690 979 977 542 933 871 603 758 653 962 997 747 974 773 766 975 770 527 960 841 989 963 865 974 967 950 984 757 685 986 809 982 959 931 880 978 867 805 562 970 900 834 782 616 885 910 608 974 918 576 700 871 980 656 941 978 759 767 840 573 859 841 928 693 853 716 927 976 851 962 962 627 797 707 873 869 988 993 533 665 887 962 880 929 980 877 887 572 790 721 883 848 782",
"output": "0"
},
{
"input": "100 84\n768 946 998 752 931 912 826 1000 991 910 875 962 901 952 958 733 959 908 872 840 923 826 952 980 974 980 947 955 959 822 997 963 966 933 829 923 971 999 926 932 865 984 974 858 994 855 949 941 992 861 951 949 991 711 763 728 935 485 716 907 869 952 960 859 909 963 978 942 968 933 923 909 997 962 687 764 924 774 875 1000 961 951 987 974 848 921 966 859 995 997 974 931 886 941 974 986 906 978 998 823",
"output": "0"
},
{
"input": "100 80\n-795 -994 -833 -930 -974 -980 -950 -940 -788 -927 -583 -956 -945 -949 -809 -974 -957 -736 -967 -908 -975 -961 -986 -983 -963 -771 -952 -847 -751 -741 -982 -959 -925 -931 -839 -937 -880 -914 -858 -998 -812 -911 -862 -965 -943 -984 -738 -920 -950 -998 -909 -998 -781 -901 -677 -940 -985 -951 -675 -952 -967 -949 -882 -641 -969 -937 -975 -993 -913 -941 -807 -851 -832 -960 -939 -943 -895 -929 -528 -880 -823 -930 -888 -862 -948 -966 -962 -857 -799 -969 -833 -998 -952 -878 -946 -971 -976 -974 -723 -992",
"output": "75068"
},
{
"input": "1 1\n0",
"output": "0"
},
{
"input": "1 1\n1",
"output": "0"
},
{
"input": "1 1\n555",
"output": "0"
},
{
"input": "1 1\n-1",
"output": "1"
},
{
"input": "1 1\n-24",
"output": "24"
}
] | 1,640,485,422
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 25
| 124
| 0
|
n = list(map(int, input().split()))
tvs = sorted(list(map(int, input().split())))
negs = [num for num in tvs if num < 0]
print(0 - sum(negs[:n[1]]))
|
Title: Sale
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Once Bob got to a sale of old TV sets. There were *n* TV sets at that sale. TV set with index *i* costs *a**i* bellars. Some TV sets have a negative price — their owners are ready to pay Bob if he buys their useless apparatus. Bob can «buy» any TV sets he wants. Though he's very strong, Bob can carry at most *m* TV sets, and he has no desire to go to the sale for the second time. Please, help Bob find out the maximum sum of money that he can earn.
Input Specification:
The first line contains two space-separated integers *n* and *m* (1<=≤<=*m*<=≤<=*n*<=≤<=100) — amount of TV sets at the sale, and amount of TV sets that Bob can carry. The following line contains *n* space-separated integers *a**i* (<=-<=1000<=≤<=*a**i*<=≤<=1000) — prices of the TV sets.
Output Specification:
Output the only number — the maximum sum of money that Bob can earn, given that he can carry at most *m* TV sets.
Demo Input:
['5 3\n-6 0 35 -2 4\n', '4 2\n7 0 0 -7\n']
Demo Output:
['8\n', '7\n']
Note:
none
|
```python
n = list(map(int, input().split()))
tvs = sorted(list(map(int, input().split())))
negs = [num for num in tvs if num < 0]
print(0 - sum(negs[:n[1]]))
```
| 3.969
|
31
|
B
|
Sysadmin Bob
|
PROGRAMMING
| 1,500
|
[
"greedy",
"implementation",
"strings"
] |
B. Sysadmin Bob
|
0
|
256
|
Email address in Berland is a string of the form *A*@*B*, where *A* and *B* are arbitrary strings consisting of small Latin letters.
Bob is a system administrator in «Bersoft» company. He keeps a list of email addresses of the company's staff. This list is as a large string, where all addresses are written in arbitrary order, separated by commas. The same address can be written more than once.
Suddenly, because of unknown reasons, all commas in Bob's list disappeared. Now Bob has a string, where all addresses are written one after another without any separators, and there is impossible to determine, where the boundaries between addresses are. Unfortunately, on the same day his chief asked him to bring the initial list of addresses. Now Bob wants to disjoin addresses in some valid way. Help him to do that.
|
The first line contains the list of addresses without separators. The length of this string is between 1 and 200, inclusive. The string consists only from small Latin letters and characters «@».
|
If there is no list of the valid (according to the Berland rules) email addresses such that after removing all commas it coincides with the given string, output No solution. In the other case, output the list. The same address can be written in this list more than once. If there are several solutions, output any of them.
|
[
"a@aa@a\n",
"a@a@a\n",
"@aa@a\n"
] |
[
"a@a,a@a\n",
"No solution\n",
"No solution\n"
] |
none
| 1,000
|
[
{
"input": "a@aa@a",
"output": "a@a,a@a"
},
{
"input": "a@a@a",
"output": "No solution"
},
{
"input": "@aa@a",
"output": "No solution"
},
{
"input": "aba@caba@daba",
"output": "aba@c,aba@daba"
},
{
"input": "asd@qwasd@qwasd@qwasd@qwasd@qw",
"output": "asd@q,wasd@q,wasd@q,wasd@q,wasd@qw"
},
{
"input": "qwer@ty",
"output": "qwer@ty"
},
{
"input": "@",
"output": "No solution"
},
{
"input": "g",
"output": "No solution"
},
{
"input": "@@",
"output": "No solution"
},
{
"input": "@@@",
"output": "No solution"
},
{
"input": "r@@",
"output": "No solution"
},
{
"input": "@@r",
"output": "No solution"
},
{
"input": "@r@",
"output": "No solution"
},
{
"input": "w@",
"output": "No solution"
},
{
"input": "@e",
"output": "No solution"
},
{
"input": "jj",
"output": "No solution"
},
{
"input": "@gh",
"output": "No solution"
},
{
"input": "n@m",
"output": "n@m"
},
{
"input": "kl@",
"output": "No solution"
},
{
"input": "fpm",
"output": "No solution"
},
{
"input": "@@@@",
"output": "No solution"
},
{
"input": "q@@@",
"output": "No solution"
},
{
"input": "@d@@",
"output": "No solution"
},
{
"input": "@@v@",
"output": "No solution"
},
{
"input": "@@@c",
"output": "No solution"
},
{
"input": "@@zx",
"output": "No solution"
},
{
"input": "@x@a",
"output": "No solution"
},
{
"input": "@pq@",
"output": "No solution"
},
{
"input": "w@@e",
"output": "No solution"
},
{
"input": "e@s@",
"output": "No solution"
},
{
"input": "ec@@",
"output": "No solution"
},
{
"input": "@hjk",
"output": "No solution"
},
{
"input": "e@vb",
"output": "e@vb"
},
{
"input": "tg@q",
"output": "tg@q"
},
{
"input": "jkl@",
"output": "No solution"
},
{
"input": "werb",
"output": "No solution"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "No solution"
},
{
"input": "@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@",
"output": "No solution"
},
{
"input": "duk@rufrxjzqbwkfrzf@sjp@mdpyrokdfmcmexxtjqaalruvtzwfsqabi@tjkxilrhkwzfeuqm@lpwnxgebirdvwplsvrtxvhmzv",
"output": "duk@r,ufrxjzqbwkfrzf@s,jp@m,dpyrokdfmcmexxtjqaalruvtzwfsqabi@t,jkxilrhkwzfeuqm@lpwnxgebirdvwplsvrtxvhmzv"
},
{
"input": "umegsn@qlmkpkyrmuclefdpfhzuhyjcoqthnvpwzhkwrdvlzfbrqpzlg@ebzycyaofyyetwcepe@nxjwyeaqbuxxbohfzrnmebuy",
"output": "umegsn@q,lmkpkyrmuclefdpfhzuhyjcoqthnvpwzhkwrdvlzfbrqpzlg@e,bzycyaofyyetwcepe@nxjwyeaqbuxxbohfzrnmebuy"
},
{
"input": "l@snuoytgflrtuexpx@txzhhdwbakfhfro@syxistypegfvdmurvuubrj@grsznzhcotagqueuxtnjgfaywzkbglwwiptjyocxcs",
"output": "l@s,nuoytgflrtuexpx@t,xzhhdwbakfhfro@s,yxistypegfvdmurvuubrj@grsznzhcotagqueuxtnjgfaywzkbglwwiptjyocxcs"
},
{
"input": "crvjlke@yqsdofatzuuspt@@uumdkiwhtg@crxiabnujfmcquylyklxaedniwnq@@f@@rfnsjtylurexmdaaykvxmgeij@jkjsyi",
"output": "No solution"
},
{
"input": "ukpcivvjubgalr@bdxangokpaxzxuxe@qlemwpvywfudffafsqlmmhhalaaolktmgmhmrwvkdcvwxcfbytnz@jgmbhpwqcmecnxc",
"output": "ukpcivvjubgalr@b,dxangokpaxzxuxe@q,lemwpvywfudffafsqlmmhhalaaolktmgmhmrwvkdcvwxcfbytnz@jgmbhpwqcmecnxc"
},
{
"input": "mehxghlvnnazggvpnjdbchdolqguiurrfghwxpwhphdbhloltwnnqovsnsdmfevlikmrlvwvkcqysefvoraorhamchghqaooxaxz",
"output": "No solution"
},
{
"input": "whazbewtogyre@wqlsswhygx@osevwzytuaukqpp@gfjbtwnhpnlxwci@ovaaat@ookd@@o@bss@wyrrwzysubw@utyltkk@hlkx",
"output": "No solution"
},
{
"input": "vpulcessdotvylvmkeonzbpncjxaaigotkyvngsbkicomikyavpsjcphlznjtdmvbqiroxvfcmcczfmqbyedujvrupzlaswbzanv",
"output": "No solution"
},
{
"input": "mhxapzklriiincpnysmegjzaxdngifbowkzivvgisqbekprdmdoqezdsrsrwwmht@hwywjqflvqdevpqisncwbftlttfkgsyetop",
"output": "mhxapzklriiincpnysmegjzaxdngifbowkzivvgisqbekprdmdoqezdsrsrwwmht@hwywjqflvqdevpqisncwbftlttfkgsyetop"
},
{
"input": "dxzqftcghawwcwh@iepanbiclstbsxbrsoep@@jwhrptgiu@zfykoravtaykvkzseqfnlsbvjnsgiajgjtgucvewlpxmqwvkghlo",
"output": "No solution"
},
{
"input": "erierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtgh@",
"output": "No solution"
},
{
"input": "@rierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd",
"output": "No solution"
},
{
"input": "e@ierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd",
"output": "e@ierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd"
},
{
"input": "erierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtg@d",
"output": "erierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtg@d"
},
{
"input": "erierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjt@h@",
"output": "No solution"
},
{
"input": "@r@erjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd",
"output": "No solution"
},
{
"input": "e@i@rjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd",
"output": "No solution"
},
{
"input": "erierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierj@g@d",
"output": "No solution"
},
{
"input": "erierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtg@@",
"output": "No solution"
},
{
"input": "@@ierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd",
"output": "No solution"
},
{
"input": "e@@erjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd",
"output": "No solution"
},
{
"input": "erierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjt@@d",
"output": "No solution"
},
{
"input": "erierjtghderierjtghderierj@@dderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghd",
"output": "No solution"
},
{
"input": "a@rierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderirjtghderierjtghderierjtghderierjthderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtgh@a",
"output": "a@r,ierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderirjtghderierjtghderierjtghderierjthderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtghderierjtgh@a"
},
{
"input": "d@nt@om@zz@ut@tr@ta@ap@ou@sy@sv@fg@el@rp@qr@nl@j",
"output": "d@n,t@o,m@z,z@u,t@t,r@t,a@a,p@o,u@s,y@s,v@f,g@e,l@r,p@q,r@n,l@j"
},
{
"input": "a@mc@ks@gu@rl@gq@zq@iz@da@uq@mi@nf@zs@hi@we@ej@ke@vb@az@yz@yl@rr@gh@um@nv@qe@qq@de@dy@op@gt@vx@ak@q",
"output": "a@m,c@k,s@g,u@r,l@g,q@z,q@i,z@d,a@u,q@m,i@n,f@z,s@h,i@w,e@e,j@k,e@v,b@a,z@y,z@y,l@r,r@g,h@u,m@n,v@q,e@q,q@d,e@d,y@o,p@g,t@v,x@a,k@q"
},
{
"input": "c@ir@xf@ap@fk@sp@wm@ec@qw@vg@by@iu@tr@wu@pv@lj@dd@tc@qj@ok@hm@bs@ul@ez@cg@ht@xf@ag@tr@hz@ap@tx@ly@dg@hu@nd@uv@il@ii@cn@nc@nb@cy@kp@dk@xa@da@ta@yr@yv@qg@db@je@wz@rn@yh@xi@mj@kc@uj@yu@cf@ps@ao@fo@le@d",
"output": "c@i,r@x,f@a,p@f,k@s,p@w,m@e,c@q,w@v,g@b,y@i,u@t,r@w,u@p,v@l,j@d,d@t,c@q,j@o,k@h,m@b,s@u,l@e,z@c,g@h,t@x,f@a,g@t,r@h,z@a,p@t,x@l,y@d,g@h,u@n,d@u,v@i,l@i,i@c,n@n,c@n,b@c,y@k,p@d,k@x,a@d,a@t,a@y,r@y,v@q,g@d,b@j,e@w,z@r,n@y,h@x,i@m,j@k,c@u,j@y,u@c,f@p,s@a,o@f,o@l,e@d"
},
{
"input": "m@us@ru@mg@rq@ed@ot@gt@fo@gs@lm@cx@au@rq@zt@zk@jr@xd@oa@py@kf@lk@zr@ko@lj@wv@fl@yl@gk@cx@px@kl@ic@sr@xn@hm@xs@km@tk@ui@ya@pa@xx@ze@py@ir@xj@cr@dq@lr@cm@zu@lt@bx@kq@kx@fr@lu@vb@rz@hg@iw@dl@pf@pl@wv@z",
"output": "m@u,s@r,u@m,g@r,q@e,d@o,t@g,t@f,o@g,s@l,m@c,x@a,u@r,q@z,t@z,k@j,r@x,d@o,a@p,y@k,f@l,k@z,r@k,o@l,j@w,v@f,l@y,l@g,k@c,x@p,x@k,l@i,c@s,r@x,n@h,m@x,s@k,m@t,k@u,i@y,a@p,a@x,x@z,e@p,y@i,r@x,j@c,r@d,q@l,r@c,m@z,u@l,t@b,x@k,q@k,x@f,r@l,u@v,b@r,z@h,g@i,w@d,l@p,f@p,l@w,v@z"
},
{
"input": "gjkjqjrks@eyqiia@qfijelnmigoditxjrtuhukalfl@nmwancimlqtfekzkxgjioedhtdivqajwbmu@hpdxuiwurpgenxaiqaqkcqimcvitljuisfiojlylveie@neqdjzeqdbiatjpuhujgykl@gmmlrhnlghsoeyrccygigtkjrjxdwmnkouaiaqpquluwcdqlxqb",
"output": "gjkjqjrks@e,yqiia@q,fijelnmigoditxjrtuhukalfl@n,mwancimlqtfekzkxgjioedhtdivqajwbmu@h,pdxuiwurpgenxaiqaqkcqimcvitljuisfiojlylveie@n,eqdjzeqdbiatjpuhujgykl@gmmlrhnlghsoeyrccygigtkjrjxdwmnkouaiaqpquluwcdqlxqb"
},
{
"input": "uakh@chpowdmvdywosakyyknpriverjjgklmdrgwufpawgvhabjbnemimjktgbkx@fzvqcodbceqnihl@kpsslhwwndad@@yavjafrwkqyt@urhnwgnqamn@xkc@vngzlssmtheuxkpzjlbbjq@mwiojmvpilm@hlrmxheszskhxritsieubjjazrngxlqeedfkiuwny",
"output": "No solution"
},
{
"input": "usmjophufnkamnvowbauu@wfoyceknkgeaejlbbqhtucbl@wurukjezj@irhdgrfhyfkz@fbmqgxvtxcebztirvwjf@fnav@@f@paookujny@z@fmcxgvab@@kpqbwuxxwxhsrbivlbunmdjzk@afjznrjjtkq@cafetoinfleecjqvlzpkqlspoufwmidvoblti@jbg",
"output": "No solution"
},
{
"input": "axkxcgcmlxq@v@ynnjximcujikloyls@lqvxiyca@feimaioavacmquasneqbrqftknpbrzpahtcc@ijwqmyzsuidqkm@dffuiitpugbvty@izbnqxhdjasihhlt@gjrol@vy@vnqpxuqbofzzwl@toywomxopbuttczszx@fuowtjmtqy@gypx@la@@tweln@jgyktb",
"output": "No solution"
},
{
"input": "mplxc@crww@gllecngcsbmxmksrgcb@lbrcnkwxclkcgvfeqeoymproppxhxbgm@q@bfxxvuymnnjolqklabcinwpdlxj@jcevvilhmpyiwggvlmdanfhhlgbkobnmei@bvqtdq@osijfdsuouvcqpcjxjqiuhgts@xapp@cpqvlhlfrxtgunbbjwhuafovbcbqyhmlu",
"output": "No solution"
},
{
"input": "aglvesxsmivijisod@mxcnbfcfgqfwjouidlsueaswf@obehqpvbkmukxkicyoknkbol@kutunggpoxxfpbe@qkhv@llddqqoyjeex@byvtlhbifqmvlukmrvgvpwrscwfhpuwyknwchqhrdqgarmnsdlqgf@lseltghg@bhuwbfjpsvayzk@fvwow@zapklumefauly",
"output": "aglvesxsmivijisod@m,xcnbfcfgqfwjouidlsueaswf@o,behqpvbkmukxkicyoknkbol@k,utunggpoxxfpbe@q,khv@l,lddqqoyjeex@b,yvtlhbifqmvlukmrvgvpwrscwfhpuwyknwchqhrdqgarmnsdlqgf@l,seltghg@b,huwbfjpsvayzk@f,vwow@zapklumefauly"
},
{
"input": "gbllovyerhudm@aluhtnstcp@uwgvejnmqpt@nez@ltzqjrcgwkkpzicb@ihh@wldhvjbrl@efbdzbeg@zyovsta@n@c@jutail@nclsbcihabzr@snowxeyl@jewen@aduffvhr@ifufzzt@i@kptygveumwaknmrn@edsapqpcwsqypmutggztum@ewzakeamobzxt",
"output": "No solution"
},
{
"input": "dokshhqwmtbefrynupvusfxroggoqkjqfyabzkbccjmavumncorbcoairybeknhnpnwftrlbopsvqlgjbrowmfmoeebqseneabvgbcxmujmcqomoawrooixmqmyspfgafudfdfyrnujhgnbtsehgsnvdztjdpnskyquwdtkbfjtvrfjcqzmourvqsnfgjfqjgndydpch",
"output": "No solution"
},
{
"input": "jrlhtwmotdhtgcqokodparuqypwlkbhfsxvmdpfiraokekrolwtlsqjzcuvjfnvblznyngasauzln@gjypvjcwljnotgjlxketfgtntbotwjehea@vppouyoujujlhjrxbhvltfdslaqwynwjefbdbnuehmipqmtsrivlnippgftgnkhdgqiqbfvgrtoxrznncncqcvf",
"output": "jrlhtwmotdhtgcqokodparuqypwlkbhfsxvmdpfiraokekrolwtlsqjzcuvjfnvblznyngasauzln@g,jypvjcwljnotgjlxketfgtntbotwjehea@vppouyoujujlhjrxbhvltfdslaqwynwjefbdbnuehmipqmtsrivlnippgftgnkhdgqiqbfvgrtoxrznncncqcvf"
},
{
"input": "oxkvgnggznlfhminxkkhictpiaokdsfrewnxiujpjpstlyxovfwugrsqnpooalknjnfugxojozizlicwvnbflhdevpvnvwztnfiapairpigexbaeshondqdecduewmfrxunphikvlfwmrpsxrhxyjlsgqfiaqnwzlzxcyuudhzr@twllmhyfclybxqazhrmxdtokxawc",
"output": "oxkvgnggznlfhminxkkhictpiaokdsfrewnxiujpjpstlyxovfwugrsqnpooalknjnfugxojozizlicwvnbflhdevpvnvwztnfiapairpigexbaeshondqdecduewmfrxunphikvlfwmrpsxrhxyjlsgqfiaqnwzlzxcyuudhzr@twllmhyfclybxqazhrmxdtokxawc"
}
] | 1,643,799,198
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 76
| 46
| 0
|
s=input().split('@'); n=len(s)-1
for i in range(1,n):
if len(s[i])<2: print('No solution'); exit()
else: s[i]=s[i][0]+','+s[i][1:]
if n>0 and s and s[0] and s[n]: print('@'.join(s))
else: print('No solution')
|
Title: Sysadmin Bob
Time Limit: 0 seconds
Memory Limit: 256 megabytes
Problem Description:
Email address in Berland is a string of the form *A*@*B*, where *A* and *B* are arbitrary strings consisting of small Latin letters.
Bob is a system administrator in «Bersoft» company. He keeps a list of email addresses of the company's staff. This list is as a large string, where all addresses are written in arbitrary order, separated by commas. The same address can be written more than once.
Suddenly, because of unknown reasons, all commas in Bob's list disappeared. Now Bob has a string, where all addresses are written one after another without any separators, and there is impossible to determine, where the boundaries between addresses are. Unfortunately, on the same day his chief asked him to bring the initial list of addresses. Now Bob wants to disjoin addresses in some valid way. Help him to do that.
Input Specification:
The first line contains the list of addresses without separators. The length of this string is between 1 and 200, inclusive. The string consists only from small Latin letters and characters «@».
Output Specification:
If there is no list of the valid (according to the Berland rules) email addresses such that after removing all commas it coincides with the given string, output No solution. In the other case, output the list. The same address can be written in this list more than once. If there are several solutions, output any of them.
Demo Input:
['a@aa@a\n', 'a@a@a\n', '@aa@a\n']
Demo Output:
['a@a,a@a\n', 'No solution\n', 'No solution\n']
Note:
none
|
```python
s=input().split('@'); n=len(s)-1
for i in range(1,n):
if len(s[i])<2: print('No solution'); exit()
else: s[i]=s[i][0]+','+s[i][1:]
if n>0 and s and s[0] and s[n]: print('@'.join(s))
else: print('No solution')
```
| 3
|
894
|
A
|
QAQ
|
PROGRAMMING
| 800
|
[
"brute force",
"dp"
] | null | null |
"QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!).
Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact.
|
The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters.
|
Print a single integer — the number of subsequences "QAQ" in the string.
|
[
"QAQAQYSYIOIWIN\n",
"QAQQQZZYNOIWIN\n"
] |
[
"4\n",
"3\n"
] |
In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN".
| 500
|
[
{
"input": "QAQAQYSYIOIWIN",
"output": "4"
},
{
"input": "QAQQQZZYNOIWIN",
"output": "3"
},
{
"input": "QA",
"output": "0"
},
{
"input": "IAQVAQZLQBQVQFTQQQADAQJA",
"output": "24"
},
{
"input": "QQAAQASGAYAAAAKAKAQIQEAQAIAAIAQQQQQ",
"output": "378"
},
{
"input": "AMVFNFJIAVNQJWIVONQOAOOQSNQSONOASONAONQINAONAOIQONANOIQOANOQINAONOQINAONOXJCOIAQOAOQAQAQAQAQWWWAQQAQ",
"output": "1077"
},
{
"input": "AAQQAXBQQBQQXBNQRJAQKQNAQNQVDQASAGGANQQQQTJFFQQQTQQA",
"output": "568"
},
{
"input": "KAZXAVLPJQBQVQQQQQAPAQQGQTQVZQAAAOYA",
"output": "70"
},
{
"input": "W",
"output": "0"
},
{
"input": "DBA",
"output": "0"
},
{
"input": "RQAWNACASAAKAGAAAAQ",
"output": "10"
},
{
"input": "QJAWZAAOAAGIAAAAAOQATASQAEAAAAQFQQHPA",
"output": "111"
},
{
"input": "QQKWQAQAAAAAAAAGAAVAQUEQQUMQMAQQQNQLAMAAAUAEAAEMAAA",
"output": "411"
},
{
"input": "QQUMQAYAUAAGWAAAQSDAVAAQAAAASKQJJQQQQMAWAYYAAAAAAEAJAXWQQ",
"output": "625"
},
{
"input": "QORZOYAQ",
"output": "1"
},
{
"input": "QCQAQAGAWAQQQAQAVQAQQQQAQAQQQAQAAATQAAVAAAQQQQAAAUUQAQQNQQWQQWAQAAQQKQYAQAAQQQAAQRAQQQWBQQQQAPBAQGQA",
"output": "13174"
},
{
"input": "QQAQQAKQFAQLQAAWAMQAZQAJQAAQQOACQQAAAYANAQAQQAQAAQQAOBQQJQAQAQAQQQAAAAABQQQAVNZAQQQQAMQQAFAAEAQAQHQT",
"output": "10420"
},
{
"input": "AQEGQHQQKQAQQPQKAQQQAAAAQQQAQEQAAQAAQAQFSLAAQQAQOQQAVQAAAPQQAWAQAQAFQAXAQQQQTRLOQAQQJQNQXQQQQSQVDQQQ",
"output": "12488"
},
{
"input": "QNQKQQQLASQBAVQQQQAAQQOQRJQQAQQQEQZUOANAADAAQQJAQAQARAAAQQQEQBHTQAAQAAAAQQMKQQQIAOJJQQAQAAADADQUQQQA",
"output": "9114"
},
{
"input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ",
"output": "35937"
},
{
"input": "AMQQAAQAAQAAAAAAQQQBOAAANAAKQJCYQAE",
"output": "254"
},
{
"input": "AYQBAEQGAQEOAKGIXLQJAIAKQAAAQPUAJAKAATFWQQAOQQQUFQYAQQMQHOKAAJXGFCARAQSATHAUQQAATQJJQDQRAANQQAE",
"output": "2174"
},
{
"input": "AAQXAAQAYQAAAAGAQHVQYAGIVACADFAAQAAAAQZAAQMAKZAADQAQDAAQDAAAMQQOXYAQQQAKQBAAQQKAXQBJZDDLAAHQQ",
"output": "2962"
},
{
"input": "AYQQYAVAMNIAUAAKBBQVACWKTQSAQZAAQAAASZJAWBCAALAARHACQAKQQAQAARPAQAAQAQAAZQUSHQAMFVFZQQQQSAQQXAA",
"output": "2482"
},
{
"input": "LQMAQQARQAQBJQQQAGAAZQQXALQQAARQAQQQQAAQQAQQQAQQCAQQAQQAYQQQRAAZATQALYQQAAHHAAQHAAAAAAAAQQMAAQNAKQ",
"output": "7768"
},
{
"input": "MAQQWAQOYQMAAAQAQPQZAOAAQAUAQNAAQAAAITQSAQAKAQKAQQWSQAAQQAGUCDQMQWKQUXKWQQAAQQAAQQZQDQQQAABXQUUXQOA",
"output": "5422"
},
{
"input": "QTAAQDAQXAQQJQQQGAAAQQQQSBQZKAQQAQQQQEAQNUQBZCQLYQZQEQQAAQHQVAORKQVAQYQNASZQAARZAAGAAAAOQDCQ",
"output": "3024"
},
{
"input": "QQWAQQGQQUZQQQLZAAQYQXQVAQFQUAQZUQZZQUKBHSHTQYLQAOQXAQQGAQQTQOAQARQADAJRAAQPQAQQUQAUAMAUVQAAAQQAWQ",
"output": "4527"
},
{
"input": "QQAAQQAQVAQZQQQQAOEAQZPQIBQZACQQAFQQLAAQDATZQANHKYQQAQTAAFQRQAIQAJPWQAQTEIRXAEQQAYWAAAUKQQAQAQQQSQQH",
"output": "6416"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAAAA",
"output": "14270"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQ",
"output": "13136"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAA",
"output": "14270"
},
{
"input": "AQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQQAA",
"output": "14231"
},
{
"input": "QQQQQAQAAQQAQAQAAAAAAAAAQAQAAAAAQAQAQQQAQQQAAAQQQAAAAAAAQAAAAQQQQQQQAQQQQAQAAAQAAAAAQAQAAAAAQAQAA",
"output": "15296"
},
{
"input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ",
"output": "0"
},
{
"input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA",
"output": "0"
},
{
"input": "QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ",
"output": "0"
},
{
"input": "QAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQA",
"output": "20825"
},
{
"input": "AQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQ",
"output": "20825"
},
{
"input": "Q",
"output": "0"
},
{
"input": "A",
"output": "0"
},
{
"input": "FFF",
"output": "0"
},
{
"input": "AAAAAA",
"output": "0"
}
] | 1,660,634,329
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 43
| 62
| 0
|
s = input()
cunt = 0
for i,n in enumerate(s):
if n=='A':
x=s[0:i].count('Q')
y=s[i: ].count('Q')
cunt+=x*y
print(cunt)
|
Title: QAQ
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
"QAQ" is a word to denote an expression of crying. Imagine "Q" as eyes with tears and "A" as a mouth.
Now Diamond has given Bort a string consisting of only uppercase English letters of length *n*. There is a great number of "QAQ" in the string (Diamond is so cute!).
Bort wants to know how many subsequences "QAQ" are in the string Diamond has given. Note that the letters "QAQ" don't have to be consecutive, but the order of letters should be exact.
Input Specification:
The only line contains a string of length *n* (1<=≤<=*n*<=≤<=100). It's guaranteed that the string only contains uppercase English letters.
Output Specification:
Print a single integer — the number of subsequences "QAQ" in the string.
Demo Input:
['QAQAQYSYIOIWIN\n', 'QAQQQZZYNOIWIN\n']
Demo Output:
['4\n', '3\n']
Note:
In the first example there are 4 subsequences "QAQ": "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN", "QAQAQYSYIOIWIN".
|
```python
s = input()
cunt = 0
for i,n in enumerate(s):
if n=='A':
x=s[0:i].count('Q')
y=s[i: ].count('Q')
cunt+=x*y
print(cunt)
```
| 3
|
|
490
|
A
|
Team Olympiad
|
PROGRAMMING
| 800
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
The School №0 of the capital of Berland has *n* children studying in it. All the children in this school are gifted: some of them are good at programming, some are good at maths, others are good at PE (Physical Education). Hence, for each child we know value *t**i*:
- *t**i*<==<=1, if the *i*-th child is good at programming, - *t**i*<==<=2, if the *i*-th child is good at maths, - *t**i*<==<=3, if the *i*-th child is good at PE
Each child happens to be good at exactly one of these three subjects.
The Team Scientific Decathlon Olympias requires teams of three students. The school teachers decided that the teams will be composed of three children that are good at different subjects. That is, each team must have one mathematician, one programmer and one sportsman. Of course, each child can be a member of no more than one team.
What is the maximum number of teams that the school will be able to present at the Olympiad? How should the teams be formed for that?
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=5000) — the number of children in the school. The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=3), where *t**i* describes the skill of the *i*-th child.
|
In the first line output integer *w* — the largest possible number of teams.
Then print *w* lines, containing three numbers in each line. Each triple represents the indexes of the children forming the team. You can print both the teams, and the numbers in the triplets in any order. The children are numbered from 1 to *n* in the order of their appearance in the input. Each child must participate in no more than one team. If there are several solutions, print any of them.
