PMCID string | Sentences string | ner list |
|---|---|---|
PMC2118063 | After transfection (48 h), the tissue culture medium was filtered through a 0.45-μm filter, and the viral supernatant was used for infection of NFS-202 cells after addition of 4 μg/ml polybrene. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11739670 | Affinities of CD8αβ and CD8αα for HLA‐A*01:01 and HLA‐A*03:01 were higher (KD 80–120 µM) compared with HLA‐A*02:01 and HLA‐A*24:02 (KD ∼230 µM) (Table S1) (hereafter HLA‐A1, HLA‐A3, HLA‐A2, HLA‐A24). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6892818 | As positive controls for p-MKK4/7, p-JNK and p-p38 protein expression induction, lysates from HCT116 cells that were treated with control (‘C’) or treated with mCD40L (‘mL’) for 6 h were included. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8409415 | Similar tumor sizes were observed between the control ADC and PBS groups (P = .92). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Similar",
"tumor",
"sizes",
"were",
"observed",
... |
PMC11599565 | The occurrence of EMT in the SKOV3 cells can also be inferred by the loss of the epithelial marker EpCAM and the gain of Vimentin, a type III intermediate filament (IF) protein exclusively expressed in mesenchymal cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11476004 | Similar observations were made by Morais et al. , who reported numerous structural and numerical mutations in a 14-year-old poodle with mammary cancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Similar... |
PMC11770199 | Relative mRNA level was shown as fold change following the 2 calculation method. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Relative",
"mRNA",
"level",
"was",
"shown",
"as",
"fold",
"change",
"... |
PMC11394730 | In various cancer types, such as bladder, colon, pancreatic, neuroblastoma, osteosarcoma, myeloblastic leukemia, and acute lymphoblastic leukemia, thymoquinone demonstrates cytotoxic effects by preventing cell proliferation and triggering cell apoptosis (Figure 4). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11708541 | Amifampridine 13 is a medication that belongs to the aminopyridine class. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Amifampridine",
"13",
"is",
"a",
"medication",
"that",
"belongs",
"to",
"the",
"amino... |
PMC11756907 | The osteosarcoma cells were grown in an incubator under the defined conditions: temperature 37°C, 5% CO2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"osteosarcoma",
... |
PMC11774112 | Compared with the other groups, the Co-PHRD group showed significant anti-tumor activity (P < 0.01), suggesting that DTIC and miRNA 34a exerted synergistic effects on A375 solid tumors in vivo. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10387886 | Whether observed changes in the above DUSP expressions in our study are secondary to changes in the activities of MAPKs proteins remains to be determined. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC9444294 | By SS18–SSX IHC, 64 of the 70 (91%) synovial sarcoma samples analyzed showed strong, positive intense nuclear staining, while all control samples stained negative with minimal background (Fig. 3 and Table 2). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | J. Takeda, K. Yoshida, M. Nakagawa, Y. Nannya, A. Yoda, R. Saiki, Y. Ochi, L. Zhao, R. Okuda, X. Qi, T. Mori, A. Kon, K. Chiba, H. Tanaka, Y. Shiraishi, M.-C. Kuo, C. Kerr, Y. Nagata, D. Morishita, N. Hiramoto, A. Hangaishi, H. Nakazawa, K. Ishiyama, S. Miyano, S. Chiba, Y. Miyazaki, T. Kitano, K. Usuki, N. Sezaki, H. Tsurumi, S. Miyawaki, J. Maciejewski, T. Ishikawa, K. Ohyashiki, A. Ganser, M. Heuser, F. Thol, L.-Y. Shih, A. Takaori−Kondo, H. Makishima, S. Ogawa Department of Pathology and Tumor Biology; Institute for the Advanced Study of Human Biology, Kyoto University, Kyoto; Division of Genome Analysis Platform Development, National Cancer Center Research Institute; M&D Data Science Center, Tokyo Medical and Dental University, Tokyo, Japan; Division of Hematology−Oncology, Department of Internal Medicine, Chang Gung Memorial Hospital, Chang Gung University, Taoyuan, Taiwan; Department of Translational Hematology and Oncology Research, Taussig Cancer Institute, Cleveland Clinic, Cleveland, United States of America; Chordia Therapeutics Inc., Kanagawa; Department of Hematology, Kobe City Medical Center