PMCID
string
Sentences
string
ner
list
PMC9436459
–Kuwanon J (81)Hep3B8.55 μM > 30 μM (ALV)P-3885.9 μg/mL –HIF-1*4.10 μM 0.0572 μM (ALV)VEGF*3.14 μM 0.0795 μM (ALV)Kuwanon Q (83)Hep3B5.94 μM > 30 μM (ALV)HIF-1*3.80 μM 0.0572 μM (ALV)VEGF*4.24 μM 0.0795 μM (ALV)Kuwanon R (86)Hep3B6.42 μM > 30 μM (ALV)HIF-1*3.17 μM 0.0572 μM (ALV)VEGF*3.51 μM 0.0795 μM (ALV)Kuwanon V (87)Hep3B9.54 μM > 30 μM (ALV)HIF-1*8.32 μM 0.0572 μM (ALV)VEGF*7.84 μM 0.0795 μM (ALV)Kuwanon G (92)A549n.a.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11046454
Additionally, by coculturing with PTK7 K562 cells, AptPTK7-CAR-T cells exhibited a relatively lower level of cytokine secretion, as well as reduced expression of CD69 and CD25 (Figures 2E and S18).
[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "B-CellLine", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O"...
PMC5833712
p ≤ 0.05.
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "p", "≤", "0.05", "." ] } ]
PMC8903741
Transient cell lines, such as HEK cells, have been utilized because of their high transfection effectiveness and antibody production capacity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transient...
PMC10154097
Our results indicate that circSOX4 knockdown was associated with decreased HCC viability and metastasis in vivo and in vitro.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "results", "indicate", "tha...
PMC11155445
Results analysis for pre-emergence applications showed that all compounds were 40% effective, while compounds (157b and 157f) exhibited a 78 and 69% inhibition rate, respectively against D. adscendens.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11678448
These dysregulations may include apoptosis-induced loss of immune effector cells, such as lymphocytes and dendritic cells, inactivation of monocytes, depletion of T cells, and an increase in myeloid-derived suppressor cells, as well as T regulatory cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7519871
The combination index (CI) was taken as a measure of combined drug action.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "combination", "index", "(", "CI", ")", "was", ...
PMC11502443
The GIP receptor is reported to be biased towards Gαs coupling (Yuliantie et al., 2020; Willard et al., 2020).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC6948907
The percentage of the cell viability for GE combined with VPA treatment groups were 46 and 42 % at different time periods (24 and 48h) respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7215722
To evaluate the influence of DSS on epithelial integrity, the Evans Blue (EB) permeability assay was used to test its effect on the permeability of Caco-2 cells monolayer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11092382
The authors identified sophocarpine as one of the most potent antifibrotic ingredients in Ku-Shen (Yang et al., 2021b).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "authors", ...
PMC11047729
To test its anti-leukemic properties, a study on AML cell lines was conducted.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "test", "its", "anti-leukemic", "properties", ",", "a", "st...
PMC11700247
CD45.2/CD3/CD45.1 T-cell infiltration in irradiated and abscopal tumor representing CART-19 cells. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD45.2/CD3/CD45.1", "T-cell", "infiltration", "in", "irradiated", "and", "abscopal", "...
PMC10810426
To determine if any of these NUPs were required for MLV nuclear entry, we used siRNA knockdown in NIH3T3 cells (Fig 5A) and BMDCs (Fig 5B) to deplete their expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Our team and others identified HSP110 as a pro-survival factor in diffuse large Bcell lymphomas (DLBCL).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "team", "and", "others", "identi...
PMC9429973
The same results were observed for the 65-75 years cohort, median OS was 62.6 months (50.9-74.3; 95%) for the 1999-2009 period, 70.6 months (33.1-108.1; 95%) between 2010 and 2014, and not reached for the 2014-2019 period (p<.001).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11438317
Next, we tested the ability of the DACS mutant to bind putative substrates.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Next", ",", "we", "tested", "the", "ability", "of", "the", ...
