input
stringlengths
159
2.05k
output
stringlengths
5
10.3k
task
stringclasses
1 value
schema
stringlengths
100
1.99k
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {"type": "object", "properties": {"hash": {"type": "string"}, "blockHash": {"type": "string"}, "blockNumber": {"type": "integer"}, "transactionIndex": {"type": "integer"}, "confirmations": {"type": "null"}, "from": {"type": "string"}, "gasPrice": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "to": {"type": "string"}, "value": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "nonce": {"type": "integer"}, "data": {"type": "string"}, "r": {"type": "string"}, "s": {"type": "string"}, "v": {"type": "integer"}, "creates": {"type": "null"}, "raw": {"type": "string"}, "networkId": {"type": "integer"}, "chainId": {"type": "integer"}}, "required": ["hash", "blockHash", "blockNumber", "transactionIndex", "confirmations", "from", "gasPrice", "gasLimit", "to", "value", "nonce", "data", "r", "s", "v", "creates", "raw", "networkId", "chainId"]}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hash" : "0x735cb7d00f71c38186b24047390b7e83bcc09b6557d614adf4014e250e290b5b", "parentHash" : "0xd43a5d4c5eef4069a8b18127fb2ff441a7ca1809ad7d987531c559e657f0dda6", "number" : 68315, "timestamp" : 1439285908, "nonce" : "0xf4498f7cefd5b31e", "difficulty" : 2005525189505, "gasLimit" : {"_hex" : "0x2fefd8"}, "gasUsed" : {"_hex" : "0x5208"}, "miner" : "0xf927a40C8B7F6E07c5af7FA2155B4864a4112B13", "extraData" : "0x", "transactions" : [{"hash" : "0x0aeb4f889dd2354b1f4eab2d3363cebb9c21255a1de8416cd92d030a3b11c814", "blockHash" : "0x735cb7d00f71c38186b24047390b7e83bcc09b6557d614adf4014e250e290b5b", "blockNumber" : 68315, "transactionIndex" : 0, "confirmations" : null, "from" : "0x6747f922385c9a6F9cfDf095F34345257DD597bE", "gasPrice" : {"_hex" : "0xba43b7400"}, "gasLimit" : {"_hex" : "0x5208"}, "to" : "0x38ef6Be89CAf64f56788723650b028AfF968CF82", "value" : {"_hex" : "0x1fcbfa42bd6000"}, "nonce" : 49, "data" : "0x", "r" : "0x39d054ec4e0d85d405c5db128a43041e76bfc952785384344990f8bfe2342818", "s" : "0x004970413177233056d7dcae7576f6218a1ecdf746c66a783538d4697392327f", "v" : 27, "creates" : null, "raw" : "0xf86a31850ba43b74008252089438ef6be89caf64f56788723650b028aff968cf82871fcbfa42bd6000801ba039d054ec4e0d85d405c5db128a43041e76bfc952785384344990f8bfe23428189f4970413177233056d7dcae7576f6218a1ecdf746c66a783538d4697392327f", "networkId" : 0, "chainId" : 0}]}
json_instruct
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {"type": "object", "properties": {"hash": {"type": "string"}, "blockHash": {"type": "string"}, "blockNumber": {"type": "integer"}, "transactionIndex": {"type": "integer"}, "confirmations": {"type": "null"}, "from": {"type": "string"}, "gasPrice": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "to": {"type": "string"}, "value": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "nonce": {"type": "integer"}, "data": {"type": "string"}, "r": {"type": "string"}, "s": {"type": "string"}, "v": {"type": "integer"}, "creates": {"type": "null"}, "raw": {"type": "string"}, "networkId": {"type": "integer"}, "chainId": {"type": "integer"}}, "required": ["hash", "blockHash", "blockNumber", "transactionIndex", "confirmations", "from", "gasPrice", "gasLimit", "to", "value", "nonce", "data", "r", "s", "v", "creates", "raw", "networkId", "chainId"]}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"/": {"type": "integer"}, "/thankyou": {"type": "integer"}, "/publicity": {"type": "integer"}, "/portfolio": {"type": "integer"}}, "required": ["/", "/thankyou", "/publicity", "/portfolio"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"/" : 16937, "/thankyou" : 1073, "/publicity" : 380, "/portfolio" : 801}
json_instruct
{"type": "object", "properties": {"/": {"type": "integer"}, "/thankyou": {"type": "integer"}, "/publicity": {"type": "integer"}, "/portfolio": {"type": "integer"}}, "required": ["/", "/thankyou", "/publicity", "/portfolio"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"userId" : 73959, "cartId" : "923ecda4-6585-4a98-81c5-689dfbd72ec2", "preferredProducts" : [4411, 4433, 347, 2392, 1993, 1550, 1670, 4523], "productReviews" : [{"productId" : 3833, "reviewText" : "This Cape works certainly well. It perfectly improves my tennis by a lot.", "reviewDate" : "2018-07-12T21:51:59.8890902+03:00"}, {"productId" : 2352, "reviewText" : "My co-worker Houston has one of these. He says it looks invisible.", "reviewDate" : "2017-11-12T02:54:30.3977895+02:00"}, {"productId" : 2852, "reviewText" : "My velociraptor loves to play with it.", "reviewDate" : "2016-12-12T16:51:43.790593+02:00"}, {"productId" : 2911, "reviewText" : "I saw one of these in French Southern and Antarctic Lands and I bought one.", "reviewDate" : "2016-06-04T09:19:00.8960003+03:00"}]}
json_instruct
{"type": "object", "properties": {"userId": {"type": "integer"}, "cartId": {"type": "string"}, "preferredProducts": {"type": "array", "items": {"type": "integer"}}, "productReviews": {"type": "array", "items": {"type": "object", "properties": {"productId": {"type": "integer"}, "reviewText": {"type": "string"}, "reviewDate": {"type": "string"}}, "required": ["productId", "reviewText", "reviewDate"]}}}, "required": ["userId", "cartId", "preferredProducts", "productReviews"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"year" : 1969, "sex" : "M", "n" : 6, "prop" : 3.28e-06}, {"year" : 1970, "sex" : "M", "n" : 5, "prop" : 2.62e-06}, {"year" : 1972, "sex" : "M", "n" : 5, "prop" : 2.99e-06}, {"year" : 1974, "sex" : "M", "n" : 5, "prop" : 3.07e-06}, {"year" : 1975, "sex" : "M", "n" : 6, "prop" : 3.7e-06}, {"year" : 1980, "sex" : "M", "n" : 7, "prop" : 3.77e-06}, {"year" : 1981, "sex" : "M", "n" : 5, "prop" : 2.68e-06}, {"year" : 1982, "sex" : "M", "n" : 7, "prop" : 3.71e-06}, {"year" : 1985, "sex" : "M", "n" : 7, "prop" : 3.64e-06}, {"year" : 1986, "sex" : "M", "n" : 6, "prop" : 3.12e-06}, {"year" : 1987, "sex" : "M", "n" : 5, "prop" : 2.56e-06}, {"year" : 1988, "sex" : "M", "n" : 8, "prop" : 4e-06}, {"year" : 1996, "sex" : "M", "n" : 5, "prop" : 2.5e-06}, {"year" : 2008, "sex" : "M", "n" : 7, "prop" : 3.21e-06}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"year": {"type": "integer"}, "sex": {"type": "string"}, "n": {"type": "integer"}, "prop": {"type": "number"}}, "required": ["year", "sex", "n", "prop"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "defined": {"type": "object", "properties": {"spec": {"type": "object", "properties": {"title": {"type": "string"}, "url": {"type": "string"}}, "required": ["title", "url"]}, "fragment": {"type": "string"}, "href": {"type": "string"}}, "required": ["spec", "fragment", "href"]}, "extended": {"type": "array", "items": {}}, "inheritance": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "defined": {"type": "object", "properties": {"spec": {"type": "object", "properties": {"title": {"type": "string"}, "url": {"type": "string"}}, "required": ["title", "url"]}, "fragment": {"type": "string"}, "href": {"type": "string"}}, "required": ["spec", "fragment", "href"]}, "extended": {"type": "array", "items": {}}, "inheritance": {"type": "null"}, "includes": {"type": "array", "items": {}}}, "required": ["name", "type", "defined", "extended", "inheritance", "includes"]}, "includes": {"type": "array", "items": {}}}, "required": ["name", "type", "defined", "extended", "inheritance", "includes"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "CSPViolationReportBody", "type" : "interface", "defined" : {"spec" : {"title" : "Content Security Policy Level 3", "url" : "https://www.w3.org/TR/CSP3/"}, "fragment" : "[Exposed=Window]\ninterface CSPViolationReportBody : ReportBody {\n readonly attribute USVString documentURL;\n readonly attribute USVString? referrer;\n readonly attribute USVString? blockedURL;\n readonly attribute DOMString effectiveDirective;\n readonly attribute DOMString originalPolicy;\n readonly attribute USVString? sourceFile;\n readonly attribute DOMString? sample;\n readonly attribute SecurityPolicyViolationEventDisposition disposition;\n readonly attribute unsigned short statusCode;\n readonly attribute unsigned long? lineNumber;\n readonly attribute unsigned long? columnNumber;\n};", "href" : "https://w3c.github.io/webappsec-csp/#cspviolationreportbody"}, "extended" : [], "inheritance" : {"name" : "ReportBody", "type" : "interface", "defined" : {"spec" : {"title" : "Reporting API 1", "url" : "https://www.w3.org/TR/reporting-1/"}, "fragment" : "[Exposed=(Window,Worker)]\ninterface ReportBody {\n [Default] object toJSON();\n};", "href" : "https://w3c.github.io/reporting/#reportbody"}, "extended" : [], "inheritance" : null, "includes" : []}, "includes" : []}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "defined": {"type": "object", "properties": {"spec": {"type": "object", "properties": {"title": {"type": "string"}, "url": {"type": "string"}}, "required": ["title", "url"]}, "fragment": {"type": "string"}, "href": {"type": "string"}}, "required": ["spec", "fragment", "href"]}, "extended": {"type": "array", "items": {}}, "inheritance": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "defined": {"type": "object", "properties": {"spec": {"type": "object", "properties": {"title": {"type": "string"}, "url": {"type": "string"}}, "required": ["title", "url"]}, "fragment": {"type": "string"}, "href": {"type": "string"}}, "required": ["spec", "fragment", "href"]}, "extended": {"type": "array", "items": {}}, "inheritance": {"type": "null"}, "includes": {"type": "array", "items": {}}}, "required": ["name", "type", "defined", "extended", "inheritance", "includes"]}, "includes": {"type": "array", "items": {}}}, "required": ["name", "type", "defined", "extended", "inheritance", "includes"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"word" : "Underline", "definitions" : ["Draw a line under (a word or phrase) to give emphasis or indicate special type.", "Emphasize (something)"], "parts-of-speech" : "Verb"}
json_instruct
{"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"loss": {"type": "array", "items": {"type": "number"}}, "accuracy": {"type": "array", "items": {"type": "number"}}, "val_loss": {"type": "array", "items": {"type": "number"}}, "val_accuracy": {"type": "array", "items": {"type": "number"}}}, "required": ["loss", "accuracy", "val_loss", "val_accuracy"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"loss" : [0.6672849655151367, 0.6040412783622742, 0.575201690196991, 0.5469605326652527, 0.5191035866737366, 0.49214375019073486, 0.4664177894592285, 0.44201725721359253, 0.4188871681690216, 0.3971170485019684, 0.37663403153419495, 0.35732796788215637, 0.3392029106616974, 0.3222273290157318, 0.30619487166404724], "accuracy" : [0.5218673944473267, 0.8579253554344177, 0.9196932911872864, 0.9367152452468872, 0.9463217258453369, 0.9562652707099915, 0.9646077156066895, 0.9679784178733826, 0.9721918106079102, 0.9744670391082764, 0.9764894247055054, 0.9787646532058716, 0.9802814722061157, 0.9813769459724426, 0.9829779863357544], "val_loss" : [0.6160140037536621, 0.5805662274360657, 0.5515473484992981, 0.5222853422164917, 0.49415937066078186, 0.46718159317970276, 0.44130468368530273, 0.4173080027103424, 0.3944150507450104, 0.3736640214920044, 0.3532223105430603, 0.33445146679878235, 0.31664541363716125, 0.3004409074783325, 0.2851144075393677], "val_accuracy" : [0.6049822568893433, 0.9339095950126648, 0.9532283544540405, 0.9618709683418274, 0.9730554819107056, 0.978647768497467, 0.9796645641326904, 0.9822064638137817, 0.9827148914337158, 0.9832232594490051, 0.9842400550842285, 0.9847484230995178, 0.9852567911148071, 0.9857652187347412, 0.9862735867500305]}
json_instruct
{"type": "object", "properties": {"loss": {"type": "array", "items": {"type": "number"}}, "accuracy": {"type": "array", "items": {"type": "number"}}, "val_loss": {"type": "array", "items": {"type": "number"}}, "val_accuracy": {"type": "array", "items": {"type": "number"}}}, "required": ["loss", "accuracy", "val_loss", "val_accuracy"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"Make": {"type": "string"}, "Model": {"type": "string"}, "Orientation": {"type": "integer"}, "XResolution": {"type": "integer"}, "YResolution": {"type": "integer"}, "ModifyDate": {"type": "string"}, "YCbCrPositioning": {"type": "integer"}, "ExifOffset": {"type": "integer"}, "Compression": {"type": "integer"}, "ThumbnailOffset": {"type": "integer"}, "ThumbnailLength": {"type": "integer"}, "ExposureTime": {"type": "string"}, "FNumber": {"type": "number"}, "ExifVersion": {"type": "string"}, "DateTimeOriginal": {"type": "string"}, "CreateDate": {"type": "string"}, "CompressedBitsPerPixel": {"type": "integer"}, "ShutterSpeedValue": {"type": "string"}, "ExposureCompensation": {"type": "integer"}, "UserComment": {"type": "string"}, "FlashpixVersion": {"type": "string"}, "ExifImageWidth": {"type": "integer"}, "ExifImageHeight": {"type": "integer"}, "InteropOffset": {"type": "integer"}, "FocalPlaneXResolution": {"type": "number"}, "FocalPlaneYResolution": {"type": "number"}, "DigitalZoomRatio": {"type": "integer"}, "InteropIndex": {"type": "string"}, "InteropVersion": {"type": "string"}, "RelatedImageWidth": {"type": "integer"}, "RelatedImageHeight": {"type": "integer"}, "error": {"type": "string"}}, "required": ["Make", "Model", "Orientation", "XResolution", "YResolution", "ModifyDate", "YCbCrPositioning", "ExifOffset", "Compression", "ThumbnailOffset", "ThumbnailLength", "ExposureTime", "FNumber", "ExifVersion", "DateTimeOriginal", "CreateDate", "CompressedBitsPerPixel", "ShutterSpeedValue", "ExposureCompensation", "UserComment", "FlashpixVersion", "ExifImageWidth", "ExifImageHeight", "InteropOffset", "FocalPlaneXResolution", "FocalPlaneYResolution", "DigitalZoomRatio", "InteropIndex", "InteropVersion", "RelatedImageWidth", "RelatedImageHeight", "error"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Make" : "Canon", "Model" : "Canon PowerShot S60", "Orientation" : 1, "XResolution" : 180, "YResolution" : 180, "ModifyDate" : "2008:09:26 21:26:01", "YCbCrPositioning" : 1, "ExifOffset" : 196, "Compression" : 6, "ThumbnailOffset" : 2548, "ThumbnailLength" : 1394, "ExposureTime" : "1", "FNumber" : 2.8, "ExifVersion" : "2.2", "DateTimeOriginal" : "2008:09:26 21:26:01", "CreateDate" : "2008:09:26 21:26:01", "CompressedBitsPerPixel" : 3, "ShutterSpeedValue" : "0", "ExposureCompensation" : 0, "UserComment" : "", "FlashpixVersion" : "1", "ExifImageWidth" : 2592, "ExifImageHeight" : 1944, "InteropOffset" : 1870, "FocalPlaneXResolution" : 9159.010600706713, "FocalPlaneYResolution" : 9169.811320754718, "DigitalZoomRatio" : 1, "InteropIndex" : "R98", "InteropVersion" : "1", "RelatedImageWidth" : 2592, "RelatedImageHeight" : 1944, "error" : "\u0011\u0000\u0001\u0000\u0003...: Unable to extract Makernote information as it is in an unsupported or unrecognized format."}
json_instruct
{"type": "object", "properties": {"Make": {"type": "string"}, "Model": {"type": "string"}, "Orientation": {"type": "integer"}, "XResolution": {"type": "integer"}, "YResolution": {"type": "integer"}, "ModifyDate": {"type": "string"}, "YCbCrPositioning": {"type": "integer"}, "ExifOffset": {"type": "integer"}, "Compression": {"type": "integer"}, "ThumbnailOffset": {"type": "integer"}, "ThumbnailLength": {"type": "integer"}, "ExposureTime": {"type": "string"}, "FNumber": {"type": "number"}, "ExifVersion": {"type": "string"}, "DateTimeOriginal": {"type": "string"}, "CreateDate": {"type": "string"}, "CompressedBitsPerPixel": {"type": "integer"}, "ShutterSpeedValue": {"type": "string"}, "ExposureCompensation": {"type": "integer"}, "UserComment": {"type": "string"}, "FlashpixVersion": {"type": "string"}, "ExifImageWidth": {"type": "integer"}, "ExifImageHeight": {"type": "integer"}, "InteropOffset": {"type": "integer"}, "FocalPlaneXResolution": {"type": "number"}, "FocalPlaneYResolution": {"type": "number"}, "DigitalZoomRatio": {"type": "integer"}, "InteropIndex": {"type": "string"}, "InteropVersion": {"type": "string"}, "RelatedImageWidth": {"type": "integer"}, "RelatedImageHeight": {"type": "integer"}, "error": {"type": "string"}}, "required": ["Make", "Model", "Orientation", "XResolution", "YResolution", "ModifyDate", "YCbCrPositioning", "ExifOffset", "Compression", "ThumbnailOffset", "ThumbnailLength", "ExposureTime", "FNumber", "ExifVersion", "DateTimeOriginal", "CreateDate", "CompressedBitsPerPixel", "ShutterSpeedValue", "ExposureCompensation", "UserComment", "FlashpixVersion", "ExifImageWidth", "ExifImageHeight", "InteropOffset", "FocalPlaneXResolution", "FocalPlaneYResolution", "DigitalZoomRatio", "InteropIndex", "InteropVersion", "RelatedImageWidth", "RelatedImageHeight", "error"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "22", "provinceId" : "18", "regencyId" : "01", "name" : "Tanjung Sari"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"version": {"type": "object", "properties": {"triggerParameters": {"type": "array", "items": {"type": "string"}}}, "required": ["triggerParameters"]}}, "required": ["version"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"version" : {"triggerParameters" : ["vibrationStatus", "movementStatus", "vibrationSensitivity", "batteryVoltage", "degC"]}}
json_instruct