If no teams can be compiled, print the only line with value *w* equal to 0.
|
[
"7\n1 3 1 3 2 1 2\n",
"4\n2 1 1 2\n"
] |
[
"2\n3 5 2\n6 7 4\n",
"0\n"
] |
none
| 500
|
[
{
"input": "7\n1 3 1 3 2 1 2",
"output": "2\n3 5 2\n6 7 4"
},
{
"input": "4\n2 1 1 2",
"output": "0"
},
{
"input": "1\n2",
"output": "0"
},
{
"input": "2\n3 1",
"output": "0"
},
{
"input": "3\n2 1 2",
"output": "0"
},
{
"input": "3\n1 2 3",
"output": "1\n1 2 3"
},
{
"input": "12\n3 3 3 3 3 3 3 3 1 3 3 2",
"output": "1\n9 12 2"
},
{
"input": "60\n3 3 1 2 2 1 3 1 1 1 3 2 2 2 3 3 1 3 2 3 2 2 1 3 3 2 3 1 2 2 2 1 3 2 1 1 3 3 1 1 1 3 1 2 1 1 3 3 3 2 3 2 3 2 2 2 1 1 1 2",
"output": "20\n6 60 1\n17 44 20\n3 5 33\n36 21 42\n59 14 2\n58 26 49\n9 29 48\n23 19 24\n10 30 37\n41 54 15\n45 31 27\n57 55 38\n39 12 25\n35 34 11\n32 52 7\n8 50 18\n43 4 53\n46 56 51\n40 22 16\n28 13 47"
},
{
"input": "12\n3 1 1 1 1 1 1 2 1 1 1 1",
"output": "1\n3 8 1"
},
{
"input": "22\n2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 1 2 2 2 2",
"output": "1\n18 2 11"
},
{
"input": "138\n2 3 2 2 2 2 2 2 2 2 1 2 1 2 2 2 1 2 1 2 2 1 2 2 2 2 2 2 2 2 2 2 2 1 2 3 2 2 2 1 2 3 2 2 2 3 1 3 2 3 2 3 2 2 2 2 3 2 2 2 2 2 1 2 2 3 2 2 3 2 1 2 2 2 2 2 3 1 2 2 2 2 2 3 2 2 3 2 2 2 2 2 1 1 2 3 2 2 2 2 3 2 2 2 2 2 1 2 1 2 2 2 2 2 1 2 3 2 3 2 2 2 1 2 2 2 1 2 2 2 2 1 2 2 2 2 1 3",
"output": "18\n13 91 84\n34 90 48\n11 39 77\n78 129 50\n137 68 119\n132 122 138\n19 12 96\n40 7 2\n22 88 69\n107 73 46\n115 15 52\n127 106 87\n93 92 66\n71 112 117\n63 124 42\n17 70 101\n109 121 57\n123 25 36"
},
{
"input": "203\n2 2 1 2 1 2 2 2 1 2 2 1 1 3 1 2 1 2 1 1 2 3 1 1 2 3 3 2 2 2 1 2 1 1 1 1 1 3 1 1 2 1 1 2 2 2 1 2 2 2 1 2 3 2 1 1 2 2 1 2 1 2 2 1 1 2 2 2 1 1 2 2 1 2 1 2 2 3 2 1 2 1 1 1 1 1 1 1 1 1 1 2 2 1 1 2 2 2 2 1 1 1 1 1 1 1 2 2 2 2 2 1 1 1 2 2 2 1 2 2 1 3 2 1 1 1 2 1 1 2 1 1 2 2 2 1 1 2 2 2 1 2 1 3 2 1 2 2 2 1 1 1 2 2 2 1 2 1 1 2 2 2 2 2 1 1 2 1 2 2 1 1 1 1 1 1 2 2 3 1 1 2 3 1 1 1 1 1 1 2 2 1 1 1 2 2 3 2 1 3 1 1 1",
"output": "13\n188 72 14\n137 4 197\n158 76 122\n152 142 26\n104 119 179\n40 63 38\n12 1 78\n17 30 27\n189 60 53\n166 190 144\n129 7 183\n83 41 22\n121 81 200"
},
{
"input": "220\n1 1 3 1 3 1 1 3 1 3 3 3 3 1 3 3 1 3 3 3 3 3 1 1 1 3 1 1 1 3 2 3 3 3 1 1 3 3 1 1 3 3 3 3 1 3 3 1 1 1 2 3 1 1 1 2 3 3 3 2 3 1 1 3 1 1 1 3 2 1 3 2 3 1 1 3 3 3 1 3 1 1 1 3 3 2 1 3 2 1 1 3 3 1 1 1 2 1 1 3 2 1 2 1 1 1 3 1 3 3 1 2 3 3 3 3 1 3 1 1 1 1 2 3 1 1 1 1 1 1 3 2 3 1 3 1 3 1 1 3 1 3 1 3 1 3 1 3 3 2 3 1 3 3 1 3 3 3 3 1 1 3 3 3 3 1 1 3 3 3 2 1 1 1 3 3 1 3 3 3 1 1 1 3 1 3 3 1 1 1 2 3 1 1 3 1 1 1 1 2 3 1 1 2 3 3 1 3 1 3 3 3 3 1 3 2 3 1 1 3",
"output": "20\n198 89 20\n141 56 131\n166 204 19\n160 132 142\n111 112 195\n45 216 92\n6 31 109\n14 150 170\n199 60 18\n173 123 140\n134 69 156\n82 191 85\n126 200 80\n24 97 46\n62 86 149\n214 101 26\n79 171 78\n125 72 118\n172 103 162\n219 51 64"
},
{
"input": "61\n2 3 1 3 2 2 2 3 1 3 2 3 1 2 1 1 2 2 2 2 3 2 3 1 2 1 3 1 3 2 1 1 3 2 1 3 3 3 1 3 3 1 1 3 1 3 2 2 1 2 2 2 1 3 2 3 1 3 3 1 1",
"output": "20\n9 55 2\n24 34 27\n3 5 37\n35 17 41\n61 11 4\n60 19 54\n15 20 59\n26 14 29\n16 22 38\n43 50 12\n49 25 36\n57 51 40\n39 6 33\n32 30 10\n31 48 8\n13 47 23\n45 1 58\n53 52 56\n42 18 21\n28 7 44"
},
{
"input": "5\n1 2 2 3 3",
"output": "1\n1 3 4"
}
] | 1,683,523,495
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 41
| 46
| 1,126,400
|
n = int(input())
t = list(map(int, input().split()))
skills = [[], [], []]
for i in range(n):
skills[t[i] - 1].append(i + 1)
teams = []
num_teams = 0
while True:
team = []
for i in range(3):
if len(skills[i]) == 0:
break
team.append(skills[i][0])
skills[i] = skills[i][1:]
if len(team) == 3:
teams.append(team)
num_teams += 1
else:
break
print(num_teams)
for team in teams:
print(team[0], team[1], team[2])
|
Title: Team Olympiad
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The School №0 of the capital of Berland has *n* children studying in it. All the children in this school are gifted: some of them are good at programming, some are good at maths, others are good at PE (Physical Education). Hence, for each child we know value *t**i*:
- *t**i*<==<=1, if the *i*-th child is good at programming, - *t**i*<==<=2, if the *i*-th child is good at maths, - *t**i*<==<=3, if the *i*-th child is good at PE
Each child happens to be good at exactly one of these three subjects.
The Team Scientific Decathlon Olympias requires teams of three students. The school teachers decided that the teams will be composed of three children that are good at different subjects. That is, each team must have one mathematician, one programmer and one sportsman. Of course, each child can be a member of no more than one team.
What is the maximum number of teams that the school will be able to present at the Olympiad? How should the teams be formed for that?
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=5000) — the number of children in the school. The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=3), where *t**i* describes the skill of the *i*-th child.
Output Specification:
In the first line output integer *w* — the largest possible number of teams.
Then print *w* lines, containing three numbers in each line. Each triple represents the indexes of the children forming the team. You can print both the teams, and the numbers in the triplets in any order. The children are numbered from 1 to *n* in the order of their appearance in the input. Each child must participate in no more than one team. If there are several solutions, print any of them.
If no teams can be compiled, print the only line with value *w* equal to 0.
Demo Input:
['7\n1 3 1 3 2 1 2\n', '4\n2 1 1 2\n']
Demo Output:
['2\n3 5 2\n6 7 4\n', '0\n']
Note:
none
|
```python
n = int(input())
t = list(map(int, input().split()))
skills = [[], [], []]
for i in range(n):
skills[t[i] - 1].append(i + 1)
teams = []
num_teams = 0
while True:
team = []
for i in range(3):
if len(skills[i]) == 0:
break
team.append(skills[i][0])
skills[i] = skills[i][1:]
if len(team) == 3:
teams.append(team)
num_teams += 1
else:
break
print(num_teams)
for team in teams:
print(team[0], team[1], team[2])
```
| 3
|
|
723
|
A
|
The New Year: Meeting Friends
|
PROGRAMMING
| 800
|
[
"implementation",
"math",
"sortings"
] | null | null |
There are three friend living on the straight line *Ox* in Lineland. The first friend lives at the point *x*1, the second friend lives at the point *x*2, and the third friend lives at the point *x*3. They plan to celebrate the New Year together, so they need to meet at one point. What is the minimum total distance they have to travel in order to meet at some point and celebrate the New Year?
It's guaranteed that the optimal answer is always integer.
|
The first line of the input contains three distinct integers *x*1, *x*2 and *x*3 (1<=≤<=*x*1,<=*x*2,<=*x*3<=≤<=100) — the coordinates of the houses of the first, the second and the third friends respectively.
|
Print one integer — the minimum total distance the friends need to travel in order to meet together.
|
[
"7 1 4\n",
"30 20 10\n"
] |
[
"6\n",
"20\n"
] |
In the first sample, friends should meet at the point 4. Thus, the first friend has to travel the distance of 3 (from the point 7 to the point 4), the second friend also has to travel the distance of 3 (from the point 1 to the point 4), while the third friend should not go anywhere because he lives at the point 4.
| 500
|
[
{
"input": "7 1 4",
"output": "6"
},
{
"input": "30 20 10",
"output": "20"
},
{
"input": "1 4 100",
"output": "99"
},
{
"input": "100 1 91",
"output": "99"
},
{
"input": "1 45 100",
"output": "99"
},
{
"input": "1 2 3",
"output": "2"
},
{
"input": "71 85 88",
"output": "17"
},
{
"input": "30 38 99",
"output": "69"
},
{
"input": "23 82 95",
"output": "72"
},
{
"input": "22 41 47",
"output": "25"
},
{
"input": "9 94 77",
"output": "85"
},
{
"input": "1 53 51",
"output": "52"
},
{
"input": "25 97 93",
"output": "72"
},
{
"input": "42 53 51",
"output": "11"
},
{
"input": "81 96 94",
"output": "15"
},
{
"input": "21 5 93",
"output": "88"
},
{
"input": "50 13 75",
"output": "62"
},
{
"input": "41 28 98",
"output": "70"
},
{
"input": "69 46 82",
"output": "36"
},
{
"input": "87 28 89",
"output": "61"
},
{
"input": "44 45 40",
"output": "5"
},
{
"input": "86 97 68",
"output": "29"
},
{
"input": "43 92 30",
"output": "62"
},
{
"input": "16 70 1",
"output": "69"
},
{
"input": "40 46 19",
"output": "27"
},
{
"input": "71 38 56",
"output": "33"
},
{
"input": "82 21 80",
"output": "61"
},
{
"input": "75 8 35",
"output": "67"
},
{
"input": "75 24 28",
"output": "51"
},
{
"input": "78 23 56",
"output": "55"
},
{
"input": "85 31 10",
"output": "75"
},
{
"input": "76 50 9",
"output": "67"
},
{
"input": "95 37 34",
"output": "61"
},
{
"input": "84 61 35",
"output": "49"
},
{
"input": "87 85 37",
"output": "50"
},
{
"input": "1 3 2",
"output": "2"
},
{
"input": "4 2 6",
"output": "4"
},
{
"input": "6 9 3",
"output": "6"
},
{
"input": "12 4 8",
"output": "8"
},
{
"input": "15 10 5",
"output": "10"
},
{
"input": "1 50 17",
"output": "49"
},
{
"input": "10 5 15",
"output": "10"
},
{
"input": "8 1 9",
"output": "8"
},
{
"input": "3 5 4",
"output": "2"
},
{
"input": "2 1 3",
"output": "2"
},
{
"input": "1 8 2",
"output": "7"
},
{
"input": "1 100 2",
"output": "99"
},
{
"input": "1 4 6",
"output": "5"
}
] | 1,671,510,977
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 0
| 31
| 0
|
d = [int(x) for x in input().split()]
mx,mn=-1,500
for i in d:
if i>mx:
mx=i
if i<mn:
mn=i
print(int((mx+mn)/2))
|
Title: The New Year: Meeting Friends
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are three friend living on the straight line *Ox* in Lineland. The first friend lives at the point *x*1, the second friend lives at the point *x*2, and the third friend lives at the point *x*3. They plan to celebrate the New Year together, so they need to meet at one point. What is the minimum total distance they have to travel in order to meet at some point and celebrate the New Year?
It's guaranteed that the optimal answer is always integer.
Input Specification:
The first line of the input contains three distinct integers *x*1, *x*2 and *x*3 (1<=≤<=*x*1,<=*x*2,<=*x*3<=≤<=100) — the coordinates of the houses of the first, the second and the third friends respectively.
Output Specification:
Print one integer — the minimum total distance the friends need to travel in order to meet together.
Demo Input:
['7 1 4\n', '30 20 10\n']
Demo Output:
['6\n', '20\n']
Note:
In the first sample, friends should meet at the point 4. Thus, the first friend has to travel the distance of 3 (from the point 7 to the point 4), the second friend also has to travel the distance of 3 (from the point 1 to the point 4), while the third friend should not go anywhere because he lives at the point 4.
|
```python
d = [int(x) for x in input().split()]
mx,mn=-1,500
for i in d:
if i>mx:
mx=i
if i<mn:
mn=i
print(int((mx+mn)/2))
```
| 0
|
|
931
|
C
|
Laboratory Work
|
PROGRAMMING
| 1,700
|
[
"implementation",
"math"
] | null | null |
Anya and Kirill are doing a physics laboratory work. In one of the tasks they have to measure some value *n* times, and then compute the average value to lower the error.
Kirill has already made his measurements, and has got the following integer values: *x*1, *x*2, ..., *x**n*. It is important that the values are close to each other, namely, the difference between the maximum value and the minimum value is at most 2.
Anya does not want to make the measurements, however, she can't just copy the values from Kirill's work, because the error of each measurement is a random value, and this coincidence will be noted by the teacher. Anya wants to write such integer values *y*1, *y*2, ..., *y**n* in her work, that the following conditions are met:
- the average value of *x*1,<=*x*2,<=...,<=*x**n* is equal to the average value of *y*1,<=*y*2,<=...,<=*y**n*;- all Anya's measurements are in the same bounds as all Kirill's measurements, that is, the maximum value among Anya's values is not greater than the maximum value among Kirill's values, and the minimum value among Anya's values is not less than the minimum value among Kirill's values;- the number of equal measurements in Anya's work and Kirill's work is as small as possible among options with the previous conditions met. Formally, the teacher goes through all Anya's values one by one, if there is equal value in Kirill's work and it is not strike off yet, he strikes off this Anya's value and one of equal values in Kirill's work. The number of equal measurements is then the total number of strike off values in Anya's work.
Help Anya to write such a set of measurements that the conditions above are met.
|
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the numeber of measurements made by Kirill.
The second line contains a sequence of integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=100<=000<=≤<=*x**i*<=≤<=100<=000) — the measurements made by Kirill. It is guaranteed that the difference between the maximum and minimum values among values *x*1,<=*x*2,<=...,<=*x**n* does not exceed 2.
|
In the first line print the minimum possible number of equal measurements.
In the second line print *n* integers *y*1,<=*y*2,<=...,<=*y**n* — the values Anya should write. You can print the integers in arbitrary order. Keep in mind that the minimum value among Anya's values should be not less that the minimum among Kirill's values, and the maximum among Anya's values should be not greater than the maximum among Kirill's values.
If there are multiple answers, print any of them.
|
[
"6\n-1 1 1 0 0 -1\n",
"3\n100 100 101\n",
"7\n-10 -9 -10 -8 -10 -9 -9\n"
] |
[
"2\n0 0 0 0 0 0 \n",
"3\n101 100 100 \n",
"5\n-10 -10 -9 -9 -9 -9 -9 \n"
] |
In the first example Anya can write zeros as here measurements results. The average value is then equal to the average value of Kirill's values, and there are only two equal measurements.
In the second example Anya should write two values 100 and one value 101 (in any order), because it is the only possibility to make the average be the equal to the average of Kirill's values. Thus, all three measurements are equal.
In the third example the number of equal measurements is 5.
| 1,750
|
[
{
"input": "6\n-1 1 1 0 0 -1",
"output": "2\n0 0 0 0 0 0 "
},
{
"input": "3\n100 100 101",
"output": "3\n101 100 100 "
},
{
"input": "7\n-10 -9 -10 -8 -10 -9 -9",
"output": "5\n-10 -10 -9 -9 -9 -9 -9 "
},
{
"input": "60\n-8536 -8536 -8536 -8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535 -8536 -8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535 -8536 -8536 -8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535 -8536 -8536 -8536 -8535 -8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535",
"output": "60\n-8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535 -8535 -8536 -8536 -8536 -8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535 -8536 -8536 -8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535 -8536 -8535 -8536 -8536 -8536 -8536 -8536 -8536 -8536 -8535 -8536 -8536 -8536 "
},
{
"input": "9\n-71360 -71359 -71360 -71360 -71359 -71359 -71359 -71359 -71359",
"output": "9\n-71359 -71359 -71359 -71359 -71359 -71360 -71360 -71359 -71360 "
},
{
"input": "10\n100 100 100 100 100 100 100 100 100 100",
"output": "10\n100 100 100 100 100 100 100 100 100 100 "
},
{
"input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0",
"output": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 "
},
{
"input": "5\n-399 -399 -400 -399 -400",
"output": "5\n-400 -399 -400 -399 -399 "
},
{
"input": "10\n1001 1000 1000 1001 1000 1000 1001 1001 1000 1001",
"output": "10\n1001 1000 1001 1001 1000 1000 1001 1000 1000 1001 "
},
{
"input": "20\n-100000 -99999 -100000 -99999 -99999 -100000 -99999 -100000 -99999 -100000 -99999 -99999 -99999 -100000 -100000 -99999 -100000 -100000 -100000 -99999",
"output": "20\n-99999 -100000 -100000 -100000 -99999 -100000 -100000 -99999 -99999 -99999 -100000 -99999 -100000 -99999 -100000 -99999 -99999 -100000 -99999 -100000 "
},
{
"input": "50\n99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 100000 99999 99999 99999 99999 99999 100000 99999 99999 99999 100000 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 100000 99999 99999 99999 100000 99999 99999 99999",
"output": "50\n99999 99999 99999 100000 99999 99999 99999 100000 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 100000 99999 99999 99999 100000 99999 99999 99999 99999 99999 100000 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 99999 "
},
{
"input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 "
},
{
"input": "1\n-100000",
"output": "1\n-100000 "
},
{
"input": "1\n-1",
"output": "1\n-1 "
},
{
"input": "1\n0",
"output": "1\n0 "
},
{
"input": "1\n1",
"output": "1\n1 "
},
{
"input": "1\n100000",
"output": "1\n100000 "
},
{
"input": "5\n2 2 1 1 2",
"output": "5\n2 1 1 2 2 "
},
{
"input": "10\n0 -1 0 1 1 1 1 -1 0 0",
"output": "6\n0 0 0 0 0 0 0 0 1 1 "
},
{
"input": "20\n-4344 -4342 -4344 -4342 -4343 -4343 -4344 -4344 -4342 -4343 -4344 -4343 -4344 -4344 -4344 -4342 -4344 -4343 -4342 -4344",
"output": "10\n-4344 -4344 -4344 -4344 -4344 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 -4343 "
},
{
"input": "40\n113 113 112 112 112 112 112 112 112 112 112 113 113 112 113 112 113 112 112 112 111 112 112 113 112 112 112 112 112 112 112 112 113 112 113 112 112 113 112 113",
"output": "12\n111 111 111 111 111 111 111 111 111 111 111 111 111 111 111 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 113 "
},
{
"input": "5\n-94523 -94523 -94523 -94524 -94524",
"output": "5\n-94524 -94524 -94523 -94523 -94523 "
},
{
"input": "10\n-35822 -35823 -35823 -35823 -35821 -35823 -35823 -35821 -35822 -35821",
"output": "4\n-35823 -35823 -35822 -35822 -35822 -35822 -35822 -35822 -35822 -35822 "
},
{
"input": "11\n-50353 -50353 -50353 -50353 -50353 -50352 -50353 -50353 -50353 -50353 -50352",
"output": "11\n-50352 -50353 -50353 -50353 -50353 -50352 -50353 -50353 -50353 -50353 -50353 "
},
{
"input": "20\n46795 46795 46795 46795 46795 46795 46795 46793 46794 46795 46794 46795 46795 46795 46795 46795 46795 46795 46795 46795",
"output": "18\n46794 46794 46794 46794 46795 46795 46795 46795 46795 46795 46795 46795 46795 46795 46795 46795 46795 46795 46795 46795 "
},
{
"input": "40\n72263 72261 72262 72263 72263 72263 72263 72263 72263 72262 72263 72263 72263 72263 72263 72262 72263 72262 72263 72262 72262 72263 72263 72262 72263 72263 72262 72262 72263 72262 72263 72263 72263 72263 72263 72263 72263 72263 72263 72262",
"output": "30\n72261 72261 72261 72261 72261 72261 72262 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 72263 "
},
{
"input": "50\n-46992 -46992 -46992 -46991 -46992 -46991 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46991 -46991 -46991 -46992 -46990 -46991 -46991 -46991 -46991 -46992 -46992 -46991 -46992 -46992 -46992 -46990 -46992 -46991 -46991 -46992 -46992 -46992 -46991 -46991 -46991 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992",
"output": "36\n-46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46992 -46991 -46990 -46990 -46990 -46990 -46990 -46990 -46990 -46990 -46990 "
},
{
"input": "60\n-86077 -86075 -86076 -86076 -86077 -86077 -86075 -86075 -86075 -86077 -86075 -86076 -86075 -86075 -86075 -86076 -86075 -86076 -86075 -86075 -86076 -86076 -86076 -86075 -86075 -86075 -86075 -86077 -86075 -86076 -86075 -86075 -86075 -86076 -86075 -86076 -86077 -86075 -86075 -86075 -86076 -86075 -86076 -86075 -86076 -86076 -86075 -86076 -86076 -86075 -86075 -86075 -86077 -86076 -86075 -86075 -86075 -86075 -86075 -86075",
"output": "42\n-86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86077 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 -86075 "
},
{
"input": "70\n-87 -86 -88 -86 -87 -86 -88 -88 -87 -86 -86 -88 -86 -86 -88 -87 -87 -87 -86 -87 -87 -87 -88 -88 -88 -87 -88 -87 -88 -87 -88 -86 -86 -86 -88 -86 -87 -87 -86 -86 -88 -86 -88 -87 -88 -87 -87 -86 -88 -87 -86 -88 -87 -86 -87 -87 -86 -88 -87 -86 -87 -88 -87 -88 -86 -87 -88 -88 -87 -87",
"output": "28\n-88 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 -87 "
},
{
"input": "2\n0 2",
"output": "0\n1 1 "
},
{
"input": "4\n1 1 3 3",
"output": "0\n2 2 2 2 "
},
{
"input": "6\n1 1 1 3 3 3",
"output": "0\n2 2 2 2 2 2 "
},
{
"input": "2\n1 3",
"output": "0\n2 2 "
},
{
"input": "7\n0 1 1 1 1 1 2",
"output": "3\n0 0 0 1 2 2 2 "
},
{
"input": "6\n1 1 1 -1 -1 -1",
"output": "0\n0 0 0 0 0 0 "
},
{
"input": "3\n1 1 3",
"output": "1\n1 2 2 "
},
{
"input": "2\n2 0",
"output": "0\n1 1 "
},
{
"input": "10\n1 3 3 3 3 3 3 3 3 3",
"output": "8\n2 2 3 3 3 3 3 3 3 3 "
},
{
"input": "7\n1 3 3 3 3 3 3",
"output": "5\n2 2 3 3 3 3 3 "
},
{
"input": "7\n1 2 2 2 2 2 3",
"output": "3\n1 1 1 2 3 3 3 "
},
{
"input": "5\n-8 -8 -8 -10 -10",
"output": "1\n-9 -9 -9 -9 -8 "
},
{
"input": "3\n1 2 3",
"output": "1\n2 2 2 "
},
{
"input": "4\n2 2 4 4",
"output": "0\n3 3 3 3 "
},
{
"input": "4\n1 1 -1 -1",
"output": "0\n0 0 0 0 "
}
] | 1,520,181,888
| 4,188
|
Python 3
|
WRONG_ANSWER
|
PRETESTS
| 10
| 421
| 13,004,800
|
n=int(input())
l=list(map(int,input().split()))
m=min(l)
p=max(l)
cm=l.count(m)
cp=l.count(p)
if p-m==2:
x=min(cm,cp)
print(n-2*x)
for i in range(2*x+n-cp-cm):
print((m+p)//2,end=" ")
if cm>cp:
for i in range(cm-cp):
print(m,end=" ")
else:
for i in range(cp-cm):
print(p,end=" ")
else:
print(n)
for i in l:
print(i,end=" ")
|
Title: Laboratory Work
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Anya and Kirill are doing a physics laboratory work. In one of the tasks they have to measure some value *n* times, and then compute the average value to lower the error.
Kirill has already made his measurements, and has got the following integer values: *x*1, *x*2, ..., *x**n*. It is important that the values are close to each other, namely, the difference between the maximum value and the minimum value is at most 2.
Anya does not want to make the measurements, however, she can't just copy the values from Kirill's work, because the error of each measurement is a random value, and this coincidence will be noted by the teacher. Anya wants to write such integer values *y*1, *y*2, ..., *y**n* in her work, that the following conditions are met:
- the average value of *x*1,<=*x*2,<=...,<=*x**n* is equal to the average value of *y*1,<=*y*2,<=...,<=*y**n*;- all Anya's measurements are in the same bounds as all Kirill's measurements, that is, the maximum value among Anya's values is not greater than the maximum value among Kirill's values, and the minimum value among Anya's values is not less than the minimum value among Kirill's values;- the number of equal measurements in Anya's work and Kirill's work is as small as possible among options with the previous conditions met. Formally, the teacher goes through all Anya's values one by one, if there is equal value in Kirill's work and it is not strike off yet, he strikes off this Anya's value and one of equal values in Kirill's work. The number of equal measurements is then the total number of strike off values in Anya's work.
Help Anya to write such a set of measurements that the conditions above are met.
Input Specification:
The first line contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the numeber of measurements made by Kirill.
The second line contains a sequence of integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=100<=000<=≤<=*x**i*<=≤<=100<=000) — the measurements made by Kirill. It is guaranteed that the difference between the maximum and minimum values among values *x*1,<=*x*2,<=...,<=*x**n* does not exceed 2.
Output Specification:
In the first line print the minimum possible number of equal measurements.
In the second line print *n* integers *y*1,<=*y*2,<=...,<=*y**n* — the values Anya should write. You can print the integers in arbitrary order. Keep in mind that the minimum value among Anya's values should be not less that the minimum among Kirill's values, and the maximum among Anya's values should be not greater than the maximum among Kirill's values.
If there are multiple answers, print any of them.
Demo Input:
['6\n-1 1 1 0 0 -1\n', '3\n100 100 101\n', '7\n-10 -9 -10 -8 -10 -9 -9\n']
Demo Output:
['2\n0 0 0 0 0 0 \n', '3\n101 100 100 \n', '5\n-10 -10 -9 -9 -9 -9 -9 \n']
Note:
In the first example Anya can write zeros as here measurements results. The average value is then equal to the average value of Kirill's values, and there are only two equal measurements.
In the second example Anya should write two values 100 and one value 101 (in any order), because it is the only possibility to make the average be the equal to the average of Kirill's values. Thus, all three measurements are equal.
In the third example the number of equal measurements is 5.
|
```python
n=int(input())
l=list(map(int,input().split()))
m=min(l)
p=max(l)
cm=l.count(m)
cp=l.count(p)
if p-m==2:
x=min(cm,cp)
print(n-2*x)
for i in range(2*x+n-cp-cm):
print((m+p)//2,end=" ")
if cm>cp:
for i in range(cm-cp):
print(m,end=" ")
else:
for i in range(cp-cm):
print(p,end=" ")
else:
print(n)
for i in l:
print(i,end=" ")
```
| 0
|
|
208
|
A
|
Dubstep
|
PROGRAMMING
| 900
|
[
"strings"
] | null | null |
Vasya works as a DJ in the best Berland nightclub, and he often uses dubstep music in his performance. Recently, he has decided to take a couple of old songs and make dubstep remixes from them.
Let's assume that a song consists of some number of words. To make the dubstep remix of this song, Vasya inserts a certain number of words "WUB" before the first word of the song (the number may be zero), after the last word (the number may be zero), and between words (at least one between any pair of neighbouring words), and then the boy glues together all the words, including "WUB", in one string and plays the song at the club.
For example, a song with words "I AM X" can transform into a dubstep remix as "WUBWUBIWUBAMWUBWUBX" and cannot transform into "WUBWUBIAMWUBX".
Recently, Petya has heard Vasya's new dubstep track, but since he isn't into modern music, he decided to find out what was the initial song that Vasya remixed. Help Petya restore the original song.
|
The input consists of a single non-empty string, consisting only of uppercase English letters, the string's length doesn't exceed 200 characters. It is guaranteed that before Vasya remixed the song, no word contained substring "WUB" in it; Vasya didn't change the word order. It is also guaranteed that initially the song had at least one word.
|
Print the words of the initial song that Vasya used to make a dubsteb remix. Separate the words with a space.
|
[
"WUBWUBABCWUB\n",
"WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB\n"
] |
[
"ABC ",
"WE ARE THE CHAMPIONS MY FRIEND "
] |
In the first sample: "WUBWUBABCWUB" = "WUB" + "WUB" + "ABC" + "WUB". That means that the song originally consisted of a single word "ABC", and all words "WUB" were added by Vasya.
In the second sample Vasya added a single word "WUB" between all neighbouring words, in the beginning and in the end, except for words "ARE" and "THE" — between them Vasya added two "WUB".
