text
stringlengths 0
868k
|
|---|
Ampk is a heterotrimeric protein that consists of an, and subunit in equal stoichiometry . The subunit constitutes the catalytic domain, conferring kinase activity, while the subunit enables ampk to monitor cellular energy status through two amp / atp binding domains, referred to as bateman domains, that bind amp or atp in a mutually exclusive manner . The hydrolysis of atp, needed for driving thermodynamically unfavorable processes, results in the formation of adendosine monophosphate (amp). Therefore, high concentrations of amp serve as a signal of increased energy expenditure and promote the binding of amp to the bateman domains . Amp binding causes ampk to undergo a conformational change, exposing an activation loop of the subunit, allowing phosphorylation on threonine by upstream kinases, referred to as ampk kinases (ampkks), resulting in a 50100-fold increase in the catalytic activity of ampk . Conversely, a high concentration of intracellular atp, characteristic of ample energy reserves, promotes atp / bateman domain binding and produces an antagonistic effect on ampk activation . Unlike other eukaryotic cell types, neurons must undergo a process of morphological polarization in order to function properly . This process entails the selection and differentiation of multiple dendrites and an axon from a single cell body, which is required for neurons to send and receive information, providing the foundation for the function of neural networks . Neuronal polarization begins with the rapid extension of a single minor neurite into an axon of remarkable size and complex geometry, while the remaining sister neurites will eventually develop into dendrites . The scale of biosynthesis required for axonal growth and thereby polarization, necessitates increased protein and membrane synthesis, in addition to the intracellular delivery of these building blocks to the growing axon tip . Considering the degree of atp consumption involved in axon formation, ampk is likely to be involved in the regulation of neuronal polarization . Our recent study has demonstrated that pharmacological activation of ampk, mimicking energy lacking conditions, during the transition from the symmetric stage 2 to the polarizing stage 3, where the initial signals for axon specification are starting to occur, effectively inhibits axon specification and neuronal polarization in both cultured embryonic hippocampal neurons and embryonic cortical brain slices . Mechanistically, we show that direct phosphorylation of the kinesin light chain of the motor protein, kif5, results in a dissociation between the motor complex and its pi3k cargo, thereby preventing pi3k enrichment at the neurite tip, a key mechanism in axon selection and growth (fig . 1a and b). Importantly, expression of a kinase dead ampk mutant (ampk kd) can rescue polarity in cultured hippocampal neurons and cortical brain slices, regardless of aicar treatment, indicating that ampk upregulation, but not its basal activity, regulates neuron polarization (fig . Has shown that genetic knockout of both ampk 1/2 catalytic isoforms in mice had no effect on cortical neurogenesis or polarization . To indicate clinical significance, we find that brief ischemia challenge during neuronal development causes phosphorylation of ampk and inhibition of neuronal polarization in cultured hippocampal neurons . Similarly, expression of ampk kd successfully rescued polarity in ischemia treated neurons, concluding that ischemia induced polarity inhibition is directly mediated by ampk . (a) under normal energy conditions ampk exists in an unphosphorylated / inactive state and pi3k is transported to the neurite tip via a physical association with the kif5 cargo adaptor, klc . The accumulation of pi3k at a single neurite tip promotes the signaling responsible for axon initiation and growth . (b) under energy - lacking conditions, amp binds to ampk producing a conformational change in the kinase, allowing phospho - activation of ampk by upstream kinases (ampkk). Ampk - caused klc phosphorylation dissociates pi3k, resulting in a loss of pi3k from the neurite tip and an inhibition of neuronal polarization . Control neuron shows typical single axon (left), which is missing in a neuron treated with ampk activator aicar (middle). Expression of kinase dead (kd) ampk rescues polarity in the aicar treated neuron . Is the fact that the serine / threonine kinase, lkb1, the major upstream activator of ampk in peripheral cells, is required for successful polarization of neurons . However, despite the fact that both lkb1 and ampk are expressed in nervous tissue, studies have indicated that lkb1 may not be the major regulator of ampk phosphorylation within the brain . For example, under basal conditions, lkb1-deficient cortical neurons show no deficit in phosphorylated ampk when compared with wild - type cells, indicating an alternative means of ampk phosphorylation . However, it is possible that regulation of ampk by lkb1 is restricted to periods of energetic stress, when amp binding has exposed the activation loop of ampk . It will be interesting to know whether ampk can be phosphorylated in lkb1-deficient neurons under atp - lacking conditions . In line with this, hawley et al . Has shown that in rat brain slices, increases of intracellular calcium by membrane depolarization result in ampk phosphorylation . Phosphorylation of ampk was concluded to result from camkk activity, as the camkk inhibitor, sto-609, abolished the effect . Importantly, membrane depolarization did not alter intracellular amp ratios, indicating that ampk can be regulated in a ca - dependent, amp - independent manner . Considering that ca influx is a hallmark of post - synaptic receptor activation, the ability of ampk to be phosphorylated by camkk may present a mechanism for coupling synaptic activity with energy regulation . Despite the ability of ampk to inhibit pi3k localization at the neurite tip, aicar treatment causes a marked increase in phosphorylated akt . This effect results directly from ampk activation, as introduction of the ampk antagonist successfully blocks aicar - induced akt phosphorylation . Furthermore, addition of a pi3k inhibitor also abolishes aicar - induced akt phosphorylation, indicating that the ampk effect on akt activation is mediated via pi3k . Although the physiological role of ampk - dependent pi3k / akt activation remains to be investigated, we hypothesize that it may represent a mechanism for stimulating atp production . Specifically, ampk has previously been characterized as an upstream regulator of glucose uptake in neurons, a mechanism that involves increased translocation of the glucose transporter, glut3, to the surface membrane . Similarly, insulin - like growth factor 1 (igf1) has also been implicated in the regulation of glucose uptake in the brain and binds to receptor tyrosine kinases that associate with insulin receptor substrate (irs-1), a known upstream activator of the pi3k / akt signaling cascade . Interestingly, ampk has been observed to phosphorylate irs-1, the most upstream component in the pi3k signaling pathway, in cell free assays and mouse myoblast c2c12 cell lines in response to aicar treatment, suggesting irs-1 as the intermediate factor linking ampk to pi3k / akt activation . The ability of ampk to suppress neuronal polarization may have significant relevance within a clinical context . Since neuron polarization and appropriate axon extension are the necessary precondition for intercellular connection and communication, the disruption of neuronal polarity resulting from ampk activation should have long - lasting effects on synapse formation and ultimately, brain function . We find that aicar treated neurons fail to specify an axon even after 3 d of recovery following treatment, indicating that the ampk effect on neuronal polarization may persist even after energy levels return to normal . In a similar scenario, pathological challenges occurring in early development, such as neonatal stroke and hypoxic - ischemic encephalopathy, that have been observed to promote ampk activation, also produce late - emergence cognitive deficits . It will be interesting to know whether ampk signaling is indeed responsible for clinically observed neurological abnormalities related to neural energy deficiency during early development.
|
Single - walled carbon nanotubes (swcnts) dispersed in aqueous media hold great promise for exciting applications in chemistry, biology, and nanomedicine . Central to these applications is the stability of these nanoscale dispersions in aqueous media . Various reagents or perturbations have been applied to control the aggregation status of swcnts, such as solution ph, light, oxidation and reduction of dispersants, temperature, and addition of salt . However, the molecular mechanisms that underlie swcnt aggregation have not been explored systematically, and there have been inconsistent views on this very important issue . The fundamental question that we concern is what the molecular interactions that drive this aggregation process are in aqueous medium . Although the surface of swcnts is hydrophobic in nature, which can in principle promote their self - association and aggregation through hydrophobic and van der waals interactions, this is not true for swcnts that have been dispersed into aqueous media assisted by various charged dispersants . For these dispersed swcnts, the charge status of these dispersant molecules on swcnt surface will have profound impact on the physical properties of swcnts in water . As demonstrated by wang and chen, swcnts dispersed by poly - l - lysine can undergo reversible aggregation that is dependent on the solution ph . When solution ph is close to the isoelectric point of lysine, dispersed swcnts become aggregated, suggesting that electrostatic interactions may play a significant role in this aggregation and redispersion process . However, how electrostatic interactions may tune the interactions among individual swcnts remains largely unexplored . In several aspects, individual swcnts coated with charged dispersants on their surface share similarity with polyelectrolytes such as double - stranded dna in solution . The sp2 carbons of swcnts form the hydrophobic backbones, and resemble the aromatic base groups located at the center of double - helical dna . The charged dispersant molecules are coated on this hydrophobic surface, very similar to the phosphate groups that lie on the exterior of double - stranded dna . Therefore, mechanisms that operate in dna condensation might work similarly in dispersed swcnts . For swcnts dispersed with charged molecules, we hypothesize that their aggregation in aqueous medium is mediated by electrostatic instead of van der waals interactions, and modulation of these electrostatic interactions can lead to reversion of swcnt aggregates . Herein we test this hypothesis by systematically investigating swcnt aggregation in aqueous medium mediated by a variety of dispersant molecules . We measure the surface charge status of swcnts during this aggregation process through measurement of the zeta potential, and correlate the extent of swcnt aggregation with zeta potential measurement . These results allow us to clarify the mechanisms of swcnt aggregation in aqueous medium . By further exploring these mechanisms, we demonstrate various strategies that can be used to reverse the aggregation of swcnts in solution . These mechanisms that we identified also apply to typical cell culture conditions and are thus relevant to the potential biological applications of swcnts in vivo . One milligram of arc - discharge (ad) swcnts (helix materials solution, tx) were dispersed in 1 ml of distilled and deionized water (ddh2o, synergy uv, millipore corporation, billerica, ma) with 1 h sonication in the presence of various dispersing reagents in a tip sonicator (ultrasonic processor s-4000, misonix, farmingdale, ny) as described previously to obtain singly dispersed tubes . This condition does not introduce defects to swcnt sidewalls, as indicated by the intensity ratio between d and g bands from raman spectrum measurements . The concentrations of dispersing reagents are 1 mg / ml for dna oligo (dt)30, fluorescein isothiocyanate (fitc), rhodamine b (rb), crystal violet (cv) and poly - l - lysine (pll), and 40 mg / ml for pluronic f 108 . Ice was constantly added to the bath to prevent heating of the sample during sonication . P3-swnts (swcnt cooh, carbon solutions, riverside, ca) were dispersed in ddh2o with the same procedure described above . We adjusted concentration of dispersed swcnts in aqueous medium as 0.02 g/l for consistency throughout the experiments . This concentration was determined based on the absorbance at 1023 nm, using an extinction coefficient of 11.9 (mg / ml)cm for ad swcnts that we estimated previously . All other reagents were purchased from sigma - aldrich (st . Louis, mo) unless specified otherwise . Seven hundred microliters of individually dispersed swcnts was agitated in an orbital shaker (excella e-24r incubator shakers, new brunswick scientific co, edison, nj) in the presence of different concentrations of various electrolytes at 20 c for 30 min at 200 rpm . After agitation, 600 l samples were used immediately for measurement of zeta potential in zetasizer zs90 (malvern, uk). The rest of the samples were centrifuged for 30 min at 17 000 g, and supernatants were collected for ultraviolet visible near - infrared (uv vis nir) absorbance measurement (shimadzu uv-1800, kyoto, japan) to determine the fraction of swcnts that remained in solution relative to the original quantity of dispersed swcnts . Aggregated swcnts were not redispersed by themselves for greater than 2 weeks . Throughout this paper, aggregation and zeta potential profiles of ad swcnts all the starting materials for aggregation experiments are supernatants of swcnts after centrifugation to remove nondispersed swcnts . For ethylenediaminetetraacetic acid (edta)-, dithiothreitol (dtt)-, 2-mercaptoethanol-, or nacl - mediated redispersion of various swcnt aggregates, we first induced aggregation of swcnts with various electrolytes at designated concentrations by agitation at a speed of 200 rpm for 30 min at room temperature (22 c). We then titrated in edta, dtt, 2-mercaptoethanol, or nacl, and agitated the sample at 20 c for 30 min at 200 rpm . After agitation, 600 l samples were used immediately for measurement of zeta potential . The rest of the samples were centrifuged for 30 min at 17 000 g, and supernatants were collected for uv vis nir absorbance measurement to determine the fraction of swcnts that were redispersed back to solution relative to the original quantity of dispersed swcnts . To determine the visible - nir absorbance spectra before and after inducing aggregation and redispersion, ad swcnts, chemical vapor deposition (cvd) swcnts (ses research, richardson, tx) and high pressure carbon monoxide (hipco) swcnts (super purified grade, unidym, sunnyvale, ca) were dispersed in the presence of (dt)30 and agitated for 30 min with 5 mm of cacl2 in order to induce aggregation . Swcnt samples were then agitated in the presence of 20 mm edta for redispersion . For side - by - side comparison, each untreated ad swcnt/(dt)30, cvd swcnt/(dt)30, and hipco swcnt/(dt)30 sample also went through the same procedures as described above, except that ddh2o was used in lieu of either cacl2 or edta . Nir absorbance spectra were recorded and plotted in parallel for side - by - side comparison . We first induced aggregation of negatively charged swcnts with 1 mm ka8k and positively charged swcnts with 5 mm ea8e (custom synthesized polypeptides, 95% purity, pierce protein, il . ). We then titrated in either protease (0.1% of trypsin and 1 mg / ml proteinase k), and agitated the sample at 20 c for 30 min at 200 rpm . After agitation, the samples were centrifuged for 30 min at 17 000 g, and supernatants were collected for uv vis nir absorbance measurement to determine the fraction of swcnts that were redispersed back to solution relative to the original quantity of dispersed swcnts . For inhibition of protease activity as a control experiment, swcnt aggregates induced by polypeptides ka8k or ea8e were treated with either 0.2 mg / ml trypsin inhibitor (from soybean) or 10 mm pmsf, respectively . Trypsin and proteinase k were then added to swcnt aggregates to monitor the redispersion of swcnts as described above . One microgram of dispersed swcnts was agitated with various fractions of complete cell culture media {90% atcc dulbecco s modified eagle medium (dmem) + 10% fetal bovine serum (fbs)} in a total volume of 100 l . After agitation at 200 rpm for various durations at various temperatures as indicated, samples were centrifuged at 17 000 g for 30 min (legend pro 17, thermo fisher scientific, ma). Supernatants were collected after centrifugation, and the fraction of individual swcnts that remained in solution was measured with uv vis previous studies on swcnts dispersed in h2o using sodium dodecyl sulfate (sds) showed that swcnts could undergo selective aggregation upon addition of salt . This phenomenon has been interpreted as aggregation mediated by van der waals attractions . When the concentration of counterions was increased, the surface of individually dispersed swcnts could be completely neutralized, at which point the adjacent swcnts would come into contact due to van der waals attractions . This leads to aggregation of swcnts upon addition of salt . To further explore this phenomenon in similar systems, we dispersed swcnts in h2o using dna oligos (dt)30, which carried negative charges under current experimental conditions . We then titrated swcnt/(dt)30 with various electrolytes, and monitored the surface charge status of swcnts by measuring the zeta potential of the swcnts after addition of the electrolytes at various concentrations . We then monitored the concentration of individually - dispersed swcnt/(dt)30 left in the aqueous medium after sedimentation . As shown in figure 1a, top panel, the fraction of dispersed swcnts that remained in solution did not change significantly until the concentration of the added electrolyte reached a certain threshold, which resulted in very sharp transitions in these curves as we progressively increased the concentrations of the electrolytes . This threshold behavior depends on the type of the electrolytes added, so that the higher the valence for the counterion, the lower the threshold concentration, which follows the order of fe <mg ca <na . In contrast to this threshold behavior, the zeta potential of the swcnts displayed a gradual instead of a sharp transition for all cases (figure 1a, bottom panel). Upon addition of various electrolytes, the surface charge of swcnts diminished monotonically, suggesting either the binding of counterions to swcnts that lead to charge neutralization or perhaps, dissociation of (dt)30 from swcnt surface . Notably, this charge decrease occurred gradually and never reached 100% even when all the swcnts in solution were aggregated . Comparison between figure 1a top and bottom panels suggests that, upon addition of electrolytes, aggregation of the swcnts did not occur until the overall surface charge was reduced below a certain threshold . Similar results were also observed for swcnts dispersed by fitc, another negatively charged dispersant for swcnts under these conditions that we described recently (figure 1b). Fraction of individual (a) swcnt/(dt)30, (b) swcnt / fitc, (c) swcnt cooh, and (d) swcnt / pluronic that remained in solution upon titration with various electrolytes (upper panel) and the zeta potential changes on swcnts associated with this process (lower panel). Error bars represent standard deviation from three independent repeats of the same experiments . Throughout this paper, aggregation and zeta potential profiles of ad swcnts the explanation offered for the aggregation of swcnts dispersed by sds upon salt addition is that salt reduces the solubility of sds in water, and the loss of sds from swcnt surface leads to charge depletion and aggregation . To test this type of mechanism, we repeated the above experiments using swcnts that carried covalent carboxylic functional moieties (swcnt cooh). The presence of cooh groups renders these swcnts readily dispersed in h2o without addition of any external dispersant molecules . As shown in figure 1c, the fraction of dispersed swcnts that remained in solution decreased sharply when the concentration of the added electrolyte reached a certain threshold . Cooh displayed a gradual instead of a sharp transition for all cases (figure 1c, bottom panel). This apparent charge decrease never reached 100% even when all the swcnts in solution were aggregated . Because cooh groups were covalently attached to swcnts, this result indicates that it is the binding of counterions to swcnt surfaces that partially neutralizes surface charge, which leads to aggregation of swcnts when the surface charge is neutralized beyond a threshold . This threshold pattern follows the same order of fe <mg ca <na, as in figure 1a, b, although the threshold concentrations of the electrolytes were different . For swcnt cooh, only 0.01 mm fecl3 is needed to aggregate more than 90% of swcnts, in contrast to 0.5 mm fecl3 that is needed to aggregate more than 90% of swcnts dispersed by (dt)30 . This difference is consistent with a higher surface charge density for swcnt cooh than swcnt/(dt)30, as revealed by the zeta potential measurement for these swcnts before addition of counterions (figure 1c bottom panel). The higher surface charge may afford a tighter binding for the same counterions on swcnt surface, which leads to the difference in threshold concentrations . The above results suggest that it is the binding of counterions to swcnts instead of dissociation of charged dispersant molecules that triggers aggregation when the surface charge of swcnt is neutralized beyond a threshold . To further test this hypothesis, we dispersed swcnts using uncharged molecules pluronic f 108, and titrated the dispersed swcnts with various concentrations of nacl, mgcl2, cacl2, or fecl3 . As shown in figure 1d, none of these reagents induced aggregation of swcnts throughout the concentrations investigated, except fecl3, which induced 10% aggregation at 1 mm fecl3 but this aggregation was less than <20% even at 1 m fecl3 tested . Consistent with these observations, the surface charge of swcnts did not change over the range of salt concentrations investigated, indicating no binding of ions to swcnt surfaces . Because pluronic f 108 does not carry any charges, these results reinforce the idea that the aggregation phenomenon we observed in figure 1a c is due to electrostatic interactions between swcnts and counterions in solution . These results support the idea that direct binding of counterions to swcnt due to electrostatic interactions triggers aggregation when the surface charge is neutralized beyond a threshold . If the above hypothesis is true, it should also be applicable to swcnts that carry positive instead of negative charges, and negatively charged counterions can bind swcnt surface that eventually leads to swcnt aggregation . To test this directly, we dispersed swcnts using positively - charged molecules that we described recently . Our prediction is that upon titration of negatively - charged counterions, these swcnts will undergo aggregation mediated by counterion binding . As expected, for swcnts dispersed by rb, cv or pll, titration of nacl, na2so4, na2co3, and na3po4 induced aggregation of swcnts . As shown in figure 2, the fraction of dispersed swcnts that remained in solution did not change significantly until the concentration of the added electrolyte reached a certain threshold, which resulted in sharp transitions in these curves as we increased the concentrations of the electrolytes . This threshold behavior depends on the type of the electrolytes added, which roughly follows the order of po4 <co3 <so4 <cl . In contrast to this threshold behavior, the zeta potential of the swcnts displayed a gradual instead of sharp decrease for all cases (figure 2, bottom panels), suggesting the direct binding of counterions to swcnt surface . Comparison between figure 2 top and bottom panels further indicates that aggregation of the swcnts does not occur until the surface charge is neutralized beyond a certain threshold . Moreover, this charge neutralization never reached 100%, even when all the swcnts in solution were aggregated . All these observations were consistent with our expectations and thus further support our hypothesis that counterion binding induces partial charge neutralization on swcnt surface, which leads to swcnt aggregation . Aggregation of (a) swcnt / rb (b) swcnt / cv, and (c) swcnt / pll upon titration with various electrolytes and the zeta potential changes associated with the process . To quantitatively examine the dependence of swcnt aggregation on their surface charge status, we plotted the fraction of swcnts that remained in solution as a function of the measured zeta potential on swcnt surfaces for each charged dispersant molecule that we have investigated (figure 3). Within each panel, the responses from the addition of various electrolytes were plotted for the same dispersant molecules . Notably, these plots all clustered closely to each other despite the differences in the counterions added . This result indicates that regardless of the type of counterions, swcnts undergo aggregation when their surface charge is neutralized beyond a threshold . The apparent plateaus in these plots permit quantitation of the zeta potential at which swcnts are fully aggregated . As shown in supporting information table s1, for various charged dispersant molecules or groups, swcnts are fully aggregated when the surface charge was neutralized to an average of 80%, varying from 74 to 86% . This result is similar to dna condensation induced by multivalent counterions, which occurs when 8990% of the dna phosphate charges were neutralized by condensed counterions . This apparent attraction instead of repulsion between dna molecules of the same charge is due to electrostatic correlation between screening counterions instead of van der waals attractions . Thus, our results reveal the similarity between dna condensation and swcnts aggregation, and swcnts dispersed by various charged dispersant molecules simply behave as polyelectrolytes . This property was conferred by the charges on the dispersant molecules (figure s1). The essential feature in this model is that the aggregation of swcnts dispersed by these charged dispersant is driven by electrostatic interactions, instead of van der waals or hydrophobic interactions among swcnts . Electrostatic attractions between individual swcnts of the same charge can develop as a result of correlation between screening counterions . These electrostatic interactions as mediated by the charged dispersant and counterions lead to swcnt aggregation in solution . Fraction of individually dispersed (a) swcnt/(dt)30, (b) swcnt / fitc, (c) swcnt cooh, (d) swcnt / rb, (e) swcnt / cv, and (f) swcnt / pll that remained in solution as a function of zeta potential on the swcnt surface . The above model of swcnts aggregation indicates that interaction of counterions with dispersant groups on swcnt surfaces eventually leads to swcnt aggregation . The model implies that removal of bound counterions from aggregated swcnts surface may lead to redispersion of swcnts . To test this hypothesis, we induced aggregation of swcnts dispersed with negatively charged dispersant molecules ((dt)30 and fitc) through addition of mg, ca, or fe, and then titrated in edta that can chelate these metal ions . As shown in figure 4a, b, we plotted the fraction of swcnts that remained in solution as a function of added edta expressed as the ratio between [edta] and the concentration of corresponding metal ions . All the aggregates can be redispersed into solution upon addition of edta above certain threshold, consistent with the threshold phenomenon observed in aggregation experiments and suggest that this process might be fully reversible under these conditions . A camera shot for this process is shown in figure 4c, where the middle test tube showed the formation of swcnt aggregates, which instantaneously disappeared upon addition of edta above a threshold level . Examination of the uv vis nir absorbance spectra of the dispersed hipco swcnts before aggregation and after redispersion revealed only small changes in peak position and very similar features for ad and cvd swcnts we have compared . The peak features of these spectra closely resemble those we published previously, suggesting that the above aggregation and redispersion process are reversible (figure 4d). We confirmed that our dispersion procedure did not induce oxidation of swcnts through raman spectra measurement . Thus, the e11 peaks displayed for hipco (blue spectra) may be related to the quality of the swcnts from the manufacturer . Control experiments using aggregates of swcnt / rb or swcnt / cv induced by addition of cacl2 (aggregation due to cl binding to positively charged swcnt surface) showed that addition of edta did not induce any redispersion of these aggregates, consistent with our expectation that only chelation of bound counterions on the surface of swcnts resulted in the dispersion of swcnts aggregates (figure s2). We note that the threshold concentration of edta required to fully disperse the aggregates vary with the type of metal ions and dispersant molecules . For example, for swcnt/(dt)30, almost stoichiometric amount of edta is sufficient to redisperse all the aggregates induced by addition of ca or mg, but almost 10-fold higher concentration is needed to redisperse the aggregates induced by addition of fe . These concentrations are not consistent with the binding constants for edta with these metal ions . Rather, it suggests that the potential packing structures of these aggregates and the resulting accessibility of metal ions in these aggregates may partially determine the concentration of edta needed to redisperse them . Consistent with this view, the aggregates of swcnt / fitc in general require a higher concentration of edta to redisperse than swcnt/(dt)30 (figure 4b), even for the aggregates induced by the same metal ions . This result suggests that the overall structure of swcnt / fitc aggregates may be more compact than that of swcnt/(dt)30 . These experiments, altogether, further support our model that the aggregation is due to binding of counterions to swcnt surface, and sequestration of the bound counterions can lead to the complete redispersion of swcnts in solution . Previous study has revealed that swcnts dispersed by pll can be aggregated and redispersed depending on the ph, which is resulted from the change in the charge status of pll in response to ph . Although ph is a different trigger for swcnts aggregation and redispersion compared to counterions in current studies, both employ similar mechanisms of electrostatic interactions to control the aggregation status of swcnts . Edta - mediated redispersion of aggregated (a) swcnt/(dt)30 and (b) swcnt / fitc . The concentrations of metal ions used to induce aggregation are 0.5 mm fecl3, 5 mm cacl2, and 5 mm mgcl2 for swcnt/(dt)30 and 1 mm fecl3, 5 mm cacl2, and 5 mm mgcl2 for swcnt / fitc . (d) visible nir absorbance spectra of various dispersed swcnts before and after aggregation and redispersion . In all the above studies, the counterions we studied were monomeric in their chemical structures, i.e., all the charges were carried in a single functional group within the molecule . Under physiological conditions, electrolytes that carry multiple charged groups in a single molecule exist, such as polyamines . To examine whether these polyamines can induce aggregation of swcnts through similar mechanisms as we demonstrated above, we prepared either swcnt/(dt)30 or swcnt cooh dispersion, and then tested spermidine, spermine, together with 1,6-diaminohexane (dh) and cystamine dihydrochloride (cd) for their effects on dispersed swcnts . As shown in figure 5a for swcnt/(dt)30, as we titrated spermidine or spermine, swcnts underwent aggregation as we expected; however, as we further increase the concentration of these polyamines above 1 mm, the aggregates transiently disappeared . Further addition of polyamines led to aggregation again, so that at 1 m polyamine, almost all swcnts were aggregated . This phenomenon was highly reproducible for swcnt/(dt)30 (figure 5a) or swcnt cooh (figure 5b). Notably, the zeta potential we measured for swcnts also varied with the concentration of polyamine