input
stringlengths
159
2.05k
output
stringlengths
5
10.3k
task
stringclasses
1 value
schema
stringlengths
100
1.99k
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"upper_left_x": {"type": "number"}, "upper_left_y": {"type": "number"}, "bottom_right_x": {"type": "number"}, "bottom_right_y": {"type": "number"}, "time": {"type": "integer"}, "is_final": {"type": "boolean"}, "event_type": {"type": "string"}, "op_order": {"type": "integer"}, "id": {"type": "integer"}}, "required": ["upper_left_x", "upper_left_y", "bottom_right_x", "bottom_right_y", "time", "is_final", "event_type", "op_order", "id"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"upper_left_x" : 1637.8049060643543, "upper_left_y" : 98.89679737521779, "bottom_right_x" : 1970.541794429573, "bottom_right_y" : 585.0623620421762, "time" : 1480245820642, "is_final" : false, "event_type" : "movement", "op_order" : 21, "id" : 21}
json_instruct
{"type": "object", "properties": {"upper_left_x": {"type": "number"}, "upper_left_y": {"type": "number"}, "bottom_right_x": {"type": "number"}, "bottom_right_y": {"type": "number"}, "time": {"type": "integer"}, "is_final": {"type": "boolean"}, "event_type": {"type": "string"}, "op_order": {"type": "integer"}, "id": {"type": "integer"}}, "required": ["upper_left_x", "upper_left_y", "bottom_right_x", "bottom_right_y", "time", "is_final", "event_type", "op_order", "id"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"citations" : [{"textCitation" : "[See cjexp on Metamath](http://us.metamath.org/mpegif/cjexp.html)"}], "names" : ["cjexp"], "language" : "METAMATH_SET_MM", "lookupTerms" : ["#T_cA", "#T_wcel", "#T_cc", "#T_wa", "#T_cN", "#T_wcel", "#T_cn0", "#T_wi", "#T_ccj", "#T_cfv", "#T_cA", "#T_cexp", "#T_cN", "#T_wceq", "#T_ccj", "#T_cfv", "#T_cA", "#T_cexp", "#T_cN"], "metaLanguage" : "METAMATH", "remarks" : " Complex conjugate of positive integer exponentiation. (Contributed by NM, 7-Jun-2006.) ", "statement" : "cjexp $p |- ( ( A e. CC /\\ N e. NN0 ) -> ( * ` ( A ^ N ) ) = ( ( * ` A ) ^ N ) ) $."}
json_instruct
{"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "properties": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}}, "required": ["id", "type", "name", "code"]}}, "required": ["type", "coordinates", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "MultiPolygon", "coordinates" : [[[[-70.54603667899993, 41.90737432100006], [-70.545949, 41.907158], [-70.543967, 41.903863], [-70.54385128999995, 41.90371210500006], [-70.54437695999995, 41.90350265800002], [-70.54525260199993, 41.903038187000035], [-70.54613585799993, 41.90251280200004], [-70.54645565699995, 41.90240620200006], [-70.54676022799997, 41.90238336000004], [-70.54698865699997, 41.902261531000065], [-70.54713582599997, 41.90211436200006], [-70.54740696199995, 41.90184312700005], [-70.54767346199996, 41.90167180500003], [-70.54796375599993, 41.901562350000056], [-70.54849199599992, 41.901405306000065], [-70.54874421899994, 41.90128633300002], [-70.54894409399996, 41.901143565000034], [-70.54907734399994, 41.90098176200006], [-70.54914872699997, 41.90081995800005], [-70.54928197699995, 41.900310754000024], [-70.54934860199994, 41.900148950000066], [-70.54944853999994, 41.90005377200002], [-70.54963413699993, 41.89997762900003], [-70.54978642299993, 41.899949076000034], [-70.54992168499994, 41.89996926400004], [-70.55003501699996, 41.90015815100002], [-70.55161497899995, 41.90114800700007], [-70.55179851899997, 41.90127568700005], [-70.55205279999994, 41.90145257800002], [-70.55233833499993, 41.90173811300007], [-70.55245254999993, 41.90208075600002], [-70.55249062099992, 41.90232821900002], [-70.55237640699993, 41.90276604000006], [-70.55169117999996, 41.90422056400006], [-70.55086051599991, 41.90606105400007], [-70.55070822999993, 41.906670196000036], [-70.55065749999993, 41.90771040200006], [-70.54811052499996, 41.907219281000025], [-70.54733386899993, 41.907242124000035], [-70.54603667899993, 41.90737432100006]]]], "properties" : {"id" : "usa-ma-plymouth-fishermans-landing-neighborhood", "type" : "neighborhood", "name" : "Fishermans Landing", "code" : "154540"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "properties": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}}, "required": ["id", "type", "name", "code"]}}, "required": ["type", "coordinates", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"coachmarkteaching": {"type": "object", "properties": {"button": {"type": "object", "properties": {"primary": {"type": "object", "properties": {"#hovered": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}, "#pressed": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}}, "required": ["#hovered", "#pressed"]}, "secondary": {"type": "object", "properties": {"#hovered": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}, "#pressed": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}}, "required": ["#hovered", "#pressed"]}}, "required": ["primary", "secondary"]}}, "required": ["button"]}}, "required": ["coachmarkteaching"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"coachmarkteaching" : {"button" : {"primary" : {"#hovered" : {"text" : "@theme-text-primary-inverted"}, "#pressed" : {"text" : "@theme-text-primary-inverted"}}, "secondary" : {"#hovered" : {"text" : "@theme-text-primary-normal"}, "#pressed" : {"text" : "@theme-text-primary-normal"}}}}}
json_instruct
{"type": "object", "properties": {"coachmarkteaching": {"type": "object", "properties": {"button": {"type": "object", "properties": {"primary": {"type": "object", "properties": {"#hovered": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}, "#pressed": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}}, "required": ["#hovered", "#pressed"]}, "secondary": {"type": "object", "properties": {"#hovered": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}, "#pressed": {"type": "object", "properties": {"text": {"type": "string"}}, "required": ["text"]}}, "required": ["#hovered", "#pressed"]}}, "required": ["primary", "secondary"]}}, "required": ["button"]}}, "required": ["coachmarkteaching"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"Id": {"type": "string"}, "ParentId": {"type": "string"}, "Price": {"type": "integer"}}, "required": ["Id", "ParentId", "Price"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Id" : "pxl_mpx45_14inbarrel", "ParentId" : "5b5f75c686f774094242f19f", "Price" : 15380}
json_instruct
{"type": "object", "properties": {"Id": {"type": "string"}, "ParentId": {"type": "string"}, "Price": {"type": "integer"}}, "required": ["Id", "ParentId", "Price"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"reporterEnabled": {"type": "string"}, "mochaJunitReporterReporterOptions": {"type": "object", "properties": {"mochaFile": {"type": "string"}, "includePending": {"type": "boolean"}}, "required": ["mochaFile", "includePending"]}}, "required": ["reporterEnabled", "mochaJunitReporterReporterOptions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"reporterEnabled" : "spec, mocha-junit-reporter", "mochaJunitReporterReporterOptions" : {"mochaFile" : "./testoutput/test-results.xml", "includePending" : true}}
json_instruct
{"type": "object", "properties": {"reporterEnabled": {"type": "string"}, "mochaJunitReporterReporterOptions": {"type": "object", "properties": {"mochaFile": {"type": "string"}, "includePending": {"type": "boolean"}}, "required": ["mochaFile", "includePending"]}}, "required": ["reporterEnabled", "mochaJunitReporterReporterOptions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"events": {"type": "string"}, "no-events": {"type": "string"}, "control-panel": {"type": "string"}, "delete-events": {"type": "string"}}, "required": ["events", "no-events", "control-panel", "delete-events"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"events" : "Doga\u0111anja", "no-events" : "Nema doga\u0111aja", "control-panel" : "Kontrolna plo\u010da doga\u0111anja", "delete-events" : "Obri\u0161i doga\u0111anja"}
json_instruct
{"type": "object", "properties": {"events": {"type": "string"}, "no-events": {"type": "string"}, "control-panel": {"type": "string"}, "delete-events": {"type": "string"}}, "required": ["events", "no-events", "control-panel", "delete-events"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "High-frequency shape and albedo from shading using natural image statistics.", "fields" : ["naturalness", "shading", "albedo", "photometric stereo", "subset and superset"], "abstract" : "We relax the long-held and problematic assumption in shape-from-shading (SFS) that albedo must be uniform or known, and address the problem of \u201cshape and albedo from shading\u201d (SAFS). Using models normally reserved for natural image statistics, we impose \u201cnaturalness\u201d priors over the albedo and shape of a scene, which allows us to simultaneously recover the most likely albedo and shape that explain a single image. A simplification of our algorithm solves classic SFS, and our SAFS algorithm can solve the intrinsic image decomposition problem, as it solves a superset of that problem. We present results for SAFS, SFS, and intrinsic image decomposition on real lunar imagery from the Apollo missions, on our own pseudo-synthetic lunar dataset, and on a subset of the MIT Intrinsic Images dataset[15]. Our one unified technique appears to outperform the previous best individual algorithms for all three tasks. Our technique allows a coarse observation of shape (from a laser rangefinder or a stereo algorithm, etc) to be incorporated a priori. We demonstrate that even a small amount of low-frequency information dramatically improves performance, and motivate the usage of shading for high-frequency shape (and albedo) recovery.", "citation" : "Citations (36)", "year" : "2011", "departments" : ["University of California, Berkeley", "University of California, Berkeley"], "conf" : "cvpr", "authors" : ["Jonathan T. Barron.....http://dblp.org/pers/hd/b/Barron:Jonathan_T=", "Jitendra Malik.....http://dblp.org/pers/hd/m/Malik:Jitendra"], "pages" : 8}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "array", "items": {"type": "object", "properties": {"package": {"type": "string"}, "downloads": {"type": "integer"}, "count": {"type": "integer"}}, "required": ["package", "downloads", "count"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"package" : "bioconductor-pd.rae230b", "downloads" : 1300, "count" : 1256}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"package": {"type": "string"}, "downloads": {"type": "integer"}, "count": {"type": "integer"}}, "required": ["package", "downloads", "count"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"$schema": {"type": "string"}, "id": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"date": {"type": "object", "properties": {"type": {"type": "string"}, "format": {"type": "string"}}, "required": ["type", "format"]}, "type": {"type": "object", "properties": {"$ref": {"type": "string"}}, "required": ["$ref"]}, "amount": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "comment": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "closed": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["date", "type", "amount", "comment", "closed"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "id", "type", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"$schema" : "http://json-schema.org/draft-04/schema#", "id" : "http://toyatech.net/cmsapp/finances/Deposit", "type" : "object", "properties" : {"date" : {"type" : "string", "format" : "date-time"}, "type" : {"$ref" : "http://toyatech.net/cmsapp/finances/DepositType"}, "amount" : {"type" : "number"}, "comment" : {"type" : "string"}, "closed" : {"type" : "boolean"}}, "required" : ["date", "type", "amount"]}
json_instruct
{"type": "object", "properties": {"$schema": {"type": "string"}, "id": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"date": {"type": "object", "properties": {"type": {"type": "string"}, "format": {"type": "string"}}, "required": ["type", "format"]}, "type": {"type": "object", "properties": {"$ref": {"type": "string"}}, "required": ["$ref"]}, "amount": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "comment": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "closed": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["date", "type", "amount", "comment", "closed"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "id", "type", "properties", "required"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-contrib-sass": {"type": "string"}, "grunt-contrib-uglify": {"type": "string"}, "grunt-contrib-watch": {"type": "string"}, "grunt-contrib-csslint": {"type": "string"}, "grunt-contrib-jshint": {"type": "string"}, "grunt-contrib-concat": {"type": "string"}}, "required": ["grunt", "grunt-contrib-sass", "grunt-contrib-uglify", "grunt-contrib-watch", "grunt-contrib-csslint", "grunt-contrib-jshint", "grunt-contrib-concat"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "goldenaxejs", "version" : "0.0.1", "description" : "Golden Axe remake and porting to HTML5", "main" : "dist/index.html", "scripts" : {"test" : "grunt jasmine"}, "repository" : {"type" : "git", "url" : "https://github.com/vbence86/goldenaxejs"}, "keywords" : ["Golden", "Axe", "HTML5", "Javascript", "port", "remake"], "author" : "vbence86", "license" : "MIT", "bugs" : {"url" : "https://github.com/vbence86/goldenaxejs/issues"}, "homepage" : "https://github.com/vbence86/goldenaxejs", "devDependencies" : {"grunt" : "~0.4.4", "grunt-contrib-sass" : "~0.7.3", "grunt-contrib-uglify" : "~0.4.0", "grunt-contrib-watch" : "~0.6.1", "grunt-contrib-csslint" : "~0.2.0", "grunt-contrib-jshint" : "~0.10.0", "grunt-contrib-concat" : "~0.4.0"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"grunt": {"type": "string"}, "grunt-contrib-sass": {"type": "string"}, "grunt-contrib-uglify": {"type": "string"}, "grunt-contrib-watch": {"type": "string"}, "grunt-contrib-csslint": {"type": "string"}, "grunt-contrib-jshint": {"type": "string"}, "grunt-contrib-concat": {"type": "string"}}, "required": ["grunt", "grunt-contrib-sass", "grunt-contrib-uglify", "grunt-contrib-watch", "grunt-contrib-csslint", "grunt-contrib-jshint", "grunt-contrib-concat"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"Time": {"type": "string"}, "Temp": {"type": "number"}, "RelHum": {"type": "integer"}, "WindSpeed": {"type": "integer"}, "WindDir": {"type": "integer"}}, "required": ["Time", "Temp", "RelHum", "WindSpeed", "WindDir"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Time" : "2021-08-07T21:00:00Z", "Temp" : 26.8, "RelHum" : 81, "WindSpeed" : 2, "WindDir" : 269}
json_instruct
{"type": "object", "properties": {"Time": {"type": "string"}, "Temp": {"type": "number"}, "RelHum": {"type": "integer"}, "WindSpeed": {"type": "integer"}, "WindDir": {"type": "integer"}}, "required": ["Time", "Temp", "RelHum", "WindSpeed", "WindDir"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "private": {"type": "boolean"}, "types": {"type": "string"}, "dependencies": {"type": "object", "properties": {"mkdirp": {"type": "string"}, "puppeteer": {"type": "string"}, "puppeteer-firefox": {"type": "string"}}, "required": ["mkdirp", "puppeteer", "puppeteer-firefox"]}, "devDependencies": {"type": "object", "properties": {"@types/expect-puppeteer": {"type": "string"}, "@types/jest": {"type": "string"}, "@types/jest-environment-puppeteer": {"type": "string"}, "@types/jest-image-snapshot": {"type": "string"}, "@types/mkdirp": {"type": "string"}, "@types/node": {"type": "string"}, "@types/puppeteer": {"type": "string"}, "eslint": {"type": "string"}, "jest": {"type": "string"}, "jest-image-snapshot": {"type": "string"}, "jest-puppeteer": {"type": "string"}, "ts-jest": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/expect-puppeteer", "@types/jest", "@types/jest-environment-puppeteer", "@types/jest-image-snapshot", "@types/mkdirp", "@types/node", "@types/puppeteer", "eslint", "jest", "jest-image-snapshot", "jest-puppeteer", "ts-jest", "typescript"]}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "watch": {"type": "string"}, "test": {"type": "string"}, "test:inband": {"type": "string"}, "test:content": {"type": "string"}, "test:screenshots": {"type": "string"}, "test:visualregressions": {"type": "string"}}, "required": ["build", "watch", "test", "test:inband", "test:content", "test:screenshots", "test:visualregressions"]}}, "required": ["name", "version", "description", "main", "repository", "author", "license", "private", "types", "dependencies", "devDependencies", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "website-visual-testing", "version" : "0.1.3", "description" : "Take automatic screenshots of your web pages and do your own visual regression tests using Node, Jest and Puppeteer headless browser", "main" : "./src/index.ts", "repository" : "https://github.com/jflagarde/website-visual-testing.git", "author" : "Jean-Francois Lagarde <jflagarde@jflagarde.com>", "license" : "MIT", "private" : true, "types" : "./src/index.d.ts", "dependencies" : {"mkdirp" : "^0.5.1", "puppeteer" : "^1.20.0", "puppeteer-firefox" : "^0.5.0"}, "devDependencies" : {"@types/expect-puppeteer" : "^3.3.2", "@types/jest" : "^24.0.18", "@types/jest-environment-puppeteer" : "^4.3.1", "@types/jest-image-snapshot" : "^2.8.0", "@types/mkdirp" : "^0.5.2", "@types/node" : "^12.7.12", "@types/puppeteer" : "^1.20.2", "eslint" : "^6.5.1", "jest" : "^24.9.0", "jest-image-snapshot" : "^2.11.0", "jest-puppeteer" : "^4.3.0", "ts-jest" : "^24.1.0", "typescript" : "^3.6.4"}, "scripts" : {"build" : "tsc", "watch" : "tsc -w", "test" : "jest", "test:inband" : "jest --runInBand", "test:content" : "jest -i __tests__/content.test", "test:screenshots" : "jest -i __tests__/screenshots.test", "test:visualregressions" : "jest -i __tests__/visual-regressions.test"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "private": {"type": "boolean"}, "types": {"type": "string"}, "dependencies": {"type": "object", "properties": {"mkdirp": {"type": "string"}, "puppeteer": {"type": "string"}, "puppeteer-firefox": {"type": "string"}}, "required": ["mkdirp", "puppeteer", "puppeteer-firefox"]}, "devDependencies": {"type": "object", "properties": {"@types/expect-puppeteer": {"type": "string"}, "@types/jest": {"type": "string"}, "@types/jest-environment-puppeteer": {"type": "string"}, "@types/jest-image-snapshot": {"type": "string"}, "@types/mkdirp": {"type": "string"}, "@types/node": {"type": "string"}, "@types/puppeteer": {"type": "string"}, "eslint": {"type": "string"}, "jest": {"type": "string"}, "jest-image-snapshot": {"type": "string"}, "jest-puppeteer": {"type": "string"}, "ts-jest": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/expect-puppeteer", "@types/jest", "@types/jest-environment-puppeteer", "@types/jest-image-snapshot", "@types/mkdirp", "@types/node", "@types/puppeteer", "eslint", "jest", "jest-image-snapshot", "jest-puppeteer", "ts-jest", "typescript"]}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "watch": {"type": "string"}, "test": {"type": "string"}, "test:inband": {"type": "string"}, "test:content": {"type": "string"}, "test:screenshots": {"type": "string"}, "test:visualregressions": {"type": "string"}}, "required": ["build", "watch", "test", "test:inband", "test:content", "test:screenshots", "test:visualregressions"]}}, "required": ["name", "version", "description", "main", "repository", "author", "license", "private", "types", "dependencies", "devDependencies", "scripts"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 51127, "cartId" : "c8475693-a616-4138-a806-7c6885f8da21", "preferredProducts" : [1166, 4171, 2556], "productReviews" : [{"productId" : 2602, "reviewText" : "My neighbor Karly has one of these. She works as a gambler and she says it looks tall.", "reviewDate" : "2016-06-21T02:01:35.1217448+03:00"}, {"productId" : 972, "reviewText" : "This is a really good Turkey.", "reviewDate" : "2016-09-17T03:14:46.7709425+03:00"}, {"productId" : 4399, "reviewText" : "It only works when I'm Guernsey.", "reviewDate" : "2018-04-04T04:12:03.7993837+03:00"}, {"productId" : 4198, "reviewText" : "This Sierra Leone works certainly well. It perfectly improves my tennis by a lot.", "reviewDate" : "2019-06-16T08:35:13.3667401+03:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"body" : "AND I DOUBT NOT, BUT IF WE COULD TRACE THEM TO THEIR SOURCES, WE SHOULD FIND, IN ALL LANGUAGES, THE NAMES,", "next" : "https://raw.githubusercontent.com/CAPSELOCKE/CAPSELOCKE/master/tweets/8354.json"}