| 500
|
[
{
"input": "WUBWUBABCWUB",
"output": "ABC "
},
{
"input": "WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB",
"output": "WE ARE THE CHAMPIONS MY FRIEND "
},
{
"input": "WUBWUBWUBSR",
"output": "SR "
},
{
"input": "RWUBWUBWUBLWUB",
"output": "R L "
},
{
"input": "ZJWUBWUBWUBJWUBWUBWUBL",
"output": "ZJ J L "
},
{
"input": "CWUBBWUBWUBWUBEWUBWUBWUBQWUBWUBWUB",
"output": "C B E Q "
},
{
"input": "WUBJKDWUBWUBWBIRAQKFWUBWUBYEWUBWUBWUBWVWUBWUB",
"output": "JKD WBIRAQKF YE WV "
},
{
"input": "WUBKSDHEMIXUJWUBWUBRWUBWUBWUBSWUBWUBWUBHWUBWUBWUB",
"output": "KSDHEMIXUJ R S H "
},
{
"input": "OGWUBWUBWUBXWUBWUBWUBIWUBWUBWUBKOWUBWUB",
"output": "OG X I KO "
},
{
"input": "QWUBQQWUBWUBWUBIWUBWUBWWWUBWUBWUBJOPJPBRH",
"output": "Q QQ I WW JOPJPBRH "
},
{
"input": "VSRNVEATZTLGQRFEGBFPWUBWUBWUBAJWUBWUBWUBPQCHNWUBCWUB",
"output": "VSRNVEATZTLGQRFEGBFP AJ PQCHN C "
},
{
"input": "WUBWUBEWUBWUBWUBIQMJNIQWUBWUBWUBGZZBQZAUHYPWUBWUBWUBPMRWUBWUBWUBDCV",
"output": "E IQMJNIQ GZZBQZAUHYP PMR DCV "
},
{
"input": "WUBWUBWUBFVWUBWUBWUBBPSWUBWUBWUBRXNETCJWUBWUBWUBJDMBHWUBWUBWUBBWUBWUBVWUBWUBB",
"output": "FV BPS RXNETCJ JDMBH B V B "
},
{
"input": "WUBWUBWUBFBQWUBWUBWUBIDFSYWUBWUBWUBCTWDMWUBWUBWUBSXOWUBWUBWUBQIWUBWUBWUBL",
"output": "FBQ IDFSY CTWDM SXO QI L "
},
{
"input": "IWUBWUBQLHDWUBYIIKZDFQWUBWUBWUBCXWUBWUBUWUBWUBWUBKWUBWUBWUBNL",
"output": "I QLHD YIIKZDFQ CX U K NL "
},
{
"input": "KWUBUPDYXGOKUWUBWUBWUBAGOAHWUBIZDWUBWUBWUBIYWUBWUBWUBVWUBWUBWUBPWUBWUBWUBE",
"output": "K UPDYXGOKU AGOAH IZD IY V P E "
},
{
"input": "WUBWUBOWUBWUBWUBIPVCQAFWYWUBWUBWUBQWUBWUBWUBXHDKCPYKCTWWYWUBWUBWUBVWUBWUBWUBFZWUBWUB",
"output": "O IPVCQAFWY Q XHDKCPYKCTWWY V FZ "
},
{
"input": "PAMJGYWUBWUBWUBXGPQMWUBWUBWUBTKGSXUYWUBWUBWUBEWUBWUBWUBNWUBWUBWUBHWUBWUBWUBEWUBWUB",
"output": "PAMJGY XGPQM TKGSXUY E N H E "
},
{
"input": "WUBYYRTSMNWUWUBWUBWUBCWUBWUBWUBCWUBWUBWUBFSYUINDWOBVWUBWUBWUBFWUBWUBWUBAUWUBWUBWUBVWUBWUBWUBJB",
"output": "YYRTSMNWU C C FSYUINDWOBV F AU V JB "
},
{
"input": "WUBWUBYGPYEYBNRTFKOQCWUBWUBWUBUYGRTQEGWLFYWUBWUBWUBFVWUBHPWUBWUBWUBXZQWUBWUBWUBZDWUBWUBWUBM",
"output": "YGPYEYBNRTFKOQC UYGRTQEGWLFY FV HP XZQ ZD M "
},
{
"input": "WUBZVMJWUBWUBWUBFOIMJQWKNZUBOFOFYCCWUBWUBWUBAUWWUBRDRADWUBWUBWUBCHQVWUBWUBWUBKFTWUBWUBWUBW",
"output": "ZVMJ FOIMJQWKNZUBOFOFYCC AUW RDRAD CHQV KFT W "
},
{
"input": "WUBWUBZBKOKHQLGKRVIMZQMQNRWUBWUBWUBDACWUBWUBNZHFJMPEYKRVSWUBWUBWUBPPHGAVVPRZWUBWUBWUBQWUBWUBAWUBG",
"output": "ZBKOKHQLGKRVIMZQMQNR DAC NZHFJMPEYKRVS PPHGAVVPRZ Q A G "
},
{
"input": "WUBWUBJWUBWUBWUBNFLWUBWUBWUBGECAWUBYFKBYJWTGBYHVSSNTINKWSINWSMAWUBWUBWUBFWUBWUBWUBOVWUBWUBLPWUBWUBWUBN",
"output": "J NFL GECA YFKBYJWTGBYHVSSNTINKWSINWSMA F OV LP N "
},
{
"input": "WUBWUBLCWUBWUBWUBZGEQUEATJVIXETVTWUBWUBWUBEXMGWUBWUBWUBRSWUBWUBWUBVWUBWUBWUBTAWUBWUBWUBCWUBWUBWUBQG",
"output": "LC ZGEQUEATJVIXETVT EXMG RS V TA C QG "
},
{
"input": "WUBMPWUBWUBWUBORWUBWUBDLGKWUBWUBWUBVVZQCAAKVJTIKWUBWUBWUBTJLUBZJCILQDIFVZWUBWUBYXWUBWUBWUBQWUBWUBWUBLWUB",
"output": "MP OR DLGK VVZQCAAKVJTIK TJLUBZJCILQDIFVZ YX Q L "
},
{
"input": "WUBNXOLIBKEGXNWUBWUBWUBUWUBGITCNMDQFUAOVLWUBWUBWUBAIJDJZJHFMPVTPOXHPWUBWUBWUBISCIOWUBWUBWUBGWUBWUBWUBUWUB",
"output": "NXOLIBKEGXN U GITCNMDQFUAOVL AIJDJZJHFMPVTPOXHP ISCIO G U "
},
{
"input": "WUBWUBNMMWCZOLYPNBELIYVDNHJUNINWUBWUBWUBDXLHYOWUBWUBWUBOJXUWUBWUBWUBRFHTGJCEFHCGWARGWUBWUBWUBJKWUBWUBSJWUBWUB",
"output": "NMMWCZOLYPNBELIYVDNHJUNIN DXLHYO OJXU RFHTGJCEFHCGWARG JK SJ "
},
{
"input": "SGWLYSAUJOJBNOXNWUBWUBWUBBOSSFWKXPDPDCQEWUBWUBWUBDIRZINODWUBWUBWUBWWUBWUBWUBPPHWUBWUBWUBRWUBWUBWUBQWUBWUBWUBJWUB",
"output": "SGWLYSAUJOJBNOXN BOSSFWKXPDPDCQE DIRZINOD W PPH R Q J "
},
{
"input": "TOWUBWUBWUBGBTBNWUBWUBWUBJVIOJBIZFUUYHUAIEBQLQXPQKZJMPTCWBKPOSAWUBWUBWUBSWUBWUBWUBTOLVXWUBWUBWUBNHWUBWUBWUBO",
"output": "TO GBTBN JVIOJBIZFUUYHUAIEBQLQXPQKZJMPTCWBKPOSA S TOLVX NH O "
},
{
"input": "WUBWUBWSPLAYSZSAUDSWUBWUBWUBUWUBWUBWUBKRWUBWUBWUBRSOKQMZFIYZQUWUBWUBWUBELSHUWUBWUBWUBUKHWUBWUBWUBQXEUHQWUBWUBWUBBWUBWUBWUBR",
"output": "WSPLAYSZSAUDS U KR RSOKQMZFIYZQU ELSHU UKH QXEUHQ B R "
},
{
"input": "WUBXEMWWVUHLSUUGRWUBWUBWUBAWUBXEGILZUNKWUBWUBWUBJDHHKSWUBWUBWUBDTSUYSJHWUBWUBWUBPXFWUBMOHNJWUBWUBWUBZFXVMDWUBWUBWUBZMWUBWUB",
"output": "XEMWWVUHLSUUGR A XEGILZUNK JDHHKS DTSUYSJH PXF MOHNJ ZFXVMD ZM "
},
{
"input": "BMBWUBWUBWUBOQKWUBWUBWUBPITCIHXHCKLRQRUGXJWUBWUBWUBVWUBWUBWUBJCWUBWUBWUBQJPWUBWUBWUBBWUBWUBWUBBMYGIZOOXWUBWUBWUBTAGWUBWUBHWUB",
"output": "BMB OQK PITCIHXHCKLRQRUGXJ V JC QJP B BMYGIZOOX TAG H "
},
{
"input": "CBZNWUBWUBWUBNHWUBWUBWUBYQSYWUBWUBWUBMWUBWUBWUBXRHBTMWUBWUBWUBPCRCWUBWUBWUBTZUYLYOWUBWUBWUBCYGCWUBWUBWUBCLJWUBWUBWUBSWUBWUBWUB",
"output": "CBZN NH YQSY M XRHBTM PCRC TZUYLYO CYGC CLJ S "
},
{
"input": "DPDWUBWUBWUBEUQKWPUHLTLNXHAEKGWUBRRFYCAYZFJDCJLXBAWUBWUBWUBHJWUBOJWUBWUBWUBNHBJEYFWUBWUBWUBRWUBWUBWUBSWUBWWUBWUBWUBXDWUBWUBWUBJWUB",
"output": "DPD EUQKWPUHLTLNXHAEKG RRFYCAYZFJDCJLXBA HJ OJ NHBJEYF R S W XD J "
},
{
"input": "WUBWUBWUBISERPQITVIYERSCNWUBWUBWUBQWUBWUBWUBDGSDIPWUBWUBWUBCAHKDZWEXBIBJVVSKKVQJWUBWUBWUBKIWUBWUBWUBCWUBWUBWUBAWUBWUBWUBPWUBWUBWUBHWUBWUBWUBF",
"output": "ISERPQITVIYERSCN Q DGSDIP CAHKDZWEXBIBJVVSKKVQJ KI C A P H F "
},
{
"input": "WUBWUBWUBIWUBWUBLIKNQVWUBWUBWUBPWUBWUBWUBHWUBWUBWUBMWUBWUBWUBDPRSWUBWUBWUBBSAGYLQEENWXXVWUBWUBWUBXMHOWUBWUBWUBUWUBWUBWUBYRYWUBWUBWUBCWUBWUBWUBY",
"output": "I LIKNQV P H M DPRS BSAGYLQEENWXXV XMHO U YRY C Y "
},
{
"input": "WUBWUBWUBMWUBWUBWUBQWUBWUBWUBITCFEYEWUBWUBWUBHEUWGNDFNZGWKLJWUBWUBWUBMZPWUBWUBWUBUWUBWUBWUBBWUBWUBWUBDTJWUBHZVIWUBWUBWUBPWUBFNHHWUBWUBWUBVTOWUB",
"output": "M Q ITCFEYE HEUWGNDFNZGWKLJ MZP U B DTJ HZVI P FNHH VTO "
},
{
"input": "WUBWUBNDNRFHYJAAUULLHRRDEDHYFSRXJWUBWUBWUBMUJVDTIRSGYZAVWKRGIFWUBWUBWUBHMZWUBWUBWUBVAIWUBWUBWUBDDKJXPZRGWUBWUBWUBSGXWUBWUBWUBIFKWUBWUBWUBUWUBWUBWUBW",
"output": "NDNRFHYJAAUULLHRRDEDHYFSRXJ MUJVDTIRSGYZAVWKRGIF HMZ VAI DDKJXPZRG SGX IFK U W "
},
{
"input": "WUBOJMWRSLAXXHQRTPMJNCMPGWUBWUBWUBNYGMZIXNLAKSQYWDWUBWUBWUBXNIWUBWUBWUBFWUBWUBWUBXMBWUBWUBWUBIWUBWUBWUBINWUBWUBWUBWDWUBWUBWUBDDWUBWUBWUBD",
"output": "OJMWRSLAXXHQRTPMJNCMPG NYGMZIXNLAKSQYWD XNI F XMB I IN WD DD D "
},
{
"input": "WUBWUBWUBREHMWUBWUBWUBXWUBWUBWUBQASNWUBWUBWUBNLSMHLCMTICWUBWUBWUBVAWUBWUBWUBHNWUBWUBWUBNWUBWUBWUBUEXLSFOEULBWUBWUBWUBXWUBWUBWUBJWUBWUBWUBQWUBWUBWUBAWUBWUB",
"output": "REHM X QASN NLSMHLCMTIC VA HN N UEXLSFOEULB X J Q A "
},
{
"input": "WUBWUBWUBSTEZTZEFFIWUBWUBWUBSWUBWUBWUBCWUBFWUBHRJPVWUBWUBWUBDYJUWUBWUBWUBPWYDKCWUBWUBWUBCWUBWUBWUBUUEOGCVHHBWUBWUBWUBEXLWUBWUBWUBVCYWUBWUBWUBMWUBWUBWUBYWUB",
"output": "STEZTZEFFI S C F HRJPV DYJU PWYDKC C UUEOGCVHHB EXL VCY M Y "
},
{
"input": "WPPNMSQOQIWUBWUBWUBPNQXWUBWUBWUBHWUBWUBWUBNFLWUBWUBWUBGWSGAHVJFNUWUBWUBWUBFWUBWUBWUBWCMLRICFSCQQQTNBWUBWUBWUBSWUBWUBWUBKGWUBWUBWUBCWUBWUBWUBBMWUBWUBWUBRWUBWUB",
"output": "WPPNMSQOQI PNQX H NFL GWSGAHVJFNU F WCMLRICFSCQQQTNB S KG C BM R "
},
{
"input": "YZJOOYITZRARKVFYWUBWUBRZQGWUBWUBWUBUOQWUBWUBWUBIWUBWUBWUBNKVDTBOLETKZISTWUBWUBWUBWLWUBQQFMMGSONZMAWUBZWUBWUBWUBQZUXGCWUBWUBWUBIRZWUBWUBWUBLTTVTLCWUBWUBWUBY",
"output": "YZJOOYITZRARKVFY RZQG UOQ I NKVDTBOLETKZIST WL QQFMMGSONZMA Z QZUXGC IRZ LTTVTLC Y "
},
{
"input": "WUBCAXNCKFBVZLGCBWCOAWVWOFKZVQYLVTWUBWUBWUBNLGWUBWUBWUBAMGDZBDHZMRMQMDLIRMIWUBWUBWUBGAJSHTBSWUBWUBWUBCXWUBWUBWUBYWUBZLXAWWUBWUBWUBOHWUBWUBWUBZWUBWUBWUBGBWUBWUBWUBE",
"output": "CAXNCKFBVZLGCBWCOAWVWOFKZVQYLVT NLG AMGDZBDHZMRMQMDLIRMI GAJSHTBS CX Y ZLXAW OH Z GB E "
},
{
"input": "WUBWUBCHXSOWTSQWUBWUBWUBCYUZBPBWUBWUBWUBSGWUBWUBWKWORLRRLQYUUFDNWUBWUBWUBYYGOJNEVEMWUBWUBWUBRWUBWUBWUBQWUBWUBWUBIHCKWUBWUBWUBKTWUBWUBWUBRGSNTGGWUBWUBWUBXCXWUBWUBWUBS",
"output": "CHXSOWTSQ CYUZBPB SG WKWORLRRLQYUUFDN YYGOJNEVEM R Q IHCK KT RGSNTGG XCX S "
},
{
"input": "WUBWUBWUBHJHMSBURXTHXWSCHNAIJOWBHLZGJZDHEDSPWBWACCGQWUBWUBWUBXTZKGIITWUBWUBWUBAWUBWUBWUBVNCXPUBCQWUBWUBWUBIDPNAWUBWUBWUBOWUBWUBWUBYGFWUBWUBWUBMQOWUBWUBWUBKWUBWUBWUBAZVWUBWUBWUBEP",
"output": "HJHMSBURXTHXWSCHNAIJOWBHLZGJZDHEDSPWBWACCGQ XTZKGIIT A VNCXPUBCQ IDPNA O YGF MQO K AZV EP "
},
{
"input": "WUBKYDZOYWZSNGMKJSWAXFDFLTHDHEOGTDBNZMSMKZTVWUBWUBWUBLRMIIWUBWUBWUBGWUBWUBWUBADPSWUBWUBWUBANBWUBWUBPCWUBWUBWUBPWUBWUBWUBGPVNLSWIRFORYGAABUXMWUBWUBWUBOWUBWUBWUBNWUBWUBWUBYWUBWUB",
"output": "KYDZOYWZSNGMKJSWAXFDFLTHDHEOGTDBNZMSMKZTV LRMII G ADPS ANB PC P GPVNLSWIRFORYGAABUXM O N Y "
},
{
"input": "REWUBWUBWUBJDWUBWUBWUBNWUBWUBWUBTWWUBWUBWUBWZDOCKKWUBWUBWUBLDPOVBFRCFWUBWUBAKZIBQKEUAZEEWUBWUBWUBLQYPNPFWUBYEWUBWUBWUBFWUBWUBWUBBPWUBWUBWUBAWWUBWUBWUBQWUBWUBWUBBRWUBWUBWUBXJL",
"output": "RE JD N TW WZDOCKK LDPOVBFRCF AKZIBQKEUAZEE LQYPNPF YE F BP AW Q BR XJL "
},
{
"input": "CUFGJDXGMWUBWUBWUBOMWUBWUBWUBSIEWUBWUBWUBJJWKNOWUBWUBWUBYBHVNRNORGYWUBWUBWUBOAGCAWUBWUBWUBSBLBKTPFKPBIWUBWUBWUBJBWUBWUBWUBRMFCJPGWUBWUBWUBDWUBWUBWUBOJOWUBWUBWUBZPWUBWUBWUBMWUBRWUBWUBWUBFXWWUBWUBWUBO",
"output": "CUFGJDXGM OM SIE JJWKNO YBHVNRNORGY OAGCA SBLBKTPFKPBI JB RMFCJPG D OJO ZP M R FXW O "
},
{
"input": "WUBJZGAEXFMFEWMAKGQLUWUBWUBWUBICYTPQWGENELVYWANKUOJYWUBWUBWUBGWUBWUBWUBHYCJVLPHTUPNEGKCDGQWUBWUBWUBOFWUBWUBWUBCPGSOGZBRPRPVJJEWUBWUBWUBDQBCWUBWUBWUBHWUBWUBWUBMHOHYBMATWUBWUBWUBVWUBWUBWUBSWUBWUBWUBKOWU",
"output": "JZGAEXFMFEWMAKGQLU ICYTPQWGENELVYWANKUOJY G HYCJVLPHTUPNEGKCDGQ OF CPGSOGZBRPRPVJJE DQBC H MHOHYBMAT V S KOWU "
},
{
"input": "A",
"output": "A "
},
{
"input": "WUBA",
"output": "A "
},
{
"input": "WUBWUBA",
"output": "A "
},
{
"input": "AWUBWUBWUB",
"output": "A "
},
{
"input": "AWUBBWUBCWUBD",
"output": "A B C D "
},
{
"input": "WUBWWUBWUBWUBUWUBWUBBWUB",
"output": "W U B "
},
{
"input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA",
"output": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA "
},
{
"input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWUBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA",
"output": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA "
},
{
"input": "WUWUBBWWUBUB",
"output": "WU BW UB "
},
{
"input": "WUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUABWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUB",
"output": "WUAB "
},
{
"input": "ZWUB",
"output": "Z "
},
{
"input": "WU",
"output": "WU "
},
{
"input": "UB",
"output": "UB "
},
{
"input": "U",
"output": "U "
},
{
"input": "WUBW",
"output": "W "
},
{
"input": "WUBWU",
"output": "WU "
},
{
"input": "WUWUB",
"output": "WU "
},
{
"input": "UBWUB",
"output": "UB "
},
{
"input": "WUWUBUBWUBUWUB",
"output": "WU UB U "
},
{
"input": "WUBWWUBAWUB",
"output": "W A "
},
{
"input": "WUUUUU",
"output": "WUUUUU "
}
] | 1,692,793,531
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 71
| 92
| 0
|
"""
@auther:Abdallah_Gaber
"""
x = input()
y = x.split("WUB")
for item in y:
print(item,end=" ")
|
Title: Dubstep
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya works as a DJ in the best Berland nightclub, and he often uses dubstep music in his performance. Recently, he has decided to take a couple of old songs and make dubstep remixes from them.
Let's assume that a song consists of some number of words. To make the dubstep remix of this song, Vasya inserts a certain number of words "WUB" before the first word of the song (the number may be zero), after the last word (the number may be zero), and between words (at least one between any pair of neighbouring words), and then the boy glues together all the words, including "WUB", in one string and plays the song at the club.
For example, a song with words "I AM X" can transform into a dubstep remix as "WUBWUBIWUBAMWUBWUBX" and cannot transform into "WUBWUBIAMWUBX".
Recently, Petya has heard Vasya's new dubstep track, but since he isn't into modern music, he decided to find out what was the initial song that Vasya remixed. Help Petya restore the original song.
Input Specification:
The input consists of a single non-empty string, consisting only of uppercase English letters, the string's length doesn't exceed 200 characters. It is guaranteed that before Vasya remixed the song, no word contained substring "WUB" in it; Vasya didn't change the word order. It is also guaranteed that initially the song had at least one word.
Output Specification:
Print the words of the initial song that Vasya used to make a dubsteb remix. Separate the words with a space.
Demo Input:
['WUBWUBABCWUB\n', 'WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB\n']
Demo Output:
['ABC ', 'WE ARE THE CHAMPIONS MY FRIEND ']
Note:
In the first sample: "WUBWUBABCWUB" = "WUB" + "WUB" + "ABC" + "WUB". That means that the song originally consisted of a single word "ABC", and all words "WUB" were added by Vasya.
In the second sample Vasya added a single word "WUB" between all neighbouring words, in the beginning and in the end, except for words "ARE" and "THE" — between them Vasya added two "WUB".
|
```python
"""
@auther:Abdallah_Gaber
"""
x = input()
y = x.split("WUB")
for item in y:
print(item,end=" ")
```
| 3
|
|
116
|
A
|
Tram
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Linear Kingdom has exactly one tram line. It has *n* stops, numbered from 1 to *n* in the order of tram's movement. At the *i*-th stop *a**i* passengers exit the tram, while *b**i* passengers enter it. The tram is empty before it arrives at the first stop. Also, when the tram arrives at the last stop, all passengers exit so that it becomes empty.
Your task is to calculate the tram's minimum capacity such that the number of people inside the tram at any time never exceeds this capacity. Note that at each stop all exiting passengers exit before any entering passenger enters the tram.
|
The first line contains a single number *n* (2<=≤<=*n*<=≤<=1000) — the number of the tram's stops.
Then *n* lines follow, each contains two integers *a**i* and *b**i* (0<=≤<=*a**i*,<=*b**i*<=≤<=1000) — the number of passengers that exits the tram at the *i*-th stop, and the number of passengers that enter the tram at the *i*-th stop. The stops are given from the first to the last stop in the order of tram's movement.
- The number of people who exit at a given stop does not exceed the total number of people in the tram immediately before it arrives at the stop. More formally, . This particularly means that *a*1<==<=0. - At the last stop, all the passengers exit the tram and it becomes empty. More formally, . - No passenger will enter the train at the last stop. That is, *b**n*<==<=0.
|
Print a single integer denoting the minimum possible capacity of the tram (0 is allowed).
|
[
"4\n0 3\n2 5\n4 2\n4 0\n"
] |
[
"6\n"
] |
For the first example, a capacity of 6 is sufficient:
- At the first stop, the number of passengers inside the tram before arriving is 0. Then, 3 passengers enter the tram, and the number of passengers inside the tram becomes 3. - At the second stop, 2 passengers exit the tram (1 passenger remains inside). Then, 5 passengers enter the tram. There are 6 passengers inside the tram now. - At the third stop, 4 passengers exit the tram (2 passengers remain inside). Then, 2 passengers enter the tram. There are 4 passengers inside the tram now. - Finally, all the remaining passengers inside the tram exit the tram at the last stop. There are no passenger inside the tram now, which is in line with the constraints.
Since the number of passengers inside the tram never exceeds 6, a capacity of 6 is sufficient. Furthermore it is not possible for the tram to have a capacity less than 6. Hence, 6 is the correct answer.
| 500
|
[
{
"input": "4\n0 3\n2 5\n4 2\n4 0",
"output": "6"
},
{
"input": "5\n0 4\n4 6\n6 5\n5 4\n4 0",
"output": "6"
},
{
"input": "10\n0 5\n1 7\n10 8\n5 3\n0 5\n3 3\n8 8\n0 6\n10 1\n9 0",
"output": "18"
},
{
"input": "3\n0 1\n1 1\n1 0",
"output": "1"
},
{
"input": "4\n0 1\n0 1\n1 0\n1 0",
"output": "2"
},
{
"input": "3\n0 0\n0 0\n0 0",
"output": "0"
},
{
"input": "3\n0 1000\n1000 1000\n1000 0",
"output": "1000"
},
{
"input": "5\n0 73\n73 189\n189 766\n766 0\n0 0",
"output": "766"
},
{
"input": "5\n0 0\n0 0\n0 0\n0 1\n1 0",
"output": "1"
},
{
"input": "5\n0 917\n917 923\n904 992\n1000 0\n11 0",
"output": "1011"
},
{
"input": "5\n0 1\n1 2\n2 1\n1 2\n2 0",
"output": "2"
},
{
"input": "5\n0 0\n0 0\n0 0\n0 0\n0 0",
"output": "0"
},
{
"input": "20\n0 7\n2 1\n2 2\n5 7\n2 6\n6 10\n2 4\n0 4\n7 4\n8 0\n10 6\n2 1\n6 1\n1 7\n0 3\n8 7\n6 3\n6 3\n1 1\n3 0",
"output": "22"
},
{
"input": "5\n0 1000\n1000 1000\n1000 1000\n1000 1000\n1000 0",
"output": "1000"
},
{
"input": "10\n0 592\n258 598\n389 203\n249 836\n196 635\n478 482\n994 987\n1000 0\n769 0\n0 0",
"output": "1776"
},
{
"input": "10\n0 1\n1 0\n0 0\n0 0\n0 0\n0 1\n1 1\n0 1\n1 0\n1 0",
"output": "2"
},
{
"input": "10\n0 926\n926 938\n938 931\n931 964\n937 989\n983 936\n908 949\n997 932\n945 988\n988 0",
"output": "1016"
},
{
"input": "10\n0 1\n1 2\n1 2\n2 2\n2 2\n2 2\n1 1\n1 1\n2 1\n2 0",
"output": "3"
},
{
"input": "10\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0",
"output": "0"
},
{
"input": "10\n0 1000\n1000 1000\n1000 1000\n1000 1000\n1000 1000\n1000 1000\n1000 1000\n1000 1000\n1000 1000\n1000 0",
"output": "1000"
},
{
"input": "50\n0 332\n332 268\n268 56\n56 711\n420 180\n160 834\n149 341\n373 777\n763 93\n994 407\n86 803\n700 132\n471 608\n429 467\n75 5\n638 305\n405 853\n316 478\n643 163\n18 131\n648 241\n241 766\n316 847\n640 380\n923 759\n789 41\n125 421\n421 9\n9 388\n388 829\n408 108\n462 856\n816 411\n518 688\n290 7\n405 912\n397 772\n396 652\n394 146\n27 648\n462 617\n514 433\n780 35\n710 705\n460 390\n194 508\n643 56\n172 469\n1000 0\n194 0",
"output": "2071"
},
{
"input": "50\n0 0\n0 1\n1 1\n0 1\n0 0\n1 0\n0 0\n1 0\n0 0\n0 0\n0 0\n0 0\n0 1\n0 0\n0 0\n0 1\n1 0\n0 1\n0 0\n1 1\n1 0\n0 1\n0 0\n1 1\n0 1\n1 0\n1 1\n1 0\n0 0\n1 1\n1 0\n0 1\n0 0\n0 1\n1 1\n1 1\n1 1\n1 0\n1 1\n1 0\n0 1\n1 0\n0 0\n0 1\n1 1\n1 1\n0 1\n0 0\n1 0\n1 0",
"output": "3"
},
{
"input": "50\n0 926\n926 971\n915 980\n920 965\n954 944\n928 952\n955 980\n916 980\n906 935\n944 913\n905 923\n912 922\n965 934\n912 900\n946 930\n931 983\n979 905\n925 969\n924 926\n910 914\n921 977\n934 979\n962 986\n942 909\n976 903\n982 982\n991 941\n954 929\n902 980\n947 983\n919 924\n917 943\n916 905\n907 913\n964 977\n984 904\n905 999\n950 970\n986 906\n993 970\n960 994\n963 983\n918 986\n980 900\n931 986\n993 997\n941 909\n907 909\n1000 0\n278 0",
"output": "1329"
},
{
"input": "2\n0 863\n863 0",
"output": "863"
},
{
"input": "50\n0 1\n1 2\n2 2\n1 1\n1 1\n1 2\n1 2\n1 1\n1 2\n1 1\n1 1\n1 2\n1 2\n1 1\n2 1\n2 2\n1 2\n2 2\n1 2\n2 1\n2 1\n2 2\n2 1\n1 2\n1 2\n2 1\n1 1\n2 2\n1 1\n2 1\n2 2\n2 1\n1 2\n2 2\n1 2\n1 1\n1 1\n2 1\n2 1\n2 2\n2 1\n2 1\n1 2\n1 2\n1 2\n1 2\n2 0\n2 0\n2 0\n0 0",
"output": "8"
},
{
"input": "50\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0",
"output": "0"
},
{
"input": "100\n0 1\n0 0\n0 0\n1 0\n0 0\n0 1\n0 1\n1 1\n0 0\n0 0\n1 1\n0 0\n1 1\n0 1\n1 1\n0 1\n1 1\n1 0\n1 0\n0 0\n1 0\n0 1\n1 0\n0 0\n0 0\n1 1\n1 1\n0 1\n0 0\n1 0\n1 1\n0 1\n1 0\n1 1\n0 1\n1 1\n1 0\n0 0\n0 0\n0 1\n0 0\n0 1\n1 1\n0 0\n1 1\n1 1\n0 0\n0 1\n1 0\n0 1\n0 0\n0 1\n0 1\n1 1\n1 1\n1 1\n0 0\n0 0\n1 1\n0 1\n0 1\n1 0\n0 0\n0 0\n1 1\n0 1\n0 1\n1 1\n1 1\n0 1\n1 1\n1 1\n0 0\n1 0\n0 1\n0 0\n0 0\n1 1\n1 1\n1 1\n1 1\n0 1\n1 0\n1 0\n1 0\n1 0\n1 0\n0 0\n1 0\n1 0\n0 0\n1 0\n0 0\n0 1\n1 0\n0 1\n1 0\n1 0\n1 0\n1 0",
"output": "11"
},
{
"input": "100\n0 2\n1 2\n2 1\n1 2\n1 2\n2 1\n2 2\n1 1\n1 1\n2 1\n1 2\n2 1\n1 2\n2 2\n2 2\n2 2\n1 2\n2 2\n2 1\n1 1\n1 1\n1 1\n2 2\n1 2\n2 2\n1 1\n1 1\n1 1\n1 1\n2 2\n1 2\n2 1\n1 1\n2 2\n1 1\n2 1\n1 1\n2 2\n2 1\n1 2\n1 1\n1 2\n2 1\n2 2\n1 1\n2 1\n1 1\n2 1\n1 1\n1 2\n2 2\n2 2\n1 1\n2 2\n1 2\n2 1\n2 1\n1 1\n1 1\n1 2\n1 2\n1 1\n1 1\n2 1\n1 2\n1 2\n2 1\n2 2\n2 2\n2 2\n2 1\n2 2\n1 1\n1 2\n1 2\n1 1\n2 2\n2 2\n1 1\n2 1\n1 1\n1 2\n1 2\n1 2\n1 1\n1 1\n2 2\n1 2\n2 1\n2 1\n2 1\n1 2\n1 2\n1 1\n2 2\n1 2\n2 0\n2 0\n2 0\n1 0",
"output": "7"
},
{
"input": "100\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0\n0 0",
"output": "0"
},
{
"input": "2\n0 1\n1 0",
"output": "1"
},
{
"input": "2\n0 900\n900 0",
"output": "900"
},
{
"input": "2\n0 1\n1 0",
"output": "1"
},
{
"input": "2\n0 0\n0 0",
"output": "0"
},
{
"input": "2\n0 1000\n1000 0",
"output": "1000"
},
{
"input": "3\n0 802\n175 188\n815 0",
"output": "815"
},
{
"input": "3\n0 910\n910 976\n976 0",
"output": "976"
},
{
"input": "3\n0 2\n2 1\n1 0",
"output": "2"
}
] | 1,691,991,047
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 71
| 92
| 102,400
|
n = int(input())
lis = [[]]
re = [0]
for i in range(0, n):
a = [int(x) for x in input().split()]
lis.append(a)
del lis[0]
for i in range(n):
v = re[i] - lis[i][0] + lis[i][1]
re.append(v)
print(max(re))
|
Title: Tram
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Linear Kingdom has exactly one tram line. It has *n* stops, numbered from 1 to *n* in the order of tram's movement. At the *i*-th stop *a**i* passengers exit the tram, while *b**i* passengers enter it. The tram is empty before it arrives at the first stop. Also, when the tram arrives at the last stop, all passengers exit so that it becomes empty.
Your task is to calculate the tram's minimum capacity such that the number of people inside the tram at any time never exceeds this capacity. Note that at each stop all exiting passengers exit before any entering passenger enters the tram.
Input Specification:
The first line contains a single number *n* (2<=≤<=*n*<=≤<=1000) — the number of the tram's stops.
Then *n* lines follow, each contains two integers *a**i* and *b**i* (0<=≤<=*a**i*,<=*b**i*<=≤<=1000) — the number of passengers that exits the tram at the *i*-th stop, and the number of passengers that enter the tram at the *i*-th stop. The stops are given from the first to the last stop in the order of tram's movement.
- The number of people who exit at a given stop does not exceed the total number of people in the tram immediately before it arrives at the stop. More formally, . This particularly means that *a*1<==<=0. - At the last stop, all the passengers exit the tram and it becomes empty. More formally, . - No passenger will enter the train at the last stop. That is, *b**n*<==<=0.
Output Specification:
Print a single integer denoting the minimum possible capacity of the tram (0 is allowed).
Demo Input:
['4\n0 3\n2 5\n4 2\n4 0\n']
Demo Output:
['6\n']
Note:
For the first example, a capacity of 6 is sufficient:
- At the first stop, the number of passengers inside the tram before arriving is 0. Then, 3 passengers enter the tram, and the number of passengers inside the tram becomes 3. - At the second stop, 2 passengers exit the tram (1 passenger remains inside). Then, 5 passengers enter the tram. There are 6 passengers inside the tram now. - At the third stop, 4 passengers exit the tram (2 passengers remain inside). Then, 2 passengers enter the tram. There are 4 passengers inside the tram now. - Finally, all the remaining passengers inside the tram exit the tram at the last stop. There are no passenger inside the tram now, which is in line with the constraints.
Since the number of passengers inside the tram never exceeds 6, a capacity of 6 is sufficient. Furthermore it is not possible for the tram to have a capacity less than 6. Hence, 6 is the correct answer.
|
```python
n = int(input())
lis = [[]]
re = [0]
for i in range(0, n):
a = [int(x) for x in input().split()]
lis.append(a)
del lis[0]
for i in range(n):
v = re[i] - lis[i][0] + lis[i][1]
re.append(v)
print(max(re))
```
| 3
|
|
768
|
B
|
Code For 1
|
PROGRAMMING
| 1,600
|
[
"constructive algorithms",
"dfs and similar",
"divide and conquer"
] | null | null |
Jon fought bravely to rescue the wildlings who were attacked by the white-walkers at Hardhome. On his arrival, Sam tells him that he wants to go to Oldtown to train at the Citadel to become a maester, so he can return and take the deceased Aemon's place as maester of Castle Black. Jon agrees to Sam's proposal and Sam sets off his journey to the Citadel. However becoming a trainee at the Citadel is not a cakewalk and hence the maesters at the Citadel gave Sam a problem to test his eligibility.
Initially Sam has a list with a single element *n*. Then he has to perform certain operations on this list. In each operation Sam must remove any element *x*, such that *x*<=><=1, from the list and insert at the same position , , sequentially. He must continue with these operations until all the elements in the list are either 0 or 1.
Now the masters want the total number of 1s in the range *l* to *r* (1-indexed). Sam wants to become a maester but unfortunately he cannot solve this problem. Can you help Sam to pass the eligibility test?
|
The first line contains three integers *n*, *l*, *r* (0<=≤<=*n*<=<<=250, 0<=≤<=*r*<=-<=*l*<=≤<=105, *r*<=≥<=1, *l*<=≥<=1) – initial element and the range *l* to *r*.
It is guaranteed that *r* is not greater than the length of the final list.
|
Output the total number of 1s in the range *l* to *r* in the final sequence.
|
[
"7 2 5\n",
"10 3 10\n"
] |
[
"4\n",
"5\n"
] |
Consider first example:
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/288fbb682a6fa1934a47b763d6851f9d32a06150.png" style="max-width: 100.0%;max-height: 100.0%;"/>
Elements on positions from 2-nd to 5-th in list is [1, 1, 1, 1]. The number of ones is 4.
For the second example:
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/52e9bc51ef858cacc27fc274c7ba9419d5c1ded9.png" style="max-width: 100.0%;max-height: 100.0%;"/>
Elements on positions from 3-rd to 10-th in list is [1, 1, 1, 0, 1, 0, 1, 0]. The number of ones is 5.
| 1,000
|
[
{
"input": "7 2 5",
"output": "4"
},
{
"input": "10 3 10",
"output": "5"
},
{
"input": "56 18 40",
"output": "20"
},
{
"input": "203 40 124",
"output": "67"
},
{
"input": "903316762502 354723010040 354723105411",
"output": "78355"
},
{
"input": "33534354842198 32529564319236 32529564342569",
"output": "22239"
},
{
"input": "62518534961045 50734311240112 50734311287877",
"output": "42439"
},
{
"input": "95173251245550 106288351347530 106288351372022",
"output": "16565"
},
{
"input": "542 321 956",
"output": "336"
},
{
"input": "3621 237 2637",
"output": "2124"
},
{
"input": "9056 336 896",
"output": "311"
},
{
"input": "36007 368 24490",
"output": "13253"
},
{
"input": "244269 149154 244246",
"output": "88609"
},
{
"input": "880234 669493 757150",
"output": "73585"
},
{
"input": "3740160 1031384 1104236",
"output": "64965"
},
{
"input": "11586121 15337246 15397874",
"output": "41868"
},
{
"input": "38658997 35923164 35985664",
"output": "36004"
},
{
"input": "192308932 207804787 207866400",
"output": "44142"
},
{
"input": "950099012 175922161 176000556",
"output": "69369"
},
{
"input": "2787326787 3799676481 3799680514",
"output": "2618"
},
{
"input": "14417262581 8527979363 8528075536",
"output": "80707"
},
{
"input": "39889373539 7747197212 7747278363",
"output": "47105"
},
{
"input": "251772781087 70597428577 70597479816",
"output": "46933"
},
{
"input": "0 1 1",
"output": "0"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "3 2 3",
"output": "2"
},
{
"input": "14 7 12",
"output": "5"
},
{
"input": "1125899906842623 1 100001",
"output": "100001"
},
{
"input": "1125899906842623 1125899906742623 1125899906842623",
"output": "100001"
},
{
"input": "1000 1 1023",
"output": "1000"
},
{
"input": "281474976710656 17179869184 17179869186",
"output": "1"
},
{
"input": "2 2 2",
"output": "0"
},
{
"input": "3 2 2",
"output": "1"
}
] | 1,666,339,663
| 2,147,483,647
|
PyPy 3-64
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 4
| 2,000
| 10,137,600
|
import sys
# sys.setrecursionlimit(200000)
import math
from collections import Counter
from collections import defaultdict
from collections import deque
input = sys.stdin.readline
from functools import lru_cache
import heapq
############ ---- Input Functions ---- ############
def inp():
return(int(input()))
def inlt():
return(list(map(int,input().split())))
def insr():
s = input()
return(list(s[:len(s)-1]))
def invr():
return(map(int,input().split()))
def rec(n,c,l,r):
if c[0] > r:
return
if n == 1 or n == 0:
c[0]+=1
if n == 1 and l <= c[0] <= r:
c[1]+=1
return
rec(n//2,c,l,r)
rec(n%2,c,l,r)
rec(n//2,c,l,r)
def main():
num,left,right = inlt()
count = [0,0]
rec(num,count,left,right)
print(count[1])
main()
|
Title: Code For 1
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Jon fought bravely to rescue the wildlings who were attacked by the white-walkers at Hardhome. On his arrival, Sam tells him that he wants to go to Oldtown to train at the Citadel to become a maester, so he can return and take the deceased Aemon's place as maester of Castle Black. Jon agrees to Sam's proposal and Sam sets off his journey to the Citadel. However becoming a trainee at the Citadel is not a cakewalk and hence the maesters at the Citadel gave Sam a problem to test his eligibility.