PMC9429973
Children born with genetic deficiencies in ALDH2 and ADH5, or the FA pathway develops bone marrow failure and leukaemia due to attrition of HSCs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC2192239
Activity of the CaM kinases was determined using a synthetic peptide substrate both in the absence and presence of an inhibitor specific for the CaM kinase family, KN-62.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11768281
These include memory precursor effector cells (MPEC), which further divide into central memory T cells (TCM), tissue-resident memory T cells (TRM), and effector memory T cells (TEM).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11535726
However, K.bulbosapicalis can be distinguished from other Kirschsteiniothelia species in having different sizes of conidiophores, conidiogenous cells and the unique feature of its conidia, which comprises one or two bulbous structures at or near the apex, with a spherical hyaline mucilaginous sheath.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11413393
We thus conclude that PRMT1 is the critical dependency among type I PRMTs in ccRCC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "thus", "conclude", "that", "PRMT1", "is", "the", ...
PMC11533140
Figure 5 shows the SAR of the newly designed compounds.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Figure", "5", "shows", "the", "SAR", "of", "the", "newly", "designed", "compounds", "." ...
PMC8557138
Existing models for tumor angiogenesis: advantages and disadvantages Endothelial cells, pericytes, vascular smooth muscle cells, and extracellular matrix are the key cellular components of a healthy vasculature.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
4: Hashmi JA, Albarry MA, Almatrafi AM, Albalawi AM, Mahmood A, Basit S. Congenit Anom (Kyoto).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC6222726
is commonly known as copal chino.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "is", "commonly", "known", "as", "copal", "chino", "." ] } ]
PMC9429973
Results: Of these 14 patients (female, N=9), 10 patients were diagnosed with essential thrombocythemia (ET), three patients with polycythemia vera (PV) and one patient with primary myelofibrosis (PMF).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11773391
Flow cytometry was used to measure the apoptosis of TMZ‐treated cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Flow", "cytometry", "was", "used", "to", "measure", "the", "apoptosis", "of", "TMZ‐tr...
PMC11470999
However, patients with metastatic melanoma, especially those with brain metastases, continue to face poor prognoses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "patients", "with", "me...
PMC6461034
As SK‐Mel‐28 is driven by BRAF, a serine/threonine kinase that is missed by pTyr‐based phosphoproteomics, downstream targets in the MEK‐ERK pathway are highlighted by blue coloring.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11513571
PBMC were stained with an anti-human CD3-PE antibody (surface marker) before the whole cell population (45.9%) and after cell depletion as the CD3 population (0%) to ensure that all CD3 populations were depleted (Figure 1B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11267830
Flow cytometric analysis indicated an increase in apoptosis among T-ALL cell lines after RBM39 suppression (Fig. 4f, Supplementary Figure 4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Flow", ...
PMC11640476
Subsequent analysis confirmed the loss of curve linearity under the LoD (R = 0.80).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Subsequent", "analysis", "confirmed", "the", "loss", "...
PMC11676169
Using this strategy, we found that BCAT1 depletion led to a significantly slower DNA break resolution (Figure 4D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Using", "this", "...
PMC9516401
Numerous activities have been proposed for plant extracts, but research on the effects of plant extracts on IDE expression and activity is riddled with drawbacks.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10482220
However, longer exposure to arsenite (1 h) leads to indistinguishable levels of SGs between the two cell lines (unpublished data).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11459296
By contrast, CD34+HSPC humanization is temporally limited, as mice require 20–24 weeks to achieve humanization.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "contrast", ",", "CD34+HSPC", "humanization"...
PMC11697189
These results suggested that HSP gene-based risk score may be a potential predictor of survival independent of TMB.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "suggested", "that", ...
PMC11306331
Illuminated droplets (blue curves) were compared to non-illuminated droplets (gray curves) several microns away from the illuminated region.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Illuminated", ...
PMC8524093
Its transmission occurs by the bite of infected mosquitoes from genus Aedes spp.,
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Its", "transmission", "occurs", "by", "the", "bite", "of", "infe...