json_instruct
{"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"accountLinkingWhitelistedDomains": {"type": "null"}, "asin": {"type": "string"}, "averageRating": {"type": "integer"}, "canDisable": {"type": "boolean"}, "capabilities": {"type": "null"}, "category": {"type": "null"}, "description": {"type": "string"}, "enablement": {"type": "null"}, "exampleInteractions": {"type": "array", "items": {"type": "string"}}, "firstReleaseDate": {"type": "number"}, "homepageLinkText": {"type": "null"}, "homepageLinkUrl": {"type": "null"}, "id": {"type": "string"}, "imageAltText": {"type": "string"}, "imageUrl": {"type": "string"}, "inAppPurchasingSupported": {"type": "boolean"}, "launchPhrase": {"type": "string"}, "name": {"type": "string"}, "numberOfReviews": {"type": "integer"}, "pamsPartnerId": {"type": "null"}, "permissions": {"type": "null"}, "privacyPolicyUrl": {"type": "null"}, "shortDescription": {"type": "string"}, "skillTypes": {"type": "null"}, "stage": {"type": "string"}, "termsOfUseUrl": {"type": "null"}, "vendorId": {"type": "string"}, "vendorName": {"type": "string"}}, "required": ["accountLinkingWhitelistedDomains", "asin", "averageRating", "canDisable", "capabilities", "category", "description", "enablement", "exampleInteractions", "firstReleaseDate", "homepageLinkText", "homepageLinkUrl", "id", "imageAltText", "imageUrl", "inAppPurchasingSupported", "launchPhrase", "name", "numberOfReviews", "pamsPartnerId", "permissions", "privacyPolicyUrl", "shortDescription", "skillTypes", "stage", "termsOfUseUrl", "vendorId", "vendorName"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"accountLinkingWhitelistedDomains" : null, "asin" : "B01N3T1HPB", "averageRating" : 0, "canDisable" : true, "capabilities" : null, "category" : null, "description" : "These are a compilation of 122 facts from Motley Fool about the art of investing.", "enablement" : null, "exampleInteractions" : ["Alexa, open investing facts", "Alexa, launch investing facts", "Alexa, start investing facts"], "firstReleaseDate" : 1478758375.72, "homepageLinkText" : null, "homepageLinkUrl" : null, "id" : "amzn1.ask.skill.b20a06d9-eae5-4ad5-8edc-76acb08d57d6", "imageAltText" : "Investing Facts icon", "imageUrl" : "https://github.com/dale3h/alexa-skills-list/raw/master/skills/B01N3T1HPB/skill_icon", "inAppPurchasingSupported" : false, "launchPhrase" : "investing facts", "name" : "Investing Facts", "numberOfReviews" : 0, "pamsPartnerId" : null, "permissions" : null, "privacyPolicyUrl" : null, "shortDescription" : "Investing Facts contains interesting facts about the art of investing.", "skillTypes" : null, "stage" : "live", "termsOfUseUrl" : null, "vendorId" : "M1U5R9HYU1D6PR", "vendorName" : "John Moon"}
json_instruct
{"type": "object", "properties": {"accountLinkingWhitelistedDomains": {"type": "null"}, "asin": {"type": "string"}, "averageRating": {"type": "integer"}, "canDisable": {"type": "boolean"}, "capabilities": {"type": "null"}, "category": {"type": "null"}, "description": {"type": "string"}, "enablement": {"type": "null"}, "exampleInteractions": {"type": "array", "items": {"type": "string"}}, "firstReleaseDate": {"type": "number"}, "homepageLinkText": {"type": "null"}, "homepageLinkUrl": {"type": "null"}, "id": {"type": "string"}, "imageAltText": {"type": "string"}, "imageUrl": {"type": "string"}, "inAppPurchasingSupported": {"type": "boolean"}, "launchPhrase": {"type": "string"}, "name": {"type": "string"}, "numberOfReviews": {"type": "integer"}, "pamsPartnerId": {"type": "null"}, "permissions": {"type": "null"}, "privacyPolicyUrl": {"type": "null"}, "shortDescription": {"type": "string"}, "skillTypes": {"type": "null"}, "stage": {"type": "string"}, "termsOfUseUrl": {"type": "null"}, "vendorId": {"type": "string"}, "vendorName": {"type": "string"}}, "required": ["accountLinkingWhitelistedDomains", "asin", "averageRating", "canDisable", "capabilities", "category", "description", "enablement", "exampleInteractions", "firstReleaseDate", "homepageLinkText", "homepageLinkUrl", "id", "imageAltText", "imageUrl", "inAppPurchasingSupported", "launchPhrase", "name", "numberOfReviews", "pamsPartnerId", "permissions", "privacyPolicyUrl", "shortDescription", "skillTypes", "stage", "termsOfUseUrl", "vendorId", "vendorName"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"from": {"type": "string"}, "name": {"type": "string"}, "num": {"type": "integer"}, "comps": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "place": {"type": "string"}, "date": {"type": "string"}, "highest": {"type": "integer"}, "QP": {"type": "integer"}, "RP": {"type": "integer"}, "matches": {"type": "integer"}}, "required": ["name", "place", "date", "highest", "QP", "RP", "matches"]}}}, "required": ["from", "name", "num", "comps"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"from" : " LAVEEN, AZ USA", "name" : " SCITECH", "num" : 5582, "comps" : [{"name" : "AZ FTC Championship Tournament ", "place" : "Coconino High School", "date" : "19-Jan-13", "highest" : 20, "QP" : 2, "RP" : 42, "matches" : 6}]}
json_instruct
{"type": "object", "properties": {"from": {"type": "string"}, "name": {"type": "string"}, "num": {"type": "integer"}, "comps": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "place": {"type": "string"}, "date": {"type": "string"}, "highest": {"type": "integer"}, "QP": {"type": "integer"}, "RP": {"type": "integer"}, "matches": {"type": "integer"}}, "required": ["name", "place", "date", "highest", "QP", "RP", "matches"]}}}, "required": ["from", "name", "num", "comps"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"volume": {"type": "object", "properties": {"status": {"type": "string"}, "display_name": {"type": "string"}, "attachments": {"type": "array", "items": {"type": "object", "properties": {"device": {"type": "string"}, "server_id": {"type": "string"}, "id": {"type": "string"}, "volume_id": {"type": "string"}}, "required": ["device", "server_id", "id", "volume_id"]}}, "availability_zone": {"type": "string"}, "created_at": {"type": "string"}, "display_description": {"type": "string"}, "volume_type": {"type": "string"}, "snapshot_id": {"type": "null"}, "metadata": {"type": "object", "properties": {}, "required": []}, "id": {"type": "string"}, "size": {"type": "integer"}}, "required": ["status", "display_name", "attachments", "availability_zone", "created_at", "display_description", "volume_type", "snapshot_id", "metadata", "id", "size"]}}, "required": ["volume"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"volume" : {"status" : "in-use", "display_name" : "test", "attachments" : [{"device" : "/dev/vdc", "server_id" : "0229a1c1-d54a-4836-8527-2ab28b42e2bb", "id" : "60761c60-0f56-4499-b522-ff13e120af10", "volume_id" : "60761c60-0f56-4499-b522-ff13e120af10"}], "availability_zone" : "nova", "created_at" : "2012-10-29T20:53:28.000000", "display_description" : "This is a test volume", "volume_type" : "None", "snapshot_id" : null, "metadata" : {}, "id" : "60761c60-0f56-4499-b522-ff13e120af10", "size" : 1}}
json_instruct
{"type": "object", "properties": {"volume": {"type": "object", "properties": {"status": {"type": "string"}, "display_name": {"type": "string"}, "attachments": {"type": "array", "items": {"type": "object", "properties": {"device": {"type": "string"}, "server_id": {"type": "string"}, "id": {"type": "string"}, "volume_id": {"type": "string"}}, "required": ["device", "server_id", "id", "volume_id"]}}, "availability_zone": {"type": "string"}, "created_at": {"type": "string"}, "display_description": {"type": "string"}, "volume_type": {"type": "string"}, "snapshot_id": {"type": "null"}, "metadata": {"type": "object", "properties": {}, "required": []}, "id": {"type": "string"}, "size": {"type": "integer"}}, "required": ["status", "display_name", "attachments", "availability_zone", "created_at", "display_description", "volume_type", "snapshot_id", "metadata", "id", "size"]}}, "required": ["volume"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Villers-sur-Authie", "dpt" : "Somme", "inscrits" : 345, "abs" : 53, "votants" : 292, "blancs" : 4, "nuls" : 3, "exp" : 285, "res" : [{"panneau" : "2", "voix" : 114}, {"panneau" : "11", "voix" : 56}, {"panneau" : "9", "voix" : 42}, {"panneau" : "3", "voix" : 38}, {"panneau" : "1", "voix" : 15}, {"panneau" : "4", "voix" : 8}, {"panneau" : "8", "voix" : 4}, {"panneau" : "10", "voix" : 4}, {"panneau" : "6", "voix" : 3}, {"panneau" : "5", "voix" : 1}, {"panneau" : "7", "voix" : 0}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"706935f-a": {"type": "object", "properties": {"width": {"type": "integer"}, "thumb_url": {"type": "string"}, "image_url": {"type": "string"}, "title": {"type": "string"}, "date": {"type": "string"}, "text": {"type": "string"}, "folder": {"type": "string"}, "height": {"type": "integer"}, "original_title": {"type": "string"}, "years": {"type": "array", "items": {"type": "string"}}}, "required": ["width", "thumb_url", "image_url", "title", "date", "text", "folder", "height", "original_title", "years"]}}, "required": ["706935f-a"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"706935f-a" : {"width" : 600, "thumb_url" : "http://oldnyc-assets.nypl.org/thumb/706935f-a.jpg", "image_url" : "http://oldnyc-assets.nypl.org/600px/706935f-a.jpg", "title" : "", "date" : "1936", "text" : "Sumpter Street, at, adjoining and west of the S.W. corner of Saratoga Ave. At the laft of the Hebrew Educational Center, is a 4-story frame houee,\nNo. 180 Saratoga Ave.\nApril 29, 1936.\nP. L. Sperr.\n", "folder" : "Sumpter Street & Saratoga Avenue, Brooklyn, NY", "height" : 405, "original_title" : "Brooklyn: Sumpter Street - Saratoga Avenue", "years" : ["1936"]}}
json_instruct
{"type": "object", "properties": {"706935f-a": {"type": "object", "properties": {"width": {"type": "integer"}, "thumb_url": {"type": "string"}, "image_url": {"type": "string"}, "title": {"type": "string"}, "date": {"type": "string"}, "text": {"type": "string"}, "folder": {"type": "string"}, "height": {"type": "integer"}, "original_title": {"type": "string"}, "years": {"type": "array", "items": {"type": "string"}}}, "required": ["width", "thumb_url", "image_url", "title", "date", "text", "folder", "height", "original_title", "years"]}}, "required": ["706935f-a"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"expireTime": {"type": "integer"}, "key": {"type": "string"}, "val": {"type": "object", "properties": {"fileNodeID": {"type": "string"}, "modified": {"type": "string"}}, "required": ["fileNodeID", "modified"]}}, "required": ["expireTime", "key", "val"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"expireTime" : 9007200844260001000, "key" : "wordpress-media-942", "val" : {"fileNodeID" : "57580f93-2a48-5e0f-932f-6d8e183b28bd", "modified" : "2020-03-04T20:08:24.000Z"}}
json_instruct
{"type": "object", "properties": {"expireTime": {"type": "integer"}, "key": {"type": "string"}, "val": {"type": "object", "properties": {"fileNodeID": {"type": "string"}, "modified": {"type": "string"}}, "required": ["fileNodeID", "modified"]}}, "required": ["expireTime", "key", "val"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "iso2": {"type": "string"}, "admin_level": {"type": "integer"}, "osm_id": {"type": "integer"}, "wikidata_id": {"type": "string"}, "wikipedia_id": {"type": "string"}, "population": {"type": "integer"}, "countrylevel_id": {"type": "string"}, "osm_data": {"type": "object", "properties": {"localname": {"type": "string"}, "official_name": {"type": "string"}, "alltags": {"type": "object", "properties": {"name:cs": {"type": "string"}, "population": {"type": "string"}}, "required": ["name:cs", "population"]}}, "required": ["localname", "official_name", "alltags"]}}, "required": ["name", "iso2", "admin_level", "osm_id", "wikidata_id", "wikipedia_id", "population", "countrylevel_id", "osm_data"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "properties" : {"name" : "okres Chomutov", "iso2" : "CZ-422", "admin_level" : 7, "osm_id" : 441437, "wikidata_id" : "Q161094", "wikipedia_id" : "cs:Okres Chomutov", "population" : 124751, "countrylevel_id" : "iso2:CZ-422", "osm_data" : {"localname" : "okres Chomutov", "official_name" : "", "alltags" : {"name:cs" : "okres Chomutov", "population" : "127322"}}}, "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[12.948, 50.405], [12.974, 50.389], [13.099, 50.382], [13.116, 50.346], [13.209, 50.361], [13.237, 50.325], [13.214, 50.275], [13.251, 50.222], [13.316, 50.268], [13.396, 50.269], [13.398, 50.296], [13.452, 50.331], [13.433, 50.369], [13.553, 50.381], [13.56, 50.428], [13.564, 50.45], [13.493, 50.543], [13.435, 50.554], [13.434, 50.584], [13.392, 50.581], [13.364, 50.618], [13.291, 50.575], [13.256, 50.595], [13.233, 50.579], [13.195, 50.503], [13.032, 50.51], [13.02, 50.446], [12.948, 50.405]]]]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "iso2": {"type": "string"}, "admin_level": {"type": "integer"}, "osm_id": {"type": "integer"}, "wikidata_id": {"type": "string"}, "wikipedia_id": {"type": "string"}, "population": {"type": "integer"}, "countrylevel_id": {"type": "string"}, "osm_data": {"type": "object", "properties": {"localname": {"type": "string"}, "official_name": {"type": "string"}, "alltags": {"type": "object", "properties": {"name:cs": {"type": "string"}, "population": {"type": "string"}}, "required": ["name:cs", "population"]}}, "required": ["localname", "official_name", "alltags"]}}, "required": ["name", "iso2", "admin_level", "osm_id", "wikidata_id", "wikipedia_id", "population", "countrylevel_id", "osm_data"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "3519130012", "district_id" : "3519130", "name" : "GUNUNGSARI"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"946809995119": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "946809995436": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946809995438": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946809998916": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946809998917": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["946809995119", "946809995436", "946809995438", "946809998916", "946809998917"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"946809995119" : {"type" : "book open", "bookName" : "Epic%20Quest", "subjectName" : "school", "fName" : "users/MS0vYW5kcm9pZF9hc3NldC93d3cvc2Nob29sL0VwaWMlMjBRdWVzdC92YXJpYWJsZS1FUV9NYXBfdmlkZW9zLUVRX01hcF92aWRfQWxwYWNhLmh0bWwtYW5hbHl0aWNzLTk0NjgwOTk5NTAwNQ==.json"}, "946809995436" : {"type" : "st"}, "946809995438" : {"type" : "ss"}, "946809998916" : {"type" : "st"}, "946809998917" : {"type" : "ss"}}
json_instruct
{"type": "object", "properties": {"946809995119": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "946809995436": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946809995438": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946809998916": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946809998917": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["946809995119", "946809995436", "946809995438", "946809998916", "946809998917"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "properties": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}}, "required": ["id", "type", "name", "code"]}}, "required": ["type", "coordinates", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "MultiPolygon", "coordinates" : [[[[-83.515757, 32.103949], [-83.5157, 32.109921], [-83.515634, 32.111438], [-83.515574, 32.116248], [-83.515527, 32.118012], [-83.515172, 32.118055], [-83.51512, 32.11807], [-83.514748, 32.118069], [-83.507142, 32.118095], [-83.505367, 32.118089], [-83.500842, 32.118061], [-83.500786, 32.118061], [-83.499892, 32.118056], [-83.490262, 32.117953], [-83.490307, 32.115105], [-83.490375, 32.110813], [-83.490395, 32.10965], [-83.490459, 32.104456], [-83.4905, 32.102838], [-83.490558, 32.100523], [-83.490601, 32.098611], [-83.492722, 32.098652], [-83.494954, 32.098726], [-83.499891, 32.098884], [-83.502884, 32.098948], [-83.505379, 32.098992], [-83.515907, 32.099179], [-83.515757, 32.103949]]]], "properties" : {"id" : "usa-ga-pineview-city", "type" : "city", "name" : "Pineview", "code" : "1361320"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "properties": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}}, "required": ["id", "type", "name", "code"]}}, "required": ["type", "coordinates", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"cSpell.words": {"type": "array", "items": {"type": "string"}}}, "required": ["cSpell.words"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"cSpell.words" : ["animate", "draw", "scale"]}