{"type": "object", "properties": {"version": {"type": "object", "properties": {"triggerParameters": {"type": "array", "items": {"type": "string"}}}, "required": ["triggerParameters"]}}, "required": ["version"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "manifest_version": {"type": "integer"}, "permissions": {"type": "array", "items": {"type": "string"}}, "background": {"type": "object", "properties": {"scripts": {"type": "array", "items": {"type": "string"}}, "persistent": {"type": "boolean"}}, "required": ["scripts", "persistent"]}, "content_scripts": {"type": "array", "items": {"type": "object", "properties": {"matches": {"type": "array", "items": {"type": "string"}}, "js": {"type": "array", "items": {"type": "string"}}, "run_at": {"type": "string"}}, "required": ["matches", "js", "run_at"]}}, "browser_action": {"type": "object", "properties": {"default_popup": {"type": "string"}, "default_icon": {"type": "object", "properties": {"16": {"type": "string"}, "32": {"type": "string"}, "48": {"type": "string"}, "128": {"type": "string"}}, "required": ["16", "32", "48", "128"]}}, "required": ["default_popup", "default_icon"]}, "icons": {"type": "object", "properties": {"16": {"type": "string"}, "32": {"type": "string"}, "48": {"type": "string"}, "128": {"type": "string"}}, "required": ["16", "32", "48", "128"]}, "web_accessible_resources": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "version", "manifest_version", "permissions", "background", "content_scripts", "browser_action", "icons", "web_accessible_resources"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "FL Assorted Cats", "description" : "Proudly display your feline companions in \"Fallen London\"!", "version" : "2.0", "manifest_version" : 2, "permissions" : ["storage"], "background" : {"scripts" : ["presets.js", "background.js"], "persistent" : false}, "content_scripts" : [{"matches" : ["https://www.fallenlondon.com/*"], "js" : ["content.js"], "run_at" : "document_start"}], "browser_action" : {"default_popup" : "popup.html", "default_icon" : {"16" : "/images/kitty-icon-16.png", "32" : "/images/kitty-icon-32.png", "48" : "/images/kitty-icon-48.png", "128" : "/images/kitty-icon-128.png"}}, "icons" : {"16" : "/images/kitty-icon-16.png", "32" : "/images/kitty-icon-32.png", "48" : "/images/kitty-icon-48.png", "128" : "/images/kitty-icon-128.png"}, "web_accessible_resources" : ["inject.js"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "manifest_version": {"type": "integer"}, "permissions": {"type": "array", "items": {"type": "string"}}, "background": {"type": "object", "properties": {"scripts": {"type": "array", "items": {"type": "string"}}, "persistent": {"type": "boolean"}}, "required": ["scripts", "persistent"]}, "content_scripts": {"type": "array", "items": {"type": "object", "properties": {"matches": {"type": "array", "items": {"type": "string"}}, "js": {"type": "array", "items": {"type": "string"}}, "run_at": {"type": "string"}}, "required": ["matches", "js", "run_at"]}}, "browser_action": {"type": "object", "properties": {"default_popup": {"type": "string"}, "default_icon": {"type": "object", "properties": {"16": {"type": "string"}, "32": {"type": "string"}, "48": {"type": "string"}, "128": {"type": "string"}}, "required": ["16", "32", "48", "128"]}}, "required": ["default_popup", "default_icon"]}, "icons": {"type": "object", "properties": {"16": {"type": "string"}, "32": {"type": "string"}, "48": {"type": "string"}, "128": {"type": "string"}}, "required": ["16", "32", "48", "128"]}, "web_accessible_resources": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "version", "manifest_version", "permissions", "background", "content_scripts", "browser_action", "icons", "web_accessible_resources"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Pagoda: Fine-Grained GPU Resource Virtualization for Narrow Tasks.", "fields" : ["pagoda", "posix threads", "task parallelism", "virtualization", "speedup"], "abstract" : "Massively multithreaded GPUs achieve high throughput by running thousands of threads in parallel. To fully utilize the hardware, workloads spawn work to the GPU in bulk by launching large tasks, where each task is a kernel that contains thousands of threads that occupy the entire GPU. GPUs face severe underutilization and their performance benefits vanish if the tasks are narrow, i.e., they contain This paper presents Pagoda, a runtime system that virtualizes GPU resources, using an OS-like daemon kernel called MasterKernel. Tasks are spawned from the CPU onto Pagoda as they become available, and are scheduled by the MasterKernel at the warp granularity. Experimental results demonstrate that Pagoda achieves a geometric mean speedup of 5.70x over PThreads running on a 20-core CPU, 1.51x over CUDA-HyperQ, and 1.69x over GeMTC, the state-of- the-art runtime GPU task scheduling system.", "citation" : "Citations (3)", "year" : "2017", "departments" : ["Purdue University", "Microsoft", "Purdue University", "Purdue University", "Purdue University"], "conf" : "ppopp", "authors" : ["Tsung Tai Yeh.....http://dblp.org/pers/hd/y/Yeh:Tsung_Tai", "Amit Sabne.....http://dblp.org/pers/hd/s/Sabne:Amit", "Putt Sakdhnagool.....http://dblp.org/pers/hd/s/Sakdhnagool:Putt", "Rudolf Eigenmann.....http://dblp.org/pers/hd/e/Eigenmann:Rudolf", "Timothy G. Rogers.....http://dblp.org/pers/hd/r/Rogers:Timothy_G="], "pages" : 14}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"sort_categories": {"type": "array", "items": {}}}, "required": ["sort_categories"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"sort_categories" : []}
json_instruct
{"type": "object", "properties": {"sort_categories": {"type": "array", "items": {}}}, "required": ["sort_categories"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "a7498ba2afea04dd554d40eee8f06f4cf8bfbe0d"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"type": {"type": "string"}, "title": {"type": "string"}, "id": {"type": "string"}, "bbox": {"type": "array", "items": {"type": "number"}}, "description": {"type": "string"}, "connectsWith": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "features": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}}, "required": ["type", "geometry", "properties"]}}}, "required": ["type", "title", "id", "bbox", "description", "connectsWith", "names", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "FeatureCollection", "title" : "Chyt(h)roi", "id" : "707496", "bbox" : [33.490691, 35.245772, 33.490691, 35.245772], "description" : "An ancient place, cited: BAtlas 72 C2 Chyt(h)roi", "connectsWith" : ["707498"], "names" : ["Chythroi", "Chytroi", "Kitrusi"], "features" : [{"type" : "Feature", "geometry" : {"type" : "Point", "coordinates" : [33.490691, 35.245772]}, "properties" : {"description" : "representative point"}}, {"geometry" : {"type" : "Point", "coordinates" : [33.490691, 35.245772]}, "id" : "darmc-location-12028", "type" : "Feature", "properties" : {"description" : "500K scale point location", "location_precision" : "precise", "title" : "DARMC location 12028", "link" : "http://pleiades.stoa.org/places/707496/darmc-location-12028"}}]}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "title": {"type": "string"}, "id": {"type": "string"}, "bbox": {"type": "array", "items": {"type": "number"}}, "description": {"type": "string"}, "connectsWith": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "features": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"description": {"type": "string"}}, "required": ["description"]}}, "required": ["type", "geometry", "properties"]}}}, "required": ["type", "title", "id", "bbox", "description", "connectsWith", "names", "features"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"72544": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "72543": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "72541": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "72542": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}}, "required": ["72544", "72543", "72541", "72542"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"72544" : {"nama" : "KAMBO", "dapil" : [73, 7303, 17311, 2737301]}, "72543" : {"nama" : "LATUPPA", "dapil" : [73, 7303, 17311, 2737301]}, "72541" : {"nama" : "MUNGKAJANG", "dapil" : [73, 7303, 17311, 2737301]}, "72542" : {"nama" : "MURANTE", "dapil" : [73, 7303, 17311, 2737301]}}
json_instruct
{"type": "object", "properties": {"72544": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "72543": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "72541": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}, "72542": {"type": "object", "properties": {"nama": {"type": "string"}, "dapil": {"type": "array", "items": {"type": "integer"}}}, "required": ["nama", "dapil"]}}, "required": ["72544", "72543", "72541", "72542"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"$schema": {"type": "string"}, "$id": {"type": "string"}, "title": {"type": "string"}, "definitions": {"type": "object", "properties": {"TargetServiceSchema": {"type": "object", "properties": {"$id": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "properties": {"type": "object", "properties": {"@type": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "description"]}, "@schemaLocation": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "description"]}}, "required": ["@type", "@schemaLocation"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$id", "type", "description", "properties", "required"]}}, "required": ["TargetServiceSchema"]}}, "required": ["$schema", "$id", "title", "definitions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"$schema" : "http://json-schema.org/draft-07/schema#", "$id" : "TargetServiceSchema.schema.json", "title" : "TargetServiceSchema", "definitions" : {"TargetServiceSchema" : {"$id" : "#TargetServiceSchema", "type" : "object", "description" : "The reference object to the schema and type of target service which is described by service specification", "properties" : {"@type" : {"type" : "string", "description" : "Class type of the target service"}, "@schemaLocation" : {"type" : "string", "description" : "This field provides a link to the schema describing the target service"}}, "required" : ["@type", "@schemaLocation"]}}}
json_instruct
{"type": "object", "properties": {"$schema": {"type": "string"}, "$id": {"type": "string"}, "title": {"type": "string"}, "definitions": {"type": "object", "properties": {"TargetServiceSchema": {"type": "object", "properties": {"$id": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "string"}, "properties": {"type": "object", "properties": {"@type": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "description"]}, "@schemaLocation": {"type": "object", "properties": {"type": {"type": "string"}, "description": {"type": "string"}}, "required": ["type", "description"]}}, "required": ["@type", "@schemaLocation"]}, "required": {"type": "array", "items": {"type": "string"}}}, "required": ["$id", "type", "description", "properties", "required"]}}, "required": ["TargetServiceSchema"]}}, "required": ["$schema", "$id", "title", "definitions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "require": {"type": "object", "properties": {"nexmo/client": {"type": "string"}}, "required": ["nexmo/client"]}}, "required": ["name", "description", "type", "authors", "require"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "charlottegalarpe/triune", "description" : "triuneapp", "type" : "project", "authors" : [{"name" : "Charlotte Faye Galarpe", "email" : "charlottefayemgalarpe@tua.edu.ph"}], "require" : {"nexmo/client" : "^1.3"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "type": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "require": {"type": "object", "properties": {"nexmo/client": {"type": "string"}}, "required": ["nexmo/client"]}}, "required": ["name", "description", "type", "authors", "require"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : "3205230003", "district_id" : "3205230", "name" : "SUKARAJA"}, {"id" : "3205230004", "district_id" : "3205230", "name" : "SUKAKARYA"}, {"id" : "3205230005", "district_id" : "3205230", "name" : "PAMEKARSARI"}, {"id" : "3205230006", "district_id" : "3205230", "name" : "SUKASENANG"}, {"id" : "3205230007", "district_id" : "3205230", "name" : "SUKARATU"}, {"id" : "3205230008", "district_id" : "3205230", "name" : "CIPICUNG"}, {"id" : "3205230009", "district_id" : "3205230", "name" : "BAGENDIT"}, {"id" : "3205230010", "district_id" : "3205230", "name" : "SUKAMUKTI"}, {"id" : "3205230011", "district_id" : "3205230", "name" : "BANYURESMI"}, {"id" : "3205230012", "district_id" : "3205230", "name" : "BINAKARYA"}, {"id" : "3205230013", "district_id" : "3205230", "name" : "DANGDEUR"}, {"id" : "3205230014", "district_id" : "3205230", "name" : "KARYASARI"}, {"id" : "3205230015", "district_id" : "3205230", "name" : "KARYAMUKTI"}, {"id" : "3205230016", "district_id" : "3205230", "name" : "CIMAREME"}, {"id" : "3205230017", "district_id" : "3205230", "name" : "SUKALAKSANA"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"text": {"type": "object", "properties": {"0": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "1": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "2": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "3": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "4": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}}, "required": ["0", "1", "2", "3", "4"]}}, "required": ["text"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"text" : {"0" : {"m1" : "\u062e\u0648\u0634 \u0622\u0646 \u0645\u0633\u062a\u06cc \u06a9\u0647 \u0628\u0627\u0634\u062f \u062f\u0648\u0633\u062a \u067e\u0646\u062f \u0622\u0645\u0648\u0632 \u0648 \u062f\u0634\u0645\u0646 \u0647\u0645", "m2" : "\u0645\u0644\u0627\u0645\u062a \u0630\u0631\u0647 \u0648\u0627\u0631 \u0627\u0632 \u062f\u0631 \u062f\u0631\u0648\u0646 \u0622\u06cc\u062f\u060c \u0627\u0632 \u0631\u0648\u0632\u0646 \u0647\u0645"}, "1" : {"m1" : "\u0647\u062c\u0648\u0645 \u06af\u0631\u06cc\u0647 \u0644\u062e\u062a\u06cc \u062f\u0627\u062f \u0628\u06cc\u0631\u0648\u0646 \u0627\u0632 \u062f\u0644 \u06af\u0631\u0645\u0645", "m2" : "\u06a9\u0647 \u062c\u0648\u06cc \u062f\u06cc\u062f\u0647 \u0622\u062a\u0634 \u062e\u06cc\u0632 \u0634\u062f\u060c \u062f\u0631\u06cc\u0627\u06cc \u062f\u0627\u0645\u0646 \u0647\u0645"}, "2" : {"m1" : "\u0634\u0648\u062f \u06af\u0644 \u062e\u0627\u0631 \u0631\u0647\u060c \u06af\u0631 \u0647\u0645\u0631\u0647 \u0635\u062f\u0642\u06cc \u0648 \u06af\u0631 \u0628\u06cc \u0627\u0648", "m2" : "\u0642\u062f\u0645 \u0628\u0631 \u06af\u0644 \u0646\u0647\u06cc\u060c \u0645\u0631\u0647\u0645 \u0628\u0647 \u0628\u0631 \u0647\u0645\u0631\u0627\u0647 \u0648 \u0633\u0648\u0632\u0646 \u0647\u0645"}, "3" : {"m1" : "\u0648\u0641\u0627 \u0627\u0632 \u0633\u0646\u06af \u062f\u0644 \u06cc\u0627\u0631\u0627\u0646 \u0646\u0647\u0627\u0646 \u0628\u0627\u06cc\u0633\u062a\u060c \u0627\u0645\u0627 \u0645\u0646", "m2" : "\u0646\u067e\u0648\u0634\u06cc\u062f\u0645 \u06a9\u0647 \u0639\u06cc\u0628\u0645 \u062f\u0648\u0633\u062a \u0645\u06cc \u062f\u0627\u0646\u0633\u062a \u0648 \u062f\u0634\u0645\u0646 \u0647\u0645"}, "4" : {"m1" : "\u0645\u06a9\u0646 \u0627\u0647\u0645\u0627\u0644 \u062f\u0631 \u0645\u06a9\u062a\u0648\u0628 \u0639\u0631\u0641\u06cc \u0628\u0631\u062f\u0646 \u0627\u06cc \u0642\u0627\u0635\u062f", "m2" : "\u0648\u0644\u06cc \u0628\u0646\u0634\u06cc\u0646 \u06a9\u0647 \u062d\u0633\u0631\u062a \u0646\u0627\u0645\u0647 \u0627\u06cc \u0627\u0646\u0634\u0627 \u06a9\u0646\u0645 \u0645\u0646 \u0647\u0645"}}}
json_instruct
{"type": "object", "properties": {"text": {"type": "object", "properties": {"0": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "1": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "2": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "3": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}, "4": {"type": "object", "properties": {"m1": {"type": "string"}, "m2": {"type": "string"}}, "required": ["m1", "m2"]}}, "required": ["0", "1", "2", "3", "4"]}}, "required": ["text"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"artist_id": {"type": "string"}, "artist_latitude": {"type": "number"}, "artist_location": {"type": "string"}, "artist_longitude": {"type": "number"}, "artist_name": {"type": "string"}, "duration": {"type": "number"}, "num_songs": {"type": "integer"}, "song_id": {"type": "string"}, "title": {"type": "string"}, "year": {"type": "integer"}}, "required": ["artist_id", "artist_latitude", "artist_location", "artist_longitude", "artist_name", "duration", "num_songs", "song_id", "title", "year"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"artist_id" : "AR59GKK1187FB4B92F", "artist_latitude" : 45.4215, "artist_location" : "Ottawa, Ontario, Canada", "artist_longitude" : -75.69189, "artist_name" : "The Acorn", "duration" : 185.46893, "num_songs" : 1, "song_id" : "SOODRGN12A58A7CB01", "title" : "Plateau Ramble", "year" : 2007}
json_instruct
{"type": "object", "properties": {"artist_id": {"type": "string"}, "artist_latitude": {"type": "number"}, "artist_location": {"type": "string"}, "artist_longitude": {"type": "number"}, "artist_name": {"type": "string"}, "duration": {"type": "number"}, "num_songs": {"type": "integer"}, "song_id": {"type": "string"}, "title": {"type": "string"}, "year": {"type": "integer"}}, "required": ["artist_id", "artist_latitude", "artist_location", "artist_longitude", "artist_name", "duration", "num_songs", "song_id", "title", "year"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"cas": {"type": "string"}, "cid": {"type": "integer"}, "iupac_name": {"type": "string"}, "canonical_smiles": {"type": "string"}, "isomeric_smiles": {"type": "string"}, "inchi": {"type": "string"}, "inchikey": {"type": "string"}, "molecular_formula": {"type": "string"}, "properties": {"type": "object", "properties": {"flash_point": {"type": "object", "properties": {"value": {"type": "number"}, "source": {"type": "string"}}, "required": ["value", "source"]}}, "required": ["flash_point"]}}, "required": ["cas", "cid", "iupac_name", "canonical_smiles", "isomeric_smiles", "inchi", "inchikey", "molecular_formula", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"cas" : "4431-82-7", "cid" : 138239, "iupac_name" : "ethoxymethoxymethoxymethoxyethane", "canonical_smiles" : "CCOCOCOCOCC", "isomeric_smiles" : "CCOCOCOCOCC", "inchi" : "1S/C7H16O4/c1-3-8-5-10-7-11-6-9-4-2/h3-7H2,1-2H3", "inchikey" : "BCJWVBNBMCOBEX-UHFFFAOYSA-N", "molecular_formula" : "C7H16O4", "properties" : {"flash_point" : {"value" : 68.0, "source" : "Co-Optima DB"}}}
json_instruct
{"type": "object", "properties": {"cas": {"type": "string"}, "cid": {"type": "integer"}, "iupac_name": {"type": "string"}, "canonical_smiles": {"type": "string"}, "isomeric_smiles": {"type": "string"}, "inchi": {"type": "string"}, "inchikey": {"type": "string"}, "molecular_formula": {"type": "string"}, "properties": {"type": "object", "properties": {"flash_point": {"type": "object", "properties": {"value": {"type": "number"}, "source": {"type": "string"}}, "required": ["value", "source"]}}, "required": ["flash_point"]}}, "required": ["cas", "cid", "iupac_name", "canonical_smiles", "isomeric_smiles", "inchi", "inchikey", "molecular_formula", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"eleventy": {"type": "string"}, "sass": {"type": "string"}, "start": {"type": "string"}}, "required": ["eleventy", "sass", "start"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@11ty/eleventy": {"type": "string"}, "sass": {"type": "string"}}, "required": ["@11ty/eleventy", "sass"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "eleventy2", "version" : "1.0.0", "description" : "session 8", "main" : "index.js", "scripts" : {"eleventy" : "eleventy --serve", "sass" : "sass ignore/scss/styles.scss static/css/styles.css --watch --source-map --style=compressed", "start" : "npm run eleventy & npm run sass"}, "keywords" : [], "author" : "", "license" : "ISC", "devDependencies" : {"@11ty/eleventy" : "^0.7.1", "sass" : "^1.17.3"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"eleventy": {"type": "string"}, "sass": {"type": "string"}, "start": {"type": "string"}}, "required": ["eleventy", "sass", "start"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@11ty/eleventy": {"type": "string"}, "sass": {"type": "string"}}, "required": ["@11ty/eleventy", "sass"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"author": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "false_positives": {"type": "array", "items": {"type": "string"}}, "from": {"type": "string"}, "index": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "license": {"type": "string"}, "name": {"type": "string"}, "query": {"type": "string"}, "references": {"type": "array", "items": {"type": "string"}}, "risk_score": {"type": "integer"}, "rule_id": {"type": "string"}, "severity": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "threat": {"type": "array", "items": {"type": "object", "properties": {"framework": {"type": "string"}, "tactic": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}}, "required": ["id", "name", "reference"]}, "technique": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}}, "required": ["id", "name", "reference"]}}}, "required": ["framework", "tactic", "technique"]}}, "type": {"type": "string"}, "version": {"type": "integer"}}, "required": ["author", "description", "false_positives", "from", "index", "language", "license", "name", "query", "references", "risk_score", "rule_id", "severity", "tags", "threat", "type", "version"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"author" : ["Elastic"], "description" : "An adversary can establish persistence by installing a new launch agent that executes at login by using launchd or launchctl to load a plist into the appropriate directories.", "false_positives" : ["Trusted applications persisting via LaunchAgent"], "from" : "now-9m", "index" : ["auditbeat-*", "logs-endpoint.events.*"], "language" : "eql", "license" : "Elastic License", "name" : "Launch Agent Creation or Modification and Immediate Loading", "query" : "sequence by host.id with maxspan=1m\n [file where event.type != \"deletion\" and \n file.path : (\"/System/Library/LaunchAgents/*\", \"/Library/LaunchAgents/*\", \"/Users/*/Library/LaunchAgents/*\")\n ]\n [process where event.type in (\"start\", \"process_started\") and process.name == \"launchctl\" and process.args == \"load\"]\n", "references" : ["https://developer.apple.com/library/archive/documentation/MacOSX/Conceptual/BPSystemStartup/Chapters/CreatingLaunchdJobs.html"], "risk_score" : 21, "rule_id" : "082e3f8c-6f80-485c-91eb-5b112cb79b28", "severity" : "low", "tags" : ["Elastic", "Host", "macOS", "Threat Detection", "Persistence"], "threat" : [{"framework" : "MITRE ATT&CK", "tactic" : {"id" : "TA0003", "name" : "Persistence", "reference" : "https://attack.mitre.org/tactics/TA0003/"}, "technique" : [{"id" : "T1159", "name" : "Launch Agent", "reference" : "https://attack.mitre.org/techniques/T1159/"}]}], "type" : "eql", "version" : 1}