Initially Sam has a list with a single element *n*. Then he has to perform certain operations on this list. In each operation Sam must remove any element *x*, such that *x*<=><=1, from the list and insert at the same position , , sequentially. He must continue with these operations until all the elements in the list are either 0 or 1.
Now the masters want the total number of 1s in the range *l* to *r* (1-indexed). Sam wants to become a maester but unfortunately he cannot solve this problem. Can you help Sam to pass the eligibility test?
Input Specification:
The first line contains three integers *n*, *l*, *r* (0<=≤<=*n*<=<<=250, 0<=≤<=*r*<=-<=*l*<=≤<=105, *r*<=≥<=1, *l*<=≥<=1) – initial element and the range *l* to *r*.
It is guaranteed that *r* is not greater than the length of the final list.
Output Specification:
Output the total number of 1s in the range *l* to *r* in the final sequence.
Demo Input:
['7 2 5\n', '10 3 10\n']
Demo Output:
['4\n', '5\n']
Note:
Consider first example:
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/288fbb682a6fa1934a47b763d6851f9d32a06150.png" style="max-width: 100.0%;max-height: 100.0%;"/>
Elements on positions from 2-nd to 5-th in list is [1, 1, 1, 1]. The number of ones is 4.
For the second example:
<img align="middle" class="tex-formula" src="https://espresso.codeforces.com/52e9bc51ef858cacc27fc274c7ba9419d5c1ded9.png" style="max-width: 100.0%;max-height: 100.0%;"/>
Elements on positions from 3-rd to 10-th in list is [1, 1, 1, 0, 1, 0, 1, 0]. The number of ones is 5.
|
```python
import sys
# sys.setrecursionlimit(200000)
import math
from collections import Counter
from collections import defaultdict
from collections import deque
input = sys.stdin.readline
from functools import lru_cache
import heapq
############ ---- Input Functions ---- ############
def inp():
return(int(input()))
def inlt():
return(list(map(int,input().split())))
def insr():
s = input()
return(list(s[:len(s)-1]))
def invr():
return(map(int,input().split()))
def rec(n,c,l,r):
if c[0] > r:
return
if n == 1 or n == 0:
c[0]+=1
if n == 1 and l <= c[0] <= r:
c[1]+=1
return
rec(n//2,c,l,r)
rec(n%2,c,l,r)
rec(n//2,c,l,r)
def main():
num,left,right = inlt()
count = [0,0]
rec(num,count,left,right)
print(count[1])
main()
```
| 0
|
|
71
|
A
|
Way Too Long Words
|
PROGRAMMING
| 800
|
[
"strings"
] |
A. Way Too Long Words
|
1
|
256
|
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation.
This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes.
Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n".
You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
|
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
|
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
|
[
"4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n"
] |
[
"word\nl10n\ni18n\np43s\n"
] |
none
| 500
|
[
{
"input": "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis",
"output": "word\nl10n\ni18n\np43s"
},
{
"input": "5\nabcdefgh\nabcdefghi\nabcdefghij\nabcdefghijk\nabcdefghijklm",
"output": "abcdefgh\nabcdefghi\nabcdefghij\na9k\na11m"
},
{
"input": "3\nnjfngnrurunrgunrunvurn\njfvnjfdnvjdbfvsbdubruvbubvkdb\nksdnvidnviudbvibd",
"output": "n20n\nj27b\nk15d"
},
{
"input": "1\ntcyctkktcctrcyvbyiuhihhhgyvyvyvyvjvytchjckt",
"output": "t41t"
},
{
"input": "24\nyou\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nunofficially\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings",
"output": "you\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nu10y\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "26\na\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz",
"output": "a\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz"
},
{
"input": "1\nabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij",
"output": "a98j"
},
{
"input": "10\ngyartjdxxlcl\nfzsck\nuidwu\nxbymclornemdmtj\nilppyoapitawgje\ncibzc\ndrgbeu\nhezplmsdekhhbo\nfeuzlrimbqbytdu\nkgdco",
"output": "g10l\nfzsck\nuidwu\nx13j\ni13e\ncibzc\ndrgbeu\nh12o\nf13u\nkgdco"
},
{
"input": "20\nlkpmx\nkovxmxorlgwaomlswjxlpnbvltfv\nhykasjxqyjrmybejnmeumzha\ntuevlumpqbbhbww\nqgqsphvrmupxxc\ntrissbaf\nqfgrlinkzvzqdryckaizutd\nzzqtoaxkvwoscyx\noswytrlnhpjvvnwookx\nlpuzqgec\ngyzqfwxggtvpjhzmzmdw\nrlxjgmvdftvrmvbdwudra\nvsntnjpepnvdaxiporggmglhagv\nxlvcqkqgcrbgtgglj\nlyxwxbiszyhlsrgzeedzprbmcpduvq\nyrmqqvrkqskqukzqrwukpsifgtdc\nxpuohcsjhhuhvr\nvvlfrlxpvqejngwrbfbpmqeirxlw\nsvmasocxdvadmaxtrpakysmeaympy\nyuflqboqfdt",
"output": "lkpmx\nk26v\nh22a\nt13w\nq12c\ntrissbaf\nq21d\nz13x\no17x\nlpuzqgec\ng18w\nr19a\nv25v\nx15j\nl28q\ny26c\nx12r\nv26w\ns27y\ny9t"
},
{
"input": "100\nm\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr",
"output": "m\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr"
}
] | 1,692,530,141
| 2,147,483,647
|
PyPy 3-64
|
RUNTIME_ERROR
|
TESTS
| 0
| 78
| 3,379,200
|
word = string(input())
if word.len>10:
print(word.start + word(word.len-2) + word.end)
else:
print(word)
|
Title: Way Too Long Words
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation.
This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes.
Thus, "localization" will be spelt as "l10n", and "internationalization» will be spelt as "i18n".
You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
Input Specification:
The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
Output Specification:
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
Demo Input:
['4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n']
Demo Output:
['word\nl10n\ni18n\np43s\n']
Note:
none
|
```python
word = string(input())
if word.len>10:
print(word.start + word(word.len-2) + word.end)
else:
print(word)
```
| -1
|
799
|
A
|
Carrot Cakes
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] | null | null |
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
|
The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
|
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
|
[
"8 6 4 5\n",
"8 6 4 6\n",
"10 3 11 4\n",
"4 2 1 4\n"
] |
[
"YES\n",
"NO\n",
"NO\n",
"YES\n"
] |
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
| 500
|
[
{
"input": "8 6 4 5",
"output": "YES"
},
{
"input": "8 6 4 6",
"output": "NO"
},
{
"input": "10 3 11 4",
"output": "NO"
},
{
"input": "4 2 1 4",
"output": "YES"
},
{
"input": "28 17 16 26",
"output": "NO"
},
{
"input": "60 69 9 438",
"output": "NO"
},
{
"input": "599 97 54 992",
"output": "YES"
},
{
"input": "11 22 18 17",
"output": "NO"
},
{
"input": "1 13 22 11",
"output": "NO"
},
{
"input": "1 1 1 1",
"output": "NO"
},
{
"input": "3 1 1 1",
"output": "YES"
},
{
"input": "1000 1000 1000 1000",
"output": "NO"
},
{
"input": "1000 1000 1 1",
"output": "YES"
},
{
"input": "1000 1000 1 400",
"output": "YES"
},
{
"input": "1000 1000 1 1000",
"output": "YES"
},
{
"input": "1000 1000 1 999",
"output": "YES"
},
{
"input": "53 11 3 166",
"output": "YES"
},
{
"input": "313 2 3 385",
"output": "NO"
},
{
"input": "214 9 9 412",
"output": "NO"
},
{
"input": "349 9 5 268",
"output": "YES"
},
{
"input": "611 16 8 153",
"output": "YES"
},
{
"input": "877 13 3 191",
"output": "YES"
},
{
"input": "340 9 9 10",
"output": "YES"
},
{
"input": "31 8 2 205",
"output": "NO"
},
{
"input": "519 3 2 148",
"output": "YES"
},
{
"input": "882 2 21 219",
"output": "NO"
},
{
"input": "982 13 5 198",
"output": "YES"
},
{
"input": "428 13 6 272",
"output": "YES"
},
{
"input": "436 16 14 26",
"output": "YES"
},
{
"input": "628 10 9 386",
"output": "YES"
},
{
"input": "77 33 18 31",
"output": "YES"
},
{
"input": "527 36 4 8",
"output": "YES"
},
{
"input": "128 18 2 169",
"output": "YES"
},
{
"input": "904 4 2 288",
"output": "YES"
},
{
"input": "986 4 3 25",
"output": "YES"
},
{
"input": "134 8 22 162",
"output": "NO"
},
{
"input": "942 42 3 69",
"output": "YES"
},
{
"input": "894 4 9 4",
"output": "YES"
},
{
"input": "953 8 10 312",
"output": "YES"
},
{
"input": "43 8 1 121",
"output": "YES"
},
{
"input": "12 13 19 273",
"output": "NO"
},
{
"input": "204 45 10 871",
"output": "YES"
},
{
"input": "342 69 50 425",
"output": "NO"
},
{
"input": "982 93 99 875",
"output": "NO"
},
{
"input": "283 21 39 132",
"output": "YES"
},
{
"input": "1000 45 83 686",
"output": "NO"
},
{
"input": "246 69 36 432",
"output": "NO"
},
{
"input": "607 93 76 689",
"output": "NO"
},
{
"input": "503 21 24 435",
"output": "NO"
},
{
"input": "1000 45 65 989",
"output": "NO"
},
{
"input": "30 21 2 250",
"output": "YES"
},
{
"input": "1000 49 50 995",
"output": "NO"
},
{
"input": "383 69 95 253",
"output": "YES"
},
{
"input": "393 98 35 999",
"output": "YES"
},
{
"input": "1000 22 79 552",
"output": "NO"
},
{
"input": "268 294 268 154",
"output": "NO"
},
{
"input": "963 465 706 146",
"output": "YES"
},
{
"input": "304 635 304 257",
"output": "NO"
},
{
"input": "4 2 1 6",
"output": "NO"
},
{
"input": "1 51 10 50",
"output": "NO"
},
{
"input": "5 5 4 4",
"output": "YES"
},
{
"input": "3 2 1 1",
"output": "YES"
},
{
"input": "3 4 3 3",
"output": "NO"
},
{
"input": "7 3 4 1",
"output": "YES"
},
{
"input": "101 10 1 1000",
"output": "NO"
},
{
"input": "5 1 1 1",
"output": "YES"
},
{
"input": "5 10 5 5",
"output": "NO"
},
{
"input": "19 1 7 1",
"output": "YES"
},
{
"input": "763 572 745 262",
"output": "YES"
},
{
"input": "1 2 1 1",
"output": "NO"
},
{
"input": "5 1 1 3",
"output": "YES"
},
{
"input": "170 725 479 359",
"output": "NO"
},
{
"input": "6 2 1 7",
"output": "YES"
},
{
"input": "6 2 5 1",
"output": "YES"
},
{
"input": "1 2 2 1",
"output": "NO"
},
{
"input": "24 2 8 3",
"output": "YES"
},
{
"input": "7 3 3 3",
"output": "YES"
},
{
"input": "5 2 2 2",
"output": "YES"
},
{
"input": "3 2 1 2",
"output": "YES"
},
{
"input": "1000 2 200 8",
"output": "NO"
},
{
"input": "3 100 2 100",
"output": "NO"
},
{
"input": "2 999 1 1000",
"output": "NO"
},
{
"input": "2 1 1 1",
"output": "NO"
},
{
"input": "2 3 5 1",
"output": "NO"
},
{
"input": "100 1 5 1",
"output": "YES"
},
{
"input": "7 2 3 3",
"output": "YES"
},
{
"input": "4 1 1 3",
"output": "NO"
},
{
"input": "3 2 2 1",
"output": "YES"
},
{
"input": "1 1 1 2",
"output": "NO"
},
{
"input": "91 8 7 13",
"output": "YES"
},
{
"input": "3 1 2 1",
"output": "NO"
},
{
"input": "5 3 2 3",
"output": "YES"
},
{
"input": "9 6 6 3",
"output": "YES"
}
] | 1,663,751,805
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 0
| 46
| 0
|
import math
n, t, k, d = map(int,input().split())
oven1 = 0
oven2 = d
process = math.ceil(n/k);
if n<=k:
print("NO")
exit()
t1 = process*t
for i in range(t1):
if oven1==i:
oven1 += t
process -= 1
if oven2==i:
oven2+=t
process -= 1
if process == 0:
break
t2 = max(oven1,oven2)
print(t2)
if t1 > t2:
print("YES")
else:
print("NO")
|
Title: Carrot Cakes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
Input Specification:
The only line contains four integers *n*, *t*, *k*, *d* (1<=≤<=*n*,<=*t*,<=*k*,<=*d*<=≤<=1<=000) — the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
Output Specification:
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
Demo Input:
['8 6 4 5\n', '8 6 4 6\n', '10 3 11 4\n', '4 2 1 4\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n', 'YES\n']
Note:
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
|
```python
import math
n, t, k, d = map(int,input().split())
oven1 = 0
oven2 = d
process = math.ceil(n/k);
if n<=k:
print("NO")
exit()
t1 = process*t
for i in range(t1):
if oven1==i:
oven1 += t
process -= 1
if oven2==i:
oven2+=t
process -= 1
if process == 0:
break
t2 = max(oven1,oven2)
print(t2)
if t1 > t2:
print("YES")
else:
print("NO")
```
| 0
|
|
344
|
A
|
Magnets
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Mad scientist Mike entertains himself by arranging rows of dominoes. He doesn't need dominoes, though: he uses rectangular magnets instead. Each magnet has two poles, positive (a "plus") and negative (a "minus"). If two magnets are put together at a close distance, then the like poles will repel each other and the opposite poles will attract each other.
Mike starts by laying one magnet horizontally on the table. During each following step Mike adds one more magnet horizontally to the right end of the row. Depending on how Mike puts the magnet on the table, it is either attracted to the previous one (forming a group of multiple magnets linked together) or repelled by it (then Mike lays this magnet at some distance to the right from the previous one). We assume that a sole magnet not linked to others forms a group of its own.
Mike arranged multiple magnets in a row. Determine the number of groups that the magnets formed.
|
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100000) — the number of magnets. Then *n* lines follow. The *i*-th line (1<=≤<=*i*<=≤<=*n*) contains either characters "01", if Mike put the *i*-th magnet in the "plus-minus" position, or characters "10", if Mike put the magnet in the "minus-plus" position.
|
On the single line of the output print the number of groups of magnets.
|
[
"6\n10\n10\n10\n01\n10\n10\n",
"4\n01\n01\n10\n10\n"
] |
[
"3\n",
"2\n"
] |
The first testcase corresponds to the figure. The testcase has three groups consisting of three, one and two magnets.
The second testcase has two groups, each consisting of two magnets.
| 500
|
[
{
"input": "6\n10\n10\n10\n01\n10\n10",
"output": "3"
},
{
"input": "4\n01\n01\n10\n10",
"output": "2"
},
{
"input": "1\n10",
"output": "1"
},
{
"input": "2\n01\n10",
"output": "2"
},
{
"input": "2\n10\n10",
"output": "1"
},
{
"input": "3\n10\n01\n10",
"output": "3"
},
{
"input": "1\n01",
"output": "1"
},
{
"input": "2\n01\n01",
"output": "1"
},
{
"input": "2\n10\n01",
"output": "2"
},
{
"input": "3\n01\n01\n01",
"output": "1"
},
{
"input": "3\n10\n10\n01",
"output": "2"
},
{
"input": "3\n01\n10\n10",
"output": "2"
},
{
"input": "115\n10\n10\n10\n10\n01\n01\n10\n10\n10\n01\n01\n10\n01\n01\n10\n10\n10\n01\n10\n01\n10\n10\n01\n01\n10\n10\n10\n10\n01\n10\n01\n01\n10\n10\n10\n10\n01\n10\n10\n10\n01\n10\n01\n10\n10\n10\n10\n01\n01\n01\n10\n10\n01\n01\n01\n10\n10\n01\n10\n01\n01\n01\n01\n10\n10\n01\n10\n01\n01\n01\n01\n01\n10\n01\n10\n10\n01\n01\n01\n10\n01\n01\n10\n10\n01\n01\n01\n01\n01\n10\n01\n10\n01\n10\n01\n01\n01\n10\n01\n10\n10\n01\n10\n10\n01\n01\n01\n10\n10\n10\n10\n10\n10\n10\n10",
"output": "55"
}
] | 1,695,229,347
| 2,147,483,647
|
PyPy 3-64
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 6
| 1,000
| 4,915,200
|
T=int(input())
N=int(input())
C=1
for _ in range(T-1):
N1=int(input())
if N1!=N:
N=N1
C=C+1
print(C)
|
Title: Magnets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mad scientist Mike entertains himself by arranging rows of dominoes. He doesn't need dominoes, though: he uses rectangular magnets instead. Each magnet has two poles, positive (a "plus") and negative (a "minus"). If two magnets are put together at a close distance, then the like poles will repel each other and the opposite poles will attract each other.
Mike starts by laying one magnet horizontally on the table. During each following step Mike adds one more magnet horizontally to the right end of the row. Depending on how Mike puts the magnet on the table, it is either attracted to the previous one (forming a group of multiple magnets linked together) or repelled by it (then Mike lays this magnet at some distance to the right from the previous one). We assume that a sole magnet not linked to others forms a group of its own.
Mike arranged multiple magnets in a row. Determine the number of groups that the magnets formed.
Input Specification:
The first line of the input contains an integer *n* (1<=≤<=*n*<=≤<=100000) — the number of magnets. Then *n* lines follow. The *i*-th line (1<=≤<=*i*<=≤<=*n*) contains either characters "01", if Mike put the *i*-th magnet in the "plus-minus" position, or characters "10", if Mike put the magnet in the "minus-plus" position.
Output Specification:
On the single line of the output print the number of groups of magnets.
Demo Input:
['6\n10\n10\n10\n01\n10\n10\n', '4\n01\n01\n10\n10\n']
Demo Output:
['3\n', '2\n']
Note:
The first testcase corresponds to the figure. The testcase has three groups consisting of three, one and two magnets.
The second testcase has two groups, each consisting of two magnets.
|
```python
T=int(input())
N=int(input())
C=1
for _ in range(T-1):
N1=int(input())
if N1!=N:
N=N1
C=C+1
print(C)
```
| 0
|
|
938
|
A
|
Word Correction
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Victor tries to write his own text editor, with word correction included. However, the rules of word correction are really strange.
Victor thinks that if a word contains two consecutive vowels, then it's kinda weird and it needs to be replaced. So the word corrector works in such a way: as long as there are two consecutive vowels in the word, it deletes the first vowel in a word such that there is another vowel right before it. If there are no two consecutive vowels in the word, it is considered to be correct.
You are given a word *s*. Can you predict what will it become after correction?
In this problem letters a, e, i, o, u and y are considered to be vowels.
|
The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of letters in word *s* before the correction.
The second line contains a string *s* consisting of exactly *n* lowercase Latin letters — the word before the correction.
|
Output the word *s* after the correction.
|
[
"5\nweird\n",
"4\nword\n",
"5\naaeaa\n"
] |
[
"werd\n",
"word\n",
"a\n"
] |
Explanations of the examples:
1. There is only one replace: weird <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> werd;1. No replace needed since there are no two consecutive vowels;1. aaeaa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> aeaa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> aaa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> aa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> a.
| 0
|
[
{
"input": "5\nweird",
"output": "werd"
},
{
"input": "4\nword",
"output": "word"
},
{
"input": "5\naaeaa",
"output": "a"
},
{
"input": "100\naaaaabbbbboyoyoyoyoyacadabbbbbiuiufgiuiuaahjabbbklboyoyoyoyoyaaaaabbbbbiuiuiuiuiuaaaaabbbbbeyiyuyzyw",
"output": "abbbbbocadabbbbbifgihjabbbklbobbbbbibbbbbezyw"
},
{
"input": "69\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb"
},
{
"input": "12\nmmmmmmmmmmmm",
"output": "mmmmmmmmmmmm"
},
{
"input": "18\nyaywptqwuyiqypwoyw",
"output": "ywptqwuqypwow"
},
{
"input": "85\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb"
},
{
"input": "13\nmmmmmmmmmmmmm",
"output": "mmmmmmmmmmmmm"
},
{
"input": "10\nmmmmmmmmmm",
"output": "mmmmmmmmmm"
},
{
"input": "11\nmmmmmmmmmmm",
"output": "mmmmmmmmmmm"
},
{
"input": "15\nmmmmmmmmmmmmmmm",
"output": "mmmmmmmmmmmmmmm"
},
{
"input": "1\na",
"output": "a"
},
{
"input": "14\nmmmmmmmmmmmmmm",
"output": "mmmmmmmmmmmmmm"
},
{
"input": "33\nmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm",
"output": "mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm"
},
{
"input": "79\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb"
},
{
"input": "90\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb"
},
{
"input": "2\naa",
"output": "a"
},
{
"input": "18\niuiuqpyyaoaetiwliu",
"output": "iqpytiwli"
},
{
"input": "5\nxxxxx",
"output": "xxxxx"
},
{
"input": "6\nxxxahg",
"output": "xxxahg"
},
{
"input": "3\nzcv",
"output": "zcv"
},
{
"input": "4\naepo",
"output": "apo"
},
{
"input": "5\nqqqqq",
"output": "qqqqq"
},
{
"input": "6\naaaaaa",
"output": "a"
},
{
"input": "4\naeta",
"output": "ata"
},
{
"input": "20\nttyttlwaoieulyiluuri",
"output": "ttyttlwalyluri"
},
{
"input": "1\nb",
"output": "b"
},
{
"input": "3\nanc",
"output": "anc"
},
{
"input": "1\ne",
"output": "e"
},
{
"input": "3\naie",
"output": "a"
},
{
"input": "3\nvio",
"output": "vi"
},
{
"input": "2\nea",
"output": "e"
},
{
"input": "3\nuas",
"output": "us"
},
{
"input": "2\nba",
"output": "ba"
},
{
"input": "2\naq",
"output": "aq"
},
{
"input": "2\nya",
"output": "y"
},
{
"input": "2\nou",
"output": "o"
},
{
"input": "2\nbb",
"output": "bb"
},
{
"input": "7\nayylmao",
"output": "alma"
},
{
"input": "2\nab",
"output": "ab"
},
{
"input": "19\nyuouiyaoiiweqrryqqp",
"output": "yweqrryqqp"
},
{
"input": "25\niqypwqpriiioetiuqqqttouei",
"output": "iqypwqpritiqqqtto"
},
{
"input": "100\naaaaabbbbboyoyoyoyoyacadabbbbbiuiufgiuiuaahjabbbklboyoyoyoyoyaaaaabbbbbiuiuiuiuiuaaaaabbbbbeyiyuyzyz",
"output": "abbbbbocadabbbbbifgihjabbbklbobbbbbibbbbbezyz"
},
{
"input": "17\naccccccccccccccca",
"output": "accccccccccccccca"
},
{
"input": "5\nababa",
"output": "ababa"
},
{
"input": "10\naaaaaaaaaa",
"output": "a"
},
{
"input": "22\naaaaabbbbboyoyoyoyoyac",
"output": "abbbbboc"
},
{
"input": "7\nmahmoud",
"output": "mahmod"
}
] | 1,553,331,463
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 3
| 108
| 0
|
n = int(input())
s = input()
z = []
q = 'aeiou'
for i in range(n):
z.append(s[i])
while True or len(z)!=1:
f = True
for i in range(len(z)-1):
if (z[i] in q) and (z[i+1] in q):
f = False
break
if not f:
del z[i+1]
else:
break
for i in range(len(z)):
print(z[i],end='')
|
Title: Word Correction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Victor tries to write his own text editor, with word correction included. However, the rules of word correction are really strange.
Victor thinks that if a word contains two consecutive vowels, then it's kinda weird and it needs to be replaced. So the word corrector works in such a way: as long as there are two consecutive vowels in the word, it deletes the first vowel in a word such that there is another vowel right before it. If there are no two consecutive vowels in the word, it is considered to be correct.
You are given a word *s*. Can you predict what will it become after correction?
In this problem letters a, e, i, o, u and y are considered to be vowels.
Input Specification:
The first line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of letters in word *s* before the correction.
The second line contains a string *s* consisting of exactly *n* lowercase Latin letters — the word before the correction.
Output Specification:
Output the word *s* after the correction.
Demo Input:
['5\nweird\n', '4\nword\n', '5\naaeaa\n']
Demo Output:
['werd\n', 'word\n', 'a\n']
Note:
Explanations of the examples:
1. There is only one replace: weird <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> werd;1. No replace needed since there are no two consecutive vowels;1. aaeaa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> aeaa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> aaa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> aa <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> a.
|
```python
n = int(input())
s = input()
z = []
q = 'aeiou'
for i in range(n):
z.append(s[i])
while True or len(z)!=1:
f = True
for i in range(len(z)-1):
if (z[i] in q) and (z[i+1] in q):
f = False
break
if not f:
del z[i+1]
else:
break
for i in range(len(z)):
print(z[i],end='')
```
| 0
|
|
1,005
|
B
|
Delete from the Left
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation",
"strings"
] | null | null |
You are given two strings $s$ and $t$. In a single move, you can choose any of two strings and delete the first (that is, the leftmost) character. After a move, the length of the string decreases by $1$. You can't choose a string if it is empty.
For example:
- by applying a move to the string "where", the result is the string "here", - by applying a move to the string "a", the result is an empty string "".
You are required to make two given strings equal using the fewest number of moves. It is possible that, in the end, both strings will be equal to the empty string, and so, are equal to each other. In this case, the answer is obviously the sum of the lengths of the initial strings.
Write a program that finds the minimum number of moves to make two given strings $s$ and $t$ equal.
|
The first line of the input contains $s$. In the second line of the input contains $t$. Both strings consist only of lowercase Latin letters. The number of letters in each string is between 1 and $2\cdot10^5$, inclusive.
|
Output the fewest number of moves required. It is possible that, in the end, both strings will be equal to the empty string, and so, are equal to each other. In this case, the answer is obviously the sum of the lengths of the given strings.
|
[
"test\nwest\n",
"codeforces\nyes\n",
"test\nyes\n",
"b\nab\n"
] |
[
"2\n",
"9\n",
"7\n",
"1\n"
] |
In the first example, you should apply the move once to the first string and apply the move once to the second string. As a result, both strings will be equal to "est".
In the second example, the move should be applied to the string "codeforces" $8$ times. As a result, the string becomes "codeforces" $\to$ "es". The move should be applied to the string "yes" once. The result is the same string "yes" $\to$ "es".
In the third example, you can make the strings equal only by completely deleting them. That is, in the end, both strings will be empty.
In the fourth example, the first character of the second string should be deleted.
| 0
|
[
{
"input": "test\nwest",
"output": "2"
},
{
"input": "codeforces\nyes",
"output": "9"
},
{
"input": "test\nyes",
"output": "7"
},
{
"input": "b\nab",
"output": "1"
},
{
"input": "z\nz",
"output": "0"
},
{
"input": "abacabadabacaba\nabacabadacaba",
"output": "18"
},
{
"input": "z\na",
"output": "2"
},
{
"input": "ama\nsama",
"output": "1"
},
{
"input": "aaabc\nbc",
"output": "3"
},
{
"input": "lxuyspmieeuyxluv\ndfwxqvavzxctblaa",
"output": "32"
},
{
"input": "ahmedaly\naly",
"output": "5"
},
{
"input": "aa\na",
"output": "1"
},
{
"input": "aa\nba",
"output": "2"
},
{
"input": "cccba\nba",
"output": "3"
},
{
"input": "a\nab",
"output": "3"
},
{
"input": "dadc\ndddc",
"output": "4"
},
{
"input": "aacaaab\nb",
"output": "6"
},
{
"input": "dddc\ncdcde",
"output": "9"
},
{
"input": "bbdab\ndab",
"output": "2"
},
{
"input": "a\naa",
"output": "1"
},
{
"input": "aa\nab",
"output": "4"
},
{
"input": "codeforces\nces",
"output": "7"
}
] | 1,693,771,626
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 1
| 15
| 0
|
sum=0
a,b=input(),input()
if len(a)>len(b):
sum+=len(a[len(b):])
a=a[:len(b)]
elif len(a) < len(b):
sum+=len(b[len(a):])
b=b[:len(a)]
x=a
mid = len(x) // 2
l=0
r=len(x)-1
if a[-1]!=b[-1]:
sum+=(len(a)+len(b))
else:
while True:
if a[mid]==b[mid]:
rtemp=mid
else:
break
mid=(rtemp+l)//2
flag=False
for i in range(rtemp,len(a)):
if a[i]!=b[i]:
break
if i>0:
sum += ((len(a) - i) * 2)
print(sum)
# Sun Sep 03 2023 23:07:06 GMT+0300 (Moscow Standard Time)
|
Title: Delete from the Left
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given two strings $s$ and $t$. In a single move, you can choose any of two strings and delete the first (that is, the leftmost) character. After a move, the length of the string decreases by $1$. You can't choose a string if it is empty.
For example:
- by applying a move to the string "where", the result is the string "here", - by applying a move to the string "a", the result is an empty string "".
You are required to make two given strings equal using the fewest number of moves. It is possible that, in the end, both strings will be equal to the empty string, and so, are equal to each other. In this case, the answer is obviously the sum of the lengths of the initial strings.
Write a program that finds the minimum number of moves to make two given strings $s$ and $t$ equal.
Input Specification:
The first line of the input contains $s$. In the second line of the input contains $t$. Both strings consist only of lowercase Latin letters. The number of letters in each string is between 1 and $2\cdot10^5$, inclusive.
Output Specification:
Output the fewest number of moves required. It is possible that, in the end, both strings will be equal to the empty string, and so, are equal to each other. In this case, the answer is obviously the sum of the lengths of the given strings.
Demo Input:
['test\nwest\n', 'codeforces\nyes\n', 'test\nyes\n', 'b\nab\n']
Demo Output:
['2\n', '9\n', '7\n', '1\n']
Note:
In the first example, you should apply the move once to the first string and apply the move once to the second string. As a result, both strings will be equal to "est".
In the second example, the move should be applied to the string "codeforces" $8$ times. As a result, the string becomes "codeforces" $\to$ "es". The move should be applied to the string "yes" once. The result is the same string "yes" $\to$ "es".
In the third example, you can make the strings equal only by completely deleting them. That is, in the end, both strings will be empty.
In the fourth example, the first character of the second string should be deleted.
|
```python
sum=0
a,b=input(),input()
if len(a)>len(b):
sum+=len(a[len(b):])
a=a[:len(b)]
elif len(a) < len(b):
sum+=len(b[len(a):])
b=b[:len(a)]
x=a
mid = len(x) // 2
l=0
r=len(x)-1
if a[-1]!=b[-1]:
sum+=(len(a)+len(b))
else:
while True:
if a[mid]==b[mid]:
rtemp=mid
else:
break
mid=(rtemp+l)//2
flag=False
for i in range(rtemp,len(a)):
if a[i]!=b[i]:
break
if i>0:
sum += ((len(a) - i) * 2)
print(sum)
# Sun Sep 03 2023 23:07:06 GMT+0300 (Moscow Standard Time)
```
| -1
|
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,687,869,848
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 92
| 0
|
a = input()
x = 0
y = 0
for i in a:
if i.islower():
x += 1
else:
y += 1
if y>x:
print(a.upper())
else:
print(a.lower())
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP — with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* — it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
a = input()
x = 0
y = 0
for i in a:
if i.islower():
x += 1
else:
y += 1
if y>x:
print(a.upper())
else:
print(a.lower())
```
| 3.977
|
509
|
A
|
Maximum in Table
|
PROGRAMMING
| 800
|
[
"brute force",
"implementation"
] | null | null |
An *n*<=×<=*n* table *a* is defined as follows:
- The first row and the first column contain ones, that is: *a**i*,<=1<==<=*a*1,<=*i*<==<=1 for all *i*<==<=1,<=2,<=...,<=*n*. - Each of the remaining numbers in the table is equal to the sum of the number above it and the number to the left of it. In other words, the remaining elements are defined by the formula *a**i*,<=*j*<==<=*a**i*<=-<=1,<=*j*<=+<=*a**i*,<=*j*<=-<=1.
These conditions define all the values in the table.