General Hospital, Kobe; Department of Hematology, NTT Medical Centre Tokyo, Tokyo; Department of Hematology, Shinshu University Hospital, Matsumoto; Department of Hematology, Kanazawa University, Kanazawa; Department of Hematology, Faculty of Medicine, University of Tsukuba, Tsukuba; Department of Hematology, Atomic Bomb Disease Institute, Nagasaki University, Nagasaki; Department of Hematology, Tazuke Kofukai Medical Research Institute, Kitano Hospital, Osaka; Department of Hematology, Chugoku Central Hospital, Hiroshima; Department of Hematology, Gifu University, Gifu; Division of Hematology, Tokyo Metropolitan Ohtsuka Hospital; Department of Hematology, Tokyo Medical University, Tokyo, Japan; Department of Hematology, Hemostasis, Oncology, and Stem Cell Transplantation, Hannover Medical School, Hannover, Germany; Department of Hematology / Oncology, Kyoto University, Kyoto, Japan Background: Acute erythroid leukemia (AEL) is a rare subtype of acute myeloid leukemia (AML) characterized by erythroid predominant proliferation and classified into two subtypes with pure erythroid (PEL) and erythroid/myeloid (EML) phenotypes based on the degree of erythroid hyperplasia. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10582049 | CAF subpopulation proportions and functions. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CAF",
"subpopulation",
"proportions",
"and",
"functions",
".",
"("
]
}
] |
PMC11015054 | No. C1052) was used to determine cell viability after 24, 48, 72, and 96 h, and the absorbance value at 450 nm was measured using an enzyme‐linked immunosorbent assay (ELISA) reader (Thermo). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Blood smear revealed the presence of stomatocytes, target cells, and rare ovalocytes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Blood",
"smear",
"revealed",
"the",
"presence",
"of",
"stomatocytes",
... |
PMC11731161 | In conclusion, our findings underscore the essential role of XPO1 degradation in the anti-myeloma efficacy of SEL and establish a research foundation for targeting USP7 to improve the effectiveness of SEL-based therapies in MM.Multiple myeloma (MM) is the second most commonly diagnosed hematologic malignancy, characterized by abnormal proliferation of clonal plasma cells in the bone marrow . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10291556 | For this purpose, we used human cervical cancer HeLa cells and human monocytic Thp-1 cells activated into macrophages by differentiating with phorbol 12-myristate 13-acetate. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC9429973 | We found that Q30 is highly sensitive and showed 100% concordance in identifying fusions associated with good cytogenetic risk AML in our cohort. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11453018 | The data represent mean ± SEM; *p< 0.05, **p< 0.01, ***p< 0.001, ****p< 0.0001, (control, n=6; treatment, n=7) Successful pharmacological targeting of ES using iP300w. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Most of the pts that were refractory to ATG had multiorgan involvement (n=17), followed by GI only (n=6), liver only (n=1) and skin only (n=1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11748363 | For methodology and stability charts, see Data S1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"methodology",
"and",
"stability",
"charts",
",",
"see",
"Data",
"S1",
"."
]
}
] |
PMC11684269 | The impaired catalytic capacity of Arg1 leads to decreased consumption of arginine, but increased utilization of glutamine, for ornithine generation, which subsequently blunts availability of glutamine flux for TCA cycle (67). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9398137 | Venetoclax has been tested in newly diagnosed or relapsed/refractory patients with DLBCL in several phase I–III clinical trials either alone or in combination with anti-CD20-based immunochemotherapies [NCT03984448 (8, 9)]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11682172 | Fig. 5Coronin 1A is highly expressed in primary breast cancers from patients who developed brain metastases. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"5Coronin",
"1A",
"is",
"highly",
"e... |
PMC9429973 | Baseline characteristics are shown in Table 1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Baseline",
"characteristics",
"are",
"shown",
"in",
"Table",
"1",
"."