json_instruct
{"type": "object", "properties": {"author": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "false_positives": {"type": "array", "items": {"type": "string"}}, "from": {"type": "string"}, "index": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "license": {"type": "string"}, "name": {"type": "string"}, "query": {"type": "string"}, "references": {"type": "array", "items": {"type": "string"}}, "risk_score": {"type": "integer"}, "rule_id": {"type": "string"}, "severity": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "threat": {"type": "array", "items": {"type": "object", "properties": {"framework": {"type": "string"}, "tactic": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}}, "required": ["id", "name", "reference"]}, "technique": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "reference": {"type": "string"}}, "required": ["id", "name", "reference"]}}}, "required": ["framework", "tactic", "technique"]}}, "type": {"type": "string"}, "version": {"type": "integer"}}, "required": ["author", "description", "false_positives", "from", "index", "language", "license", "name", "query", "references", "risk_score", "rule_id", "severity", "tags", "threat", "type", "version"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Fouqui\u00e8res-l\u00e8s-B\u00e9thune", "circ" : "9\u00e8me circonscription", "dpt" : "Pas-de-Calais", "inscrits" : 845, "abs" : 359, "votants" : 486, "blancs" : 39, "nuls" : 12, "exp" : 435, "res" : [{"nuance" : "MDM", "nom" : "Mme Marguerite DEPREZ-AUDEBERT", "voix" : 292}, {"nuance" : "FN", "nom" : "M. Jacques DELAIRE", "voix" : 143}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"variants": {"type": "object", "properties": {"age=0": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=1": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=2": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=3": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=4": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=5": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=6": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=7": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": ["age=0", "age=1", "age=2", "age=3", "age=4", "age=5", "age=6", "age=7"]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"variants" : {"age=0" : {"model" : "pokecube:block/berrycrop"}, "age=1" : {"model" : "pokecube:block/crop_rowap_1"}, "age=2" : {"model" : "pokecube:block/crop_rowap_2"}, "age=3" : {"model" : "pokecube:block/crop_rowap_3"}, "age=4" : {"model" : "pokecube:block/crop_rowap_4"}, "age=5" : {"model" : "pokecube:block/crop_rowap_5"}, "age=6" : {"model" : "pokecube:block/crop_rowap_6"}, "age=7" : {"model" : "pokecube:block/crop_rowap_7"}}}
json_instruct
{"type": "object", "properties": {"variants": {"type": "object", "properties": {"age=0": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=1": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=2": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=3": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=4": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=5": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=6": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}, "age=7": {"type": "object", "properties": {"model": {"type": "string"}}, "required": ["model"]}}, "required": ["age=0", "age=1", "age=2", "age=3", "age=4", "age=5", "age=6", "age=7"]}}, "required": ["variants"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "main": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {}, "required": []}, "scripts": {"type": "object", "properties": {}, "required": []}, "license": {"type": "string"}}, "required": ["name", "version", "description", "author", "contributors", "main", "repository", "bugs", "keywords", "dependencies", "devDependencies", "scripts", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@doctrina/vue-video-player", "version" : "0.0.1", "description" : "Video player for Doctrina training platform.", "author" : "Doctrina <info@doctrina.biz>", "contributors" : [{"name" : "Tadej Stanic"}, {"name" : "Kristijan Sedlak"}], "main" : "dist/index.js", "repository" : {"type" : "git", "url" : "https://github.com/doctrinalabs/vue-video-player.git"}, "bugs" : {"url" : "https://github.com/doctrinalabs/vue-video-player/issues"}, "keywords" : ["video", "player", "vue"], "dependencies" : {}, "devDependencies" : {}, "scripts" : {}, "license" : "MIT"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "author": {"type": "string"}, "contributors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "main": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {}, "required": []}, "devDependencies": {"type": "object", "properties": {}, "required": []}, "scripts": {"type": "object", "properties": {}, "required": []}, "license": {"type": "string"}}, "required": ["name", "version", "description", "author", "contributors", "main", "repository", "bugs", "keywords", "dependencies", "devDependencies", "scripts", "license"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : "3602100001", "district_id" : "3602100", "name" : "KANEKES"}, {"id" : "3602100002", "district_id" : "3602100", "name" : "NAYAGATI"}, {"id" : "3602100003", "district_id" : "3602100", "name" : "BOJONG MENTENG"}, {"id" : "3602100004", "district_id" : "3602100", "name" : "CISIMEUT"}, {"id" : "3602100005", "district_id" : "3602100", "name" : "MARGAWANGI"}, {"id" : "3602100006", "district_id" : "3602100", "name" : "SANGKANWANGI"}, {"id" : "3602100007", "district_id" : "3602100", "name" : "JALUPANG MULYA"}, {"id" : "3602100008", "district_id" : "3602100", "name" : "LEUWIDAMAR"}, {"id" : "3602100009", "district_id" : "3602100", "name" : "CIBUNGUR"}, {"id" : "3602100010", "district_id" : "3602100", "name" : "LEBAK PARAHIANG"}, {"id" : "3602100011", "district_id" : "3602100", "name" : "WANTISARI"}, {"id" : "3602100012", "district_id" : "3602100", "name" : "CISIMEUT RAYA"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"name" : "ZACHARY", "frequency" : 1249, "gender" : "male"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "frequency": {"type": "integer"}, "gender": {"type": "string"}}, "required": ["name", "frequency", "gender"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "array", "items": {"type": "object", "properties": {"p": {"type": "string"}, "d": {"type": "integer"}}, "required": ["p", "d"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"p" : "c23fadc1-4a80-4ce9-80e4-c7fb05889bed", "d" : 275}, {"p" : "330d6512-6cba-4f6c-9320-7084256e94a3", "d" : 82}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"p": {"type": "string"}, "d": {"type": "integer"}}, "required": ["p", "d"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "name_long": {"type": "string"}, "fips": {"type": "string"}, "state_code_int": {"type": "integer"}, "state_code_postal": {"type": "string"}, "state_code_iso": {"type": "string"}, "county_code": {"type": "integer"}, "population": {"type": "integer"}, "countrylevel_id": {"type": "string"}, "census_data": {"type": "object", "properties": {"COUNTYNS": {"type": "string"}, "AFFGEOID": {"type": "string"}, "LSAD": {"type": "string"}, "ALAND": {"type": "integer"}, "AWATER": {"type": "integer"}}, "required": ["COUNTYNS", "AFFGEOID", "LSAD", "ALAND", "AWATER"]}, "center_lat": {"type": "number"}, "center_lon": {"type": "number"}, "area_m2": {"type": "integer"}, "timezone": {"type": "string"}}, "required": ["name", "name_long", "fips", "state_code_int", "state_code_postal", "state_code_iso", "county_code", "population", "countrylevel_id", "census_data", "center_lat", "center_lon", "area_m2", "timezone"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "properties" : {"name" : "Saline County", "name_long" : "Saline County, MO", "fips" : "29195", "state_code_int" : 29, "state_code_postal" : "MO", "state_code_iso" : "US-MO", "county_code" : 195, "population" : 22761, "countrylevel_id" : "fips:29195", "census_data" : {"COUNTYNS" : "00758550", "AFFGEOID" : "0500000US29195", "LSAD" : "06", "ALAND" : 1956717078, "AWATER" : 29587347}, "center_lat" : 39.14, "center_lon" : -93.2, "area_m2" : 1986304425, "timezone" : "America/Chicago"}, "geometry" : {"type" : "Polygon", "coordinates" : [[[-93.477, 39.293], [-93.465, 39.292], [-93.444, 39.269], [-93.411, 39.267], [-93.403, 39.26], [-93.415, 39.235], [-93.396, 39.226], [-93.368, 39.233], [-93.333, 39.25], [-93.329, 39.265], [-93.344, 39.287], [-93.344, 39.297], [-93.332, 39.31], [-93.293, 39.309], [-93.278, 39.312], [-93.256, 39.338], [-93.23, 39.328], [-93.215, 39.338], [-93.192, 39.366], [-93.19, 39.382], [-93.201, 39.402], [-93.185, 39.411], [-93.164, 39.405], [-93.14, 39.379], [-93.104, 39.384], [-93.08, 39.372], [-93.073, 39.336], [-93.045, 39.318], [-93.024, 39.313], [-92.977, 39.315], [-92.96, 39.313], [-92.953, 39.298], [-92.959, 39.283], [-92.947, 39.27], [-92.924, 39.263], [-92.915, 39.253], [-92.92, 39.232], [-92.912, 39.224], [-92.896, 39.222], [-92.865, 39.236], [-92.849, 39.226], [-92.86, 39.201], [-92.891, 39.18], [-92.905, 39.166], [-92.906, 39.148], [-92.923, 39.131], [-92.944, 39.122], [-92.945, 39.107], [-92.934, 39.099], [-92.909, 39.096], [-92.907, 39.084], [-92.935, 39.065], [-93.048, 38.972], [-93.05, 38.928], [-93.106, 38.932], [-93.274, 38.935], [-93.274, 38.935], [-93.496, 38.943], [-93.477, 39.293]]]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "name_long": {"type": "string"}, "fips": {"type": "string"}, "state_code_int": {"type": "integer"}, "state_code_postal": {"type": "string"}, "state_code_iso": {"type": "string"}, "county_code": {"type": "integer"}, "population": {"type": "integer"}, "countrylevel_id": {"type": "string"}, "census_data": {"type": "object", "properties": {"COUNTYNS": {"type": "string"}, "AFFGEOID": {"type": "string"}, "LSAD": {"type": "string"}, "ALAND": {"type": "integer"}, "AWATER": {"type": "integer"}}, "required": ["COUNTYNS", "AFFGEOID", "LSAD", "ALAND", "AWATER"]}, "center_lat": {"type": "number"}, "center_lon": {"type": "number"}, "area_m2": {"type": "integer"}, "timezone": {"type": "string"}}, "required": ["name", "name_long", "fips", "state_code_int", "state_code_postal", "state_code_iso", "county_code", "population", "countrylevel_id", "census_data", "center_lat", "center_lon", "area_m2", "timezone"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"symbol": {"type": "string"}, "account_name": {"type": "string"}}, "required": ["symbol", "account_name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"symbol" : "Dabble", "account_name" : "eoscafekorea"}
json_instruct
{"type": "object", "properties": {"symbol": {"type": "string"}, "account_name": {"type": "string"}}, "required": ["symbol", "account_name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "locationSet": {"type": "object", "properties": {"include": {"type": "array", "items": {"type": "string"}}}, "required": ["include"]}, "country_code": {"type": "string"}, "name": {"type": "string"}, "url": {"type": "string"}, "max_zoom": {"type": "integer"}, "license_url": {"type": "string"}, "best": {"type": "boolean"}, "start_date": {"type": "string"}, "end_date": {"type": "string"}}, "required": ["id", "type", "locationSet", "country_code", "name", "url", "max_zoom", "license_url", "best", "start_date", "end_date"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "Benin_cotonou_pleiade_2016", "type" : "tms", "locationSet" : {"include" : ["benin_cotonou_pleiade.geojson"]}, "country_code" : "BJ", "name" : "Benin: Cotonou Pleiade 2016", "url" : "https://geoxxx.agrocampus-ouest.fr/owsifl/gwc/service/wmts?SERVICE=WMTS&REQUEST=GetTile&VERSION=1.0.0&LAYER=Benin:cotonou_pleiade_2016&STYLE=&FORMAT=image/jpeg&tileMatrixSet=EPSG:3857&tileMatrix=EPSG:3857:{zoom}&tileRow={y}&tileCol={x}", "max_zoom" : 21, "license_url" : "http://taches.francophonelibre.org/project/6", "best" : true, "start_date" : "2016", "end_date" : "2016"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "locationSet": {"type": "object", "properties": {"include": {"type": "array", "items": {"type": "string"}}}, "required": ["include"]}, "country_code": {"type": "string"}, "name": {"type": "string"}, "url": {"type": "string"}, "max_zoom": {"type": "integer"}, "license_url": {"type": "string"}, "best": {"type": "boolean"}, "start_date": {"type": "string"}, "end_date": {"type": "string"}}, "required": ["id", "type", "locationSet", "country_code", "name", "url", "max_zoom", "license_url", "best", "start_date", "end_date"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country": {"type": "string"}, "region": {"type": "string"}, "identifiers": {"type": "object", "properties": {"icao": {"type": "string"}, "usaf": {"type": "string"}}, "required": ["icao", "usaf"]}, "location": {"type": "object", "properties": {"latitude": {"type": "number"}, "longitude": {"type": "number"}, "elevation": {"type": "integer"}}, "required": ["latitude", "longitude", "elevation"]}, "timezone": {"type": "string"}}, "required": ["id", "name", "country", "region", "identifiers", "location", "timezone"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "CWKS0", "name" : {"en" : "Sikanni Chief"}, "country" : "CA", "region" : "BC", "identifiers" : {"icao" : "CWKS", "usaf" : "710334"}, "location" : {"latitude" : 57.2503, "longitude" : -122.7181, "elevation" : 937}, "timezone" : "America/Dawson_Creek"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country": {"type": "string"}, "region": {"type": "string"}, "identifiers": {"type": "object", "properties": {"icao": {"type": "string"}, "usaf": {"type": "string"}}, "required": ["icao", "usaf"]}, "location": {"type": "object", "properties": {"latitude": {"type": "number"}, "longitude": {"type": "number"}, "elevation": {"type": "integer"}}, "required": ["latitude", "longitude", "elevation"]}, "timezone": {"type": "string"}}, "required": ["id", "name", "country", "region", "identifiers", "location", "timezone"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "state": {"type": "string"}}, "required": ["name", "state"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[145.77620000500008, -38.45342999299993], [145.76451902000008, -38.45213099699998], [145.766464981, -38.44139500399996], [145.76842298700012, -38.43022662799996], [145.77205298500007, -38.43068100599993], [145.7729849760001, -38.425202008999975], [145.773727021, -38.42527900599998], [145.77464798900007, -38.41977399799998], [145.782035005, -38.420568998999954], [145.78270602100008, -38.416792001999966], [145.78732801600006, -38.41673999799997], [145.78932701200006, -38.41764899599997], [145.7903720060001, -38.41775699899995], [145.79018713400012, -38.42066196099995], [145.79030915300007, -38.42170001499994], [145.79105112500008, -38.421978938999985], [145.79087293200007, -38.42277399499994], [145.78662707, -38.42631495099994], [145.785598208, -38.42726903299996], [145.784714032, -38.42794800099995], [145.78454375900003, -38.42854784499997], [145.78407108500005, -38.42954900999996], [145.78320994000012, -38.430762923999964], [145.78301988400005, -38.43197495199996], [145.78203310700007, -38.431911052999965], [145.77994910300004, -38.43167993199995], [145.77620000500008, -38.45342999299993]]]}, "properties" : {"name" : "Whitelaw", "state" : "VIC"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "state": {"type": "string"}}, "required": ["name", "state"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"LA-BK": {"type": "string"}, "LA-BL": {"type": "string"}, "LA-HO": {"type": "string"}}, "required": ["LA-BK", "LA-BL", "LA-HO"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"LA-BK" : "Bokeo tartom\u00e1ny", "LA-BL" : "Bolikhamszaj (tartom\u00e1ny)", "LA-HO" : "Houaphan tartom\u00e1ny"}
json_instruct
{"type": "object", "properties": {"LA-BK": {"type": "string"}, "LA-BL": {"type": "string"}, "LA-HO": {"type": "string"}}, "required": ["LA-BK", "LA-BL", "LA-HO"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "url": {"type": "string"}, "username": {"type": "string"}, "text": {"type": "string"}, "date": {"type": "string"}, "retweet": {"type": "integer"}, "like": {"type": "integer"}}, "required": ["id", "url", "username", "text", "date", "retweet", "like"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : "1099393169915957249", "url" : "https://twitter.com/filmz_maneerat/status/1099393169915957249", "username" : "", "text" : "\u0e01\u0e47\u0e44\u0e21\u0e48\u0e40\u0e02\u0e49\u0e32\u0e43\u0e08\u0e27\u0e48\u0e32\u0e17\u0e33\u0e44\u0e21\u0e15\u0e49\u0e2d\u0e07\u0e2d\u0e22\u0e32\u0e01\u0e01\u0e34\u0e19\u0e42\u0e23\u0e15\u0e35\u0e2a\u0e32\u0e22\u0e44\u0e2b\u0e21\u0e15\u0e2d\u0e19\u0e15\u0e352...\u0e21\u0e35\u0e17\u0e35\u0e44\u0e2b\u0e19\u0e43\u0e2b\u0e49\u0e01\u0e39\u0e0b\u0e37\u0e49\u0e2d\u0e16\u0e32\u0e21\u0e17\u0e35555 pic.twitter.com/KmjgqD0ESn", "date" : "24-02-2019 02:38", "retweet" : 0, "like" : 0}, {"id" : "1098950186187943936", "url" : "https://twitter.com/filmz_maneerat/status/1098950186187943936", "username" : "", "text" : "\u0e19\u0e31\u0e48\u0e19\u0e2a\u0e34\u0e19\u0e30\u0e41\u0e21\u0e48\u0e08\u0e30\u0e43\u0e08\u0e14\u0e35\u0e01\u0e31\u0e1a\u0e40\u0e1e\u0e37\u0e48\u0e2d\u0e19\u0e41\u0e15\u0e48\u0e01\u0e31\u0e1a\u0e40\u0e23\u0e32\u0e08\u0e30\u0e44\u0e21\u0e48\u0e04\u0e48\u0e2d\u0e22\u0e43\u0e08\u0e14\u0e35\u0e40\u0e17\u0e48\u0e32\u0e44\u0e2b\u0e23\u0e48555\u0e0b\u0e37\u0e49\u0e2d\u0e02\u0e19\u0e21\u0e43\u0e2b\u0e49\u0e40\u0e1e\u0e37\u0e48\u0e2d\u0e19\u0e41\u0e15\u0e48\u0e15\u0e31\u0e27\u0e40\u0e23\u0e32\u0e40\u0e2d\u0e07\u0e19\u0e31\u0e49\u0e19\u0e27\u0e48\u0e32\u0e07\u0e40\u0e1b\u0e25\u0e48\u0e32\u0e32555", "date" : "22-02-2019 21:18", "retweet" : 0, "like" : 0}, {"id" : "1098641397010190336", "url" : "https://twitter.com/filmz_maneerat/status/1098641397010190336", "username" : "", "text" : "\u0e44\u0e21\u0e48\u0e23\u0e39\u0e49\u0e21\u0e35\u0e43\u0e04\u0e23\u0e40\u0e1b\u0e47\u0e19\u0e21\u0e31\u0e49\u0e22\u0e41\u0e15\u0e48\u0e19\u0e35\u0e48\u0e04\u0e37\u0e2d\u0e41\u0e1a\u0e1a\u0e40\u0e1e\u0e37\u0e48\u0e2d\u0e19\u0e22\u0e37\u0e21\u0e25\u0e49\u0e30\u0e2b\u0e32\u0e22\u0e44\u0e07\u0e44\u0e21\u0e48\u0e2d\u0e22\u0e32\u0e01\u0e43\u0e2b\u0e49\u0e40\u0e1e\u0e37\u0e48\u0e2d\u0e19\u0e43\u0e0a\u0e49\u0e40\u0e25\u0e22\u0e1a\u0e2d\u0e01\u0e40\u0e1e\u0e37\u0e48\u0e2d\u0e19\u0e27\u0e48\u0e32\u0e41\u0e21\u0e48\u0e40\u0e23\u0e32\u0e44\u0e21\u0e48\u0e43\u0e2b\u0e49\u0e43\u0e04\u0e23\u0e43\u0e0a\u0e49\u0e2d\u0e48\u0e30\u0e02\u0e33555555", "date" : "22-02-2019 00:51", "retweet" : 0, "like" : 0}, {"id" : "1098233692776845313", "url" : "https://twitter.com/filmz_maneerat/status/1098233692776845313", "username" : "", "text" : "\u0e21\u0e32\u0e43\u0e2b\u0e21\u0e48\u0e2d\u0e23\u0e48\u0e2d\u0e22\u0e14\u0e3555\u0e40\u0e04\u0e47\u0e21\u0e46\u0e40\u0e1c\u0e47\u0e14\u0e21\u0e35\u0e01\u0e25\u0e34\u0e48\u0e19\u0e44\u0e02\u0e48\u0e40\u0e04\u0e47\u0e21\u0e19\u0e35\u0e48\u0e01\u0e47\u0e04\u0e37\u0e2d\u0e0a\u0e2d\u0e1a555 #\u0e23\u0e35\u0e27\u0e34\u0e27\u0e40\u0e0b\u0e40\u0e27\u0e48\u0e19 pic.twitter.com/1zso5nVaOw", "date" : "20-02-2019 21:51", "retweet" : 0, "like" : 0}, {"id" : "1098216767808139264", "url" : "https://twitter.com/filmz_maneerat/status/1098216767808139264", "username" : "", "text" : "\u0e40\u0e1e\u0e37\u0e48\u0e2d\u0e19\u0e41\u0e04\u0e1b\u0e21\u0e32\u0e43\u0e2b\u0e49\u0e14\u0e39\u0e14\u0e39\u0e04\u0e27\u0e32\u0e21\u0e41\u0e15\u0e01\u0e15\u0e48\u0e32\u0e07\u0e2a\u0e34//\u0e22\u0e34\u0e49\u0e21\u0e2d\u0e48\u0e2d\u0e19\u0e19555 #\u0e2b\u0e19\u0e31\u0e01\u0e41\u0e1c\u0e48\u0e19\u0e14\u0e34\u0e19 #\u0e2d\u0e19\u0e32\u0e04\u0e15\u0e43\u0e2b\u0e21\u0e48 #\u0e19\u0e32\u0e22\u0e01\u0e44\u0e21\u0e48\u0e43\u0e0a\u0e48\u0e04\u0e19\u0e15\u0e25\u0e01\u0e41\u0e15\u0e48\u0e40\u0e1b\u0e47\u0e19\u0e04\u0e19\u0e1a\u0e49\u0e32 #\u0e1b\u0e23\u0e30\u0e40\u0e17\u0e28\u0e44\u0e17\u0e22\u0e44\u0e21\u0e48\u0e43\u0e0a\u0e48\u0e04\u0e48\u0e32\u0e22\u0e17\u0e2b\u0e32\u0e23 pic.twitter.com/FDFMiJB7Vs", "date" : "20-02-2019 20:44", "retweet" : 2, "like" : 0}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "url": {"type": "string"}, "username": {"type": "string"}, "text": {"type": "string"}, "date": {"type": "string"}, "retweet": {"type": "integer"}, "like": {"type": "integer"}}, "required": ["id", "url", "username", "text", "date", "retweet", "like"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"rows": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}}, "required": ["rows"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"rows" : [["speakingpet", "1", "Description", "wh.mp3", "ch.mp3", "whale", "whale.mp3", "A", "1,2", "why", "why.mp3", "A", "1,2", "choose", "choose.mp3", "B", "1,2", "chick", "chick.mp3", "B", "1,2"], ["grid", "1", "Description", "h,s,k", "ole,ale"], ["grid", "1", "Description", "m,p", "ale,ile"], ["grid", "1", "Description", "h", "ug,en,ome,ate"], ["grid", "1", "Description", "l", "ike,ate,ute"], ["grid", "1", "Description", "m", "ule,ice,ade"], ["quizliteracy", "1", "Description", "word_word", "ale", "ome", "ale", "ile", "", "wh___", "whale.mp3"], ["quizliteracy", "1", "Description", "word_word", "ale", "ale", "ate", "ain", "", "s___", "sale.mp3"], ["quizliteracy", "1", "Description", "word_word", "ate", "ime", "omg", "ate", "", "h___", "hate.mp3"], ["quizliteracy", "1", "Description", "word_word", "ate", "ate", "ave", "art", "", "l___", "late.mp3"], ["quizliteracy", "1", "Description", "word_word", "ade", "ele", "ade", "org", "", "m___", "made.mp3"]]}