in phase: surface charge was neutralized to about 80% when swcnts were fully aggregated; the zeta potential recovered to original values when aggregates became redispersed . Control experiments using swcnts dispersed by pluronic f 108 did not yield any aggregation or redispersion (figure 5c), suggesting once again that this complex phenomenon of aggregation, redispersion, and reaggregation was caused by polyamine binding, dissociation, and rebinding . Spermine and spermidine concentration - dependent aggregation and redispersion of (a) swcnt/(dt)30, (b) swcnt cooh, and (c) swcnt / pluronic together with the zeta potential changes associated with the process . In contrast to these observations in figure 5a, b, experiments using either dh or cd produced simpler results . As shown in figure 6a, b, swcnts underwent aggregation as we titrated either dh or cd into swcnt dispersion . Almost all swcnts were aggregated at 100 mm dh or cd, and no transient redispersion was observed throughout this process . Control experiments using swcnt / pluronic showed no aggregation throughout the concentrations of dh or cd tested (figure 6c). Because dh and spermidine only differ slightly in their chemical structures: spermidine has one extra ch2 and one extra nh group that carried one more positive charge than dh under current solution conditions (chart s1), we reasoned that the above process of aggregation started with the direct binding of the positively charged amino groups at the ends of these molecules to swcnt surfaces . This is possible because these positive charges serve as counterions for the negative charges on the surface of swcnts, either due to the dna phosphate backbone or cooh group that was covalently attached to the swcnt surface . However, more importantly, these molecules can induce swcnt aggregation through bridges mediated by the charged groups at both ends of these chain molecules . This bridging effect is favored by entropy, as these chain molecules have more degrees of freedom upon bridging between two individual swcnts, in contrast to the binding of both ends of the molecule to the same tube . For both spermidine and spermine but not dh or cd, due to the presence of additional positive charges, the increasing concentration of polyamines in solution increases the ionic strength of the solution, so that these entropic bridge interactions are weakened and collapsed (as shown in figure s3), consistent with the recovery of surface charge monitored by zeta potential (figure 5a, b bottom panel). This collapse does not occur to either dh or cd due to their lower charge status as compared to either spermidine or spermine . Cystamine dihydrochloride (cd) and diaminohexane (dh) mediated aggregation of (a) swcnt/(dt)30, (b) swcnt cooh, and (c) swcnt / pluronic . Error bars represent standard deviation from three independent repeats of the same experiments . To directly test this model of swcnt aggregation induced by addition of polyelectrolytes, we first focused on the bridging effect . We used cd and dh to induce aggregation of either swcnt/(dt)30 or swcnt cooh . If the bridging effect is responsible for swcnt aggregation, we would expect a redispersion of swcnt aggregates formed with cd upon addition of either dtt or 2-mercaptoethanol, because both reducing agents can reduce cd and thus break the molecule into two separate parts . In contrast, aggregates formed with dh should remain intact because dh contains no disulfide bonds that can be reduced . As we expected, more than 80% of the aggregates formed with cd could be redispersed upon addition of either dtt or 2-mercaptoethanol . This was true for both swcnt/(dt)30 and swcnt cooh (figure 7). In contrast, the aggregates formed with dh remain intact throughout the concentrations of both reducing agents used (figure s4). These results directly support our hypothesis that the initial swcnt aggregates formed in the presence of these polyelectrolytes are mediated by bridging interactions . Disulfide bond reducing agents, dtt or 2-mecaptoethanol (bme), mediated redispersion of (a) swcnt/(dt)30, (b) swcnt cooh, and (c) swcnt / fitc aggregates induced by addition of cd . The corresponding zeta potential changes associated with the process were shown in bottom panels . We then focused on the transient redispersion of swcnt aggregates upon addition of medium concentrations of spermidine or spermine, which was absent for either cd or dh . To directly examine the transient nature of this redispersion we then titrated the mixture with increasing concentrations of nacl ([nacl]). Interestingly, increasing [nacl] first reduced aggregation . At 200 mm nacl, these observations were very similar to the redispersion and aggregation of swcnts induced by either spermidine or spermine as shown in figure 5 and suggests that the transient redispersion is due to increased ionic strength in solution that weakened the entropic bridge interactions . The zeta potential first decreased upon addition of nacl, indicating dissociation of bound polyamine molecules . This was then followed by a steady increase in zeta potential, which resulted from the reassociation of counterions to swcnts at high concentrations and induced reaggregation of swcnts . This bridging effect as we observed for polyelectrolytes suggests a possible application of these molecules to induce reversible aggregation and redispersion of swcnts that can be controlled through chain breaking . To test this possibility, we synthesized oligopeptides that are flanked by either two positive lysine residues or two negative glutamic acid residues on the two ends of the peptides (chart s1). As expected, the positively charged peptide ka8k can induce aggregation of either swcnt/(dt)30 or swcnt cooh, while the negatively charged peptide ea8e can induce aggregation of either swcnt / cv or swcnt / pll, as shown in figure 9 together with the zeta potential measurement results for this titration process . Under conditions where we induced full aggregation of swcnts, we treated the swcnt aggregates with either trypsin that can cleave the ka8k peptide or protease k that can cleave the ea8e peptide . As shown in figure 10, greater than 50% of swcnt aggregates could be redispersed upon addition of these protease enzymes for swcnts initially dispersed with various molecules . This redispersion was due to protease action because inclusion of either trypsin inhibitor or pmsf (which inhibits protease k) completely blocked the redispersion of swcnt aggregates (figure 10). Fraction of individual (a) negatively charged swcnts and (b) positively charged swcnts that remained in solution after addition of polypeptides (ka8k for negatively charged and ea8e for positively charged swcnts). Enzyme mediated redispersion of (a) swcnt/(dt)30 and swcnt cooh aggregated by polypeptide (ka8k) and (b) swcnt / pll and swcnt / cv aggregated by polypeptide (ea8e) and the inhibition of this redispersion by enzyme inhibitors . The above results on swcnt aggregation, as we observed for both monomeric electrolyte and polyelectrolyte molecules, bear direct relevance for the potential applications of swcnts as delivery vehicles for genes into the cells . When swcnts are conjugated with nucleic acids, they can undergo aggregation and redispersion as a result of interactions with their counterions . Notably, the concentrations of counterions that are required to induce aggregation of swcnts under current experimental conditions are close to the concentrations of these ions in vivo . Thus, swcnts conjugated with dna or other charged molecules may well undergo aggregation in vivo that could lead to toxicity in cells and tissues . To test this aggregation, as expected, majorities of swcnts precipitated out of the solution with 50% culture media in the solution (figure s5). In contrast, controls using swcnts dispersed with pluronic f 108 underwent little aggregation even when the solution contains 80% of culture media . Thus, our results suggest that the application of swcnts in tissue culture experiments has to consider the potential aggregation due to interactions with counterions . Here we have investigated the properties of aggregation and redispersion of swcnts in aqueous medium . For swcnts that are dispersed into aqueous medium assisted by charged molecules, addition of electrolytes can induce their aggregation that is reversible under certain conditions . Neutralization of the swcnt surface charge by 74 to 86% leads to aggregation of swcnts . This aggregation is driven by electrostatic attractions instead of van der waals or hydrophobic interactions due to correlations between screening counterions, similar to the mechanisms of dna condensation induced by multivalent cations . Polyelectrolyte can induce swcnt aggregation through molecular bridging, which can be utilized to engineer the aggregation and redipersion of swcnts in solution by exploiting various chain breaking mechanisms . Our data suggest that swcnts can be aggregated during in vitro as well as in vivo applications as gene delivery vehicles, which may lead to toxicity of these nanomaterials in vivo . Our method of redispersing aggregated swcnts could be potentially used to control the aggregation status of swcnts within biological systems . The mechanisms that we identified for swcnt aggregation have broad implications on various applications of swcnts in water.
|
Sleep behaviors are among the most common concerns that bring parents of young children to their physicians . A child who goes to bed unwillingly or wakes frequently during the night can be highly disruptive to a family . As a rule, the frequency of night waking starts in 100 percent of newborns and tails off to approximately 20 - 30 percent in six - month - olds . It is estimated that sleep problems are experienced by 25 - 30 percent of children and adolescents, regardless of age . Thus, while sleep occupies a major portion of the childhood years, childhood sleep problems constitute a major parental concern . Sleep problems, which can include inadequate, disrupted, poor quality, or non - restful sleep, are one of the most common complaints raised by parents to pediatricians and practitioners . In contrast, the relationship between insufficient or disturbed sleep and the many manifestations of daytime sleepiness, such as mood and behavior problems, although less frequently recognized by parents, has a major impact on quality of life of children and adolescents . Although many sleep problems in infants and children are transient and self - limited in nature, certain intrinsic and extrinsic risk factors such as difficult temperament, chronic illness, and maternal depression may predispose some children to develop more chronic sleep disturbances . Despite the magnitude and clinical importance of sleep issues, several studies have documented that there is a low level of recognition of sleep disorders by primary care physicians in children[56]. For example, in a survey of over 600 community pediatricians, approximately 20% of the respondents did not routinely screen for sleep problems in school - aged children in well - child visit, about 25 percent of routinely screened toddlers and pre - schoolers for snoring, and less than 40 percent questioned adolescents directly about sleep habits, despite the respondents knowledge of the importance of sleep's impact on health, behavior, and school performance . In another study a validated pediatric sleep questionnaire used to identify a series of children with sleep - related symptoms at two community based general pediatrics clinics and reviewed medical chart notes for the previous 2 years to determine how often sleep problems had been addressed . Fewer than 15 percent of patients had current chart notes that mentioned some of the questionnaire - defined sleep problems; diagnoses were mentioned for two of 86 patients and no treatments were discussed . The consequences of untreated sleep problems may include significant emotional, behavioral, and cognitive dysfunction[711]. The impact of childhood sleep problems is further intensified by their direct effect on parents sleep, resulting in parental daytime fatigue, mood disturbances, and a decreased level of effective parenting . After the school entrance such sleep problems impact adversely on behavior, school functioning, and health - related quality of life . Surprisingly little attention has been paid to the impact of sleep problems in the vital preschool years and there have not been enough studies investigating etiologic factors of these problems[7, 12]. Preschool and school children with habitual snoring were more likely to have sleep - related daytime and nighttime symptoms . But the studies determined no significant association between habitual snoring and poor school performance[7, 10]. A recent study from nigeria concluded that snoring is an important health problem among preschool and school children as a significant percentage of them snore and most of whom are between third and sixth year of life . Most of the studies regarding sleep habits in children are from the west; however, a few asian studies[1214] are available and these studies emphasize the effect of culture . In a previous study in iran, the authors first determined the reliability and validity of persian version of the well - known bedtime problems, excessive sleepiness, awakenings during the night, regularity of sleep, snoring (bears) pediatric sleep questionnaire and then designed a pilot study to describe sleep patterns and sleep problems among pre - school and school - aged children in two primary care pediatric clinics in tehran . The purpose of the tehran's children sleep study (tcss) was to investigate the possible relationship between gender and school entrance on sleep complaints . The authors supposed that these mentioned factors might be of value for both practitioners and parents to plan for tailored and more effective interventions to combat sleep problems in boys and girls and in pre - school (2 - 6 years of age) versus school - age children (7 - 12 years of age). The subjects were pre - school - aged and school - going children between the ages 2 and 12 years who were selected by clustered randomization of families in tehran based on their zip codes . Subjects were included randomly if their parents agreed to cooperate in filling bears sleep screening questionnaire (see the procedure). A total of 746 subjects were entered in the study: 325 pre - school - aged children (2 - 6 years old group) and 421 primary school - aged children (7 - 12 years old group). Our study protocol was approved by the ethical board committee of ent, head and neck research center of tehran university of medical sciences, in tehran . The bears is a screening tool developed by the investigators of brown university school of medicine, rhode island hospital, usa . It was designed to address the most common sleep issues in toddlers, pre - schoolers, and school - aged children . It is an acronym and incorporates five basic sleep domains: bedtime problems, including difficulty going to bed and falling asleep; excessive daytime sleepiness, which includes behaviors typically associated with daytime somnolence in children; awakenings during the night; regularity of sleep / wake cycles (bedtime, wake time) and average sleep duration; and snoring . Reliability and validity of the persian version of the bears questionnaire was assessed in a previous study ., all parents were informed about the importance of sleep problems screening in children and they were asked to sign the consent to participate in the study . Then, the persian version of the bears questionnaire with five domains was asked by general pediatricians . Questions for pre - school children were answered by their parents; but for school - age children, some questions were asked from the children themselves . Data were entered into the statistical package for the social sciences (spss) software version 11.5 . Descriptive statistics were used to report frequency counts, percentages and means (standard deviations). Proportions (prevalence) of sleep complaints in each b - e - a - r - s category were calculated for pre - school and school - age groups, totally and stratified by gender . The same test was used to assess if there was any difference between boys and girls in each age category . Two - sided p - values were reported and an alpha level of 0.05 was considered as the threshold of statistical significance . As the effect measure, the odds ratio (or) plus its 95 percent confidence interval (95%ci) was calculated to compare the effect size of gender on sleep complaints difference in each b - e - a - r - s category . Again, the same approach was used to calculate the effects of school attendance on sleep problems . For comparing mean sleep duration between two groups, the subjects were pre - school - aged and school - going children between the ages 2 and 12 years who were selected by clustered randomization of families in tehran based on their zip codes . Subjects were included randomly if their parents agreed to cooperate in filling bears sleep screening questionnaire (see the procedure). A total of 746 subjects were entered in the study: 325 pre - school - aged children (2 - 6 years old group) and 421 primary school - aged children (7 - 12 years old group). Our study protocol was approved by the ethical board committee of ent, head and neck research center of tehran university of medical sciences, in tehran . The bears is a screening tool developed by the investigators of brown university school of medicine, rhode island hospital, usa . It was designed to address the most common sleep issues in toddlers, pre - schoolers, and school - aged children . It is an acronym and incorporates five basic sleep domains: bedtime problems, including difficulty going to bed and falling asleep; excessive daytime sleepiness, which includes behaviors typically associated with daytime somnolence in children; awakenings during the night; regularity of sleep / wake cycles (bedtime, wake time) and average sleep duration; and snoring . Reliability and validity of the persian version of the bears questionnaire was assessed in a previous study ., all parents were informed about the importance of sleep problems screening in children and they were asked to sign the consent to participate in the study . Then, the persian version of the bears questionnaire with five domains was asked by general pediatricians . Questions for pre - school children were answered by their parents; but for school - age children, some questions were asked from the children themselves . Data were entered into the statistical package for the social sciences (spss) software version 11.5 . Descriptive statistics were used to report frequency counts, percentages and means (standard deviations). Proportions (prevalence) of sleep complaints in each b - e - a - r - s category were calculated for pre - school and school - age groups, totally and stratified by gender . The same test was used to assess if there was any difference between boys and girls in each age category . Two - sided p - values were reported and an alpha level of 0.05 was considered as the threshold of statistical significance . As the effect measure, the odds ratio (or) plus its 95 percent confidence interval (95%ci) was calculated to compare the effect size of gender on sleep complaints difference in each b - e - a - r - s category . Again, the same approach was used to calculate the effects of school attendance on sleep problems . For comparing mean sleep duration between two groups, bears questionnaire was completed for a total of 746 (2 - 12 years old) children; 325 consisting of 142 (43.7%) females and 183 (56.3%) males were in pre - school - age group (2 - 6 years old) and 421 with 173 (41.1%) females and 248 (58.9%) males were in primary school - age group (7 - 12 years old). Male to female ratio was not different between the two age groups (p=0.4). The average age was 3.93 (0.16) years in pre - school - age group and 9.63 (0.16) years in primary school - age group . Table 1 shows the prevalence of probable or definite problems in each domain of bears, where screening questionnaire and also the comparison of percentages between pre - school and school - aged groups is shown . The most common screening problem in both pre - school and school - aged group was excessive daytime sleepiness (64.9% and 62.9% respectively). The least common problem in both groups was sleep disordered breathing (7.1% and 11.9% respectively). Bedtime problems and also regularity and duration of sleep were significantly more prevalent in pre - school - age group (p<0.0002; or=1.98; 95% ci: 1.98 - 4.20; and or=2.00; 95%ci: 1.41 - 2.84, respectively). However, sleep - disordered breathing was lower in pre - school children (p=0.029; or=0.57; 95%ci: 0.34 - 0.94). Other bears domains - excessive daytime sleepiness and awakening during the night - did not differ significantly between the two groups . Comparison of the prevalence of sleep problems in each domain of bears questionnaire among pre - school and school - aged groups odds ratio for the effect of school entrance; ci: confidence interval; bears: bedtime problems, excessive sleepiness, awakenings during the night, regularity of sleep, snoring for pre - school children, mean time for going to bed at night was 22:54 (sd 1.20 hrs), mean wakeup time in the morning was 08:43 (sd 1.20 hrs), and mean sleep duration was 9.81 hours (sd 1.13). For school - aged children, mean time for going to bed at night in school days was 22:36 (sd 1.12 hrs), mean wakeup time in the morning in school days was 07:11 (sd 1.12 hrs), and mean sleep duration was 8.59 hours (sd 1.33). The difference between mean sleep duration between pre - school age and school - age groups was statistically significant (p<0.0001). Table 2 shows the comparison between boys and girls for sleep problems in both pre - school and school - aged groups . Pre - school boys showed significantly less bedtime problems than pre - school girls (p=0.003; or=0.49; 0.30 - 0.79). However, in school - aged group all items were statistically the same between girls and boys . Comparison of the prevalence of sleep problems in each domain of bears questionnaire among boys and girls in both pre - school and school - aged groups bears: bedtime problems, excessive sleepiness, awakenings during the night, regularity of sleep, snoring tables 3 and 4 reveal the comparison of sleep problems between pre - school and school - aged boys and also between pre - school and school - aged girls . Among both genders, bedtime problems, and regularity and duration of sleep problems were significantly more prevalent in pre - school - age group (p=0.0002 and 0.04 respectively), (p=0.003 and 0.0005 respectively). Comparison of the prevalence of sleep problems in each domain of bears questionnaire among pre - school and school - aged groups in boys odds ratio for the effect of school entrance in boys; ci: confidence interval; bears: bedtime problems, excessive sleepiness, awakenings during the night, regularity of sleep, snoring comparison of the prevalence of sleep problems in each domain of bears questionnaire among pre - school and school - aged groups in girls odds ratio for the effect of school entrance in girls; bears: bedtime problems, excessive sleepiness, awakenings during the night, regularity of sleep, snoring awakening times during the night and sleep - disordered breathing were more prevalent in school - aged boys (p=0.0003 and 0.04 respectively). It seems that the prevalence of sleep problems according to bears questionnaire is relatively high in our study especially in excessive daytime sleeping domain . The overall findings in different bears domains are in agreement with authors previous pilot study; but in excessive daytime sleeping domain we came to a much larger figure . The prevalence estimates of sleep problems are very diverse in multiple old and new studies and in different parts of the world and it ranges from 20.7% in a 1989 - 90 survey in headington, oxford by ali et al to almost 40% in a 2010 study in australian indigenous and non - indigenous children by blunden et al . But most of these studies have not used the bears questionnaire as a screening tool for sleep problems assessment . Owens et al have reported the following prevalence estimates in their leading study: bedtime issues 16.3%; nighttime awakenings 18.4%; and snoring 10.7% (our relevant estimates are 28.9%, 27.7%, and 7.1% in pre - school children and 12.4%, 44.2%, and 11.9% in school - aged children respectively). The more important thing here is the regular assessment of the prevalence estimates at different times using reliable and valid tools to become able to perform trend analyses . The prevalence of sleep problems in these groups of children in our study was also nearly comparable to percentages found in other studies[3, 18]. We thought of gender and school attendance as possible factors affecting sleep problems in children . The reason for the first one is that especially in school - aged children, boys and girls attend separate schools in most parts of our country especially in tehran . Some studies also have evaluated the effects of gender on sleep related problems and have found interesting points . For example, gau et al reported that girls sleep fewer hours than boys and do not show an increase in daytime sleepiness . Simola et al showed that age and gender were related to phenotype of the sleeping problems while there were no gender differences in any sleep parameters in another study conducted by seo et al . Few studies have estimated if there is any difference between boys and girls on sleep problems, and as shown in table 2, there is just a statistically significant difference in one bears domain (bedtime problems) between boys and girls . In a study by van litsenburg et al, parents reported that girls experienced more sleep problems than boys, notably for sleep onset delay and daytime sleepiness, while for the child self - reports, no gender difference was found . Secondly, few studies guided us to consider school attendance as a possible factor affecting sleep problems[1923]. Because the usual starting year for school attendance is 7 years of age, we divided the age range of our subjects to two broad categories shown in tables . Considering total subjects, bedtime problems regularity and duration of sleep, and sleep - disordered breathing had statistically significant difference between pre - school and school - aged children . The added value of calculating odds ratio as an effect measure helps us better understand the consequence of going to school on sleep . School entrance seems to exacerbate sleep problems in bedtime problems and also regularity and duration of sleep domains and plays the role of a risk factor . The opposite effect is seen for sleep - disordered breathing domain (table 1). Considering males and females separately (tables 3 and 4), same pattern is seen for males and females in bedtime problems and regularity and duration of sleep; but, school attendance seems to have a protective effect in awakening during the night domain in both boys and girls . School entrance plays a protective role for sleep - disordered breathing in boys but not in girls . Seo et al demonstrated that extracurricular academic activities, is related to the children's sleep duration and that the older children sleep less than younger children . They thought that the main reason is late bedtimes due to socio - cultural factors, high levels of nighttime and recreational activities, and/or excessive academic activities . Quach et al showed that sleep problems during school transition are common and associated with poorer child outcomes . They conducted the first study, to their knowledge, to examine the natural history of sleep problems in children over the transition from preschool to school . Liu et al believed that unique school schedules and sleep practices may contribute to the differences in the sleep patterns and sleep problems of children from the united states and china . Gau et al hypothesized that little sleep at night made the students feel sleepy in the daytime and tired, drowsy, moody and difficult at arising in the morning . Compared with our study showing no significant difference of sleep - quality between girls and boys, japanese findings support the hypothesis that during the junior high school period, the majority of sleep - quality indicators in japanese schoolchildren were better for girls than for boys . Boys sleep was less efficient and more fragmented during the entire week in comparison to that of the girls . Few studies such as the one conducted by kahn et al, have assessed the effect of poor sleeping on school performance and have found interesting results such as the point that among the poor sleepers, 21% had failed 1 or more years at school . School achievement difficulties were encountered significantly more often among the poor sleepers than among the children without sleep problems (p=.001). Although this point of view has not been considered as our hypothesis of research, there seems to be diverse effects from school attendance on different sleep patterns and behaviors that need specific and more rigorous exploration . No study (including ours) has assessed the possibility of correlation between the results of answers to five bears domains; the same fact is also true for correlation between parent - answered questions and child - answered ones . Although van litsenburg et al used different questionnaires to study sleep habits and sleep disturbances in dutch children, they were concerned that correlations between parental and self - assessments were low to moderate and this fact may have an effect on bears questionnaire too . Maybe the work done by iwasaki et al should be repeated for bears as well . They studied the utility of subjective sleep assessment tools for healthy preschool children and compared sleep logs, questionnaires, and actigraphy; their results showed that sleep schedule variables in the parental reports generally correlated well with actigraphic assessment of sleep patterns and although the daily sleep log was better correlated with actigraphy, the brief questionnaire showed a good correlation with sleep pattern on weekday actigraphic assessments . We hypothesized that high prevalence of sleep problems in school aged and pre - school aged children of tehran is due to bad sleep time that we think is caused by our culture and loss of enough family attention and related ignorance on the harmfulness of poor sleep of children . Moreover, the poor sleep quality of iranian preschool children is probably due to cultural characteristics, climate differences, or harmful sleep habits . The difference between mean sleep duration between pre - school age and school - age groups is important (as it is statistically significant in our study) because it affects the risk of becoming overweight in later years . Ochiai et al reported that short sleep duration increases the risk of becoming overweight and this relationship differs between the two sexes . Newer population - based researches may elucidate this kind of relationship in iranian children . Against this strength, our study had some limitations . Cross sectional design limited our causative assessment for sleep problems, more- over we did not include some familial factors such as socioeconomic factors and psychological problems in the families . We have categorized the subjects to two groups according to their age and took the whole 2 - 6 years as one group and the 7 - 12 years as another . This type of unification may have an effect on the final results, but we have tried to conduct a comparable scenario to the work of owens et al, and also to our previous pilot study . The other fact is that socioeconomic status (ses) of families was not assessed in our study . Higher ses might have negative impact on total sleep duration, sleep hygiene and also on children's psychological well - being . The present survey shows that the prevalence of sleep problems is relatively high especially in excessive daytime sleeping domain of preschool - aged and school children . We demonstrated that there is a significant relationship between school entrance and lower bedtime as well as regularity problems . Our findings suggest a development of a more tailored sleep - related health service to help both preschool and school children and also assist parents to know and tackle sleep troubles more effectively and thoroughly . The authors recommend using results of regularly conducted sleep studies to design, implement, and evaluate effective interventions to downsize the harmful effects of bad sleep habits.