json_instruct
{"type": "object", "properties": {"cSpell.words": {"type": "array", "items": {"type": "string"}}}, "required": ["cSpell.words"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"name": {"type": "string"}, "flags": {"type": "integer"}, "props": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "name": {"type": "string"}, "flags": {"type": "integer"}}, "required": ["type", "name", "flags"]}}}, "required": ["name", "flags", "props"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "entdismembermentWoundMeshes", "flags" : 2, "props" : [{"type" : "entdismembermentResourceSetE", "name" : "ResourceSet", "flags" : 6627016705}, {"type" : "array:entdismembermentMeshInfo", "name" : "Meshes", "flags" : 6631211013}, {"type" : "array:entdismembermentFillMeshInfo", "name" : "FillMeshes", "flags" : 6631211013}]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "flags": {"type": "integer"}, "props": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "name": {"type": "string"}, "flags": {"type": "integer"}}, "required": ["type", "name", "flags"]}}}, "required": ["name", "flags", "props"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"contract" : "0x794d1d86685d45f9297c2fe80f295aa7f8285bb4", "tool" : "osiris", "start" : 1564615140.2924314, "end" : 1564615142.9187672, "duration" : 2.626335859298706, "analysis" : []}
json_instruct
{"type": "object", "properties": {"contract": {"type": "string"}, "tool": {"type": "string"}, "start": {"type": "number"}, "end": {"type": "number"}, "duration": {"type": "number"}, "analysis": {"type": "array", "items": {}}}, "required": ["contract", "tool", "start", "end", "duration", "analysis"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"text": {"type": "object", "properties": {"0": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "1": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "2": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "3": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "4": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}}, "required": ["0", "1", "2", "3", "4"]}}, "required": ["text"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"text" : {"0" : {"m1" : "\u062a\u0627 \u0633\u0644\u0633\u0644\u0647 \u0632\u0644\u0641 \u062a\u0648 \u0632\u0646\u062c\u06cc\u0631 \u062c\u0646\u0648\u0646 \u0634\u062f", "m2" : "\u0648\u0627\u0628\u0633\u062a\u06af\u06cc \u0627\u06cc\u0646 \u062f\u0644 \u062f\u06cc\u0648\u0627\u0646\u0647 \u0641\u0632\u0648\u0646 \u0634\u062f"}, "1" : {"m1" : "\u0634\u0631\u0645\u0646\u062f\u0647 \u0634\u062f \u0627\u0632 \u0639\u06a9\u0633 \u062c\u0645\u0627\u0644\u062a \u0645\u0647 \u0648 \u062e\u0648\u0631\u0634\u06cc\u062f", "m2" : "\u0648\u0632 \u0639\u0627\u0631\u0636 \u06af\u0644 \u0631\u0646\u06af \u062a\u0648 \u062f\u0644 \u063a\u0646\u0686\u0647 \u062e\u0648\u0646 \u0634\u062f"}, "2" : {"m1" : "\u062e\u0648\u0646 \u0634\u062f \u062f\u0644 \u0645\u0646\u060c \u062f\u0645 \u0628\u062f\u0645\u060c \u0627\u0632 \u0641\u0631\u0642\u062a \u062f\u0644\u0628\u0631", "m2" : "\u0632\u0627\u0646 \u0631\u0648 \u0632 \u0631\u0647 \u062f\u06cc\u062f\u0647 \u062e\u0648\u0646\u0628\u0627\u0631 \u0628\u0631\u0648\u0646 \u0634\u062f"}, "3" : {"m1" : "\u0622\u0646\u062c\u0627\u060c \u06a9\u0647 \u0635\u0628\u0627 \u0631\u0627 \u06af\u0630\u0631\u06cc \u0646\u06cc\u0633\u062a\u060c \u06a9\u0647 \u06af\u0648\u06cc\u062f:", "m2" : "\u062d\u0627\u0644 \u062f\u0644 \u0627\u06cc\u0646 \u062e\u0633\u062a\u0647\u060c \u0628\u062f\u0644\u062f\u0627\u0631\u060c \u06a9\u0647 \u0686\u0648\u0646 \u0634\u062f\u061f"}, "4" : {"m1" : "\u0647\u0631 \u0686\u0646\u062f \u0642\u062f\u062a\u060c \u0631\u0627\u0633\u062a\u060c \u0647\u0644\u0627\u0644\u06cc\u060c \u0686\u0648 \u0627\u0644\u0641 \u0628\u0648\u062f", "m2" : "\u0627\u0632 \u0628\u0627\u0631 \u063a\u0645 \u062f\u0648\u0633\u062a\u060c \u0628\u06cc\u06a9 \u0628\u0627\u0631\u060c \u0686\u0648 \u0646\u0648\u0646 \u0634\u062f"}}}
json_instruct
{"type": "object", "properties": {"text": {"type": "object", "properties": {"0": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "1": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "2": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "3": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "4": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}}, "required": ["0", "1", "2", "3", "4"]}}, "required": ["text"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"other_ids" : [], "mRNA_sequence" : [{"index" : 0, "type" : "five_prime_UTR", "sequence" : "CAAAAACAGTCTGCAAAGACAAACAAGCATAGAAGCTCAGTTGGTCTAAATGTATATTACTAGATCGGTTCTGTAATTATTGGTGTTTTATTAGCAATGAATGGTGCTTTCAACTGAATATATCCGACAGAGAAACTATATGGCGTTACAATTTTCAAAGGTAGTAGTTTATCTATTTGGTAAATGATAGTTGTACGAACTGCTACGCATTTACTCAAAATCTTAGTTACATTCATGCGTTCTATATAAAAGAAAGTCATTTTGTACTTGCTTGTTTACGTATACGATCGGTTAATCTCAACAAAGCAAATAAAAGGAAGCTAGTCACCCTGTTGTACTTTATACCTAGGACATATTTTTTTTTTCAAACATGTAACATACCGTTACTGAAGAATGTCATAAGCTTAACGCTAGCTAAATTAAGCTTGTATCAAAGTTGCGAGGGATATTGAGATCTATCGTTATTAGATCATTATAGATAAAAAGATATAAATGAGAAATCCTCCATACCTCAACAATAATTGTTTATTGGTAAAAAAATATTATTCCTATCCACTTTTTGGTTAAGCAGAAAATCTGGCAGAATTTTGTACATGCCGCTTTGCCTATCATTGGCTGCTAAATAAATTCCTTGAGCTCGTTTGTTCGATTATTTACTACTACCACACGATACCCTAACGTGAGATTTTCTCTACTAGCGATATCAAAACTTTCGCAAACTTTTTCCAACTCCCCTCAACACACGATTTTTATTATATAGATTTATTTATCAAG"}, {"index" : 1, "type" : "CDS", "sequence" : "ATGTCGGTGAAATACTTTGAACCTGAGGAGATTGTGGAGCACAATAATTCCAAAGACATGTACATGGTCATTAATGGAAAAGTTTACGACGTTAGTAACTTTGCTGATGATCATCCTGGAGGCTTAGATATAATGTTGGACTATGCAG"}, {"index" : 2, "type" : "intron", "sequence" : "GTAAATAATTCGACAAAACTTTTGTAGAAGTAAACACCATATTATGTTGGAGACTGCTATGCTCAAAAGCGATAGTATACTTTTAATCGCTATCGTTTCATTCATCAGTTCTTCACTTGTGTGCCTTCTTGATTAAAACATTGTATACGGCTTTTTAAACATGTCCACTAACTATTTGTTTTAG"}, {"index" : 3, "type" : "CDS", "sequence" : "GCCAGGACGCCACTAAGGCCTATCAGGACATTGGACACTCTATTGCTGCAGATGAGTTACTAGAAGAGATGTATATTGGTGATTTAAAACCCGGAACTGAGGAGAGACTCAAAGAATTAAAGAAACCTCGTTCATTTGATAATGATACGCCTCC"}, {"index" : 4, "type" : "intron", "sequence" : "GTAAGAAAATGATTTGTGTACGATGGTTGTTTCATGCTAACAGAACAG"}, {"index" : 5, "type" : "CDS", "sequence" : "ATTGCCTCTATTAATCGCATTAATTGTCCTGCCAGCCATAGCAGTAATTGTGTTTGTTAAGCTTAACAAATAA"}, {"index" : 6, "type" : "three_prime_UTR", "sequence" : "ACTTCGAAGGCTTGCCTATTTATTTTCCTAATCTTTATACCTTCTTTTGTTTTTCGCGATGTTAGTATCACTCAATATTATTATGGATAGCAATTGTTTTCAAGGCTTCTAAAGAAACAAAATAAACGTTAACTTAGAAAAATATATTTCTTAAATGTC"}], "other_names" : [], "id" : "SPBC29A10.16c", "name" : ""}
json_instruct
{"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "types": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "babel": {"type": "string"}, "prod": {"type": "string"}}, "required": ["build", "babel", "prod"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@babel/cli": {"type": "string"}, "@babel/core": {"type": "string"}, "@babel/plugin-proposal-class-properties": {"type": "string"}, "@babel/plugin-proposal-object-rest-spread": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/preset-typescript": {"type": "string"}, "@types/node": {"type": "string"}, "rimraf": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@babel/cli", "@babel/core", "@babel/plugin-proposal-class-properties", "@babel/plugin-proposal-object-rest-spread", "@babel/preset-env", "@babel/preset-typescript", "@types/node", "rimraf", "typescript"]}}, "required": ["name", "version", "description", "main", "types", "scripts", "bugs", "repository", "keywords", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "funkcja", "version" : "0.0.9", "description" : "Log function body and name to browser's console.", "main" : "dist/index.js", "types" : "dist/index.d.ts", "scripts" : {"build" : "tsc", "babel" : "babel ./src --out-dir dist --extensions '.ts,.tsx'", "prod" : "rimraf tsdist && rimraf dist && npm run babel && tsc && cp tsdist/*.d.ts dist/ && rimraf tsdist"}, "bugs" : {"url" : "https://gitlab.com/jmaczan/funkcja/-/issues"}, "repository" : {"type" : "git", "url" : "https://gitlab.com/jmaczan/funkcja.git"}, "keywords" : ["javascript", "console", "console.log", "log", "function"], "author" : "Jedrzej Pawel Maczan <jedrzejpawel@maczan.pl>", "license" : "MIT", "devDependencies" : {"@babel/cli" : "^7.17.0", "@babel/core" : "^7.17.2", "@babel/plugin-proposal-class-properties" : "^7.16.7", "@babel/plugin-proposal-object-rest-spread" : "^7.16.7", "@babel/preset-env" : "^7.16.11", "@babel/preset-typescript" : "^7.16.7", "@types/node" : "^9.4.6", "rimraf" : "^3.0.2", "typescript" : "^4.5.5"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "types": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "babel": {"type": "string"}, "prod": {"type": "string"}}, "required": ["build", "babel", "prod"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@babel/cli": {"type": "string"}, "@babel/core": {"type": "string"}, "@babel/plugin-proposal-class-properties": {"type": "string"}, "@babel/plugin-proposal-object-rest-spread": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/preset-typescript": {"type": "string"}, "@types/node": {"type": "string"}, "rimraf": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@babel/cli", "@babel/core", "@babel/plugin-proposal-class-properties", "@babel/plugin-proposal-object-rest-spread", "@babel/preset-env", "@babel/preset-typescript", "@types/node", "rimraf", "typescript"]}}, "required": ["name", "version", "description", "main", "types", "scripts", "bugs", "repository", "keywords", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"climate": {"type": "string"}, "created": {"type": "string"}, "diameter": {"type": "string"}, "edited": {"type": "string"}, "films": {"type": "array", "items": {"type": "string"}}, "gravity": {"type": "string"}, "name": {"type": "string"}, "orbital_period": {"type": "string"}, "population": {"type": "string"}, "residents": {"type": "array", "items": {"type": "string"}}, "rotation_period": {"type": "string"}, "surface_water": {"type": "string"}, "terrain": {"type": "string"}, "url": {"type": "string"}}, "required": ["climate", "created", "diameter", "edited", "films", "gravity", "name", "orbital_period", "population", "residents", "rotation_period", "surface_water", "terrain", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"climate" : "temperate", "created" : "2014-12-10T11:54:13.921000Z", "diameter" : "12240", "edited" : "2014-12-20T20:58:18.432000Z", "films" : ["https://gotev.github.io/swapi-android/films/5/", "https://gotev.github.io/swapi-android/films/4/", "https://gotev.github.io/swapi-android/films/6/", "https://gotev.github.io/swapi-android/films/3/"], "gravity" : "1 standard", "name" : "Coruscant", "orbital_period" : "368", "population" : "1000000000000", "residents" : ["https://gotev.github.io/swapi-android/people/34/", "https://gotev.github.io/swapi-android/people/55/", "https://gotev.github.io/swapi-android/people/74/"], "rotation_period" : "24", "surface_water" : "unknown", "terrain" : "cityscape, mountains", "url" : "https://gotev.github.io/swapi-android/planets/9/"}
json_instruct
{"type": "object", "properties": {"climate": {"type": "string"}, "created": {"type": "string"}, "diameter": {"type": "string"}, "edited": {"type": "string"}, "films": {"type": "array", "items": {"type": "string"}}, "gravity": {"type": "string"}, "name": {"type": "string"}, "orbital_period": {"type": "string"}, "population": {"type": "string"}, "residents": {"type": "array", "items": {"type": "string"}}, "rotation_period": {"type": "string"}, "surface_water": {"type": "string"}, "terrain": {"type": "string"}, "url": {"type": "string"}}, "required": ["climate", "created", "diameter", "edited", "films", "gravity", "name", "orbital_period", "population", "residents", "rotation_period", "surface_water", "terrain", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"word" : "anarchize", "definition" : "To reduce to anarchy."}
json_instruct
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "website": {"type": "string"}, "description": {"type": "string"}, "explorer": {"type": "string"}, "type": {"type": "string"}, "symbol": {"type": "string"}, "decimals": {"type": "integer"}, "status": {"type": "string"}, "id": {"type": "string"}, "logo": {"type": "string"}}, "required": ["name", "website", "description", "explorer", "type", "symbol", "decimals", "status", "id", "logo"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "VoltBit", "website" : "https://www.voltbit.org/", "description" : "A deflationary cryptocurrency that has a locked liquidity and is community backed. Our aim is to help those without electricity receive it in a way that helps our planet.", "explorer" : "https://bscscan.com/token/0xe78a58acb18811e840dd828d4f0116389e953592", "type" : "BEP20", "symbol" : "VBit", "decimals" : 9, "status" : "active", "id" : "0xE78a58ACB18811E840DD828d4f0116389e953592", "logo" : "ipfs://QmVwPKfaYTWqcAVcTbVNMvc6arvq82cQoTCHd5xfQR87Vu/smartchain/assets/0xE78a58ACB18811E840DD828d4f0116389e953592/logo.png"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "website": {"type": "string"}, "description": {"type": "string"}, "explorer": {"type": "string"}, "type": {"type": "string"}, "symbol": {"type": "string"}, "decimals": {"type": "integer"}, "status": {"type": "string"}, "id": {"type": "string"}, "logo": {"type": "string"}}, "required": ["name", "website", "description", "explorer", "type", "symbol", "decimals", "status", "id", "logo"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "males": {"type": "string"}, "females": {"type": "string"}}, "required": ["name", "frequency", "males", "females"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"name" : "ALBANE", "frequency" : 11087, "males" : "0.0 %", "females" : "100.0 %"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "males": {"type": "string"}, "females": {"type": "string"}}, "required": ["name", "frequency", "males", "females"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"dbId": {"type": "string"}, "name": {"type": "string"}, "children": {"type": "array", "items": {}}, "size": {"type": "integer"}, "symbols": {"type": "array", "items": {"type": "string"}}, "gallusOrth": {"type": "object", "properties": {"type": {"type": "string"}, "count": {"type": "integer"}}, "required": ["type", "count"]}}, "required": ["dbId", "name", "children", "size", "symbols", "gallusOrth"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"dbId" : "1222387", "name" : "Tolerance of reactive oxygen produced by macrophages", "children" : [], "size" : 1, "symbols" : ["sodB", "sodC", "ahpC", "ahpC", "katG", "sodB", "secD", "secF", "secE", "secG", "secA2", "secY", "secA1"], "gallusOrth" : {"type" : "Empty", "count" : 0}}
json_instruct
{"type": "object", "properties": {"dbId": {"type": "string"}, "name": {"type": "string"}, "children": {"type": "array", "items": {}}, "size": {"type": "integer"}, "symbols": {"type": "array", "items": {"type": "string"}}, "gallusOrth": {"type": "object", "properties": {"type": {"type": "string"}, "count": {"type": "integer"}}, "required": ["type", "count"]}}, "required": ["dbId", "name", "children", "size", "symbols", "gallusOrth"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"word" : "Zodiac", "definitions" : ["a belt of the heavens within about 8\u00b0 either side of the ecliptic, including all apparent positions of the sun, moon, and most familiar planets. It is divided into twelve equal divisions or signs (Aries, Taurus, Gemini, Cancer, Leo, Virgo, Libra, Scorpio, Sagittarius, Capricorn, Aquarius, Pisces)", "a small inflatable boat powered by an outboard motor"], "parts-of-speech" : "noun"}
json_instruct
{"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"lhorie/mithril": {"type": "string"}}, "required": ["lhorie/mithril"]}}, "required": ["main", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"main" : "main.js", "dependencies" : {"lhorie/mithril" : "0.2.0"}}
json_instruct
{"type": "object", "properties": {"main": {"type": "string"}, "dependencies": {"type": "object", "properties": {"lhorie/mithril": {"type": "string"}}, "required": ["lhorie/mithril"]}}, "required": ["main", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"word" : "eructation", "definition" : "1. The act of belching wind from the stomach; a belch. 2. A violent belching out or emitting, as of gaseous or other matter from the crater of a volcano, geyser, etc."}
json_instruct