json_instruct
{"type": "object", "properties": {"rows": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}}, "required": ["rows"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Verlinghem", "circ" : "4\u00e8me circonscription", "dpt" : "Nord", "inscrits" : 1941, "abs" : 676, "votants" : 1265, "blancs" : 4, "nuls" : 3, "exp" : 1258, "res" : [{"nuance" : "LR", "nom" : "M. Jacques HOUSSIN", "voix" : 482}, {"nuance" : "REM", "nom" : "Mme Brigitte LISO", "voix" : 392}, {"nuance" : "FN", "nom" : "M. Julien FRANQUET", "voix" : 92}, {"nuance" : "FI", "nom" : "M. Jean-Pierre HOUBRON", "voix" : 83}, {"nuance" : "DVD", "nom" : "M. S\u00e9bastien LEPRETRE", "voix" : 78}, {"nuance" : "ECO", "nom" : "M. St\u00e9phane BALY", "voix" : 61}, {"nuance" : "DIV", "nom" : "M. Olivier FAUCHILLE", "voix" : 34}, {"nuance" : "DLF", "nom" : "Mme Christine TAVERNIER", "voix" : 10}, {"nuance" : "COM", "nom" : "M. Pierre-Yves PIRA", "voix" : 8}, {"nuance" : "EXG", "nom" : "Mme Carole BAILLEUL", "voix" : 5}, {"nuance" : "DVD", "nom" : "M. Tanguy LATRON", "voix" : 5}, {"nuance" : "DIV", "nom" : "M. Alexandre ROUBINOWITZ", "voix" : 3}, {"nuance" : "DIV", "nom" : "Mme Hourya SLIMANI", "voix" : 3}, {"nuance" : "ECO", "nom" : "Mme Gwendoline ALLIMANT", "voix" : 1}, {"nuance" : "SOC", "nom" : "M. Philippe HARQUET", "voix" : 1}, {"nuance" : "DIV", "nom" : "Mme Elise RENAULD", "voix" : 0}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"ractive.js": {"type": "string"}, "ractive.min.js": {"type": "string"}, "ractive.runtime.js": {"type": "string"}, "ractive.runtime.min.js": {"type": "string"}}, "required": ["ractive.js", "ractive.min.js", "ractive.runtime.js", "ractive.runtime.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ractive.js" : "sha256-DmGe8vGn/Qw9xIS7o2PqVFz7QEXVjJH7GFF8VbIfXdU=", "ractive.min.js" : "sha256-P/1r+Pur9RTn8uYvkiOdB08P/9R1oZq/npwksygXXwA=", "ractive.runtime.js" : "sha256-gBfey0ppfCRQVYthT1HB8RPlijkw9x7f3unq8NJ4b3Y=", "ractive.runtime.min.js" : "sha256-+3zrWI9nLDsMZAWOxpfkCaRqZayevKkFLKi5aNieyOE="}
json_instruct
{"type": "object", "properties": {"ractive.js": {"type": "string"}, "ractive.min.js": {"type": "string"}, "ractive.runtime.js": {"type": "string"}, "ractive.runtime.min.js": {"type": "string"}}, "required": ["ractive.js", "ractive.min.js", "ractive.runtime.js", "ractive.runtime.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"files": {"type": "object", "properties": {"main.css": {"type": "string"}, "main.js": {"type": "string"}, "main.js.map": {"type": "string"}, "runtime-main.js": {"type": "string"}, "runtime-main.js.map": {"type": "string"}, "static/js/2.0fb25790.chunk.js": {"type": "string"}, "static/js/2.0fb25790.chunk.js.map": {"type": "string"}, "index.html": {"type": "string"}, "static/css/main.bab0b925.chunk.css.map": {"type": "string"}, "static/js/2.0fb25790.chunk.js.LICENSE.txt": {"type": "string"}}, "required": ["main.css", "main.js", "main.js.map", "runtime-main.js", "runtime-main.js.map", "static/js/2.0fb25790.chunk.js", "static/js/2.0fb25790.chunk.js.map", "index.html", "static/css/main.bab0b925.chunk.css.map", "static/js/2.0fb25790.chunk.js.LICENSE.txt"]}, "entrypoints": {"type": "array", "items": {"type": "string"}}}, "required": ["files", "entrypoints"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"files" : {"main.css" : "/static/css/main.bab0b925.chunk.css", "main.js" : "/static/js/main.9e4e166f.chunk.js", "main.js.map" : "/static/js/main.9e4e166f.chunk.js.map", "runtime-main.js" : "/static/js/runtime-main.3b245b9d.js", "runtime-main.js.map" : "/static/js/runtime-main.3b245b9d.js.map", "static/js/2.0fb25790.chunk.js" : "/static/js/2.0fb25790.chunk.js", "static/js/2.0fb25790.chunk.js.map" : "/static/js/2.0fb25790.chunk.js.map", "index.html" : "/index.html", "static/css/main.bab0b925.chunk.css.map" : "/static/css/main.bab0b925.chunk.css.map", "static/js/2.0fb25790.chunk.js.LICENSE.txt" : "/static/js/2.0fb25790.chunk.js.LICENSE.txt"}, "entrypoints" : ["static/js/runtime-main.3b245b9d.js", "static/js/2.0fb25790.chunk.js", "static/css/main.bab0b925.chunk.css", "static/js/main.9e4e166f.chunk.js"]}
json_instruct
{"type": "object", "properties": {"files": {"type": "object", "properties": {"main.css": {"type": "string"}, "main.js": {"type": "string"}, "main.js.map": {"type": "string"}, "runtime-main.js": {"type": "string"}, "runtime-main.js.map": {"type": "string"}, "static/js/2.0fb25790.chunk.js": {"type": "string"}, "static/js/2.0fb25790.chunk.js.map": {"type": "string"}, "index.html": {"type": "string"}, "static/css/main.bab0b925.chunk.css.map": {"type": "string"}, "static/js/2.0fb25790.chunk.js.LICENSE.txt": {"type": "string"}}, "required": ["main.css", "main.js", "main.js.map", "runtime-main.js", "runtime-main.js.map", "static/js/2.0fb25790.chunk.js", "static/js/2.0fb25790.chunk.js.map", "index.html", "static/css/main.bab0b925.chunk.css.map", "static/js/2.0fb25790.chunk.js.LICENSE.txt"]}, "entrypoints": {"type": "array", "items": {"type": "string"}}}, "required": ["files", "entrypoints"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Tuleap\\Userlog\\": {"type": "string"}}, "required": ["Tuleap\\Userlog\\"]}, "classmap": {"type": "array", "items": {"type": "string"}}}, "required": ["psr-4", "classmap"]}, "config": {"type": "object", "properties": {"sort-packages": {"type": "boolean"}}, "required": ["sort-packages"]}}, "required": ["name", "autoload", "config"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "tuleap/plugin-userlog", "autoload" : {"psr-4" : {"Tuleap\\Userlog\\" : "include/"}, "classmap" : ["include/"]}, "config" : {"sort-packages" : true}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Tuleap\\Userlog\\": {"type": "string"}}, "required": ["Tuleap\\Userlog\\"]}, "classmap": {"type": "array", "items": {"type": "string"}}}, "required": ["psr-4", "classmap"]}, "config": {"type": "object", "properties": {"sort-packages": {"type": "boolean"}}, "required": ["sort-packages"]}}, "required": ["name", "autoload", "config"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 404401939, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes_pg", "src:geom" : "quattroshapes_pg", "wof:geomhash" : "bf8277bf21bea09c0317356de6a85136", "wof:id" : 404401939, "wof:repo" : "whosonfirst-data-admin-fr"}, "bbox" : [4.20806, 43.87333, 4.20806, 43.87333], "geometry" : {"coordinates" : [4.20806, 43.87333], "type" : "Point"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"fro": {"type": "string"}, "too": {"type": "string"}, "value": {"type": "integer"}, "date": {"type": "number"}, "sign": {"type": "string"}}, "required": ["fro", "too", "value", "date", "sign"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"fro" : "Judith", "too" : "Moritz", "value" : 300, "date" : 3789590400.0, "sign" : "3045022100c4379dfa325eaf00a1cefa6b990b191f1dcd21e669183888ee7dbf4193285e6602206893dd7ec04dbd149f3224d8e0b81dc8f8146f7790933f185a039ced325e3036"}
json_instruct
{"type": "object", "properties": {"fro": {"type": "string"}, "too": {"type": "string"}, "value": {"type": "integer"}, "date": {"type": "number"}, "sign": {"type": "string"}}, "required": ["fro", "too", "value", "date", "sign"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}, "address": {"type": "object", "properties": {"addressLine1": {"type": "string"}, "addressLine2": {"type": "string"}, "county": {"type": "string"}, "postcode": {"type": "string"}}, "required": ["addressLine1", "addressLine2", "county", "postcode"]}, "organisation": {"type": "object", "properties": {"id": {"type": "string"}, "code": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "code", "name"]}}, "required": ["id", "name", "code", "address", "organisation"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "bab2e1e5-7211-4a2f-9aa4-36d93da00a03", "name" : "Main Site", "code" : "-", "address" : {"addressLine1" : "Hathaway Gardens", "addressLine2" : "Ealing", "county" : "London", "postcode" : "W13 0DH"}, "organisation" : {"id" : "d2ce1fbe-879c-42d1-b2ed-e27efee10045", "code" : "1RW", "name" : "Castlebar School"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}, "address": {"type": "object", "properties": {"addressLine1": {"type": "string"}, "addressLine2": {"type": "string"}, "county": {"type": "string"}, "postcode": {"type": "string"}}, "required": ["addressLine1", "addressLine2", "county", "postcode"]}, "organisation": {"type": "object", "properties": {"id": {"type": "string"}, "code": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "code", "name"]}}, "required": ["id", "name", "code", "address", "organisation"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"require": {"type": "object", "properties": {"twig/twig": {"type": "string"}, "monolog/monolog": {"type": "string"}, "webit/eval-math": {"type": "string"}, "ccampbell/chromephp": {"type": "string"}}, "required": ["twig/twig", "monolog/monolog", "webit/eval-math", "ccampbell/chromephp"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "satooshi/php-coveralls": {"type": "string"}}, "required": ["phpunit/phpunit", "satooshi/php-coveralls"]}}, "required": ["require", "require-dev"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"require" : {"twig/twig" : "~1.0", "monolog/monolog" : "^1.22", "webit/eval-math" : "^1.0", "ccampbell/chromephp" : "^4.1"}, "require-dev" : {"phpunit/phpunit" : "^5.7", "satooshi/php-coveralls" : "^1.0"}}
json_instruct
{"type": "object", "properties": {"require": {"type": "object", "properties": {"twig/twig": {"type": "string"}, "monolog/monolog": {"type": "string"}, "webit/eval-math": {"type": "string"}, "ccampbell/chromephp": {"type": "string"}}, "required": ["twig/twig", "monolog/monolog", "webit/eval-math", "ccampbell/chromephp"]}, "require-dev": {"type": "object", "properties": {"phpunit/phpunit": {"type": "string"}, "satooshi/php-coveralls": {"type": "string"}}, "required": ["phpunit/phpunit", "satooshi/php-coveralls"]}}, "required": ["require", "require-dev"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01009242": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01009242"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Topology", "objects" : {"E01009242" : {"type" : "GeometryCollection", "crs" : {"type" : "name", "properties" : {"name" : "urn:ogc:def:crs:OGC:1.3:CRS84"}}, "geometries" : [{"type" : "Polygon", "properties" : {"OA11CD" : "E00046867", "LAD11CD" : "E08000025"}, "arcs" : [[0, 1, 2]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00046869", "LAD11CD" : "E08000025"}, "arcs" : [[-2, 3, 4]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00046871", "LAD11CD" : "E08000025"}, "arcs" : [[5, 6]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00046873", "LAD11CD" : "E08000025"}, "arcs" : [[-3, -5, 7, -6, 8, 9]]}, {"type" : "Polygon", "properties" : {"OA11CD" : "E00046874", "LAD11CD" : "E08000025"}, "arcs" : [[-7, -8, 10, -9]]}]}}, "arcs" : [[[5525, 7237], [-456, 1258], [-1207, 319], [1254, 767]], [[5116, 9581], [1285, -1595], [-400, -700], [246, -566]], [[6247, 6720], [-495, 148], [-227, 369]], [[5116, 9581], [365, 270], [423, 148], [887, -715], [970, -376], [796, 57], [119, -148], [-696, -226], [-292, -374], [1000, -1037], [-1035, 256], [-418, -344], [-276, -443], [583, -740], [-158, -364]], [[7384, 5545], [-1137, 1175]], [[5065, 4524], [682, -219], [350, 373], [-7, 693], [860, -391]], [[6950, 4980], [564, -748], [-184, -346], [-654, -250], [-9, -291], [-1526, 20], [-76, 1159]], [[7384, 5545], [-434, -565]], [[5065, 4524], [-776, 2488]], [[4289, 7012], [1236, 225]], [[7384, 5545], [585, -106], [1038, -1315], [-17, -1196], [1009, -1089], [-1163, -1120], [-298, -719], [-789, 146], [-2485, 758], [-925, 454], [-2341, 1423], [-1998, 1640], [151, 325], [2634, 1789], [1504, 477]]], "transform" : {"scale" : [1.7767315123924408e-06, 1.090329416895922e-06], "translate" : [-1.916553168095051, 52.5162740112604]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "objects": {"type": "object", "properties": {"E01009242": {"type": "object", "properties": {"type": {"type": "string"}, "crs": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["type", "properties"]}, "geometries": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"OA11CD": {"type": "string"}, "LAD11CD": {"type": "string"}}, "required": ["OA11CD", "LAD11CD"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "required": ["type", "properties", "arcs"]}}}, "required": ["type", "crs", "geometries"]}}, "required": ["E01009242"]}, "arcs": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "integer"}}}}, "transform": {"type": "object", "properties": {"scale": {"type": "array", "items": {"type": "number"}}, "translate": {"type": "array", "items": {"type": "number"}}}, "required": ["scale", "translate"]}}, "required": ["type", "objects", "arcs", "transform"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"users": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "firstName": {"type": "string"}, "lastName": {"type": "string"}, "phone": {"type": "string"}}, "required": ["id", "firstName", "lastName", "phone"]}}}, "required": ["users"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"users" : [{"id" : 1, "firstName" : "Serhii", "lastName" : "Ovsianykov", "phone" : "+380508054899"}, {"id" : 2, "firstName" : "Oleg", "lastName" : "Kogan", "phone" : "+380667463440"}, {"id" : 3, "firstName" : "Alex", "lastName" : "Direktor", "phone" : "+380504567898"}, {"id" : 4, "firstName" : "Vladimir", "lastName" : "Swell", "phone" : "+380506068910"}]}
json_instruct
{"type": "object", "properties": {"users": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "firstName": {"type": "string"}, "lastName": {"type": "string"}, "phone": {"type": "string"}}, "required": ["id", "firstName", "lastName", "phone"]}}}, "required": ["users"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"body" : "WHEREOF THERE IS NO REALITY; AND THEREFORE WILL QUESTION THE EXISTENCE OF ALL THINGS, OR OUR KNOWLEDGE OF ANY THING;", "next" : "https://raw.githubusercontent.com/CAPSELOCKE/CAPSELOCKE/master/tweets/11620.json"}
json_instruct
{"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"description": {"type": "string"}, "name": {"type": "string"}, "type": {"type": "string"}, "mode": {"type": "string"}}, "required": ["description", "name", "type", "mode"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"description" : "datetime", "name" : "datetime", "type" : "DATETIME", "mode" : "REQUIRED"}, {"description" : "open", "name" : "open", "type" : "NUMERIC", "mode" : "REQUIRED"}, {"description" : "high", "name" : "high", "type" : "NUMERIC", "mode" : "REQUIRED"}, {"description" : "low", "name" : "low", "type" : "NUMERIC", "mode" : "REQUIRED"}, {"description" : "close", "name" : "close", "type" : "NUMERIC", "mode" : "REQUIRED"}, {"description" : "volume", "name" : "volume", "type" : "NUMERIC", "mode" : "REQUIRED"}, {"description" : "ticker", "name" : "ticker", "type" : "STRING", "mode" : "REQUIRED"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"description": {"type": "string"}, "name": {"type": "string"}, "type": {"type": "string"}, "mode": {"type": "string"}}, "required": ["description", "name", "type", "mode"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"dev": {"type": "object", "properties": {"awscloudformation": {"type": "object", "properties": {"AuthRoleName": {"type": "string"}, "UnauthRoleArn": {"type": "string"}, "AuthRoleArn": {"type": "string"}, "Region": {"type": "string"}, "DeploymentBucketName": {"type": "string"}, "UnauthRoleName": {"type": "string"}, "StackName": {"type": "string"}, "StackId": {"type": "string"}, "AmplifyAppId": {"type": "string"}}, "required": ["AuthRoleName", "UnauthRoleArn", "AuthRoleArn", "Region", "DeploymentBucketName", "UnauthRoleName", "StackName", "StackId", "AmplifyAppId"]}, "categories": {"type": "object", "properties": {"auth": {"type": "object", "properties": {"fitnest680e0989": {"type": "object", "properties": {}, "required": []}}, "required": ["fitnest680e0989"]}}, "required": ["auth"]}}, "required": ["awscloudformation", "categories"]}}, "required": ["dev"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"dev" : {"awscloudformation" : {"AuthRoleName" : "amplify-fitnest-dev-180435-authRole", "UnauthRoleArn" : "arn:aws:iam::156687757803:role/amplify-fitnest-dev-180435-unauthRole", "AuthRoleArn" : "arn:aws:iam::156687757803:role/amplify-fitnest-dev-180435-authRole", "Region" : "us-west-2", "DeploymentBucketName" : "amplify-fitnest-dev-180435-deployment", "UnauthRoleName" : "amplify-fitnest-dev-180435-unauthRole", "StackName" : "amplify-fitnest-dev-180435", "StackId" : "arn:aws:cloudformation:us-west-2:156687757803:stack/amplify-fitnest-dev-180435/22f643f0-ddf6-11eb-bae2-027c0063b53f", "AmplifyAppId" : "d3fh2gq929dpxt"}, "categories" : {"auth" : {"fitnest680e0989" : {}}}}}
json_instruct