|
Health services and health policy research can be based on qualitative research methods, especially when they deal with a rapid change and develop a more fully integrated theory base and research agenda . However, the field must be with the best traditions and techniques of qualitative methods and should distinguish the essentiality of special training and experience in applying these methods . Health knowledge must also include interpretive action to maintain scientific quality when research methods are applied . Qualitative and quantitative strategies should be seen as complementary rather than being thought of as incompatible . Although the procedures of interpreting texts are different from those of statistical analysis, due to their different type of data and questions to be answered, the underlying scientific principles are very much the same . While working for more than a decade as qualitative designer, khankeh faced a lot of challenges in conducting qualitative research in the field of health which occupied the mind of other health researchers . Therefore, this article contributes to the discussion of challenges related to qualitative research in healthcare in the light of personal experiences of a researcher conducting purely qualitative health research . Qualitative research methods involve systematic collection, organizing, and interpretation of material in textual form derived from talk or observations . They are useful to explore the meanings of social phenomena as experienced by individuals in their natural context . The health community still looks at qualitative research with skepticism and accuses it for the subjective nature and absence of facts . Scientific standards, criteria and checklists do exist and the adequacy of guidelines has been vigorously debated within this cross - disciplinary field . Clinical knowledge consists of interpretive action and interaction factors that involve communication, shared opinions, and experiences . The current quantitative research methods indicate a confined access to clinical knowledge, since they insert only the questions and phenomena that can be controlled, measured, and are countable where it is necessary to investigate, share and contest the tacit knowledge of an experienced practitioner . It is concerned with increased understanding of the meaning of certain conditions for health professionals and patients, and how their relationships are built in a particular social context . These kinds of research allow exploration of the social events as experienced by individuals in their natural context . Qualitative inquiry could contribute to a broader understanding of health science considering the substantial congruence between the core elements of health practice and the principles underpinning qualitative research . Corbin (2008) reported that in the past 10 years, the interest in qualitative methods in general and grounded theory in particular has burgeoned according to a review of the literature and dissertation abstracts . A researcher engaged in qualitative research will be confronted with a number of challenges . Identifying the research problem and forming the research question are some of the initial challenges that researchers encounter in the early stages of a qualitative research project . Researchers and students sometimes fail to understand that adopting a qualitative approach is only the first stage in the process of selecting an appropriate research methodology . Once the initial research question has been identified, the crucial decision to be made is on the selection of an appropriate method, such as content analysis, ethnography, or grounded theory, and selecting the research design as well . Subsequent arrangements would be on the proper methods of data collection, participants, and the research setting, according to the methodology and the research question . Qualitative researchers should also handle other important concerns such as data analysis, ethical issues, and rigor methods of results . In this paper, we are going to discuss important practical challenges of qualitative inquiry in health and the challenges faced by researchers using interpretive research methodologies . It is important to provide an honest and concise appreciation of the essential characteristics of the qualitative research before discussing the challenges of the interpretive research approach to studies in health . Qualitative research does not promise a clear or direct and orderly method of tackling research problems in health studies . It does not provide researchers with a set of rules to be followed or give them a comforting sense of security and safety backup against possible mistakes on the road to knowledge . This research method depends on the power of words and images, but does not offer the assimilated meanings such as numbers and equations; it is rather an attentive search of meaning and understanding and an attempt for profound comprehension and awareness of the problems and phenomena . The essentially diagnostic and exploratory nature of qualitative research is invaluable in developing conceptualizations in health as an evolving discipline . It tenders the possible tap into the sea of complex interactions in health that can be as follows . Researchers launch the quest for new theories in health which should acknowledge that qualitative research is an approach rather than a particular set of techniques, and its appropriateness derives from the nature of the social phenomena to be explored . In qualitative research, knowledge derives from the context - specific perspective on the experienced phenomena, interpretations, and explanation of social experiences . The approach is helpful in understanding human experiences, which is important for health professionals who focus on caring, communication, and interaction . Many potential researchers intend to find the answer to the questions about a problem or a major issue in clinical practice or quantitative research cannot verify them . In fact, they choose qualitative research for some significant reasons: the emotions, perceptions, and actions of people who suffer from a medical condition can be understood by qualitative researchthe meanings of health professions will only be uncovered through observing the interactions of professionals with clients and interviewing about their experience . This is also applicable to the students destined for the healthcare fieldqualitative research is individualized; hence, researchers consider the participants as whole human beings, not as a bunch of physical compartmentsobservation and asking people are the only ways to understand the causes of particular behaviors . Therefore, this type of research can develop health or education policies; policies for altering health behavior can only be effective if the behavior's basis is clearly understood . The emotions, perceptions, and actions of people who suffer from a medical condition can be understood by qualitative research the meanings of health professions will only be uncovered through observing the interactions of professionals with clients and interviewing about their experience . This is also applicable to the students destined for the healthcare field qualitative research is individualized; hence, researchers consider the participants as whole human beings, not as a bunch of physical compartments observation and asking people are the only ways to understand the causes of particular behaviors . Therefore, this type of research can develop health or education policies; policies for altering health behavior can only be effective if the behavior's basis is clearly understood . Before adhering to a distinct research methodology, researchers have to exactly understand the nature and character of their inquiries and the knowledge they choose to create . However, all defects and challenges of qualitative research should be realized rather than discarded as a compelling way to knowledge structure . New endeavors in excellent academic achievement and building new tradition of qualitative research in health can be facilitated through acknowledging traps and clarifying the real practical challenges . Finally, qualitative research provides investigators with the tools to study the health phenomena from the perspective of those experiencing them . This approach is especially applied in situ ations that have not been previously studied, where major gaps exists in research field, and when there is a need for a new perspective to be identified for the arena of health care intervention . Based on corbin and strauss (2008), committed qualitative researchers lean toward qualitative work because they are drawn to the fluid, evolving, and dynamic nature of this approach in contrast to the more rigid and structured format of quantitative methods . It is the endless possibilities to learn more about people that qualitative researchers resonate to . It is not distance that qualitative researchers want between themselves and their participants, but the opportunity to connect with them at a human level (epistemology). Qualitative researchers have a natural curiosity that leads them to study worlds that interest them and that they otherwise might not have access to . Furthermore, qualitative researchers enjoy playing with words, making order out of seeming disorder, and thinking in terms of complex relationships . For them, doing qualitative research is a challenge that brings the whole self into the process . Researchers select approaches and methodology based on some scientific logics, not on being easy or interesting . The nature and type of the research question or problem; the researcher's epistemological stance, capabilities, knowledge, skills, and training; and the resources available for the research project are the criteria upon which adopting methodology and procedures depend . Inconsistency between research question and methodology, insufficient methodological knowledge, and lack of attention on philosophical underpinning of qualitative methodology can be mentioned as some important challenges here . There are several different ways of qualitative research and researchers will have to select between various approaches . The qualitative research is based on the theoretical and philosophical assumptions that researchers try to understand . Then, the research methodology and process should be chosen to be consistent with these basic assumptions and the research question as well . Some researchers believe that there is no need to study the methodology and methods before beginning the research . Many researchers neglect to gain this knowledge because they are not aware of the qualitative inquiry complexities which make them go wrong . For instance, lack of information about interview, qualitative data analysis, or sampling is very common . My experience shows that lack of knowledge, experience, and skills in a research team to do qualitative research can hinder the formation of original knowledge and improvement in understanding the phenomenon under study . The result of such a study will not be new and interesting, and even the study process will be very mechanical without good interpretation or enough exploration . Sometimes there is an inconsistency between research question, research methodology, and basic philosophical assumptions, and the researchers fail to justify their methods of choice in line with the research question and the ontological and epidemiological assumptions . Finally, the researcher's intentions, the aims of the research question / inquiry, and the chosen approach are regarded as the most important reasons to select a qualitative research method consistent with them and their underpinning philosophical assumptions as well . Qualitative research is exciting because it asks questions about people's everyday lives and experiences . A qualitative researcher will have the chance of discovering the significant truths in the lives of people . That is a wonderful privilege, but you need to get those questions right if you dig into people's lives and ask about their real experiences . An adequate and explicit research question, or a set of interrelated questions, builds the basis for a good research . But excellent research questions are not easy to write at all . A good research requires a good research question as well because it allows us to identify what we really want to know . However, at the beginning of a project, researchers may be uncertain about what exactly they intend to know, so vague questions can lead to an unfocused project . Common problems coming up with a research question include: deciding about the research area among a range of issues that are heeded in your field of interestnot capable of pointing toward any interesting area or topic sufficient to focus a major piece of work onknowing about the area you want to concentrate on (e.g. Emergency), but not a certain topicknowing what area and topic is specifically difficult to articulate a clear question . Deciding about the research area among a range of issues that are heeded in your field of interest not capable of pointing toward any interesting area or topic sufficient to focus a major piece of work on knowing about the area you want to concentrate on (e.g. Emergency), but not a certain topic knowing what area and topic is specifically difficult to articulate a clear question . Having identified a research area, your next step will be to identify a topic within that interesting area . Suggestions for future work at the end of a paper you have found interesting . Moreover, you can search for some verifiable gaps through literature review, or based on your personal or professional experience and expert opinion, which should be studied . Therefore, all the previous studies that have already been conducted in the area are considered as important . In this way, you do not run the risk of asking a research question that has already been addressed and/or answered . Based on my experience, novice researchers have some problems finding the right topics in their field of interest because they do not perform a broad literature review to find the gaps and problems suitable to be investigated . Sometimes their field of interest is different from that of their supervisors or there are no experts to help them in this regard . Although the topic may retain your interest and you may be committed to undertake such a study, it is important to recognize that some topics of personal relevance may also be deeply significant and difficult to research . Finally you need to make sure that your topic of interest is the one that you can actually study within the project constraints such as time and fund . Once you have identified your interesting topic for research (according to a broad literature review, personal and professional experience, and/or expert opinion), you can begin to create a research question . Forming the research question is one of the initial challenges that researchers encounter in the early stages of a research project . Therefore, it acquires significance by the very fact that it provides brief, but nevertheless, important information on the research topic that allows the reader to decide if the topic is relevant, researchable, and a remarkable issue . Furthermore, the research question in qualitative studies has an additional significance as it determines the manner of conducting the study . The qualitative research question delineates the procedures that are executed in the study and provides a map to the readers by which they can trail the researcher's intentions and actions in the study . Therefore, special attention is needed on how a qualitative research question will specifically be structured, organized, and formed in the way to quote the necessary information and elements that allow the readers to assess and evaluate the study . The formation of a qualitative research question acquires a basic conducting role for the study and a fundamental function to develop an audit trail that can empower the readers to judge the value, rigor, and validity of the whole research project . Hence, researchers should not only pay special attention toward developing a significant and relevant question, but also formulate it properly . The qualitative research question must be provided in such a way as to impart, reflect, and conjoin the theoretical and abstract assumptions with the practical and pragmatic means of attaining them . In plain words, a good qualitative research question implicates particular phrasing, whereas the order of words should make the topic of interest amenable to the qualitative quest . The researcher has to concentrate on how the content of the research topic is understood when phrasing the qualitative research questions, adhering to the topic with the philosophical / theoretical suggestions and to the structure of the study which requires compounding specific principal elements . Also, the content provides a brief focus on the issue to be investigated, but does not define the exact relationship of the variables to make these relationships flexible in emanating from the study according to the qualitative research theory . The qualitative research question incepts necessarily with an active verb like understanding, exploring, interpreting, constructing, explaining, describing, etc ., to reflect the paradigm / philosophy underpinning the qualitative study . Consequently, specific nouns that represent the aims of qualitative studies, such as experiences, feelings, views, perspectives, knowledge, etc . Finally, the methodology or method should appear in the qualitative research question coherent with them . Meanwhile, the structure of a good qualitative research question will address five of the following six: who, when, where, what, how, and why, and the entire research question should devise the sixth element . For instance, exploring the experiences of self - immolated women regarding their motives for attempting suicide: a qualitative content analysis study in kermanshah iran make sure that your research question is consistent with the approach you are adopting . It is like an easy trap if you decide about the research question before considering the proper way by which you are intending to make assumptions and analyze your data . My experiences show that novice researchers formulate their research question without considering the approach of their study in a proper way and usually their research questions are very broad, unclear, and vague . Since the intention of their studies is not completely clear at the beginning, they cannot decide about the research approach; also, they have to change their research question and take different directions in the course of study or they will end up without adequate results that can help readers or consumers improve their understanding or solve the problem . Although a researcher initiates a study with a general question and topic, the interesting aspect of qualitative research is that the questions, which are more specific and can help in further data collection and analysis, arise during the course of the study . Thus, a qualitative research question can be broadly, rather than narrowly, focused in the beginning . Qualitative research is cyclic, which means that the research question in this approach immerses gradually into the topic . It means that when you come to know more and more about your topic, your ideas develop about what to focus, either through reading, thinking about what you have read, or in early stages of data analysis . Finally, it is literature review, general reading, and discussion with an expert supervisor that can help you find the right topic . If the background knowledge is poor at the beginning of the study, broad but clear research question can be reasonable . Research question may become more focused or develop in a different direction according to more reading and/or preliminary data analysis . A clear and focused research question is articulated and used to conduct further analysis and any future literature reviews necessary for the final write - up . However, it is very important to take time to choose a research question, because it can be a very challenging exercise . Actually, the ultimate success of the project depends on selecting a clear and convenient question . The question should be appropriate for the qualitative research and for the specific approach you choose which must be grounded in research . It must ask precisely what you want to find out and be articulated and clear . Knowing this will help you plan your project . Crucial decisions need to be made about an appropriate methodology, such as ethnography or grounded theory, after identifying the initial research question . The main concern of novice researchers is to find the reason and appropriate design to do the research, and proper methodology to answer the question . Researchers ought to figure out about the planning of qualitative research and how to choose the methodology . Researchers sometimes fail to understand that in the process of selecting an adequate research methodology, adopting a qualitative approach is only the first stage . Students, and sometimes researchers, choose qualitative research because they think it is easier to use than the other methodologies . But this reasoning is fumble since qualitative research is a complex methodology where data collection and analysis can be mostly challenging . Sometimes lack of planning and inadequate attention paid to the properness of the selected approach considering the purpose of research will be problematic . For new qualitative researchers, it often seems that the researcher should totally concentrate on the dual process of data collection and data analysis . It is very important to consider thorough planning in all stages of the research process, from developing the question to the final write - up of the findings for publication . The research design and methodology must be adequate to address the selected topics and the research question . Researchers have to identify, describe, and justify the methodology they chose, besides the strategies and procedures involved . So, it is pivotal to find the proper method for the research question . It should be noticed that some of the details of a qualitative research project cannot be ascertained in advance and may be specified as they arise during the research process . An important problem for novice researchers is the little acknowledgement of different approaches that address different kinds and levels of questions and take a different stance on the kind of phenomena which is focused upon . The need for consistency and coherence becomes more obvious when we consider the risk of something called method - slurring . Each approach has to demonstrate its consistency to its foundations and will reflect them in data collection, analysis, and knowledge claim . It may be important to acknowledge the distinctive features by specific approaches such as phenomenology or grounded theory at some levels such as the type of question they are suited to answer, data collection methods they are consistent with, and also the kinds of analysis and presentation of the results that fit within the approach such as goodness of fit or logical staged linking and can be referred to as consistency . If such consistency occurs, then the whole thing hangs together as coherent; that is, the kind of knowledge generated in the results or presentation section doing what is said it would do following the aims of the project . In order to consider these criteria of consistency and coherence in greater detail, we need to look at the distinctive differences between qualitative approaches in the following: the aims of the research approach, its roots in different disciplines and ideologies, the knowledge claims linked to it, and to a lesser extent, the data collection and analysis specific to each approach . My experience shows that novice researchers have some problems to justify their methodology of choice and sometimes they experience some degree of methodological slurring . They do not have any clear understanding of the research process in terms of data gathering strategies, data analysis method, and even appropriate sampling plan, which should be indentified based on philosophical and methodological principles . Finally, besides the above - mentioned problems, regarding research design, there are two common problems encountered especially by students who want to do qualitative study; sometimes researchers and research team try to identify everything, even the sample size, in advance when they design their study because they have a strong background of quantitative research, and this is completely in contrast with the flexible nature and explorative approach of qualitative research . The other problem is the examination committee and the format of proposal of grant sites and funding agencies, which are based on the principles of quantitative study . So, flexibility is regarded as the most important credibility criterion in all kinds of qualitative research and it should be considered when designing the study and following its process . Qualitative research does not promise a clear or direct and orderly method of tackling research problems in health studies . It does not provide researchers with a set of rules to be followed or give them a comforting sense of security and safety backup against possible mistakes on the road to knowledge . This research method depends on the power of words and images, but does not offer the assimilated meanings such as numbers and equations; it is rather an attentive search of meaning and understanding and an attempt for profound comprehension and awareness of the problems and phenomena . The essentially diagnostic and exploratory nature of qualitative research is invaluable in developing conceptualizations in health as an evolving discipline . It tenders the possible tap into the sea of complex interactions in health that can be as follows . Researchers launch the quest for new theories in health which should acknowledge that qualitative research is an approach rather than a particular set of techniques, and its appropriateness derives from the nature of the social phenomena to be explored . In qualitative research, knowledge derives from the context - specific perspective on the experienced phenomena, interpretations, and explanation of social experiences . The approach is helpful in understanding human experiences, which is important for health professionals who focus on caring, communication, and interaction . Many potential researchers intend to find the answer to the questions about a problem or a major issue in clinical practice or quantitative research cannot verify them . In fact, they choose qualitative research for some significant reasons: the emotions, perceptions, and actions of people who suffer from a medical condition can be understood by qualitative researchthe meanings of health professions will only be uncovered through observing the interactions of professionals with clients and interviewing about their experience . This is also applicable to the students destined for the healthcare fieldqualitative research is individualized; hence, researchers consider the participants as whole human beings, not as a bunch of physical compartmentsobservation and asking people are the only ways to understand the causes of particular behaviors . Therefore, this type of research can develop health or education policies; policies for altering health behavior can only be effective if the behavior's basis is clearly understood . The emotions, perceptions, and actions of people who suffer from a medical condition can be understood by qualitative research the meanings of health professions will only be uncovered through observing the interactions of professionals with clients and interviewing about their experience . This is also applicable to the students destined for the healthcare field qualitative research is individualized; hence, researchers consider the participants as whole human beings, not as a bunch of physical compartments observation and asking people are the only ways to understand the causes of particular behaviors . Therefore, this type of research can develop health or education policies; policies for altering health behavior can only be effective if the behavior's basis is clearly understood . Before adhering to a distinct research methodology, researchers have to exactly understand the nature and character of their inquiries and the knowledge they choose to create . However, all defects and challenges of qualitative research should be realized rather than discarded as a compelling way to knowledge structure . New endeavors in excellent academic achievement and building new tradition of qualitative research in health can be facilitated through acknowledging traps and clarifying the real practical challenges . Finally, qualitative research provides investigators with the tools to study the health phenomena from the perspective of those experiencing them . This approach is especially applied in situ ations that have not been previously studied, where major gaps exists in research field, and when there is a need for a new perspective to be identified for the arena of health care intervention . Based on corbin and strauss (2008), committed qualitative researchers lean toward qualitative work because they are drawn to the fluid, evolving, and dynamic nature of this approach in contrast to the more rigid and structured format of quantitative methods . It is the endless possibilities to learn more about people that qualitative researchers resonate to . It is not distance that qualitative researchers want between themselves and their participants, but the opportunity to connect with them at a human level (epistemology). Qualitative researchers have a natural curiosity that leads them to study worlds that interest them and that they otherwise might not have access to . Furthermore, qualitative researchers enjoy playing with words, making order out of seeming disorder, and thinking in terms of complex relationships . For them, doing qualitative research is a challenge that brings the whole self into the process . Researchers select approaches and methodology based on some scientific logics, not on being easy or interesting . The nature and type of the research question or problem; the researcher's epistemological stance, capabilities, knowledge, skills, and training; and the resources available for the research project are the criteria upon which adopting methodology and procedures depend . Inconsistency between research question and methodology, insufficient methodological knowledge, and lack of attention on philosophical underpinning of qualitative methodology can be mentioned as some important challenges here . There are several different ways of qualitative research and researchers will have to select between various approaches . The qualitative research is based on the theoretical and philosophical assumptions that researchers try to understand . Then, the research methodology and process should be chosen to be consistent with these basic assumptions and the research question as well . Some researchers believe that there is no need to study the methodology and methods before beginning the research . Many researchers neglect to gain this knowledge because they are not aware of the qualitative inquiry complexities which make them go wrong . For instance, lack of information about interview, qualitative data analysis, or sampling is very common . My experience shows that lack of knowledge, experience, and skills in a research team to do qualitative research can hinder the formation of original knowledge and improvement in understanding the phenomenon under study . The result of such a study will not be new and interesting, and even the study process will be very mechanical without good interpretation or enough exploration . Sometimes there is an inconsistency between research question, research methodology, and basic philosophical assumptions, and the researchers fail to justify their methods of choice in line with the research question and the ontological and epidemiological assumptions . Finally, the researcher's intentions, the aims of the research question / inquiry, and the chosen approach are regarded as the most important reasons to select a qualitative research method consistent with them and their underpinning philosophical assumptions as well . Qualitative research is exciting because it asks questions about people's everyday lives and experiences . A qualitative researcher will have the chance of discovering the significant truths in the lives of people . That is a wonderful privilege, but you need to get those questions right if you dig into people's lives and ask about their real experiences . An adequate and explicit research question, or a set of interrelated questions, builds the basis for a good research . But excellent research questions are not easy to write at all . A good research requires a good research question as well because it allows us to identify what we really want to know . However, at the beginning of a project, researchers may be uncertain about what exactly they intend to know, so vague questions can lead to an unfocused project . Common problems coming up with a research question include: deciding about the research area among a range of issues that are heeded in your field of interestnot capable of pointing toward any interesting area or topic sufficient to focus a major piece of work onknowing about the area you want to concentrate on (e.g. Emergency), but not a certain topicknowing what area and topic is specifically difficult to articulate a clear question . Deciding about the research area among a range of issues that are heeded in your field of interest not capable of pointing toward any interesting area or topic sufficient to focus a major piece of work on knowing about the area you want to concentrate on (e.g. Emergency), but not a certain topic knowing what area and topic is specifically difficult to articulate a clear question . Having identified a research area, your next step will be to identify a topic within that interesting area . Suggestions for future work at the end of a paper you have found interesting . Moreover, you can search for some verifiable gaps through literature review, or based on your personal or professional experience and expert opinion, which should be studied . Therefore, all the previous studies that have already been conducted in the area are considered as important . In this way, you do not run the risk of asking a research question that has already been addressed and/or answered . Based on my experience, novice researchers have some problems finding the right topics in their field of interest because they do not perform a broad literature review to find the gaps and problems suitable to be investigated . Sometimes their field of interest is different from that of their supervisors or there are no experts to help them in this regard . Although the topic may retain your interest and you may be committed to undertake such a study, it is important to recognize that some topics of personal relevance may also be deeply significant and difficult to research . Finally you need to make sure that your topic of interest is the one that you can actually study within the project constraints such as time and fund . Once you have identified your interesting topic for research (according to a broad literature review, personal and professional experience, and/or expert opinion), you can begin to create a research question . Forming the research question is one of the initial challenges that researchers encounter in the early stages of a research project . Therefore, it acquires significance by the very fact that it provides brief, but nevertheless, important information on the research topic that allows the reader to decide if the topic is relevant, researchable, and a remarkable issue . Furthermore, the research question in qualitative studies has an additional significance as it determines the manner of conducting the study . The qualitative research question delineates the procedures that are executed in the study and provides a map to the readers by which they can trail the researcher's intentions and actions in the study . Therefore, special attention is needed on how a qualitative research question will specifically be structured, organized, and formed in the way to quote the necessary information and elements that allow the readers to assess and evaluate the study . The formation of a qualitative research question acquires a basic conducting role for the study and a fundamental function to develop an audit trail that can empower the readers to judge the value, rigor, and validity of the whole research project . Hence, researchers should not only pay special attention toward developing a significant and relevant question, but also formulate it properly . The qualitative research question must be provided in such a way as to impart, reflect, and conjoin the theoretical and abstract assumptions with the practical and pragmatic means of attaining them . In plain words, a good qualitative research question implicates particular phrasing, whereas the order of words should make the topic of interest amenable to the qualitative quest . The researcher has to concentrate on how the content of the research topic is understood when phrasing the qualitative research questions, adhering to the topic with the philosophical / theoretical suggestions and to the structure of the study which requires compounding specific principal elements . Also, the content provides a brief focus on the issue to be investigated, but does not define the exact relationship of the variables to make these relationships flexible in emanating from the study according to the qualitative research theory . The qualitative research question incepts necessarily with an active verb like understanding, exploring, interpreting, constructing, explaining, describing, etc . Consequently, specific nouns that represent the aims of qualitative studies, such as experiences, feelings, views, perspectives, knowledge, etc . Finally, the methodology or method should appear in the