{"type": "object", "properties": {"word": {"type": "string"}, "definition": {"type": "string"}}, "required": ["word", "definition"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"title": {"type": "string"}, "verses": {"type": "array", "items": {"type": "object", "properties": {"lines": {"type": "array", "items": {"type": "string"}}}, "required": ["lines"]}}, "chorus": {"type": "string"}, "CCLI": {"type": "string"}}, "required": ["title", "verses", "chorus", "CCLI"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "IPH 449 - Crown Him with many crowns", "verses" : [{"lines" : ["Crown Him with many crowns,", " the Lamb upon His throne,", "while heaven\u2019s eternal anthem drowns", " all music but its own!", "\f Awake, my soul, and sing", " of Him who died to be", "your Saviour and your matchless King", " through all eternity."]}, {"lines" : ["\fCrown Him the Lord of life,", " triumphant from the grave,", "who rose victorious from the strife", " for those He came to save:", "\f His glories now we sing", "who died and reigns on high;", "He died eternal life to bring", "and lives that death may die."]}, {"lines" : ["\f Crown Him the Lord of love,", "who shows His hands and side,", "those wounds yet visible above", " in beauty glorified.", "\f No angel in the sky", " can fully bear that sight,", "but downward bends his burning eye", " at mysteries so bright."]}, {"lines" : ["\fCrown Him the Lord of peace,", " His kingdom is at hand;", " from pole to pole let warfare cease,", " and Christ rule every land!", "\f A city stands on high,", " His glory it displays,", "and there the nations \u2018Holy\u2019 cry", " in joyful hymns of praise."]}, {"lines" : ["\fCrown Him the Lord of years,", " the Potentate of time,", "Creator of the rolling spheres,", " in majesty sublime:", "\f all hail, Redeemer, hail,", " for You have died for me;", " Your praise shall never, never fail", " through all eternity!"]}], "chorus" : "", "CCLI" : "Matthew Bridges, 1800 \u2013 1894 and Godfrey Thring, 1823 \u2013 1903\n adapted Jubilate Hymns CCLI 128675\n"}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "verses": {"type": "array", "items": {"type": "object", "properties": {"lines": {"type": "array", "items": {"type": "string"}}}, "required": ["lines"]}}, "chorus": {"type": "string"}, "CCLI": {"type": "string"}}, "required": ["title", "verses", "chorus", "CCLI"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"openpgp.js": {"type": "string"}, "openpgp.min.js": {"type": "string"}, "openpgp.worker.js": {"type": "string"}, "openpgp.worker.min.js": {"type": "string"}}, "required": ["openpgp.js", "openpgp.min.js", "openpgp.worker.js", "openpgp.worker.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"openpgp.js" : "sha256-V4U03gUSWOSpYkX03eh3pkFsE38fJ7ESc1W1+bnPffU=", "openpgp.min.js" : "sha256-vjRRhp79B0yaY8j3khAFlaySqCHDg+dzve+GHrWGnl8=", "openpgp.worker.js" : "sha256-bptSpAfg+LmItSpDYpTHITRqV1a27Ky9qb/ZF72QVu4=", "openpgp.worker.min.js" : "sha256-fiqa9O73V6FfqyTF/0I2kNYsd7Vc/fhQ6HiEPOxrnSw="}
json_instruct
{"type": "object", "properties": {"openpgp.js": {"type": "string"}, "openpgp.min.js": {"type": "string"}, "openpgp.worker.js": {"type": "string"}, "openpgp.worker.min.js": {"type": "string"}}, "required": ["openpgp.js", "openpgp.min.js", "openpgp.worker.js", "openpgp.worker.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "sideEffects": {"type": "boolean"}, "main": {"type": "string"}, "module": {"type": "string"}, "types": {"type": "string"}}, "required": ["name", "private", "sideEffects", "main", "module", "types"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "reakit-utils/fireEvent", "private" : true, "sideEffects" : false, "main" : "../lib/fireEvent", "module" : "../es/fireEvent", "types" : "../ts/fireEvent"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "private": {"type": "boolean"}, "sideEffects": {"type": "boolean"}, "main": {"type": "string"}, "module": {"type": "string"}, "types": {"type": "string"}}, "required": ["name", "private", "sideEffects", "main", "module", "types"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "license": {"type": "string"}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "files": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "keywords", "description", "repository", "license", "engines", "bugs", "files"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "cra-template-nimble", "version" : "2.1.0", "keywords" : ["react", "create-react-app", "template", "typescript", "nimble"], "description" : "The base template for Nimble React App.", "repository" : {"type" : "git", "url" : "https://github.com/nimblehq/react-templates.git"}, "license" : "MIT", "engines" : {"node" : "^14.18.2 || ^16 || ^17"}, "bugs" : {"url" : "https://github.com/nimblehq/react-templates/issues"}, "files" : ["template", "template.json"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "license": {"type": "string"}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "files": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "version", "keywords", "description", "repository", "license", "engines", "bugs", "files"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 99186, "cartId" : "ee467c61-309b-48e1-84d9-c7d6f125e90a", "preferredProducts" : [2380, 593, 1810, 3181, 3277, 1963, 216, 4680], "productReviews" : [{"productId" : 4368, "reviewText" : "one of my hobbies is programming. and when i'm programming this works great.", "reviewDate" : "2019-11-11T23:35:47.1619291+02:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "prepublishOnly": {"type": "string"}}, "required": ["test", "prepublishOnly"]}, "jest": {"type": "object", "properties": {"testMatch": {"type": "array", "items": {"type": "string"}}}, "required": ["testMatch"]}, "repository": {"type": "string"}, "author": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "private": {"type": "boolean"}, "devDependencies": {"type": "object", "properties": {"jest": {"type": "string"}, "prettier": {"type": "string"}}, "required": ["jest", "prettier"]}}, "required": ["name", "version", "description", "main", "files", "scripts", "jest", "repository", "author", "keywords", "license", "private", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@mitchreece/prettier-config", "version" : "1.0.0", "description" : "configuration for prettier code formatter", "main" : "index.js", "files" : ["index.js"], "scripts" : {"test" : "jest", "prepublishOnly" : "yarn test"}, "jest" : {"testMatch" : ["**/?(*.)+(spec|test).[jt]s?(x)"]}, "repository" : "git@github.com:mitchreece/front-end-toolkit.git", "author" : "Mitch Reece <mitchellreece18@gmail.com>", "keywords" : ["prettier", "config", "javascript"], "license" : "MIT", "private" : false, "devDependencies" : {"jest" : "^24.8.0", "prettier" : "^1.18.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "files": {"type": "array", "items": {"type": "string"}}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "prepublishOnly": {"type": "string"}}, "required": ["test", "prepublishOnly"]}, "jest": {"type": "object", "properties": {"testMatch": {"type": "array", "items": {"type": "string"}}}, "required": ["testMatch"]}, "repository": {"type": "string"}, "author": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "private": {"type": "boolean"}, "devDependencies": {"type": "object", "properties": {"jest": {"type": "string"}, "prettier": {"type": "string"}}, "required": ["jest", "prettier"]}}, "required": ["name", "version", "description", "main", "files", "scripts", "jest", "repository", "author", "keywords", "license", "private", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"id": {"type": "string"}, "version_id": {"type": "string"}, "version": {"type": "integer"}, "created_at": {"type": "string"}, "modified_at": {"type": "string"}, "type": {"type": "string"}, "body": {"type": "object", "properties": {"name": {"type": "string"}, "mmsi": {"type": "string"}, "imo": {"type": "string"}, "eni": {"type": "string"}, "callsign": {"type": "string"}, "shiptype": {"type": "string"}}, "required": ["name", "mmsi", "imo", "eni", "callsign", "shiptype"]}}, "required": ["id", "version_id", "version", "created_at", "modified_at", "type", "body"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "ae200793-ef1e-49da-a5fc-8a04c5be612f", "version_id" : "b6504b09-83c3-57fc-881a-ad5fc0c92912", "version" : 1, "created_at" : "2018-08-14T00:28:27.761Z", "modified_at" : "2018-08-14T00:28:27.761Z", "type" : "vessel", "body" : {"name" : "SZENT LASZLO", "mmsi" : "243071912", "imo" : "0", "eni" : "38601708", "callsign" : "HGSL", "shiptype" : "69"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "version_id": {"type": "string"}, "version": {"type": "integer"}, "created_at": {"type": "string"}, "modified_at": {"type": "string"}, "type": {"type": "string"}, "body": {"type": "object", "properties": {"name": {"type": "string"}, "mmsi": {"type": "string"}, "imo": {"type": "string"}, "eni": {"type": "string"}, "callsign": {"type": "string"}, "shiptype": {"type": "string"}}, "required": ["name", "mmsi", "imo", "eni", "callsign", "shiptype"]}}, "required": ["id", "version_id", "version", "created_at", "modified_at", "type", "body"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "author": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "string"}, "homepage": {"type": "string"}, "type": {"type": "string"}, "main": {"type": "string"}, "module": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "watch": {"type": "string"}, "test": {"type": "string"}}, "required": ["start", "watch", "test"]}, "devDependencies": {"type": "object", "properties": {"@open-wc/testing": {"type": "string"}, "@web/dev-server": {"type": "string"}, "@web/test-runner": {"type": "string"}, "@web/test-runner-commands": {"type": "string"}, "@web/test-runner-puppeteer": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-prettier": {"type": "string"}, "eslint-plugin-prettier": {"type": "string"}}, "required": ["@open-wc/testing", "@web/dev-server", "@web/test-runner", "@web/test-runner-commands", "@web/test-runner-puppeteer", "eslint", "eslint-config-prettier", "eslint-plugin-prettier"]}}, "required": ["name", "version", "description", "keywords", "license", "author", "repository", "bugs", "homepage", "type", "main", "module", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@savvywombat/accessible-web-components", "version" : "0.1.0", "description" : "A library of accessible web components", "keywords" : ["accessible", "web component", "accessible web component"], "license" : "MIT", "author" : "Stuart Jones <stuart@savvywombat.com.au>", "repository" : {"type" : "git", "url" : "git+https://github.com/savvywombat/accessible-web-components.git"}, "bugs" : "https://github.com/savvywombat/accessible-web-components/issues", "homepage" : "https://github.com/savvywombat/accessible-web-components#readme", "type" : "module", "main" : "src/index.js", "module" : "src/index.js", "scripts" : {"start" : "web-dev-server", "watch" : "web-dev-server --watch", "test" : "web-test-runner test/**/*.test.js --node-resolve --puppeteer"}, "devDependencies" : {"@open-wc/testing" : "^3.0.3", "@web/dev-server" : "^0.1.29", "@web/test-runner" : "^0.13.26", "@web/test-runner-commands" : "^0.6.1", "@web/test-runner-puppeteer" : "^0.10.5", "eslint" : "^8.7.0", "eslint-config-prettier" : "^8.3.0", "eslint-plugin-prettier" : "^4.0.0"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "license": {"type": "string"}, "author": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "string"}, "homepage": {"type": "string"}, "type": {"type": "string"}, "main": {"type": "string"}, "module": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "watch": {"type": "string"}, "test": {"type": "string"}}, "required": ["start", "watch", "test"]}, "devDependencies": {"type": "object", "properties": {"@open-wc/testing": {"type": "string"}, "@web/dev-server": {"type": "string"}, "@web/test-runner": {"type": "string"}, "@web/test-runner-commands": {"type": "string"}, "@web/test-runner-puppeteer": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-prettier": {"type": "string"}, "eslint-plugin-prettier": {"type": "string"}}, "required": ["@open-wc/testing", "@web/dev-server", "@web/test-runner", "@web/test-runner-commands", "@web/test-runner-puppeteer", "eslint", "eslint-config-prettier", "eslint-plugin-prettier"]}}, "required": ["name", "version", "description", "keywords", "license", "author", "repository", "bugs", "homepage", "type", "main", "module", "scripts", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 43330, "cartId" : "7ca5c1ac-e36a-4ef4-a179-1f6986840fce", "preferredProducts" : [1904, 3624, 492, 3426], "productReviews" : [{"productId" : 2434, "reviewText" : "talk about surprise!!!", "reviewDate" : "2020-05-02T19:14:11.5578847+03:00"}, {"productId" : 4508, "reviewText" : "one of my hobbies is hiking. and when i'm hiking this works great.", "reviewDate" : "2019-07-19T23:27:00.1364581+03:00"}, {"productId" : 3138, "reviewText" : "My neighbor Honora has one of these. She works as a reporter and she says it looks enormous.", "reviewDate" : "2018-08-23T21:40:48.3151355+03:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "6107160033", "district_id" : "6107160", "name" : "BULUK JEGARA"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 5561, "cartId" : "f4ba7521-d1c1-4f12-8c96-fe91fbbe5c08", "preferredProducts" : [4665, 3627, 2021, 3949, 1449, 4713, 827, 3638], "productReviews" : [{"productId" : 2492, "reviewText" : "I tried to scratch it but got cheeseburger all over it.", "reviewDate" : "2019-02-17T18:08:55.4159294+02:00"}, {"productId" : 1767, "reviewText" : "heard about this on balearic beat radio, decided to give it a try.", "reviewDate" : "2017-11-10T11:15:14.8341736+02:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"coords": {"type": "object", "properties": {"timestamp": {"type": "string"}, "lon": {"type": "integer"}, "hdg": {"type": "integer"}, "relative_alt": {"type": "integer"}, "lat": {"type": "integer"}, "alt": {"type": "integer"}}, "required": ["timestamp", "lon", "hdg", "relative_alt", "lat", "alt"]}, "data": {"type": "array", "items": {"type": "integer"}}}, "required": ["coords", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"coords" : {"timestamp" : "2017_04_22_10_40_20_030843", "lon" : 350786175, "hdg" : 12697, "relative_alt" : 1114400, "lat" : 326416438, "alt" : 891060}, "data" : [5045, 3290, 2125, 1330, 885, 700, 610, 470, 350, 295, 185, 135, 105, 90, 55, 36, 36, 16, 7, 4, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}
json_instruct
{"type": "object", "properties": {"coords": {"type": "object", "properties": {"timestamp": {"type": "string"}, "lon": {"type": "integer"}, "hdg": {"type": "integer"}, "relative_alt": {"type": "integer"}, "lat": {"type": "integer"}, "alt": {"type": "integer"}}, "required": ["timestamp", "lon", "hdg", "relative_alt", "lat", "alt"]}, "data": {"type": "array", "items": {"type": "integer"}}}, "required": ["coords", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"year" : 1963, "sex" : "F", "n" : 5, "prop" : 2.52e-06}, {"year" : 1964, "sex" : "F", "n" : 6, "prop" : 3.07e-06}, {"year" : 1965, "sex" : "F", "n" : 9, "prop" : 4.93e-06}, {"year" : 1968, "sex" : "F", "n" : 5, "prop" : 2.92e-06}, {"year" : 1970, "sex" : "F", "n" : 7, "prop" : 3.82e-06}, {"year" : 1971, "sex" : "F", "n" : 13, "prop" : 7.42e-06}, {"year" : 1973, "sex" : "F", "n" : 9, "prop" : 5.79e-06}, {"year" : 1975, "sex" : "F", "n" : 7, "prop" : 4.49e-06}, {"year" : 1976, "sex" : "F", "n" : 8, "prop" : 5.09e-06}, {"year" : 1977, "sex" : "F", "n" : 5, "prop" : 3.04e-06}, {"year" : 1978, "sex" : "F", "n" : 5, "prop" : 3.04e-06}, {"year" : 1979, "sex" : "F", "n" : 7, "prop" : 4.06e-06}, {"year" : 1981, "sex" : "F", "n" : 8, "prop" : 4.47e-06}, {"year" : 1985, "sex" : "F", "n" : 6, "prop" : 3.25e-06}, {"year" : 1986, "sex" : "F", "n" : 5, "prop" : 2.71e-06}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"372012": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "count": {"type": "integer"}, "419091": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "353031": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "412010": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "435081": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "N.A.//": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "413041": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "352010": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "519061": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "4520XX": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "1940YY": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}}, "required": ["372012", "count", "419091", "353031", "412010", "435081", "N.A.//", "413041", "352010", "519061", "4520XX", "1940YY"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"372012" : {"count" : 2}, "count" : 38, "419091" : {"count" : 1}, "353031" : {"count" : 2}, "412010" : {"count" : 2}, "435081" : {"count" : 2}, "N.A.//" : {"count" : 23}, "413041" : {"count" : 1}, "352010" : {"count" : 1}, "519061" : {"count" : 1}, "4520XX" : {"count" : 1}, "1940YY" : {"count" : 2}}
json_instruct
{"type": "object", "properties": {"372012": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "count": {"type": "integer"}, "419091": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "353031": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "412010": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "435081": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "N.A.//": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "413041": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "352010": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "519061": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "4520XX": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "1940YY": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}}, "required": ["372012", "count", "419091", "353031", "412010", "435081", "N.A.//", "413041", "352010", "519061", "4520XX", "1940YY"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"timestamp": {"type": "string"}, "data": {"type": "array", "items": {"type": "object", "properties": {"data_type": {"type": "string"}, "value": {"type": "string"}, "max": {"type": "string"}, "min": {"type": "string"}, "sd": {"type": "string"}}, "required": ["data_type", "value", "max", "min", "sd"]}}}, "required": ["timestamp", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"timestamp" : "2020-10-03T02:42:51Z", "data" : [{"data_type" : "pm10", "value" : "0.20", "max" : "1.00", "min" : "0.00", "sd" : "0.41"}, {"data_type" : "pm2.5", "value" : "0.20", "max" : "1.00", "min" : "0.00", "sd" : "0.41"}, {"data_type" : "pm1", "value" : "0.00", "max" : "0.00", "min" : "0.00", "sd" : "0.00"}, {"data_type" : "pm10", "value" : "0.00", "max" : "0.00", "min" : "0.00", "sd" : "0.00", "sensor" : 2}, {"data_type" : "pm2.5", "value" : "0.00", "max" : "0.00", "min" : "0.00", "sd" : "0.00", "sensor" : 2}, {"data_type" : "pm1", "value" : "0.00", "max" : "0.00", "min" : "0.00", "sd" : "0.00", "sensor" : 2}, {"data_type" : "noise", "value" : "30.88", "max" : "45.74", "min" : "27.76", "sd" : "1.47"}, {"data_type" : "illuminance", "value" : "52.00", "max" : "52.00", "min" : "52.00", "sd" : "0.00"}, {"data_type" : "irradiance", "value" : "0.00", "max" : "0.00", "min" : "0.00", "sd" : "0.00"}, {"data_type" : "temperature", "value" : "9.05", "max" : "9.08", "min" : "9.02", "sd" : "0.07"}, {"data_type" : "humidity", "value" : "81.33", "max" : "81.67", "min" : "81.05", "sd" : "0.28"}, {"data_type" : "presure", "value" : "692.13", "max" : "692.19", "min" : "692.06", "sd" : "0.13"}, {"data_type" : "voltage", "value" : "5.04", "max" : "5.05", "min" : "5.04", "sd" : "0.03"}, {"data_type" : "batery", "value" : "4.18", "max" : "4.18", "min" : "4.18", "sd" : "0.00"}, {"data_type" : "panel", "value" : "0.00", "max" : "0.03", "min" : "0.00", "sd" : "0.05"}]}