You are given a number *n*. You need to determine the maximum value in the *n*<=×<=*n* table defined by the rules above.
|
The only line of input contains a positive integer *n* (1<=≤<=*n*<=≤<=10) — the number of rows and columns of the table.
|
Print a single line containing a positive integer *m* — the maximum value in the table.
|
[
"1\n",
"5\n"
] |
[
"1",
"70"
] |
In the second test the rows of the table look as follows:
| 0
|
[
{
"input": "1",
"output": "1"
},
{
"input": "5",
"output": "70"
},
{
"input": "2",
"output": "2"
},
{
"input": "3",
"output": "6"
},
{
"input": "4",
"output": "20"
},
{
"input": "6",
"output": "252"
},
{
"input": "7",
"output": "924"
},
{
"input": "9",
"output": "12870"
},
{
"input": "10",
"output": "48620"
},
{
"input": "8",
"output": "3432"
}
] | 1,593,967,095
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 10
| 93
| 6,656,000
|
n = int(input())
matr = [[0]*n for i in range(n)]
for i in range(n):
matr[i][0] = 1
matr[0][i] = 1
for i in range(1, n):
for j in range(1, n):
matr[i][j] = matr[i-1][j] + matr[i][j-1]
print(matr[n-1][n-1])
|
Title: Maximum in Table
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
An *n*<=×<=*n* table *a* is defined as follows:
- The first row and the first column contain ones, that is: *a**i*,<=1<==<=*a*1,<=*i*<==<=1 for all *i*<==<=1,<=2,<=...,<=*n*. - Each of the remaining numbers in the table is equal to the sum of the number above it and the number to the left of it. In other words, the remaining elements are defined by the formula *a**i*,<=*j*<==<=*a**i*<=-<=1,<=*j*<=+<=*a**i*,<=*j*<=-<=1.
These conditions define all the values in the table.
You are given a number *n*. You need to determine the maximum value in the *n*<=×<=*n* table defined by the rules above.
Input Specification:
The only line of input contains a positive integer *n* (1<=≤<=*n*<=≤<=10) — the number of rows and columns of the table.
Output Specification:
Print a single line containing a positive integer *m* — the maximum value in the table.
Demo Input:
['1\n', '5\n']
Demo Output:
['1', '70']
Note:
In the second test the rows of the table look as follows:
|
```python
n = int(input())
matr = [[0]*n for i in range(n)]
for i in range(n):
matr[i][0] = 1
matr[0][i] = 1
for i in range(1, n):
for j in range(1, n):
matr[i][j] = matr[i-1][j] + matr[i][j-1]
print(matr[n-1][n-1])
```
| 3
|
|
61
|
A
|
Ultra-Fast Mathematician
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Ultra-Fast Mathematician
|
2
|
256
|
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
|
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
|
Write one line — the corresponding answer. Do not omit the leading 0s.
|
[
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] |
[
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] |
none
| 500
|
[
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "10\n01",
"output": "11"
},
{
"input": "00111111\n11011101",
"output": "11100010"
},
{
"input": "011001100\n101001010",
"output": "110000110"
},
{
"input": "1100100001\n0110101100",
"output": "1010001101"
},
{
"input": "00011101010\n10010100101",
"output": "10001001111"
},
{
"input": "100000101101\n111010100011",
"output": "011010001110"
},
{
"input": "1000001111010\n1101100110001",
"output": "0101101001011"
},
{
"input": "01011111010111\n10001110111010",
"output": "11010001101101"
},
{
"input": "110010000111100\n001100101011010",
"output": "111110101100110"
},
{
"input": "0010010111110000\n0000000011010110",
"output": "0010010100100110"
},
{
"input": "00111110111110000\n01111100001100000",
"output": "01000010110010000"
},
{
"input": "101010101111010001\n001001111101111101",
"output": "100011010010101100"
},
{
"input": "0110010101111100000\n0011000101000000110",
"output": "0101010000111100110"
},
{
"input": "11110100011101010111\n00001000011011000000",
"output": "11111100000110010111"
},
{
"input": "101010101111101101001\n111010010010000011111",
"output": "010000111101101110110"
},
{
"input": "0000111111100011000010\n1110110110110000001010",
"output": "1110001001010011001000"
},
{
"input": "10010010101000110111000\n00101110100110111000111",
"output": "10111100001110001111111"
},
{
"input": "010010010010111100000111\n100100111111100011001110",
"output": "110110101101011111001001"
},
{
"input": "0101110100100111011010010\n0101100011010111001010001",
"output": "0000010111110000010000011"
},
{
"input": "10010010100011110111111011\n10000110101100000001000100",
"output": "00010100001111110110111111"
},
{
"input": "000001111000000100001000000\n011100111101111001110110001",
"output": "011101000101111101111110001"
},
{
"input": "0011110010001001011001011100\n0000101101000011101011001010",
"output": "0011011111001010110010010110"
},
{
"input": "11111000000000010011001101111\n11101110011001010100010000000",
"output": "00010110011001000111011101111"
},
{
"input": "011001110000110100001100101100\n001010000011110000001000101001",
"output": "010011110011000100000100000101"
},
{
"input": "1011111010001100011010110101111\n1011001110010000000101100010101",
"output": "0000110100011100011111010111010"
},
{
"input": "10111000100001000001010110000001\n10111000001100101011011001011000",
"output": "00000000101101101010001111011001"
},
{
"input": "000001010000100001000000011011100\n111111111001010100100001100000111",
"output": "111110101001110101100001111011011"
},
{
"input": "1101000000000010011011101100000110\n1110000001100010011010000011011110",
"output": "0011000001100000000001101111011000"
},
{
"input": "01011011000010100001100100011110001\n01011010111000001010010100001110000",
"output": "00000001111010101011110000010000001"
},
{
"input": "000011111000011001000110111100000100\n011011000110000111101011100111000111",
"output": "011000111110011110101101011011000011"
},
{
"input": "1001000010101110001000000011111110010\n0010001011010111000011101001010110000",
"output": "1011001001111001001011101010101000010"
},
{
"input": "00011101011001100101111111000000010101\n10010011011011001011111000000011101011",
"output": "10001110000010101110000111000011111110"
},
{
"input": "111011100110001001101111110010111001010\n111111101101111001110010000101101000100",
"output": "000100001011110000011101110111010001110"
},
{
"input": "1111001001101000001000000010010101001010\n0010111100111110001011000010111110111001",
"output": "1101110101010110000011000000101011110011"
},
{
"input": "00100101111000000101011111110010100011010\n11101110001010010101001000111110101010100",
"output": "11001011110010010000010111001100001001110"
},
{
"input": "101011001110110100101001000111010101101111\n100111100110101011010100111100111111010110",
"output": "001100101000011111111101111011101010111001"
},
{
"input": "1111100001100101000111101001001010011100001\n1000110011000011110010001011001110001000001",
"output": "0111010010100110110101100010000100010100000"
},
{
"input": "01100111011111010101000001101110000001110101\n10011001011111110000000101011001001101101100",
"output": "11111110000000100101000100110111001100011001"
},
{
"input": "110010100111000100100101100000011100000011001\n011001111011100110000110111001110110100111011",
"output": "101011011100100010100011011001101010100100010"
},
{
"input": "0001100111111011010110100100111000000111000110\n1100101011000000000001010010010111001100110001",
"output": "1101001100111011010111110110101111001011110111"
},
{
"input": "00000101110110110001110010100001110100000100000\n10010000110011110001101000111111101010011010001",
"output": "10010101000101000000011010011110011110011110001"
},
{
"input": "110000100101011100100011001111110011111110010001\n101011111001011100110110111101110011010110101100",
"output": "011011011100000000010101110010000000101000111101"
},
{
"input": "0101111101011111010101011101000011101100000000111\n0000101010110110001110101011011110111001010100100",
"output": "0101010111101001011011110110011101010101010100011"
},
{
"input": "11000100010101110011101000011111001010110111111100\n00001111000111001011111110000010101110111001000011",
"output": "11001011010010111000010110011101100100001110111111"
},
{
"input": "101000001101111101101111111000001110110010101101010\n010011100111100001100000010001100101000000111011011",
"output": "111011101010011100001111101001101011110010010110001"
},
{
"input": "0011111110010001010100010110111000110011001101010100\n0111000000100010101010000100101000000100101000111001",
"output": "0100111110110011111110010010010000110111100101101101"
},
{
"input": "11101010000110000011011010000001111101000111011111100\n10110011110001010100010110010010101001010111100100100",
"output": "01011001110111010111001100010011010100010000111011000"
},
{
"input": "011000100001000001101000010110100110011110100111111011\n111011001000001001110011001111011110111110110011011111",
"output": "100011101001001000011011011001111000100000010100100100"
},
{
"input": "0111010110010100000110111011010110100000000111110110000\n1011100100010001101100000100111111101001110010000100110",
"output": "1100110010000101101010111111101001001001110101110010110"
},
{
"input": "10101000100111000111010001011011011011110100110101100011\n11101111000000001100100011111000100100000110011001101110",
"output": "01000111100111001011110010100011111111110010101100001101"
},
{
"input": "000000111001010001000000110001001011100010011101010011011\n110001101000010010000101000100001111101001100100001010010",
"output": "110001010001000011000101110101000100001011111001011001001"
},
{
"input": "0101011100111010000111110010101101111111000000111100011100\n1011111110000010101110111001000011100000100111111111000111",
"output": "1110100010111000101001001011101110011111100111000011011011"
},
{
"input": "11001000001100100111100111100100101011000101001111001001101\n10111110100010000011010100110100100011101001100000001110110",
"output": "01110110101110100100110011010000001000101100101111000111011"
},
{
"input": "010111011011101000000110000110100110001110100001110110111011\n101011110011101011101101011111010100100001100111100100111011",
"output": "111100101000000011101011011001110010101111000110010010000000"
},
{
"input": "1001011110110110000100011001010110000100011010010111010101110\n1101111100001000010111110011010101111010010100000001000010111",
"output": "0100100010111110010011101010000011111110001110010110010111001"
},
{
"input": "10000010101111100111110101111000010100110111101101111111111010\n10110110101100101010011001011010100110111011101100011001100111",
"output": "00110100000011001101101100100010110010001100000001100110011101"
},
{
"input": "011111010011111000001010101001101001000010100010111110010100001\n011111001011000011111001000001111001010110001010111101000010011",
"output": "000000011000111011110011101000010000010100101000000011010110010"
},
{
"input": "1111000000110001011101000100100100001111011100001111001100011111\n1101100110000101100001100000001001011011111011010101000101001010",
"output": "0010100110110100111100100100101101010100100111011010001001010101"
},
{
"input": "01100000101010010011001110100110110010000110010011011001100100011\n10110110010110111100100111000111000110010000000101101110000010111",
"output": "11010110111100101111101001100001110100010110010110110111100110100"
},
{
"input": "001111111010000100001100001010011001111110011110010111110001100111\n110000101001011000100010101100100110000111100000001101001110010111",
"output": "111111010011011100101110100110111111111001111110011010111111110000"
},
{
"input": "1011101011101101011110101101011101011000010011100101010101000100110\n0001000001001111010111100100111101100000000001110001000110000000110",
"output": "1010101010100010001001001001100000111000010010010100010011000100000"
},
{
"input": "01000001011001010011011100010000100100110101111011011011110000001110\n01011110000110011011000000000011000111100001010000000011111001110000",
"output": "00011111011111001000011100010011100011010100101011011000001001111110"
},
{
"input": "110101010100110101000001111110110100010010000100111110010100110011100\n111010010111111011100110101011001011001110110111110100000110110100111",
"output": "001111000011001110100111010101111111011100110011001010010010000111011"
},
{
"input": "1001101011000001011111100110010010000011010001001111011100010100110001\n1111100111110101001111010001010000011001001001010110001111000000100101",
"output": "0110001100110100010000110111000010011010011000011001010011010100010100"
},
{
"input": "00000111110010110001110110001010010101000111011001111111100110011110010\n00010111110100000100110101000010010001100001100011100000001100010100010",
"output": "00010000000110110101000011001000000100100110111010011111101010001010000"
},
{
"input": "100101011100101101000011010001011001101110101110001100010001010111001110\n100001111100101011011111110000001111000111001011111110000010101110111001",
"output": "000100100000000110011100100001010110101001100101110010010011111001110111"
},
{
"input": "1101100001000111001101001011101000111000011110000001001101101001111011010\n0101011101010100011011010110101000010010110010011110101100000110110001000",
"output": "1000111100010011010110011101000000101010101100011111100001101111001010010"
},
{
"input": "01101101010011110101100001110101111011100010000010001101111000011110111111\n00101111001101001100111010000101110000100101101111100111101110010100011011",
"output": "01000010011110111001011011110000001011000111101101101010010110001010100100"
},
{
"input": "101100101100011001101111110110110010100110110010100001110010110011001101011\n000001011010101011110011111101001110000111000010001101000010010000010001101",
"output": "101101110110110010011100001011111100100001110000101100110000100011011100110"
},
{
"input": "0010001011001010001100000010010011110110011000100000000100110000101111001110\n1100110100111000110100001110111001011101001100001010100001010011100110110001",
"output": "1110111111110010111000001100101010101011010100101010100101100011001001111111"
},
{
"input": "00101101010000000101011001101011001100010001100000101011101110000001111001000\n10010110010111000000101101000011101011001010000011011101101011010000000011111",
"output": "10111011000111000101110100101000100111011011100011110110000101010001111010111"
},
{
"input": "111100000100100000101001100001001111001010001000001000000111010000010101101011\n001000100010100101111011111011010110101100001111011000010011011011100010010110",
"output": "110100100110000101010010011010011001100110000111010000010100001011110111111101"
},
{
"input": "0110001101100100001111110101101000100101010010101010011001101001001101110000000\n0111011000000010010111011110010000000001000110001000011001101000000001110100111",
"output": "0001010101100110011000101011111000100100010100100010000000000001001100000100111"
},
{
"input": "10001111111001000101001011110101111010100001011010101100111001010001010010001000\n10000111010010011110111000111010101100000011110001101111001000111010100000000001",
"output": "00001000101011011011110011001111010110100010101011000011110001101011110010001001"
},
{
"input": "100110001110110000100101001110000011110110000110000000100011110100110110011001101\n110001110101110000000100101001101011111100100100001001000110000001111100011110110",
"output": "010111111011000000100001100111101000001010100010001001100101110101001010000111011"
},
{
"input": "0000010100100000010110111100011111111010011101000000100000011001001101101100111010\n0100111110011101010110101011110110010111001111000110101100101110111100101000111111",
"output": "0100101010111101000000010111101001101101010010000110001100110111110001000100000101"
},
{
"input": "11000111001010100001110000001001011010010010110000001110100101000001010101100110111\n11001100100100100001101010110100000111100011101110011010110100001001000011011011010",
"output": "00001011101110000000011010111101011101110001011110010100010001001000010110111101101"
},
{
"input": "010110100010001000100010101001101010011010111110100001000100101000111011100010100001\n110000011111101101010011111000101010111010100001001100001001100101000000111000000000",
"output": "100110111101100101110001010001000000100000011111101101001101001101111011011010100001"
},
{
"input": "0000011110101110010101110110110101100001011001101010101001000010000010000000101001101\n1100111111011100000110000111101110011111100111110001011001000010011111100001001100011",
"output": "1100100001110010010011110001011011111110111110011011110000000000011101100001100101110"
},
{
"input": "10100000101101110001100010010010100101100011010010101000110011100000101010110010000000\n10001110011011010010111011011101101111000111110000111000011010010101001100000001010011",
"output": "00101110110110100011011001001111001010100100100010010000101001110101100110110011010011"
},
{
"input": "001110000011111101101010011111000101010111010100001001100001001100101000000111000000000\n111010000000000000101001110011001000111011001100101010011001000011101001001011110000011",
"output": "110100000011111101000011101100001101101100011000100011111000001111000001001100110000011"
},
{
"input": "1110111100111011010101011011001110001010010010110011110010011111000010011111010101100001\n1001010101011001001010100010101100000110111101011000100010101111111010111100001110010010",
"output": "0111101001100010011111111001100010001100101111101011010000110000111000100011011011110011"
},
{
"input": "11100010001100010011001100001100010011010001101110011110100101110010101101011101000111111\n01110000000110111010110100001010000101011110100101010011000110101110101101110111011110001",
"output": "10010010001010101001111000000110010110001111001011001101100011011100000000101010011001110"
},
{
"input": "001101011001100101101100110000111000101011001001100100000100101000100000110100010111111101\n101001111110000010111101111110001001111001111101111010000110111000100100110010010001011111",
"output": "100100100111100111010001001110110001010010110100011110000010010000000100000110000110100010"
},
{
"input": "1010110110010101000110010010110101011101010100011001101011000110000000100011100100011000000\n0011011111100010001111101101000111001011101110100000110111100100101111010110101111011100011",
"output": "1001101001110111001001111111110010010110111010111001011100100010101111110101001011000100011"
},
{
"input": "10010010000111010111011111110010100101100000001100011100111011100010000010010001011100001100\n00111010100010110010000100010111010001111110100100100011101000101111111111001101101100100100",
"output": "10101000100101100101011011100101110100011110101000111111010011001101111101011100110000101000"
},
{
"input": "010101110001010101100000010111010000000111110011001101100011001000000011001111110000000010100\n010010111011100101010101111110110000000111000100001101101001001000001100101110001010000100001",
"output": "000111001010110000110101101001100000000000110111000000001010000000001111100001111010000110101"
},
{
"input": "1100111110011001000111101001001011000110011010111111100010111111001100111111011101100111101011\n1100000011001000110100110111000001011001010111101000010010100011000001100100111101101000010110",
"output": "0000111101010001110011011110001010011111001101010111110000011100001101011011100000001111111101"
},
{
"input": "00011000100100110111100101100100000000010011110111110010101110110011100001010111010011110100101\n00011011111011111011100101100111100101001110010111000010000111000100100100000001110101111011011",
"output": "00000011011111001100000000000011100101011101100000110000101001110111000101010110100110001111110"
},
{
"input": "000101011001001100000111100010110101111011110101111101000110001101011010111110110011100100000001\n011000101010011111011000111000100000000011011000000001111110001000001111101010110000011100001111",
"output": "011101110011010011011111011010010101111000101101111100111000000101010101010100000011111000001110"
},
{
"input": "1000101001011010000100100100010010011101011001110101111011101111111110010101001101010001010101001\n0110110010011100011111011111110111000000010001110100001010111110101011010011111011111110000110000",
"output": "1110011011000110011011111011100101011101001000000001110001010001010101000110110110101111010011001"
},
{
"input": "01111010010101100111110111111011011010100001011101010000111100101101101110111011001100101011100111\n00001100110110100001111011000010001001001100000010111101000001111011100000010111010010000011000010",
"output": "01110110100011000110001100111001010011101101011111101101111101010110001110101100011110101000100101"
},
{
"input": "111101011101111000001011001101111010110111001101110100100011111011011101001101010101011010111000110\n101111100101101101001100110011000001111010011101110111110110101110011011110011111100001001110101101",
"output": "010010111000010101000111111110111011001101010000000011010101010101000110111110101001010011001101011"
},
{
"input": "1010000011010110011101001101110001110010000111011101110010110110111111001001110100101100010101010001\n0111101000111100101100000101111010100100001000011101010100110011100011010011010101000100101011100011",
"output": "1101101011101010110001001000001011010110001111000000100110000101011100011010100001101000111110110010"
},
{
"input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001\n1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111010",
"output": "1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111011"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "0\n1",
"output": "1"
}
] | 1,588,188,052
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 102
| 109
| 0
|
print(''.join(['1' if z[0] != z[1] else '0' for z in zip(input(),input())]))
|
Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
Input Specification:
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
Output Specification:
Write one line — the corresponding answer. Do not omit the leading 0s.
Demo Input:
['1010100\n0100101\n', '000\n111\n', '1110\n1010\n', '01110\n01100\n']
Demo Output:
['1110001\n', '111\n', '0100\n', '00010\n']
Note:
none
|
```python
print(''.join(['1' if z[0] != z[1] else '0' for z in zip(input(),input())]))
```
| 3.97275
|
106
|
A
|
Card Game
|
PROGRAMMING
| 1,000
|
[
"implementation"
] |
A. Card Game
|
2
|
256
|
There is a card game called "Durak", which means "Fool" in Russian. The game is quite popular in the countries that used to form USSR. The problem does not state all the game's rules explicitly — you can find them later yourselves if you want.
To play durak you need a pack of 36 cards. Each card has a suit ("S", "H", "D" and "C") and a rank (in the increasing order "6", "7", "8", "9", "T", "J", "Q", "K" and "A"). At the beginning of the game one suit is arbitrarily chosen as trump.
The players move like that: one player puts one or several of his cards on the table and the other one should beat each of them with his cards.
A card beats another one if both cards have similar suits and the first card has a higher rank then the second one. Besides, a trump card can beat any non-trump card whatever the cards’ ranks are. In all other cases you can not beat the second card with the first one.
You are given the trump suit and two different cards. Determine whether the first one beats the second one or not.
|
The first line contains the tramp suit. It is "S", "H", "D" or "C".
The second line contains the description of the two different cards. Each card is described by one word consisting of two symbols. The first symbol stands for the rank ("6", "7", "8", "9", "T", "J", "Q", "K" and "A"), and the second one stands for the suit ("S", "H", "D" and "C").
|
Print "YES" (without the quotes) if the first cards beats the second one. Otherwise, print "NO" (also without the quotes).
|
[
"H\nQH 9S\n",
"S\n8D 6D\n",
"C\n7H AS\n"
] |
[
"YES\n",
"YES",
"NO"
] |
none
| 500
|
[
{
"input": "H\nQH 9S",
"output": "YES"
},
{
"input": "S\n8D 6D",
"output": "YES"
},
{
"input": "C\n7H AS",
"output": "NO"
},
{
"input": "C\nKC 9C",
"output": "YES"
},
{
"input": "D\n7D KD",
"output": "NO"
},
{
"input": "H\n7H KD",
"output": "YES"
},
{
"input": "D\nAS AH",
"output": "NO"
},
{
"input": "H\nKH KS",
"output": "YES"
},
{
"input": "C\n9H 6C",
"output": "NO"
},
{
"input": "C\n9H JC",
"output": "NO"
},
{
"input": "D\nTD JD",
"output": "NO"
},
{
"input": "H\n6S 7S",
"output": "NO"
},
{
"input": "D\n7S 8S",
"output": "NO"
},
{
"input": "S\n8H 9H",
"output": "NO"
},
{
"input": "C\n9D TD",
"output": "NO"
},
{
"input": "H\nTC JC",
"output": "NO"
},
{
"input": "C\nJH QH",
"output": "NO"
},
{
"input": "H\nQD KD",
"output": "NO"
},
{
"input": "D\nKS AS",
"output": "NO"
},
{
"input": "S\nAH 6H",
"output": "YES"
},
{
"input": "H\n7D 6D",
"output": "YES"
},
{
"input": "S\n8H 7H",
"output": "YES"
},
{
"input": "D\n9S 8S",
"output": "YES"
},
{
"input": "S\nTC 9C",
"output": "YES"
},
{
"input": "H\nJS TS",
"output": "YES"
},
{
"input": "S\nQD JD",
"output": "YES"
},
{
"input": "D\nKH QH",
"output": "YES"
},
{
"input": "H\nAD KD",
"output": "YES"
},
{
"input": "H\nQS QD",
"output": "NO"
},
{
"input": "C\nTS TH",
"output": "NO"
},
{
"input": "C\n6C 6D",
"output": "YES"
},
{
"input": "H\n8H 8D",
"output": "YES"
},
{
"input": "S\n7D 7S",
"output": "NO"
},
{
"input": "H\nJC JH",
"output": "NO"
},
{
"input": "H\n8H 9C",
"output": "YES"
},
{
"input": "D\n9D 6S",
"output": "YES"
},
{
"input": "C\nJC AH",
"output": "YES"
},
{
"input": "S\nAS KD",
"output": "YES"
},
{
"input": "S\n7S JS",
"output": "NO"
},
{
"input": "H\nTH 8H",
"output": "YES"
},
{
"input": "S\n7S QS",
"output": "NO"
},
{
"input": "C\nKC QC",
"output": "YES"
},
{
"input": "S\nAD 9S",
"output": "NO"
},
{
"input": "D\n7H 8D",
"output": "NO"
},
{
"input": "H\nJC 9H",
"output": "NO"
},
{
"input": "C\n7S AC",
"output": "NO"
},
{
"input": "C\n8C 7C",
"output": "YES"
},
{
"input": "H\n9D 8S",
"output": "NO"
},
{
"input": "D\nAC KS",
"output": "NO"
},
{
"input": "H\n8C QH",
"output": "NO"
},
{
"input": "S\n7S TS",
"output": "NO"
},
{
"input": "C\nAH 6S",
"output": "NO"
},
{
"input": "S\nKS QS",
"output": "YES"
},
{
"input": "H\nAC QC",
"output": "YES"
},
{
"input": "S\n9H 8D",
"output": "NO"
},
{
"input": "S\nTS JS",
"output": "NO"
},
{
"input": "S\n8H 7C",
"output": "NO"
},
{
"input": "C\nAH 6S",
"output": "NO"
},
{
"input": "S\n7S QS",
"output": "NO"
},
{
"input": "C\nAH 6S",
"output": "NO"
},
{
"input": "S\nTS KS",
"output": "NO"
},
{
"input": "C\nTH KH",
"output": "NO"
},
{
"input": "H\n9C 6D",
"output": "NO"
},
{
"input": "H\n9C 8D",
"output": "NO"
},
{
"input": "H\nTH AH",
"output": "NO"
},
{
"input": "H\nTH JH",
"output": "NO"
},
{
"input": "H\nQS 9C",
"output": "NO"
},
{
"input": "H\nKC AC",
"output": "NO"
},
{
"input": "H\nAH KH",
"output": "YES"
},
{
"input": "H\nKS QS",
"output": "YES"
},
{
"input": "C\nAD KS",
"output": "NO"
},
{
"input": "H\nQS 9C",
"output": "NO"
},
{
"input": "H\n9D 7S",
"output": "NO"
},
{
"input": "D\n6D 9S",
"output": "YES"
},
{
"input": "H\nAH KH",
"output": "YES"
},
{
"input": "H\nKC AC",
"output": "NO"
},
{
"input": "D\n8S 6C",
"output": "NO"
},
{
"input": "S\nAC KC",
"output": "YES"
}
] | 1,555,041,174
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 216
| 0
|
suite = str(input())
carda, cardb = [str(x) for x in input().strip().split()]
win = 0
deck = ["6", "7", "8", "9", "T", "J", "Q", "K", "A"]
if(carda[1]==suite[0]):
win=1
elif(cardb[1]==suite[0]):
win=2
elif(deck.index(carda[0]) > deck.index(cardb[0])):
win=1
elif(deck.index(carda[0]) < deck.index(cardb[0])):
win=2
else:
win=0
if(win==1):
print("YES")
elif(win==2):
print("NO")
|
Title: Card Game
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
There is a card game called "Durak", which means "Fool" in Russian. The game is quite popular in the countries that used to form USSR. The problem does not state all the game's rules explicitly — you can find them later yourselves if you want.
To play durak you need a pack of 36 cards. Each card has a suit ("S", "H", "D" and "C") and a rank (in the increasing order "6", "7", "8", "9", "T", "J", "Q", "K" and "A"). At the beginning of the game one suit is arbitrarily chosen as trump.
The players move like that: one player puts one or several of his cards on the table and the other one should beat each of them with his cards.
A card beats another one if both cards have similar suits and the first card has a higher rank then the second one. Besides, a trump card can beat any non-trump card whatever the cards’ ranks are. In all other cases you can not beat the second card with the first one.
You are given the trump suit and two different cards. Determine whether the first one beats the second one or not.
Input Specification:
The first line contains the tramp suit. It is "S", "H", "D" or "C".
The second line contains the description of the two different cards. Each card is described by one word consisting of two symbols. The first symbol stands for the rank ("6", "7", "8", "9", "T", "J", "Q", "K" and "A"), and the second one stands for the suit ("S", "H", "D" and "C").
Output Specification:
Print "YES" (without the quotes) if the first cards beats the second one. Otherwise, print "NO" (also without the quotes).
Demo Input:
['H\nQH 9S\n', 'S\n8D 6D\n', 'C\n7H AS\n']
Demo Output:
['YES\n', 'YES', 'NO']
Note:
none
|
```python
suite = str(input())
carda, cardb = [str(x) for x in input().strip().split()]
win = 0
deck = ["6", "7", "8", "9", "T", "J", "Q", "K", "A"]
if(carda[1]==suite[0]):
win=1
elif(cardb[1]==suite[0]):
win=2
elif(deck.index(carda[0]) > deck.index(cardb[0])):
win=1
elif(deck.index(carda[0]) < deck.index(cardb[0])):
win=2
else:
win=0
if(win==1):
print("YES")
elif(win==2):
print("NO")
```
| 0
|
250
|
A
|
Paper Work
|
PROGRAMMING
| 1,000
|
[
"greedy"
] | null | null |
Polycarpus has been working in the analytic department of the "F.R.A.U.D." company for as much as *n* days. Right now his task is to make a series of reports about the company's performance for the last *n* days. We know that the main information in a day report is value *a**i*, the company's profit on the *i*-th day. If *a**i* is negative, then the company suffered losses on the *i*-th day.
Polycarpus should sort the daily reports into folders. Each folder should include data on the company's performance for several consecutive days. Of course, the information on each of the *n* days should be exactly in one folder. Thus, Polycarpus puts information on the first few days in the first folder. The information on the several following days goes to the second folder, and so on.
It is known that the boss reads one daily report folder per day. If one folder has three or more reports for the days in which the company suffered losses (*a**i*<=<<=0), he loses his temper and his wrath is terrible.
Therefore, Polycarpus wants to prepare the folders so that none of them contains information on three or more days with the loss, and the number of folders is minimal.
Write a program that, given sequence *a**i*, will print the minimum number of folders.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=100), *n* is the number of days. The second line contains a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (|*a**i*|<=≤<=100), where *a**i* means the company profit on the *i*-th day. It is possible that the company has no days with the negative *a**i*.
|
Print an integer *k* — the required minimum number of folders. In the second line print a sequence of integers *b*1, *b*2, ..., *b**k*, where *b**j* is the number of day reports in the *j*-th folder.