qualitative research question coherent with them . Meanwhile, the structure of a good qualitative research question will address five of the following six: who, when, where, what, how, and why, and the entire research question should devise the sixth element . For instance, exploring the experiences of self - immolated women regarding their motives for attempting suicide: a qualitative content analysis study in kermanshah iran make sure that your research question is consistent with the approach you are adopting . It is like an easy trap if you decide about the research question before considering the proper way by which you are intending to make assumptions and analyze your data . My experiences show that novice researchers formulate their research question without considering the approach of their study in a proper way and usually their research questions are very broad, unclear, and vague . Since the intention of their studies is not completely clear at the beginning, they cannot decide about the research approach; also, they have to change their research question and take different directions in the course of study or they will end up without adequate results that can help readers or consumers improve their understanding or solve the problem . Although a researcher initiates a study with a general question and topic, the interesting aspect of qualitative research is that the questions, which are more specific and can help in further data collection and analysis, arise during the course of the study . Thus, a qualitative research question can be broadly, rather than narrowly, focused in the beginning . Qualitative research is cyclic, which means that the research question in this approach immerses gradually into the topic . It means that when you come to know more and more about your topic, your ideas develop about what to focus, either through reading, thinking about what you have read, or in early stages of data analysis . Finally, it is literature review, general reading, and discussion with an expert supervisor that can help you find the right topic . If the background knowledge is poor at the beginning of the study, broad but clear research question can be reasonable . Research question may become more focused or develop in a different direction according to more reading and/or preliminary data analysis . A clear and focused research question is articulated and used to conduct further analysis and any future literature reviews necessary for the final write - up . However, it is very important to take time to choose a research question, because it can be a very challenging exercise . Actually, the ultimate success of the project depends on selecting a clear and convenient question . The question should be appropriate for the qualitative research and for the specific approach you choose which must be grounded in research . It must ask precisely what you want to find out and be articulated and clear . Knowing this will help you plan your project . Having identified a research area, your next step will be to identify a topic within that interesting area . Suggestions for future work at the end of a paper you have found interesting . Moreover, you can search for some verifiable gaps through literature review, or based on your personal or professional experience and expert opinion, which should be studied . Therefore, all the previous studies that have already been conducted in the area are considered as important . In this way, you do not run the risk of asking a research question that has already been addressed and/or answered . Based on my experience, novice researchers have some problems finding the right topics in their field of interest because they do not perform a broad literature review to find the gaps and problems suitable to be investigated . Sometimes their field of interest is different from that of their supervisors or there are no experts to help them in this regard . Although the topic may retain your interest and you may be committed to undertake such a study, it is important to recognize that some topics of personal relevance may also be deeply significant and difficult to research . Finally you need to make sure that your topic of interest is the one that you can actually study within the project constraints such as time and fund . Once you have identified your interesting topic for research (according to a broad literature review, personal and professional experience, and/or expert opinion), you can begin to create a research question . Forming the research question is one of the initial challenges that researchers encounter in the early stages of a research project . Therefore, it acquires significance by the very fact that it provides brief, but nevertheless, important information on the research topic that allows the reader to decide if the topic is relevant, researchable, and a remarkable issue . Furthermore, the research question in qualitative studies has an additional significance as it determines the manner of conducting the study . The qualitative research question delineates the procedures that are executed in the study and provides a map to the readers by which they can trail the researcher's intentions and actions in the study . Therefore, special attention is needed on how a qualitative research question will specifically be structured, organized, and formed in the way to quote the necessary information and elements that allow the readers to assess and evaluate the study . The formation of a qualitative research question acquires a basic conducting role for the study and a fundamental function to develop an audit trail that can empower the readers to judge the value, rigor, and validity of the whole research project . Hence, researchers should not only pay special attention toward developing a significant and relevant question, but also formulate it properly . The qualitative research question must be provided in such a way as to impart, reflect, and conjoin the theoretical and abstract assumptions with the practical and pragmatic means of attaining them . In plain words, a good qualitative research question implicates particular phrasing, whereas the order of words should make the topic of interest amenable to the qualitative quest . The researcher has to concentrate on how the content of the research topic is understood when phrasing the qualitative research questions, adhering to the topic with the philosophical / theoretical suggestions and to the structure of the study which requires compounding specific principal elements . Also, the content provides a brief focus on the issue to be investigated, but does not define the exact relationship of the variables to make these relationships flexible in emanating from the study according to the qualitative research theory . The qualitative research question incepts necessarily with an active verb like understanding, exploring, interpreting, constructing, explaining, describing, etc ., to reflect the paradigm / philosophy underpinning the qualitative study . Consequently, specific nouns that represent the aims of qualitative studies, such as experiences, feelings, views, perspectives, knowledge, etc . Finally, the methodology or method should appear in the qualitative research question coherent with them . Meanwhile, the structure of a good qualitative research question will address five of the following six: who, when, where, what, how, and why, and the entire research question should devise the sixth element . For instance, exploring the experiences of self - immolated women regarding their motives for attempting suicide: a qualitative content analysis study in kermanshah iran make sure that your research question is consistent with the approach you are adopting . It is like an easy trap if you decide about the research question before considering the proper way by which you are intending to make assumptions and analyze your data . My experiences show that novice researchers formulate their research question without considering the approach of their study in a proper way and usually their research questions are very broad, unclear, and vague . Since the intention of their studies is not completely clear at the beginning, they cannot decide about the research approach; also, they have to change their research question and take different directions in the course of study or they will end up without adequate results that can help readers or consumers improve their understanding or solve the problem . Although a researcher initiates a study with a general question and topic, the interesting aspect of qualitative research is that the questions, which are more specific and can help in further data collection and analysis, arise during the course of the study . Thus, a qualitative research question can be broadly, rather than narrowly, focused in the beginning . Qualitative research is cyclic, which means that the research question in this approach immerses gradually into the topic . It means that when you come to know more and more about your topic, your ideas develop about what to focus, either through reading, thinking about what you have read, or in early stages of data analysis . Finally, it is literature review, general reading, and discussion with an expert supervisor that can help you find the right topic . If the background knowledge is poor at the beginning of the study, broad but clear research question can be reasonable . Research question may become more focused or develop in a different direction according to more reading and/or preliminary data analysis . A clear and focused research question is articulated and used to conduct further analysis and any future literature reviews necessary for the final write - up . However, it is very important to take time to choose a research question, because it can be a very challenging exercise . Actually, the ultimate success of the project depends on selecting a clear and convenient question . The question should be appropriate for the qualitative research and for the specific approach you choose which must be grounded in research . It must ask precisely what you want to find out and be articulated and clear . Knowing this will help you plan your project . Crucial decisions need to be made about an appropriate methodology, such as ethnography or grounded theory, after identifying the initial research question . The main concern of novice researchers is to find the reason and appropriate design to do the research, and proper methodology to answer the question . Researchers ought to figure out about the planning of qualitative research and how to choose the methodology . Researchers sometimes fail to understand that in the process of selecting an adequate research methodology, adopting a qualitative approach is only the first stage . Students, and sometimes researchers, choose qualitative research because they think it is easier to use than the other methodologies . But this reasoning is fumble since qualitative research is a complex methodology where data collection and analysis can be mostly challenging . Sometimes lack of planning and inadequate attention paid to the properness of the selected approach considering the purpose of research will be problematic . For new qualitative researchers, it often seems that the researcher should totally concentrate on the dual process of data collection and data analysis . It is very important to consider thorough planning in all stages of the research process, from developing the question to the final write - up of the findings for publication . The research design and methodology must be adequate to address the selected topics and the research question . Researchers have to identify, describe, and justify the methodology they chose, besides the strategies and procedures involved . It should be noticed that some of the details of a qualitative research project cannot be ascertained in advance and may be specified as they arise during the research process . An important problem for novice researchers is the little acknowledgement of different approaches that address different kinds and levels of questions and take a different stance on the kind of phenomena which is focused upon . The need for consistency and coherence becomes more obvious when we consider the risk of something called method - slurring . Each approach has to demonstrate its consistency to its foundations and will reflect them in data collection, analysis, and knowledge claim . It may be important to acknowledge the distinctive features by specific approaches such as phenomenology or grounded theory at some levels such as the type of question they are suited to answer, data collection methods they are consistent with, and also the kinds of analysis and presentation of the results that fit within the approach such as goodness of fit or logical staged linking and can be referred to as consistency . If such consistency occurs, then the whole thing hangs together as coherent; that is, the kind of knowledge generated in the results or presentation section doing what is said it would do following the aims of the project . In order to consider these criteria of consistency and coherence in greater detail, we need to look at the distinctive differences between qualitative approaches in the following: the aims of the research approach, its roots in different disciplines and ideologies, the knowledge claims linked to it, and to a lesser extent, the data collection and analysis specific to each approach . My experience shows that novice researchers have some problems to justify their methodology of choice and sometimes they experience some degree of methodological slurring . They do not have any clear understanding of the research process in terms of data gathering strategies, data analysis method, and even appropriate sampling plan, which should be indentified based on philosophical and methodological principles . Finally, besides the above - mentioned problems, regarding research design, there are two common problems encountered especially by students who want to do qualitative study; sometimes researchers and research team try to identify everything, even the sample size, in advance when they design their study because they have a strong background of quantitative research, and this is completely in contrast with the flexible nature and explorative approach of qualitative research . The other problem is the examination committee and the format of proposal of grant sites and funding agencies, which are based on the principles of quantitative study . So, flexibility is regarded as the most important credibility criterion in all kinds of qualitative research and it should be considered when designing the study and following its process . Qualitative research focuses on social world and provides investigators with the tools to study health phenomena from the perspective of those experiencing them . Identifying the research problem, forming the research question, and selecting an appropriate methodology and research design are some of the initial challenges that researchers encounter in the early stages of a qualitative research project . Once the research problem and the initial research question are identified, the crucial decision has to be made in selecting the appropriate methodology . Subsequent arrangements would be on the proper methods of data collection, and choosing the participants and the research setting according to the methodology and the research question . It is highly recommended that the researchers exactly understand the nature and character of their inquiries and the knowledge they choose to create before adhering to a distinct research methodology based on scientific knowledge . The essence and type of the research question or problem, the researcher's epistemological stance, capabilities, knowledge, skills and training, and the resources available for the research project are the criteria upon which the adopting methodology and procedures depend . Inconsistency between research question and methodology, insufficient methodological knowledge, and lack of attention to the philosophical underpinning of qualitative methodology are some important challenges . Lack of knowledge, experience, and skills to do qualitative research can hinder the formation of original knowledge and improvement in understanding the phenomenon under study . The result of such a study will not be new and interesting, and even the study process will be very mechanical without good interpretation or enough exploration . A good research requires a good research question as well because it allows us to identify what we really want to know . However, at the beginning of a project, researchers may be wavering about what they exactly intend to know; so, vague questions can lead to an unfocused project . Broad literature review, personal and professional experience, and/or expert opinion can be regarded as the main sources to identify interesting research topics and research questions as well . Forming the research question is one of the initial challenges that researchers encounter in the early stages of a research project . Therefore, it acquires significance by the very fact that it provides brief, but nevertheless, important information on the research topic that allows the reader to decide if the topic is relevant, researchable, and a remarkable issue that can help the researcher to determine the manner of conducting the study . Then crucial decisions need to be made about an appropriate methodology . The main concern of novice researchers is to find the reason and appropriate design to do the research and the proper methodology to answer the question . Researchers first ought to figure out the planning of qualitative research and how to choose the methodology . It is very important to consider thorough planning in all stages of the research process, from developing the question to final write - up of the findings for publication . It is worth knowing that some of the details of a qualitative research project cannot be ascertained in advance and may be specified as they arise during the research process . For a novice researcher, more discussions and debates method - slurring is another common problem, which means the act of blurring distinctions between qualitative approaches . Each approach has to demonstrate its consistency to its foundations and will reflect them in data collection, analysis, and knowledge claim . It is not rare to find that researchers and research team try to identify everything, even sample size, in advance when they design their qualitative study because of the strong background they have about the quantitative research . This is completely in contrast with the flexible nature and explorative approach of qualitative research; as these kinds of researches are completely explorative, the mentioned issues such as sample size should be clarified in the course of the study . The other problem is the examination committee and the format of proposal in the grant sites and funding agencies, which is based on the principles of quantitative study . Therefore, flexibility is actually the most important credibility criterion in all qualitative researches that should be considered when a study is designed and the study process is followed . As the final word, the researcher should make sure that he / she gives serious consideration to the chosen area as the basis of research and that a qualitative project is relevant and possible . Thus, forming the research question in a proper way and selecting appropriate methodology can guarantee original, interesting, and applied knowledge, which at least can increase our understanding about the meaning of certain conditions for professionals and patients and how their relationships are built in a particular social context.
|
Safety and efficacy of pharmaceuticals are two basic problems with importance in drug therapy . Instability of pharmaceuticals can cause a change in physical, chemical, pharmacological, and toxicological properties of the active pharmaceutical ingredients (api), thereby affecting its safety and efficacy . Hence, the pharmacists should take cognizance of various factors such as drug stability, possible degradation products, mechanisms and routes of degradation, and potential interactions with excipients utilized in the formulation to ensure the delivery of their therapeutic values to patients . In order to assess the stability of a drug product, one needs an appropriate analytical methodology, the so - called stability - indicating methods which allow accurate and precise quantitation of the drug and its degradation products and interaction products, if any . In recent times, the development of stability - indicating assays has increased dramatically using the approach of stress testing as enshrined in ich guideline and even this approach is being extended to drug combinations . This ich guideline requires that stress testing on api and drug products should be carried out to establish their inherent stability characteristics, which should include the effect of temperature, humidity, light, and oxidizing agents as well as susceptibility across a wide range of ph . However, there are no detailed regulatory guidelines that direct how stress testing is to be done and hence stress testing has evolved into an artful science that is highly dependent on the experience of the pharmaceutical industries or the individuals directing the studies . Emt, a synthetic nucleoside analog of cytidine, is phosphorylated by cellular enzymes to form emt 5-triphosphate . Emt 5-triphosphate inhibits the activity of the hiv-1 rt by competing with the natural substrate deoxycytidine 5-triphosphate and by being incorporated into nascent viral dna which results in chain termination . Tdf is an orally bioavailable ester prodrug of tenofovir (also known as pmpa), an acyclic nucleotide analog with activity in vitro against retroviruses, including hiv-1, hiv-2, and hepatitis b virus (hbv). Due to the presence of a phosphonate group, following absorption, tdf is rapidly converted to tenofovir which is metabolized intracellularly to the active metabolite, tdf diphosphate, a competitive inhibitor of hiv-1 rt that terminates the growing dna chain . Acyclic phosphono - methyl ether nucleosides like tdf exhibit distinct biological properties . Due to their efficient intracellular activation to their active metabolites, they possess potent antiviral activity in vivo . Rpv is a second generation nonnucleoside reverse transcriptase inhibitor (nnrti) for the treatment of hiv . It has higher potency, longer half - life, and reduced side - effect profile compared with older nnrtis such as efavirenz . It has demonstrated activity against nnrti resistant viral strains due to the flexibility of interactions with the hiv rt . Highly active antiretroviral therapy (haart) has brought new hope for those people who live with hiv / aids by decreasing the morbidity and mortality among people infected with hiv . Highly active antiretroviral therapy also has improved the quality of life among the people who live with hiv / aids . The fixed dose combinations of nucleoside rt inhibitors emt, tdf, and nnrti rpv (figure 1) are effective in the therapy of human immunodeficiency virus infection . It is used as a part of highly active antiretroviral therapy for the treatment of hiv . Three drug fixed dose combinations (fdcs) comprising emt, tdf, and rpv form one of the first line regimens in hiv - therapy [5, 6]. Literature indicates that spectrophotometry [711], hplc [1215], hptlc, and lc / ms / ms methods for determination of tdf individually and in combination with other drugs in pharmaceutical formulations have been reported for drug substance and biological matrices . Similarly, for emt individually and in combination with other drugs by uv, hplc in pharmaceutical formulations, drug substance, and biological matrices [1921], lc / ms / ms, and stability - indicating liquid chromatographic methods were reported . A detailed literature survey for rpv revealed that few analytical methods are available using spectrophotometry, hplc and hptlc were reported individually . However, an intensive literature search revealed to the best of our knowledge that only two methods are available for the determination of these analytes, emt, tdf, and rpv, in pharmaceutical mixtures [27, 28]. Hence, recently, we have developed an optimized reversed - phase hplc method for the routine quality control analysis of emt, tdf, and rpv simultaneously from tablets . The method gave acceptable results for fresh quality control samples but gave overestimation during analysis of stability samples and aged products, as it lacks assay specificity in the presence of their degradation products . Further, no stability - indicating method has been reported in literature for simultaneous determination of emt, tdf, and rpv in presence of their degradants . Therefore, the present study targets the development and subsequent validation of a stability - indicating assay of new rp - hplc method for the simultaneous determination of emt, tdf, and rpv in presence of interaction / degradation product . The pharmaceutical dosage form used in this study was complera procured from the local market and labelled to contain 200 mg of emtricitabine, 300 mg of tenofovir disoproxil fumarate, and 25 mg of rilpivirine per tablet . The solvent of acetonitrile (mecn) was of hplc grade and potassium dihydrogen phosphate, sodium hydroxide, hydrochloric acid, hydrogen peroxide, and triethylamine were of analytical reagent grade purchased from merck, india . The hplc grade water was prepared by using milli - q academic, millipore, bangalore, india . The lc system of shimadzu model with uv - visible detector (spd-10a) was used for this study and chromatographic separation was achieved on phenomenex c18 (150 mm 4.6 mm i.d ., chromatographic separations were carried out on a phenomenex c18 analytical column (150 mm 4.6 mm i.d ., 5 m) connected with a phenomenex c18 guard cartridge (4 mm 3 mm i.d . The mobile phase consisted of mecn potassium dihydrogen phosphate buffer (20 mm, ph 3.3)and triethylamine the injection volume of the sample was 20 l . The hplc system was used in an air - conditioned laboratory atmosphere . Working standard solutions were freshly obtained by diluting the stock standard solutions with mobile phase during the day of analysis . The standard solution prepared for the optimization procedure constituted emt, tdf, and rpv at 56.0, 84.0, and 7.0 g / ml, respectively . An amount of tablet powder equivalent to 20 mg of emt and 30 mg of tdf with 2.5 mg of rpv was accurately weighed and transferred into a 50 ml volumetric flask . This mixture was subjected to sonication for 10 min for complete extraction of drugs . From the above solution, 7 ml of solution was pipetted out into 50 ml volumetric flask; the solution was made up to the mark with a mobile phase to obtain concentrations of 56.0, 84.0, and 7.0 g / ml of emt, tdf, and rpv, respectively, for stability - indicating assay tablets . The marketed complera tablets containing 200 mg of emt, 300 mg of tdf, and 25 mg of rpv were subjected to various forced degradation conditions to effect partial degradation of the drug preferably in 230% range [29, 30]. The forced degradation studies were performed not only for the drug product, but also for api of emt, tdf, and rpv to determine whether any observed degradation occurred because of drug properties or drug - excipient interactions . Moreover, the studies provide information about the conditions in which the drug is unstable so that measures can be taken during formulation to avoid potential instabilities . The stability samples were prepared by dissolving each api or drug product in mobile phase and later diluted with either distilled water, aqueous hydrochloric acid, aqueous sodium hydroxide, or aqueous hydrogen peroxide solution at concentrations of 400 (emt), 600 (tdf), and 50 (rpv) g / ml separately . After the degradation treatments were completed, the stress content solutions were allowed to equilibrate to room temperature and dilute with mobile phase to achieve the nominal concentrations of 56 (emt), 84 (tdf), and 7 (rpv) g / ml, which was based on their label strength in tablets . Solutions for acid degradation studies were prepared in mobile phase and 0.3 n hydrochloric acid at room temperature for 24 hrs and mixture was neutralized and the resultant solutions were analyzed after 510 min of preparation . Solutions for base degradation studies were prepared in mobile phase and 0.1n sodium hydroxide at room temperature for 2 hrs and mixture was neutralized and the resultant solutions were analyzed after 510 min of preparation . Solutions for neutral degradation studies were prepared in mobile phase and water and the resultant solutions heated on a water bath at 90c for 20 min . The mixture was neutralized and then allowed to cool at room temperature, filtered using syringe filters, and analyzed after 510 min of preparation . Solutions for use in oxidation studies were prepared in mobile phase and 8% hydrogen peroxide at room temperature for 5 hrs and the resultant solutions were filtered using syringe filters and analyzed after 510 min . Solutions for photostability studies were prepared in mobile phase and the resultant solution was exposed to natural sunlight during the day time for 8 hrs for 3 days . Tablets and api in powder forms were exposed to dry heat (60c) in an oven for 24 hrs . The api and tablet powders were then removed from the oven and an aliquot of tablet powder equivalent to the weight of one tablet was prepared for analysis as previously described . Our earlier hplc method was optimized with respect to mobile phase composition, buffer concentration, and flow rate to achieve an optimal chromatographic condition for the separation and simultaneous quantification of emt, tdf, and rpv from complera tablet containing emt 200 mg, tdf 300 mg, and rpv 25 mg . This optimized method employs phenomenex gemini c18 column (150 mm 4.6 mm i.d ., 5 m) and mobile phase consisting of mecn potassium dihydrogen phosphate buffer (20 mm, ph 3.3)and triethylamine 58.72: 41.23: 0.05 (v / v) for the separation of emt, tdf, and rpv without affecting the stability of these analytes . However, this method does not give data on specificity for the estimation of the three analytes in the presence of their degradants . Therefore, as an attempt to develop stability - indicating assay, the same optimal chromatographic condition has been tried to separate these analytes from the degradation products generated during forced degradation studies . Using this customized optimized method, it was possible to separate emt, tdf, and rpv and their degradation products without any interference and thus the assay can be considered stability - indicating . Preliminary trials on individual drugs and those in tablet dosage form were conducted to optimize various stress conditions . Samples were withdrawn at 35 hr intervals to monitor the rate of degradation and optimize the stress conditions . Degradation conditions were attenuated such that all three drugs would get degraded in the range of 230% for establishing the stability - indicating nature of the assay method . Forced degradation studies of apis of three analytes and formulations (complera tablet) the extents of degradation of the three analytes in complera tablet are shown in figure 2 . The degradation product formed from each drug has been identified by comparing the respective chromatograms of each api with formulations obtained after forced degradation studies . Each of the degradation or interaction products was given the name with respect to its original source like r1: the degradation product of rpv . Labeling of all degradation products was done by a degrading individual drug with a similar condition as used for the combination tablets . All three apis and tablet showed no degradation in 0.1 n hcl at room temperature for 24 hours; therefore, drastic condition was experimented with the use of higher concentration of hcl and reflux . Emt and tdf were easily susceptible to degradation in comparison to rpv in drastic condition and tdf and emt undergo 18% and 16% decomposition under acidic stress condition for both pure and tablet dosage form . Similarly, rpv undergoes 3% decomposition under the same condition for both pure and tablet dosage form . All drugs showed sufficient degradation when subjected to milder stress conditions of 0.1 n naoh at room temperature for 2 hours . Tdf undergoes 31% decomposition under basic stress condition whereas emt and rpv undergo 17% and 7% degradation for both pure and tablet dosage form . Rpv was quite stable under neutral degradation due to its nonpolar nature whereas tdf and emt undergo 11% and 7% degradation, respectively, for both apis and tablet dosage forms . In oxidation stress condition, lower concentration of oxidizing agent was insufficient to give sufficient degradation for rpv even after prolonged exposure . Hence, samples were stressed at harsher conditions of 8% h2o2 at room temperature for 5 hrs . Emt, tdf, and rpv in apis and tablets were moderately stable showing 12%, 13%, and 7% degradation, respectively . In photolytic degradation, apis and tablets were exposed to direct sunlight at 8 hours for 3 days . Emt, tdf, and rpv in apis and tablets were highly stable and they undergo degradations of 2%, 6%, and 1%, respectively . Similarly, in thermal degradation subjected to dry heat (60c) in an oven for 24 hours, emt, tdf, and rpv in apis and tablets were highly stable and they undergo degradations of 2%, 5%, and 1%, respectively . The degradation products of emt, tdf, and rpv were found to be similar for all the formulations (complera tablet) and api powders assessed . The stability of stock solutions (stored at 28c and at ambient temperature for 3 days) was determined by quantitation of each drug in solution in comparison to the response obtained for freshly prepared standard solutions . No significant changes (<2%) were observed for the chromatographic responses for the stock solutions analyzed, relative to freshly prepared standards . The degradation study was not intended to identify the degradation products but merely to show that they would not interfere if and when they present . To conclude, the results of stress testing studies indicate a high degree of specificity of this method for emt, tdf, and rpv . The optimized hplc method for the analysis of fresh quality control samples was validated in accordance with the ich q2 (r1) guidelines and reported . The sensitivity of the hplc method that uses uv detection depends upon the proper selection of the wavelength . The standard solutions were scanned from 200 to 400 nm and the overlain uv spectra obtained were recorded (figure 3). From the overlain uv spectra, the detection wavelengths were selected for the methods to estimate simultaneously two or more drugs; the drugs in multicomponent dosage forms used in the present study gave good peak response at the wavelength selected . The results of forced degradation studies of each drug in the presence of their degradation products indicated a high degree of specificity of this method for emt, tdf, and rpv . The degradation product of each of the parent peaks was found to be similar for the complera tablet compared to that of api powders assessed . Typical chromatograms obtained following the assay of untreated and stressed samples of api and formulations are shown in figure 2 . Accuracy of the method was determined by performing the recovery experiment at 50, 100, and 150% levels of the labeled number of the analytes in the commercial formulation . The recoveries for emt, tdf, and rpv were found to be 99.50, 99.90, and 99%, respectively, which were within acceptable ranges of 100 2% . The% rsd values for the intraday and interday precision were 2% confirming that the method was sufficiently precise . The linearity was established over the ranges of 2884, 42126, and 3.510.5 for emt, tdf, and rpv, respectively . Correlation coefficients (r) were found to be more than 0.999 for all the analytes . Typically, the means of the regression equations were y = 87545x + 15731, y = 41493x + 18505, and y = 23045x + 65860 for emt, tdf, and rpv . The lod and loq were estimated as 1.90 and 0.43 ng / ml for emt, 2.18 and 0.54 ng / ml for tdf, and 3.12 and 1.78 ng / ml for rpv . Robustness of the method was checked by small deliberate changes made in the method parameters such as wavelength (2 nm), mobile phase ratio (2%), flow rate (0.1 ml), and ph (0.05), but these changes did not affect the method results . The% rsd for the tablets were <2, indicating the robustness of the analytical methodology . A study was conducted to determine the effect of variation in analyst to analyst, lab to lab, and instrument to instrument in triplicate measurement as per the assay method .% rsd was calculated for each condition and results are presented in table 4 . Table 5 shows the results obtained in the solution stability study at different time intervals for test preparation . It was concluded that the test preparation solution was found stable up to 72 h at 28c and was at ambient temperature as during this time the result was not decreased below the minimum percentage . The optimized and validated formulation assay method was applied to the quantitative analysis of commercial tablet (complera) and was evaluated by the proposed hplc method . Good agreement was found between the assay results and the label claim of the product . The% rsd for the tablets were <2, indicating the precision of the analytical methodology . An isocratic stability - indicating hplc - uv method has been developed for the estimation of emt, tdf, and rpv in the presence of degradation products . The proposed method is simple, accurate, precise, and specific and has the ability to separate the drugs from degradation products and excipients found in the pharmaceutical dosage forms . The method is suitable for use in routine analysis of both drugs in bulk api powder or in pharmaceutical dosage forms . The method can be applied even to the analysis of stability samples obtained during accelerated stability experiments, as no interference was found with the degradants formed under various stress conditions.