json_instruct
{"type": "object", "properties": {"timestamp": {"type": "string"}, "data": {"type": "array", "items": {"type": "object", "properties": {"data_type": {"type": "string"}, "value": {"type": "string"}, "max": {"type": "string"}, "min": {"type": "string"}, "sd": {"type": "string"}}, "required": ["data_type", "value", "max", "min", "sd"]}}}, "required": ["timestamp", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"address_components": {"type": "array", "items": {"type": "object", "properties": {"long_name": {"type": "string"}, "short_name": {"type": "string"}, "types": {"type": "array", "items": {"type": "string"}}}, "required": ["long_name", "short_name", "types"]}}, "formatted_address": {"type": "string"}, "geometry": {"type": "object", "properties": {"bounds": {"type": "object", "properties": {"northeast": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}, "southwest": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}}, "required": ["northeast", "southwest"]}, "location": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}, "location_type": {"type": "string"}, "viewport": {"type": "object", "properties": {"northeast": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}, "southwest": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}}, "required": ["northeast", "southwest"]}}, "required": ["bounds", "location", "location_type", "viewport"]}, "place_id": {"type": "string"}, "types": {"type": "array", "items": {"type": "string"}}}, "required": ["address_components", "formatted_address", "geometry", "place_id", "types"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"address_components" : [{"long_name" : "Ye\u015filhisar", "short_name" : "Ye\u015filhisar", "types" : ["locality", "political"]}, {"long_name" : "Ye\u015filhisar", "short_name" : "Ye\u015filhisar", "types" : ["administrative_area_level_2", "political"]}, {"long_name" : "Kayseri", "short_name" : "Kayseri", "types" : ["administrative_area_level_1", "political"]}, {"long_name" : "Turkey", "short_name" : "TR", "types" : ["country", "political"]}], "formatted_address" : "Ye\u015filhisar, Kayseri, Turkey", "geometry" : {"bounds" : {"northeast" : {"lat" : 38.362571, "lng" : 35.093421}, "southwest" : {"lat" : 38.3332361, "lng" : 35.07786000000001}}, "location" : {"lat" : 38.35616, "lng" : 35.085944}, "location_type" : "APPROXIMATE", "viewport" : {"northeast" : {"lat" : 38.362571, "lng" : 35.093421}, "southwest" : {"lat" : 38.3332361, "lng" : 35.07786000000001}}}, "place_id" : "ChIJgbhjUB43KhURNlC2OQZ8G4M", "types" : ["locality", "political"]}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"address_components": {"type": "array", "items": {"type": "object", "properties": {"long_name": {"type": "string"}, "short_name": {"type": "string"}, "types": {"type": "array", "items": {"type": "string"}}}, "required": ["long_name", "short_name", "types"]}}, "formatted_address": {"type": "string"}, "geometry": {"type": "object", "properties": {"bounds": {"type": "object", "properties": {"northeast": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}, "southwest": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}}, "required": ["northeast", "southwest"]}, "location": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}, "location_type": {"type": "string"}, "viewport": {"type": "object", "properties": {"northeast": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}, "southwest": {"type": "object", "properties": {"lat": {"type": "number"}, "lng": {"type": "number"}}, "required": ["lat", "lng"]}}, "required": ["northeast", "southwest"]}}, "required": ["bounds", "location", "location_type", "viewport"]}, "place_id": {"type": "string"}, "types": {"type": "array", "items": {"type": "string"}}}, "required": ["address_components", "formatted_address", "geometry", "place_id", "types"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "body": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "start": {"type": "integer"}, "end": {"type": "integer"}, "snapshot": {"type": "string"}, "state": {"type": "string"}, "author": {"type": "string"}, "space": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "votes": {"type": "integer"}, "votes_data": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "voter": {"type": "string"}, "created": {"type": "integer"}, "choice": {"type": "integer"}, "space": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}, "required": ["id", "voter", "created", "choice", "space"]}}}, "required": ["id", "title", "body", "choices", "start", "end", "snapshot", "state", "author", "space", "votes", "votes_data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "QmQHS3sMFGuT66kFZR478WriiS8EUr1VksDeQE2u9nHtkS", "title" : "Market LOGE through a YouTuber", "body" : "We've had a rough week and I think it's important we get some good exposure before listings to CMC and Coingecko.\n\nI think we should find a YouTuber involved in the crypto space who has a decent amount of subscribers. Obviously, the team needs to be careful with blowing their marketing wallet wod, so some might think this is premature. \nI'd argue that we need to get some momentum back for both the price and morale. \n\nI'm not sure how much it costs to have a big YouTuber to push a project so maybe a top 50 channel is out of the question. I've seen smaller channels with 15k + subscribers who might be affordable and get us decent exposure.\nExamples/suggestions would be: Crypto ZEUS, and Brandon10x\n\nThey're in the 20k range of subscribers and have a lot of vids about Safemoon (especially ZEUS) and this might be a good audience to hit (considering the LOGE is a fork of Safemoon) to attract some new buyers. ", "choices" : ["Yes, it's worth it", "No, its not worth it"], "start" : 1621054800, "end" : 1621177200, "snapshot" : "7421313", "state" : "closed", "author" : "0x11EC5D4D869FB993e85387a36F90802BdA0bfd23", "space" : {"id" : "lunadoge.eth", "name" : "LunaDoge"}, "votes" : 3, "votes_data" : [{"id" : "Qmbiey6mTKX2LbAVjFipGDP9b9tN3fMut36RRHUGZqndZr", "voter" : "0x69b16357F622ab53F2E18d262daf6311Ff0c6B23", "created" : 1621071852, "choice" : 1, "space" : {"id" : "lunadoge.eth"}}, {"id" : "QmcwLhT5ZyKJQBLhCrFgAgswBcS9s3qjXyyhbCpwF1MCRi", "voter" : "0xF2739583a8EAC971d25721e049BD5239782Ce22D", "created" : 1621070666, "choice" : 1, "space" : {"id" : "lunadoge.eth"}}, {"id" : "QmP7VwmBpqerB2UvkkxbkQ28C9CjnBgu3xEuTetAxd4Mvs", "voter" : "0x11EC5D4D869FB993e85387a36F90802BdA0bfd23", "created" : 1621055724, "choice" : 1, "space" : {"id" : "lunadoge.eth"}}]}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "body": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "start": {"type": "integer"}, "end": {"type": "integer"}, "snapshot": {"type": "string"}, "state": {"type": "string"}, "author": {"type": "string"}, "space": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "votes": {"type": "integer"}, "votes_data": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "voter": {"type": "string"}, "created": {"type": "integer"}, "choice": {"type": "integer"}, "space": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}, "required": ["id", "voter", "created", "choice", "space"]}}}, "required": ["id", "title", "body", "choices", "start", "end", "snapshot", "state", "author", "space", "votes", "votes_data"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Charbonni\u00e8res-les-Varennes", "dpt" : "Puy-de-D\u00f4me", "inscrits" : 1314, "abs" : 236, "votants" : 1078, "blancs" : 111, "nuls" : 32, "exp" : 935, "res" : [{"panneau" : "1", "voix" : 614}, {"panneau" : "2", "voix" : 321}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[125.375, 27.25], [125.375, 27.333333333333332], [125.5, 27.333333333333332], [125.5, 27.25], [125.375, 27.25]]]}, "properties" : {"code" : 402573, "url" : "http://madefor.github.io/0410/api/v1/402573.geojson", "view" : "https://github.com/madefor/0410/blob/gh-pages/api/v1/402573.geojson"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"uuid": {"type": "string"}, "children": {"type": "array", "items": {"type": "string"}}, "befores": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "status": {"type": "string"}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["name", "status", "start", "stop"]}}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["uuid", "children", "befores", "start", "stop"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"uuid" : "0a5ad5b1-235a-4a85-ae75-c07f618ce138", "children" : ["d5a5cbc8-745e-4bd8-91d8-2463249aaa8e"], "befores" : [{"name" : "gen", "status" : "passed", "start" : 1555196589619, "stop" : 1555196589990}], "start" : 1555196589619, "stop" : 1555196591461}
json_instruct
{"type": "object", "properties": {"uuid": {"type": "string"}, "children": {"type": "array", "items": {"type": "string"}}, "befores": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "status": {"type": "string"}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["name", "status", "start", "stop"]}}, "start": {"type": "integer"}, "stop": {"type": "integer"}}, "required": ["uuid", "children", "befores", "start", "stop"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"loss_data": {"type": "array", "items": {"type": "number"}}, "train_accs": {"type": "array", "items": {"type": "number"}}, "dev_accs": {"type": "array", "items": {"type": "number"}}, "test_accs": {"type": "array", "items": {"type": "number"}}}, "required": ["loss_data", "train_accs", "dev_accs", "test_accs"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"loss_data" : [3.320683717727661, 2.7862250804901123, 2.5551843643188477, 2.203528642654419, 1.9543778896331787, 1.7020726203918457, 1.386312484741211, 1.2587344646453857, 1.0853033065795898, 0.9232302904129028, 0.8159053325653076, 0.6797688007354736, 0.5956819653511047, 0.5242130160331726, 0.42910337448120117, 0.40007397532463074, 0.3875962793827057, 0.3590710163116455, 0.3205203115940094, 0.2391633540391922, 0.2735104560852051, 0.19796834886074066, 0.1739719659090042, 0.1649329662322998, 0.1654491275548935, 0.1556827425956726, 0.1330367624759674, 0.11888103932142258, 0.10112263262271881, 0.10232238471508026], "train_accs" : [0.939274404133563, 1.0], "dev_accs" : [0.8689282960678488, 1.0], "test_accs" : [0.04470198675496689, 0.47516556291390727]}
json_instruct
{"type": "object", "properties": {"loss_data": {"type": "array", "items": {"type": "number"}}, "train_accs": {"type": "array", "items": {"type": "number"}}, "dev_accs": {"type": "array", "items": {"type": "number"}}, "test_accs": {"type": "array", "items": {"type": "number"}}}, "required": ["loss_data", "train_accs", "dev_accs", "test_accs"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"author": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "date": {"type": "object", "properties": {"day": {"type": "integer"}, "full": {"type": "integer"}, "month": {"type": "integer"}, "week": {"type": "integer"}}, "required": ["day", "full", "month", "week"]}, "id": {"type": "string"}, "picture": {"type": "object", "properties": {"filesize": {"type": "integer"}, "fullUrl": {"type": "string"}, "hash": {"type": "string"}, "height": {"type": "integer"}, "lqip": {"type": "string"}, "url": {"type": "string"}, "width": {"type": "integer"}}, "required": ["filesize", "fullUrl", "hash", "height", "lqip", "url", "width"]}, "score": {"type": "object", "properties": {"comments": {"type": "integer"}, "downs": {"type": "integer"}, "ratio": {"type": "integer"}, "ups": {"type": "integer"}, "value": {"type": "integer"}}, "required": ["comments", "downs", "ratio", "ups", "value"]}, "subreddit": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "tags": {"type": "array", "items": {}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["author", "date", "id", "picture", "score", "subreddit", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"author" : {"id" : "t2_zkpeq", "name" : "jono40kstories"}, "date" : {"day" : 1621209600, "full" : 1621228083, "month" : 1619827200, "week" : 1621123200}, "id" : "t3_ne7c8t", "picture" : {"filesize" : 81460, "fullUrl" : "https://preview.redd.it/6owzmbxm5mz61.jpg?width=2896&format=pjpg&auto=webp&s=18e85c53f58f43614f93537f31d294f84bfd3a59", "hash" : "7fda9a7c54", "height" : 431, "lqip" : "data:image/jpg;base64,/9j/2wBDAAYEBQYFBAYGBQYHBwYIChAKCgkJChQODwwQFxQYGBcUFhYaHSUfGhsjHBYWICwgIyYnKSopGR8tMC0oMCUoKSj/2wBDAQcHBwoIChMKChMoGhYaKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCj/wAARCAALABADASIAAhEBAxEB/8QAFgABAQEAAAAAAAAAAAAAAAAABwUG/8QAJxAAAQMCBQIHAAAAAAAAAAAAAQIDBAYRAAUSITETYRRBQlFScZH/xAAVAQEBAAAAAAAAAAAAAAAAAAAAAf/EABURAQEAAAAAAAAAAAAAAAAAAAAR/9oADAMBAAIRAxEAPwCvnFXZqxTUVGQlydmSVjxUZKFXaa3Ic1BJHpI3I8/bGHrKrpU3oqiwXoMd5KiEyHdZeHyHbnfj8wpNNohwHZMZIQ60jWk8i4BtdJ2P0QcFNWRGGnGwhvZtrQi5J0JJvYX4FyTbvgkf/9k=", "url" : "https://preview.redd.it/6owzmbxm5mz61.jpg?width=640&crop=smart&auto=webp&s=0f85f09b713278974ee70c415eb61e5bba174f53", "width" : 640}, "score" : {"comments" : 19, "downs" : 0, "ratio" : 1, "ups" : 569, "value" : 569}, "subreddit" : {"id" : "t5_2xy5e", "name" : "TerrainBuilding"}, "tags" : [], "title" : "I made some dumpsters and garbage bags", "url" : "https://www.reddit.com/r/TerrainBuilding/comments/ne7c8t/i_made_some_dumpsters_and_garbage_bags/"}
json_instruct
{"type": "object", "properties": {"author": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "date": {"type": "object", "properties": {"day": {"type": "integer"}, "full": {"type": "integer"}, "month": {"type": "integer"}, "week": {"type": "integer"}}, "required": ["day", "full", "month", "week"]}, "id": {"type": "string"}, "picture": {"type": "object", "properties": {"filesize": {"type": "integer"}, "fullUrl": {"type": "string"}, "hash": {"type": "string"}, "height": {"type": "integer"}, "lqip": {"type": "string"}, "url": {"type": "string"}, "width": {"type": "integer"}}, "required": ["filesize", "fullUrl", "hash", "height", "lqip", "url", "width"]}, "score": {"type": "object", "properties": {"comments": {"type": "integer"}, "downs": {"type": "integer"}, "ratio": {"type": "integer"}, "ups": {"type": "integer"}, "value": {"type": "integer"}}, "required": ["comments", "downs", "ratio", "ups", "value"]}, "subreddit": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "tags": {"type": "array", "items": {}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["author", "date", "id", "picture", "score", "subreddit", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"images": {"type": "array", "items": {"type": "object", "properties": {"filename": {"type": "string"}, "idiom": {"type": "string"}, "scale": {"type": "string"}}, "required": ["filename", "idiom", "scale"]}}, "info": {"type": "object", "properties": {"author": {"type": "string"}, "version": {"type": "integer"}}, "required": ["author", "version"]}}, "required": ["images", "info"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"images" : [{"filename" : "ic_mood_bad_18pt.png", "idiom" : "universal", "scale" : "1x"}, {"filename" : "ic_mood_bad_18pt_2x.png", "idiom" : "universal", "scale" : "2x"}, {"filename" : "ic_mood_bad_18pt_3x.png", "idiom" : "universal", "scale" : "3x"}], "info" : {"author" : "xcode", "version" : 1}}
json_instruct
{"type": "object", "properties": {"images": {"type": "array", "items": {"type": "object", "properties": {"filename": {"type": "string"}, "idiom": {"type": "string"}, "scale": {"type": "string"}}, "required": ["filename", "idiom", "scale"]}}, "info": {"type": "object", "properties": {"author": {"type": "string"}, "version": {"type": "integer"}}, "required": ["author", "version"]}}, "required": ["images", "info"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"id": {"type": "string"}, "symbol": {"type": "string"}, "name": {"type": "string"}, "platforms": {"type": "object", "properties": {"polygon-pos": {"type": "string"}}, "required": ["polygon-pos"]}, "hashing_algorithm": {"type": "string"}, "categories": {"type": "array", "items": {"type": "string"}}, "description": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country_origin": {"type": "string"}, "genesis_date": {"type": "string"}, "contract_address": {"type": "string"}, "url": {"type": "string"}, "explorers": {"type": "array", "items": {"type": "string"}}, "twitter": {"type": "string"}, "github_org": {"type": "string"}}, "required": ["id", "symbol", "name", "platforms", "hashing_algorithm", "categories", "description", "country_origin", "genesis_date", "contract_address", "url", "explorers", "twitter", "github_org"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "ubiq", "symbol" : "ubq", "name" : "Ubiq", "platforms" : {"polygon-pos" : "0xb1c5c9b97b35592777091cd34ffff141ae866abd"}, "hashing_algorithm" : "Ubqhash", "categories" : ["Smart Contract Platform"], "description" : {"en" : "Ubiq is a decentralized platform which allows the creation and implementation of smart contracts and decentralized applications. Built upon an improved Ethereum codebase, the Ubiq blockchain acts as a large globally distributed ledger and supercomputer, allowing developers to create decentralized and automated solutions to thousands of tasks which today are carried out by third party intermediaries.\r\n\r\n"}, "country_origin" : "", "genesis_date" : "2017-01-28", "contract_address" : "0xb1c5c9b97b35592777091cd34ffff141ae866abd", "url" : "https://ubiqsmart.com/", "explorers" : ["https://ubiqscan.io/", "https://ubiq.cc/", "https://polygonscan.com/token/0xb1c5c9b97b35592777091cd34ffff141ae866abd"], "twitter" : "ubiqsmart", "github_org" : "ubiq"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "symbol": {"type": "string"}, "name": {"type": "string"}, "platforms": {"type": "object", "properties": {"polygon-pos": {"type": "string"}}, "required": ["polygon-pos"]}, "hashing_algorithm": {"type": "string"}, "categories": {"type": "array", "items": {"type": "string"}}, "description": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country_origin": {"type": "string"}, "genesis_date": {"type": "string"}, "contract_address": {"type": "string"}, "url": {"type": "string"}, "explorers": {"type": "array", "items": {"type": "string"}}, "twitter": {"type": "string"}, "github_org": {"type": "string"}}, "required": ["id", "symbol", "name", "platforms", "hashing_algorithm", "categories", "description", "country_origin", "genesis_date", "contract_address", "url", "explorers", "twitter", "github_org"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"name": {"type": "string"}, "url": {"type": "string"}, "maintainer": {"type": "string"}}, "required": ["name", "url", "maintainer"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Hass.io Addons (Edge) by einschmidt", "url" : "https://github.com/einschmidt/hassio-addons-edge", "maintainer" : "einschmidt"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "url": {"type": "string"}, "maintainer": {"type": "string"}}, "required": ["name", "url", "maintainer"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"ApplicationNames": {"type": "object", "properties": {"type": {"type": "string"}, "metadata": {"type": "object", "properties": {"displayName": {"type": "string"}, "description": {"type": "string"}}, "required": ["displayName", "description"]}}, "required": ["type", "metadata"]}}, "required": ["ApplicationNames"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ApplicationNames" : {"type" : "string", "metadata" : {"displayName" : "Application names", "description" : "Application names. Example: 'python', 'powershell', or a comma separated list such as 'python,powershell'."}}}