PMC11194678
Cells were incubated with Lyso-Tracker Red (50 nM) or LysoSensor Green (1 μM) at 37°C for 30 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11461874
Contrary to our expectations, DBP protein level in the liver of the TRAF7-KO mouse was indistinguishable from that in WT mouse (Supplementary Fig. S3a).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11770199
At the end of the experiment, the tumors were isolated and imaged.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "At", "the", "end", "of", "the", "experiment", ",", "the", "tumors", ...
PMC10772747
By inhibiting this pathway, EBE compounds can reduce apoptotic response and impact cancer cell proliferation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "inhibiting", "this", "pathway", ",", "EBE", ...
PMC11190538
Phytochemicals in phytosomal structures are mostly contained inside vesicles, resulting in increased bioavailability due to enhanced permeability to membrane and cell absorption.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Phytoch...
PMC11779876
We assessed distinct types of peripheral T cell lymphomas including one case of T-prolymphocytic leukemia (T-PLL), one case of primary cutaneous T cell lymphoma (CTCL), and ten cases of nodal T-follicular helper cell lymphoma (PTCL-TFH).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11775197
A fascinating study found that high expression or activation of PPARβ/δ resisted the PPARγ-induced apoptosis effects in CRC cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "fascinating", "study", "foun...
PMC10329237
Enhancing cellular migration is one of the important characteristics of EMT induction.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Enhancing", "cellular", "migration", "is", "one", "of", "the", "important", "cha...
PMC8540692
In this regard, 5 µM CCM and 7.5 mM NaBu reduced the percentage of living cells to ~40% for all the cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11718817
Other groups are pushing even further.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Other", "groups", "are", "pushing", "even", "further", "." ] } ]
PMC9429973
Regarding the genetic analysis, risk-factor variants were found in ADAMTD13 (rs2301612), C3 (rs2230199), and CFH (rs800292).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10761571
Due to the anticancer features of Gingerol, the major phenolic compound from Ginger, this study aims to prepare Fe3O4@Glucose-Gingerol nanoparticles (NPs) and investigate their anticancer potential in a lung adenocarcinoma cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10329237
A M was the principal author for the grant and contributed to experimental design, supervising the project, and final revision of the manuscript.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11481779
That metric, widely used in computer vision and image generation, decreases when the quality increases.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "That", "metric", ",", "widely", "used", "in...
PMC11711066
Conversely, no changes were observed in the inhibitory effect of As‐IV upon the administration of bicalutamide, an androgen receptor antagonist (Fig. 1c), implicating estrogen (E2)‐like action of As‐IV in the vessels.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11750165
Expression of GAD1 and islet1 by whole-mount in situ hybridization staining in the embryos injected with Con-MO (A, C) and PEX1-MO (B, D) at 25 hpf.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8427838
B Immunofluorescence staining of kidney and intestine tissues from wild type (TMIGD1 + / +) or TMIGD1 knockout mice (TMIGD1−/−) stained with antibodies against moesin and ezrin, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10926885
It has also been shown that NDE1 may bind to the cancer‐causing protein p78/MCRS1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "has", "also", "been", "shown", "that", "NDE1", "may", ...
PMC11730305
Fig. 3XRD analysis of Co3O4@Glu-Ellagic acid NPs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig.", "3XRD", "analysis", "of", "Co3O4@Glu-Ellagic", "acid", "NPs", "." ] } ]
PMC11634027
Two guide RNAs (CRISPR Target Site 01: AGTTCAGTAGCTGAAAAGGATGG; CRISPR Target Site 02: ACACGGATGTAATCGAGCACTGG) were used to delete ds exon 12 and replaced with an RMCE cassette containing an attP cassette and a 3xP3-RFP selection marker.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7433824
OO and US contributed to the bioinformatic analyses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "OO", "and", "US", "contributed", "to", "the", "bioinformatic", "analyses", "." ] } ]
PMC11545737
Although excessive activation of Niap/NLRC4 pyroptosis in intestinal epithelial cells (IECs) contributes to the disruption of the gastrointestinal barrier, this pathway protects mice against Salmonella infection .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11060216
It contains a total of 25 known members, each coded by a separate gene in humans.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "contains", "a", "total", "of", "25", ...