|
Traumatic lumbar spondylolisthesis is rare disease and in the literature, different surgical approaches, including anterior, posterior, or combined approaches (posterior and anterior) are used to treat the lesion . We treated a case of traumatic lumbosacral spondylolisthesis using posterior approach and the patient showed a satisfactory outcome . At the final follow - up, he was completely asymptomatic, and radiographic images revealed normal lumbar alignment and a solid interbody fusion . Traumatic lumbosacral spondylolisthesis can be treated using posterior approach alone to obtain reduction, decompression, and solid fusion . Traumatic lumbosacral spondylolisthesis is a rare injury (1 - 3); most of the cases were published as case reports in the literature . The injury results from a complex and high - energy mechanism (4) or forces, including hyperextension stress; hyperflexion and compression stress; or tangential force (5). Most surgeons believe that the injury should be treated surgically, and in this regard different surgical approaches are used in spine departments . We report a case of traumatic lumbar spondylolisthesis, which was treated using posterior approach to realize the stable 3-column fixation and solid interbody fusion . A 38-year - old man was referred to the affiliated hospital of jinan university, guangzhou, china due to injury in a motorcycle accident on july 25, 2011 . He was conscious with stable vital signs, but complained of pain in his back and right thigh, numbness and weakness in both lower extremities . Upon physical examination, grade 4 power was found in both lower limbs, and the perianal sensation and anal tone were normal too . X - radiographs showed a grade 2 spondylolisthesis of l5 on s1 (figure 1), fracture of the left transverse process of l4 as well as the fracture of right femur . Mri demonstrated traumatic lumbar spondylolisthesis of l5 on s1, avulsion of the l5 intervertebral disc and compression of the cauda equina (figure 1). First, open reduction and internal fixation were performed for the fracture of right femur, and then a posterior approach surgery was performed for the traumatic lumbosacral spondylolisthesis using a standard posterior midline incision . During operation, bilateral fracture of the pars interarticularis, disruption of interspinal ligament and flaval ligaments of l5-s1, and disruption of l5 annulus fibrosus were found . Decompression and reduction were done followed by internal fixation using pedicle screws and rods from l4 to s1 . Posterolateral fusion was performed at l4 - 5 level; l5 disk was excised and 2 peek cages were inserted posteriorly with autologous bone grafts . The procedure lasted 145 minutes with intraoperative blood loss of 400 ml, without intraoperative complications . Four weeks later, his strength and cutaneous sensation in both lower extremities recovered completely . One and a half year after surgery, at the final follow - up, the patient was completely asymptomatic and radiographs revealed normal lumbar alignment and a solid interbody fusion (figure 2). In addition, the fracture of right femur obtained bony union and he could stand and walk without any support, and resumed his previous level of physical activities . In the english literature, some cases of traumatic spondylolisthesis were reported, which were treated successfully using conservative methods (7, 8), but the non - surgical treatment may result in posttraumatic translational instability or chronic low back pain (1, 3). Moreover, the rare lesion belonged to a 3-column injury (9) and need a solid internal fixation . As a result, surgical treatment was a better choice for the injury (1 - 3, 9). In the literature, this kind of injury was treated using different surgical approaches, including anterior (10), posterior (1, 2, 9), or combined approach (anterior and posterior) (11, 12), but there is not a decisive criterion to determine which surgical approach to select . In this case, the lesion included a traumatic disruption of the intervertebral disk material, dislocation of l5 vertebral body and bilateral fracture of the pars interarticularis . Therefore, excision of intervertebral disc and reduction of l5 vertebral body as well as interbody fusion were needed (1). In addition, decompression and internal fixation to avoid further injury to the nerve system, stabilize the spine, and promote the recovery of the nerve system was necessary . Compared with anterior or combined approach, the posterior approach is safe, easy, and with minimum complication . Moreover, the pedicle - rod system can result in perfect reduction of vertebral body and 3-column fixation . Consequently, decompression, fixation, and interbody fusion can be achieved using posterior approach alone . At the same time, the higher risk of blood loss, longer hospital stay and the high cost which is associated with anterior or combined approach can be avoided or decreased . In the present case, this kind of case is rare, and it is difficult to compare different surgical approaches using a large scale, or a clinical controlled trial, but we believe the posterior approach alone may be an optimal selection for this rare injury.
|
Primary pulmonary histoplasmosis is a lung disease caused by the dimorphic fungus histoplasma capsulatum, with a worldwide incidence . It is endemic in certain areas of north america, and was first reported in china in 1958 (1). The severity of this mycosis is dependent upon the number of inhaled fungal particles and the immune status of the host (2). The morbidity and mortality rates of pulmonary histoplasmosis are low among immunocompetent patients . However, the morbidity and mortality rates of this mycosis are greater among immunocompromised individuals . In china, pulmonary histoplasmosis is sporadic . By 2015, only 76 cases with complete clinical data had been reported in the literature (320). Clinical presentations may include protean symptoms of fevers, chills, malaise, weight loss, cough and wheezing, symptoms . The majority of affected individuals present clinically silent manifestations and display no apparent symptoms (3). Therefore, misdiagnosis of pulmonary histoplasmosis as other pulmonary diseases, including tuberculosis, is highly likely . Misdiagnosis may delay the treatment, and the disease is fatal if left untreated (4). Therefore, the present study reports the case of a patient diagnosed with pulmonary histoplasmosis . The study aimed to increase the understanding on the disease characteristics in order to facilitate the diagnosis and treatment of pulmonary histoplasmosis . A 54-year - old male patient was admitted to the xiangya hospital (changsha, china) in june 2011 with a persistent cough that had appeared 1 week earlier due to contracting a cold . No signs of fever, sweating, chest pain, sputum, hemoptysis or other discomfort were noted . Pulmonary computed tomography (ct) scans conducted 2 days prior to admission detected a lump with enhanced intensity in the upper right lung and a large mass of high intensity in the right middle lobe with a pattern of air bronchogram observed in the mass (fig . Physical examination indicated the following: body temperature, 36.5c; heart rate, 76 beats / min; blood pressure, 140/80 mmhg . In addition, no superficial lymphadenopathy was noted, while bilateral symmetry was observed in thoracic cage . Laboratory examination was also performed and revealed the following results: white blood cell count, 9.410/l (normal range, 41010/l); red blood cell count, 4.510/l (normal range, 3.55.510/l); hemoglobin level, 134 g / l); blood platelet count, 23710/l (normal range, 10030010/l); an elevated erythrocyte sedimentation rate, 70 mm / l (normal range, <20 mm / l); and negativity for tuberculosis antibody . In addition, the result of a g - test (for the detection of (1,3)--d - glucan, a fungal cell wall components) was abnormal at 57.0 pg / ml (normal range, <20 pg / ml). Bronchoscopy conducted 5 days after admission detected signs of inflammation of the bronchi, particularly the presence of severe inflammation in the right middle lobe . Pathological examination under bronchoscopy revealed chronic mucosal inflammation in the branches of the right middle lobe . In combination with clinical data, the patient was preliminarily diagnosed with bacterial pneumonia . This diagnosis was made on the basis that lung infection is most commonly bacterial, whereas fungal infections often occur in immunodeficient patients and the present patient was an immunocompetent individual . Furthermore, g - tests may produce false positive results .. the patient was treated with levofloxacin (0.6 g once daily, intravenously; daiichi sankyo, tokyo, japan) for 2 weeks, starting from day 1 after admission; however, the symptoms were not alleviated . Lung ct scans 12 days after admission revealed that the infectious lesions increased in number and in size, as shown in fig . Subsequent pathological examination revealed signs of granulomatous inflammation in the right middle lung, as shown in fig . 3 . Based on the findings of ct scans and hematoxylin - eosin staining, the patient was suspected with histoplasmosis . Subsequently, the patient was diagnosed with pulmonary histoplasmosis, which was confirmed by the aforementioned imaging and pathological findings . Following diagnosis, the patient was treated with itraconazole (janssen pharmaceuticals, inc ., titusville, nj, usa) for 2 weeks, starting from 15 days after admission . The dosage was 200 mg, by intravenous infusion, twice daily for the first 2 days and 200 mg once daily thereafter . Subsequent lung ct scans conducted 4 weeks after admission revealed that the pulmonary infection was alleviated (fig . 4), and the symptom of cough disappeared; thus, the patient was discharged from hospital . Subsequent to discharge, the treatment was altered to oral administration of itraconazole only (200 mg, twice daily, orally). A further three rounds of lung ct scans performed in september 2011, november 2011 and february 2012 demonstrated that the pulmonary lesions were gradually adsorbed, as illustrated in fig . 5a - c, respectively . A second ct examination scan in february 2012, 10 days after the previous one, revealed that all the lesions in the lung had almost disappeared (fig . Primary pulmonary histoplasmosfis is a primary lung disease caused by infection with fungus histoplasma capsulatum . Histoplasma capsulatum is a thermally dimorphic fungus, found in soil, caves and abandoned constructions that are enriched in bat or bird excrement . .infection with histoplasma capsulatum occurs by the inhalation of microconidia or mycelial fragments, which then settle in the host's lungs and convert to yeast forms . If the patient has strong cellular immunity, then macrophages, epithelial cells and lymphocytes can eliminate the fungi . However, in immunocompromised individuals, histoplasma capsulatum disseminates to a variety of organs, including the bones, spleen, liver, adrenal glands and mucocutaneous membranes, resulting in progressive disseminated histoplasmosis (21). In the present study, pulmonary histoplasmosis was selected as the keyword to search the literature for relevant studies published between 1990 and 2015 . The cnki, vip and wanfang databases were searched for relevant studies . In addition, the pubmed database was searched with pulmonary histoplasmosis and china as search terms . Exclusion criteria were as follows: i) cases who were repeatedly reported; ii) cases with pulmonary histoplasmosis evolving into disseminated histoplasmosis; and iii) cases with incomplete clinical data . In total, 18 eligible studies reporting 76 cases were identified and included for systematic review (320). Complete clinical data, including age, gender, risk factors, primary disease, clinical manifestation, misdiagnosis, confirmed diagnosis, treatment and prognosis were pooled and evaluated . Exclusion criteria were as follows: i) cases who were repeatedly reported; ii) cases with pulmonary histoplasmosis evolving into disseminated histoplasmosis; and iii) cases with incomplete clinical data . Subsequent to case screening, a total of 76 patients, including 40 male and 36 female aged 2769 years, were eventually recruited for subsequent analysis . Among these patients, 52 cases were found to present increased risk factors or primary diseases, 5 cases were treated with glucocorticoid therapy or chemotherapy, and 1 case was orally treated with immunosuppressive agents for an immunodeficiency disease . In total, 46 patients were complicated with alternative diseases or high risk factors, including diabetes mellitus, viral hepatitis, tuberculosis, history of surgery and contact with poultry . However, the case reported in the present study had seldom contacted with duck, swine, cattle and other poultry, and had no history of any systemic disorders or use of immunosuppressive drugs prior to onset . The environment in which the present patient worked was not likely to have caused infection with histoplasma capsulatum spore, suggesting that not all cases of pulmonary histoplasmosis have contact with the fungal spore or exposure to high risk factors . Previous studies demonstrated that the symptoms of pulmonary histoplasmosis greatly vary, and ~95% of patients diagnosed with pulmonary histoplasmosis present with atypical clinical manifestations (315). Common symptoms observed in the eligible studies mainly included fever in 11 cases, chest pain in 6 cases and other respiratory symptoms in 13 cases . However, in the current report, the patient solely presented with cough without apparent pulmonary infection . The imaging manifestations of patients with pulmonary histoplasmosis are significantly diverse . Among the 77 cases, which included the 76 previous cases (320) and the patient in the present study, nodular or lump lesions were noted in 50 patients (64.9%), pneumonia - like exudative lesions were noted in 19 patients (24.7%) and different shapes of lung lesions were detected in 8 patients (10.4%) (22). Based on the findings of the present literature review, the following lung ct manifestations can be summarized for cases of pulmonary histoplasmosis: i) cases with a short medical history of the disease are predominantly manifested as multiple sporadic exudative lesions of varying sizes and indistinct boundary . By contrast, cases with a long history of pulmonary histoplasmosis present with nodular lesions with an explicit boundary or histoplasma capsulatum - infected tumors, or both; ii) sporadic or multiple lesions are frequently noted in the middle upper lobe of bilateral lungs; iii) pneumonia - like lesions, nodular lesions or both are observed; iv) exudates surround the pathological changes; v) the intensity enhancement is not evident; vi) pleural thickening is noted rather than pleural traction; and vii) the disease has a slow course . In the current study case report, the patient was found to have lump lesions in the right middle lung and exudates surrounding the lesions with insignificant enhancement . Lung tissue biopsy and fungal culture have been widely recognized as the gold standards for diagnosing pulmonary histoplasmosis (23,24). Among the 77 cases enrolled in the present study, 74 cases were diagnosed by lung tissue biopsy, while the remaining 3 cases were diagnosed by fungal culture . However, the fungal culture endured for at least 3 weeks and the positive rate was not adequately high; therefore, it has limited application in clinical practice (320). Similarly, the patient in the present case study was misdiagnosed with infectious pneumonia and showed no improvement following anti - infectious medication therapy . Subsequently, ct - guided percutaneous lung aspiration biopsy was conducted, which confirmed the diagnosis of pulmonary histoplasmosis . Consequently, bronchoscopy or ct - guided percutaneous lung aspiration biopsy is recommended to obtain histopathologic evidence and enhance the diagnostic accuracy when the diagnosis is ambiguous and undetermined . According to the practice guidelines for histoplasmosis updated by the infectious diseases society of america (25) following literature analysis, 45 patients with histoplasmosis were surgically treated, 20 were treated with antifungal medication, 4 received itraconazole, 3 received triazole and 1 received with amphotericin b. in the present study, the patient fully recovered following the use of levofloxacin combined with itraconazole for 2 weeks during hospitalization and oral liquid of itraconazole for 10 months after discharge . Among the 77 cases, 38 patients were subject to follow - up for as long as> 20 years . The majority of these patients were successfully treated or improved, whereas a minority of cases progressed into disseminated histoplasmosis or succumbed to the disease . In the current study, the patient was followed - up for> 10 months and fully recovered following effective antifungal medication therapy . In conclusion, the present study reported a case of pulmonary histoplasmosis that was initially misdiagnosed as bacterial pneumonia, and later successfully treated with antifungal therapy . For suspicious cases based on medical history and imaging manifestations, bronchoscopy or ct - guided lung needle aspiration biopsy should be actively performed to facilitate the differential diagnosis of pulmonary infection . After the diagnosis is confirmed, effective and proper antifungal treatment should be timely delivered upon the individual situations, aiming to enhance the clinical efficacy.