]
}
] |
PMC11322866 | Scale bar: 10 μm. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Scale",
"bar",
":",
"10",
"μm",
".",
"("
]
}
] |
PMC11638255 | Samples were collected in K2-EDTA tubes (Greiner, Germany; #450532) and analyzed immediately using the Mindray BC-5150 Auto Hematology Analyzer (Mindray, China) according to the manufacturer’s instructions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11457557 | PON is a potential gene for DCVD because it encodes for paraoxons, an enzyme found in HDL . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PON",
"is",
"a",
"potential",
"gene",
... |
PMC11714165 | Significant differences were defined as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11699465 | TMEM199 is also involved in Golgi homeostasis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"TMEM199",
"is",
"also",
"involved",
"in",
"Golgi",
"homeostasis",
"."
]
}
] |
PMC9429973 | Population characteristics are shown in Table 1A. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Population",
"characteristics",
"are",
"shown",
"in",
"Table",
"1A",
"."
]
}
] |
PMC8316344 | Then, we assessed whether TFRC and βTrCP contribute to the effects by which TRIB2 desensitizes liver cancer cells to ferroptosis that induced by RSL3 and erastin. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11655536 | Vehicle treatment group was used as the control (n = 5), and the other two were intraperitoneal injection HA at the dosage of 5 or 10 mg/kg body weight (n = 5 each group) once daily for consecutive ten days. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11531735 | MDA MB 231-BrHer2+GFP-RFP-Luc/firefly3 cells express luciferase-RFP proteins; and (B) same cells expressing HER2+GFP proteins; (C) Mycoplasma detection by PCR, 1. | [
{
"tags": [
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"... |
PMC4485648 | Based on the growing evidence, sulforaphane acts through molecular mechanisms that interfere with multiple oncogenic pathways in diverse tumor cell types. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Based",
"on"... |
PMC9429973 | Acute, life-threatening spleen-related complications in SCD are well studied. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Acute",
",",
"life-threatening",
"spleen-related",
"complications",
"in",
"SCD",
"are",
"well",
... |
PMC11411131 | Expression of selenoprotein N (SelN). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Expression",
"of",
"selenoprotein",
"N",
"(",
"SelN",
")",
"."
]
}
] |
PMC11705862 | Neuroinflammatory processes accompany the accumulation of Aβ plaques and NFTs in the AD brain. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Neuroinflammatory",
"processes",
"accompany",
"the",
"accumulation",
"of",
... |
PMC11361748 | Mice were treated with 20 μl of 0.2 mg/ml of TPA (Cell Signaling Technology #4174S), topically on the dorsal side of ear skin, with the other ear treated with acetone vehicle control. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10944868 | Isoropyl (Z)-3-(cyano(phenyl)methoxy)acrylate (4Z). ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Isoropyl",
"(Z)-3-(cyano(phenyl)methoxy)acrylate",
"(",
"4Z",
")",
".",
"("
]
}
] |
PMC11754436 | In the DHRS4-AS1 + mimic NC group (D + mNC), DHRS4-AS1 was overexpressed but not miR-362-5p. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"DHRS... |
PMC11476264 | Tumors with FBXO11 deletion showed significant local invasion, while the results for tumors with FBXO11 and ZEB1 double knockdown were similar to those of tumors with ZEB1 single knockdown, with clear tumor boundaries (Figure 6B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11594806 | The authors also examined cytosolic CD73 staining in pancreatic ductal adenocarcinoma (PDAC) patient specimens, finding substantial amounts of intracellular CD73 localized to the endoplasmic reticulum membrane. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11519567 | A Schematic illustration for SS18-SSX onco-fusion protein. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"Schematic",
"illustration",
"for",
"SS18-SSX",
"onco-fusion",
"protein",
"."
]
}
] |
PMC11748363 | All reagents and solvents (unless stated otherwise) were purchased from Merck (Darmstadt, Germany) and used without further purification. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
... |
PMC9684669 | Nevertheless, it was withdrawn from the market due to its ability to inhibit the hERG channel (38). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Nevertheless",
",",
"it",
... |
PMC11377827 | HIF complex components and HIF-2 target genes were analysed by immunoblot (F) or qPCR (G) as previously described. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"HIF",
"compl... |
PMC9429973 | Real-world evidence studies provide unique and complementary information on treatment patterns, efficacy, side effects and may help identify unmet medical needs of CML patients Aims: This study was aimed at studying frequency of TKI switching, reason for switch, duration of treatment without switching as a function of line of treatment and specific TKI using the real-world data of the Québec registry created in 2009 Methods: Patients with Philadelphia positive (Ph+) CML were recruited with informed consent in the Québec registry. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11407042 | Check the cell distribution under the inverted microscope.h. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Check",
"the",
"cell",
"distribution",
"under",
"the",
"inverted",
"microscope.h",
"."