json_instruct
{"type": "object", "properties": {"ApplicationNames": {"type": "object", "properties": {"type": {"type": "string"}, "metadata": {"type": "object", "properties": {"displayName": {"type": "string"}, "description": {"type": "string"}}, "required": ["displayName", "description"]}}, "required": ["type", "metadata"]}}, "required": ["ApplicationNames"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
[["It", "ai", "n't", "no", "excuse", ",", "it", "'s", "the", "trutAnnotateh"], ["We", "never", "had", "a", "chance", "cause", "the", "enemy", "'s", "not", "human"], ["Bite", "off", "more", "than", "you", "could", "chew", "then"], ["Good", "and", "bad", "opportunities", ",", "I", "'ve", "ruined", "them", "both"], ["What", "you", "be", "about", ",", "Lord", "?", "''", "Aiyo", ",", "I", "be", "about", "Tiaamat", "'s", "law"], ["Before", "the", "Great", "Wall", "was", "destroyed", ".", "''"], ["Did", "n't", "wan", "na", "listen", "when", "I", "told", "you"], ["Now", "you", "eating", "soy", "bean", "tofu", ",", "look", "what", "you", "go", "through"], ["The", "faggot", "wants", "to", "be", "accepted", ",", "the", "Anti-Christ", "is", "erected"], ["China", "got", "two", "hundred", "and", "fifty", "quadrillion", "golden", "tons"], ["Drones", "in", "the", "sky", "filmin", "'", "terrorist", "training"], ["The", "white", "man", "'s", "mad", "because", "the", "white", "man", "is", "selling", "out", "the", "white", "man"], ["The", "Asian", "man", "got", "computers", "that", "do", "n't", "subtract", ",", "they", "just", "add", "up"], ["While", "the", "Arab", "man", "'ll", "still", "pull", "the", "dagger"], ["The", "rednecks", "from", "Santa", "Ana", "reach", "for", "they", "hammer"], ["Blam", ",", "Blam", ",", "Blamma", "look", "straight", "into", "the", "camera"], ["Jenny", "Lake", ",", "Wyoming", "camping", ",", "the", "stars", "are", "dancing"]]
json_instruct
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"hour positive count": {"type": "integer"}, "hour neutral count": {"type": "integer"}, "hour negative count": {"type": "integer"}, "hour distri": {"type": "object", "properties": {"1.0": {"type": "integer"}, "0.65": {"type": "integer"}, "0.55": {"type": "integer"}, "0.99": {"type": "integer"}, "0.93": {"type": "integer"}, "0.94": {"type": "integer"}, "0.07": {"type": "integer"}, "0.9": {"type": "integer"}, "0.98": {"type": "integer"}, "0.96": {"type": "integer"}, "0.64": {"type": "integer"}, "0.13": {"type": "integer"}, "0.01": {"type": "integer"}, "0.76": {"type": "integer"}}, "required": ["1.0", "0.65", "0.55", "0.99", "0.93", "0.94", "0.07", "0.9", "0.98", "0.96", "0.64", "0.13", "0.01", "0.76"]}}, "required": ["hour positive count", "hour neutral count", "hour negative count", "hour distri"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hour positive count" : 15, "hour neutral count" : 4, "hour negative count" : 3, "hour distri" : {"1.0" : 3, "0.65" : 1, "0.55" : 1, "0.99" : 5, "0.93" : 1, "0.94" : 1, "0.07" : 1, "0.9" : 1, "0.98" : 2, "0.96" : 2, "0.64" : 1, "0.13" : 1, "0.01" : 1, "0.76" : 1}}
json_instruct
{"type": "object", "properties": {"hour positive count": {"type": "integer"}, "hour neutral count": {"type": "integer"}, "hour negative count": {"type": "integer"}, "hour distri": {"type": "object", "properties": {"1.0": {"type": "integer"}, "0.65": {"type": "integer"}, "0.55": {"type": "integer"}, "0.99": {"type": "integer"}, "0.93": {"type": "integer"}, "0.94": {"type": "integer"}, "0.07": {"type": "integer"}, "0.9": {"type": "integer"}, "0.98": {"type": "integer"}, "0.96": {"type": "integer"}, "0.64": {"type": "integer"}, "0.13": {"type": "integer"}, "0.01": {"type": "integer"}, "0.76": {"type": "integer"}}, "required": ["1.0", "0.65", "0.55", "0.99", "0.93", "0.94", "0.07", "0.9", "0.98", "0.96", "0.64", "0.13", "0.01", "0.76"]}}, "required": ["hour positive count", "hour neutral count", "hour negative count", "hour distri"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 38063, "cartId" : "761f28d6-a783-466f-a18e-79c5da192b69", "preferredProducts" : [3901, 3276], "productReviews" : [{"productId" : 1395, "reviewText" : "I saw one of these in Tanzania and I bought one.", "reviewDate" : "2016-12-23T11:59:33.1280525+02:00"}, {"productId" : 3200, "reviewText" : "i use it until further notice when i'm in my nightclub.", "reviewDate" : "2016-12-29T17:18:31.1726058+02:00"}, {"productId" : 889, "reviewText" : "My co-worker Archer has one of these. He says it looks crooked.", "reviewDate" : "2018-05-12T09:35:39.7021879+03:00"}, {"productId" : 1128, "reviewText" : "heard about this on folktronica radio, decided to give it a try.", "reviewDate" : "2016-05-17T13:46:44.2342069+03:00"}, {"productId" : 4411, "reviewText" : "I saw one of these in Tanzania and I bought one.", "reviewDate" : "2016-05-14T10:00:50.2098361+03:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 ASNAWI.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 76611, "noUrut" : 1, "nama" : "ASNAWI, SE, M.Si", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 MILAH SUSANTI.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 77265, "noUrut" : 2, "nama" : "MILA SUSANTI, SE", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 SURAHBIL.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 84264, "noUrut" : 3, "nama" : "SURAHBIL", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 ABDUL RAHMAN.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 84904, "noUrut" : 4, "nama" : "ABDUL RAHMAN, S.Pd.I", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 KHAIRIANI.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 84412, "noUrut" : 5, "nama" : "KHAIRIYANI", "stringJenisKelamin" : "Perempuan"}, {"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 PENGKY.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 78952, "noUrut" : 6, "nama" : "PENGKY", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 ZAINAL ABIDIN.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 83701, "noUrut" : 7, "nama" : "ZAINAL ABIDIN, S.Pd.I", "stringJenisKelamin" : "Laki-Laki"}, {"namaKab" : "INDRAGIRI HILIR", "originalFilename" : "4 X 6 FIX 1000 YUSMANITA 2.jpg", "namaPartai" : "Partai Bulan Bintang", "id" : 122893, "noUrut" : 8, "nama" : "YUSMANITA", "stringJenisKelamin" : "Perempuan"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"namaKab": {"type": "string"}, "originalFilename": {"type": "string"}, "namaPartai": {"type": "string"}, "id": {"type": "integer"}, "noUrut": {"type": "integer"}, "nama": {"type": "string"}, "stringJenisKelamin": {"type": "string"}}, "required": ["namaKab", "originalFilename", "namaPartai", "id", "noUrut", "nama", "stringJenisKelamin"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"status_code": {"type": "integer"}, "data": {"type": "object", "properties": {"ResponseMetadata": {"type": "object", "properties": {"RequestId": {"type": "string"}, "HTTPStatusCode": {"type": "integer"}, "HTTPHeaders": {"type": "object", "properties": {"x-amzn-requestid": {"type": "string"}, "etag": {"type": "string"}, "content-type": {"type": "string"}, "content-length": {"type": "string"}, "vary": {"type": "string"}, "date": {"type": "string"}}, "required": ["x-amzn-requestid", "etag", "content-type", "content-length", "vary", "date"]}, "RetryAttempts": {"type": "integer"}}, "required": ["RequestId", "HTTPStatusCode", "HTTPHeaders", "RetryAttempts"]}, "ETag": {"type": "string"}, "Distribution": {"type": "object", "properties": {"Id": {"type": "string"}, "ARN": {"type": "string"}, "Status": {"type": "string"}, "DistributionConfig": {"type": "object", "properties": {"CallerReference": {"type": "string"}, "Comment": {"type": "string"}, "Logging": {"type": "object", "properties": {"Enabled": {"type": "boolean"}, "IncludeCookies": {"type": "boolean"}, "Bucket": {"type": "string"}, "Prefix": {"type": "string"}}, "required": ["Enabled", "IncludeCookies", "Bucket", "Prefix"]}, "Enabled": {"type": "boolean"}}, "required": ["CallerReference", "Comment", "Logging", "Enabled"]}}, "required": ["Id", "ARN", "Status", "DistributionConfig"]}}, "required": ["ResponseMetadata", "ETag", "Distribution"]}}, "required": ["status_code", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"status_code" : 200, "data" : {"ResponseMetadata" : {"RequestId" : "b1d631b0-64d2-4536-94d4-fde33b5e2042", "HTTPStatusCode" : 200, "HTTPHeaders" : {"x-amzn-requestid" : "b1d631b0-64d2-4536-94d4-fde33b5e2042", "etag" : "E51JMM89BDP7", "content-type" : "text/xml", "content-length" : "2757", "vary" : "Accept-Encoding", "date" : "Fri, 28 Feb 2020 17:58:16 GMT"}, "RetryAttempts" : 0}, "ETag" : "E51JMM89BDP7", "Distribution" : {"Id" : "E1FBPN9VF9FG4X", "ARN" : "arn:aws:cloudfront::12346789012:distribution/E1FBPN9VF9FG4X", "Status" : "InProgress", "DistributionConfig" : {"CallerReference" : "1582867337153", "Comment" : "", "Logging" : {"Enabled" : true, "IncludeCookies" : false, "Bucket" : "test-enable-logging-c7n.s3.amazonaws.com", "Prefix" : ""}, "Enabled" : true}}}}
json_instruct
{"type": "object", "properties": {"status_code": {"type": "integer"}, "data": {"type": "object", "properties": {"ResponseMetadata": {"type": "object", "properties": {"RequestId": {"type": "string"}, "HTTPStatusCode": {"type": "integer"}, "HTTPHeaders": {"type": "object", "properties": {"x-amzn-requestid": {"type": "string"}, "etag": {"type": "string"}, "content-type": {"type": "string"}, "content-length": {"type": "string"}, "vary": {"type": "string"}, "date": {"type": "string"}}, "required": ["x-amzn-requestid", "etag", "content-type", "content-length", "vary", "date"]}, "RetryAttempts": {"type": "integer"}}, "required": ["RequestId", "HTTPStatusCode", "HTTPHeaders", "RetryAttempts"]}, "ETag": {"type": "string"}, "Distribution": {"type": "object", "properties": {"Id": {"type": "string"}, "ARN": {"type": "string"}, "Status": {"type": "string"}, "DistributionConfig": {"type": "object", "properties": {"CallerReference": {"type": "string"}, "Comment": {"type": "string"}, "Logging": {"type": "object", "properties": {"Enabled": {"type": "boolean"}, "IncludeCookies": {"type": "boolean"}, "Bucket": {"type": "string"}, "Prefix": {"type": "string"}}, "required": ["Enabled", "IncludeCookies", "Bucket", "Prefix"]}, "Enabled": {"type": "boolean"}}, "required": ["CallerReference", "Comment", "Logging", "Enabled"]}}, "required": ["Id", "ARN", "Status", "DistributionConfig"]}}, "required": ["ResponseMetadata", "ETag", "Distribution"]}}, "required": ["status_code", "data"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "license": {"type": "string"}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "support": {"type": "object", "properties": {"email": {"type": "string"}, "source": {"type": "string"}, "issues": {"type": "string"}}, "required": ["email", "source", "issues"]}, "require": {"type": "object", "properties": {"php": {"type": "string"}}, "required": ["php"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}}, "required": ["phpunit/phpunit"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"RValidate\\": {"type": "string"}}, "required": ["RValidate\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "keywords", "type", "license", "homepage", "authors", "support", "require", "require-dev", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "z7zmey/rvalidate", "description" : "Recursive array validator", "keywords" : ["rvalidate", "matcher", "validation", "validate", "validator", "array", "schema", "pattern", "recursive", "nested", "complex", "z7zmey"], "type" : "library", "license" : "BSD", "homepage" : "https://github.com/z7zmey/RValidate", "authors" : [{"name" : "Vadim Slizov", "email" : "z7zmey@gmail.com"}], "support" : {"email" : "z7zmey@gmail.com", "source" : "https://github.com/z7zmey/RValidate", "issues" : "https://github.com/z7zmey/RValidate/issues"}, "require" : {"php" : ">=5.6"}, "require-dev" : {"phpunit/phpunit" : "4.5.*"}, "autoload" : {"psr-4" : {"RValidate\\" : "./src"}}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "license": {"type": "string"}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "support": {"type": "object", "properties": {"email": {"type": "string"}, "source": {"type": "string"}, "issues": {"type": "string"}}, "required": ["email", "source", "issues"]}, "require": {"type": "object", "properties": {"php": {"type": "string"}}, "required": ["php"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}}, "required": ["phpunit/phpunit"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"RValidate\\": {"type": "string"}}, "required": ["RValidate\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "keywords", "type", "license", "homepage", "authors", "support", "require", "require-dev", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"brief" : "good", "long" : "<i>Meaning:</i> \"good\" (as an adjective) in the widest sense; used likewise as a noun, both in the masculine and the feminine, the singular and the plural (good, a good or good thing, a good man or woman; the good, goods or good things, good men or women), also as an adverb (well).<br/><i>Usage:</i> beautiful, best, better, bountiful, cheerful, at ease, \u00d7 fair (word), (be in) favour, fine, glad, good (deed, -lier, -liest, -ly, -ness, -s), graciously, joyful, kindly, kindness, liketh (best), loving, merry, \u00d7 most, pleasant, pleaseth, pleasure, precious, prosperity, ready, sweet, wealth, welfare, (be) well(-favoured).<br/><i>Source:</i> from \"H2895\";"}
json_instruct
{"type": "object", "properties": {"brief": {"type": "string"}, "long": {"type": "string"}}, "required": ["brief", "long"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {}, "required": []}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"latest_version" : ["1.0.2"], "meta" : {"description" : "A patch for singing dancing that logs SMTP errors", "homepage" : "https://svn.ingeniweb.com/svn/ingeniweb/zope/projects/loreal/dpl-dt/marketsurfer/packages/patch.singingdancing", "license" : "GPL"}, "versions" : {}}
json_instruct
{"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {}, "required": []}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"subreddit": {"type": "string"}, "author": {"type": "string"}, "count": {"type": "integer"}}, "required": ["subreddit", "author", "count"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"subreddit" : "Chiraqology", "author" : "memofrm757", "count" : 103}
json_instruct