|
The aim of the danish gynecological cancer database (dgcd) is to achieve the greatest possible knowledge regarding examination, treatment methods, and results within the field of gynecological cancer in denmark . Dgcd is by definition nationwide: a clinical quality registry where a minimum of 90% of the relevant patient population in denmark is registered.2 the database was initiated on january 1, 2005 . The database before june 1, 2013, is referred to as the old dgcd and the database after this date as the new dgcd . Data from the old dgcd are mapped into the new dgcd in order to assure continuity . Since july 2015, 19,729 patients had been registered in dgcd, on average 1,879 patients per year since january 1, 2005 . Table 1 shows an overview of the patients currently enrolled in dgcd and the diagnoses that dgcd covers.3,4 as seen in table 2, dgcd has had a high coverage rate throughout the years . The coverage estimates are based on the registrations in the danish national patient registry (npr). Data are registered online in special data forms programmed in the tietoenator s quality measurement system.5 data are placed on a central server hosted by the registry support center (east) the data of dgcd are primarily recorded in four main online forms: clinical data, surgery, pathology, and final quality check . In the old dgcd, some of the variables were optional, thus resulting in varying registration of the optional variables . In the new dgcd,, it was possible to add and fill in data forms in a way in which the sequence of patient events were incorrectly registered . In order to get valid data, constant data review and time consuming correction by doctors and secretaries all data forms are designed to logically and consecutively provide variables specific for each type of gynecological cancer and surgery . Staging reports are available both in the figo and tumor nodes metastasis system . In case of ovarian cancer, the final staging is based on both surgical and pathological staging . In uterine cancers, when the diagnosis is based only on a biopsy, the gynecological clinician can choose to stage the disease based on imaging and clinical findings . Staging and treatment of cervical, vulva, and ovarian cancer is centralized in denmark and only allowed in centers with specialized gynecological oncologists . The fourth data form is the final quality check, which is recorded by the gynecologists . Data from all data forms described earlier are consolidated and from this the final staging and diagnosis is performed . In the new dgcd, data forms for registering pre- and postoperative nurses care and data forms for vulva / vaginal cancer and trophoblastic disease were added in 2013 . The old dgcd also included a data form for registration of data regarding the oncological treatment . Due to poor cover rate, this data form was omitted in the new dgcd . Oncologic data in the new dgcd are imported from the npr which only includes date and type of oncologic treatment . In addition, data such as diagnosis, duration of hospitalization, and perioperative complications are drawn from the npr . In this way, pathological data regarding histology and relapse biopsies are drawn from the danish pathology register, data regarding cause of death from the cause of death register, and overall survival from the civil registration system, which is updated day - to - day . Data regarding follow - up are registered in dgcd with a form describing each follow - up visit, including registration of relapse and residual disease . The unique nationwide civil registration system and cause of death register ensure virtually complete follow - up of all patients recorded in the dgcd . Until recently, danish gynecologic cancer patients had follow - up visits at the hospital for 5 years or to recurrence and/or death . According to new guidelines from the national institute of health, follow - up visits after the first year this spans from scholarship fellows and bachelor theses to phd theses, doctoral theses, and post - doc publications . In 2014 alone, dgcd data were used in nine ongoing phd projects and three ongoing post - docs.6 several dgcd studies have been published for assurance of quality . Fag - olsen et al demonstrated in 2011 that centralization of treatment for ovarian cancer improves survival . It was shown that patients with stage iiic and iv ovarian cancer benefit from treatment in a tertiary referral center.7 another quality study based solely on dgcd data by hkansson et al in 2012 validated the use of the risk of malignancy index (rmi) as a tool for ovarian cancer risk assessment and referral to a tertiary center . They found that rmi 200 was a reliable tool for identifying patients with ovarian cancer.8 in 2014, svolgaard et al published an article for assurance of quality based on dgcd data . The aim was to evaluate the danish nationwide progress in implementing lymphadenectomy for women presenting with tumor(s) macroscopically confined to the ovary, and the effect of lymphadenectomy on the overall survival . The study concluded that the national number of lymphadenectomies was too low, although increasing, and that the effect of lymphadenectomies on overall survival was not significant.9 the results of the study formed the basis for a very intense debate about systematic lymphadenectomy and revision of guidelines . Dgcd publishes annual reports, which are widely used as a source of quality results of danish gynecologic cancer treatment.3 a dgcd validation study from 2014 concluded: the data on endometrial cancer registered in the dgcd regarding surgery and pathology is valid and complete, and they provide a solid base for research.10 the completeness of data on pathology and surgery reported to the dgcd was 97.3% and the agreement for the reported data in the dgcd was 88.3%.10 a dgcd validation study on postoperative complications in ovarian cancer, tubal cancer, and ovarian borderline tumor patients showed that the completeness of reporting to the dgcd was 94.2% and the strength of agreement between the variables in the dgcd and the medical file varied from moderate to very good.11 a new large validation study on ovarian cancer based on a combination of npr and dgcd variables is currently under progress (personal communication by srensen et al, march 6, 2016). Dgcd has also been used in studies showing how comorbidity independently affects overall survival in women with uterine or ovarian cancer.12 dgcd is furthermore extensively used in translational and clinical national and international studies as data are easily combined with data from the danish cancer biobank.1316 in one of the first dgcd - based translational studies from 2010 performed by petri et al, data from dgcd combined with material from the danish cancer biobank were used in comparison of proteomic biomarker panels in urine and serum for ovarian cancer diagnosis . The authors concluded that urine and serum proteomic panels can be used individually or in combination in ovarian cancer diagnostics.17 the danish multidisciplinary cancer group (dmcg) produced a report on cancer survival in denmark in the period 19952012.18 this report included calculations of ovarian cancer survival based on dgcd data . The report showed that the 5-year survival for ovarian cancer was 37% in the period 20052009, that the mortality rates of ovarian cancer patients in denmark have been decreasing since 1995, and the survival trends have been gradually increasing since 2000 . This report provided important information on trends in the management and prognosis of ovarian cancer . The monitoring and improvement of the treatment quality of gynecological cancer is the key objective that ensures the funding of dgcd, which is anchored to the national expert group, the danish gynecological cancer group, consisting of clinicians and researchers responsible for developing and maintaining national clinical guidelines for the treatment of gynecological cancer . Dgcd is under the auspices of the dmcg; an umbrella organization comprised of 24 national, disease - specific cancer groups and clinical databases . The running and maintenance of dgcd is managed by the dgcd steering committee, which consists of a chairperson and 14 members appointed by the danish gynecological cancer group board and the registry support centre (east) to ensure maximal coverage rate, shortage lists are created specifically for each hospital and continually updated . The steering committee develops the annual dgcd report and clinical quality indicators in cooperation with registry support centre (east) epidemiology and biostatistics . The present 13 quality indicators, which are used to monitor the quality of the management of gynecological cancer between different regions of denmark and across hospitals, are presented in table 4 . The dgcd is a large compulsory nationwide clinical database with a high coverage of all gynecological cancers . The selected data from all the registers are, together with dgcd data, available in a structured form in the statistical analysis software portal and as raw data . This very complete collection of available data from several registers forms one of the unique strengths of dgcd, compared to many other clinical databases . . Other unique strengths of the dgcd are the high coverage, almost 100% follow - up, and that dgcd represents data from all danish patients with a gynecologic malignancy with minimal risk of selection bias in research and presentations . One of the major problems in dgcd registration is the lack of specific oncology data such as more detailed oncologic treatment, oncologic complications, and response and relapse data
|
Nonalcoholic fatty liver disease (nafld) is the most prevalent cause of chronic liver diseases . This disorder occurs because of the pathologic accumulation of fat (mainly triglycerides) in the liver . It is estimated that in iran, 7% of children and 35% of adults are affected . Until now results of these studies have sometimes caused the researchers to suggest different nutritional reasons for this disease such that some of studies suggest that high - calorie food patterns, which lead to obesity, can also increase the risk of accumulation of lipids in liver and incidence of steatosis . On the other hand, high carbohydrate level diets can affect nafld by influencing on de novo synthesis of fatty acids and increasing blood triglycerides . Results of some other studies indicates a relation between type of lipid intake and developing this disease . Such that it seems increase in receiving omega 6 to omega 3 ratio is in relation to advanced stages of the disease by activating inflammatory pathways . Moreover, it seems that saturated fatty acids can damage the structure of hepatocytes by inducing apoptosis and thus advancing nafld . In some studies, such that it seems patients with nafld have a lower level intake of vitamin d and antioxidant vitamins (e and c) than healthy individuals . Moreover, results from some of these studies indicated that calcium and zinc intake in patients with nafld was less than healthy individuals . Despite these results, the relation between dietary intake and nafld, in some other studies, no relation has been observed . These inconsistent results might be because of difference in studies design and aims, participant groups, and small sample size in some studies . Because of some limitations in previous studies and also according to the fact that nutrition has an essential role in etiology of nafld, further investigation of relationship between diets components and this disease can help us to prevent and control it . The present study is a case - control study that was approved by the tehran university committee and ethics advisory committee, and written consent was obtained from all participants . Patients with nafld who admitted isfahan fatty liver research center were chosen as the case group . In this study, according to sample size, estimation of 140 people for case and control group: and on the basis of expectancy for over- and under - reporting of dietary intakes while completing the 24-h dietary recall, 170 people were selected for each group . After calculating participant's energy intake, who receiving under 800 kcal and over 4200 kcal of energy each day inclusion criteria for case group included the following: individuals between 20 and 60 years old who were diagnosed with nafld after giving blood tests and performing ultrasonography, by a radiology specialist (the device used for ultrasonography was esaot medica, which is equipped with a convex 3.5 mhz probe). Inclusion criteria for control group included the following: volunteers who were the neighbors of case group and were same as them in age and sex . Blood tests and ultrasonography were performed on them and their wellbeing in case of nafld was approved (not suffering from any stages of hepatic steatosis). Exclusion criteria included the following: alcohol consumption, following special diets 2 months before the study, regular use (at least continues for 1 week) of any nutritional supplements in the last 6 months, pregnant or breastfeeding women, individuals with type b or c hepatitis and diagnosed wilson's disease, use of drugs effective on liver, and biochemical biomarkers . Data about age and sex were recorded by researcher by means of general information questionnaire . Physical activity rate was estimated by short form of international physical activity questionnaire . Based on instructions of this questionnaire, low - level physical activity category: if the individual does not meet the criteria for intermediate- or high - level categories . Intermediate - level physical activity category: if the individual meets one of these criteria: three days or more, each day at least 20 min of intense physical activity or five days or more, each day at least 30 min of intermediate physical activity or walking . High - level physical activity category: if the individual meets one of these criteria: having at least three days of intense physical activity which reaches the minimum of 1500 met - min / week or seven days a week, any combination of walking, intermediate, or intense activity, if the total score of physical activity reaches a minimum of 3000 met - min / week . For determining the nutritional intake, then, foods were converted into their ingredients, and their amounts were calculated into grams and were encoded . Then, the amounts of energy, macronutrients, and micronutrients were calculated by entering the data to nut4 software nutritionist 4 (version7; n - squared computing, or usa) which was modified for iranian items were used . After collecting quantitative and qualitative data were presented as mean standard deviation (sd) and frequency and percentages, respectively . The relationship of the disease status with qualitative variables was assessed by chi - square and comparing the quantitative data between groups was conducted using independent t - test and analysis of covariance as appropriate . The present study is a case - control study that was approved by the tehran university committee and ethics advisory committee, and written consent was obtained from all participants . Patients with nafld who admitted isfahan fatty liver research center were chosen as the case group . In this study, according to sample size, estimation of 140 people for case and control group: and on the basis of expectancy for over- and under - reporting of dietary intakes while completing the 24-h dietary recall, 170 people were selected for each group . After calculating participant's energy intake, who receiving under 800 kcal and over 4200 kcal of energy each day inclusion criteria for case group included the following: individuals between 20 and 60 years old who were diagnosed with nafld after giving blood tests and performing ultrasonography, by a radiology specialist (the device used for ultrasonography was esaot medica, which is equipped with a convex 3.5 mhz probe). Inclusion criteria for control group included the following: volunteers who were the neighbors of case group and were same as them in age and sex . Blood tests and ultrasonography were performed on them and their wellbeing in case of nafld was approved (not suffering from any stages of hepatic steatosis). Exclusion criteria included the following: alcohol consumption, following special diets 2 months before the study, regular use (at least continues for 1 week) of any nutritional supplements in the last 6 months, pregnant or breastfeeding women, individuals with type b or c hepatitis and diagnosed wilson's disease, use of drugs effective on liver, and biochemical biomarkers . Data about age and sex were recorded by researcher by means of general information questionnaire . Physical activity rate was estimated by short form of international physical activity questionnaire . Based on instructions of this questionnaire, low - level physical activity category: if the individual does not meet the criteria for intermediate- or high - level categories . Intermediate - level physical activity category: if the individual meets one of these criteria: three days or more, each day at least 20 min of intense physical activity or five days or more, each day at least 30 min of intermediate physical activity or walking . High - level physical activity category: if the individual meets one of these criteria: having at least three days of intense physical activity which reaches the minimum of 1500 met - min / week or seven days a week, any combination of walking, intermediate, or intense activity, if the total score of physical activity reaches a minimum of 3000 met - min / week . For determining the nutritional intake, a 24 h dietary recall questionnaire was filled for every individual . Then, foods were converted into their ingredients, and their amounts were calculated into grams and were encoded . Then, the amounts of energy, macronutrients, and micronutrients were calculated by entering the data to nut4 software nutritionist 4 (version7; n - squared computing, or usa) which was modified for iranian items were used . After collecting, data were analyzed using spss software version 16 (spss inc ., quantitative and qualitative data were presented as mean standard deviation (sd) and frequency and percentages, respectively . The relationship of the disease status with qualitative variables was assessed by chi - square and comparing the quantitative data between groups was conducted using independent t - test and analysis of covariance as appropriate . There is no difference between two groups in frequency of two genders, average of age, height, and weight (p> 0.05). However, the body mass index (bmi) was higher in the case group (p <0.05). Physical activity comparisons show that patients are less active than healthy individuals (p <0.05). Comparison of demographic, anthropometric, and physical activity data between nonalcoholic fatty liver disease and control groups mean sd of total energy and macronutrients intake between case and control groups is shown in table 2 . No difference in these variables was observed between two groups (p> 0.05). Intake of saturated fat in patients with nafld was more than healthy individuals (p <0.05). Other dietary lipids intake in case and control groups had no difference (p> 0.05). Comparison of energy and macronutrients intake between nonalcoholic fatty liver disease and control groups sugar intake had a statistically significant difference between two groups such that it was denoted that sugar consumption in patients with nafld is more than healthy individuals (p <0.05). Mean sd of total dietary fiber (tdf) in healthy individuals was more than patients with nafld (p <0.05), but no difference was observed in soluble dietary fiber and insoluble dietary fiber (p> 0.05) [table 3]. Comparison of dietary carbohydrates and dietary fiber intake between nonalcoholic fatty liver disease and control groups in table 4, intake of vitamins and minerals after adjustment of energy intake between two groups are shown . Mean sd of dietary intake of folic acid and vitamin d in healthy individuals are more than patients with nafld (p <0.05). Moreover, it was declared that intake of potassium and zinc in healthy individuals is higher than patients with nafld (p <0.05). No other difference was observed in intake of other vitamins and minerals in two groups (p> 0.05). There is no difference between two groups in frequency of two genders, average of age, height, and weight (p> 0.05). However, the body mass index (bmi) was higher in the case group (p <0.05). Physical activity comparisons show that patients are less active than healthy individuals (p <0.05). Comparison of demographic, anthropometric, and physical activity data between nonalcoholic fatty liver disease and control groups mean sd of total energy and macronutrients intake between case and control groups is shown in table 2 . No difference in these variables was observed between two groups (p> 0.05). Intake of saturated fat in patients with nafld was more than healthy individuals (p <0.05). Other dietary lipids intake in case and control groups had no difference (p> 0.05). Comparison of energy and macronutrients intake between nonalcoholic fatty liver disease and control groups sugar intake had a statistically significant difference between two groups such that it was denoted that sugar consumption in patients with nafld is more than healthy individuals (p <0.05). Mean sd of total dietary fiber (tdf) in healthy individuals was more than patients with nafld (p <0.05), but no difference was observed in soluble dietary fiber and insoluble dietary fiber (p> 0.05) [table 3]. Comparison of dietary carbohydrates and dietary fiber intake between nonalcoholic fatty liver disease and control groups in table 4, intake of vitamins and minerals after adjustment of energy intake between two groups are shown . Mean sd of dietary intake of folic acid and vitamin d in healthy individuals are more than patients with nafld (p <0.05). Moreover, it was declared that intake of potassium and zinc in healthy individuals is higher than patients with nafld (p <0.05). No other difference was observed in intake of other vitamins and minerals in two groups (p> 0.05). Our study results indicated that waistline, hipline, and bmi in the case group are higher than control group . The results of hashemi kani et al . Study indicate that patients with nafld have higher average of weight, waistline, and bmi than healthy individuals . Moreover, capristo et al . (by using dual - energy x - ray) found that weight and body fat percentage of patients with nafld are more than healthy individuals . As the results suggest, physical activity level in healthy participants is more than nafld patients . An overview of the epidemiological evidence reported lower chance of diagnosis with nafld in individuals who exercise two times per week compared to sedentary people . According to the present study, consumption of saturated fatty acids in patients is more than healthy individuals . In studies conducted by musso et al . And zelber - sagi et al ., it was shown that consumption of saturated fat sources such as red meat has a direct relation with nafld . Glucose - dependent insulinotropic polypeptide has a role in lipid metabolism as an intermediate polypeptide . Intake of sugar in patients with nafld is higher than healthy individuals but no difference in other carbohydrates was observed . Until now, a few studies have surveyed type of consuming carbohydrate in nafld patients . In the study of yoshari et al . Showed direct relation between weekly intake of fructose - rich sources and nafld . In two other studies conducted by zelber - sagi et al . And toshimitsu et al ., it was indicated that the consumption of food sources containing simple carbohydrates is in direct relation with developing this disease . According to the conducted studies using high levels of sugar can lead to advance in steatosis by increasing de novo synthesis of free fatty acids and lipid accumulation in hepatic tissue . In our study, tdf intake in healthy individuals is higher than patients with nafld . In two studies conducted by cortez - pinto et al . And, it was found that healthy people use more fiber - rich foods such as vegetables than patients with nafld . It seems intake of dietary fiber can be a protective factor against nafld because by increasing dietary fiber intake, blood ldl, fat accumulation in body, and resistance to insulin are decreased . Results of our study indicated that dietary intake of vitamin d was higher in control group than nafld . Also in a case - control study conducted by targher, the results indicated that vitamin d intake in patients with nafld was much lower than healthy individuals . It is declared that deficiency vitamin d has a relation with lipid accumulation outside of hepatocytes and development of nafld . Results of the presents study show that healthy individuals receive more folic acid, potassium, and zinc than patients with nafld . In study of toshimitsu, it was found that decrease in intake of zinc has a direct relation with the intensity of stages of this disease . Studies indicate that some antioxidants in diet (such as zinc) can regulate hepatic aminotransferases and also prevent lipid accumulation in the liver of patients with nafld . On the basis of our information from studies conducted until now limitations of this study are using ultrasonography for diagnosing nafld because this method has much lower accuracy than fibro - scan or liver biopsy methods . Also using only one 24 h strength, however, is using case - control nature of the study that is better than cross - sectional designs and provides stronger evidence regarding risk factors . Also comparing all of the dietary macronutrients and micronutrients between two groups of patients with nafld and control group which were matched for age and sex in total, it seems that in etiology of nafld what is more important than essential macronutrients intake ratio, is the type of intake sources . Such that according to our study results, individuals with nafld consume more amounts of sugar and saturated fatty acids and less amount of sources containing fiber (soluble and insoluble) in comparison to healthy individuals . Also it seems that low intake of vitamin d, folic acid, zinc, and potassium are associated with the development of this disease.
|
Following endodontic treatment, there is a decrease in the fracture resistance of the teeth . This is also seen after the preparation of wide mesio - occluso - distal (mod) cavities . An ideal restoration for a tooth is able to maintain the aesthetics and function, preserve the remaining tooth structure and prevent the microleakage . Indirect restorative procedures such as metallic post and core fabrication followed by full crown are customary . However, there may be cases where the tooth is still erupting, or where the tooth or root canal therapy has a questionable prognosis, or where the clinician wants to wait and evaluate the healing of a periapical lesion before proceeding with full crown restorations . To prevent the failure of root canal treatment, a simple, quick, high strength adhesive technology is advancing by leaps and bounds every day, making it possible to create conservative and highly aesthetic restorations with direct bonding to the teeth . A significant increase in the fracture resistance of root filled teeth was observed when they were intracoronally restored with a resin composite material . Reinforcing composites with polyethylene fibres and glass fibres has successfully provided superior results. [57] however, there are no studies comparing the two in direct composite restorations . The aim of this study was to evaluate the fracture resistance of endodontically treated maxillary premolars with wide mesio - occluso - distal (mod) cavities restored with either composite resin, composite resin reinforced with a polyethylene fibre, or composite resin reinforced with a composite impregnated glass fibre . All the specimens were scaled to remove the adhering soft tissue and calculus, and were stored in physiologic saline . Five intact teeth were used as positive controls and endodontic access cavities were prepared in forty five teeth using a water cooled diamond bur (endo access bur; dentsply) with an airotor hand piece, and the pulp tissue was removed with barbed broaches . A size 15 k - file (mani prime dental pvt . Ltd .) The canals were prepared with protaper (dentsply maillefer) nickel titanium (ni - ti) instruments using a 1:64 reduction handpiece (anthogyr niti control; dentsply) at a speed of 300 revolutions per minute . Canals were shaped till the working length using the s1 and s2 files, and the apical third of the canal was finished using finishing file f1 and later f2 . Copious irrigation using 5 ml of 5.25% sodium hypochlorite was carried out throughout the procedure . Obturation was donewith protaper gutta percha points and ah plus root canal sealer (dentsply de trey, konstanz, germany) using a cold lateral condensation technique . Mod cavities were prepared in the teeth using an airotor hand piece with a long straight fissure diamond point (sf-12c; mani dia burs). The dimensions of the cavity were decided with the help of a periodontal probe to standardize the remaining tooth structure . The remaining thickness of the buccal and lingual wall of the teeth was 2.5 mm from the height of contour of the buccal and lingual surface till the buccal and lingual cavity walls, and the gingival cavosurface margin was 1.5 mm above the cement - enamel junction (cej) [figure 1a]. (a) standardized dimensions of mesio - occluso - distal cavity (b) preparation of bucco - occluso - lingual groove subsequently, the teeth were randomly divided into three groups (n = 15): group a - preparations restored with composite, without fibre (n = 15)group b - preparations restored with composite impregnated with glass fibre (n = 15)group c - preparations restored with composite impregnated with polyethylene fibre (n = 15)positive control - intact teeth (n = 5) group a - preparations restored with composite, without fibre (n = 15) group b - preparations restored with composite impregnated with glass fibre (n = 15) group c - preparations restored with composite impregnated with polyethylene fibre (n = 15) positive control - intact teeth (n = 5) cavities were cleaned, dried, and etched with 35% phosphoric acid (scotch bond multi purpose etchant; 3 m espe, st . The tooth surfaces were then rinsed for 10 seconds and gently dried for 1 - 2 seconds . Subsequently, a single bottle total etch adhesive (adper single bond 2; 3 m espe, st . Paul, mn, usa) was applied and photocured using light - emitting diode (led) (ledition; ivoclar vivadent) at 600 mw / cm for 10 seconds . Light intensity output was verified after every 10 samples using a digital read out light meter . Tofflemire retainer and matrix band were applied and the preparations were restored with a nanocomposite (filtek z350 xt; 3 m espe, st . The layers were placed at a 1.5 mm thickness and cured for 40 seconds according to the manufacturer's instruction . After restoring the preparation as described for group a, a groove 2 mm wide and 1 mm deep was prepared buccolingually on the occlusal surface of the restoration and cusp tips . The ends of the groove were on the occlusal third of the buccal and lingual surfaces of the tooth [figure 1b]. After etching the grooves, single bottle total etch adhesive was applied and cured for 10 seconds . Flowable composite with 10 mm of composite impregnated glass fibre (interlig; angelus, londrina pr, brazil) was placed on the floor of the groove and light cured for 20 seconds . A layer of the nanocomposite was added to cover the exposed fibre surface and cured from the occlusal direction for 40 seconds according to manufacturer's instructions . Buccolingual grooves were prepared, etched and bonded in a manner similar to group b. flowable composite resin with 10 mm of polyethylene fibre (ribbond; ribbond inc ., seattle, wa, usa) which had been saturated with the unfilled resin (scotch bond multi purpose plus; 3 m espe, st . Paul, mn, usa) was added to the groove and cured from occlusal direction for 20 seconds . The exposed surface of the fibre was covered with a layer of the nanocomposite and cured for 40 seconds from the occlusal direction according to the manufacturer's instructions . The teeth were then mounted in a block of cold cure acrylic measuring 2 cm in diameter, at cej . A layer of polyvinyl siloxane was adapted around the root surfaces to simulate the periodontal ligament . Thermocycling was carried out for 500 cycles at 5 to 55c, 30 second dwell time and 5 second transfer time . All the specimens were stored in an incubator (ibod) at 37c and 100% humidity for 24 hours . The fracture resistance of the teeth was measured using a universal testing machine (lr 50k; lloyd instruments), under a compressive force at a strain rate of 0.5 mm / min . A 5 mm diameter round stainless steel ball was positioned parallel to the long axis of the teeth and centered over the teeth until the bar just contacted the occlusal surface of the restoration and the buccal and lingual cusps . The force needed to fracture each tooth was recorded in newtons. [57] the study design was a three arm comparative study where the outcome variable was fracture resistance . Statistical analysis was performed using descriptive statistical methods, one way anova test and the post - hoc tukey test . The statistical software namely sas 9.2, spss 15.0, stata 10.1, medcalc 9.0.1, systat 12.0 and r environment ver.2.11.1 were used for the analysis of the data and microsoft word and excel were used to generate graphs, tables etc . Cavities were cleaned, dried, and etched with 35% phosphoric acid (scotch bond multi purpose etchant; 3 m espe, st . The tooth surfaces were then rinsed for 10 seconds and gently dried for 1 - 2 seconds . Subsequently, a single bottle total etch adhesive (adper single bond 2; 3 m espe, st . Paul, mn, usa) was applied and photocured using light - emitting diode (led) (ledition; ivoclar vivadent) at 600 mw / cm for 10 seconds . Light intensity output was verified after every 10 samples using a digital read out light meter . Tofflemire retainer and matrix band were applied and the preparations were restored with a nanocomposite (filtek z350 xt; 3 m espe, st . The layers were placed at a 1.5 mm thickness and cured for 40 seconds according to the manufacturer's instruction . After restoring the preparation as described for group a, a groove 2 mm wide and 1 mm deep was prepared buccolingually on the occlusal surface of the restoration and cusp tips . The ends of the groove were on the occlusal third of the buccal and lingual surfaces of the tooth [figure 1b]. After etching the grooves, single bottle total etch adhesive was applied and cured for 10 seconds . Flowable composite with 10 mm of composite impregnated glass fibre (interlig; angelus, londrina pr, brazil) was placed on the floor of the groove and light cured for 20 seconds . A layer of the nanocomposite was added to cover the exposed fibre surface and cured from the occlusal direction for 40 seconds according to manufacturer's instructions . Buccolingual grooves were prepared, etched and bonded in a manner similar to group b. flowable composite resin with 10 mm of polyethylene fibre (ribbond; ribbond inc ., seattle, wa, usa) which had been saturated with the unfilled resin (scotch bond multi purpose plus; 3 m espe, st . Paul, mn, usa) was added to the groove and cured from occlusal direction for 20 seconds . The exposed surface of the fibre was covered with a layer of the nanocomposite and cured for 40 seconds from the occlusal direction according to the manufacturer's instructions . The teeth were then mounted in a block of cold cure acrylic measuring 2 cm in diameter, at cej . A layer of polyvinyl siloxane was adapted around the root surfaces to simulate the periodontal ligament . Thermocycling was carried out for 500 cycles at 5 to 55c, 30 second dwell time and 5 second transfer time . All the specimens were stored in an incubator (ibod) at 37c and 100% humidity for 24 hours . The fracture resistance of the teeth was measured using a universal testing machine (lr 50k; lloyd instruments), under a compressive force at a strain rate of 0.5 mm / min . A 5 mm diameter round stainless steel ball was positioned parallel to the long axis of the teeth and centered over the teeth until the bar just contacted the occlusal surface of the restoration and the buccal and lingual cusps . The force needed to fracture each tooth was recorded in newtons. [57] the study design was a three arm comparative study where the outcome variable was fracture resistance . Statistical analysis was performed using descriptive statistical methods, one way anova test and the post - hoc tukey test . The statistical software namely sas 9.2, spss 15.0, stata 10.1, medcalc 9.0.1, systat 12.0 and r environment ver.2.11.1 were used for the analysis of the data and microsoft word and excel were used to generate graphs, tables etc . Cavities were cleaned, dried, and etched with 35% phosphoric acid (scotch bond multi purpose etchant; 3 m espe, st . The tooth surfaces were then rinsed for 10 seconds and gently dried for 1 - 2 seconds . Subsequently, a single bottle total etch adhesive (adper single bond 2; 3 m espe, st . Paul, mn, usa) was applied and photocured using light - emitting diode (led) (ledition; ivoclar vivadent) at 600 mw / cm for 10 seconds . Light intensity output was verified after every 10 samples using a digital read out light meter . Tofflemire retainer and matrix band were applied and the preparations were restored with a nanocomposite (filtek z350 xt; 3 m espe, st . The layers were placed at a 1.5 mm thickness and cured for 40 seconds according to the manufacturer's instruction . After restoring the preparation as described for group a, a groove 2 mm wide and 1 mm deep was prepared buccolingually on the occlusal surface of the restoration and cusp tips . The ends of the groove were on the occlusal third of the buccal and lingual surfaces of the tooth [figure 1b]. After etching the grooves, single bottle total etch adhesive was applied and cured for 10 seconds . Flowable composite with 10 mm of composite impregnated glass fibre (interlig; angelus, londrina pr, brazil) was placed on the floor of the groove and light cured for 20 seconds . A layer of the nanocomposite was added to cover the exposed fibre surface and cured from the occlusal direction for 40 seconds according to manufacturer's instructions . Buccolingual grooves were prepared, etched and bonded in a manner similar to group b. flowable composite resin with 10 mm of polyethylene fibre (ribbond; ribbond inc ., seattle, wa, usa) which had been saturated with the unfilled resin (scotch bond multi purpose plus; 3 m espe, st . Paul, mn, usa) was added to the groove and cured from occlusal direction for 20 seconds . The exposed surface of the fibre was covered with a layer of the nanocomposite and cured for 40 seconds from the occlusal direction according to the manufacturer's instructions . The teeth were then mounted in a block of cold cure acrylic measuring 2 cm in diameter, at cej . A layer of polyvinyl siloxane was adapted around the root surfaces to simulate the periodontal ligament . Thermocycling was carried out for 500 cycles at 5 to 55c, 30 second dwell time and 5 second transfer time . All the specimens were stored in an incubator (ibod) at 37c and 100% humidity for 24 hours . The fracture resistance of the teeth was measured using a universal testing machine (lr 50k; lloyd instruments), under a compressive force at a strain rate of 0.5 mm / min . A 5 mm diameter round stainless steel ball was positioned parallel to the long axis of the teeth and centered over the teeth until the bar just contacted the occlusal surface of the restoration and the buccal and lingual cusps . The force needed to fracture each tooth was recorded in newtons. [57] the study design was a three arm comparative study where the outcome variable was fracture resistance . Statistical analysis was performed using descriptive statistical methods, one way anova test and the post - hoc tukey test . The statistical software namely sas 9.2, spss 15.0, stata 10.1, medcalc 9.0.1, systat 12.0 and r environment ver.2.11.1 were used for the analysis of the data and microsoft word and excel were used to generate graphs, tables etc . Highest mean fracture resistance was observed with positive control followed by group b and group a respectively . One way anova test revealed a significant difference (p = 0.001) between the groups [table 1] [figure 2]. On intergroup comparison, post - hoc tukey test revealed a moderately significant difference between control and group b (p = 0.034) whereas a strongly significant difference was recorded between control and group a (p = 0.002) and between control and group c (p = 0.001). No significant difference was recorded between any of the experimental groups (group a, b and c) (p> 0.1) [table 2]. Mean fracture resistance in newton (n) in all four groups as seen in the study graph depicting mean fracture resistance values pair wise comparison: difference and p value in the study restoration of root filled teeth, despite posing a major challenge to the clinician, is an essential final step of root canal treatment . The purpose of the restoration is not only to repair, reinforce and strengthen the tooth, but also to provide an effective seal between the canal system and the mouth . The gold standard of post endodontic restorations is the full crown; however, there are situations where the clinician may choose to delay the delivery of the full crown . In such cases, an efficient, direct, high strength adhesive restorations allow a more efficient transfer and distribution of functional stresses across the bonding interface to the tooth structure . The smaller size of the fillers allows them to have excellent optical properties along with good mechanical properties . Despite the advances in material sciences, original ribbond (group c) consists of cold plasma treated, leno weave ultra high modulus (lwuhmw) polyethylene fibres, which are arranged in a lock - stitch design . Interlig (group b) consists of glass fibres pre - impregnated with light curable composite resin arranged in a braided design . Fibres were placed occlusal to the restoration following a technique given by oskoee et al ., and belli et al .. placing fibres on the occlusal surface keeps buccal and lingual cusps together and protects the natural cusps resulting in higher fracture resistance . In addition, fracture resistance increases when fibres are placed close to the point where the force is exerted because it leads to a shorter working arm according to levers principle . The results of the present study revealed that the positive control group had highest mean fracture resistance (811.90 n). This is in accordance with the study by beli et al ., and also denotes that endodontic and restorative treatment have a detrimental effect on fracture resistance of teeth . Among the experimental groups, group b had the highest mean fracture resistance (600.49 n) followed by group a (516.96 n), and group c (514.64 n) [table 1] [figure 2]. The one way anova test done in the present study revealed a statistically significant difference (p = 0.001) between all the groups [table 1]. Post - hoc tukey test revealed a moderately significant difference between control and group b (p = 0.034) and a strongly significant difference between control and group a (p = 0.002), and between control and group c (p = 0.001). No significant difference was found between any of the experimental groups (group a, b and c) (p> 0.1) [table 2]. Group a showed an acceptable fracture resistance due to the use of nanocomposites in the present study . The high filler loading enables nanocomposites to demonstrate good physical and mechanical properties and reinforce the tooth structure well . Single bottle total etch system gave evidence of better bond strength than the newer self- etch systems . The presence of the adhesive layer under the restoration acts as a stress buffer . A study by ausiello et al ., has shown that an optimal adhesive layer thickness leads to maximum stress release while preserving interface integrity . The fracture resistance of group a can be attributed to the increase in strain capacity of the adhesive resin and the improved physical and mechanical properties of nanocomposites . This study recorded that group b had the highest fracture resistance amongst the experimental groups . The superior performance of group b may be because of the pre - fabricated resin impregnation of these fibres by the manufacturers . Also, glass fibres have very high tensile strength, density and percentage of elongation allowing them to withstand high stresses without fracturing . Results of this study were in agreement with the study by kolbeck et al ., who reported the glass fibres performed better than polyethylene fibres due to pre - impregnation with light cured composite which ensures a good bond with the composite resin . Polyethylene fibres have shown high fracture resistance in previous studies . According to the manufacturer original ribbond fibres are woven using the lock - stitch leno weave which prevents slipping of fibres within resin matrix, prevents micro - cracks from propagating to form larger cracks and reinforces the restoration in multiple directions . Beli et al ., found that insertion of polyethylene fibre in the occlusal third of a composite restoration increased the fracture resistance of root filled teeth compared to teeth restored with composite resin alone . However, the present study showed that insertion of polyethylene fibre did not significantly increase the fracture resistance of a root filled tooth as compared to teeth restored with composite resin alone (group a) (p> 0.1). The causes for lower fracture resistance of group c may include the following: non uniform wetting of fibre with unfilled resin - manual wetting of original ribbond (group c) with unfilled adhesive was done as suggested by the manufacturer . This may lead to areas of non - uniform wetting in the fibre which will affect the adhesion of fibre to resin matrix . The poorly impregnated regions may become areas of increased water sorption, hence causing deterioration of mechanical properties of the composite . Such voids may also act as oxygen reserves hence preventing complete polymerisation of composite resin.the lwuhmw polyethylene fibre is treated with cold gas plasma to convert the material from hydrophobic to hydrophilic . This treatment is meant to make the fibre surface more receptive to bonding with the resin however; it makes the fibre very technique sensitive . The fibres frayed on cutting, and became very stiff after the wetting procedure.an additional reason for its poor performance may be lower tensile strength, density and elongation compared to glass fibres . Non uniform wetting of fibre with unfilled resin - manual wetting of original ribbond (group c) with unfilled adhesive was done as suggested by the manufacturer . This may lead to areas of non - uniform wetting in the fibre which will affect the adhesion of fibre to resin matrix . The poorly impregnated regions may become areas of increased water sorption, hence causing deterioration of mechanical properties of the composite . Such voids may also act as oxygen reserves hence preventing complete polymerisation of composite resin . The lwuhmw polyethylene fibre is treated with cold gas plasma to convert the material from hydrophobic to hydrophilic . This treatment is meant to make the fibre surface more receptive to bonding with the resin however; it makes the fibre very technique sensitive . An additional reason for its poor performance may be lower tensile strength, density and elongation compared to glass fibres . Though it was not among the objectives of the study it was observed that the majority of failures in the fibre reinforced groups were favourable in nature . This can prove immensely beneficial to clinicians as despite fracturing, the tooth remains repairable with techniques such as post and core followed by full crown . Additionally, the study done by reeh et al ., showed a relative loss of stiffness of 5% due to endodontic procedures and 63% in mod cavity preparation whereas the present study found a relatively smaller decrease of 25 - 35% in fracture resistance of root filled teeth with mod cavity preparation restored with nanocomposites or nanocomposites restored with different fibres . Despite this decrease in fracture resistance all the experimental groups demonstrated results much higher than the average normal biting force of human maxillary premolars (100 - 300n). Forces generated intraorally during function vary in magnitude, speed of application and direction, whereas the forces applied to the teeth in this study were at a constant direction and speed and they increased continuously until fracture occurred . Further in vivo studies should be done to test the reinforcement effect of fibres in clinical situations . Root canal treatment and mod cavity preparation significantly reduced fracture resistance of root filled maxillary premolars (p = 0.001).even though there was no statistically significant difference between the test groups, the fracture resistance of the composite impregnated glass fibre reinforced group was much higher . Root canal treatment and mod cavity preparation significantly reduced fracture resistance of root filled maxillary premolars (p = 0.001). Even though there was no statistically significant difference between the test groups, the fracture resistance of the composite impregnated glass fibre reinforced group was much higher.