{"type": "object", "properties": {"dev": {"type": "object", "properties": {"awscloudformation": {"type": "object", "properties": {"AuthRoleName": {"type": "string"}, "UnauthRoleArn": {"type": "string"}, "AuthRoleArn": {"type": "string"}, "Region": {"type": "string"}, "DeploymentBucketName": {"type": "string"}, "UnauthRoleName": {"type": "string"}, "StackName": {"type": "string"}, "StackId": {"type": "string"}, "AmplifyAppId": {"type": "string"}}, "required": ["AuthRoleName", "UnauthRoleArn", "AuthRoleArn", "Region", "DeploymentBucketName", "UnauthRoleName", "StackName", "StackId", "AmplifyAppId"]}, "categories": {"type": "object", "properties": {"auth": {"type": "object", "properties": {"fitnest680e0989": {"type": "object", "properties": {}, "required": []}}, "required": ["fitnest680e0989"]}}, "required": ["auth"]}}, "required": ["awscloudformation", "categories"]}}, "required": ["dev"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"code": {"type": "string"}, "code3": {"type": "string"}, "name": {"type": "string"}, "capital": {"type": "string"}, "region": {"type": "string"}, "subregion": {"type": "string"}, "states": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "name": {"type": "string"}}, "required": ["code", "name"]}}, "dialCode": {"type": "string"}}, "required": ["code", "code3", "name", "capital", "region", "subregion", "states", "dialCode"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"code" : "CL", "code3" : "CHL", "name" : "Chile", "capital" : "Santiago", "region" : "Americas", "subregion" : "South America", "states" : [{"code" : "AI", "name" : "Ais\u00e9n del General Carlos Iba\u00f1ez del Campo"}, {"code" : "AN", "name" : "Antofagasta"}, {"code" : "AR", "name" : "Araucan\u00eda"}, {"code" : "AP", "name" : "Arica y Parinacota"}, {"code" : "AT", "name" : "Atacama"}, {"code" : "BI", "name" : "B\u00edo-B\u00edo"}, {"code" : "CO", "name" : "Coquimbo"}, {"code" : "LI", "name" : "Libertador General Bernardo O'Higgins"}, {"code" : "LL", "name" : "Los Lagos"}, {"code" : "LR", "name" : "Los R\u00edos"}, {"code" : "MA", "name" : "Magallanes"}, {"code" : "ML", "name" : "Maule"}, {"code" : "RM", "name" : "Regi\u00f3n Metropolitana de Santiago"}, {"code" : "TA", "name" : "Tarapac\u00e1"}, {"code" : "VS", "name" : "Valpara\u00edso"}], "dialCode" : "+56"}
json_instruct
{"type": "object", "properties": {"code": {"type": "string"}, "code3": {"type": "string"}, "name": {"type": "string"}, "capital": {"type": "string"}, "region": {"type": "string"}, "subregion": {"type": "string"}, "states": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "name": {"type": "string"}}, "required": ["code", "name"]}}, "dialCode": {"type": "string"}}, "required": ["code", "code3", "name", "capital", "region", "subregion", "states", "dialCode"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "tags": {"type": "string"}, "cpl.readme": {"type": "string"}, "cpl.uri": {"type": "string"}, "cpl.title": {"type": "string"}, "cpl.author": {"type": "string"}, "cpl.name": {"type": "string"}, "cpl.description": {"type": "string"}, "cpl.plugin-type": {"type": "string"}, "cpl.dependents": {"type": "string"}, "cpl.core-version": {"type": "string"}, "title": {"type": "string"}}, "required": ["type", "tags", "cpl.readme", "cpl.uri", "cpl.title", "cpl.author", "cpl.name", "cpl.description", "cpl.plugin-type", "cpl.dependents", "cpl.core-version", "title"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"type" : "application/json", "tags" : "$:/tags/PluginWiki", "cpl.readme" : "\\define showInfo()\n<$action-setfield $tiddler=\"$:/state/popup/tiddler-info-471453735\" text=\"yes\" />\n\\end\n\nThis plugin adds a toggle button to the Fields tab in the tiddler info area, which can be seen in tiddler view mode.\n\nIf you need the tiddler info button in edit mode you will need to install the: \"Tiddler Info in Edit Mode\" plugin.\n\n<$button actions=<<showInfo>> to=\"test-field-visibility\" >\nClick this button to show the tiddler info area\n</$button>\n\n''Important:'' This plugin changes the following core tiddlers\n\n* $:/core/ui/TiddlerInfo/Fields\n* $:/core/ui/TiddlerFieldTemplate\n", "cpl.uri" : "https://wikilabs.github.io/editions/pluginlibraryWL/library/latest/recipes/library/tiddlers/%2524%253A%252Fplugins%252Fwikilabs%252Ffield-visibility.json", "cpl.title" : "$:/plugins/wikilabs/field-visibility", "cpl.author" : "Mario Pietsch", "cpl.name" : "Toggle Field Visibility", "cpl.description" : "Change the field visibility in the tiddler info area fields tab", "cpl.plugin-type" : "plugin", "cpl.dependents" : "", "cpl.core-version" : ">=5.1.15", "title" : "Plugin_202203243723000"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}, "tags": {"type": "string"}, "cpl.readme": {"type": "string"}, "cpl.uri": {"type": "string"}, "cpl.title": {"type": "string"}, "cpl.author": {"type": "string"}, "cpl.name": {"type": "string"}, "cpl.description": {"type": "string"}, "cpl.plugin-type": {"type": "string"}, "cpl.dependents": {"type": "string"}, "cpl.core-version": {"type": "string"}, "title": {"type": "string"}}, "required": ["type", "tags", "cpl.readme", "cpl.uri", "cpl.title", "cpl.author", "cpl.name", "cpl.description", "cpl.plugin-type", "cpl.dependents", "cpl.core-version", "title"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"cronExpression": {"type": "string"}, "blockchain": {"type": "object", "properties": {"selectedConnector": {"type": "string"}, "connectors": {"type": "object", "properties": {"ethereum": {"type": "object", "properties": {"network": {"type": "string"}, "overrideGasConfig": {"type": "boolean"}, "gasLimit": {"type": "integer"}, "gasPrice": {"type": "string"}, "rpc": {"type": "object", "properties": {"host": {"type": "string"}, "port": {"type": "string"}}, "required": ["host", "port"]}, "account": {"type": "object", "properties": {"privateKey": {"type": "string"}}, "required": ["privateKey"]}}, "required": ["network", "overrideGasConfig", "gasLimit", "gasPrice", "rpc", "account"]}}, "required": ["ethereum"]}}, "required": ["selectedConnector", "connectors"]}}, "required": ["cronExpression", "blockchain"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"cronExpression" : "*/10 * * * * *", "blockchain" : {"selectedConnector" : "ethereum", "connectors" : {"ethereum" : {"network" : "ganache", "overrideGasConfig" : true, "gasLimit" : 4712388, "gasPrice" : "100000000000", "rpc" : {"host" : "http://localhost", "port" : "6000"}, "account" : {"privateKey" : "0x06dd0990d19001c57eeea6d32e8fdeee40d3945962caf18c18c3930baa5a6ec9"}}}}}
json_instruct
{"type": "object", "properties": {"cronExpression": {"type": "string"}, "blockchain": {"type": "object", "properties": {"selectedConnector": {"type": "string"}, "connectors": {"type": "object", "properties": {"ethereum": {"type": "object", "properties": {"network": {"type": "string"}, "overrideGasConfig": {"type": "boolean"}, "gasLimit": {"type": "integer"}, "gasPrice": {"type": "string"}, "rpc": {"type": "object", "properties": {"host": {"type": "string"}, "port": {"type": "string"}}, "required": ["host", "port"]}, "account": {"type": "object", "properties": {"privateKey": {"type": "string"}}, "required": ["privateKey"]}}, "required": ["network", "overrideGasConfig", "gasLimit", "gasPrice", "rpc", "account"]}}, "required": ["ethereum"]}}, "required": ["selectedConnector", "connectors"]}}, "required": ["cronExpression", "blockchain"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"angular-material.css": {"type": "string"}, "angular-material.js": {"type": "string"}, "angular-material.min.css": {"type": "string"}, "angular-material.min.js": {"type": "string"}}, "required": ["angular-material.css", "angular-material.js", "angular-material.min.css", "angular-material.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"angular-material.css" : "sha256-bg39jOKAKfvCHBFO1zuktUYG3LPuaD55JiFx00Hcfjw=", "angular-material.js" : "sha256-QUI0pyfTkwP0sJ0S9sm00D8tRA+/pQI+e1/M+8S7hpU=", "angular-material.min.css" : "sha256-pgHfUQWQrqhxQo0WZGy87XluCncoJvHMTwrpu+sRSLM=", "angular-material.min.js" : "sha256-K/2o4PJWKFMkzSOesqLZWTaTDA/r2uTQsp6qcQOObTY="}
json_instruct
{"type": "object", "properties": {"angular-material.css": {"type": "string"}, "angular-material.js": {"type": "string"}, "angular-material.min.css": {"type": "string"}, "angular-material.min.js": {"type": "string"}}, "required": ["angular-material.css", "angular-material.js", "angular-material.min.css", "angular-material.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "logoURI": {"type": "string"}, "decimals": {"type": "integer"}, "address": {"type": "string"}, "chainId": {"type": "integer"}, "tags": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "symbol", "logoURI", "decimals", "address", "chainId", "tags"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "SweetBoiCoin", "symbol" : "SWBO", "logoURI" : "https://raw.githubusercontent.com/sweetboicoin/crypto/main/bret-coin.png", "decimals" : 0, "address" : "8dwADjpVptdHtyPxRTsyVZJgWSaLLPfNNWeYRY1ZXyjb", "chainId" : 101, "tags" : ["social-token"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "logoURI": {"type": "string"}, "decimals": {"type": "integer"}, "address": {"type": "string"}, "chainId": {"type": "integer"}, "tags": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "symbol", "logoURI", "decimals", "address", "chainId", "tags"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"3D_enabled": {"type": "boolean"}}, "required": ["3D_enabled"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"3D_enabled" : false}
json_instruct
{"type": "object", "properties": {"3D_enabled": {"type": "boolean"}}, "required": ["3D_enabled"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"id": {"type": "string"}, "instances": {"type": "integer"}, "cpus": {"type": "integer"}, "mem": {"type": "integer"}, "cmd": {"type": "string"}, "fetch": {"type": "array", "items": {"type": "object", "properties": {"uri": {"type": "string"}}, "required": ["uri"]}}, "env": {"type": "object", "properties": {"ACCESS_KEY_ID": {"type": "string"}, "SECRET_ACCESS_KEY": {"type": "string"}}, "required": ["ACCESS_KEY_ID", "SECRET_ACCESS_KEY"]}, "labels": {"type": "object", "properties": {"HAPROXY_GROUP": {"type": "string"}}, "required": ["HAPROXY_GROUP"]}, "portDefinitions": {"type": "array", "items": {"type": "object", "properties": {"port": {"type": "integer"}}, "required": ["port"]}}, "requirePorts": {"type": "boolean"}}, "required": ["id", "instances", "cpus", "mem", "cmd", "fetch", "env", "labels", "portDefinitions", "requirePorts"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "drill", "instances" : 1, "cpus" : 1, "mem" : 1500, "cmd" : "export JAVA_HOME=\"`pwd`/jdk1.8.0_91\" && export PATH=\"$JAVA_HOME/bin:$PATH\" && export DRILL_HOME=\"apache-drill-1.11.0/\" && sed -i \"s/localhost:2181/master.mesos:2181/\" apache-drill-1.11.0/conf/drill-override.conf && mv apache-drill-1.11.0/conf/core-site-example.xml apache-drill-1.11.0/conf/core-site.xml && sed -i \"s,ENTER_YOUR_ACCESSKEY,$ACCESS_KEY_ID,; s,ENTER_YOUR_SECRETKEY,$SECRET_ACCESS_KEY,\" apache-drill-1.11.0/conf/core-site.xml && sed -i \"s,</configuration>,<property><name>fs.s3a.endpoint</name><value>http://_PUBLIC_AGENT_IP:9000</value></property></configuration>,\" apache-drill-1.11.0/conf/core-site.xml && apache-drill-1.11.0/bin/drillbit.sh run", "fetch" : [{"uri" : "https://s3.amazonaws.com/downloads.mesosphere.io/java/jdk-8u91-linux-x64.tar.gz"}, {"uri" : "https://s3.amazonaws.com/downloads.mesosphere.io/dcos-demo/drill/apache-drill-1.11.0.tar.gz"}], "env" : {"ACCESS_KEY_ID" : "minio", "SECRET_ACCESS_KEY" : "minio123"}, "labels" : {"HAPROXY_GROUP" : "external"}, "portDefinitions" : [{"port" : 8047}], "requirePorts" : true}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "instances": {"type": "integer"}, "cpus": {"type": "integer"}, "mem": {"type": "integer"}, "cmd": {"type": "string"}, "fetch": {"type": "array", "items": {"type": "object", "properties": {"uri": {"type": "string"}}, "required": ["uri"]}}, "env": {"type": "object", "properties": {"ACCESS_KEY_ID": {"type": "string"}, "SECRET_ACCESS_KEY": {"type": "string"}}, "required": ["ACCESS_KEY_ID", "SECRET_ACCESS_KEY"]}, "labels": {"type": "object", "properties": {"HAPROXY_GROUP": {"type": "string"}}, "required": ["HAPROXY_GROUP"]}, "portDefinitions": {"type": "array", "items": {"type": "object", "properties": {"port": {"type": "integer"}}, "required": ["port"]}}, "requirePorts": {"type": "boolean"}}, "required": ["id", "instances", "cpus", "mem", "cmd", "fetch", "env", "labels", "portDefinitions", "requirePorts"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"category": {"type": "string"}, "classinstvars": {"type": "array", "items": {}}, "classvars": {"type": "array", "items": {}}, "commentStamp": {"type": "string"}, "instvars": {"type": "array", "items": {}}, "name": {"type": "string"}, "pools": {"type": "array", "items": {}}, "super": {"type": "string"}, "type": {"type": "string"}}, "required": ["category", "classinstvars", "classvars", "commentStamp", "instvars", "name", "pools", "super", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"category" : "Path-View-Morphic", "classinstvars" : [], "classvars" : [], "commentStamp" : "<historical>", "instvars" : [], "name" : "SPVMenuMorph", "pools" : [], "super" : "SMenuMorph", "type" : "normal"}
json_instruct
{"type": "object", "properties": {"category": {"type": "string"}, "classinstvars": {"type": "array", "items": {}}, "classvars": {"type": "array", "items": {}}, "commentStamp": {"type": "string"}, "instvars": {"type": "array", "items": {}}, "name": {"type": "string"}, "pools": {"type": "array", "items": {}}, "super": {"type": "string"}, "type": {"type": "string"}}, "required": ["category", "classinstvars", "classvars", "commentStamp", "instvars", "name", "pools", "super", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"n_dim" : 21, "n_trials" : 340, "objective" : "paviani_on_cube", "white" : "platypus_moead", "black" : "pymoo_nsga2", "traceback" : ["passing", "passing"], "best_val" : [-671.9668012803614, -489.7662665083408], "best_x" : [[0.9653165028691663, 0.9038243042936699, 0.594548198274634, 0.9847088906482119, 0.8006224414136657, 0.6789079141494968, 0.8861907156071602, 0.9888713283101138, 0.9920087232882739, 0.9956842211007055, 0.8612995257394729, 0.3887827789911994, 0.9872010233862489, 0.7530981903133768, 0.40803994047707026, 0.7246377756275443, 0.9479500711361913, 0.41800676858927577, 0.42632162858752676, 0.9990955100044706, 0.9579450222794116], [0.4882896547115704, 0.9278559226463223, 0.7752498185427125, 0.8502708961564244, 0.9827095293448908, 0.6403663653432315, 0.7714700892542183, 0.691246187001041, 0.8490898145627447, 0.6078653583750396, 0.012848638625673828, 0.7294520761933058, 0.935384995487733, 0.7518834932200196, 0.2368597936831614, 0.9680813852899739, 0.6862323328958195, 0.9198642287202909, 0.3603785724441996, 0.9487936189714049, 0.8043898487172516]], "feval_count" : [341, 300], "n_trials_instructed" : [340, 289], "passing" : [true, true], "completed" : true, "points" : 1.0, "winner" : "platypus_moead", "loser" : "pymoo_nsga2"}
json_instruct
{"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"ambientDependencies": {"type": "object", "properties": {"angular": {"type": "string"}, "jquery": {"type": "string"}, "lodash": {"type": "string"}, "socket.io-client": {"type": "string"}}, "required": ["angular", "jquery", "lodash", "socket.io-client"]}, "ambientDevDependencies": {"type": "object", "properties": {"angular-protractor": {"type": "string"}, "selenium-webdriver": {"type": "string"}, "mocha": {"type": "string"}, "chai": {"type": "string"}, "assertion-error": {"type": "string"}, "sinon": {"type": "string"}, "sinon-chai": {"type": "string"}}, "required": ["angular-protractor", "selenium-webdriver", "mocha", "chai", "assertion-error", "sinon", "sinon-chai"]}}, "required": ["ambientDependencies", "ambientDevDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ambientDependencies" : {"angular" : "registry:dt/angular#1.5.0+20160412133217", "jquery" : "github:DefinitelyTyped/DefinitelyTyped/jquery/jquery.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "lodash" : "github:DefinitelyTyped/DefinitelyTyped/lodash/lodash.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "socket.io-client" : "github:DefinitelyTyped/DefinitelyTyped/socket.io-client/socket.io-client.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe"}, "ambientDevDependencies" : {"angular-protractor" : "github:DefinitelyTyped/DefinitelyTyped/angular-protractor/angular-protractor.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "selenium-webdriver" : "github:DefinitelyTyped/DefinitelyTyped/selenium-webdriver/selenium-webdriver.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "mocha" : "github:DefinitelyTyped/DefinitelyTyped/mocha/mocha.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "chai" : "github:DefinitelyTyped/DefinitelyTyped/chai/chai.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "assertion-error" : "github:DefinitelyTyped/DefinitelyTyped/assertion-error/assertion-error.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "sinon" : "github:DefinitelyTyped/DefinitelyTyped/sinon/sinon.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe", "sinon-chai" : "github:DefinitelyTyped/DefinitelyTyped/sinon-chai/sinon-chai.d.ts#40c60850ad6c8175a62d5ab48c4e016ea5b3dffe"}}
json_instruct
{"type": "object", "properties": {"ambientDependencies": {"type": "object", "properties": {"angular": {"type": "string"}, "jquery": {"type": "string"}, "lodash": {"type": "string"}, "socket.io-client": {"type": "string"}}, "required": ["angular", "jquery", "lodash", "socket.io-client"]}, "ambientDevDependencies": {"type": "object", "properties": {"angular-protractor": {"type": "string"}, "selenium-webdriver": {"type": "string"}, "mocha": {"type": "string"}, "chai": {"type": "string"}, "assertion-error": {"type": "string"}, "sinon": {"type": "string"}, "sinon-chai": {"type": "string"}}, "required": ["angular-protractor", "selenium-webdriver", "mocha", "chai", "assertion-error", "sinon", "sinon-chai"]}}, "required": ["ambientDependencies", "ambientDevDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "href": {"type": "string"}, "url": {"type": "string"}, "description": {"type": "string"}, "isoPatterns": {"type": "null"}, "count": {"type": "integer"}, "qualityRules": {"type": "null"}}, "required": ["id", "name", "href", "url", "description", "isoPatterns", "count", "qualityRules"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "CWE-671", "name" : "Lack of Administrator Control over Security", "href" : "CARL/quality-standards/CWE/items/CWE-671", "url" : "https://cwe.mitre.org/data/definitions/671.html", "description" : "The product uses security features in a way that prevents the product's administrator from tailoring security settings to reflect the environment in which the product is being used. This introduces resultant weaknesses or prevents it from operating at a level of security that is desired by the administrator.", "isoPatterns" : null, "count" : 0, "qualityRules" : null}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "href": {"type": "string"}, "url": {"type": "string"}, "description": {"type": "string"}, "isoPatterns": {"type": "null"}, "count": {"type": "integer"}, "qualityRules": {"type": "null"}}, "required": ["id", "name", "href", "url", "description", "isoPatterns", "count", "qualityRules"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "link": {"type": "string"}, "club": {"type": "string"}, "class_classic": {"type": "string"}, "class_dnd": {"type": "string"}, "A": {"type": "string"}, "B": {"type": "string"}, "C": {"type": "string"}, "D": {"type": "string"}, "E": {"type": "string"}, "Ch": {"type": "string"}, "S": {"type": "string"}, "M": {"type": "string"}, "RS": {"type": "string"}, "Beg": {"type": "string"}, "story_classic": {"type": "string"}, "story_dnd": {"type": "string"}}, "required": ["id", "name", "link", "club", "class_classic", "class_dnd", "A", "B", "C", "D", "E", "Ch", "S", "M", "RS", "Beg", "story_classic", "story_dnd"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "03952", "name" : "\u0417\u0430\u043c\u0430\u0439 \u0413\u0430\u043b\u0438\u043d\u0430 \u0421\u0435\u0440\u0433\u0435\u0435\u0432\u043d\u0430 ", "link" : "pages/03952.html", "club" : "\u0414\u0432\u0438\u0436\u0435\u043d\u0438\u0435 (\u0433.