]
}
] |
PMC2777936 | Luciferase activity was measured using the Promega (WI) luciferase assay system and normalized to protein concentrations, as above. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Luciferase",
"activity"... |
PMC10940855 | The negative cell fraction was plated in BMEC media to generate BM ECs from patients with multiple myeloma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"negative",
"cell",
"fraction",
... |
PMC2193049 | The cDNA coding for MAGE-3 was digested with PstI and XbaI, blunted using Klenow PolI, and inserted into the SmaI site of the vector pSc11. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8916024 | Our findings also revealed that the phyla Proteobacteria, Fusobacteria, and Tenericutes were significantly more abundant in the snail gut than in sediment. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11543935 | Fig. 2Experimental setup of biocompatibility test (ISO 10993-5) with 5 × 10NIH3T3 cells per well. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
"2Experimental",
"set... |
PMC11634027 | Part of this can be ascribed to effects on Ds protein levels and distribution, as deletion of the A motif increases Ds protein levels, whereas deletion of the D motif decreases Ds protein at cell membranes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11643361 | Moreover, complexes containing 2-mercapto-benzimidazole displayed significantly higher anticancer activity compared to those with 2-mercapto-benzothiazole. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Moreover",
",",
"complexes",
"containing",
"2-mercapto-benzimidazole",
... |
PMC9429973 | We compared treatment response and progression-free survival (PFS) among patients with different characteristics and treatments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"compared",
"treatment",
"response",
"and",
... |
PMC6642070 | The matching consensus p53RRE bases are shown in uppercase characters. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"matching",
"consensus",
"p53RRE",
"bases",
"are",
"shown",
"in",
"uppercase",
"characters... |
PMC11394112 | Diffuse large B cell lymphoma (DLBCL) is the most diagnosed, aggressive non-Hodgkin lymphoma, a type of blood cancer. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Diffuse",
"l... |
PMC11657744 | Cells were subjected to serum deprivation for 24 h to promote cilia development. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cells",
"were",
"subjected",
"to",
"serum",
"deprivation",
"for",
"24",
... |
PMC9479186 | High NDUFC1 expression was associated with poor prognosis and was an independent risk factor for reduced overall survival (OS). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"High",
"NDUFC1",
... |
PMC11489175 | The UCH family comprises four enzymes, i.e., UCHL1, UCHL3, UCHL5, and BAP1. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"UCH",
"family",
"comprises",
"four",
... |
PMC7762347 | CYN mainly targets the liver, although other organs may be affected as well suggesting its cytotoxic properties . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CYN",
"mainly",
"targets",
"the",
"liv... |
PMC9727330 | Furthermore, NNDAsp stimulates the production level of proinflammatory cytokines IL-1α and IL-1β that facilitate the PCD in cancer-treated cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Furthermore",
",",
"NNDAsp",... |
PMC11335267 | PCK1 is the rate-limiting enzyme of glyceroneogenesis for the synthesis of triacylglycerol in the adipose tissue. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"PCK1",
"is",
"the",
"rate-limiting",
"enzyme",
"of",
... |
PMC9792775 | The inhibitory rate of LFU at 100 mW was higher, increasing to 11.9% ± 0.68% and 14.5% ± 0.17% respectively (Table 2). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9895440 | For the staining for phospho-AKT-Ser473, cells were fixed with IC fix for 20 min at room temperature and then permeabilized in a custom 0.1% Triton-X100+ 1% BSA in PBS buffer for 5 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9739791 | For TARF and FMN the highest TOF numbers (≈20) were observed, while flavoprotein miniSOG showed the lowest TOF values of less than 6. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC11588085 | Overall, results from our in silico analysis demonstrated a significant downregulation of XIST in ovarian cancer patient samples, particularly in higher-grade tumors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11629461 | The miniSOG (JX999997) gene was synthesized (Genscript, Nanjing, China): ATGGAAAAGAGCTTTGTGATTACCGATCCGCGCCTGCCAGACAACCCGATCATTTTCGCGAGCGATGGCTTTCTGGAGTTAACCGAATATTCTCGTGAGGAAATTCTGGGTCGCAATGGCCGTTTCTTGCAGGGTCCGGAAACGGATCAAGCCACCGTGCAGAAAATCCGCGATGCGATTCGTGACCAACGCGAAATCACCGTTCAGCTGATTAACTATACGAAAAGCGGCAAGAAATTTTGGAACTTACTGCATCTGCAACCGATGCGCGATCAGAAAGGCGAATTGCAATATTTCATTGGTGTGCAGCTGGATGGCTAG. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"miniSOG",