|
Chlamydophila pneumoniae is a common etiological factor of the respiratory tract infections, including pharyngitis, bronchitis, and pneumonia . It is estimated that c. pneumoniae is responsible for pneumonia in approximately 10% of cases, and for bronchitis and sinusitis in approximately 5% of cases . The main symptoms of infection include cough, pharyngitis and, hoarseness, often accompanied by sinusitis pharyngitis occurs in the first phase, followed by bronchitis or pneumonia in the second phase of a disease . Prolonging cough (for more than 3 weeks) is a basic symptom indicating c. pneumoniae infection [4 - 6]. Respiratory tract infections of c. pneumoniae etiology are characterized by a long incubation period, usually lasting 14 - 21 days . Untreated infections can lead to many complications, such as exacerbations of bronchial asthma, endocarditis, coronary heart disease, endothelitis, and abortions [7 - 9]. The aim of this study was to assess the incidence of chlamydial respiratory tract infections in children and adolescents in the lower silesia region of poland in the year 2009 . The study was performed in accordance with the declaration of helsinki for human research and the study protocol was accepted by institutional ethics committee . In 2009, children treated for various, non - specific respiratory illnesses in different hospital wards, in clinical departments, or as outpatients (mainly from family practices) in the lower silesia region were investigated for c. pneumoniae infections . The study materials were 641 throat swabs obtained from 326 girls and 315 boys, aged 11 months to 18 years . Past medical history of these patients was indicative of recurrent respiratory tract infections, long - lasting paroxysmal dry cough, rhinitis, and hoarseness . Throat swabs from the posterior wall of the pharynx were made before the start of any treatment, with the use of thin, sterile disposable swabs . Tests for the presence of c. pneumoniae antigens in throat swabs were performed by an indirect immunofluorescence antibody (ifa) technique, using the chlamydia cel pn testing kits (cellabs pty ltd ., sydney, australia). Table 1 presents the results of throat swabs examination for c. pneumoniae in 641 children . The positive ifa test results were shown in 276 patients (43.1% of the study group), including 41.4% of girls and 44.8% of boys . The proportion of positive results was strikingly large, and it should be taken into consideration regarding epidemiologic assessment, differential diagnosis, and therapeutic management . The presence of c. pneumoniae antigens in children depending on the diagnosis and the clinical symptoms is shown in table 2 . In the group of children with features of infection which manifested itself in the form of dry cough, the proportion of positive results for c. pneumoniae was 41.4%, and in the children with cough, rhinitis, and discharge from the throat - 47.2% . An assumption can be made that these are the dominant clinical symptoms of infection, since other symptoms like hoarseness occurred only in 22.9% of the examined subjects . In the group of children with symptoms of infection and having contact with sick people around them, the proportion of positive findings for c. pneumoniae was 48.3%, whereas in the children without infection in their environment this proportion was as low as 29.3% . That shows that there was a high probability of transmitting infection with cough or as droplet infection . In the group of children followed up for 14 days after the end of treatment, the presence of c. pneumoniae antigens was revealed in 54.2% . The latter observation is of a substantial interest to us, since it could have a bearing on further patients' management . The significance of this observation is, however, hampered by a relatively small number of patients, 48 (17.3%) out of the group of 276 with positive tests for the presence of c. pneumoniae antigens, who were followed up . The following conclusions can be drawn from the findings of this study: in the group of children and adolescents from the lower silesia region a large number of c. pneumoniae airborne and droplet infections were revealed; the most common clinical symptoms were dry cough lasting for more than 3 weeks and rhinitis; the diagnosis of the respiratory tract infection in a child caused by chlamydia should be the signal for a thorough examination of people from its closest circle; patients treated with antibiotics should always be followed up, because in nearly 50% of them the presence of chlamydia pneumoniae can still be detected.
|
Gastric cancer is still one of the most frequent causes of cancer - related deaths . Although its incidence has decreased in recent years, it is still high in eastern asia, including china . Familial gastric cancer (fgc) has a lower incidence in western countries, only 1%3% of patients have been diagnosed as family gastric cancer . Reports indicate that in northern china about 7.8% of patients with gastric cancer can be diagnosed as fgc . Hereditary diffuse gastric cancer (hdgc) is the only familial cancer syndrome which primarily affects the stomach and for which a mutation has been identified . Asymptomatic family members have to make a choice about whether to have genetic testing and individuals who test positive for an inherited e - cadherin mutation have to make difficult decisions about whether to option for endoscopic surveillance or prophylactic gastrectomy . However, it should be remembered that mutations of the e - cadherin gene (cdhi) only in one - third of familial gastric cancer cases are only relevant for diffuse - type gastric cancer, and the observed mutations were different in western and asian ethic groups . At present, most scholars are focusing on the level of familial gastric cancer gene pathogenesis [36], but the reports on analysis of clinical and pathological features and prognosis are rare . This study retrospectively analyzed 51 cases of familial gastric cancer (fgc) in patients with clinical and pathological data and prognosis, treated by the department of gastric surgery, union hospital of fujian medical university from january 2004 to december 2006 and compared with the 673 cases of sporadic gastric cancer (sgc) within the same period . This is so far the first reported clinical and pathological features and prognosis of patients with familial gastric cancer in southeast china population aimed at improving the diagnosis and treatment of familial gastric cancer . The inclusion criteria for fgc are as follows: (1) first and (or) second degree relatives have two cases or more than two cases in any tissue type of gastric cancer, one confirmed before 50 years; (2) first and (or) second degree relatives have three or more than three cases of gastric cancer, with no age limited . Hereditary nonpolyposis colorectal cancer (hnpcc), family gonadal fibromatosis (fap), li - fraumeni syndrome, cowden syndrome, and peutz - jegher syndrome were excluded . Those that do not comply with the above standards of familial gastric cancer are defined as sporadic gastric cancer (sgc). This group has collected the clinical data of the 724 patients with gastric cancer who accepted the radical surgical treatment, cured by the department of gastric surgery, union hospital of fujian medical university from january 2004 to december 2006, among which there are 51 cases of fgc and 673 cases of sgc, accounting for 7.0% and 93.0% of the total number of patients with gastric cancer during the period, respectively . The comparison of general information of patients in two groups is shown in table 1 . Patients were followed up by hand, using the outpatient door visit, letter, and telephone followup . The survival time was the time from diagnosis until the last contact, the date of death, or the date that the survival information was collected . In addition to the patients who died, all surviving patients were followed up for more than five years . The survival rate was calculated according to the kaplan - meier method, and the comparison of the survival rate was tested using the log - rank method . The comparison showed that the proportion of patients with fgc under the age of 50 was significantly higher than the sgc group, but in terms of the tumor site, tumor size, histological type, depth of invasion, lymph node metastasis, the two groups have no statistical difference (table 1). The postoperative 5-year survival rates in fgc and sgc patients were 40.1% and 51.8%, respectively . The univariate analysis found that the factors that affect fgc prognosis are lymph node metastasis, depth of invasion, tissue type, and tumor size, while the factors that impact the prognosis of the sgc in patients are lymph node metastasis, depth of invasion, histological type, tumor size, and tumor location (p <0.05, table 2). Cox proportional hazards model analysis showed that lymph node metastasis and depth of invasion are the independent factors to affect the prognosis of fgc patients; lymph node metastasis, depth of invasion, and tumor size are the independent factors affecting sgc prognosis (p <0.05, table 3). Depth of invasion stratified analysis found that the postoperative 5-year survival rates of fgc and sgc patients in stages t1, t2, and t3 and were 100% and 94.9%, 80.0% and 66.1%, and 50.0% and 45.5%, respectively, and the differences were not statistically significant (p> 0.05, figures 2(a)2(c)). The postoperative 5-year survival rates of fgc and sgc patients in stages t4a, t4b 21.2% and 38.6%, and 9.1% and 22.3%, and the differences were statistically significant (p <0.05, figures 2(d) and 2(e)). Stratified analysis of lymph node metastasis showed that the post - operative 5-year survival rates of fgc and sgc patients in stages n0, n1, and n2 were 92.3% and 83.0%, 80.0% and 58.4%, and 33.3% and 45.1%, respectively, and the differences were not statistically significance (p> 0.05, figures 3(a)3(c)). The postoperative 5-year survival rates of fgc and sgc patients in stage n3 were 7.7% and 21.3%, respectively, and the difference was statistically significant (p <0.05, figure 3(d)). The characteristics of the sick people include the apparently younger ages and familial aggregation [7, 8]. According to the lauren pathological type, fgc defined in this study can be divided into two categories: hereditary diffuse gastric cancer (hdgc) and familial intestinal gastric cancer (figc). In 1998, guilford and his colleagues first discovered that the hdgc is connected with the e - cadherin gene (cdh1) mutations, which opened the prelude of the the fgc genetics research . So far, although there were a large number of studies indicating that the occurrence of hdgc is closely related to cdh1 gene [3, 4], still the pathogenesis remains unclear . The research made by yamada et al . Revealed that cdh1 gene mutation rate in japanese fgc patients was 15.4% and that the incidence of fgc was connected with the environmental factors, such as smoking, helicobacter pylori infection, high - salt diet, or other genes (e.g., p53, the met, stk11) mutations . It has been reported that fgc usually has a unique biological behavior [13, 14]: early onset, poor tumor differentiation, and the trend of parenteral tumors and multiple primary cancers . As for the distribution of tumor location, charlton et al . Reported that hereditary diffuse gastric lesions are mainly in distal gastric cancer and rogers et al . Reported that early lesions are often multifocal, reviewed 81 cases of fgc patients and indicated that the age of onset, depth of invasion, lymph node metastasis, pathological stage, and other aspects in fgc and sgc patients were not statistically different . Our data showed that, compared with the sgc, the fgc patients have earlier age of onset, but the tumor site, tumor size, histological type, depth of invasion, and lymph node metastasis were not statistically different . Despite the detailed description of the pathogenesis of the fgc gene level by many scholars and the gradual discovery of its clinical and pathological features, its low incidence makes the postoperative long - term efficacy still poorly recognized . In recent years, some scholars believe that prophylactic total gastrectomy on patients whose families have a gastric cancer history and who are detected cdh1 gene mutation can help to improve their prognosis [18, 19]. Study revealed that the postoperative 5-year survival rates of fgc and sgc patients who underwent radical surgery were 48% and 57%, and the difference was statistically significant (p <0.05); p53-positive and ajcc staging are the independent factors impacting fgc prognosis . In our study, 5-year survival rate in patients with fgc was obviously worse than that in sgc patients (p <0.05). Further prognosis stratification analysis of the depth of invasion and lymph node metastasis indicated that the fgc patients in stages t13 or n02 who underwent radical surgery can achieve similar prognosis to sgc . Therefore, we believe that early diagnosis and treatment of fgc is critical; timely and radical surgery can improve the prognosis of patients . In addition, we also found that the fgc and sgc prognostic factors are not consistent, and fgc may be a special type of gastric cancer . In summary, this study showed that fgc has early onset; the lymph node metastasis and depth of invasion are the independent prognostic factors . Fgc patients in stage t13 or n02 who underwent radical surgery can achieve similar prognosis to sgc; however, patients in stages t4 or n3 have poorer prognosis . We believe that, the key to improve the prognosis of fgc patients is early diagnosis and treatment . Besides, a further analysis with a larger sample is extremely essential to verify the findings in our study.