\u041a\u0440\u0430\u0441\u043d\u043e\u044f\u0440\u0441\u043a)", "class_classic" : "D", "class_dnd" : "BG", "A" : "0", "B" : "0", "C" : "0", "D" : "0", "E" : "5", "Ch" : "0", "S" : "0", "M" : "0", "RS" : "0", "Beg" : "0", "story_classic" : "22.04.2012 \u2014 \u041e\u0442\u043a\u0440\u044b\u0442\u044b\u0439 \u0442\u0443\u0440\u043d\u0438\u0440\u0433.\u041a\u0440\u0430\u0441\u043d\u043e\u044f\u0440\u0441\u043a : E1/16+4<br><br>09.03.2012 \u2014 \u041a\u0443\u0431\u043e\u043a \u041a\u0425\u041a \u0414\u0432\u0438\u0436\u0435\u043d\u0438\u0435 \u041a\u0440\u0430\u0441\u043d\u043e\u044f\u0440\u0441\u043a : D27/27<br><br>16.10.2011 \u2014 \u041e\u0442\u043a\u0440\u044b\u0442\u044b\u0439 \u0442\u0443\u0440\u043d\u0438\u0440 \u041a\u0440\u0430\u0441\u043d\u043e\u044f\u0440\u0441\u043a : E4/9+1<br><br>", "story_dnd" : ""}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "link": {"type": "string"}, "club": {"type": "string"}, "class_classic": {"type": "string"}, "class_dnd": {"type": "string"}, "A": {"type": "string"}, "B": {"type": "string"}, "C": {"type": "string"}, "D": {"type": "string"}, "E": {"type": "string"}, "Ch": {"type": "string"}, "S": {"type": "string"}, "M": {"type": "string"}, "RS": {"type": "string"}, "Beg": {"type": "string"}, "story_classic": {"type": "string"}, "story_dnd": {"type": "string"}}, "required": ["id", "name", "link", "club", "class_classic", "class_dnd", "A", "B", "C", "D", "E", "Ch", "S", "M", "RS", "Beg", "story_classic", "story_dnd"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 101829563, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes", "src:geom" : "quattroshapes", "wof:geomhash" : "92b34adcc50e33b63d378b6f26f40d5b", "wof:id" : 101829563, "wof:repo" : "whosonfirst-data-admin-fr"}, "bbox" : [7.28351564385457, 47.68950624004987, 7.30475755289132, 47.70261723071741], "geometry" : {"coordinates" : [[[7.30472175351395, 47.69363017406351], [7.30471043600863, 47.69362989532203], [7.30475755289132, 47.69273061043089], [7.30209635684412, 47.69266501874961], [7.30204919354577, 47.69356430231795], [7.29805734143434, 47.69346579149692], [7.29815180516755, 47.69166722791283], [7.29682123730225, 47.69163435994778], [7.29686848921165, 47.69073507818672], [7.29553794609825, 47.69070219471013], [7.29549067098412, 47.69160147580811], [7.2888378626223, 47.69143681249238], [7.28888525376078, 47.69053753471536], [7.28755471994452, 47.69050455419426], [7.28760213217083, 47.68960527666059], [7.28361060964698, 47.68950624004987], [7.28351564385457, 47.69130479070066], [7.2848461962169, 47.69133782041013], [7.28475126835758, 47.6931363707069], [7.2887430739986, 47.69323536678223], [7.28869567651338, 47.69413464329489], [7.29002630470575, 47.69416761030163], [7.28997892831296, 47.69506688705798], [7.29130958126541, 47.69509983855369], [7.29121486855593, 47.69689839213231], [7.29387627195314, 47.69696424925348], [7.2938289588509, 47.69786352673924], [7.29782114519986, 47.69796219308756], [7.29763215024701, 47.70155930678368], [7.29896297498561, 47.70159216586399], [7.29901020367129, 47.70069288740837], [7.30300261751188, 47.70079136559326], [7.30290829733622, 47.70258992605756], [7.30401662098791, 47.70261723071741], [7.30472175351395, 47.69363017406351]]], "type" : "Polygon"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "bin": {"type": "object", "properties": {"git-askpass-env": {"type": "string"}}, "required": ["git-askpass-env"]}, "scripts": {"type": "object", "properties": {"compile": {"type": "string"}, "prepublish": {"type": "string"}}, "required": ["compile", "prepublish"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@types/node": {"type": "string"}, "cross-env": {"type": "string"}, "tslint": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/node", "cross-env", "tslint", "typescript"]}}, "required": ["name", "version", "description", "bin", "scripts", "repository", "author", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "git-askpass-env", "version" : "0.0.3", "description" : "A GIT_ASKPASS that just spews out environment variables", "bin" : {"git-askpass-env" : "./lib/index.js"}, "scripts" : {"compile" : "cross-env NODE_ENV='production' git clean -xdf lib && tsc", "prepublish" : "npm run compile"}, "repository" : {"type" : "git", "url" : "https://github.com/surf-build/ask-pass"}, "author" : "Paul Betts <paul@paulbetts.org>", "license" : "MIT", "bugs" : {"url" : "https://github.com/surf-build/ask-pass/issues"}, "homepage" : "https://github.com/surf-build/ask-pass", "devDependencies" : {"@types/node" : "^9.4.6", "cross-env" : "^3.2.4", "tslint" : "^5.7.0", "typescript" : "^2.5.3"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "bin": {"type": "object", "properties": {"git-askpass-env": {"type": "string"}}, "required": ["git-askpass-env"]}, "scripts": {"type": "object", "properties": {"compile": {"type": "string"}, "prepublish": {"type": "string"}}, "required": ["compile", "prepublish"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@types/node": {"type": "string"}, "cross-env": {"type": "string"}, "tslint": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@types/node", "cross-env", "tslint", "typescript"]}}, "required": ["name", "version", "description", "bin", "scripts", "repository", "author", "license", "bugs", "homepage", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"station" : [{"pref_cd" : 2, "line_cd" : 11205, "line_name" : "JR\u6d25\u8efd\u7dda", "station_cd" : 1120516, "station_g_cd" : 1120516, "station_name" : "\u4eca\u5225", "lon" : 140.490448, "lat" : 41.179741}]}
json_instruct
{"type": "object", "properties": {"station": {"type": "array", "items": {"type": "object", "properties": {"pref_cd": {"type": "integer"}, "line_cd": {"type": "integer"}, "line_name": {"type": "string"}, "station_cd": {"type": "integer"}, "station_g_cd": {"type": "integer"}, "station_name": {"type": "string"}, "lon": {"type": "number"}, "lat": {"type": "number"}}, "required": ["pref_cd", "line_cd", "line_name", "station_cd", "station_g_cd", "station_name", "lon", "lat"]}}}, "required": ["station"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"Device Name": {"type": "string"}, "Type of Device": {"type": "string"}, "Driver Version": {"type": "string"}, "Support e-mail": {"type": "string"}, "Serial Number": {"type": "string"}, "MAC Address": {"type": "string"}, "Person In Charge": {"type": "string"}}, "required": ["Device Name", "Type of Device", "Driver Version", "Support e-mail", "Serial Number", "MAC Address", "Person In Charge"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Device Name" : "CAN BUS", "Type of Device" : "Actuator", "Driver Version" : "2020.03.01", "Support e-mail" : "autonomous@vehicle.com", "Serial Number" : "342-343-2423", "MAC Address" : "AB:00:CD:34:54:AB", "Person In Charge" : "Darth Vader"}
json_instruct
{"type": "object", "properties": {"Device Name": {"type": "string"}, "Type of Device": {"type": "string"}, "Driver Version": {"type": "string"}, "Support e-mail": {"type": "string"}, "Serial Number": {"type": "string"}, "MAC Address": {"type": "string"}, "Person In Charge": {"type": "string"}}, "required": ["Device Name", "Type of Device", "Driver Version", "Support e-mail", "Serial Number", "MAC Address", "Person In Charge"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"debugMode": {"type": "integer"}, "showFPS": {"type": "boolean"}, "frameRate": {"type": "integer"}, "id": {"type": "string"}, "renderMode": {"type": "integer"}, "engineDir": {"type": "string"}, "modules": {"type": "array", "items": {"type": "string"}}, "jsList": {"type": "array", "items": {"type": "string"}}}, "required": ["debugMode", "showFPS", "frameRate", "id", "renderMode", "engineDir", "modules", "jsList"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"debugMode" : 0, "showFPS" : false, "frameRate" : 60, "id" : "gameCanvas", "renderMode" : 0, "engineDir" : "assets/js/", "modules" : ["cocos2d"], "jsList" : ["assets/js/load_assets.js", "assets/js/game_script.js"]}
json_instruct
{"type": "object", "properties": {"debugMode": {"type": "integer"}, "showFPS": {"type": "boolean"}, "frameRate": {"type": "integer"}, "id": {"type": "string"}, "renderMode": {"type": "integer"}, "engineDir": {"type": "string"}, "modules": {"type": "array", "items": {"type": "string"}}, "jsList": {"type": "array", "items": {"type": "string"}}}, "required": ["debugMode", "showFPS", "frameRate", "id", "renderMode", "engineDir", "modules", "jsList"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"lint": {"type": "string"}, "test": {"type": "string"}, "coverage": {"type": "string"}}, "required": ["lint", "test", "coverage"]}, "author": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "peerDependencies": {"type": "object", "properties": {"react": {"type": "string"}, "react-native": {"type": "string"}}, "required": ["react", "react-native"]}, "devDependencies": {"type": "object", "properties": {"babel-eslint": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-airbnb": {"type": "string"}, "eslint-plugin-import": {"type": "string"}, "eslint-plugin-jsx-a11y": {"type": "string"}, "eslint-plugin-react": {"type": "string"}, "coveralls": {"type": "string"}, "istanbul": {"type": "string"}, "mocha": {"type": "string"}}, "required": ["babel-eslint", "eslint", "eslint-config-airbnb", "eslint-plugin-import", "eslint-plugin-jsx-a11y", "eslint-plugin-react", "coveralls", "istanbul", "mocha"]}, "dependencies": {"type": "object", "properties": {"@exponent/react-native-navigator": {"type": "string"}}, "required": ["@exponent/react-native-navigator"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "repository", "bugs", "homepage", "keywords", "peerDependencies", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "react-native-autopilot", "version" : "0.4.1", "description" : "Automatically push and pop navigator routes/scenes/screens if the navigator props was changed.", "main" : "lib/index.js", "scripts" : {"lint" : "eslint lib test", "test" : "mocha --recursive", "coverage" : "istanbul cover ./node_modules/mocha/bin/_mocha --recursive"}, "author" : "Christoph Jerolimov", "license" : "MIT", "repository" : {"type" : "git", "url" : "git+https://github.com/bringnow/react-native-autopilot.git"}, "bugs" : {"url" : "https://github.com/bringnow/react-native-autopilot/issues"}, "homepage" : "https://github.com/bringnow/react-native-autopilot#readme", "keywords" : ["react-native", "react-component", "android", "ios", "navigator", "navigatorios", "exnavigator"], "peerDependencies" : {"react" : ">=15.2", "react-native" : ">=0.30"}, "devDependencies" : {"babel-eslint" : "^6.0.4", "eslint" : "^2.11.1", "eslint-config-airbnb" : "^9.0.1", "eslint-plugin-import" : "^1.8.1", "eslint-plugin-jsx-a11y" : "^1.3.0", "eslint-plugin-react" : "^5.1.1", "coveralls" : "^2.11.4", "istanbul" : "^0.4.1", "mocha" : "^2.3.4"}, "dependencies" : {"@exponent/react-native-navigator" : "^0.4.7"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"lint": {"type": "string"}, "test": {"type": "string"}, "coverage": {"type": "string"}}, "required": ["lint", "test", "coverage"]}, "author": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "peerDependencies": {"type": "object", "properties": {"react": {"type": "string"}, "react-native": {"type": "string"}}, "required": ["react", "react-native"]}, "devDependencies": {"type": "object", "properties": {"babel-eslint": {"type": "string"}, "eslint": {"type": "string"}, "eslint-config-airbnb": {"type": "string"}, "eslint-plugin-import": {"type": "string"}, "eslint-plugin-jsx-a11y": {"type": "string"}, "eslint-plugin-react": {"type": "string"}, "coveralls": {"type": "string"}, "istanbul": {"type": "string"}, "mocha": {"type": "string"}}, "required": ["babel-eslint", "eslint", "eslint-config-airbnb", "eslint-plugin-import", "eslint-plugin-jsx-a11y", "eslint-plugin-react", "coveralls", "istanbul", "mocha"]}, "dependencies": {"type": "object", "properties": {"@exponent/react-native-navigator": {"type": "string"}}, "required": ["@exponent/react-native-navigator"]}}, "required": ["name", "version", "description", "main", "scripts", "author", "license", "repository", "bugs", "homepage", "keywords", "peerDependencies", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Approximation Analysis of Stochastic Gradient Langevin Dynamics by using Fokker-Planck Equation and Ito Process.", "fields" : ["stochastic optimization", "bayesian inference", "fokker planck equation", "bayesian probability", "langevin dynamics"], "abstract" : "The stochastic gradient Langevin dynamics (SGLD) algorithm is appealing for large scale Bayesian learning. The SGLD algorithm seamlessly transit stochastic optimization and Bayesian posterior sampling. However, solid theories, such as convergence proof, have not been developed. We theoretically analyze the SGLD algorithm with constant stepsize in two ways. First, we show by using the Fokker-Planck equation that the probability distribution of random variables generated by the SGLD algorithm converges to the Bayesian posterior. Second, we analyze the convergence of the SGLD algorithm by using the Ito process, which reveals that the SGLD algorithm does not strongly but weakly converges. This result indicates that the SGLD algorithm can be an approximation method for posterior averaging.", "citation" : "Citations (22)", "year" : "2014", "departments" : ["University of Tokyo", "University of Tokyo"], "conf" : "icml", "authors" : ["Issei Sato.....http://dblp.org/pers/hd/s/Sato:Issei", "Hiroshi Nakagawa.....http://dblp.org/pers/hd/n/Nakagawa:Hiroshi"], "pages" : 9}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"directions": {"type": "array", "items": {"type": "string"}}, "ingredients": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "source": {"type": "string"}, "tags": {"type": "array", "items": {}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["directions", "ingredients", "language", "source", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"directions" : ["Preheat oven to 400 degrees F (200 degrees C). Spray 20 muffin cups with cooking spray.", "Place zucchini, onions, and red bell pepper into a food processor, and pulse several times until finely chopped but not liquefied. Place the vegetables into a bowl, and mix in ground turkey, couscous, egg, Worcestershire sauce, and Dijon mustard until thoroughly combined. Fill each prepared muffin cup about 3/4 full. Top each cup with about 1 teaspoon of barbecue sauce.", "Bake in the preheated oven until juices run clear, about 25 minutes. Internal temperature of a muffin measured by an instant-read meat thermometer should be at least 160 degrees F (70 degrees C). Let stand 5 minutes before serving."], "ingredients" : ["2 cups coarsely chopped zucchini", "1 1/2 cups coarsely chopped onions", "1 red bell pepper, coarsely chopped", "1 pound extra lean ground turkey", "1/2 cup uncooked couscous", "1 egg", "2 tablespoons Worcestershire sauce", "1 tablespoon Dijon mustard", "1/2 cup barbecue sauce, or as needed"], "language" : "en-US", "source" : "allrecipes.com", "tags" : [], "title" : "Turkey Veggie Meatloaf Cups", "url" : "http://allrecipes.com/recipe/216688/turkey-veggie-meatloaf-cups/"}
json_instruct
{"type": "object", "properties": {"directions": {"type": "array", "items": {"type": "string"}}, "ingredients": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "source": {"type": "string"}, "tags": {"type": "array", "items": {}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["directions", "ingredients", "language", "source", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"bbox": {"type": "array", "items": {"type": "number"}}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}, "properties": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}, "type": {"type": "string"}}, "required": ["geometry", "properties", "type"]}}, "metadata": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}, "type": {"type": "string"}}, "required": ["bbox", "features", "metadata", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"bbox" : [35.2117, 31.90879, 35.4854, 31.95263], "features" : [{"geometry" : {"coordinates" : [35.4854, 31.9163], "type" : "Point"}, "properties" : {"id" : "m52acf7.point"}, "type" : "Feature"}, {"geometry" : {"coordinates" : [35.298889, 31.929722], "type" : "Point"}, "properties" : {"id" : "m77308e.point"}, "type" : "Feature"}, {"geometry" : {"coordinates" : [35.2117, 31.90879], "type" : "Point"}, "properties" : {"id" : "m857981.point"}, "type" : "Feature"}, {"geometry" : {"coordinates" : [35.295664, 31.940843], "type" : "Point"}, "properties" : {"id" : "m9fd5a0.point"}, "type" : "Feature"}, {"geometry" : {"coordinates" : [35.27447, 31.95263], "type" : "Point"}, "properties" : {"id" : "mfe4d03.point"}, "type" : "Feature"}], "metadata" : {"name" : "Zemaraim"}, "type" : "FeatureCollection"}
json_instruct
{"type": "object", "properties": {"bbox": {"type": "array", "items": {"type": "number"}}, "features": {"type": "array", "items": {"type": "object", "properties": {"geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "number"}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}, "properties": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}, "type": {"type": "string"}}, "required": ["geometry", "properties", "type"]}}, "metadata": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}, "type": {"type": "string"}}, "required": ["bbox", "features", "metadata", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Boudou", "circ" : "2\u00e8me circonscription", "dpt" : "Tarn-et-Garonne", "inscrits" : 545, "abs" : 303, "votants" : 242, "blancs" : 23, "nuls" : 16, "exp" : 203, "res" : [{"nuance" : "FN", "nom" : "M. Romain LOPEZ", "voix" : 104}, {"nuance" : "RDG", "nom" : "Mme Sylvia PINEL", "voix" : 99}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Analyzing multicore dumps to facilitate concurrency bug reproduction.", "fields" : ["multi core processor", "deterministic system", "core dump", "concurrency", "debugging"], "abstract" : "Debugging concurrent programs is difficult. This is primarily because the inherent non-determinism that arises because of scheduler interleavings makes it hard to easily reproduce bugs that may manifest only under certain interleavings. The problem is exacerbated in multi-core environments where there are multiple schedulers, one for each core. In this paper, we propose a reproduction technique for concurrent programs that execute on multi-core platforms. Our technique performs a lightweight analysis of a failing execution that occurs in a multi-core environment, and uses the result of the analysis to enable reproduction of the bug in a single-core system, under the control of a deterministic scheduler. More specifically, our approach automatically identifies the execution point in the re-execution that corresponds to the failure point. It does so by analyzing the failure core dump and leveraging a technique called execution indexing that identifies a related point in the re-execution. By generating a core dump at this point, and comparing the differences betwen the two dumps, we are able to guide a search algorithm to efficiently generate a failure inducing schedule. Our experiments show that our technique is highly effective and has reasonable overhead.", "citation" : "Citations (71)", "year" : "2010", "departments" : ["Purdue University", "Purdue University", "Purdue University"], "conf" : "asplos", "authors" : ["Dasarath Weeratunge.....http://dblp.org/pers/hd/w/Weeratunge:Dasarath", "Xiangyu Zhang.....http://dblp.org/pers/hd/z/Zhang_0001:Xiangyu", "Suresh Jagannathan.....http://dblp.org/pers/hd/j/Jagannathan:Suresh"], "pages" : 12}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "fields": {"type": "array", "items": {"type": "string"}}, "abstract": {"type": "string"}, "citation": {"type": "string"}, "year": {"type": "string"}, "departments": {"type": "array", "items": {"type": "string"}}, "conf": {"type": "string"}, "authors": {"type": "array", "items": {"type": "string"}}, "pages": {"type": "integer"}}, "required": ["title", "fields", "abstract", "citation", "year", "departments", "conf", "authors", "pages"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"body": {"type": "string"}, "user": {"type": "string"}, "url": {"type": "string"}, "updated_at": {"type": "string"}, "created_at": {"type": "string"}, "closed_at": {"type": "string"}, "state": {"type": "string"}, "title": {"type": "string"}, "number": {"type": "integer"}, "milestone": {"type": "null"}, "labels": {"type": "array", "items": {}}, "id": {"type": "integer"}, "html_url": {"type": "string"}, "assignees": {"type": "array", "items": {}}, "comments": {"type": "integer"}}, "required": ["body", "user", "url", "updated_at", "created_at", "closed_at", "state", "title", "number", "milestone", "labels", "id", "html_url", "assignees", "comments"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"body" : "Architecture flags have been added for the AOCC compiler in file microarchitectures.json given below \r\n\r\nFile:\r\nspack/lib/spack/external/archspec/json/cpu/microarchitectures.json", "user" : "GaneshPrasadMA", "url" : "https://api.github.com/repos/spack/spack/issues/20049", "updated_at" : "2020-11-23 09:52:16", "created_at" : "2020-11-23 03:39:56", "closed_at" : "2020-11-23 09:31:06", "state" : "closed", "title" : "Added architecture flags for AOCC compiler", "number" : 20049, "milestone" : null, "labels" : [], "id" : 748439850, "html_url" : "https://github.com/spack/spack/pull/20049", "assignees" : [], "comments" : 2}