{"type": "object", "properties": {"subreddit": {"type": "string"}, "author": {"type": "string"}, "count": {"type": "integer"}}, "required": ["subreddit", "author", "count"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "files": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"adbkit": {"type": "string"}, "bluebird": {"type": "string"}, "debug": {"type": "string"}, "promise-socket": {"type": "string"}}, "required": ["adbkit", "bluebird", "debug", "promise-socket"]}, "devDependencies": {"type": "object", "properties": {"chai": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-airbnb-base": {"type": "string"}, "eslint-plugin-import": {"type": "string"}, "mocha": {"type": "string"}}, "required": ["chai", "eslint", "eslint-config-airbnb-base", "eslint-plugin-import", "mocha"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "files", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "scrcpy-client", "version" : "0.1.2", "description" : "Client for scrcpy android server ", "main" : "index.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1"}, "repository" : {"type" : "git", "url" : "git+https://github.com/jvictorsoto/node-scrcpy-client.git"}, "keywords" : ["scrcpy", "screenrecording", "android"], "files" : ["lib"], "author" : "J. Victor Soto", "license" : "MIT", "bugs" : {"url" : "https://github.com/jvictorsoto/node-scrcpy-client/issues"}, "homepage" : "https://github.com/jvictorsoto/node-scrcpy-client#readme", "dependencies" : {"adbkit" : "^2.11.0", "bluebird" : "^3.5.3", "debug" : "^4.1.1", "promise-socket" : "^3.1.1"}, "devDependencies" : {"chai" : "^4.2.0", "eslint" : "^5.14.1", "eslint-config-airbnb-base" : "^13.1.0", "eslint-plugin-import" : "^2.16.0", "mocha" : "^6.0.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "files": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "dependencies": {"type": "object", "properties": {"adbkit": {"type": "string"}, "bluebird": {"type": "string"}, "debug": {"type": "string"}, "promise-socket": {"type": "string"}}, "required": ["adbkit", "bluebird", "debug", "promise-socket"]}, "devDependencies": {"type": "object", "properties": {"chai": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-airbnb-base": {"type": "string"}, "eslint-plugin-import": {"type": "string"}, "mocha": {"type": "string"}}, "required": ["chai", "eslint", "eslint-config-airbnb-base", "eslint-plugin-import", "mocha"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "files", "author", "license", "bugs", "homepage", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "defaultMessage": {"type": "string"}, "file": {"type": "string"}, "start": {"type": "object", "properties": {"line": {"type": "integer"}, "column": {"type": "integer"}}, "required": ["line", "column"]}, "end": {"type": "object", "properties": {"line": {"type": "integer"}, "column": {"type": "integer"}}, "required": ["line", "column"]}}, "required": ["id", "defaultMessage", "file", "start", "end"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : "changeserver.headline", "defaultMessage" : "!!!Change server", "file" : "src/components/auth/ChangeServer.js", "start" : {"line" : 13, "column" : 12}, "end" : {"line" : 16, "column" : 3}}, {"id" : "changeserver.label", "defaultMessage" : "!!!Server", "file" : "src/components/auth/ChangeServer.js", "start" : {"line" : 17, "column" : 9}, "end" : {"line" : 20, "column" : 3}}, {"id" : "changeserver.warning", "defaultMessage" : "!!!Extra settings offered by Ferdi will not be saved", "file" : "src/components/auth/ChangeServer.js", "start" : {"line" : 21, "column" : 11}, "end" : {"line" : 24, "column" : 3}}, {"id" : "changeserver.customServerLabel", "defaultMessage" : "!!!Custom server", "file" : "src/components/auth/ChangeServer.js", "start" : {"line" : 25, "column" : 21}, "end" : {"line" : 28, "column" : 3}}, {"id" : "changeserver.urlError", "defaultMessage" : "!!!Enter a valid URL", "file" : "src/components/auth/ChangeServer.js", "start" : {"line" : 29, "column" : 12}, "end" : {"line" : 32, "column" : 3}}, {"id" : "changeserver.submit", "defaultMessage" : "!!!Submit", "file" : "src/components/auth/ChangeServer.js", "start" : {"line" : 33, "column" : 10}, "end" : {"line" : 36, "column" : 3}}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "defaultMessage": {"type": "string"}, "file": {"type": "string"}, "start": {"type": "object", "properties": {"line": {"type": "integer"}, "column": {"type": "integer"}}, "required": ["line", "column"]}, "end": {"type": "object", "properties": {"line": {"type": "integer"}, "column": {"type": "integer"}}, "required": ["line", "column"]}}, "required": ["id", "defaultMessage", "file", "start", "end"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01000286": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01000286"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Topology", "objects" : {"E01000286" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00001435", "LAD11CD" : "E09000003"}, "arcs" : [[0, 1, 2, 3]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00001436", "LAD11CD" : "E09000003"}, "arcs" : [[4, -3, 5]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00001439", "LAD11CD" : "E09000003"}, "arcs" : [[6, 7, 8, -1, 9]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00001440", "LAD11CD" : "E09000003"}, "arcs" : [[-7, 10]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00001444", "LAD11CD" : "E09000003"}, "arcs" : [[-6, -2, -9, 11]]}]}}, "arcs" : [[[4716, 7897], [-239, -1251], [741, -93], [22, 488], [718, -1167], [-494, 162], [-799, -2021]], [[4665, 4015], [-1080, -448]], [[3585, 3567], [-500, 2464], [-941, 75]], [[2144, 6106], [-411, 695], [586, 628], [-401, 456], [1144, 1651], [407, 463], [1247, -2102]], [[751, 2999], [-751, 1671], [1846, 767], [298, 669]], [[3585, 3567], [-1246, -368], [-390, -873], [-1198, 673]], [[9114, 5465], [-811, -1228], [-785, 216], [-437, -1034]], [[7081, 3419], [-780, -158]], [[6301, 3261], [-1022, -56], [-614, 810]], [[4716, 7897], [332, -431], [1604, 2064], [1391, -1937], [267, -1513], [804, -615]], [[9114, 5465], [387, -361], [-264, -533], [762, -518], [-428, -945], [-315, -941], [-1087, 634], [-150, 900], [-465, -741], [-473, 459]], [[6301, 3261], [18, -813], [-2391, -1449], [-388, -999], [-951, 898], [-258, -383], [-983, 1220], [-671, 628], [74, 636]]], "transform" : {"scale" : [1.0983770408797893e-06, 6.091902059498836e-07], "translate" : [-0.223580961157923, 51.645180012933594]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01000286": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01000286"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"$schema": {"type": "string"}, "title": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"id": {"type": "object", "properties": {"title": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "pattern": {"type": "string"}}, "required": ["title", "description", "type", "pattern"]}}, "required": ["id"]}, "required": {"type": "array", "items": {"type": "string"}}, "additionalProperties": {"type": "boolean"}}, "required": ["$schema", "title", "type", "properties", "required", "additionalProperties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"$schema" : "http://json-schema.org/draft-04/schema#", "title" : "Self-employment source of income", "type" : "object", "properties" : {"id" : {"title" : "ID", "description" : "The unique identifier of the savings account. For example, SAVKB2UVwUTBQGJ", "type" : "string", "pattern" : "^[A-Za-z0-9]{15}$"}}, "required" : ["id"], "additionalProperties" : false}
json_instruct
{"type": "object", "properties": {"$schema": {"type": "string"}, "title": {"type": "string"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"id": {"type": "object", "properties": {"title": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "pattern": {"type": "string"}}, "required": ["title", "description", "type", "pattern"]}}, "required": ["id"]}, "required": {"type": "array", "items": {"type": "string"}}, "additionalProperties": {"type": "boolean"}}, "required": ["$schema", "title", "type", "properties", "required", "additionalProperties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"citations" : [{"textCitation" : "[See releqg on Metamath](http://us.metamath.org/mpegif/releqg.html)"}], "names" : ["releqg"], "language" : "METAMATH_SET_MM", "lookupTerms" : ["#T_cR", "#T_wceq", "#T_cG", "#T_cqg", "#T_cS", "#T_wrel", "#T_cR"], "metaLanguage" : "METAMATH", "remarks" : " The left coset equivalence relation is a relation. (Contributed by Mario Carneiro, 14-Jun-2015.) ", "statement" : "releqg.r $e |- R = ( G ~QG S ) $.\nreleqg $p |- Rel R $."}
json_instruct
{"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"Title": {"type": "string"}, "Year": {"type": "string"}, "Rated": {"type": "string"}, "Released": {"type": "string"}, "Runtime": {"type": "string"}, "Genre": {"type": "string"}, "Director": {"type": "string"}, "Writer": {"type": "string"}, "Actors": {"type": "string"}, "Plot": {"type": "string"}, "Language": {"type": "string"}, "Country": {"type": "string"}, "Awards": {"type": "string"}, "Poster": {"type": "string"}, "Metascore": {"type": "string"}, "imdbRating": {"type": "string"}, "imdbVotes": {"type": "string"}, "imdbID": {"type": "string"}, "Type": {"type": "string"}, "Response": {"type": "string"}}, "required": ["Title", "Year", "Rated", "Released", "Runtime", "Genre", "Director", "Writer", "Actors", "Plot", "Language", "Country", "Awards", "Poster", "Metascore", "imdbRating", "imdbVotes", "imdbID", "Type", "Response"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Title" : "Bone Tomahawk", "Year" : "2015", "Rated" : "NOT RATED", "Released" : "19 Feb 2016", "Runtime" : "132 min", "Genre" : "Adventure, Drama, Horror", "Director" : "S. Craig Zahler", "Writer" : "S. Craig Zahler", "Actors" : "Kurt Russell, Patrick Wilson, Matthew Fox, Richard Jenkins", "Plot" : "Four men set out in the Wild West to rescue a group of captives from cannibalistic cave dwellers.", "Language" : "English", "Country" : "USA, UK", "Awards" : "5 wins & 19 nominations.", "Poster" : "http://ia.media-imdb.com/images/M/MV5BMzQ0MzE4OTUzMF5BMl5BanBnXkFtZTgwODAyNzI3NjE@._V1_SX300.jpg", "Metascore" : "72", "imdbRating" : "7.1", "imdbVotes" : "27,785", "imdbID" : "tt2494362", "Type" : "movie", "Response" : "True"}
json_instruct
{"type": "object", "properties": {"Title": {"type": "string"}, "Year": {"type": "string"}, "Rated": {"type": "string"}, "Released": {"type": "string"}, "Runtime": {"type": "string"}, "Genre": {"type": "string"}, "Director": {"type": "string"}, "Writer": {"type": "string"}, "Actors": {"type": "string"}, "Plot": {"type": "string"}, "Language": {"type": "string"}, "Country": {"type": "string"}, "Awards": {"type": "string"}, "Poster": {"type": "string"}, "Metascore": {"type": "string"}, "imdbRating": {"type": "string"}, "imdbVotes": {"type": "string"}, "imdbID": {"type": "string"}, "Type": {"type": "string"}, "Response": {"type": "string"}}, "required": ["Title", "Year", "Rated", "Released", "Runtime", "Genre", "Director", "Writer", "Actors", "Plot", "Language", "Country", "Awards", "Poster", "Metascore", "imdbRating", "imdbVotes", "imdbID", "Type", "Response"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "null"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "string"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 67556, "name" : "Maroon 5 Logo Button (Tumblr)", "description" : "An add to the first Maroon 5's dashboard theme.Change the Tumblr Logo on the top left of your dashboard for the best band ever mark. It looks gorgeous! Enjoy.", "user" : {"id" : 146007, "name" : "LuyDuarte", "email" : "redacted", "paypal_email" : null, "homepage" : null, "about" : null, "license" : null}, "updated" : "2012-06-13T20:59:22.000Z", "weekly_install_count" : 0, "total_install_count" : 531, "rating" : null, "after_screenshot_name" : "https://userstyles.org/style_screenshots/67556_after.jpeg?r=1588061121", "obsoleting_style_id" : null, "obsoleting_style_name" : null, "obsolete" : 0, "admin_delete_reason_id" : null, "obsoletion_message" : null, "screenshots" : null, "license" : null, "created" : "2012-06-13T20:59:22.000Z", "category" : "site", "raw_subcategory" : "tumblr", "subcategory" : "tumblr", "additional_info" : "Version 1.0\r\n|Instruction:\r\n - Click the installing button.\r\n|Important Info:\r\n - Make sure you have the needed plug-ins intalled on your browser.\r\n - Only for Google Chrome and Mozilla Firefox.\r\n - It's suggested that you use the Maroon 5 Dashboard Theme and Background as well.\r\n|Credits:\r\n*Photo by Google.\r\n*Photo editing by Luy Duarte (thesoapmaker.tumblr.com)", "style_tags" : [], "css" : "@namespace url(http://www.w3.org/1999/xhtml);\r\n\r\n@-moz-document url-prefix('http://www.tumblr.com/'), url-prefix('https://www.tumblr.com/') {\r\n\r\n#logo {height: 0 !important;\r\n\r\n width: 0 !important;\r\n\r\n\tpadding-left: 205px !important;\r\n\r\n\tpadding-top: 60px !important;\r\n\r\n\tbackground: url(http://img710.imageshack.us/img710/8996/ls6tu.png) no-repeat !important;}}\r\n\r\n\r\n\r\n/* By tumboy(http://tumboy.tumblr.com) */", "discussions" : [], "discussionsCount" : 0, "commentsCount" : 0, "userjs_url" : "/styles/userjs/67556/maroon-5-logo-button-tumblr.user.js", "style_settings" : []}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "description": {"type": "string"}, "user": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "email": {"type": "string"}, "paypal_email": {"type": "null"}, "homepage": {"type": "null"}, "about": {"type": "null"}, "license": {"type": "null"}}, "required": ["id", "name", "email", "paypal_email", "homepage", "about", "license"]}, "updated": {"type": "string"}, "weekly_install_count": {"type": "integer"}, "total_install_count": {"type": "integer"}, "rating": {"type": "null"}, "after_screenshot_name": {"type": "string"}, "obsoleting_style_id": {"type": "null"}, "obsoleting_style_name": {"type": "null"}, "obsolete": {"type": "integer"}, "admin_delete_reason_id": {"type": "null"}, "obsoletion_message": {"type": "null"}, "screenshots": {"type": "null"}, "license": {"type": "null"}, "created": {"type": "string"}, "category": {"type": "string"}, "raw_subcategory": {"type": "string"}, "subcategory": {"type": "string"}, "additional_info": {"type": "string"}, "style_tags": {"type": "array", "items": {}}, "css": {"type": "string"}, "discussions": {"type": "array", "items": {}}, "discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}, "userjs_url": {"type": "string"}, "style_settings": {"type": "array", "items": {}}}, "required": ["id", "name", "description", "user", "updated", "weekly_install_count", "total_install_count", "rating", "after_screenshot_name", "obsoleting_style_id", "obsoleting_style_name", "obsolete", "admin_delete_reason_id", "obsoletion_message", "screenshots", "license", "created", "category", "raw_subcategory", "subcategory", "additional_info", "style_tags", "css", "discussions", "discussionsCount", "commentsCount", "userjs_url", "style_settings"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "array", "items": {"type": "object", "properties": {"key": {"type": "string"}, "brand_id": {"type": "string"}, "series_id": {"type": "string"}, "value": {"type": "string"}, "nameL": {"type": "string"}, "price": {"type": "string"}, "year": {"type": "string"}, "max_year": {"type": "string"}, "min_year": {"type": "string"}}, "required": ["key", "brand_id", "series_id", "value", "nameL", "price", "year", "max_year", "min_year"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"key" : "23521", "brand_id" : "84", "series_id" : "866", "value" : "2014\u6b3e R.S. 2.0T \u8857\u7248", "nameL" : "2014\u6b3e \u6885\u7518\u5a1c R.S. 2.0T \u8857\u7248", "price" : "33.99", "year" : "2014", "max_year" : "2016", "min_year" : "2014"}, {"key" : "23522", "brand_id" : "84", "series_id" : "866", "value" : "2014\u6b3e R.S. 2.0T \u8d5b\u7248", "nameL" : "2014\u6b3e \u6885\u7518\u5a1c R.S. 2.0T \u8d5b\u7248", "price" : "35.99", "year" : "2014", "max_year" : "2016", "min_year" : "2014"}, {"key" : "13040", "brand_id" : "84", "series_id" : "866", "value" : "2011\u6b3e CC 2.0L CVT \u65f6\u5c1a\u5bfc\u822a\u7248", "nameL" : "2011\u6b3e \u6885\u7518\u5a1c CC 2.0L CVT \u65f6\u5c1a\u5bfc\u822a\u7248", "price" : "38.78", "year" : "2011", "max_year" : "2015", "min_year" : "2011"}, {"key" : "29008", "brand_id" : "84", "series_id" : "866", "value" : "2006\u6b3e SEDAN 2.0 4AT", "nameL" : "2006\u6b3e \u6885\u7518\u5a1c SEDAN 2.0 4AT", "price" : "19.5", "year" : "2006", "max_year" : "2010", "min_year" : "2005"}, {"key" : "29009", "brand_id" : "84", "series_id" : "866", "value" : "2006\u6b3e SEDAN 2.0 5MT", "nameL" : "2006\u6b3e \u6885\u7518\u5a1c SEDAN 2.0 5MT", "price" : "19.8", "year" : "2006", "max_year" : "2010", "min_year" : "2005"}, {"key" : "13045", "brand_id" : "84", "series_id" : "866", "value" : "2006\u6b3e ", "nameL" : "2006\u6b3e \u6885\u7518\u5a1c", "price" : "19.9", "year" : "2006", "max_year" : "2010", "min_year" : "2006"}, {"key" : "13046", "brand_id" : "84", "series_id" : "866", "value" : "2006\u6b3e CC \u786c\u9876\u655e\u7bf7\u8f66", "nameL" : "2006\u6b3e \u6885\u7518\u5a1c CC \u786c\u9876\u655e\u7bf7\u8f66", "price" : "37", "year" : "2006", "max_year" : "2010", "min_year" : "2005"}, {"key" : "29010", "brand_id" : "84", "series_id" : "866", "value" : "2004\u6b3e 1.6 Coupe", "nameL" : "2004\u6b3e \u6885\u7518\u5a1c 1.6 Coupe", "price" : "31", "year" : "2004", "max_year" : "2007", "min_year" : "2003"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"key": {"type": "string"}, "brand_id": {"type": "string"}, "series_id": {"type": "string"}, "value": {"type": "string"}, "nameL": {"type": "string"}, "price": {"type": "string"}, "year": {"type": "string"}, "max_year": {"type": "string"}, "min_year": {"type": "string"}}, "required": ["key", "brand_id", "series_id", "value", "nameL", "price", "year", "max_year", "min_year"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "id"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"name" : "Portugu\u00eas", "id" : "39ee8140-901a-4762-bfca-8260dea1310f"}, {"name" : "Desenvolvimento na web", "id" : "c23ce252-cf78-4b98-8c11-8769801aaf3a"}, {"name" : "Desenvolvimento para desktop", "id" : "a106f013-6e26-4f27-9a4b-01e9d76084e2"}, {"name" : "Desenvolvimento para dispositivos m\u00f3veis", "id" : "6e23d976-33ec-47e8-b22b-3727acd41862"}, {"name" : "Desenvolvimento de software", "id" : "6f86127d-6051-4a38-94bb-f7b475dde109"}, {"name" : "Programa\u00e7\u00e3o", "id" : "a59f1e4e-257b-4bd0-90c7-189c3efbf917"}, {"name" : "JavaScript", "id" : "b741fd1d-e96d-49b8-9f2d-03a631c33e04"}, {"name" : "Brasil", "id" : "988c8c1b-b991-4b66-9a6d-b36f60363f6d"}, {"name" : "LGBTQIA+", "id" : "8bbdb07d-df18-4f82-a928-04a9003e9a7e"}, {"name" : "Desenvolvimento de jogos", "id" : "f588bd74-e496-4d11-9169-3597f38a5d25"}, {"name" : "Sem palpites", "id" : "69318d09-f132-4853-b4b6-09a0580f7092"}, {"name" : "Bissexual", "id" : "ede26632-aa15-4a55-af9b-d2775b00c4c3"}, {"name" : "Relaxada", "id" : "81e9d348-82e5-4c4f-a140-d2b3779b912d"}, {"name" : "AMA", "id" : "67259b26-ff83-444e-9d3c-faab390df16f"}, {"name" : "PvP", "id" : "8486f56b-8677-44f7-8004-000295391524"}, {"name" : "PHP", "id" : "60a9f03f-4c87-4307-be57-31c85347f0b6"}, {"name" : "Para toda a fam\u00edlia", "id" : "e90b5f6e-4c6e-4003-885b-4d0d5adeb580"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "id": {"type": "string"}}, "required": ["name", "id"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"cpuInfo": {"type": "string"}, "lang": {"type": "string"}, "os": {"type": "string"}, "compiler": {"type": "string"}, "compilerVersion": {"type": "string"}, "test": {"type": "string"}, "code": {"type": "string"}, "input": {"type": "string"}, "timeMS": {"type": "number"}, "timeStdDevMS": {"type": "number"}, "memBytes": {"type": "integer"}, "cpuTimeMS": {"type": "number"}, "cpuTimeUserMS": {"type": "number"}, "cpuTimeKernelMS": {"type": "number"}, "githubRunId": {"type": "string"}, "buildLog": {"type": "object", "properties": {"compilerVersion": {"type": "string"}, "start": {"type": "string"}, "finished": {"type": "string"}, "durationMs": {"type": "integer"}}, "required": ["compilerVersion", "start", "finished", "durationMs"]}, "testLog": {"type": "object", "properties": {"runtimeVersion": {"type": "null"}, "start": {"type": "string"}, "finished": {"type": "string"}, "durationMs": {"type": "integer"}}, "required": ["runtimeVersion", "start", "finished", "durationMs"]}}, "required": ["cpuInfo", "lang", "os", "compiler", "compilerVersion", "test", "code", "input", "timeMS", "timeStdDevMS", "memBytes", "cpuTimeMS", "cpuTimeUserMS", "cpuTimeKernelMS", "githubRunId", "buildLog", "testLog"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"cpuInfo" : "[x86_64][2 cores] Intel(R) Xeon(R) Platinum 8272CL CPU @ 2.60GHz", "lang" : "rust", "os" : "linux", "compiler" : "rustc", "compilerVersion" : "nightly", "test" : "mandelbrot", "code" : "9-m.rs", "input" : "7000", "timeMS" : 367.0594, "timeStdDevMS" : 2.84197950790168, "memBytes" : 6586368, "cpuTimeMS" : 683.3332, "cpuTimeUserMS" : 683.3332, "cpuTimeKernelMS" : 0.0, "githubRunId" : "1771040648", "buildLog" : {"compilerVersion" : "rustc 1.60.0-nightly (08df8b81d 2022-01-30)", "start" : "2022-01-31T05:55:42.6635432+00:00", "finished" : "2022-01-31T05:55:48.2529478+00:00", "durationMs" : 5589}, "testLog" : {"runtimeVersion" : null, "start" : "2022-01-31T06:14:43.4783656+00:00", "finished" : "2022-01-31T06:14:43.4889091+00:00", "durationMs" : 10}}