If there are multiple ways to sort the reports into *k* days, print any of them.
|
[
"11\n1 2 3 -4 -5 -6 5 -5 -6 -7 6\n",
"5\n0 -1 100 -1 0\n"
] |
[
"3\n5 3 3 ",
"1\n5 "
] |
Here goes a way to sort the reports from the first sample into three folders:
In the second sample you can put all five reports in one folder.
| 500
|
[
{
"input": "11\n1 2 3 -4 -5 -6 5 -5 -6 -7 6",
"output": "3\n5 3 3 "
},
{
"input": "5\n0 -1 100 -1 0",
"output": "1\n5 "
},
{
"input": "1\n0",
"output": "1\n1 "
},
{
"input": "1\n-1",
"output": "1\n1 "
},
{
"input": "2\n0 0",
"output": "1\n2 "
},
{
"input": "2\n-2 2",
"output": "1\n2 "
},
{
"input": "2\n-2 -1",
"output": "1\n2 "
},
{
"input": "12\n1 -12 -5 -8 0 -8 -1 -1 -6 12 -9 12",
"output": "4\n3 3 2 4 "
},
{
"input": "4\n1 2 0 3",
"output": "1\n4 "
},
{
"input": "4\n4 -3 3 3",
"output": "1\n4 "
},
{
"input": "4\n0 -3 4 -3",
"output": "1\n4 "
},
{
"input": "4\n-3 -2 4 -3",
"output": "2\n1 3 "
},
{
"input": "4\n-3 -2 -1 -4",
"output": "2\n2 2 "
},
{
"input": "5\n-2 -2 4 0 -1",
"output": "2\n1 4 "
},
{
"input": "5\n-5 -3 -1 2 -1",
"output": "2\n2 3 "
},
{
"input": "5\n-3 -2 -3 -2 -3",
"output": "3\n1 2 2 "
},
{
"input": "10\n0 5 2 3 10 9 4 9 9 3",
"output": "1\n10 "
},
{
"input": "10\n10 2 1 2 9 10 7 4 -4 5",
"output": "1\n10 "
},
{
"input": "10\n1 -3 1 10 -7 -6 7 0 -5 3",
"output": "2\n5 5 "
},
{
"input": "10\n6 5 -10 -4 -3 -7 5 -2 -6 -10",
"output": "4\n3 2 3 2 "
},
{
"input": "10\n-2 -4 -1 -6 -5 -5 -7 0 -7 -8",
"output": "5\n1 2 2 2 3 "
},
{
"input": "100\n48 36 10 85 15 57 100 70 14 82 15 75 67 44 40 83 12 94 80 77 92 40 39 80 11 10 2 22 71 31 93 51 22 29 98 90 33 91 66 64 87 70 46 86 62 13 85 15 37 3 49 11 21 57 26 14 5 80 33 82 9 75 26 76 50 32 48 100 62 11 97 47 67 81 86 80 51 51 44 97 2 22 18 52 43 54 65 91 94 54 22 80 23 63 44 7 52 98 80 69",
"output": "1\n100 "
},
{
"input": "100\n7 51 31 14 17 0 72 29 77 6 32 94 70 94 1 64 85 29 67 66 56 -90 38 85 51 5 69 36 62 99 99 43 43 40 68 88 62 39 45 75 50 95 51 96 69 60 65 27 63 89 23 43 49 39 92 90 1 49 22 78 13 90 97 87 5 100 60 82 50 49 0 11 87 34 67 7 35 65 20 92 89 29 73 48 41 8 14 76 91 34 13 18 42 75 36 14 78 80 74 9",
"output": "1\n100 "
},
{
"input": "100\n83 71 43 50 61 54 -45 44 36 35 44 21 34 65 23 32 73 36 70 17 46 47 10 30 48 25 84 58 63 96 44 88 24 93 26 24 70 69 90 75 20 42 63 11 0 41 54 23 95 99 17 27 43 20 46 100 65 -79 15 72 78 0 13 94 76 72 69 35 61 3 65 83 28 12 27 48 8 37 30 37 40 87 30 76 81 78 71 44 79 92 10 60 5 7 9 33 79 31 86 51",
"output": "1\n100 "
},
{
"input": "100\n78 96 4 24 -66 42 28 16 42 -48 89 0 74 19 12 86 75 21 42 100 2 43 11 -76 85 24 12 51 26 48 22 74 68 73 22 39 53 42 37 -78 100 5 9 58 10 63 19 89 76 42 10 -96 76 49 67 59 86 37 13 66 75 92 48 80 37 59 49 -4 83 1 82 25 0 31 73 40 52 3 -47 17 68 94 51 84 47 76 73 -65 83 72 56 50 62 -5 40 12 81 75 84 -6",
"output": "5\n10 30 28 20 12 "
},
{
"input": "100\n-63 20 79 73 18 82 23 -93 55 8 -31 37 33 24 30 41 70 77 14 34 84 79 -94 88 54 81 7 90 74 35 29 3 75 71 14 28 -61 63 90 79 71 97 -90 74 -33 10 27 34 46 31 9 90 100 -73 58 2 73 51 5 46 -27 -9 30 65 73 28 15 14 1 59 96 21 100 78 12 97 72 37 -28 52 12 0 -42 84 88 8 88 8 -48 39 13 -78 20 56 38 82 32 -87 45 39",
"output": "8\n1 10 26 8 16 18 10 11 "
},
{
"input": "100\n21 40 60 28 85 10 15 -3 -27 -7 26 26 9 93 -3 -65 70 88 68 -85 24 75 24 -69 53 56 44 -53 -15 -74 12 22 37 22 77 90 9 95 40 15 -76 7 -81 65 83 51 -57 59 19 78 34 40 11 17 99 75 56 67 -81 39 22 86 -78 61 19 25 53 13 -91 91 17 71 45 39 63 32 -57 83 70 26 100 -53 7 95 67 -47 84 84 28 56 94 72 48 58 21 -89 91 73 16 93",
"output": "10\n9 6 5 8 2 13 16 10 13 18 "
},
{
"input": "100\n39 -70 7 7 11 27 88 16 -3 94 94 -2 23 91 41 49 69 61 53 -99 98 54 87 44 48 73 62 80 86 -33 34 -87 56 48 4 18 92 14 -37 84 7 42 9 70 0 -78 17 68 54 -82 65 -21 59 90 72 -19 -81 8 92 88 -68 65 -42 -60 98 -39 -2 2 88 24 9 -95 17 75 12 -32 -9 85 7 88 59 14 90 69 19 -88 -73 1 2 72 15 -83 65 18 26 25 -71 3 -51 95",
"output": "13\n2 10 18 9 11 6 5 3 3 9 10 6 8 "
},
{
"input": "100\n-47 -28 -90 -35 28 32 63 77 88 3 -48 18 48 22 47 47 89 2 88 46 25 60 65 44 100 28 73 71 19 -55 44 47 30 -25 50 15 -98 5 73 -56 61 15 15 77 67 59 -64 22 17 70 67 -12 26 -81 -58 -20 1 22 34 52 -45 56 78 29 47 -11 -10 70 -57 -2 62 85 -84 -54 -67 67 85 23 6 -65 -6 -79 -13 -1 12 68 1 71 73 77 48 -48 90 70 52 100 45 38 -43 -93",
"output": "15\n2 2 26 7 10 7 2 10 3 4 2 6 2 9 8 "
},
{
"input": "100\n-34 -61 96 14 87 33 29 64 -76 7 47 -41 54 60 79 -28 -18 88 95 29 -89 -29 52 39 8 13 68 13 15 46 -34 -49 78 -73 64 -56 83 -16 45 17 40 11 -86 55 56 -35 91 81 38 -77 -41 67 16 -37 -56 -84 -42 99 -83 45 46 -56 -14 -15 79 77 -48 -87 94 46 77 18 -32 16 -18 47 67 35 89 95 36 -32 51 46 40 78 0 58 81 -47 41 5 -48 65 89 6 -79 -56 -25 74",
"output": "18\n1 8 7 5 10 3 4 8 5 4 2 5 2 4 7 15 7 3 "
},
{
"input": "100\n14 36 94 -66 24 -24 14 -87 86 94 44 88 -68 59 4 -27 -74 12 -75 92 -31 29 18 -69 -47 45 -85 67 95 -77 7 -56 -80 -46 -40 73 40 71 41 -86 50 87 94 16 43 -96 96 -63 66 24 3 90 16 42 50 41 15 -45 72 32 -94 -93 91 -31 -30 -73 -88 33 45 9 71 18 37 -26 43 -82 87 67 62 -9 29 -70 -34 99 -30 -25 -86 -91 -70 -48 24 51 53 25 90 69 -17 -53 87 -62",
"output": "20\n6 7 4 4 4 5 3 2 11 12 4 3 2 9 6 3 2 2 8 3 "
},
{
"input": "100\n-40 87 -68 72 -49 48 -62 73 95 27 80 53 76 33 -95 -53 31 18 -61 -75 84 40 35 -82 49 47 -13 22 -81 -65 -17 47 -61 21 9 -12 52 67 31 -86 -63 42 18 -25 70 45 -3 -18 94 -62 -28 16 -100 36 -96 -73 83 -65 9 -51 83 36 65 -24 77 38 81 -84 32 -34 75 -50 -92 11 -73 -17 81 -66 -61 33 -47 -50 -72 -95 -58 54 68 -46 -41 8 76 28 58 87 88 100 61 -61 75 -1",
"output": "23\n1 4 10 4 5 5 2 5 5 6 3 3 3 4 8 4 3 3 3 2 2 4 11 "
},
{
"input": "100\n-61 56 1 -37 61 -77 -6 -5 28 36 27 -32 -10 -44 -89 -26 67 100 -94 80 -18 -5 -92 94 81 -38 -76 4 -77 2 79 55 -93 54 -19 10 -35 -12 -42 -32 -23 -67 -95 -62 -16 23 -25 41 -16 -51 3 -45 -1 53 20 0 0 21 87 28 15 62 64 -21 6 45 -19 95 -23 87 15 -35 21 -88 47 -81 89 68 66 -65 95 54 18 -97 65 -7 75 -58 -54 -3 99 -95 -57 -84 98 -6 33 44 81 -56",
"output": "25\n4 3 5 2 2 5 2 4 6 4 2 2 2 2 4 3 12 5 5 6 6 3 3 2 6 "
},
{
"input": "100\n-21 61 -52 47 -25 -42 -48 -46 58 -13 75 -65 52 88 -59 68 -12 -25 33 14 -2 78 32 -41 -79 17 0 85 -39 -80 61 30 -27 -92 -100 66 -53 -11 -59 65 -5 92 -2 -85 87 -72 19 -50 -24 32 -27 -92 -100 14 72 13 67 -22 -27 -56 -84 -90 -74 -70 44 -92 70 -49 -50 11 57 -73 23 68 65 99 82 -18 -93 -34 85 45 89 -58 -80 5 -57 -98 -11 -96 28 30 29 -71 47 50 -15 30 -96 -53",
"output": "28\n1 4 2 3 5 3 6 5 4 2 3 3 3 4 3 2 6 2 2 3 3 9 2 5 3 2 7 3 "
},
{
"input": "100\n-61 15 -88 52 -75 -71 -36 29 93 99 -73 -97 -69 39 -78 80 -28 -20 -36 -89 88 -82 56 -37 -13 33 2 -6 -88 -9 8 -24 40 5 8 -33 -83 -90 -48 55 69 -12 -49 -41 -4 92 42 57 -17 -68 -41 -68 77 -17 -45 -64 -39 24 -78 -3 -49 77 3 -23 84 -36 -19 -16 -72 74 -19 -81 65 -79 -57 64 89 -29 49 69 88 -18 16 26 -86 -58 -91 69 -43 -28 86 6 -87 47 -71 18 81 -55 -42 -30",
"output": "30\n3 3 5 2 4 2 3 3 4 3 5 2 4 2 5 2 3 2 3 4 3 2 3 3 7 4 3 4 5 2 "
},
{
"input": "100\n-21 -98 -66 26 3 -5 86 99 96 -22 78 -16 20 -3 93 22 -67 -37 -27 12 -97 43 -46 -48 -58 -4 -19 26 -87 -61 67 -76 -42 57 -87 -50 -24 -79 -6 43 -68 -42 13 -1 -82 81 -32 -88 -6 -99 46 42 19 -17 89 14 -98 -24 34 -37 -17 49 76 81 -61 23 -46 -79 -48 -5 87 14 -97 -67 -31 94 -77 15 -44 38 -44 -67 -69 -84 -58 -59 -17 -54 3 -15 79 -28 -10 -26 34 -73 -37 -57 -42 -44",
"output": "33\n1 2 7 4 4 3 3 2 3 3 3 2 2 3 3 3 2 7 3 5 3 2 4 3 4 2 2 2 3 3 3 2 2 "
},
{
"input": "100\n-63 -62 -88 -14 -58 -75 -28 19 -71 60 -38 77 98 95 -49 -64 -87 -97 2 -37 -37 -41 -47 -96 -58 -42 -88 12 -90 -65 0 52 -59 87 -79 -68 -66 -90 -19 -4 86 -65 -49 -94 67 93 -61 100 68 -40 -35 -67 -4 -100 -90 -86 15 -3 -75 57 65 -91 -80 -57 51 -88 -61 -54 -13 -46 -64 53 -87 -54 -69 29 -67 -23 -96 -93 -3 -77 -10 85 55 -44 17 24 -78 -82 -33 14 85 79 84 -91 -81 54 -89 -86",
"output": "35\n2 2 2 3 6 2 3 2 2 2 3 4 3 2 2 3 4 4 2 2 3 4 2 3 2 2 3 3 2 2 2 6 2 6 3 "
},
{
"input": "100\n30 -47 -87 -49 -4 -58 -10 -10 -37 -15 -12 -85 4 24 -3 -2 57 57 -60 94 -21 82 1 -54 -39 -98 -72 57 84 -6 -41 82 93 -81 -61 -30 18 -68 -88 17 87 -6 43 -26 72 -14 -40 -75 -69 60 -91 -70 -26 -62 -13 -19 -97 -14 -59 -17 -44 -15 -65 60 -60 74 26 -6 12 -83 -49 82 -76 -96 -31 -98 -100 49 -50 -42 -43 92 -56 -79 -38 -86 -99 -37 -75 -26 -79 -12 -9 -87 -63 -62 -25 -3 -5 -92",
"output": "38\n2 2 2 2 2 2 4 5 4 2 4 4 3 4 4 2 3 2 2 2 2 2 2 5 3 3 2 3 2 3 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n-58 -18 -94 -96 -18 -2 -35 -49 47 69 96 -46 -88 -91 -9 -95 -12 -46 -12 16 44 -53 -96 71 -11 -98 -62 -27 -89 -88 -28 -11 -14 -47 67 -69 -33 -64 15 -24 67 53 -93 -10 -75 -98 -8 -97 -62 67 -52 -59 -9 -89 -39 -23 -37 -61 -83 -89 23 -47 -67 18 -38 -63 -73 -98 -65 -70 -20 13 -33 -46 -50 -30 -33 85 -93 -42 -37 48 -8 -11 -32 0 -58 -70 -27 -79 -52 82 22 -62 -100 -12 -5 -82 88 -74",
"output": "40\n2 2 2 2 5 2 2 2 4 3 2 2 2 2 3 3 4 2 2 3 2 2 2 2 3 3 2 2 2 3 2 3 2 3 3 2 2 4 2 3 "
},
{
"input": "100\n-60 -62 -19 -42 -50 -22 -90 -82 -56 40 87 -1 -30 -76 -8 -32 -57 38 -14 -39 84 -60 -28 -82 -62 -83 -37 -59 -61 -86 -13 48 18 -8 50 -27 -47 -100 -42 -88 -19 -45 30 -93 -46 3 -26 -80 -61 -13 -20 76 -95 -51 -26 -1 39 -92 -41 -76 -67 26 -23 30 79 -26 -51 -40 -29 -14 -2 -43 -30 -19 -62 -65 -1 -90 -66 -38 -50 89 -17 -53 -6 -13 -41 -54 -1 -23 -31 -88 -59 -44 -67 -11 -83 -16 -23 -71",
"output": "43\n1 2 2 2 2 4 2 2 3 3 2 2 2 2 5 2 2 2 3 3 2 3 2 3 2 3 4 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n-1 -65 76 -28 -58 -63 -86 -54 -62 -66 -39 -3 -62 -35 -2 -86 -6 -16 -85 -30 -6 -41 -88 38 -8 -78 -6 -73 -83 -12 40 -99 -78 -51 -97 -15 81 -76 -1 -78 -38 -14 -24 -2 -70 -80 -24 -28 -51 -50 61 -64 -81 -32 -59 -60 -58 -10 -24 -81 -42 -7 58 -23 -11 -14 -84 -27 -45 2 -31 -32 -20 -72 -2 -81 -31 -6 -8 -91 55 -76 -93 -65 -94 -8 -57 -20 -75 -20 -27 -37 -82 97 -37 -8 -16 49 -90 -3",
"output": "45\n2 3 2 2 2 2 2 2 2 2 2 3 2 2 3 2 3 2 2 2 2 2 2 3 2 2 2 2 3 2 2 3 2 2 2 2 3 2 2 2 2 2 3 2 3 "
},
{
"input": "100\n-75 -29 -14 -2 99 -94 -75 82 -17 -19 -61 -18 -14 -94 -17 16 -16 -4 -41 -8 -81 -26 -65 24 -7 -87 -85 -22 -74 -21 46 -31 -39 -82 -88 -20 -2 -13 -46 -1 -78 -66 -83 -50 -13 -15 -60 -56 36 -79 -99 -52 -96 -80 -97 -74 80 -90 -52 -33 -1 -78 73 -45 -3 -77 62 -4 -85 -44 -62 -74 -33 -35 -44 -14 -80 -20 -17 -83 -32 -40 -74 -13 -90 -62 -15 -16 -59 -15 -40 -50 -98 -33 -73 -25 -86 -35 -84 -41",
"output": "46\n1 2 3 3 2 2 2 3 2 2 3 2 2 3 2 2 2 2 2 2 2 2 3 2 2 3 2 2 3 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n-43 -90 -65 -70 -7 -49 -90 -93 -43 -80 -2 -47 -13 -5 -70 -42 -71 -68 -60 -71 -27 -84 82 -74 -75 -65 -32 -32 -50 -74 62 -96 -85 -95 -65 -51 -69 49 3 -19 -92 -61 -33 -7 -70 -51 -3 -1 -48 -48 -64 -7 -4 -46 -11 -36 -80 -69 -67 -1 -39 -40 66 -9 -40 -8 -58 -74 -27 66 -52 -26 -62 -72 -48 -25 -41 -13 -65 -82 -50 -68 -94 -52 -77 -91 -37 -18 -8 -51 -19 -22 -52 -95 35 -32 59 -41 -54 -88",
"output": "46\n2 2 2 2 2 2 2 2 2 2 2 3 2 2 3 2 2 4 2 2 2 2 2 2 2 2 2 2 2 3 2 2 3 2 2 2 2 2 2 2 2 2 2 2 4 2 "
},
{
"input": "100\n-67 -100 -7 -13 -9 -78 -55 -68 -31 -18 -92 -23 -4 -99 -54 -97 -45 -24 -33 -95 -42 -20 -63 -24 -89 -25 -55 -35 -84 -30 -1 57 -88 -94 -67 -27 -91 -14 -13 -20 -7 -8 -33 -95 -1 -75 -80 -49 -15 -64 -73 -49 -87 -19 -44 -50 -19 -10 -90 -51 -74 90 -42 -18 -93 -99 -43 51 -96 95 -97 -36 -21 -13 -73 -37 -33 -22 -83 -33 -44 -84 -20 -78 -34 -70 -83 -83 -85 -17 -36 62 83 -73 -6 51 -77 -82 -83 -68",
"output": "47\n1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 4 2 2 2 2 2 2 2 2 2 2 4 3 2 "
},
{
"input": "100\n-30 -40 -64 -50 -13 -69 -87 -54 -7 -32 -38 30 -79 -31 57 -50 -3 -6 -13 -94 -28 -57 -95 -67 -82 -49 -83 -39 -41 -12 -73 -20 -17 -46 -92 -31 -36 -31 -80 -47 -37 -67 -41 -65 -7 -95 -85 -53 -87 -18 -52 -61 -98 -85 -6 -80 -96 -95 -72 -9 -19 -49 74 84 -60 -69 -64 -39 -82 -28 -24 -82 -13 -7 -15 -28 -26 -48 -88 -9 -36 -38 -75 -1 9 -15 -12 -47 -11 -45 -3 -10 -60 -62 -54 -60 45 -8 -43 -89",
"output": "47\n2 2 2 2 2 3 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 4 2 2 2 2 2 2 2 2 2 3 2 2 2 2 3 2 "
},
{
"input": "100\n-78 -77 -84 -29 -99 -15 -60 97 -56 -9 -19 -21 -5 -29 -20 -41 -56 -15 -77 -22 -87 -75 -56 -96 -46 -24 -35 -64 63 -5 -16 -27 34 -77 84 -30 -9 -73 -58 -93 -20 -20 -69 -16 -42 -40 -44 -66 -42 -90 -47 -35 -87 -55 -37 -48 -34 -3 -40 -3 -46 -25 -80 -55 -12 -62 -46 -99 -38 -33 -72 -60 -18 -12 -52 -3 -75 -5 -48 -30 -59 -56 99 -52 -59 -72 -41 -15 -19 -19 -26 -28 -16 -23 -46 -93 -92 -38 -12 -75",
"output": "48\n1 2 2 2 3 2 2 2 2 2 2 2 2 2 3 3 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n22 -83 -95 -61 -100 -53 -50 -19 -24 -85 -45 -43 -3 -74 -6 -24 -78 -54 -58 -52 -42 -16 -18 -56 -93 -45 -97 -67 -88 -27 83 -7 -72 -85 -24 -45 -22 -82 -83 -94 -75 -79 -22 -44 -22 -44 -42 -44 -61 85 -11 -16 -91 -12 -15 -3 -15 -82 -1 -2 -28 -24 -68 -22 -25 -46 -40 -21 -67 -90 -31 -33 -54 -83 -91 -74 -56 -67 -87 -36 -8 -100 -76 -88 -90 -45 -64 -25 -55 -15 -84 -67 -57 -73 -78 86 -28 -41 -63 -57",
"output": "48\n3 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 "
},
{
"input": "100\n-13 -43 -95 -61 -62 -94 -97 -48 -16 -88 -96 -74 -26 -58 -79 -44 -72 -22 -18 -66 -8 85 -98 -3 -36 -17 -80 -82 -77 -41 -24 -86 -62 -1 -22 -29 -30 -18 -25 -90 -66 -58 -86 -81 -34 -76 -67 -72 -77 -29 -66 -67 -34 3 -16 -90 -9 -14 -28 -60 -26 -99 75 -74 -94 -55 -54 -23 -30 -34 -4 -92 -88 -46 -52 -63 -98 -6 -89 -99 -80 -100 -97 -62 -70 -97 -75 -85 -22 -2 -32 -47 -85 -44 -23 -4 -21 -30 -6 -34",
"output": "49\n1 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n-5 -37 -22 -85 -63 -46 -44 -43 -23 -77 -75 -64 -84 -46 -78 -94 -67 -19 -5 -59 -32 -92 -10 -92 -58 -73 -72 -16 99 -58 -94 -49 -60 -3 -60 -74 -12 -8 -32 -94 -63 -53 -24 -29 -6 -46 -30 -32 -87 -41 -58 -70 -53 -20 -73 -42 -54 -5 -84 -45 -11 -9 -84 -7 -68 -100 -11 -2 -87 -27 -65 -45 -17 -33 -88 -55 90 -58 -89 -13 -66 -1 -46 -90 -69 -74 -84 -90 -50 -32 -62 -37 -44 -51 -25 -94 -73 -43 -1 -44",
"output": "49\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n-76 -48 -63 -62 -94 -37 -54 -67 -9 -52 -83 -1 -87 -36 -94 -10 -19 -55 -93 -23 -2 -87 -15 -59 -60 -87 -63 -18 -62 -92 -10 -61 -12 -89 -85 -38 -37 -3 -71 -22 -94 -96 -100 -47 -20 -93 -28 77 -35 -74 -50 -72 -38 -29 -58 -80 -24 -9 -59 -4 -93 -65 -31 -47 -36 -13 -89 -96 -99 -83 -99 -36 -45 -58 -22 -93 -51 -26 -93 -36 -85 -72 -49 -27 -69 -29 -51 -84 -35 -26 -41 -43 -45 -87 -65 -100 -45 -69 -69 -73",
"output": "50\n1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n-77 -6 -71 -86 -42 -1 -40 -41 -31 -67 -75 -49 -62 -21 -2 -40 -2 -82 -90 -42 -43 -14 -72 -50 -33 -37 -58 -51 -67 -96 -63 -39 -56 -22 -17 -69 -88 -60 -18 -47 -16 -41 -32 -59 -82 -48 -22 -46 -29 -69 -21 -2 -41 -52 -83 -3 -49 -39 -31 -78 -60 -100 -12 -64 -28 -72 -43 -68 -60 -98 -21 -29 -72 -82 -5 -4 -65 -76 -60 -40 -37 -17 -77 -21 -19 -98 -39 -67 -49 -75 -7 -45 -11 -13 -45 -19 -83 -38 -14 -89",
"output": "50\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 "
},
{
"input": "4\n1 2 3 4",
"output": "1\n4 "
},
{
"input": "4\n1 2 3 -4",
"output": "1\n4 "
},
{
"input": "4\n-4 2 1 2",
"output": "1\n4 "
},
{
"input": "1\n-1",
"output": "1\n1 "
},
{
"input": "2\n2 -1",
"output": "1\n2 "
},
{
"input": "2\n-100 100",
"output": "1\n2 "
},
{
"input": "3\n-100 0 -100",
"output": "1\n3 "
},
{
"input": "5\n1 2 3 -1 -1",
"output": "1\n5 "
},
{
"input": "5\n-1 -1 2 3 4",
"output": "1\n5 "
},
{
"input": "3\n-3 -4 -5",
"output": "2\n1 2 "
},
{
"input": "4\n-3 -4 1 -3",
"output": "2\n1 3 "
},
{
"input": "1\n-1",
"output": "1\n1 "
},
{
"input": "2\n-1 0",
"output": "1\n2 "
},
{
"input": "4\n0 0 0 0",
"output": "1\n4 "
},
{
"input": "3\n-1 -1 -1",
"output": "2\n1 2 "
},
{
"input": "6\n-1 -1 0 -1 -1 -1",
"output": "3\n1 3 2 "
},
{
"input": "2\n0 0",
"output": "1\n2 "
},
{
"input": "6\n0 0 -1 -1 -1 0",
"output": "2\n3 3 "
}
] | 1,571,134,801
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 69
| 248
| 0
|
n=int(input())
lst=list(map(int,input().split()))
k,res,last,length=0,[0],0,1
for i,x in enumerate(lst):
if x<0:
if k==2:
res.append(i-last)
length+=1
last,k=i,1
else:k+=1
res.append(n-last)
res.pop(0)
print(length)
print(*res)
|
Title: Paper Work
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus has been working in the analytic department of the "F.R.A.U.D." company for as much as *n* days. Right now his task is to make a series of reports about the company's performance for the last *n* days. We know that the main information in a day report is value *a**i*, the company's profit on the *i*-th day. If *a**i* is negative, then the company suffered losses on the *i*-th day.
Polycarpus should sort the daily reports into folders. Each folder should include data on the company's performance for several consecutive days. Of course, the information on each of the *n* days should be exactly in one folder. Thus, Polycarpus puts information on the first few days in the first folder. The information on the several following days goes to the second folder, and so on.
It is known that the boss reads one daily report folder per day. If one folder has three or more reports for the days in which the company suffered losses (*a**i*<=<<=0), he loses his temper and his wrath is terrible.
Therefore, Polycarpus wants to prepare the folders so that none of them contains information on three or more days with the loss, and the number of folders is minimal.
Write a program that, given sequence *a**i*, will print the minimum number of folders.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=100), *n* is the number of days. The second line contains a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (|*a**i*|<=≤<=100), where *a**i* means the company profit on the *i*-th day. It is possible that the company has no days with the negative *a**i*.
Output Specification:
Print an integer *k* — the required minimum number of folders. In the second line print a sequence of integers *b*1, *b*2, ..., *b**k*, where *b**j* is the number of day reports in the *j*-th folder.
If there are multiple ways to sort the reports into *k* days, print any of them.
Demo Input:
['11\n1 2 3 -4 -5 -6 5 -5 -6 -7 6\n', '5\n0 -1 100 -1 0\n']
Demo Output:
['3\n5 3 3 ', '1\n5 ']
Note:
Here goes a way to sort the reports from the first sample into three folders:
In the second sample you can put all five reports in one folder.
|
```python
n=int(input())
lst=list(map(int,input().split()))
k,res,last,length=0,[0],0,1
for i,x in enumerate(lst):
if x<0:
if k==2:
res.append(i-last)
length+=1
last,k=i,1
else:k+=1
res.append(n-last)
res.pop(0)
print(length)
print(*res)
```
| 3
|
|
591
|
A
|
Wizards' Duel
|
PROGRAMMING
| 900
|
[
"implementation",
"math"
] | null | null |
Harry Potter and He-Who-Must-Not-Be-Named engaged in a fight to the death once again. This time they are located at opposite ends of the corridor of length *l*. Two opponents simultaneously charge a deadly spell in the enemy. We know that the impulse of Harry's magic spell flies at a speed of *p* meters per second, and the impulse of You-Know-Who's magic spell flies at a speed of *q* meters per second.
The impulses are moving through the corridor toward each other, and at the time of the collision they turn round and fly back to those who cast them without changing their original speeds. Then, as soon as the impulse gets back to it's caster, the wizard reflects it and sends again towards the enemy, without changing the original speed of the impulse.
Since Harry has perfectly mastered the basics of magic, he knows that after the second collision both impulses will disappear, and a powerful explosion will occur exactly in the place of their collision. However, the young wizard isn't good at math, so he asks you to calculate the distance from his position to the place of the second meeting of the spell impulses, provided that the opponents do not change positions during the whole fight.
|
The first line of the input contains a single integer *l* (1<=≤<=*l*<=≤<=1<=000) — the length of the corridor where the fight takes place.
The second line contains integer *p*, the third line contains integer *q* (1<=≤<=*p*,<=*q*<=≤<=500) — the speeds of magical impulses for Harry Potter and He-Who-Must-Not-Be-Named, respectively.
|
Print a single real number — the distance from the end of the corridor, where Harry is located, to the place of the second meeting of the spell impulses. Your answer will be considered correct if its absolute or relative error will not exceed 10<=-<=4.
Namely: let's assume that your answer equals *a*, and the answer of the jury is *b*. The checker program will consider your answer correct if .
|
[
"100\n50\n50\n",
"199\n60\n40\n"
] |
[
"50\n",
"119.4\n"
] |
In the first sample the speeds of the impulses are equal, so both of their meetings occur exactly in the middle of the corridor.
| 500
|
[
{
"input": "100\n50\n50",
"output": "50"
},
{
"input": "199\n60\n40",
"output": "119.4"
},
{
"input": "1\n1\n1",
"output": "0.5"
},
{
"input": "1\n1\n500",
"output": "0.001996007984"
},
{
"input": "1\n500\n1",
"output": "0.998003992"
},
{
"input": "1\n500\n500",
"output": "0.5"
},
{
"input": "1000\n1\n1",
"output": "500"
},
{
"input": "1000\n1\n500",
"output": "1.996007984"
},
{
"input": "1000\n500\n1",
"output": "998.003992"
},
{
"input": "1000\n500\n500",
"output": "500"
},
{
"input": "101\n11\n22",
"output": "33.66666667"
},
{
"input": "987\n1\n3",
"output": "246.75"
},
{
"input": "258\n25\n431",
"output": "14.14473684"
},
{
"input": "979\n39\n60",
"output": "385.6666667"
},
{
"input": "538\n479\n416",
"output": "287.9351955"
},
{
"input": "583\n112\n248",
"output": "181.3777778"
},
{
"input": "978\n467\n371",
"output": "545.0190931"
},
{
"input": "980\n322\n193",
"output": "612.7378641"
},
{
"input": "871\n401\n17",
"output": "835.576555"
},
{
"input": "349\n478\n378",
"output": "194.885514"
},
{
"input": "425\n458\n118",
"output": "337.9340278"
},
{
"input": "919\n323\n458",
"output": "380.0729834"
},
{
"input": "188\n59\n126",
"output": "59.95675676"
},
{
"input": "644\n428\n484",
"output": "302.2280702"
},
{
"input": "253\n80\n276",
"output": "56.85393258"
},
{
"input": "745\n152\n417",
"output": "199.0158172"
},
{
"input": "600\n221\n279",
"output": "265.2"
},
{
"input": "690\n499\n430",
"output": "370.6243272"
},
{
"input": "105\n68\n403",
"output": "15.15923567"
},
{
"input": "762\n462\n371",
"output": "422.6218487"
},
{
"input": "903\n460\n362",
"output": "505.3284672"
},
{
"input": "886\n235\n95",
"output": "630.9393939"
},
{
"input": "655\n203\n18",
"output": "601.6515837"
},
{
"input": "718\n29\n375",
"output": "51.53960396"
},
{
"input": "296\n467\n377",
"output": "163.7819905"
},
{
"input": "539\n61\n56",
"output": "281.017094"
},
{
"input": "133\n53\n124",
"output": "39.82485876"
},
{
"input": "998\n224\n65",
"output": "773.5363322"
},
{
"input": "961\n173\n47",
"output": "755.6954545"
},
{
"input": "285\n468\n62",
"output": "251.6603774"
},
{
"input": "496\n326\n429",
"output": "214.1668874"
},
{
"input": "627\n150\n285",
"output": "216.2068966"
},
{
"input": "961\n443\n50",
"output": "863.535497"
},
{
"input": "623\n422\n217",
"output": "411.4334898"
},
{
"input": "678\n295\n29",
"output": "617.3148148"
}
] | 1,596,431,427
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 45
| 155
| 20,172,800
|
def f(ll):
l,p,q=ll
return l*p/(p+q)
l = [int(input()) for _ in range(3)]
print(f(l))
|
Title: Wizards' Duel
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Harry Potter and He-Who-Must-Not-Be-Named engaged in a fight to the death once again. This time they are located at opposite ends of the corridor of length *l*. Two opponents simultaneously charge a deadly spell in the enemy. We know that the impulse of Harry's magic spell flies at a speed of *p* meters per second, and the impulse of You-Know-Who's magic spell flies at a speed of *q* meters per second.
The impulses are moving through the corridor toward each other, and at the time of the collision they turn round and fly back to those who cast them without changing their original speeds. Then, as soon as the impulse gets back to it's caster, the wizard reflects it and sends again towards the enemy, without changing the original speed of the impulse.
Since Harry has perfectly mastered the basics of magic, he knows that after the second collision both impulses will disappear, and a powerful explosion will occur exactly in the place of their collision. However, the young wizard isn't good at math, so he asks you to calculate the distance from his position to the place of the second meeting of the spell impulses, provided that the opponents do not change positions during the whole fight.
Input Specification:
The first line of the input contains a single integer *l* (1<=≤<=*l*<=≤<=1<=000) — the length of the corridor where the fight takes place.
The second line contains integer *p*, the third line contains integer *q* (1<=≤<=*p*,<=*q*<=≤<=500) — the speeds of magical impulses for Harry Potter and He-Who-Must-Not-Be-Named, respectively.
Output Specification:
Print a single real number — the distance from the end of the corridor, where Harry is located, to the place of the second meeting of the spell impulses. Your answer will be considered correct if its absolute or relative error will not exceed 10<=-<=4.
Namely: let's assume that your answer equals *a*, and the answer of the jury is *b*. The checker program will consider your answer correct if .
Demo Input:
['100\n50\n50\n', '199\n60\n40\n']
Demo Output:
['50\n', '119.4\n']
Note:
In the first sample the speeds of the impulses are equal, so both of their meetings occur exactly in the middle of the corridor.
|
```python
def f(ll):
l,p,q=ll
return l*p/(p+q)
l = [int(input()) for _ in range(3)]
print(f(l))
```
| 3
|
|
822
|
A
|
I'm bored with life
|
PROGRAMMING
| 800
|
[
"implementation",
"math",
"number theory"
] | null | null |
Holidays have finished. Thanks to the help of the hacker Leha, Noora managed to enter the university of her dreams which is located in a town Pavlopolis. It's well known that universities provide students with dormitory for the period of university studies. Consequently Noora had to leave Vičkopolis and move to Pavlopolis. Thus Leha was left completely alone in a quiet town Vičkopolis. He almost even fell into a depression from boredom!
Leha came up with a task for himself to relax a little. He chooses two integers *A* and *B* and then calculates the greatest common divisor of integers "*A* factorial" and "*B* factorial". Formally the hacker wants to find out GCD(*A*!,<=*B*!). It's well known that the factorial of an integer *x* is a product of all positive integers less than or equal to *x*. Thus *x*!<==<=1·2·3·...·(*x*<=-<=1)·*x*. For example 4!<==<=1·2·3·4<==<=24. Recall that GCD(*x*,<=*y*) is the largest positive integer *q* that divides (without a remainder) both *x* and *y*.
Leha has learned how to solve this task very effective. You are able to cope with it not worse, aren't you?
|
The first and single line contains two integers *A* and *B* (1<=≤<=*A*,<=*B*<=≤<=109,<=*min*(*A*,<=*B*)<=≤<=12).
|
Print a single integer denoting the greatest common divisor of integers *A*! and *B*!.
|
[
"4 3\n"
] |
[
"6\n"
] |
Consider the sample.