PMC7582629
In Figure 4b, MCR-ALS spectra corresponding to nucleus (blue), cytosol (red), vesicle + DNPs (green) are shown .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC9429973
remained significant for a shorter OS in the multivariate model (p=0.030, HR 2.318, 95%CI 1.083-4.961 and p= 0.020, HR 2.473, 95%CI 1.151-5.314, respectively).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7351993
Therefore, fluorescence images were obtained immediately after sorting for counting nuclei stained with Hoechst 33342 (that is, the number of C-probed Euglena gracilis cells), and then additional Hoechst reagent was added and incubated for more than 1.5 h to stain the nuclei of the whole cells to estimate the total number of cells by fluorescence microscopy again.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6642070
2 Statins increase lactate production in cultured skeletal muscle cell lines. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "2", "Statins", "increase", "lactate", "production", "in", "cultured", "skeletal", ...
PMC11723947
Data show mean ± SEM of 3 to 6 independent experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "show", "mean", "±", "SEM", "of", "3", "to", "6", "independent", "experi...
PMC7192625
The ChAs values on the PP networks are also variable, but all are found to be significantly higher than expected by distance-preserving randomizations (Figure 3D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7189327
Our findings revealed that CYFIP2 (AUC = 0.949), HOXB5 (AUC = 0.908), PTPN3 (AUC = 0.952), MARCKSL1 (AUC = 0.962), PTCH1 (AUC = 0.981), and CDC20 (AUC = 0.956) could significantly distinguish BCC samples and healthy controls, implying that these genes might serve as diagnostic makers for BCC detection (Figure 5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
If hospitalization occurred 6 and 12 months prior to the PedsQoL measurement, a decrease of 3.61 (p=0.049) and 3.80 points (p=0.007) in HRQoL respectively, was seen compared to patients without hospitalization.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11334037
However, the molecular mechanism of IGF2 specific to GISTs requires further investigation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "the", "molecular", "mechanism", "of", "IGF2", "specific", ...
PMC11711345
Correlations (rho coefficient) between Pa of mechanisms of action and Pa of activity against HCCLs were examined through Spearman’s Rank Order using GraphPad Prism 8 program.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11794847
It can activate the expression of insulin-sensitizing genes and participate in various biological processes, including metabolism, proliferation, development, differentiation, apoptosis, and immunity .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9918897
For example, amino acids and polysaccharides can significantly affect the results obtained, so that the specific levels depend not only on the amount of antioxidants present, but also on several characteristics of the matrix .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11098378
As expected, 0.05 μg/mL ActD treatment increased GFP signal in VSV-GFP and SINV-GFP infections by ~10,000- and 100-fold, respectively (Fig 1B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11615101
Upper panel showing WB image of NF-kB p65 band along with GAPDH in different doses of α-Taxilin (1: 0ng/ml, 2: 6.25ng/ml, 3: 12.5ng/ml, 4: 25ng/ml, 5: 50 ng/ml, 6: 100ng/ml) induction, and the lower panel shows p-65 level along with GAPDH after knockdown of α-Taxilin (25nM) and induction of pure protein of α-Taxilin (50ng/ml) and TNF-α (20ng/ml). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
High response rates to immunosuppressive therapy with anti-thymocyte-globulin and cyclosporin A suggest a key role for T cells in disease pathogenesis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "High", "response", ...
PMC7136814
The concept of differentiation therapy was proposed as early as the 1970s based on the idea that the malignant cells (perhaps Cancer Stem Cells or Tumor Propagating Cells) could differentiate into less aggressive or benign cells, allowing differentiation to be an alternative or complementary strategy to chemotherapy-mediated cytotoxicity [40–42].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9587866
Gene Expression Studies Gene expression studies revealed some promising results that can further aid in the prevention of Ewing sarcoma’s aggressive growth (Table 5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11575040
A Flowchart depicting the identification process of differentially expressed genes through NGS in two melanoma cell lines with and without metformin treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "Flowcha...