"(",
"JX999997",
")",
"gene",
"... |
PMC11045125 | Gene sets down-regulated in the Myc-expressing lymphomas include “Hallmark_TNFA_signaling_via_NF-κB” and “Dirmeier_LMP1_Response_Early” (Fig 4C), reflecting Myc’s ability to turn down NF-κB signaling as well as LMP1 expression. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | B. Dhakal, H. Einsele, R. Potluri, J. Schecter, W. Deraedt, N. Lendvai, A. Slaughter, C. Lonardi, S. Nair, J. He, N. Joseph, P. Cost, S. Valluri, F. Yalniz, L. Pacaud, K. Yong Medical College of Wisconsin, Milwaukee, United States of America; Universitätsklinikum Würzburg, Medizinische Klinik und Poliklinik II, Wuerzburg, Germany; SmartAnalyst Inc, New York; Janssen R&D, Raritan, United States of America; Janssen Pharmaceutica NV, Beerse, Belgium; Cilag GmbH International, Zug, Switzerland; Janssen, Buenos Aires, Argentina; Janssen Global Services, LLC, Raritan; Janssen Scientific Affairs, LLC, Horsham; Legend Biotech USA, Piscataway, United States of America; University College London Cancer Institute, London, United Kingdom Background: New treatment combinations using proteasome inhibitors (PIs), immunomodulatory drugs (IMiDs), and anti-CD38 monoclonal antibodies have significantly improved survival outcomes in patients with multiple myeloma (MM). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11078693 | Prepare permeabilization/quenching buffer. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"Prepare",
"permeabilization/quenching",
"buffer",
"."
]
}
] |
PMC9847912 | Analyses of virions from bevirimat-treated, HIV-1–infected cell cultures , together with data from cell-free assays utilizing culture-derived HIV-1 cores or in vitro CA assemblies , showed that bevirimat blocks or delays the proteolytic cleavage of CA-SP1, and that this inhibitory activity targets multimeric Gag assemblies as opposed to soluble Gag monomers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11098378 | Cells were stained with CellTracker dye 72 hpi and imaged to calculate fold-change in normalized GFP signal over empty vector (control) treatments. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11320834 | The first example is olaparib plus cediranib, an antiangiogenic agent. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"first",
"example",
"is",
"olaparib",
"plus",
"cediranib",
",",
"an",
"antiangi... |
PMC11670954 | This barrier plays crucial roles in protecting host tissues from infections, environmental toxins, pollutants, and allergens, all of which can disrupt host homeostasis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11412721 | Right, below: the Trp53 allele only enables the synthesis of proteins with the ‘canonical’ α C-terminus. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Right",
",",
"bel... |
PMC11765988 | This overlap may suggest a common underlying immune or inflammatory response in the vitreous humor in these conditions, though the study emphasized distinct proteomic signatures for VRL and sarcoidosis . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9559528 | Here, we describe a case of serology-confirmed secondary syphilis and pathology-confirmed psoriasis in an HIV-positive patient presenting clinically with erythema multiforme-like lesions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Here",
... |