json_instruct
{"type": "object", "properties": {"body": {"type": "string"}, "user": {"type": "string"}, "url": {"type": "string"}, "updated_at": {"type": "string"}, "created_at": {"type": "string"}, "closed_at": {"type": "string"}, "state": {"type": "string"}, "title": {"type": "string"}, "number": {"type": "integer"}, "milestone": {"type": "null"}, "labels": {"type": "array", "items": {}}, "id": {"type": "integer"}, "html_url": {"type": "string"}, "assignees": {"type": "array", "items": {}}, "comments": {"type": "integer"}}, "required": ["body", "user", "url", "updated_at", "created_at", "closed_at", "state", "title", "number", "milestone", "labels", "id", "html_url", "assignees", "comments"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"meta": {"type": "object", "properties": {"label": {"type": "string"}, "description": {"type": "string"}, "icon": {"type": "string"}}, "required": ["label", "description", "icon"]}, "defaultDefinableInline": {"type": "boolean"}, "defaultDefinableAtProjectLevel": {"type": "boolean"}, "pluginParams": {"type": "array", "items": {}}, "params": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "credentialRequestSettings": {"type": "object", "properties": {"type": {"type": "string"}, "oauth2Flow": {"type": "string"}, "oauth2Provider": {"type": "string"}, "authorizationEndpoint": {"type": "string"}, "tokenEndpoint": {"type": "string"}, "scope": {"type": "string"}, "resources": {"type": "array", "items": {"type": "string"}}}, "required": ["type", "oauth2Flow", "oauth2Provider", "authorizationEndpoint", "tokenEndpoint", "scope", "resources"]}}, "required": ["name", "type", "credentialRequestSettings"]}}}, "required": ["meta", "defaultDefinableInline", "defaultDefinableAtProjectLevel", "pluginParams", "params"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"meta" : {"label" : "Azure Single Sign On", "description" : "", "icon" : "icon-powerbi"}, "defaultDefinableInline" : true, "defaultDefinableAtProjectLevel" : true, "pluginParams" : [], "params" : [{"name" : "ms-oauth_credentials", "type" : "CREDENTIAL_REQUEST", "credentialRequestSettings" : {"type" : "OAUTH2", "oauth2Flow" : "authorization_code", "oauth2Provider" : "AZURE", "authorizationEndpoint" : "https://login.microsoftonline.com/common/oauth2/authorize", "tokenEndpoint" : "https://login.microsoftonline.com/common/oauth2/token", "scope" : "openid Dataset.ReadWrite.All", "resources" : ["https://analysis.windows.net/powerbi/api"]}}]}
json_instruct
{"type": "object", "properties": {"meta": {"type": "object", "properties": {"label": {"type": "string"}, "description": {"type": "string"}, "icon": {"type": "string"}}, "required": ["label", "description", "icon"]}, "defaultDefinableInline": {"type": "boolean"}, "defaultDefinableAtProjectLevel": {"type": "boolean"}, "pluginParams": {"type": "array", "items": {}}, "params": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "credentialRequestSettings": {"type": "object", "properties": {"type": {"type": "string"}, "oauth2Flow": {"type": "string"}, "oauth2Provider": {"type": "string"}, "authorizationEndpoint": {"type": "string"}, "tokenEndpoint": {"type": "string"}, "scope": {"type": "string"}, "resources": {"type": "array", "items": {"type": "string"}}}, "required": ["type", "oauth2Flow", "oauth2Provider", "authorizationEndpoint", "tokenEndpoint", "scope", "resources"]}}, "required": ["name", "type", "credentialRequestSettings"]}}}, "required": ["meta", "defaultDefinableInline", "defaultDefinableAtProjectLevel", "pluginParams", "params"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"snap.svg-min.js": {"type": "string"}, "snap.svg.js": {"type": "string"}}, "required": ["snap.svg-min.js", "snap.svg.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"snap.svg-min.js" : "sha256-Hr2qLip2tc7B/X8TtGoArfCa8briWm7sgGyqbEunIa4=", "snap.svg.js" : "sha256-MDt3Fro4IiM4Gwh1DrnNMEl0Gg7h0aqlQBE8wzKo6BA="}
json_instruct
{"type": "object", "properties": {"snap.svg-min.js": {"type": "string"}, "snap.svg.js": {"type": "string"}}, "required": ["snap.svg-min.js", "snap.svg.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "dependencies": {"type": "object", "properties": {"he": {"type": "string"}}, "required": ["he"]}, "main": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"web": {"type": "string"}}, "required": ["web"]}}, "required": ["name", "description", "version", "author", "engines", "dependencies", "main", "repository", "bugs"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "lwink", "description" : "Lwink is a Twitter unique link tracker, expander and emitter", "version" : "0.0.2", "author" : "George Stagas <gstagas@gmail.com>", "engines" : {"node" : ">=0.4.0"}, "dependencies" : {"he" : ">=0.4.1"}, "main" : "./lwink", "repository" : {"type" : "git", "url" : "https://github.com/stagas/lwink"}, "bugs" : {"web" : "https://github.com/stagas/lwink/issues"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "author": {"type": "string"}, "engines": {"type": "object", "properties": {"node": {"type": "string"}}, "required": ["node"]}, "dependencies": {"type": "object", "properties": {"he": {"type": "string"}}, "required": ["he"]}, "main": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "bugs": {"type": "object", "properties": {"web": {"type": "string"}}, "required": ["web"]}}, "required": ["name", "description", "version", "author", "engines", "dependencies", "main", "repository", "bugs"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"date": {"type": "string"}, "cve": {"type": "string"}, "summary": {"type": "string"}, "link": {"type": "string"}, "versions": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}}, "required": ["date", "cve", "summary", "link", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"date" : "January 4, 2022", "cve" : "CVE-2021-45116", "summary" : "Potential information disclosure in dictsort template filter", "link" : "https://www.djangoproject.com/weblog/2022/jan/04/security-releases/", "versions" : [["2.2", "2.2.26"], ["3.2", "3.2.11"], ["4.0", "4.0.1"]]}
json_instruct
{"type": "object", "properties": {"date": {"type": "string"}, "cve": {"type": "string"}, "summary": {"type": "string"}, "link": {"type": "string"}, "versions": {"type": "array", "items": {"type": "array", "items": {"type": "string"}}}}, "required": ["date", "cve", "summary", "link", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"stationGroupId": {"type": "integer"}, "stations": {"type": "array", "items": {"type": "string"}}}, "required": ["stationGroupId", "stations"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"stationGroupId" : 1192704, "stations" : ["1192704"]}
json_instruct
{"type": "object", "properties": {"stationGroupId": {"type": "integer"}, "stations": {"type": "array", "items": {"type": "string"}}}, "required": ["stationGroupId", "stations"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"code": {"type": "string"}, "messages": {"type": "string"}, "value": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "id_kecamatan": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "id_kecamatan", "name"]}}}, "required": ["code", "messages", "value"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"code" : "200", "messages" : "Successfully received data", "value" : [{"id" : "9201051001", "id_kecamatan" : "920105", "name" : "Katinim"}, {"id" : "9201051006", "id_kecamatan" : "920105", "name" : "Majener"}, {"id" : "9201051007", "id_kecamatan" : "920105", "name" : "Majaran"}, {"id" : "9201051009", "id_kecamatan" : "920105", "name" : "Matawolot"}, {"id" : "9201052011", "id_kecamatan" : "920105", "name" : "Walal"}, {"id" : "9201052012", "id_kecamatan" : "920105", "name" : "Malaus"}, {"id" : "9201052018", "id_kecamatan" : "920105", "name" : "Rawa Sugi"}]}
json_instruct
{"type": "object", "properties": {"code": {"type": "string"}, "messages": {"type": "string"}, "value": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "id_kecamatan": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "id_kecamatan", "name"]}}}, "required": ["code", "messages", "value"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "dependencies": {"type": "object", "properties": {"cookie-parser": {"type": "string"}, "debug": {"type": "string"}, "express": {"type": "string"}, "morgan": {"type": "string"}}, "required": ["cookie-parser", "debug", "express", "morgan"]}, "description": {"type": "string"}, "main": {"type": "string"}, "devDependencies": {"type": "object", "properties": {}, "required": []}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "private", "scripts", "dependencies", "description", "main", "devDependencies", "repository", "keywords", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "poli-care", "version" : "1.0.0", "private" : true, "scripts" : {"start" : "node ./bin/www"}, "dependencies" : {"cookie-parser" : "~1.4.4", "debug" : "~2.6.9", "express" : "~4.16.1", "morgan" : "~1.9.1"}, "description" : "API to manage the information of the Poli Care APP", "main" : "app.js", "devDependencies" : {}, "repository" : {"type" : "git", "url" : "git+https://github.com/Caivan/poli-care-API.git"}, "keywords" : ["Poli", "Coronavirus"], "author" : "Carlos Ivan Rivera Parra", "license" : "MIT", "bugs" : {"url" : "https://github.com/Caivan/poli-care-API/issues"}, "homepage" : "https://github.com/Caivan/poli-care-API#readme"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "private": {"type": "boolean"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "dependencies": {"type": "object", "properties": {"cookie-parser": {"type": "string"}, "debug": {"type": "string"}, "express": {"type": "string"}, "morgan": {"type": "string"}}, "required": ["cookie-parser", "debug", "express", "morgan"]}, "description": {"type": "string"}, "main": {"type": "string"}, "devDependencies": {"type": "object", "properties": {}, "required": []}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "bugs": {"type": "object", "properties": {"url": {"type": "string"}}, "required": ["url"]}, "homepage": {"type": "string"}}, "required": ["name", "version", "private", "scripts", "dependencies", "description", "main", "devDependencies", "repository", "keywords", "author", "license", "bugs", "homepage"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {"type": "string"}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"other_ids" : [], "mRNA_sequence" : [{"index" : 0, "type" : "five_prime_UTR", "sequence" : "GTCACATTTGTACAACAAGGGTTTAGCAGAGAAACTTTATGCTGTCGAGTTCCTAATCACCACCATCTAACCATCACTTATAAAAGTATCAAAAA"}, {"index" : 1, "type" : "CDS", "sequence" : "ATGGTGAACATTCCCAAGACCCGTAAGACTTACTGTCCTGGTAAGAACTGCCGCAAGCACACTGTCCACAGAGTCACCCAATACAAGAAGGGACCTGATTCCAAGCTTGCTCAGGGTAAGCGTCGTTATGACCGCAAGCAAAGTGGTTTTGGTGGTCAAACTAAGCCCGTTTTCCACAAGAAGGCTAAGGTTACCAAGAAGGTTGTCCTTCGTTTGGAATGCGTCTCTTGCAAATACAAGAATCAATTGGTTTTGAAGCGTTGCAAGCATTTCGAGCTTGGTGGTGAAAAGAAGACTAAG"}, {"index" : 2, "type" : "intron", "sequence" : "GTATGTCGAAGAATGCTGATAACGAGTGGATTGGATTTAGACGAATTTGTAAAAGAGTTTTTGCCGTGGTTGAATACCTCTCAAATCCAGAAAAAAAATTTTGCAAAGCGCTTTTATGAATTGTCTTTTGTTGAGTTTCATCCTTATTATCGATCATTTTCTTTATTTCATCTACTAACAATCATTTTAG"}, {"index" : 3, "type" : "CDS", "sequence" : "GGTGCTGCTATCCAATTCTAA"}, {"index" : 4, "type" : "three_prime_UTR", "sequence" : "GTGTTTTAGCAAATACAATTTTCTTCTTTTACGGTGATCCTAAAAGCAATTCAAA"}], "other_names" : ["rpl36a"], "id" : "SPAC15E1.03", "name" : "rpl42"}
json_instruct
{"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {"type": "string"}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
[["130726210201", "\u767d\u8349\u6751\u59d4\u4f1a", "210", "0"], ["130726210202", "\u5a18\u5b50\u57ce\u6751\u59d4\u4f1a", "220", "0"], ["130726210203", "\u697c\u5b50\u6e7e\u6751\u59d4\u4f1a", "220", "0"], ["130726210204", "\u6866\u6811\u6c9f\u6751\u59d4\u4f1a", "220", "0"], ["130726210205", "\u6cb3\u6da7\u6e20\u6751\u59d4\u4f1a", "220", "0"], ["130726210206", "\u4e94\u5c94\u6751\u59d4\u4f1a", "220", "0"], ["130726210207", "\u6cc9\u5b50\u6da7\u6751\u59d4\u4f1a", "220", "0"], ["130726210208", "\u524d\u6881\u6751\u59d4\u4f1a", "220", "0"], ["130726210209", "\u897f\u5c0f\u7f8a\u5708\u6751\u59d4\u4f1a", "220", "0"], ["130726210210", "\u897f\u7ec6\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130726210211", "\u949f\u697c\u6751\u59d4\u4f1a", "220", "0"], ["130726210212", "\u897f\u6237\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130726210213", "\u5927\u9152\u52a1\u5934\u6751\u59d4\u4f1a", "220", "0"], ["130726210214", "\u5c0f\u9152\u52a1\u5934\u6751\u59d4\u4f1a", "220", "0"], ["130726210215", "\u5317\u8f9b\u5e84\u6751\u59d4\u4f1a", "220", "0"], ["130726210216", "\u6c34\u5cea\u6751\u59d4\u4f1a", "220", "0"], ["130726210217", "\u738b\u5bb6\u6881\u6751\u59d4\u4f1a", "220", "0"], ["130726210218", "\u97e9\u5bb6\u6e7e\u6751\u59d4\u4f1a", "220", "0"], ["130726210219", "\u848b\u5bb6\u6881\u6751\u59d4\u4f1a", "220", "0"], ["130726210220", "\u54b8\u5468\u6751\u59d4\u4f1a", "220", "0"], ["130726210221", "\u70df\u58a9\u5761\u6751\u59d4\u4f1a", "220", "0"]]
json_instruct
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"axios": {"type": "string"}, "compression": {"type": "string"}, "cors": {"type": "string"}, "dotenv": {"type": "string"}, "express": {"type": "string"}, "helmet": {"type": "string"}, "mongodb": {"type": "string"}, "node-cron": {"type": "string"}, "saslprep": {"type": "string"}}, "required": ["axios", "compression", "cors", "dotenv", "express", "helmet", "mongodb", "node-cron", "saslprep"]}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}}, "required": ["nodemon"]}}, "required": ["name", "version", "main", "scripts", "repository", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "linkapi-entrevista", "version" : "1.0.0", "main" : "index.js", "scripts" : {"start" : "node index.js"}, "repository" : "git@github.com:higordiego/linkapi-entrevista.git", "author" : "Higor Diego <higordiegoti@gmail.com>", "license" : "MIT", "dependencies" : {"axios" : "^0.21.1", "compression" : "^1.7.4", "cors" : "^2.8.5", "dotenv" : "^8.2.0", "express" : "^4.17.1", "helmet" : "^4.4.1", "mongodb" : "^3.6.3", "node-cron" : "^2.0.3", "saslprep" : "^1.0.3"}, "devDependencies" : {"nodemon" : "^2.0.7"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}}, "required": ["start"]}, "repository": {"type": "string"}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"axios": {"type": "string"}, "compression": {"type": "string"}, "cors": {"type": "string"}, "dotenv": {"type": "string"}, "express": {"type": "string"}, "helmet": {"type": "string"}, "mongodb": {"type": "string"}, "node-cron": {"type": "string"}, "saslprep": {"type": "string"}}, "required": ["axios", "compression", "cors", "dotenv", "express", "helmet", "mongodb", "node-cron", "saslprep"]}, "devDependencies": {"type": "object", "properties": {"nodemon": {"type": "string"}}, "required": ["nodemon"]}}, "required": ["name", "version", "main", "scripts", "repository", "author", "license", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "clean": {"type": "string"}, "lodash": {"type": "string"}, "prepublishOnly": {"type": "string"}}, "required": ["build", "clean", "lodash", "prepublishOnly"]}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "files": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@goldfishjs/module-usage": {"type": "string"}, "@types/lodash": {"type": "string"}, "@types/lodash-es": {"type": "string"}, "lodash-cli": {"type": "string"}, "lodash-es": {"type": "string"}}, "required": ["@goldfishjs/module-usage", "@types/lodash", "@types/lodash-es", "lodash-cli", "lodash-es"]}, "devDependencies": {"type": "object", "properties": {"gulp-if": {"type": "string"}, "gulp-replace": {"type": "string"}}, "required": ["gulp-if", "gulp-replace"]}, "registry": {"type": "string"}}, "required": ["name", "version", "description", "main", "scripts", "publishConfig", "repository", "keywords", "files", "author", "license", "dependencies", "devDependencies", "registry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@goldfishjs/utils", "version" : "1.9.2", "description" : "goldfish-utils", "main" : "lib/index.js", "scripts" : {"build" : "npm run clean && ../../node_modules/.bin/gulp copy && ../../node_modules/.bin/gulp ts", "clean" : "rm -rf lib", "lodash" : "lodash include='cloneDeep,find,isEqual,omit,pick,debounce' exports='es' modularize -o './src/lodash'", "prepublishOnly" : "npm run lodash"}, "publishConfig" : {"access" : "public"}, "repository" : {"type" : "git", "url" : "https://github.com/alipay/goldfish/blob/master/packages/requester/README.md"}, "keywords" : ["request", "mini", "app"], "files" : ["lib", "babel-plugin-import-config.js"], "author" : "likun7981 <likun7891@gmail.com>", "license" : "MIT", "dependencies" : {"@goldfishjs/module-usage" : "^1.9.2", "@types/lodash" : "^4.14.161", "@types/lodash-es" : "^4.17.3", "lodash-cli" : "^4.17.5", "lodash-es" : "^4.17.15"}, "devDependencies" : {"gulp-if" : "^3.0.0", "gulp-replace" : "^1.0.0"}, "registry" : "https://registry.npmjs.org/"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"build": {"type": "string"}, "clean": {"type": "string"}, "lodash": {"type": "string"}, "prepublishOnly": {"type": "string"}}, "required": ["build", "clean", "lodash", "prepublishOnly"]}, "publishConfig": {"type": "object", "properties": {"access": {"type": "string"}}, "required": ["access"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "files": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@goldfishjs/module-usage": {"type": "string"}, "@types/lodash": {"type": "string"}, "@types/lodash-es": {"type": "string"}, "lodash-cli": {"type": "string"}, "lodash-es": {"type": "string"}}, "required": ["@goldfishjs/module-usage", "@types/lodash", "@types/lodash-es", "lodash-cli", "lodash-es"]}, "devDependencies": {"type": "object", "properties": {"gulp-if": {"type": "string"}, "gulp-replace": {"type": "string"}}, "required": ["gulp-if", "gulp-replace"]}, "registry": {"type": "string"}}, "required": ["name", "version", "description", "main", "scripts", "publishConfig", "repository", "keywords", "files", "author", "license", "dependencies", "devDependencies", "registry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "users-db": {"type": "string"}, "bucket-db": {"type": "string"}, "auth": {"type": "string"}, "circle": {"type": "string"}, "start": {"type": "string"}}, "required": ["test", "users-db", "bucket-db", "auth", "circle", "start"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}, "jsonwebtoken": {"type": "string"}, "lodash": {"type": "string"}, "lowdb": {"type": "string"}, "oompa": {"type": "string"}, "oompa-cache": {"type": "string"}, "oompa-ensure": {"type": "string"}, "oompa-token": {"type": "string"}, "uuid": {"type": "string"}}, "required": ["chalk", "jsonwebtoken", "lodash", "lowdb", "oompa", "oompa-cache", "oompa-ensure", "oompa-token", "uuid"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "oompa-playground", "version" : "1.0.0", "description" : "", "main" : "index.js", "scripts" : {"test" : "echo \"Error: no test specified\" && exit 1", "users-db" : "node db.js 42000 users.json", "bucket-db" : "node db.js 42001 resources.json", "auth" : "node auth.js", "circle" : "node circle.js", "start" : "node ."}, "keywords" : [], "author" : "", "license" : "ISC", "dependencies" : {"chalk" : "^1.1.3", "jsonwebtoken" : "^7.0.1", "lodash" : "^4.13.1", "lowdb" : "^0.13.1", "oompa" : "^0.5.0", "oompa-cache" : "^1.0.0", "oompa-ensure" : "^1.0.0", "oompa-token" : "^1.0.0", "uuid" : "^2.0.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}, "users-db": {"type": "string"}, "bucket-db": {"type": "string"}, "auth": {"type": "string"}, "circle": {"type": "string"}, "start": {"type": "string"}}, "required": ["test", "users-db", "bucket-db", "auth", "circle", "start"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}, "jsonwebtoken": {"type": "string"}, "lodash": {"type": "string"}, "lowdb": {"type": "string"}, "oompa": {"type": "string"}, "oompa-cache": {"type": "string"}, "oompa-ensure": {"type": "string"}, "oompa-token": {"type": "string"}, "uuid": {"type": "string"}}, "required": ["chalk", "jsonwebtoken", "lodash", "lowdb", "oompa", "oompa-cache", "oompa-ensure", "oompa-token", "uuid"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"_id": {"type": "string"}, "_tpl": {"type": "string"}, "parentId": {"type": "string"}, "slotId": {"type": "string"}}, "required": ["_id", "_tpl", "parentId", "slotId"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"_id" : "5e064f56eb009468d90ba80c", "_tpl" : "5abcbb20d8ce87001773e258", "parentId" : "5e064f56eb009468d90ba808", "slotId" : "mod_sight_rear"}