PMC9429973
The diagnosis of aggressive non-Hodgkin lymphoma (NHL) was predominant (59.5%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "diagnosis", "of", "aggressive", "non-Hodgkin", "lymphoma",...
PMC11540664
All patients provided written informed consent before undergoing systemic therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "patients", "provided", "written", "informed", "consent", "before", "undergoing", "systemic", ...
PMC11252033
To date, NSAIDs are one of the best explored candidate as repurposed drugs for cancer prevention and treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "date", ",", "NSAIDs", ...
PMC9429973
O. Pasvolsky, D. Milton, M. Rauf, M. Tanner, Q. Bashir, S. Srour, N. Saini, J. Ramdial, Y. Nieto, H. Lee, K. Patel, P. Kebriaei, S. Thomas, D. Weber, R. Orlowski, E. Shpall, R. Champlin, M. Qazilbash Stem Cell Transplantation & Cellular Therapy; Biostatistics; Lymphoma/Myeloma, The University of Texas MD Anderson Cancer Center, Houston, United States of America Background: Maintenance therapy with single-agent lenalidomide (Len) after autologous hematopoietic stem cell transplantation (autoHCT) for multiple myeloma (MM) is associated with improved progression-free survival (PFS).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11791264
As expected, Snail and N-cadherin were noticeably elevated, while E-cadherin was decreased in SETD7 OE SKOV3 cells (Fig. 1K).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], ...
PMC9429973
4 pts had a primary GF and 1 had a secondary GF.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "4", "pts", "had", "a", "primary", "GF", "and", "1", "had", "a", "sec...
PMC11033180
Data are mean ± SEM, n = 8 cultures from 2 independent experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "are", "mean", "±", "SEM", ",", "n", "=", "8", ...
PMC11093197
Then, cells were fixed with 4%PFA at RT for 10 min and were permeabilized with 0.5% Triton X‐100 at RT for 5 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973
PCR for the disease defining transcripts (CBFB::MYH11 or RUNX1::RUNX1T1) were monitored after C1, C3 and end of therapy (EOT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9621239
HBx protein is encoded by the HBV X gene and can bind to transcription factors, playing a role in transactivation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HBx", "protein", ...
PMC11422497
OE: OverExpression.
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "OE", ":", "OverExpression", "." ] } ]
PMC11422150
However, their application is limited because of ethical issues, potential hazards for bone marrow donors (e.g., bone marrow aspiration), inadequate sources, immunogenicity, and the low survival rate of transplanted cells (Baxter et al., 2004; Hess, 2009).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10040136
For the wound-healing migration experiment, GIST-882 cells were collected, planted in triplicate wells of a 6-well plate, and grown to 80% confluence in either a control medium or MSC-CM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11297139
This ΔDD mutant failed to undergo LLPS (Fig. 1f), proving the indispensable roles of DDs of PrLD1 and PrLD2 in ARID1A condensation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11750696
Decreased levels of CHOP, IRE1, and PERK in peripheral blood mononuclear cells (PBMCs) of SLE patients have been reported, contrasted with the upregulation of total XBP1 and its spliced form (67).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11707577
The sample was then extensively dialyzed against PBS 1x in cellulose membrane dialysis tubes with a 14 kDa cut‐off to remove the water‐soluble byproducts generated during the coupling procedure.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5308810
Cells (5x10/sample) were counted using a FACS (Beckman Coulter Gallios, Indianapolis, IN).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "(", "5x10/sample", ")", "were...
PMC8609870
In summary, a lncRNA-related ceRNA network containing 31 lncRNAs, 1 miRNA (hsa-miR-210-5p) and 3 mRNAs (NTNG2, GRIA1 and AQP1) was constructed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...