4! = 1·2·3·4 = 24. 3! = 1·2·3 = 6. The greatest common divisor of integers 24 and 6 is exactly 6.
| 500
|
[
{
"input": "4 3",
"output": "6"
},
{
"input": "10 399603090",
"output": "3628800"
},
{
"input": "6 973151934",
"output": "720"
},
{
"input": "2 841668075",
"output": "2"
},
{
"input": "7 415216919",
"output": "5040"
},
{
"input": "3 283733059",
"output": "6"
},
{
"input": "11 562314608",
"output": "39916800"
},
{
"input": "3 990639260",
"output": "6"
},
{
"input": "11 859155400",
"output": "39916800"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "5 3",
"output": "6"
},
{
"input": "1 4",
"output": "1"
},
{
"input": "5 4",
"output": "24"
},
{
"input": "1 12",
"output": "1"
},
{
"input": "9 7",
"output": "5040"
},
{
"input": "2 3",
"output": "2"
},
{
"input": "6 11",
"output": "720"
},
{
"input": "6 7",
"output": "720"
},
{
"input": "11 11",
"output": "39916800"
},
{
"input": "4 999832660",
"output": "24"
},
{
"input": "7 999228288",
"output": "5040"
},
{
"input": "11 999257105",
"output": "39916800"
},
{
"input": "11 999286606",
"output": "39916800"
},
{
"input": "3 999279109",
"output": "6"
},
{
"input": "999632727 11",
"output": "39916800"
},
{
"input": "999625230 7",
"output": "5040"
},
{
"input": "999617047 3",
"output": "6"
},
{
"input": "999646548 7",
"output": "5040"
},
{
"input": "999639051 3",
"output": "6"
},
{
"input": "12 12",
"output": "479001600"
},
{
"input": "12 1",
"output": "1"
},
{
"input": "1213 5",
"output": "120"
},
{
"input": "8 9",
"output": "40320"
},
{
"input": "12 9",
"output": "362880"
},
{
"input": "12 1000000000",
"output": "479001600"
},
{
"input": "1000000000 1",
"output": "1"
},
{
"input": "12 13",
"output": "479001600"
},
{
"input": "2 29845",
"output": "2"
},
{
"input": "10 21",
"output": "3628800"
},
{
"input": "12 20",
"output": "479001600"
},
{
"input": "15 12",
"output": "479001600"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1000000000 12",
"output": "479001600"
},
{
"input": "11 30",
"output": "39916800"
},
{
"input": "17 12",
"output": "479001600"
},
{
"input": "4 19",
"output": "24"
},
{
"input": "12 15",
"output": "479001600"
},
{
"input": "20 6",
"output": "720"
},
{
"input": "10 20",
"output": "3628800"
},
{
"input": "10 10",
"output": "3628800"
},
{
"input": "22 12",
"output": "479001600"
},
{
"input": "20 12",
"output": "479001600"
},
{
"input": "12 23",
"output": "479001600"
},
{
"input": "12 22",
"output": "479001600"
},
{
"input": "18 3",
"output": "6"
},
{
"input": "14 10",
"output": "3628800"
},
{
"input": "14 12",
"output": "479001600"
},
{
"input": "8 3",
"output": "6"
},
{
"input": "5 5",
"output": "120"
}
] | 1,650,901,097
| 2,147,483,647
|
Python 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 1
| 1,000
| 0
|
def factorial(n):
ans = 1
for i in range(1,n+1):
ans*=i
return ans
a,b = map(int,input().split())
ans = min(factorial(a),factorial(b))
print(ans)
|
Title: I'm bored with life
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Holidays have finished. Thanks to the help of the hacker Leha, Noora managed to enter the university of her dreams which is located in a town Pavlopolis. It's well known that universities provide students with dormitory for the period of university studies. Consequently Noora had to leave Vičkopolis and move to Pavlopolis. Thus Leha was left completely alone in a quiet town Vičkopolis. He almost even fell into a depression from boredom!
Leha came up with a task for himself to relax a little. He chooses two integers *A* and *B* and then calculates the greatest common divisor of integers "*A* factorial" and "*B* factorial". Formally the hacker wants to find out GCD(*A*!,<=*B*!). It's well known that the factorial of an integer *x* is a product of all positive integers less than or equal to *x*. Thus *x*!<==<=1·2·3·...·(*x*<=-<=1)·*x*. For example 4!<==<=1·2·3·4<==<=24. Recall that GCD(*x*,<=*y*) is the largest positive integer *q* that divides (without a remainder) both *x* and *y*.
Leha has learned how to solve this task very effective. You are able to cope with it not worse, aren't you?
Input Specification:
The first and single line contains two integers *A* and *B* (1<=≤<=*A*,<=*B*<=≤<=109,<=*min*(*A*,<=*B*)<=≤<=12).
Output Specification:
Print a single integer denoting the greatest common divisor of integers *A*! and *B*!.
Demo Input:
['4 3\n']
Demo Output:
['6\n']
Note:
Consider the sample.
4! = 1·2·3·4 = 24. 3! = 1·2·3 = 6. The greatest common divisor of integers 24 and 6 is exactly 6.
|
```python
def factorial(n):
ans = 1
for i in range(1,n+1):
ans*=i
return ans
a,b = map(int,input().split())
ans = min(factorial(a),factorial(b))
print(ans)
```
| 0
|
|
41
|
A
|
Translation
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Translation
|
2
|
256
|
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
|
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
|
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
|
[
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,694,233,503
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 92
| 0
|
s = input()
r = input()
L = []
for i in range(len(s)):
L.extend(s[i])
L.reverse()
ans = L[0]
for i in range(1,len(s)):
ans += L[i]
if ans == r:
print('YES')
else:
print('NO')
|
Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the «translation». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
s = input()
r = input()
L = []
for i in range(len(s)):
L.extend(s[i])
L.reverse()
ans = L[0]
for i in range(1,len(s)):
ans += L[i]
if ans == r:
print('YES')
else:
print('NO')
```
| 3.977
|
837
|
B
|
Flag of Berland
|
PROGRAMMING
| 1,600
|
[
"brute force",
"implementation"
] | null | null |
The flag of Berland is such rectangular field *n*<=×<=*m* that satisfies following conditions:
- Flag consists of three colors which correspond to letters 'R', 'G' and 'B'. - Flag consists of three equal in width and height stripes, parralel to each other and to sides of the flag. Each stripe has exactly one color. - Each color should be used in exactly one stripe.
You are given a field *n*<=×<=*m*, consisting of characters 'R', 'G' and 'B'. Output "YES" (without quotes) if this field corresponds to correct flag of Berland. Otherwise, print "NO" (without quotes).
|
The first line contains two integer numbers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the sizes of the field.
Each of the following *n* lines consisting of *m* characters 'R', 'G' and 'B' — the description of the field.
|
Print "YES" (without quotes) if the given field corresponds to correct flag of Berland . Otherwise, print "NO" (without quotes).
|
[
"6 5\nRRRRR\nRRRRR\nBBBBB\nBBBBB\nGGGGG\nGGGGG\n",
"4 3\nBRG\nBRG\nBRG\nBRG\n",
"6 7\nRRRGGGG\nRRRGGGG\nRRRGGGG\nRRRBBBB\nRRRBBBB\nRRRBBBB\n",
"4 4\nRRRR\nRRRR\nBBBB\nGGGG\n"
] |
[
"YES\n",
"YES\n",
"NO\n",
"NO\n"
] |
The field in the third example doesn't have three parralel stripes.
Rows of the field in the fourth example are parralel to each other and to borders. But they have different heights — 2, 1 and 1.
| 0
|
[
{
"input": "6 5\nRRRRR\nRRRRR\nBBBBB\nBBBBB\nGGGGG\nGGGGG",
"output": "YES"
},
{
"input": "4 3\nBRG\nBRG\nBRG\nBRG",
"output": "YES"
},
{
"input": "6 7\nRRRGGGG\nRRRGGGG\nRRRGGGG\nRRRBBBB\nRRRBBBB\nRRRBBBB",
"output": "NO"
},
{
"input": "4 4\nRRRR\nRRRR\nBBBB\nGGGG",
"output": "NO"
},
{
"input": "1 3\nGRB",
"output": "YES"
},
{
"input": "3 1\nR\nG\nB",
"output": "YES"
},
{
"input": "4 3\nRGB\nGRB\nGRB\nGRB",
"output": "NO"
},
{
"input": "4 6\nGGRRBB\nGGRRBB\nGGRRBB\nRRGGBB",
"output": "NO"
},
{
"input": "100 3\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nRGB\nGRB",
"output": "NO"
},
{
"input": "3 100\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRG",
"output": "NO"
},
{
"input": "3 1\nR\nR\nB",
"output": "NO"
},
{
"input": "3 2\nRR\nBB\nRR",
"output": "NO"
},
{
"input": "3 2\nRR\nBG\nBG",
"output": "NO"
},
{
"input": "3 2\nBB\nRR\nBB",
"output": "NO"
},
{
"input": "3 3\nRRR\nRRR\nRRR",
"output": "NO"
},
{
"input": "3 3\nGGG\nGGG\nGGG",
"output": "NO"
},
{
"input": "1 3\nRGG",
"output": "NO"
},
{
"input": "4 3\nRGR\nRGR\nRGR\nRGR",
"output": "NO"
},
{
"input": "3 4\nRRGG\nRRGG\nBBBB",
"output": "NO"
},
{
"input": "3 3\nBRG\nBRG\nBRG",
"output": "YES"
},
{
"input": "3 1\nR\nG\nR",
"output": "NO"
},
{
"input": "5 3\nBBG\nBBG\nBBG\nBBG\nBBG",
"output": "NO"
},
{
"input": "3 3\nRRR\nGGG\nRRR",
"output": "NO"
},
{
"input": "1 3\nRGR",
"output": "NO"
},
{
"input": "3 6\nRRBBGG\nRRBBGG\nRRBBGG",
"output": "YES"
},
{
"input": "6 6\nRRBBGG\nRRBBGG\nRRBBGG\nRRBBGG\nRRBBGG\nRRBBGG",
"output": "YES"
},
{
"input": "4 3\nRRR\nGGG\nBBB\nBBB",
"output": "NO"
},
{
"input": "3 3\nRRR\nBBB\nRRR",
"output": "NO"
},
{
"input": "3 1\nB\nR\nB",
"output": "NO"
},
{
"input": "1 3\nBGB",
"output": "NO"
},
{
"input": "3 1\nB\nB\nB",
"output": "NO"
},
{
"input": "3 4\nRRRR\nBBBB\nRRRR",
"output": "NO"
},
{
"input": "1 6\nRGGGBB",
"output": "NO"
},
{
"input": "9 3\nBBB\nBBB\nBBB\nGGG\nGGG\nGRG\nRGR\nRRR\nRRR",
"output": "NO"
},
{
"input": "4 4\nRGBB\nRGBB\nRGBB\nRGBB",
"output": "NO"
},
{
"input": "3 3\nRBR\nRBR\nRBR",
"output": "NO"
},
{
"input": "1 6\nRRRRBB",
"output": "NO"
},
{
"input": "1 6\nRRRRRR",
"output": "NO"
},
{
"input": "1 6\nRRGGGG",
"output": "NO"
},
{
"input": "4 4\nRRRR\nRRRR\nRRRR\nRRRR",
"output": "NO"
},
{
"input": "3 1\nB\nG\nB",
"output": "NO"
},
{
"input": "3 1\nR\nR\nR",
"output": "NO"
},
{
"input": "1 9\nRRRGGGBBB",
"output": "YES"
},
{
"input": "1 3\nRRR",
"output": "NO"
},
{
"input": "3 5\nRRRRR\nBBBBB\nBBBBB",
"output": "NO"
},
{
"input": "3 3\nRRR\nGGG\nGGG",
"output": "NO"
},
{
"input": "1 1\nR",
"output": "NO"
},
{
"input": "3 3\nRGR\nRGR\nRGR",
"output": "NO"
},
{
"input": "1 3\nGGG",
"output": "NO"
},
{
"input": "3 3\nRBG\nGBR\nRGB",
"output": "NO"
},
{
"input": "3 3\nRGB\nRGB\nRGB",
"output": "YES"
},
{
"input": "1 3\nBRB",
"output": "NO"
},
{
"input": "2 1\nR\nB",
"output": "NO"
},
{
"input": "1 3\nRBR",
"output": "NO"
},
{
"input": "3 5\nRRGBB\nRRGBB\nRRGBB",
"output": "NO"
},
{
"input": "5 3\nBBR\nBBR\nBBR\nBBR\nBBR",
"output": "NO"
},
{
"input": "3 3\nRGB\nRBG\nRGB",
"output": "NO"
},
{
"input": "1 2\nRB",
"output": "NO"
},
{
"input": "4 3\nBBB\nBBB\nBBB\nBBB",
"output": "NO"
},
{
"input": "36 6\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR\nBBRRRR",
"output": "NO"
},
{
"input": "4 1\nR\nB\nG\nR",
"output": "NO"
},
{
"input": "13 12\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR\nRRRRGGGGRRRR",
"output": "NO"
},
{
"input": "2 2\nRR\nRR",
"output": "NO"
},
{
"input": "6 6\nRRGGBB\nGRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB",
"output": "NO"
},
{
"input": "70 3\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG\nBGG",
"output": "NO"
},
{
"input": "4 3\nBBG\nBBG\nBBG\nBBG",
"output": "NO"
},
{
"input": "6 3\nBBB\nGGG\nRRR\nBRG\nBRG\nBRG",
"output": "NO"
},
{
"input": "3 6\nRRBBGG\nRBBBGG\nRBBBGG",
"output": "NO"
},
{
"input": "6 6\nGGGGGG\nGGGGGG\nBBBBBB\nBBBBBB\nGGGGGG\nGGGGGG",
"output": "NO"
},
{
"input": "6 1\nR\nB\nG\nR\nB\nG",
"output": "NO"
},
{
"input": "6 5\nRRRRR\nBBBBB\nGGGGG\nRRRRR\nBBBBB\nGGGGG",
"output": "NO"
},
{
"input": "6 3\nRRR\nGGG\nBBB\nRRR\nGGG\nBBB",
"output": "NO"
},
{
"input": "6 5\nRRRRR\nRRRRR\nRRRRR\nGGGGG\nGGGGG\nGGGGG",
"output": "NO"
},
{
"input": "15 28\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nBBBBBBBBBBBBBBBBBBBBBBBBBBBB\nGGGGGGGGGGGGGGGGGGGGGGGGGGGG\nGGGGGGGGGGGGGGGGGGGGGGGGGGGG\nGGGGGGGGGGGGGGGGGGGGGGGGGGGG\nGGGGGGGGGGGGGGGGGGGGGGGGGGGG\nGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "NO"
},
{
"input": "21 10\nRRRRRRRRRR\nRRRRRRRRRR\nRRRRRRRRRR\nRRRRRRRRRR\nRRRRRRRRRR\nRRRRRRRRRR\nRRRRRRRRRR\nBBBBBBBBBB\nBBBBBBBBBB\nBBBBBGBBBB\nBBBBBBBBBB\nBBBBBBBBBB\nBBBBBBBBBB\nBBBBBBBBBB\nGGGGGGGGGG\nGGGGGGGGGG\nGGGGGGGGGG\nGGGGGGGGGG\nGGGGGGGGGG\nGGGGGGGGGG\nGGGGGGGGGG",
"output": "NO"
},
{
"input": "3 2\nRR\nGB\nGB",
"output": "NO"
},
{
"input": "3 2\nRG\nRG\nBB",
"output": "NO"
},
{
"input": "6 5\nRRRRR\nRRRRR\nBBBBB\nBBBBB\nRRRRR\nRRRRR",
"output": "NO"
},
{
"input": "3 3\nRGB\nGBR\nBRG",
"output": "NO"
},
{
"input": "1 3\nRBB",
"output": "NO"
},
{
"input": "3 3\nBGR\nBGR\nBGR",
"output": "YES"
},
{
"input": "6 6\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB",
"output": "YES"
},
{
"input": "4 2\nRR\nGG\nRR\nBB",
"output": "NO"
},
{
"input": "3 3\nRRR\nRRR\nGGG",
"output": "NO"
},
{
"input": "8 6\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR",
"output": "NO"
},
{
"input": "3 4\nRRRR\nRRRR\nGGGG",
"output": "NO"
},
{
"input": "3 4\nRRRR\nRRRR\nRRRR",
"output": "NO"
},
{
"input": "6 1\nR\nR\nR\nR\nR\nR",
"output": "NO"
},
{
"input": "1 6\nRRBBGG",
"output": "YES"
},
{
"input": "1 6\nRGBRGB",
"output": "NO"
},
{
"input": "3 4\nRRRR\nGGGG\nRRRR",
"output": "NO"
},
{
"input": "3 3\nRRB\nGRG\nGBB",
"output": "NO"
},
{
"input": "3 7\nRRGGBBB\nRRGGBBB\nRRGGBBB",
"output": "NO"
},
{
"input": "3 1\nG\nR\nR",
"output": "NO"
},
{
"input": "2 3\nRGG\nRBB",
"output": "NO"
},
{
"input": "3 3\nRRG\nGGG\nBBB",
"output": "NO"
},
{
"input": "3 3\nRGB\nRBB\nRGB",
"output": "NO"
},
{
"input": "3 3\nRGR\nRGB\nRGB",
"output": "NO"
},
{
"input": "3 1\nB\nR\nR",
"output": "NO"
},
{
"input": "1 3\nGRR",
"output": "NO"
},
{
"input": "4 4\nRRRR\nGGGG\nBBBB\nBBBB",
"output": "NO"
},
{
"input": "1 3\nGGR",
"output": "NO"
},
{
"input": "3 3\nRGB\nGGB\nRGB",
"output": "NO"
},
{
"input": "3 3\nRGR\nGGG\nBBB",
"output": "NO"
},
{
"input": "6 6\nRRRRRR\nGGGGGG\nGGGGGG\nGGGGGG\nBBBBBB\nBBBBBB",
"output": "NO"
},
{
"input": "6 6\nRRRRRR\nRRRRRR\nGGGGGG\nBBBBBB\nBBBBBB\nBBBBBB",
"output": "NO"
},
{
"input": "3 1\nG\nB\nR",
"output": "YES"
},
{
"input": "3 3\nGGB\nRGB\nRGB",
"output": "NO"
},
{
"input": "3 3\nGRR\nGGG\nBBB",
"output": "NO"
},
{
"input": "6 6\nRRRRRR\nRRRRRR\nGGGGGG\nGGGGGG\nBBBBBB\nRRRRRR",
"output": "NO"
},
{
"input": "3 3\nRRR\nGBG\nBBB",
"output": "NO"
},
{
"input": "3 8\nRRGGBBBB\nRRGGBBBB\nRRGGBBBB",
"output": "NO"
},
{
"input": "2 2\nRR\nGG",
"output": "NO"
},
{
"input": "3 3\nRGB\nRGR\nRGB",
"output": "NO"
},
{
"input": "1 3\nRBG",
"output": "YES"
},
{
"input": "2 6\nRRGGBB\nGGRRBB",
"output": "NO"
},
{
"input": "6 2\nRR\nGG\nBB\nRR\nGG\nBB",
"output": "NO"
},
{
"input": "1 5\nRRGGB",
"output": "NO"
},
{
"input": "1 2\nRG",
"output": "NO"
},
{
"input": "1 6\nRGBRBG",
"output": "NO"
},
{
"input": "1 6\nRRRGGB",
"output": "NO"
},
{
"input": "1 3\nRGB",
"output": "YES"
},
{
"input": "4 3\nRRR\nBBR\nGBB\nGGG",
"output": "NO"
},
{
"input": "6 3\nRRR\nBBB\nBBB\nBBB\nGGG\nGGG",
"output": "NO"
},
{
"input": "3 3\nRBG\nRBG\nRBG",
"output": "YES"
},
{
"input": "6 3\nRRR\nBBB\nGGG\nRRR\nBBB\nGGG",
"output": "NO"
},
{
"input": "1 4\nRGBB",
"output": "NO"
},
{
"input": "6 6\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR\nRRRRRR",
"output": "NO"
},
{
"input": "6 5\nRRRRR\nRRRRR\nGGGGG\nGGGGG\nRRRRR\nRRRRR",
"output": "NO"
},
{
"input": "3 3\nRGB\nBRG\nGBR",
"output": "NO"
},
{
"input": "6 10\nRRRRRRRRRR\nGGGGGGGGGG\nBBBBBBBBBB\nRRRRRRRRRR\nGGGGGGGGGG\nBBBBBBBBBB",
"output": "NO"
},
{
"input": "20 6\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB\nRRGGBB",
"output": "YES"
},
{
"input": "4 1\nR\nG\nB\nR",
"output": "NO"
},
{
"input": "1 4\nRGBR",
"output": "NO"
},
{
"input": "2 4\nRGBB\nRRGB",
"output": "NO"
}
] | 1,615,894,804
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 153
| 62
| 307,200
|
def rotate_90_degree_anticlckwise(matrix):
new_matrix = []
for i in range(len(matrix[0]), 0, -1):
new_matrix.append(list(map(lambda x: x[i-1], matrix)))
return new_matrix
n,m = map(int,input().split())
mat = []
for i in range(n):
temp = input()
mat.append([i for i in temp])
horiz, verti = False, False
check = True
resH = []
for i in range(n):
if(mat[i].count(mat[i][0]) == m):
first = mat[i][0]
if(resH):
if(resH[-1][0] == first):
resH[-1][1] += 1
else:
resH.append([first, 1])
else:
resH.append([first, 1])
else:
check = False
break
if(len(resH) == 3 and check):
if(len(set([i[1] for i in resH])) == 1 and len(set([i[0] for i in resH])) == 3):
horiz = True
newMat = rotate_90_degree_anticlckwise(mat)
check = True
resV = []
for i in range(m):
if(newMat[i].count(newMat[i][0]) == n):
first = newMat[i][0]
if(resV):
if(resV[-1][0] == first):
resV[-1][1] += 1
else:
resV.append([first, 1])
else:
resV.append([first, 1])
else:
check = False
break
if(len(resV) == 3 and check):
if(len(set([i[1] for i in resV])) == 1 and len(set([i[0] for i in resV])) == 3):
verti = True
if(horiz or verti):
print("YES")
else:
print("NO")
|
Title: Flag of Berland
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The flag of Berland is such rectangular field *n*<=×<=*m* that satisfies following conditions:
- Flag consists of three colors which correspond to letters 'R', 'G' and 'B'. - Flag consists of three equal in width and height stripes, parralel to each other and to sides of the flag. Each stripe has exactly one color. - Each color should be used in exactly one stripe.
You are given a field *n*<=×<=*m*, consisting of characters 'R', 'G' and 'B'. Output "YES" (without quotes) if this field corresponds to correct flag of Berland. Otherwise, print "NO" (without quotes).
Input Specification:
The first line contains two integer numbers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the sizes of the field.
Each of the following *n* lines consisting of *m* characters 'R', 'G' and 'B' — the description of the field.
Output Specification:
Print "YES" (without quotes) if the given field corresponds to correct flag of Berland . Otherwise, print "NO" (without quotes).
Demo Input:
['6 5\nRRRRR\nRRRRR\nBBBBB\nBBBBB\nGGGGG\nGGGGG\n', '4 3\nBRG\nBRG\nBRG\nBRG\n', '6 7\nRRRGGGG\nRRRGGGG\nRRRGGGG\nRRRBBBB\nRRRBBBB\nRRRBBBB\n', '4 4\nRRRR\nRRRR\nBBBB\nGGGG\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n', 'NO\n']
Note:
The field in the third example doesn't have three parralel stripes.
Rows of the field in the fourth example are parralel to each other and to borders. But they have different heights — 2, 1 and 1.
|
```python
def rotate_90_degree_anticlckwise(matrix):
new_matrix = []
for i in range(len(matrix[0]), 0, -1):
new_matrix.append(list(map(lambda x: x[i-1], matrix)))
return new_matrix
n,m = map(int,input().split())
mat = []
for i in range(n):
temp = input()
mat.append([i for i in temp])
horiz, verti = False, False
check = True
resH = []
for i in range(n):
if(mat[i].count(mat[i][0]) == m):
first = mat[i][0]
if(resH):
if(resH[-1][0] == first):
resH[-1][1] += 1
else:
resH.append([first, 1])
else:
resH.append([first, 1])
else:
check = False
break
if(len(resH) == 3 and check):
if(len(set([i[1] for i in resH])) == 1 and len(set([i[0] for i in resH])) == 3):
horiz = True
newMat = rotate_90_degree_anticlckwise(mat)
check = True
resV = []
for i in range(m):
if(newMat[i].count(newMat[i][0]) == n):
first = newMat[i][0]
if(resV):
if(resV[-1][0] == first):
resV[-1][1] += 1
else:
resV.append([first, 1])
else:
resV.append([first, 1])
else:
check = False
break
if(len(resV) == 3 and check):
if(len(set([i[1] for i in resV])) == 1 and len(set([i[0] for i in resV])) == 3):
verti = True
if(horiz or verti):
print("YES")
else:
print("NO")
```
| 3
|
|
1
|
A
|
Theatre Square
|
PROGRAMMING
| 1,000
|
[
"math"
] |
A. Theatre Square
|
1
|
256
|
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
|
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
|
Write the needed number of flagstones.
|
[
"6 6 4\n"
] |
[
"4\n"
] |
none
| 0
|
[
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,683,558,386
| 2,147,483,647
|
Python 3
|
WRONG_ANSWER
|
TESTS
| 4
| 46
| 0
|
import math
ar=list(map(int,input().split()))
sum=0
for _ in ar:
sum=sum+_
k=math.sqrt(sum)
print(int(k))
|
Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none
|
```python
import math
ar=list(map(int,input().split()))
sum=0
for _ in ar:
sum=sum+_
k=math.sqrt(sum)
print(int(k))
```
| 0
|
86
|
D
|
Powerful array
|
PROGRAMMING
| 2,200
|
[
"data structures",
"implementation",
"math",
"two pointers"
] |
D. Powerful array
|
5
|
256
|
An array of positive integers *a*1,<=*a*2,<=...,<=*a**n* is given. Let us consider its arbitrary subarray *a**l*,<=*a**l*<=+<=1...,<=*a**r*, where 1<=≤<=*l*<=≤<=*r*<=≤<=*n*. For every positive integer *s* denote by *K**s* the number of occurrences of *s* into the subarray. We call the power of the subarray the sum of products *K**s*·*K**s*·*s* for every positive integer *s*. The sum contains only finite number of nonzero summands as the number of different values in the array is indeed finite.
You should calculate the power of *t* given subarrays.
|
First line contains two integers *n* and *t* (1<=≤<=*n*,<=*t*<=≤<=200000) — the array length and the number of queries correspondingly.
Second line contains *n* positive integers *a**i* (1<=≤<=*a**i*<=≤<=106) — the elements of the array.
Next *t* lines contain two positive integers *l*, *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*) each — the indices of the left and the right ends of the corresponding subarray.
|
Output *t* lines, the *i*-th line of the output should contain single positive integer — the power of the *i*-th query subarray.
Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preferred to use cout stream (also you may use %I64d).
|
[
"3 2\n1 2 1\n1 2\n1 3\n",
"8 3\n1 1 2 2 1 3 1 1\n2 7\n1 6\n2 7\n"
] |
[
"3\n6\n",
"20\n20\n20\n"
] |
Consider the following array (see the second sample) and its [2, 7] subarray (elements of the subarray are colored):
| 2,500
|
[
{
"input": "3 2\n1 2 1\n1 2\n1 3",
"output": "3\n6"
},
{
"input": "8 3\n1 1 2 2 1 3 1 1\n2 7\n1 6\n2 7",
"output": "20\n20\n20"
},
{
"input": "20 8\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2\n4 15\n1 2\n2 20\n7 7\n13 18\n7 7\n3 19\n3 8",
"output": "108\n3\n281\n1\n27\n1\n209\n27"
},
{
"input": "10 5\n10 9 8 7 6 5 4 3 2 1\n4 8\n1 10\n3 9\n2 2\n5 10",
"output": "25\n55\n35\n9\n21"
},
{
"input": "8 10\n100 100 100 100 100 100 100 100\n1 8\n2 8\n3 8\n4 8\n5 8\n6 8\n7 8\n8 8\n1 1\n1 5",
"output": "6400\n4900\n3600\n2500\n1600\n900\n400\n100\n100\n2500"
},
{
"input": "1 2\n1\n1 1\n1 1",
"output": "1\n1"
},
{
"input": "1 1\n1000000\n1 1",
"output": "1000000"
},
{
"input": "5 15\n103 45 103 67 45\n1 1\n1 2\n1 3\n1 4\n1 5\n2 2\n2 3\n2 4\n2 5\n3 3\n3 4\n3 5\n4 4\n4 5\n5 5",
"output": "103\n148\n457\n524\n659\n45\n148\n215\n350\n103\n170\n215\n67\n112\n45"
},
{
"input": "8 10\n5 7 3 1 4 2 1 1\n5 7\n3 8\n2 7\n4 8\n4 5\n2 8\n4 6\n1 2\n4 7\n3 5",
"output": "7\n18\n20\n15\n5\n25\n7\n12\n10\n8"
},
{
"input": "9 10\n5 3 10 2 4 8 7 5 1\n6 9\n1 8\n3 3\n2 7\n3 5\n4 6\n9 9\n8 8\n1 9\n5 6",
"output": "21\n54\n10\n34\n16\n14\n1\n5\n55\n12"
},
{
"input": "9 10\n10 2 6 2 4 6 6 4 1\n4 8\n8 9\n2 3\n8 9\n9 9\n4 5\n1 7\n6 6\n6 8\n1 1",
"output": "42\n5\n8\n5\n1\n6\n76\n6\n28\n10"
},
{
"input": "10 10\n5 10 9 2 9 3 5 5 6 5\n5 10\n2 2\n3 10\n4 8\n1 3\n1 5\n5 5\n10 10\n8 9\n6 10",
"output": "63\n10\n92\n34\n24\n53\n9\n5\n11\n54"
},
{
"input": "9 10\n6 2 3 1 4 8 5 9 8\n3 9\n6 6\n9 9\n9 9\n9 9\n2 3\n3 9\n3 8\n6 9\n5 6",
"output": "54\n8\n8\n8\n8\n5\n54\n30\n46\n12"
}
] | 1,578,764,681
| 2,147,483,647
|
Python 3
|
RUNTIME_ERROR
|
TESTS
| 0
| 186
| 0
|
import numpy as np
n,t = map(int,input().split())
l1 = list(map(int,input().split()))
for _ in range(t):
ans = 0
l,r = map(int,input().split())
l2 = np.array(l1[l-1:r])
l2 = np.power(l2,2)
ans = np.sum(l2)
print(ans)
|
Title: Powerful array
Time Limit: 5 seconds
Memory Limit: 256 megabytes
Problem Description:
An array of positive integers *a*1,<=*a*2,<=...,<=*a**n* is given. Let us consider its arbitrary subarray *a**l*,<=*a**l*<=+<=1...,<=*a**r*, where 1<=≤<=*l*<=≤<=*r*<=≤<=*n*. For every positive integer *s* denote by *K**s* the number of occurrences of *s* into the subarray. We call the power of the subarray the sum of products *K**s*·*K**s*·*s* for every positive integer *s*. The sum contains only finite number of nonzero summands as the number of different values in the array is indeed finite.
You should calculate the power of *t* given subarrays.
Input Specification:
First line contains two integers *n* and *t* (1<=≤<=*n*,<=*t*<=≤<=200000) — the array length and the number of queries correspondingly.
Second line contains *n* positive integers *a**i* (1<=≤<=*a**i*<=≤<=106) — the elements of the array.
Next *t* lines contain two positive integers *l*, *r* (1<=≤<=*l*<=≤<=*r*<=≤<=*n*) each — the indices of the left and the right ends of the corresponding subarray.
Output Specification:
Output *t* lines, the *i*-th line of the output should contain single positive integer — the power of the *i*-th query subarray.
Please, do not use %lld specificator to read or write 64-bit integers in C++. It is preferred to use cout stream (also you may use %I64d).
Demo Input:
['3 2\n1 2 1\n1 2\n1 3\n', '8 3\n1 1 2 2 1 3 1 1\n2 7\n1 6\n2 7\n']
Demo Output:
['3\n6\n', '20\n20\n20\n']
Note:
Consider the following array (see the second sample) and its [2, 7] subarray (elements of the subarray are colored):
|
```python
import numpy as np
n,t = map(int,input().split())
l1 = list(map(int,input().split()))
for _ in range(t):
ans = 0
l,r = map(int,input().split())
l2 = np.array(l1[l-1:r])
l2 = np.power(l2,2)
ans = np.sum(l2)
print(ans)
```
| -1
|
96
|
A
|
Football
|
PROGRAMMING
| 900
|
[
"implementation",
"strings"
] |
A. Football
|
2
|
256
|
Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A zero corresponds to players of one team; a one corresponds to players of another team. If there are at least 7 players of some team standing one after another, then the situation is considered dangerous. For example, the situation 00100110111111101 is dangerous and 11110111011101 is not. You are given the current situation. Determine whether it is dangerous or not.
|
The first input line contains a non-empty string consisting of characters "0" and "1", which represents players. The length of the string does not exceed 100 characters. There's at least one player from each team present on the field.
|
Print "YES" if the situation is dangerous. Otherwise, print "NO".
|
[
"001001\n",
"1000000001\n"
] |
[
"NO\n",
"YES\n"
] |
none
| 500
|
[
{
"input": "001001",
"output": "NO"
},
{
"input": "1000000001",
"output": "YES"
},
{
"input": "00100110111111101",
"output": "YES"
},
{
"input": "11110111111111111",
"output": "YES"
},
{
"input": "01",
"output": "NO"
},
{
"input": "10100101",
"output": "NO"
},
{
"input": "1010010100000000010",
"output": "YES"
},
{
"input": "101010101",
"output": "NO"
},
{
"input": "000000000100000000000110101100000",
"output": "YES"
},
{
"input": "100001000000110101100000",
"output": "NO"
},
{
"input": "100001000011010110000",
"output": "NO"
},
{
"input": "010",
"output": "NO"
},
{
"input": "10101011111111111111111111111100",
"output": "YES"
},
{
"input": "1001101100",
"output": "NO"
},
{
"input": "1001101010",
"output": "NO"
},
{
"input": "1111100111",
"output": "NO"
},
{
"input": "00110110001110001111",
"output": "NO"
},
{
"input": "11110001001111110001",
"output": "NO"
},
{
"input": "10001111001011111101",
"output": "NO"
},
{
"input": "10000010100000001000110001010100001001001010011",
"output": "YES"
},
{
"input": "01111011111010111100101100001011001010111110000010",
"output": "NO"
},
{
"input": "00100000100100101110011001011011101110110110010100",
"output": "NO"
},
{
"input": "10110100110001001011110101110010100010000000000100101010111110111110100011",
"output": "YES"
},
{
"input": "00011101010101111001011011001101101011111101000010100000111000011100101011",
"output": "NO"
},
{
"input": "01110000110100110101110100111000101101011101011110110100100111100001110111",
"output": "NO"
},
{
"input": "11110110011000100111100111101101011111110100010101011011111101110110110111",
"output": "YES"
},
{
"input": "100100010101110010001011001110100011100010011110100101100011010001001010001001101111001100",
"output": "NO"
},
{
"input": "111110010001011010010011111100110110001111000010100011011100111101111101110010101111011110000001010",
"output": "NO"
},
{
"input": "111110111100010100000100001010111011101011000111011011011010110010100010000101011111000011010011110",
"output": "NO"
},
{
"input": "1011110110111010110111111010010010100011111011110000011000110010011110111010110100011010100010111000",
"output": "NO"
},
{
"input": "0010100111100010110110000011100111110100111110001010000100111111111010111100101101010101001011010110",
"output": "YES"
},
{
"input": "1111010100010100101011101100101101110011000010100010000001111100010011100101010001101111000001011000",
"output": "NO"
},
{
"input": "0101100011001110001110100111100011010101011000000000110110010010111100101111010111100011101100100101",
"output": "YES"
},
{
"input": "0001101110011101110000000010011111101001101111100001001010110000110001100000010001111011011110001101",
"output": "YES"
},
{
"input": "1000010000100000100010000100001000010000100001000010000100001000010000100001000010000100001000010000",
"output": "NO"
},
{
"input": "1000000000100000000010000000001000000000100000000010000000001000000000100000000010000000001000000000",
"output": "YES"
},
{
"input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001",
"output": "YES"
},
{
"input": "1111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111",
"output": "YES"
},
{
"input": "10100101000",
"output": "NO"
},
{
"input": "11110111011101",
"output": "NO"
},
{
"input": "10000000",
"output": "YES"
},
{
"input": "00000001",
"output": "YES"
},
{
"input": "01111111",
"output": "YES"
},
{
"input": "11111110",
"output": "YES"
}
] | 1,690,346,349
| 2,147,483,647
|
PyPy 3-64
|
WRONG_ANSWER
|
TESTS
| 0
| 92
| 0
|
s = input()
count = 0
count2 = 0
for i in s:
if i == "1":
count += 1
if count >= 7:
break
if i == "0":
count = 0
for i in s:
if i == "0":
count2 += 1
if count2 >= 7:
break
if i == "1":
count2 = 0
if count2 == 7 or count == 7:
print("Yes")
else:
print("No")
|
Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A zero corresponds to players of one team; a one corresponds to players of another team. If there are at least 7 players of some team standing one after another, then the situation is considered dangerous. For example, the situation 00100110111111101 is dangerous and 11110111011101 is not. You are given the current situation. Determine whether it is dangerous or not.