json_instruct
{"type": "object", "properties": {"_id": {"type": "string"}, "_tpl": {"type": "string"}, "parentId": {"type": "string"}, "slotId": {"type": "string"}}, "required": ["_id", "_tpl", "parentId", "slotId"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"value_locale": {"type": "string"}, "value_dateFormatFull": {"type": "string"}, "title": {"type": "string"}, "noTitle": {"type": "string"}, "creator": {"type": "string"}, "presenter": {"type": "string"}, "views": {"type": "string"}, "series": {"type": "string"}, "recordingDate": {"type": "string"}, "description": {"type": "string"}, "noDescriptionAvailable": {"type": "string"}}, "required": ["value_locale", "value_dateFormatFull", "title", "noTitle", "creator", "presenter", "views", "series", "recordingDate", "description", "noDescriptionAvailable"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"value_locale" : "en", "value_dateFormatFull" : "Do MMMM YYYY, h:mm:ss a", "title" : "Title", "noTitle" : "No title", "creator" : "Creator", "presenter" : "Contributor", "views" : "Views", "series" : "Series", "recordingDate" : "Recording date", "description" : "Description", "noDescriptionAvailable" : "No description available."}
json_instruct
{"type": "object", "properties": {"value_locale": {"type": "string"}, "value_dateFormatFull": {"type": "string"}, "title": {"type": "string"}, "noTitle": {"type": "string"}, "creator": {"type": "string"}, "presenter": {"type": "string"}, "views": {"type": "string"}, "series": {"type": "string"}, "recordingDate": {"type": "string"}, "description": {"type": "string"}, "noDescriptionAvailable": {"type": "string"}}, "required": ["value_locale", "value_dateFormatFull", "title", "noTitle", "creator", "presenter", "views", "series", "recordingDate", "description", "noDescriptionAvailable"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"2593": {"type": "string"}, "2591": {"type": "string"}}, "required": ["2593", "2591"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"2593" : "2594", "2591" : "2592"}
json_instruct
{"type": "object", "properties": {"2593": {"type": "string"}, "2591": {"type": "string"}}, "required": ["2593", "2591"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"dailyDeaths": {"type": "array", "items": {"type": "integer"}}}, "required": ["dailyDeaths"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"dailyDeaths" : [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 1, 0, 0, 2, 1, 1, 2, 2, 2, 1, 1, 4, 1, 2, 1, 1, 2, 4, 3, 5, 2, 0, 2, 2, 3, 2, 9, 7, 10, 7, 6, 8, 11, 5, 6, 3, 3, 5, 9, 10, 8, 9, 7, 3, 10, 9, 11, 7, 8, 6, 4, 6, 8, 10, 10, 5, 4, 2, 4, 6, 4, 7, 2, 5, 3, 2, 5, 6, 7, 4, 4, 3, 2, 2, 3, 4, 2, 4, 4, 1, 1, 5, 3, 5, 4, 2, 3, 1, 3, 4, 3, 3, 3, 3, 2, 3, 1, 0, 4, 5, 4, 4, 4, 4, 5, 4, 2, 1, 2, 6, 4, 4, 4, 3, 1, 2, 3, 4, 4, 4, 3, 0, 5, 4, 3, 1, 3, 2, 2, 2, 2, 2, 3, 1, 2, 1, 3, 3, 2, 1, 3, 1, 1, 1, 3, 4, 2, 2, 4, 4, 1, 1, 2, 3, 5, 3, 4, 5, 1, 3, 1, 3, 2, 2, 3, 2, 4, 4, 2, 3, 2, 3, 5, 4, 4, 4, 7, 3, 7, 6, 3, 6, 8, 4, 8, 6, 4, 7, 9, 4, 7, 9, 10, 4, 2, 3, 7, 7, 4, 6, 6, 3, 4, 3, 5, 5, 5, 4, 3, 5, 5, 5, 4, 3, 2, 3, 4, 6, 9, 2, 2, 2, 3, 2, 2, 1, 1, 2, 1, 3, 2, 1, 1, 2, 2, 3, 2, 6, 3, 5, 5, 0, 1, 0, 1, 1, 0, 0, 3, 2, 3, 1, 1, 1, 2, 0, 3, 2, 1, 0, 1, 1, 2, 1, 0, 1, 0, 0, 0, 2, 2, 1, 2, 1, 0, 0, 1, 0, 0, 1, 2, 1, 0, 1, 0, 0, 2, 3, 0, 1, 0, 1, 0, 0, 1, 1, 1, 2, 0, 2, 3]}
json_instruct
{"type": "object", "properties": {"dailyDeaths": {"type": "array", "items": {"type": "integer"}}}, "required": ["dailyDeaths"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "03", "provinceId" : "11", "regencyId" : "03", "name" : "Idi Rayeuk"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "provinceId": {"type": "string"}, "regencyId": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "provinceId", "regencyId", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "YezWallet", "displayName" : "YezWallet"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "displayName": {"type": "string"}}, "required": ["name", "displayName"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "is_illegal": {"type": "boolean"}, "is_custom": {"type": "boolean"}, "text": {"type": "string"}, "images": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "attribute": {"type": "string"}, "atk": {"type": "integer"}, "species": {"type": "string"}, "monster_type": {"type": "string"}, "is_pendulum": {"type": "boolean"}, "ability": {"type": "string"}, "has_effect": {"type": "boolean"}, "def": {"type": "integer"}, "level": {"type": "integer"}, "is_tuner": {"type": "boolean"}}, "required": ["id", "name", "is_illegal", "is_custom", "text", "images", "type", "attribute", "atk", "species", "monster_type", "is_pendulum", "ability", "has_effect", "def", "level", "is_tuner"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 6276588, "name" : "Karakuri Ninja mdl 919 \"Kuick\"", "is_illegal" : false, "is_custom" : false, "text" : "This card must attack if able. When this face-up card is selected as an attack target, change its battle position. When this card destroys an opponent's monster by battle and sends it to the Graveyard, select 1 Level 4 or lower \"Karakuri\" monster in your Graveyard, and Special Summon it in face-up Defense Position.", "images" : ["https://storage.googleapis.com/ygoprodeck.com/pics/6276588.jpg"], "type" : "Monster", "attribute" : "EARTH", "atk" : 1700, "species" : "Machine", "monster_type" : "", "is_pendulum" : false, "ability" : "", "has_effect" : true, "def" : 1500, "level" : 4, "is_tuner" : false}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "is_illegal": {"type": "boolean"}, "is_custom": {"type": "boolean"}, "text": {"type": "string"}, "images": {"type": "array", "items": {"type": "string"}}, "type": {"type": "string"}, "attribute": {"type": "string"}, "atk": {"type": "integer"}, "species": {"type": "string"}, "monster_type": {"type": "string"}, "is_pendulum": {"type": "boolean"}, "ability": {"type": "string"}, "has_effect": {"type": "boolean"}, "def": {"type": "integer"}, "level": {"type": "integer"}, "is_tuner": {"type": "boolean"}}, "required": ["id", "name", "is_illegal", "is_custom", "text", "images", "type", "attribute", "atk", "species", "monster_type", "is_pendulum", "ability", "has_effect", "def", "level", "is_tuner"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"appid": {"type": "integer"}, "name": {"type": "string"}, "windows": {"type": "boolean"}, "mac": {"type": "boolean"}, "linux": {"type": "boolean"}, "early_access": {"type": "boolean"}, "lookup_time": {"type": "integer"}}, "required": ["appid", "name", "windows", "mac", "linux", "early_access", "lookup_time"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"appid" : 3530, "name" : "Amazing Adventures Around the World", "windows" : true, "mac" : false, "linux" : false, "early_access" : false, "lookup_time" : 1490962336}
json_instruct
{"type": "object", "properties": {"appid": {"type": "integer"}, "name": {"type": "string"}, "windows": {"type": "boolean"}, "mac": {"type": "boolean"}, "linux": {"type": "boolean"}, "early_access": {"type": "boolean"}, "lookup_time": {"type": "integer"}}, "required": ["appid", "name", "windows", "mac", "linux", "early_access", "lookup_time"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"explorer.sources": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "expand": {"type": "boolean"}}, "required": ["name", "expand"]}}, "explorer.keyMappings": {"type": "object", "properties": {"<space>": {"type": "string"}}, "required": ["<space>"]}, "explorer.presets": {"type": "object", "properties": {"floating": {"type": "object", "properties": {"position": {"type": "string"}}, "required": ["position"]}}, "required": ["floating"]}, "explorer.icon.enableNerdfont": {"type": "boolean"}, "explorer.buffer.tabOnly": {"type": "boolean"}, "explorer.file.autoReveal": {"type": "boolean"}, "explorer.debug": {"type": "boolean"}}, "required": ["explorer.sources", "explorer.keyMappings", "explorer.presets", "explorer.icon.enableNerdfont", "explorer.buffer.tabOnly", "explorer.file.autoReveal", "explorer.debug"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"explorer.sources" : [{"name" : "buffer", "expand" : false}, {"name" : "file", "expand" : true}], "explorer.keyMappings" : {"<space>" : "toggleSelection"}, "explorer.presets" : {"floating" : {"position" : "floating"}}, "explorer.icon.enableNerdfont" : true, "explorer.buffer.tabOnly" : true, "explorer.file.autoReveal" : false, "explorer.debug" : true}
json_instruct
{"type": "object", "properties": {"explorer.sources": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "expand": {"type": "boolean"}}, "required": ["name", "expand"]}}, "explorer.keyMappings": {"type": "object", "properties": {"<space>": {"type": "string"}}, "required": ["<space>"]}, "explorer.presets": {"type": "object", "properties": {"floating": {"type": "object", "properties": {"position": {"type": "string"}}, "required": ["position"]}}, "required": ["floating"]}, "explorer.icon.enableNerdfont": {"type": "boolean"}, "explorer.buffer.tabOnly": {"type": "boolean"}, "explorer.file.autoReveal": {"type": "boolean"}, "explorer.debug": {"type": "boolean"}}, "required": ["explorer.sources", "explorer.keyMappings", "explorer.presets", "explorer.icon.enableNerdfont", "explorer.buffer.tabOnly", "explorer.file.autoReveal", "explorer.debug"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"address": {"type": "string"}, "cert_auth_type": {"type": "string"}, "cert_sign": {"type": "string"}, "cert_user_id": {"type": "string"}, "files": {"type": "object", "properties": {"data.json": {"type": "object", "properties": {"sha512": {"type": "string"}, "size": {"type": "integer"}}, "required": ["sha512", "size"]}}, "required": ["data.json"]}, "inner_path": {"type": "string"}, "modified": {"type": "number"}, "signs": {"type": "object", "properties": {"1EM7qKQzKiyZCtdQPb5EZMAFnV71KTR61T": {"type": "string"}}, "required": ["1EM7qKQzKiyZCtdQPb5EZMAFnV71KTR61T"]}}, "required": ["address", "cert_auth_type", "cert_sign", "cert_user_id", "files", "inner_path", "modified", "signs"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"address" : "1oranGeS2xsKZ4jVsu9SVttzgkYXu4k9v", "cert_auth_type" : "web", "cert_sign" : "HP8H293Wm2xRIeR0zx+mIbqPQBvn/kD4iMIOt/Sv1CbHJuQn/0GD3bOlin0KrW/jykSFzbPvvquZ9SnuAO8ZJd8=", "cert_user_id" : "aramis@zeroid.bit", "files" : {"data.json" : {"sha512" : "2b2c7206536e16782b793ae406cf5cb8b06b6c56d438bf809a8b3a250e9fa7c3", "size" : 337}}, "inner_path" : "data/users/1EM7qKQzKiyZCtdQPb5EZMAFnV71KTR61T/content.json", "modified" : 1483473014.514, "signs" : {"1EM7qKQzKiyZCtdQPb5EZMAFnV71KTR61T" : "G4DkA8DsYUpddNkAjuR8fhZHtrX2xVPHFusgZ8LxNhdR/KWzREdgz8glOyJwPY4rDUHrY3eazi6vp3g/1wtjLNs="}}
json_instruct
{"type": "object", "properties": {"address": {"type": "string"}, "cert_auth_type": {"type": "string"}, "cert_sign": {"type": "string"}, "cert_user_id": {"type": "string"}, "files": {"type": "object", "properties": {"data.json": {"type": "object", "properties": {"sha512": {"type": "string"}, "size": {"type": "integer"}}, "required": ["sha512", "size"]}}, "required": ["data.json"]}, "inner_path": {"type": "string"}, "modified": {"type": "number"}, "signs": {"type": "object", "properties": {"1EM7qKQzKiyZCtdQPb5EZMAFnV71KTR61T": {"type": "string"}}, "required": ["1EM7qKQzKiyZCtdQPb5EZMAFnV71KTR61T"]}}, "required": ["address", "cert_auth_type", "cert_sign", "cert_user_id", "files", "inner_path", "modified", "signs"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"id": {"type": "string"}, "timestamp": {"type": "string"}, "source": {"type": "string"}, "header": {"type": "string"}, "content": {"type": "string"}, "language": {"type": "string"}, "experience": {"type": "string"}, "employment_time": {"type": "string"}, "poster": {"type": "string"}, "application_link": {"type": "string"}, "company_name": {"type": "string"}, "location": {"type": "string"}, "deadline": {"type": "string"}, "community_only": {"type": "string"}, "contact_name": {"type": "string"}}, "required": ["id", "timestamp", "source", "header", "content", "language", "experience", "employment_time", "poster", "application_link", "company_name", "location", "deadline", "community_only", "contact_name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "0511cf7f-f1df-423d-8474-fb82b36ecf16", "timestamp" : "2021-04-09T23:41:23.668Z", "source" : "Anazing Jobs", "header" : "Backend Developer (w/m/d)", "content" : "Do you hate javascript? Does CSS give you nightmares? Did you think CSP was the name of some drug? Then get in touch<br>We're looking for a Golang rockstar with a passion for strongly typed programming languages.", "language" : "es", "experience" : "junior", "employment_time" : "part time", "poster" : "Mary Jane", "application_link" : "https://www.redi-school.org", "company_name" : "ReDi School of Digital Integration", "location" : "Munich, Germany", "deadline" : "August 2021", "community_only" : "false", "contact_name" : "Bob Redi"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "timestamp": {"type": "string"}, "source": {"type": "string"}, "header": {"type": "string"}, "content": {"type": "string"}, "language": {"type": "string"}, "experience": {"type": "string"}, "employment_time": {"type": "string"}, "poster": {"type": "string"}, "application_link": {"type": "string"}, "company_name": {"type": "string"}, "location": {"type": "string"}, "deadline": {"type": "string"}, "community_only": {"type": "string"}, "contact_name": {"type": "string"}}, "required": ["id", "timestamp", "source", "header", "content", "language", "experience", "employment_time", "poster", "application_link", "company_name", "location", "deadline", "community_only", "contact_name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"946803927838": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "946803929749": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803929751": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803931953": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803932373": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803932374": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803933251": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803933922": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803933923": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803934789": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803936562": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803936563": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803942469": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["946803927838", "946803929749", "946803929751", "946803931953", "946803932373", "946803932374", "946803933251", "946803933922", "946803933923", "946803934789", "946803936562", "946803936563", "946803942469"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"946803927838" : {"type" : "book open", "bookName" : "Epic%20Quest", "subjectName" : "school", "fName" : "users/My0vYW5kcm9pZF9hc3NldC93d3cvc2Nob29sL0VwaWMlMjBRdWVzdC92YXJpYWJsZS1FUV9XT1JMRF95b3UtRVElMjBXb3JsZCUyME1hcCUyMFNlYXJjaC5odG1sLWFuYWx5dGljcy05NDY4MDM5Mjc3NzY=.json"}, "946803929749" : {"type" : "st"}, "946803929751" : {"type" : "ss"}, "946803931953" : {"type" : "sf"}, "946803932373" : {"type" : "st"}, "946803932374" : {"type" : "ss"}, "946803933251" : {"type" : "sf"}, "946803933922" : {"type" : "st"}, "946803933923" : {"type" : "ss"}, "946803934789" : {"type" : "sf"}, "946803936562" : {"type" : "st"}, "946803936563" : {"type" : "ss"}, "946803942469" : {"type" : "sf"}}
json_instruct
{"type": "object", "properties": {"946803927838": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "946803929749": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803929751": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803931953": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803932373": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803932374": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803933251": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803933922": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803933923": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803934789": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803936562": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803936563": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "946803942469": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "required": ["946803927838", "946803929749", "946803929751", "946803931953", "946803932373", "946803932374", "946803933251", "946803933922", "946803933923", "946803934789", "946803936562", "946803936563", "946803942469"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Grane", "dpt" : "Dr\u00f4me", "inscrits" : 1509, "abs" : 274, "votants" : 1235, "blancs" : 28, "nuls" : 15, "exp" : 1192, "res" : [{"panneau" : "9", "voix" : 279}, {"panneau" : "2", "voix" : 277}, {"panneau" : "3", "voix" : 252}, {"panneau" : "11", "voix" : 184}, {"panneau" : "4", "voix" : 81}, {"panneau" : "1", "voix" : 51}, {"panneau" : "8", "voix" : 21}, {"panneau" : "6", "voix" : 20}, {"panneau" : "10", "voix" : 13}, {"panneau" : "5", "voix" : 12}, {"panneau" : "7", "voix" : 2}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"panneau": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["panneau", "voix"]}}}, "required": ["nom", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}