PMC11706491 | To precisely quantify the duration of halted growth, we incorporated GFP-CRIB into the FLCCR system, omitting Sid2-GFP, which also labels the septum (Fig 3A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Results: At data cut off of 23 Feb22, 13 pts have been enrolled, median age 73 years and median 2 previous lines of therapy, ECOG PS 2 in 4 pts, 1 in 7, 0 in 2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10938377 | Here, we focused on conjugates comprising nucleosome-binding viral peptides, which are based on the chromatin-tethering proteins that certain viruses express in order to maintain their genomes in, or deliver their genomes to, the cell nuclei. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Inclusion criteria include age ≥18 y, histologically confirmed FL (grade 1, 2, or 3a) or MZL (nodal, splenic, or extranodal), documented R/R disease, ≥1 prior systemic anti-CD20 therapy (including anti-CD20 refractory disease), ECOG PS ≤2, adequate systemic organ function, and high tumor burden (per GELF criteria). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11739504 | 2Kat2b interacts with and regulates the acetylation level of α-tubulin. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"2Kat2b",
"interacts",
"with",
"and",
"regulates",
"the",
"acetylation",
"level",
"of",
... |
PMC9429973 | M. Tatarczuch, M. Waltham, J. Shortt, E. Hawkes, S.-J. Ho, J. Trotman, D. Brasacchio, M. Co, J. Li, V. Ramakrishnan, K. Dunne, S. Opat, G. Gregory Clinical Sciences at Monash Health, Monash University; Monash Haematology, Monash Health; Eastern Health; Olivia Newton John Cancer Research Institute at Austin Health; School of Public Health and Preventive Medicine, Monash University, Melbourne; Haematology, St George Hospital; St George & Sutherland Clinical School, University of New South Wales; Haematology, Concord Repatriation General Hospital; Concord Clinical School, University of Sydney, Sydney, Australia; BeiGene (Beijing) Co., Ltd., Beijing, China and BeiGene USA, Inc., San Mateo, United States of America; Australasian Leukaemia & Lymphoma Group, Melbourne, Australia Background: The MAGNOLIA trial demonstrated the safety and efficacy of zanubrutinib, a second generation BTK inhibitor (BTKi), in patients with rrMZL (ORR 68.2%, CR 26%, 15-month PFS 83%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11786767 | The 10X enlarged images of the insets at regions of epichromatin in the whole-cell images are shown in the rightmost panels. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"10X",
"enl... |
PMC11725127 | Immunohistochemical staining images of USP2, KRAS, TUNEL, and Ki67 of NOD/SCID mice-resected xenografts with or without USP2 knockout. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Immunohistochemical",
"... |
PMC11201245 | The hybridized and washed microarrays (Agilent 2x400k+SNP, design: 028081) were read out using a Dx Microarray Scanner G5761 from Agilent (Agilent, Santa Clara, CA, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11562028 | There was a total of 2592 DEGs, including 1141 up-regulated genes and 1451 down-regulated genes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"There",
"was",
"a",
"total",
"of",
"2592",
"DEGs... |
PMC9429973 | The mean number of footsteps of the robust patients was higher than the footsteps of the prefragile patients (7,321 vs 4,853) but this difference was not statistically significant (p=0.17). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11802855 | L Immunofluorescence was implemented for the precise detection of TRAP and MMP13, where TRAP acted as a definitive marker of osteoclasts. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"L",
"Immunof... |
PMC11711347 | The Ni(II) Proline Dithiocarbamate Synthesis Process. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"Ni(II",
")",
"Proline",
"Dithiocarbamate",
"Synthesis",
"Process",
"."
]
}
] |
PMC10024132 | While the need for continuous infusion of blinatumomab is cumbersome and a clear practical disadvantage, the short half-life also makes drug elimination quick in cases with severe adverse effects . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11655536 | Caspase-3 and Caspase-7 are critical to cell apoptosis, so we detected the percentage of Caspase-3/Caspase-7 by the Caspase-3/7 activity apoptosis assay kit. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Caspase... |
PMC11026382 | Supernatants containing plasmids were isolated from the pellet. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Supernatants",
"containing",
"plasmids",
"were",
"isolated",
"from",
"the",
"pellet",
"."
]
}
] |
PMC11377827 | It is, therefore, plausible that USP43 interacts with different 14-3-3 proteins depending on the context. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"It",
"is",
",",
... |
PMC11143482 | Previous studies have reported the same body weight pattern in cancer mouse models (Johnen et al., 2007; MD-Msc et al.). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.