Input Specification:
The first input line contains a non-empty string consisting of characters "0" and "1", which represents players. The length of the string does not exceed 100 characters. There's at least one player from each team present on the field.
Output Specification:
Print "YES" if the situation is dangerous. Otherwise, print "NO".
Demo Input:
['001001\n', '1000000001\n']
Demo Output:
['NO\n', 'YES\n']
Note:
none
|
```python
s = input()
count = 0
count2 = 0
for i in s:
if i == "1":
count += 1
if count >= 7:
break
if i == "0":
count = 0
for i in s:
if i == "0":
count2 += 1
if count2 >= 7:
break
if i == "1":
count2 = 0
if count2 == 7 or count == 7:
print("Yes")
else:
print("No")
```
| 0
|
455
|
A
|
Boredom
|
PROGRAMMING
| 1,500
|
[
"dp"
] | null | null |
Alex doesn't like boredom. That's why whenever he gets bored, he comes up with games. One long winter evening he came up with a game and decided to play it.
Given a sequence *a* consisting of *n* integers. The player can make several steps. In a single step he can choose an element of the sequence (let's denote it *a**k*) and delete it, at that all elements equal to *a**k*<=+<=1 and *a**k*<=-<=1 also must be deleted from the sequence. That step brings *a**k* points to the player.
Alex is a perfectionist, so he decided to get as many points as possible. Help him.
|
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) that shows how many numbers are in Alex's sequence.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=105).
|
Print a single integer — the maximum number of points that Alex can earn.
|
[
"2\n1 2\n",
"3\n1 2 3\n",
"9\n1 2 1 3 2 2 2 2 3\n"
] |
[
"2\n",
"4\n",
"10\n"
] |
Consider the third test example. At first step we need to choose any element equal to 2. After that step our sequence looks like this [2, 2, 2, 2]. Then we do 4 steps, on each step we choose any element equals to 2. In total we earn 10 points.
| 500
|
[
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n1 2 3",
"output": "4"
},
{
"input": "9\n1 2 1 3 2 2 2 2 3",
"output": "10"
},
{
"input": "5\n3 3 4 5 4",
"output": "11"
},
{
"input": "5\n5 3 5 3 4",
"output": "16"
},
{
"input": "5\n4 2 3 2 5",
"output": "9"
},
{
"input": "10\n10 5 8 9 5 6 8 7 2 8",
"output": "46"
},
{
"input": "10\n1 1 1 1 1 1 2 3 4 4",
"output": "14"
},
{
"input": "100\n6 6 8 9 7 9 6 9 5 7 7 4 5 3 9 1 10 3 4 5 8 9 6 5 6 4 10 9 1 4 1 7 1 4 9 10 8 2 9 9 10 5 8 9 5 6 8 7 2 8 7 6 2 6 10 8 6 2 5 5 3 2 8 8 5 3 6 2 1 4 7 2 7 3 7 4 10 10 7 5 4 7 5 10 7 1 1 10 7 7 7 2 3 4 2 8 4 7 4 4",
"output": "296"
},
{
"input": "100\n6 1 5 7 10 10 2 7 3 7 2 10 7 6 3 5 5 5 3 7 2 4 2 7 7 4 2 8 2 10 4 7 9 1 1 7 9 7 1 10 10 9 5 6 10 1 7 5 8 1 1 5 3 10 2 4 3 5 2 7 4 9 5 10 1 3 7 6 6 9 3 6 6 10 1 10 6 1 10 3 4 1 7 9 2 7 8 9 3 3 2 4 6 6 1 2 9 4 1 2",
"output": "313"
},
{
"input": "100\n7 6 3 8 8 3 10 5 3 8 6 4 6 9 6 7 3 9 10 7 5 5 9 10 7 2 3 8 9 5 4 7 9 3 6 4 9 10 7 6 8 7 6 6 10 3 7 4 5 7 7 5 1 5 4 8 7 3 3 4 7 8 5 9 2 2 3 1 6 4 6 6 6 1 7 10 7 4 5 3 9 2 4 1 5 10 9 3 9 6 8 5 2 1 10 4 8 5 10 9",
"output": "298"
},
{
"input": "100\n2 10 9 1 2 6 7 2 2 8 9 9 9 5 6 2 5 1 1 10 7 4 5 5 8 1 9 4 10 1 9 3 1 8 4 10 8 8 2 4 6 5 1 4 2 2 1 2 8 5 3 9 4 10 10 7 8 6 1 8 2 6 7 1 6 7 3 10 10 3 7 7 6 9 6 8 8 10 4 6 4 3 3 3 2 3 10 6 8 5 5 10 3 7 3 1 1 1 5 5",
"output": "312"
},
{
"input": "100\n4 9 7 10 4 7 2 6 1 9 1 8 7 5 5 7 6 7 9 8 10 5 3 5 7 10 3 2 1 3 8 9 4 10 4 7 6 4 9 6 7 1 9 4 3 5 8 9 2 7 10 5 7 5 3 8 10 3 8 9 3 4 3 10 6 5 1 8 3 2 5 8 4 7 5 3 3 2 6 9 9 8 2 7 6 3 2 2 8 8 4 5 6 9 2 3 2 2 5 2",
"output": "287"
},
{
"input": "100\n4 8 10 1 8 8 8 1 10 3 1 8 6 8 6 1 10 3 3 3 3 7 2 1 1 6 10 1 7 9 8 10 3 8 6 2 1 6 5 6 10 8 9 7 4 3 10 5 3 9 10 5 10 8 8 5 7 8 9 5 3 9 9 2 7 8 1 10 4 9 2 8 10 10 5 8 5 1 7 3 4 5 2 5 9 3 2 5 6 2 3 10 1 5 9 6 10 4 10 8",
"output": "380"
},
{
"input": "100\n4 8 10 1 8 8 8 1 10 3 1 8 6 8 6 1 10 3 3 3 3 7 2 1 1 6 10 1 7 9 8 10 3 8 6 2 1 6 5 6 10 8 9 7 4 3 10 5 3 9 10 5 10 8 8 5 7 8 9 5 3 9 9 2 7 8 1 10 4 9 2 8 10 10 5 8 5 1 7 3 4 5 2 5 9 3 2 5 6 2 3 10 1 5 9 6 10 4 10 8",
"output": "380"
},
{
"input": "100\n10 5 8 4 4 4 1 4 5 8 3 10 2 4 1 10 8 1 1 6 8 4 2 9 1 3 1 7 7 9 3 5 5 8 6 9 9 4 8 1 3 3 2 6 1 5 4 5 3 5 5 6 7 5 7 9 3 5 4 9 2 6 8 1 1 7 7 3 8 9 8 7 3 2 4 1 6 1 3 9 4 2 2 8 5 10 1 8 8 5 1 5 6 9 4 5 6 5 10 2",
"output": "265"
},
{
"input": "100\n7 5 1 8 5 6 6 2 6 2 7 7 3 6 2 4 4 2 10 2 2 2 10 6 6 1 5 10 9 1 5 9 8 9 4 1 10 5 7 5 7 6 4 8 8 1 7 8 3 8 2 1 8 4 10 3 5 6 6 10 9 6 5 1 10 7 6 9 9 2 10 10 9 1 2 1 7 7 4 10 1 10 5 5 3 8 9 8 1 4 10 2 4 5 4 4 1 6 2 9",
"output": "328"
},
{
"input": "100\n5 6 10 7 1 7 10 1 9 1 5 1 4 1 3 3 7 9 1 6 1 6 5 7 1 6 3 1 3 6 3 8 2 4 1 5 2 10 7 3 10 4 10 1 5 4 2 9 7 9 5 7 10 4 1 4 8 9 3 1 3 7 7 4 3 7 7 10 6 9 5 5 6 5 3 9 8 8 5 5 4 10 9 4 10 4 1 8 3 5 4 10 9 3 10 4 10 7 10 9",
"output": "324"
},
{
"input": "10\n7 4 5 3 9 1 10 3 4 5",
"output": "34"
},
{
"input": "10\n8 9 6 5 6 4 10 9 1 4",
"output": "39"
},
{
"input": "10\n1 7 1 4 9 10 8 2 9 9",
"output": "40"
},
{
"input": "1\n100000",
"output": "100000"
}
] | 1,697,773,571
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 47
| 109
| 13,619,200
|
def max_points(n, a):
frequency = [0] * 100001
for num in a:
frequency[num] += 1
dp = [0] * 100001
dp[0] = 0
dp[1] = frequency[1]
for i in range(2, 100001):
dp[i] = max(dp[i - 1], dp[i - 2] + i * frequency[i])
return dp[100000]
n = int(input())
a = list(map(int, input().split()))
result = max_points(n, a)
print(result)
|
Title: Boredom
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Alex doesn't like boredom. That's why whenever he gets bored, he comes up with games. One long winter evening he came up with a game and decided to play it.
Given a sequence *a* consisting of *n* integers. The player can make several steps. In a single step he can choose an element of the sequence (let's denote it *a**k*) and delete it, at that all elements equal to *a**k*<=+<=1 and *a**k*<=-<=1 also must be deleted from the sequence. That step brings *a**k* points to the player.
Alex is a perfectionist, so he decided to get as many points as possible. Help him.
Input Specification:
The first line contains integer *n* (1<=≤<=*n*<=≤<=105) that shows how many numbers are in Alex's sequence.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=105).
Output Specification:
Print a single integer — the maximum number of points that Alex can earn.
Demo Input:
['2\n1 2\n', '3\n1 2 3\n', '9\n1 2 1 3 2 2 2 2 3\n']
Demo Output:
['2\n', '4\n', '10\n']
Note:
Consider the third test example. At first step we need to choose any element equal to 2. After that step our sequence looks like this [2, 2, 2, 2]. Then we do 4 steps, on each step we choose any element equals to 2. In total we earn 10 points.
|
```python
def max_points(n, a):
frequency = [0] * 100001
for num in a:
frequency[num] += 1
dp = [0] * 100001
dp[0] = 0
dp[1] = frequency[1]
for i in range(2, 100001):
dp[i] = max(dp[i - 1], dp[i - 2] + i * frequency[i])
return dp[100000]
n = int(input())
a = list(map(int, input().split()))
result = max_points(n, a)
print(result)
```
| 3
|
|
994
|
A
|
Fingerprints
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
You are locked in a room with a door that has a keypad with 10 keys corresponding to digits from 0 to 9. To escape from the room, you need to enter a correct code. You also have a sequence of digits.
Some keys on the keypad have fingerprints. You believe the correct code is the longest not necessarily contiguous subsequence of the sequence you have that only contains digits with fingerprints on the corresponding keys. Find such code.
|
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 10$) representing the number of digits in the sequence you have and the number of keys on the keypad that have fingerprints.
The next line contains $n$ distinct space-separated integers $x_1, x_2, \ldots, x_n$ ($0 \le x_i \le 9$) representing the sequence.
The next line contains $m$ distinct space-separated integers $y_1, y_2, \ldots, y_m$ ($0 \le y_i \le 9$) — the keys with fingerprints.
|
In a single line print a space-separated sequence of integers representing the code. If the resulting sequence is empty, both printing nothing and printing a single line break is acceptable.
|
[
"7 3\n3 5 7 1 6 2 8\n1 2 7\n",
"4 4\n3 4 1 0\n0 1 7 9\n"
] |
[
"7 1 2\n",
"1 0\n"
] |
In the first example, the only digits with fingerprints are $1$, $2$ and $7$. All three of them appear in the sequence you know, $7$ first, then $1$ and then $2$. Therefore the output is 7 1 2. Note that the order is important, and shall be the same as the order in the original sequence.
In the second example digits $0$, $1$, $7$ and $9$ have fingerprints, however only $0$ and $1$ appear in the original sequence. $1$ appears earlier, so the output is 1 0. Again, the order is important.
| 500
|
[
{
"input": "7 3\n3 5 7 1 6 2 8\n1 2 7",
"output": "7 1 2"
},
{
"input": "4 4\n3 4 1 0\n0 1 7 9",
"output": "1 0"
},
{
"input": "9 4\n9 8 7 6 5 4 3 2 1\n2 4 6 8",
"output": "8 6 4 2"
},
{
"input": "10 5\n3 7 1 2 4 6 9 0 5 8\n4 3 0 7 9",
"output": "3 7 4 9 0"
},
{
"input": "10 10\n1 2 3 4 5 6 7 8 9 0\n4 5 6 7 1 2 3 0 9 8",
"output": "1 2 3 4 5 6 7 8 9 0"
},
{
"input": "1 1\n4\n4",
"output": "4"
},
{
"input": "3 7\n6 3 4\n4 9 0 1 7 8 6",
"output": "6 4"
},
{
"input": "10 1\n9 0 8 1 7 4 6 5 2 3\n0",
"output": "0"
},
{
"input": "5 10\n6 0 3 8 1\n3 1 0 5 4 7 2 8 9 6",
"output": "6 0 3 8 1"
},
{
"input": "8 2\n7 2 9 6 1 0 3 4\n6 3",
"output": "6 3"
},
{
"input": "5 4\n7 0 1 4 9\n0 9 5 3",
"output": "0 9"
},
{
"input": "10 1\n9 6 2 0 1 8 3 4 7 5\n6",
"output": "6"
},
{
"input": "10 2\n7 1 0 2 4 6 5 9 3 8\n3 2",
"output": "2 3"
},
{
"input": "5 9\n3 7 9 2 4\n3 8 4 5 9 6 1 0 2",
"output": "3 9 2 4"
},
{
"input": "10 6\n7 1 2 3 8 0 6 4 5 9\n1 5 8 2 3 6",
"output": "1 2 3 8 6 5"
},
{
"input": "8 2\n7 4 8 9 2 5 6 1\n6 4",
"output": "4 6"
},
{
"input": "10 2\n1 0 3 5 8 9 4 7 6 2\n0 3",
"output": "0 3"
},
{
"input": "7 6\n9 2 8 6 1 3 7\n4 2 0 3 1 8",
"output": "2 8 1 3"
},
{
"input": "1 6\n3\n6 8 2 4 5 3",
"output": "3"
},
{
"input": "1 8\n0\n9 2 4 8 1 5 0 7",
"output": "0"
},
{
"input": "6 9\n7 3 9 4 1 0\n9 1 5 8 0 6 2 7 4",
"output": "7 9 4 1 0"
},
{
"input": "10 2\n4 9 6 8 3 0 1 5 7 2\n0 1",
"output": "0 1"
},
{
"input": "10 5\n5 2 8 0 9 7 6 1 4 3\n9 6 4 1 2",
"output": "2 9 6 1 4"
},
{
"input": "6 3\n8 3 9 2 7 6\n5 4 3",
"output": "3"
},
{
"input": "4 10\n8 3 9 6\n4 9 6 2 7 0 8 1 3 5",
"output": "8 3 9 6"
},
{
"input": "1 2\n1\n1 0",
"output": "1"
},
{
"input": "3 6\n1 2 3\n4 5 6 1 2 3",
"output": "1 2 3"
},
{
"input": "1 2\n2\n1 2",
"output": "2"
},
{
"input": "1 10\n9\n0 1 2 3 4 5 6 7 8 9",
"output": "9"
}
] | 1,581,972,734
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 108
| 0
|
number1, number2 = input().split()
lst1 = list(map(int, input().split()))
lst2 = list(map(int, input().split()))
for x in lst1:
for y in lst2:
if x == y:
print(y, end=" ")
|
Title: Fingerprints
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are locked in a room with a door that has a keypad with 10 keys corresponding to digits from 0 to 9. To escape from the room, you need to enter a correct code. You also have a sequence of digits.
Some keys on the keypad have fingerprints. You believe the correct code is the longest not necessarily contiguous subsequence of the sequence you have that only contains digits with fingerprints on the corresponding keys. Find such code.
Input Specification:
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 10$) representing the number of digits in the sequence you have and the number of keys on the keypad that have fingerprints.
The next line contains $n$ distinct space-separated integers $x_1, x_2, \ldots, x_n$ ($0 \le x_i \le 9$) representing the sequence.
The next line contains $m$ distinct space-separated integers $y_1, y_2, \ldots, y_m$ ($0 \le y_i \le 9$) — the keys with fingerprints.
Output Specification:
In a single line print a space-separated sequence of integers representing the code. If the resulting sequence is empty, both printing nothing and printing a single line break is acceptable.
Demo Input:
['7 3\n3 5 7 1 6 2 8\n1 2 7\n', '4 4\n3 4 1 0\n0 1 7 9\n']
Demo Output:
['7 1 2\n', '1 0\n']
Note:
In the first example, the only digits with fingerprints are $1$, $2$ and $7$. All three of them appear in the sequence you know, $7$ first, then $1$ and then $2$. Therefore the output is 7 1 2. Note that the order is important, and shall be the same as the order in the original sequence.
In the second example digits $0$, $1$, $7$ and $9$ have fingerprints, however only $0$ and $1$ appear in the original sequence. $1$ appears earlier, so the output is 1 0. Again, the order is important.
|
```python
number1, number2 = input().split()
lst1 = list(map(int, input().split()))
lst2 = list(map(int, input().split()))
for x in lst1:
for y in lst2:
if x == y:
print(y, end=" ")
```
| 3
|
|
380
|
C
|
Sereja and Brackets
|
PROGRAMMING
| 2,000
|
[
"data structures",
"schedules"
] | null | null |
Sereja has a bracket sequence *s*1,<=*s*2,<=...,<=*s**n*, or, in other words, a string *s* of length *n*, consisting of characters "(" and ")".
Sereja needs to answer *m* queries, each of them is described by two integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). The answer to the *i*-th query is the length of the maximum correct bracket subsequence of sequence *s**l**i*,<=*s**l**i*<=+<=1,<=...,<=*s**r**i*. Help Sereja answer all queries.
You can find the definitions for a subsequence and a correct bracket sequence in the notes.
|
The first line contains a sequence of characters *s*1,<=*s*2,<=...,<=*s**n* (1<=≤<=*n*<=≤<=106) without any spaces. Each character is either a "(" or a ")". The second line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. Each of the next *m* lines contains a pair of integers. The *i*-th line contains integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the description of the *i*-th query.
|
Print the answer to each question on a single line. Print the answers in the order they go in the input.
|
[
"())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10\n"
] |
[
"0\n0\n2\n10\n4\n6\n6\n"
] |
A subsequence of length |*x*| of string *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">|*s*|</sub> (where |*s*| is the length of string *s*) is string *x* = *s*<sub class="lower-index">*k*<sub class="lower-index">1</sub></sub>*s*<sub class="lower-index">*k*<sub class="lower-index">2</sub></sub>... *s*<sub class="lower-index">*k*<sub class="lower-index">|*x*|</sub></sub> (1 ≤ *k*<sub class="lower-index">1</sub> < *k*<sub class="lower-index">2</sub> < ... < *k*<sub class="lower-index">|*x*|</sub> ≤ |*s*|).
A correct bracket sequence is a bracket sequence that can be transformed into a correct aryphmetic expression by inserting characters "1" and "+" between the characters of the string. For example, bracket sequences "()()", "(())" are correct (the resulting expressions "(1)+(1)", "((1+1)+1)"), and ")(" and "(" are not.
For the third query required sequence will be «()».
For the fourth query required sequence will be «()(())(())».
| 1,500
|
[
{
"input": "())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10",
"output": "0\n0\n2\n10\n4\n6\n6"
},
{
"input": "(((((()((((((((((()((()(((((\n1\n8 15",
"output": "0"
},
{
"input": "((()((())(((((((((()(()(()(((((((((((((((()(()((((((((((((((()(((((((((((((((((((()(((\n39\n28 56\n39 46\n57 63\n29 48\n51 75\n14 72\n5 70\n51 73\n10 64\n31 56\n50 54\n15 78\n78 82\n1 11\n1 70\n1 19\n10 22\n13 36\n3 10\n34 40\n51 76\n64 71\n36 75\n24 71\n1 63\n5 14\n46 67\n32 56\n39 43\n43 56\n61 82\n2 78\n1 21\n10 72\n49 79\n12 14\n53 79\n15 31\n7 47",
"output": "4\n4\n2\n4\n2\n12\n16\n2\n12\n4\n0\n12\n0\n6\n18\n6\n2\n6\n6\n0\n2\n0\n6\n8\n18\n4\n2\n4\n2\n2\n2\n18\n8\n12\n2\n0\n2\n6\n12"
},
{
"input": "))(()))))())())))))())((()()))))()))))))))))))\n9\n26 42\n21 22\n6 22\n7 26\n43 46\n25 27\n32 39\n22 40\n2 45",
"output": "4\n0\n6\n8\n0\n2\n2\n10\n20"
},
{
"input": "(()((((()(())((((((((()((((((()((((\n71\n15 29\n17 18\n5 26\n7 10\n16 31\n26 35\n2 30\n16 24\n2 24\n7 12\n15 18\n12 13\n25 30\n1 30\n12 13\n16 20\n6 35\n20 28\n18 23\n9 31\n12 35\n14 17\n8 16\n3 10\n12 33\n7 19\n2 33\n7 17\n21 27\n10 30\n29 32\n9 28\n18 32\n28 31\n31 33\n4 26\n15 27\n10 17\n8 14\n11 28\n8 23\n17 33\n4 14\n3 6\n6 34\n19 23\n4 21\n16 27\n14 27\n6 19\n31 32\n29 32\n9 17\n1 21\n2 31\n18 29\n16 26\n15 18\n4 5\n13 20\n9 28\n18 30\n1 32\n2 9\n16 24\n1 20\n4 15\n16 23\n19 34\n5 22\n5 23",
"output": "2\n0\n8\n2\n4\n2\n10\n2\n10\n4\n0\n0\n0\n10\n0\n0\n10\n2\n2\n8\n4\n0\n6\n2\n4\n6\n12\n6\n2\n6\n2\n6\n4\n2\n0\n8\n2\n4\n6\n4\n8\n4\n6\n0\n10\n2\n6\n2\n2\n6\n0\n2\n4\n8\n12\n2\n2\n0\n0\n0\n6\n2\n12\n4\n2\n8\n6\n2\n4\n6\n8"
},
{
"input": "(((())((((()()((((((()((()(((((((((((()((\n6\n20 37\n28 32\n12 18\n7 25\n21 33\n4 5",
"output": "4\n0\n2\n6\n4\n2"
},
{
"input": "(((()((((()()()(()))((((()(((()))()((((()))()((())\n24\n37 41\n13 38\n31 34\n14 16\n29 29\n12 46\n1 26\n15 34\n8 47\n11 23\n6 32\n2 22\n9 27\n17 40\n6 15\n4 49\n12 33\n3 48\n22 47\n19 48\n10 27\n23 25\n4 44\n27 48",
"output": "2\n16\n0\n2\n0\n26\n16\n12\n30\n8\n18\n14\n14\n12\n6\n34\n16\n32\n18\n18\n12\n0\n30\n16"
},
{
"input": ")()((((((((((((((((()(((()()(()((((((()(((((((()()))((((())(((((((((()(((((((((\n51\n29 53\n31 69\n54 59\n3 52\n26 46\n14 62\n6 54\n39 56\n17 27\n46 74\n60 72\n18 26\n38 46\n4 27\n22 52\n44 49\n42 77\n2 20\n39 57\n61 70\n33 54\n10 30\n67 70\n46 66\n17 77\n5 52\n33 77\n26 32\n1 72\n40 78\n38 68\n19 47\n30 53\n19 29\n52 71\n1 11\n22 53\n17 42\n2 51\n4 12\n24 76\n22 34\n21 69\n11 69\n36 52\n17 31\n57 58\n54 62\n23 71\n5 46\n51 53",
"output": "12\n14\n4\n18\n6\n22\n18\n8\n4\n12\n2\n4\n2\n4\n16\n2\n14\n2\n8\n2\n10\n6\n2\n10\n24\n18\n16\n4\n26\n14\n14\n10\n12\n6\n6\n2\n16\n10\n18\n0\n22\n6\n20\n22\n10\n8\n2\n4\n22\n10\n0"
},
{
"input": "(\n1\n1 1",
"output": "0"
},
{
"input": ")\n1\n1 1",
"output": "0"
},
{
"input": "()\n1\n1 2",
"output": "2"
},
{
"input": ")(\n1\n1 2",
"output": "0"
}
] | 1,654,680,479
| 2,147,483,647
|
PyPy 3
|
TIME_LIMIT_EXCEEDED
|
TESTS
| 12
| 1,000
| 175,718,400
|
def inlt():
return(list(map(int,input().split())))
import sys
from collections import defaultdict
from math import sqrt, ceil,floor,factorial,log2
from bisect import bisect_left , bisect_right
from io import BytesIO, IOBase, StringIO
MYPC = False
if MYPC :
sys.stdin = open('in.txt' , 'r')
sys.stdout = open('out.txt' , 'w')
input = lambda : sys.stdin.readline().rstrip(
)
class DSU:
def __init__(self, n):
self.parent = list(range(n))
self.size = [1] * n
self.num_sets = n
def find(self, a):
acopy = a
while a != self.parent[a]:
a = self.parent[a]
while acopy != a:
self.parent[acopy], acopy = a, self.parent[acopy]
return a
def union(self, a, b):
a, b = self.find(a), self.find(b)
if a != b:
if self.size[a] < self.size[b]:
a, b = b, a
self.num_sets -= 1
self.parent[b] = a
self.size[a] += self.size[b]
def set_size(self, a):
return self.size[self.find(a)]
def __len__(self):
return self.num_sets
#index 0 for answer
#index 1 for left
#index 2 for right
s=input()
n=2**ceil(log2(len(s)))
seg=[]
for j in range(2*n):
seg.append([0,0,0])
for j in range(len(s)):
if s[j]=="(":
seg[j+n]=[0,1,0]
else:
seg[j+n]=[0,0,1]
for j in range(n-1,0,-1):
try:
seg[j][0]=seg[j*2][0] + seg[2*j+1][0]+min(seg[2*j][1],seg[2*j+1][2])
seg[j][1]=seg[2*j][1] - min(seg[2*j][1],seg[2*j+1][2]) + seg[2*j+1][1]
seg[j][2]=seg[2*j][2] + seg[2*j + 1][2] - min(seg[2*j][1],seg[2*j+1][2])
except:
pass
def rang(i,j):
i=i+n
j=j+n
ans=0
new=[]
st=[]
while i<=j:
if i&1:
ans=ans+seg[i][0]
new.append([seg[i][1],seg[i][2]])
i+=1
if not j&1:
ans=ans+seg[j][0]
st.append([seg[j][1],seg[j][2]])
j-=1
i>>=1
j>>=1
for j in range(len(st)-1,-1,-1):
new.append(st[j])
left=0
for j in new:
ans = ans + min(j[1],left)
left=left-min(j[1],left)
left=left+j[0]
return ans
t=int(input())
while t:
t-=1
a,b=map(int,input().split())
print(2*rang(a-1,b-1))
|
Title: Sereja and Brackets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sereja has a bracket sequence *s*1,<=*s*2,<=...,<=*s**n*, or, in other words, a string *s* of length *n*, consisting of characters "(" and ")".
Sereja needs to answer *m* queries, each of them is described by two integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*). The answer to the *i*-th query is the length of the maximum correct bracket subsequence of sequence *s**l**i*,<=*s**l**i*<=+<=1,<=...,<=*s**r**i*. Help Sereja answer all queries.
You can find the definitions for a subsequence and a correct bracket sequence in the notes.
Input Specification:
The first line contains a sequence of characters *s*1,<=*s*2,<=...,<=*s**n* (1<=≤<=*n*<=≤<=106) without any spaces. Each character is either a "(" or a ")". The second line contains integer *m* (1<=≤<=*m*<=≤<=105) — the number of queries. Each of the next *m* lines contains a pair of integers. The *i*-th line contains integers *l**i*,<=*r**i* (1<=≤<=*l**i*<=≤<=*r**i*<=≤<=*n*) — the description of the *i*-th query.
Output Specification:
Print the answer to each question on a single line. Print the answers in the order they go in the input.
Demo Input:
['())(())(())(\n7\n1 1\n2 3\n1 2\n1 12\n8 12\n5 11\n2 10\n']
Demo Output:
['0\n0\n2\n10\n4\n6\n6\n']
Note:
A subsequence of length |*x*| of string *s* = *s*<sub class="lower-index">1</sub>*s*<sub class="lower-index">2</sub>... *s*<sub class="lower-index">|*s*|</sub> (where |*s*| is the length of string *s*) is string *x* = *s*<sub class="lower-index">*k*<sub class="lower-index">1</sub></sub>*s*<sub class="lower-index">*k*<sub class="lower-index">2</sub></sub>... *s*<sub class="lower-index">*k*<sub class="lower-index">|*x*|</sub></sub> (1 ≤ *k*<sub class="lower-index">1</sub> < *k*<sub class="lower-index">2</sub> < ... < *k*<sub class="lower-index">|*x*|</sub> ≤ |*s*|).
A correct bracket sequence is a bracket sequence that can be transformed into a correct aryphmetic expression by inserting characters "1" and "+" between the characters of the string. For example, bracket sequences "()()", "(())" are correct (the resulting expressions "(1)+(1)", "((1+1)+1)"), and ")(" and "(" are not.
For the third query required sequence will be «()».
For the fourth query required sequence will be «()(())(())».
|
```python
def inlt():
return(list(map(int,input().split())))
import sys
from collections import defaultdict
from math import sqrt, ceil,floor,factorial,log2
from bisect import bisect_left , bisect_right
from io import BytesIO, IOBase, StringIO
MYPC = False
if MYPC :
sys.stdin = open('in.txt' , 'r')
sys.stdout = open('out.txt' , 'w')
input = lambda : sys.stdin.readline().rstrip(
)
class DSU:
def __init__(self, n):
self.parent = list(range(n))
self.size = [1] * n
self.num_sets = n
def find(self, a):
acopy = a
while a != self.parent[a]:
a = self.parent[a]
while acopy != a:
self.parent[acopy], acopy = a, self.parent[acopy]
return a
def union(self, a, b):
a, b = self.find(a), self.find(b)
if a != b:
if self.size[a] < self.size[b]:
a, b = b, a
self.num_sets -= 1
self.parent[b] = a
self.size[a] += self.size[b]
def set_size(self, a):
return self.size[self.find(a)]
def __len__(self):
return self.num_sets
#index 0 for answer
#index 1 for left
#index 2 for right
s=input()
n=2**ceil(log2(len(s)))
seg=[]
for j in range(2*n):
seg.append([0,0,0])
for j in range(len(s)):
if s[j]=="(":
seg[j+n]=[0,1,0]
else:
seg[j+n]=[0,0,1]
for j in range(n-1,0,-1):
try:
seg[j][0]=seg[j*2][0] + seg[2*j+1][0]+min(seg[2*j][1],seg[2*j+1][2])
seg[j][1]=seg[2*j][1] - min(seg[2*j][1],seg[2*j+1][2]) + seg[2*j+1][1]
seg[j][2]=seg[2*j][2] + seg[2*j + 1][2] - min(seg[2*j][1],seg[2*j+1][2])
except:
pass
def rang(i,j):
i=i+n
j=j+n
ans=0
new=[]
st=[]
while i<=j:
if i&1:
ans=ans+seg[i][0]
new.append([seg[i][1],seg[i][2]])
i+=1
if not j&1:
ans=ans+seg[j][0]
st.append([seg[j][1],seg[j][2]])
j-=1
i>>=1
j>>=1
for j in range(len(st)-1,-1,-1):
new.append(st[j])
left=0
for j in new:
ans = ans + min(j[1],left)
left=left-min(j[1],left)
left=left+j[0]
return ans
t=int(input())
while t:
t-=1
a,b=map(int,input().split())
print(2*rang(a-1,b-1))
```
| 0
|
Subsets and Splits
Successful Python Submissions
Retrieves all records from the train dataset where the verdict is 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Retrieves records of users with a rating of 1600 or higher and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a rating above 2000 and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a 'OK' verdict, providing a basic overview of a specific category within the dataset.