json_instruct
{"type": "object", "properties": {"cpuInfo": {"type": "string"}, "lang": {"type": "string"}, "os": {"type": "string"}, "compiler": {"type": "string"}, "compilerVersion": {"type": "string"}, "test": {"type": "string"}, "code": {"type": "string"}, "input": {"type": "string"}, "timeMS": {"type": "number"}, "timeStdDevMS": {"type": "number"}, "memBytes": {"type": "integer"}, "cpuTimeMS": {"type": "number"}, "cpuTimeUserMS": {"type": "number"}, "cpuTimeKernelMS": {"type": "number"}, "githubRunId": {"type": "string"}, "buildLog": {"type": "object", "properties": {"compilerVersion": {"type": "string"}, "start": {"type": "string"}, "finished": {"type": "string"}, "durationMs": {"type": "integer"}}, "required": ["compilerVersion", "start", "finished", "durationMs"]}, "testLog": {"type": "object", "properties": {"runtimeVersion": {"type": "null"}, "start": {"type": "string"}, "finished": {"type": "string"}, "durationMs": {"type": "integer"}}, "required": ["runtimeVersion", "start", "finished", "durationMs"]}}, "required": ["cpuInfo", "lang", "os", "compiler", "compilerVersion", "test", "code", "input", "timeMS", "timeStdDevMS", "memBytes", "cpuTimeMS", "cpuTimeUserMS", "cpuTimeKernelMS", "githubRunId", "buildLog", "testLog"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"count": {"type": "integer"}, "252030": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "N.A.//": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "211010": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "132011": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "111021": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "411011": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "413099": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "251000": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "291141": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "211020": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}}, "required": ["count", "252030", "N.A.//", "211010", "132011", "111021", "411011", "413099", "251000", "291141", "211020"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"count" : 21, "252030" : {"count" : 1}, "N.A.//" : {"count" : 12}, "211010" : {"count" : 1}, "132011" : {"count" : 1}, "111021" : {"count" : 1}, "411011" : {"count" : 1}, "413099" : {"count" : 1}, "251000" : {"count" : 1}, "291141" : {"count" : 1}, "211020" : {"count" : 1}}
json_instruct
{"type": "object", "properties": {"count": {"type": "integer"}, "252030": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "N.A.//": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "211010": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "132011": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "111021": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "411011": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "413099": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "251000": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "291141": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "211020": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}}, "required": ["count", "252030", "N.A.//", "211010", "132011", "111021", "411011", "413099", "251000", "291141", "211020"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"cam/image_array": {"type": "string"}, "user/angle": {"type": "number"}, "user/throttle": {"type": "number"}, "user/mode": {"type": "string"}, "pos/pos_x": {"type": "number"}, "pos/pos_y": {"type": "number"}, "pos/pos_z": {"type": "number"}, "pos/speed": {"type": "number"}, "pos/cte": {"type": "number"}, "milliseconds": {"type": "integer"}}, "required": ["cam/image_array", "user/angle", "user/throttle", "user/mode", "pos/pos_x", "pos/pos_y", "pos/pos_z", "pos/speed", "pos/cte", "milliseconds"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"cam/image_array" : "4891_cam-image_array_.jpg", "user/angle" : 0.684, "user/throttle" : 0.394, "user/mode" : "user", "pos/pos_x" : 62.4779, "pos/pos_y" : 0.5543703, "pos/pos_z" : 80.87467, "pos/speed" : 10.00603, "pos/cte" : -3.922103, "milliseconds" : 260959}
json_instruct
{"type": "object", "properties": {"cam/image_array": {"type": "string"}, "user/angle": {"type": "number"}, "user/throttle": {"type": "number"}, "user/mode": {"type": "string"}, "pos/pos_x": {"type": "number"}, "pos/pos_y": {"type": "number"}, "pos/pos_z": {"type": "number"}, "pos/speed": {"type": "number"}, "pos/cte": {"type": "number"}, "milliseconds": {"type": "integer"}}, "required": ["cam/image_array", "user/angle", "user/throttle", "user/mode", "pos/pos_x", "pos/pos_y", "pos/pos_z", "pos/speed", "pos/cte", "milliseconds"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"station" : [{"pref_cd" : 1, "line_cd" : 11111, "line_name" : "JR\u65e5\u9ad8\u672c\u7dda", "station_cd" : 1111111, "station_g_cd" : 1111111, "station_name" : "\u539a\u8cc0", "lon" : 142.215896, "lat" : 42.430507}]}
json_instruct
{"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "country_code": {"type": "string"}, "name": {"type": "string"}, "parent_code": {"type": "null"}, "type": {"type": "string"}}, "required": ["code", "country_code", "name", "parent_code", "type"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"code" : "GL-KU", "country_code" : "GL", "name" : "Kommune Kujalleq", "parent_code" : null, "type" : "Municipality"}, {"code" : "GL-QA", "country_code" : "GL", "name" : "Qaasuitsup Kommunia", "parent_code" : null, "type" : "Municipality"}, {"code" : "GL-QE", "country_code" : "GL", "name" : "Qeqqata Kommunia", "parent_code" : null, "type" : "Municipality"}, {"code" : "GL-SM", "country_code" : "GL", "name" : "Kommuneqarfik Sermersooq", "parent_code" : null, "type" : "Municipality"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "country_code": {"type": "string"}, "name": {"type": "string"}, "parent_code": {"type": "null"}, "type": {"type": "string"}}, "required": ["code", "country_code", "name", "parent_code", "type"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"rows": {"type": "array", "items": {"type": "integer"}}}, "required": ["rows"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"rows" : [1, 2, 3, 42, 100]}
json_instruct
{"type": "object", "properties": {"rows": {"type": "array", "items": {"type": "integer"}}}, "required": ["rows"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[138.875, 24.083333333333332], [138.875, 24.166666666666668], [139.0, 24.166666666666668], [139.0, 24.083333333333332], [138.875, 24.083333333333332]]]}, "properties" : {"code" : 363817, "url" : "http://madefor.github.io/0410/api/v1/363817.geojson", "view" : "https://github.com/madefor/0410/blob/gh-pages/api/v1/363817.geojson"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "2D cardiac model viewer"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hash" : "0x8d370420af0b8ded1b86aa1f7a0cc2b8c95d2f3766733fc536cfcf4f2c734821", "parentHash" : "0x6f1bc35bc635cee42108a338f3194039ee2df0f2dc0f4442b5149831104e9eb0", "number" : 105392, "timestamp" : 1439886791, "nonce" : "0xd9c433ca6ad57d6b", "difficulty" : 4371811749766, "gasLimit" : {"_hex" : "0x2fefd8"}, "gasUsed" : {"_hex" : "0x0"}, "miner" : "0x790b8a3cE86E707ED0eD32bF89B3269692a23CC1", "extraData" : "0xd783010001844765746887676f312e342e32856c696e7578", "transactions" : []}
json_instruct
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"id": {"type": "string"}, "zone_id": {"type": "string"}, "entity_id": {"type": "string"}, "details": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "type": {"type": "string"}, "timeout": {"type": "integer"}, "period": {"type": "integer"}, "ip_addresses": {"type": "object", "properties": {"default": {"type": "string"}}, "required": ["default"]}, "target_alias": {"type": "string"}, "target_hostname": {"type": "null"}, "target_resolver": {"type": "null"}, "disabled": {"type": "boolean"}}, "required": ["id", "zone_id", "entity_id", "details", "type", "timeout", "period", "ip_addresses", "target_alias", "target_hostname", "target_resolver", "disabled"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "chPingGoogle", "zone_id" : "pzA", "entity_id" : "enAAAAIPV4", "details" : {"count" : 3}, "type" : "remote.ping", "timeout" : 15, "period" : 30, "ip_addresses" : {"default" : "google.com"}, "target_alias" : "default", "target_hostname" : null, "target_resolver" : null, "disabled" : false}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "zone_id": {"type": "string"}, "entity_id": {"type": "string"}, "details": {"type": "object", "properties": {"count": {"type": "integer"}}, "required": ["count"]}, "type": {"type": "string"}, "timeout": {"type": "integer"}, "period": {"type": "integer"}, "ip_addresses": {"type": "object", "properties": {"default": {"type": "string"}}, "required": ["default"]}, "target_alias": {"type": "string"}, "target_hostname": {"type": "null"}, "target_resolver": {"type": "null"}, "disabled": {"type": "boolean"}}, "required": ["id", "zone_id", "entity_id", "details", "type", "timeout", "period", "ip_addresses", "target_alias", "target_hostname", "target_resolver", "disabled"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "test": {"type": "string"}, "dev": {"type": "string"}}, "required": ["build", "test", "dev"]}, "author": {"type": "string"}, "license": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "devDependencies": {"type": "object", "properties": {"@grafana/ui": {"type": "string"}, "@grafana/data": {"type": "string"}, "@grafana/toolkit": {"type": "string"}}, "required": ["@grafana/ui", "@grafana/data", "@grafana/toolkit"]}}, "required": ["name", "version", "description", "scripts", "author", "license", "keywords", "repository", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "lapnap-tail-datasource", "version" : "0.0.1-dev", "description" : "Tail Files from grafana server", "scripts" : {"build" : "grafana-toolkit plugin:build", "test" : "grafana-toolkit plugin:test", "dev" : "grafana-toolkit plugin:dev"}, "author" : "ryantxu", "license" : "MIT", "keywords" : ["grafana", "tail", "datasource"], "repository" : {"type" : "git", "url" : "https://github.com/ryantxu/grafana-firebase-app.git"}, "devDependencies" : {"@grafana/ui" : "latest", "@grafana/data" : "latest", "@grafana/toolkit" : "next"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "test": {"type": "string"}, "dev": {"type": "string"}}, "required": ["build", "test", "dev"]}, "author": {"type": "string"}, "license": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "devDependencies": {"type": "object", "properties": {"@grafana/ui": {"type": "string"}, "@grafana/data": {"type": "string"}, "@grafana/toolkit": {"type": "string"}}, "required": ["@grafana/ui", "@grafana/data", "@grafana/toolkit"]}}, "required": ["name", "version", "description", "scripts", "author", "license", "keywords", "repository", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"shape": {"type": "string"}, "rotation": {"type": "integer"}, "hash": {"type": "integer"}, "points": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "center": {"type": "array", "items": {"type": "number"}}, "sides": {"type": "array", "items": {"type": "number"}}, "perimeter": {"type": "number"}, "angles": {"type": "array", "items": {"type": "number"}}, "area": {"type": "number"}}, "required": ["shape", "rotation", "hash", "points", "center", "sides", "perimeter", "angles", "area"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"shape" : "triangle", "rotation" : -152, "hash" : -6501577733816205095, "points" : [[71.66666666666666, 68.66666666666667], [156.66666666666666, 115.66666666666667], [71.66666666666666, 115.66666666666667]], "center" : [100.0, 100.0], "sides" : [97.12878049270464, 85.0, 47.0], "perimeter" : 229.12878049270464, "angles" : [28.94001269283935, 90.0, 61.05998730716065], "area" : 1997.5}
json_instruct
{"type": "object", "properties": {"shape": {"type": "string"}, "rotation": {"type": "integer"}, "hash": {"type": "integer"}, "points": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "center": {"type": "array", "items": {"type": "number"}}, "sides": {"type": "array", "items": {"type": "number"}}, "perimeter": {"type": "number"}, "angles": {"type": "array", "items": {"type": "number"}}, "area": {"type": "number"}}, "required": ["shape", "rotation", "hash", "points", "center", "sides", "perimeter", "angles", "area"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hash" : "0xf3d099a0b4f1574240686bfd9eb6a850580c68c1591f6375661cd5f4ef33e607", "parentHash" : "0x4685029a1a14e6be2781a61dc210661941db283a0f269de074309ba4b7ae7f3f", "number" : 109357, "timestamp" : 1439955195, "nonce" : "0xc5dd9c16b12b2678", "difficulty" : 4462463383847, "gasLimit" : {"_hex" : "0x2fefd8"}, "gasUsed" : {"_hex" : "0x0"}, "miner" : "0xe6A7a1d47ff21B6321162AEA7C6CB457D5476Bca", "extraData" : "0x476574682f76312e302e312d38326566323666362f6c696e75782f676f312e34", "transactions" : []}
json_instruct
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"eslint.options": {"type": "object", "properties": {"configFile": {"type": "string"}}, "required": ["configFile"]}}, "required": ["eslint.options"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"eslint.options" : {"configFile" : "./node_modules/@fpoumian/common/eslint-configs/node-standard/.eslintrc"}}
json_instruct
{"type": "object", "properties": {"eslint.options": {"type": "object", "properties": {"configFile": {"type": "string"}}, "required": ["configFile"]}}, "required": ["eslint.options"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"examine": {"type": "string"}}, "required": ["examine"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"examine" : "A most unlikely creature."}
json_instruct
{"type": "object", "properties": {"examine": {"type": "string"}}, "required": ["examine"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"organisation": {"type": "string"}, "geometry": {"type": "string"}, "geography": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}}, "required": ["organisation", "geometry", "geography", "name", "reference", "slug", "entity", "entry-date"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[-0.225539, 51.463578], [-0.225642, 51.46287], [-0.226129, 51.462922], [-0.226141, 51.462869], [-0.227446, 51.46303], [-0.227553, 51.462099], [-0.227559, 51.461751], [-0.227426, 51.461728], [-0.2274, 51.461432], [-0.22666, 51.46145], [-0.22669, 51.462053], [-0.226667, 51.462626], [-0.226311, 51.462623], [-0.226313, 51.462547], [-0.226071, 51.462529], [-0.226034, 51.462857], [-0.223605, 51.462647], [-0.222749, 51.462507], [-0.22251, 51.462442], [-0.222197, 51.462727], [-0.222985, 51.463006], [-0.223946, 51.463263], [-0.225532, 51.46363], [-0.225539, 51.463578]]]]}, "properties" : {"organisation" : "local-authority-eng:WND", "geometry" : "MULTIPOLYGON (((-0.225539 51.463578,-0.225642 51.462870,-0.226129 51.462922,-0.226141 51.462869,-0.227446 51.463030,-0.227553 51.462099,-0.227559 51.461751,-0.227426 51.461728,-0.227400 51.461432,-0.226660 51.461450,-0.226690 51.462053,-0.226667 51.462626,-0.226311 51.462623,-0.226313 51.462547,-0.226071 51.462529,-0.226034 51.462857,-0.223605 51.462647,-0.222749 51.462507,-0.222510 51.462442,-0.222197 51.462727,-0.222985 51.463006,-0.223946 51.463263,-0.225532 51.463630,-0.225539 51.463578)))", "geography" : "conservation-area:COA00000863", "name" : "Parkfields Cons Area COA00000863", "reference" : "COA00000863", "slug" : "/conservation-area/local-authority-eng/WND/COA00000863", "entity" : 474227, "entry-date" : "2020-09-04"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"organisation": {"type": "string"}, "geometry": {"type": "string"}, "geography": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}}, "required": ["organisation", "geometry", "geography", "name", "reference", "slug", "entity", "entry-date"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"default_registry": {"type": "string"}, "provider_repos": {"type": "array", "items": {"type": "string"}}, "enable_providers": {"type": "array", "items": {"type": "string"}}, "kind_cluster_name": {"type": "string"}}, "required": ["default_registry", "provider_repos", "enable_providers", "kind_cluster_name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"default_registry" : "public.ecr.aws/a4z9h2b1/cluster-api-provider-capc", "provider_repos" : [".."], "enable_providers" : ["cloudstack", "kubeadm-bootstrap", "kubeadm-control-plane"], "kind_cluster_name" : "capi-test"}
json_instruct
{"type": "object", "properties": {"default_registry": {"type": "string"}, "provider_repos": {"type": "array", "items": {"type": "string"}}, "enable_providers": {"type": "array", "items": {"type": "string"}}, "kind_cluster_name": {"type": "string"}}, "required": ["default_registry", "provider_repos", "enable_providers", "kind_cluster_name"], "$schema": "http://json-schema.org/draft-07/schema#"}