|
Breast cancer, which has the highest incidence and mortality rate of women cancers globally, imposes a significant disease burden in developing countries . Among breast cancer risk factors, dense breasts found on mammography due to breast epithelium and stroma are known to be a potent risk factor, raising breast cancer risk by four to six times [2 - 4] according to previous systematic reviews (srs) [5 - 9]. However, these srs have mostly been performed on studies of white women in the west . Asian women, whose breast cancer incidence rate is lower than that of western white women, have been reported to have dense breasts on mammography more frequently [11 - 14]. That is, asian women have denser breasts on mammography, but lower breast cancer incidence than white women . These facts make us doubt the proposal that breast density may be a risk factor in asian women . In particular, the incidence curves of breast cancer in accordance with age are significantly different in asian women, including koreans, than in western women [18 - 20]. Thus, we can infer that the risk factor of breast density works differently in asian women than in western women . Some studies have reported that breast density on mammography was a risk factor for breast cancer in asian women [21 - 23]. However, the risks varied depending on the density measurement index, statistical significance varied for each density interval, and a dose - response relationship has not been shown . As of the end of december 2015, no sr was found that evaluated the association between breast density on mammography and breast cancer risk in asian women . The final selection criteria for the meta - analysis included analytical epidemiology studies that evaluated the association between breast density levels determined using mammography and breast cancer risk in asian women . Article selection was conducted in accordance with the preferred reporting items proposed for srs and meta - analyses, including three stages: searching, screening using titles and abstracts, and evaluating articles . The databases searched in the first stage were pubmed (http://www.ncbi.nlm.nih.gov/pubmed) and scopus (www.scopus.com), and the following search formula was applied: [(breast) or (mammary)] and [(cancer) or (neoplasm)] and [(density) or (index)] and [(asia) or (women)]. Furthermore, a list was made while performing a hand search to investigate whether an sr had already been published evaluating the same hypothesis . The lists from the three search sources were combined to remove duplicates . For the 2-stage screening process, the following exclusion criteria were applied based on the titles and abstracts to the summarized list: (1) studies not related to breast cancer, (2) laboratory studies, (3) expert or systematic reviews, and (4) descriptive epidemiological studies including cross - sectional prevalence studies . After the 2-stage screening process and exclusion, the third - stage evaluation was conducted for the remaining articles . For this purpose, the content was evaluated using the full text of each article, and articles that fell into the following categories were excluded sequentially: (5) analytical epidemiology studies that did not provide the information necessary for a meta - analysis, and (6) duplicate studies . Judgment of duplicates was made when the study subjects were selected from the same institution during the same recruiting period . Among duplicates, the following information was extracted from each article: the nationality of the subjects, the recruiting institution, data sources for cohort construction, menopausal status, number of cancer cases and controls, type of breast density measurement index, and adjusted odds ratios (aors) or relative risks and their 95% confidence intervals (cis) for potential confounders at each density level . The measurement indices included the wolfe classification (wolfe), percent density (pd,%), volumetric density grade (%), density area (cm), total breast area (tba, cm), absolute dense area (cm), and mean dense area (mda, cm). An article showing aors divided according to menopausal status and several measurement indices was considered to provide independent datasets for each stratum . The effect size (es) of each dataset to be used in the meta - analysis was calculated using the interval collapsing method (icm) rather than highest vs. lowest intake method (hlm), because the icm increases the statistical precision more than the hlm . Icm application adopts the es and its 95% ci calculated by performing a meta - analysis with a random effect model (rem) on the aor and its 95% ci presented for each density level within a dataset as the es for each dataset . After dividing the data into subgroups according to menopausal status and measurement indices, a rem meta - analysis was performed again using the es for each dataset to calculate a summary effect size (ses) and its 95% ci . Meta - analysis was performed only in cases in which two or more datasets were found in the subgroup analyses . In the meta - analysis, furthermore, to investigate the dose - response relationship in breast cancer risk in accordance with the density level presented in breast density indices, a random effects dose - response meta - regression (drmr) was conducted . The median values within the interval were used for dosage determination, and the lower limit was set at zero when the lowest interval was open . When the highest interval was open, the median interval of the adjacent interval was used . If the density index was pd, the dosage unit was determined to be 25% . The statistical significance level was set at 5%, and stata version 14.0 (statacorp, college station, tx, usa) was used . The final selection criteria for the meta - analysis included analytical epidemiology studies that evaluated the association between breast density levels determined using mammography and breast cancer risk in asian women . Article selection was conducted in accordance with the preferred reporting items proposed for srs and meta - analyses, including three stages: searching, screening using titles and abstracts, and evaluating articles . The databases searched in the first stage were pubmed (http://www.ncbi.nlm.nih.gov/pubmed) and scopus (www.scopus.com), and the following search formula was applied: [(breast) or (mammary)] and [(cancer) or (neoplasm)] and [(density) or (index)] and [(asia) or (women)]. Furthermore, a list was made while performing a hand search to investigate whether an sr had already been published evaluating the same hypothesis . The lists from the three search sources were combined to remove duplicates . For the 2-stage screening process, the following exclusion criteria were applied based on the titles and abstracts to the summarized list: (1) studies not related to breast cancer, (2) laboratory studies, (3) expert or systematic reviews, and (4) descriptive epidemiological studies including cross - sectional prevalence studies . After the 2-stage screening process and exclusion, the third - stage evaluation was conducted for the remaining articles . For this purpose, the content was evaluated using the full text of each article, and articles that fell into the following categories were excluded sequentially: (5) analytical epidemiology studies that did not provide the information necessary for a meta - analysis, and (6) duplicate studies . Judgment of duplicates was made when the study subjects were selected from the same institution during the same recruiting period . Among duplicates, the following information was extracted from each article: the nationality of the subjects, the recruiting institution, data sources for cohort construction, menopausal status, number of cancer cases and controls, type of breast density measurement index, and adjusted odds ratios (aors) or relative risks and their 95% confidence intervals (cis) for potential confounders at each density level . The measurement indices included the wolfe classification (wolfe), percent density (pd,%), volumetric density grade (%), density area (cm), total breast area (tba, cm), absolute dense area (cm), and mean dense area (mda, cm). An article showing aors divided according to menopausal status and several measurement indices was considered to provide independent datasets for each stratum . The effect size (es) of each dataset to be used in the meta - analysis was calculated using the interval collapsing method (icm) rather than highest vs. lowest intake method (hlm), because the icm increases the statistical precision more than the hlm . Icm application adopts the es and its 95% ci calculated by performing a meta - analysis with a random effect model (rem) on the aor and its 95% ci presented for each density level within a dataset as the es for each dataset . After dividing the data into subgroups according to menopausal status and measurement indices, a rem meta - analysis was performed again using the es for each dataset to calculate a summary effect size (ses) and its 95% ci . Meta - analysis was performed only in cases in which two or more datasets were found in the subgroup analyses . In the meta - analysis, furthermore, to investigate the dose - response relationship in breast cancer risk in accordance with the density level presented in breast density indices, a random effects dose - response meta - regression (drmr) was conducted . The median values within the interval were used for dosage determination, and the lower limit was set at zero when the lowest interval was open . When the highest interval was open, the median interval of the adjacent interval was used . If the density index was pd, the dosage unit was determined to be 25% . The statistical significance level was set at 5%, and stata version 14.0 (statacorp, college station, tx, usa) was used . Figure 1 shows a flow diagram illustrating a series of processes from the searching, screening, and evaluation stages to the final selection of articles to include in the analysis . From the two databases, pubmed and scopus, eight articles acquired from the hand - searching process were added to the list, and then 197 duplicates were removed, leaving a list of 1374 articles . From this list, the texts of the 53 remaining articles were obtained and the content was evaluated to remove 47 articles, leaving the final six articles for meta - analysis [20 - 22,28 - 30]. The exclusion criteria during the selection process were the following: (1) 766 studies were not related to breast cancer; (2) 48 articles were laboratory studies; (3) 97 studies were expert or srs; (4) 410 articles were descriptive epidemiological studies, including cross - sectional prevalence studies; (5) 40 analytical epidemiology studies did not provide sufficient information for a meta - analysis; and (6) seven articles were duplicate studies . The study subjects of nagata et al . Were patients at gifu city hospital, and four duplicates were removed [31 - 34]. The study subjects of lee et al . Were participants of the singapore breast cancer screening programme (sbcsp), and two duplicates were removed . The study subjects of kim et al . Were patients at the samsung medical cancer in korea, and one duplicate was removed . Table 1 shows a summary of the final six articles with 17 datasets based on type of breast density index and menopausal status . Categorized by country, the six articles included three japanese studies, two korean studies, and one singaporean study . Seven datasets were of premenopausal women and eight were of postmenopausal women . In terms of the breast density index, five used pd, four used tba, and two or fewer datasets used the remaining indices . Since the findings varied in accordance with the index type and menopausal status, subgroup analysis was performed rather than calculating the ses values of the 17 datasets in order to control for potential heterogeneity . In other words, the datasets were divided according to menopausal status, and meta - analysis was performed only in cases with two or more datasets for each density index (table 2, figure 2). In premenopausal women, the pd index was significantly associated with elevated breast cancer risk (ses, 3.23; 95% ci, 2.23 to 4.66; i=0.0%), whereas the tba index did not show a statistically significant association . In the group of postmenopausal women, the tba index did not show a statistically significant association, whereas the pd index was associated with a significant increase in breast cancer risk (ses, 1.62; 95% ci, 1.13 to 2.32; i=0.0%). For premenopausal and postmenopausal women, meta - analysis was performed if two or more datasets were present for each density index, and the results showed significantly elevated breast cancer risks for the pd, density area, and volumetric density indices . Among the six articles selected, three provided the information necessary for drmr analysis . Three datasets (2, 5, and 8 in table 1) were obtained using the pd index, and homogeneity was detected between two datasets (5 and 8 in table 1) of postmenopausal women (p=0.35), showing a risk increase of 1.73 times for each 25% increase in pd in postmenopausal women (95% ci, 1.20 to 2.47). In this study, the first sr of breast density and breast cancer risk in asian women, breast cancer risk was found to increase as the pd value increased . Although the tba index did not show statistical significance, the risk increased by 73% for each 25% increase in pd in postmenopausal women, which indicates that higher breast cancer risk is associated with higher pd values in women in asian countries . However, the risk calculated for pd in premenopausal and postmenopausal women was estimated to be 2.21 times that of baseline (95% ci, 1.52 to 3.21), which is lower than the risk elevation of four to six times that has been confirmed in western women (two to four). First, breast density itself is not a risk factor, but a phenomenon determined by other risk factors [37 - 40]. Density can be affected by obesity, family history, genotype as well as obstetrical history . Second, in asian women, the positive predictive value in breast cancer diagnosis decreases with decreased sensitivity in mammography of denser breasts, resulting in underestimation of cancer occurrence . Third, risk levels were found to change in accordance with the type of density measurement index [43 - 45], suggesting that different measurement indices have been used by different researchers, and that different indices may be appropriate depending on race . Fourth, this study analyzed limited data, meaning that the conclusions may be tentative . Further studies evaluating breast density, as measured using several indices, and the risk of breast cancer in asian women are needed . First, an overall es reflecting information from all 6 articles was not calculated, not only because the number of articles related to asian women was small, but also because the breast density index varied across articles . However, the study performed by wong et al ., which was excluded because its participants overlapped with the sbcsp participants, presented breast cancer risks adjusted for menopausal status and the pd index . When this was added to the five data - sets using pd in the meta - analysis, as shown in table 2, the ses increased from 2.12 to 2.30 (95% ci, 1.67 to 3.16; i=40.5%, not shown in table 2). When two groups (premenopausal and postmenopausal women) were differentiated in a single article, it was possible that the ses values were determined by calculations within the subgroup analysis . However, the studies of nagao et al . And lee et al . Could not be used in the subgroup analysis because the results were not divided according to menopausal status . Furthermore, in cases where various indices were used for the same subjects, these results could not be incorporated without omission, resulting in a selective analysis within subgroups as well . Applying drmr to the density indices was possible because three datasets were established from the total of two articles on japanese women, while only one was possible for premenopausal women . The aforementioned three limitations could be overcome by creating a single database for a pooled analysis of the selected articles . First, the subjects included only women who were born and lived in asia . In other words, this decision was based on studies reporting that immigration as an environmental change affects breast cancer risk . In the future, studies will be needed to investigate how breast density affects cancer risk among people of the same race depending on emigration . Second, in the five case - control studies, the most recent mammography results before breast cancer diagnosis were used as breast density values . This design does not reflect the fact that breast density changes with age in individual women [46 - 48]. In the future, cohort studies that investigate breast cancer risk according to individual changes in breast density will be needed . In conclusion, regardless of menopausal status, breast cancer risk in asian women increased with breast density measured using pd . In particular, postmenopausal women with a high pd index had an elevated risk of breast cancer . As this sr suggests that the pd index represents breast cancer risks well in asian women, we propose the further development of a breast - cancer risk prediction model involving pd for asian women . To investigate the risks more precisely, a pooled analysis is proposed, along with the application of pd in breast cancer prediction models in asian women
|
Blood - questing mosquitoes mainly rely on olfactory cues to locate their hosts (takken, 1991; costantini et al ., 1996; takken and knols, 1999). Funestus giles, these cues are strongly reminiscent of those released by humans i.e., the principal source of the mosquitoes blood meals (gillies and coetzee, 1987). Odorants from human skin and carbon dioxide from breath are particularly important (costantini et al ., 1996; mukabana et al ., 2004; spitzen et al ., this difference in host preference is expressed clearly in odor - guided behavior, where an . These behavioral differences also are reflected in the role of these species as malaria vectors, an . Arabiensis is equally susceptible to the plasmodium parasite but, due to its different feeding behavior, is of less importance as a vector . Host preference, and hence the selection of hosts based on their odorants, is of principal importance to understand the role of these mosquitoes in malaria epidemiology . Given the strong association of an . Gambiae with humans, unraveling the odor cues that mediate this behavior is of scientific as well as practical importance . For an . Gambiae the principal olfactory cues of humans originate from the feet (de jong and knols, 1995), and recent work has demonstrated that these cues are partially produced by the microbial flora present on the feet (verhulst et al ., 2010). From these studies, several chemical compounds have been identified that play a critical role in the odor - mediated behavior of an . Detailed information on the role of these compounds allows for the development of synthetic blends that can be used to better understand the host - seeking behavior of this mosquito . Such blends also have the potential to be used for mosquito surveillance or intervention through mass trapping . Studies on the development of kairomones for malaria vectors have demonstrated strong behavioral responses to synthetic blends of human odorant compounds (smallegange et al ., 2010a). In laboratory and semi - field studies, these blends attract a large proportion of host - seeking mosquitoes, but when tested against a natural human host, or against natural human odorants released from a nylon matrix, these blends demonstrate poor competitive characters compared to the natural odorants . This suggests that either the concentration of the odorants in the blend was insufficient or that one or more compounds to make the blend sufficiently competitive were missing (smallegange et al ., 2005, 2010a; verhulst et al ., 2011a). Recent progress, however, has demonstrated the development of odor blends that approach the attractiveness of natural human skin odorants (okumu et al ., 2010b). In addition, there is sometimes a mismatch between laboratory behavioral results and field trials, which can be caused by differences in concentration or spatial effects (verhulst et al ., 2009, 2011a). Assessment of existing synthetic attractant compounds under semi - field and field conditions provides a potential for the development of technologies that can be used for sampling and control of malaria mosquitoes (kline, 2006; jawara et al . The current study was designed to evaluate the attractiveness of selected synthetic blends and human hosts to host - seeking mosquitoes in western kenya, with emphasis on the malaria vectors an . Thus, the comparative trapping efficacy of the attractant blends and the physiological status of the mosquitoes trapped were investigated . Behavioral responses of mosquitoes to synthetic attractants were evaluated under field and semi - field conditions . The semi - field experiments utilized a laboratory colony of the mbita strain of an . Aquatic stages of the mosquitoes were reared under ambient atmospheric conditions in screen - walled greenhouses at the thomas risley odhiambo (tro) campus of the international centre of insect physiology and ecology (icipe) located near mbita point township in western kenya . All larval instars were fed on tetramin baby fish food supplied three times a day . Pupae were collected daily, transferred to adult holding rooms, and placed in mesh - covered cages (30 30 30 cm) prior to adult emergence . Adult mosquitoes were fed on 6% glucose solution through wicks made from adsorbent tissue paper . Mosquitoes used for semi - field experiments were placed in mosquito - gauze covered plastic cups and starved for 8 hr . . Only water, availed on wet cotton towels placed on top of mosquito holding cups, was provided during starvation . All semi - field experiments were carried out at night (20300630 h) inside the screenhouses (verhulst et al ., 2011b). All chemicals used to constitute the synthetic attractant blends in this study, with the exception of carbon dioxide, water, sugar, and yeast, were purchased from sigma - aldrich chemie gmbh (germany). The chemicals included propionic acid (99.6%), butanoic acid (99.9%), pentanoic acid (> 99%), heptanoic acid (98%), octanoic acid (99%), tetradecanoic acid (99%), ammonia solution (purity 25%), (s)-lactic acid (85%), isovaleric acid (99.8%), 4,5-dimethylthiazole (97%), 2-methyl-1-butanol (99%; a racemic mixture of the r and s isomers of unknown ratio), and 3-methyl-1-butanol (purity 98.5%). Carbon dioxide was produced by mixing 250 g sucrose (sony sugar company limited, kenya), 17.5 g dry yeast (angel yeast company limited, china), and water (2 l) as described in smallegange et al . Field studies were carried out in lwanda and kigoche villages of homa bay and kisumu counties of western kenya, respectively . Lwanda village is located on the southern shore of the winam gulf of lake victoria (002828s, 341722e) at an altitude of 1,169 m above sea level (verhulst et al ., 2011a). Hoof prints of cattle and night - grazing hippopotami provide excellent mosquito breeding sites in lwanda . Kigoche village lies adjacent to the ahero rice irrigation scheme (000819s, 345550e) at an altitude of 1,160 m above sea level . Kigoche has an average annual rainfall of 1,0001,800 mm and an average relative humidity of 65% . Most houses in the two villages are mud - walled with open eaves, have corrugated iron - sheet roofs, have no ceiling, and are either single- or double - roomed . Eaves, about one foot wide, increase ventilation in the houses and form the predominant entry points for mosquitoes (snow, 1987; lindsay and snow, 1988). Malaria caused by plasmodium falciparum is endemic in the two villages . The villages experience two rainy seasons: between april june and september october . During these periods, cattle, goats, chicken, dogs, cats, and a few sheep constitute the domestic animal population, with cattle being most abundant . Maize, millet and sorghum are cultivated at subsistence level in lwanda, whereas rice is a main cash crop in kigoche . In both villages, trapped mosquitoes were morphologically identified using the keys published by gillies and coetzee (1987), counted, and the data entered in ms excel spreadsheets . Abdominal statuses of female mosquitoes were categorized as unfed, blood - fed, or gravid . Gambiae complex were identified to species using a ribosomal dna polymerase chain reaction assay (scott et al ., 1993). Prototype blends were made by adding components to a standard attractive blend (standard blend, sb) consisting of ammonia, (s)-lactic acid, and tetradecanoic acid (smallegange et al . The standard blend was augmented with locally - made carbon dioxide plus individual additional candidate compounds or groups of 24 of these compounds . These compounds were selected following two studies in which a total of 39 chemical compounds were evaluated for their attractiveness to an . Gambiae (verhulst et al ., 2011b; smallegange et al ., 2012). All compounds except carbon dioxide were delivered to experimental mosquitoes by using low density polyethylene sachets (ldpe). To prepare a sachet, a tube foil of ldpe material was cut (35 30 mm), thermally sealed at one end before pipetting 1,000 l of a pure compound through the open end of the sachet . The sachet was subsequently sealed, confining the candidate compounds within an area of 25 25 mm . The wall thickness of the ldpe material used was 0.1 mm (isovaleric acid and 3-methyl-1-butanol), 0.2 mm (2-methyl-1-butanol), 0.03 mm (ammonia solution, 4,5 dimethylthiazole, and tetradecanoic acid), and 0.05 mm ((s)-lactic acid). Several sachets, varying in number according to the number of chemical compounds constituting a specific prototype blend, were placed onto a hook (verhulst et al ., 2009), which was subsequently inserted inside the outlet tube of a mm - x trap (american biophysics cooperation, ri, usa). Dual - choice tests comparing mosquito behavioral responses to a total of 15 prototype blends, with different combinations of the four candidate compounds + sb vs. sb alone then were conducted in the semi - field screenhouse facility by placing mm - x traps in diagonal corners (verhulst et al . The experiments were replicated four times . The prototype blend attracting the highest numbers of an . Gambiae mosquitoes in the screenhouse was evaluated in lwanda village and compared with the attractiveness of other blends, which we had tested in previous field experiments (okumu et al ., 2010b). The number of mosquitoes attracted to each one of three blends including ifakara blend 1 (ib1; okumu et al ., 2005, 2009) and a best, newly - formulated prototype blend namely mbita blend (mb) was recorded . The textile composition was 90% polyamide and 10% spandex (bata shoe company, kenya). The nylon strips were cut into narrow pieces each measuring 26.5 cm long and 1.0 cm wide . Treatments included blend ib1 dispensed via nylon strips, ib1 dispensed via ldpe sachets, sb dispensed via nylon strips, sb dispensed via ldpe sachets, and mb dispensed via ldpe sachets . Blend ib1 consisted of propionic acid (0.01%; ldpe thickness 0.2 mm), butanoic acid (1%; ldpe 0.2 mm), pentanoic acid (0.0001%; ldpe 0.2 mm), 3-methyl butanoic acid (0.000001%; ldpe 0.2 mm), heptanoic acid (0.0001%; ldpe 0.1 mm), octanoic acid (0.0001%; ldpe 0.1 mm), tetradecanoic acid (0.00025%; ldpe 0.03 mm), ammonia (2.5%; ldpe 0.03 mm), (s)lactic acid (85%; ldpe 0.05 mm), distilled water (ldpe 0.2 mm), and carbon dioxide (63.23 2.82 ml / min). An unbaited mm - x trap acted as the negative control . All blends were dispensed from mm - x traps hung outside the bedroom window (for details: see verhulst et al . A total of eight village houses were selected and experiments carried out from 1830 to 0630 h each night for 40 nights . The selected houses were mud - walled, had open eaves and corrugated iron sheet roofs . The houses, occupied by owners (one person per house) throughout the night, were located at least 25 m. apart (hill et al ., 2007). The blend that attracted most mosquitoes compared to the standard blend was selected and adapted for release on nylon strips, which are known to yield higher mosquito catches than ldpe sachets (okumu et al . The blend, named mbita blend or mb consisted of 3-methyl-1-butanol, tetradecanoic acid, ammonia solution, (s)-lactic acid, and carbon dioxide . The most effective dilutions for tetradecanoic acid (0.00025%), ammonia (2.5%), (s)-lactic acid (85%) had been determined previously (okumu et al . Thus, the optimal dilution for dispensing 3-methyl-1-butanol on nylon strips was determined experimentally under semi - field conditions using mm - x traps . Binary assays evaluating mosquito behavioral responses to sb with all constituents availed at their optimally attractive concentrations vs. sb plus 3-methyl-1-butanol offered at variable dilutions (100%, 10%, 1%, 0.01% and 0.0001% and 0.000001% v / v) were run . The efficacy of attracting host - seeking mosquitoes using mb was evaluated by testing it against ifakara blend 1 (ib1), the standard blend (sb), and a control (unbaited trap) under semi - field conditions . All blends were dispensed on nylon strips by pipetting 1,000 l of each component of a blend on a separate strip (measuring 26.5 1.0 cm). The 3-methyl-1-butanol component of mb was used at a dilution of 0.000001% . In kigoche village, five houses spaced apart at a distance of at least 25 m and at least 100 m away from rice paddies were selected for the study . A 5 5 latin square experimental design preceded by a 5 d trial period was run to assess the potential of mb in attracting malaria and other mosquito vectors . The treatments, assigned to each of the five houses on rotational basis per night, included a human host, ib1, sb, mb, and an empty house i.e., all components of the synthetic attractants, with the exception of carbon dioxide, were delivered via nylon strips (okumu et al ., 2010a) and dispensed using mm - x traps . The traps were suspended 15 cm above a bed inside unimpregnated mosquito nets, and were operated using 12 volt batteries . One of the fans on the mm - x trap was disabled to prevent it from trapping mosquitoes . Mosquitoes were trapped by hanging an unlit cdc miniature light trap (model 512; john w. hock company, gainesville fl ., usa) operated on 6 v batteries (gaston battery industry ltd, china) beside and at 15 cm (jawara et al ., 2009) above the odor outlet tube of the mm - x trap, outside the bed net . Both mm - x and cdc light traps were hung on the foot end region of the beds in all cases (mboera et al ., 2000). Only one mm - x trap and one cdc light trap were used in houses where mosquito catches were based on synthetic attractants . The volunteer slept inside a well tucked - in bed net with a cdc light trap suspended besides it . Whereas a total of five adult men aged 1825 years volunteered to participate in the study, only one individual participated per night . Each experimental night lasted from 1900 to 0630 h. after the experiments traps were disconnected from the batteries, the trapped mosquitoes were taken to the laboratory, where they were killed by freezing at 4c . Consent for houses to be used in the study was obtained from the household heads and the local administration prior to the start of the study . Dispersion tests, performed to establish whether means equaled variances (grafen and rosie, 2005), were employed to determine if the count data indeed assumed a poisson distribution . Henceforth, the number of mosquitoes attracted to the different sources of behavioral stimuli (human subjects, control, or the synthetic attractants) was modeled as a proportion of the total number of mosquitoes recovered from the different treatments . All statistical analyses were carried out using generalized linear models (agresti, 1990) in which data were transformed to assume linearity using a logarithmic link function . All fitted models were followed by post hoc t - tests, to assess levels of statistical difference between pairs of competing blends assessed through the binary assays . All data were analyzed using the general statistical software program (genstat discovery edition 3) (payne, 1986). Adding 3-methyl-1-butanol to the standard blend of ammonia, (s)-lactic acid, tetradecanoic acid, and carbon dioxide either singly or in combination with 2-methyl-1-butanol formed the two most potent attractant blends for host - seeking an . Gambiae mosquitoes (catching 72% of those released) relative to the standard blend on its own under semi - field conditions (table 1). Neither adding 2-methyl-1-butanol to the basic blend, nor adding it to 3-methyl-1-butanol enhanced attractiveness . The blend containing 3-methyl-1-butanol plus components of the standard blend was considered the most potent synthetic attractant for an . The prototype product, termed mbita blend (mb), consisted of 3-methyl-1-butanol (released in 0.1 mm - ldpe sachets), tetradecanoic acid (0.03 mm - ldpe), ammonia solution (0.03 mm - ldpe), (s)-lactic acid (0.05 mm - ldpe), and carbon dioxide (130 ml / min). As adding isovaleric acid and 4,5 dimethyl - thiazole to the standard blend diminished the numbers of an . Gambiae attracted (table 1), these compounds were excluded from the prototype blend.table 1mean (se) mosquito catches per night and levels of statistical difference (p - value) between 15 prototype synthetic blends vs. a standard blend (sb) of ammonia, (s)-lactic acid, tetradecanoic acid, and carbon dioxide . Each of the compounds except carbon dioxide was dispensed from a ldpe - sachet in pure form . N is the number of replicates (nights) and n the total number of mosquitoes trapped out of a total of 800 released.% response equals n/800 . Compound 1, 2, 3, and 4 are isovaleric acid, 4,5 dimethyl - thiazole, 2-methyl-1-butanol, and 3-methyl-1-butanol, respectivelydescription of synthetic blendnn% responsemosquito trap catches (mean se)p - valuestandard blend (sb)synthetic blend1 . Sb + compound 1&2&3&442192728.00 9.8125.75 13.490.350 mean (se) mosquito catches per night and levels of statistical difference (p - value) between 15 prototype synthetic blends vs. a standard blend (sb) of ammonia, (s)-lactic acid, tetradecanoic acid, and carbon dioxide . Each of the compounds except carbon dioxide was dispensed from a ldpe - sachet in pure form . N is the number of replicates (nights) and n the total number of mosquitoes trapped out of a total of 800 released.% response equals n/800 . Compound 1, 2, 3, and 4 are isovaleric acid, 4,5 dimethyl - thiazole, 2-methyl-1-butanol, and 3-methyl-1-butanol, respectively a total of 1,286 mosquitoes were trapped in lwanda village over a period of 40 d from 28 april 2010 to 11 june 2010 . Funestus (n = 207), culex species (n = 544), mansonia species (n = 112), aedes species (n = 43), and other mosquito species (n = 121) (table 2). Gambiae s.l . Than the unbaited traps, no blend attracted significantly more mosquitoes of this species than the other (table 2). However, the standard blend dispensed from nylon strips attracted comparatively higher numbers of mansonia spp, aedes spp . And an . Ifakara blend 1 (ib1) dispensed using nylon strips attracted comparatively higher numbers of culex spp . And was performed before the optimal dilution for releasing mb on nylon strips was determined, it was not possible to fully evaluate its competitiveness against other attractants in lwanda village . Out of the 107 specimens of an ., mansonia spp ., aedes spp . And other mosquito species collected indoors per night in lwanda village, western kenya . Mosquitoes were attracted to various synthetic attractants dispensed from nylon strips or ldpe sachets mounted in mm - x traps placed under a bed net . N = number of replicates (nights); n is total number of mosquitoes per taxon caught over 40 nights . Numbers followed by different letter superscripts in the same column differ significantly (p <0.05)treatment (delivery)nan . Spp.aedes spp.other spp.empty (control)400.650.552.280.250.100.43ib1 (ldpe)401.300.531.850.530.150.43ib1 (nylon strips)401.431.152.980.550.130.58sb (ldpe)401.050.582.480.330.250.38sb (nylon strips)401.031.731.880.600.380.40 mb (ldpe)401.030.582.150.550.080.83total mosquito catches (n)25920754411243121 mean numbers of anopheles gambiae s.l ., an ., aedes spp . And other mosquito species collected indoors per night in lwanda village, western kenya . Mosquitoes were attracted to various synthetic attractants dispensed from nylon strips or ldpe sachets mounted in mm - x traps placed under a bed net . N = number of replicates (nights); n is total number of mosquitoes per taxon caught over 40 nights . Numbers followed by different letter superscripts in the same column differ significantly (p <0.05) the overall combined response of the mosquitoes to the blends ranged from 39% to 68% (table 3). Dilutions of 3-methyl-1-bunanol from pure compound to 10,000 times were significantly (p <0.001) in favor of the standard blend, except for the 1,000-fold dilution, for which no difference in attractiveness between the two blends was found . Only with the highest dilution (100,000) did significantly more (p <0.05) mosquitoes respond to the augmented blend than to the standard blend . This blend (mb) subsequently was chosen for further evaluation.table 3mean number se of anopheles gambiae caught per night in mm - x traps baited with a synthetic blend containing various dilutions of 3-methyl-1-butanol plus a standard blend vs. the standard blend alone, dispensed from nylon strips, under semi - field conditions . N is the number of replicates (nights) and n the number of mosquitoes trappeddilution (%) nn% responsemosquito trap catches (mean se)p - valuesbsynthetic blendpure compound (99.9)45476877.50 16.9759.25 2.140.00210.043404352.00 18.4833.00 11.200.0011.044745968.25 13.1250.25 17.800.0010.144125253.25 4.29049.75 14.420.4900.0143073945.25 6.2431.50 4.050.0020.00143794742.25 12.5952.25 8.090.040 mean number se of anopheles gambiae caught per night in mm - x traps baited with a synthetic blend containing various dilutions of 3-methyl-1-butanol plus a standard blend vs. the standard blend alone, dispensed from nylon strips, under semi - field conditions . N is the number of replicates (nights) and n the number of mosquitoes trapped the attraction efficacy of mb vs. ib1, sb, and a control (unbaited trap) was evaluated over a period of 16 nights i.e., from 30 november 2010 to 16 december 2010 . Out of the total of 3,200 mosquitoes used for these experiments, there was a significant effect (glm; p <0.001) of treatment on mosquito trap catches . Whereas all the synthetic blends attracted significantly more mosquitoes than the unbaited control (p = 0.001), mb attracted more mosquitoes than blends ib1 (p = 0.001) and sb (p = 0.001). Results of these experiments are shown in table 4.table 4mean number se of anopheles gambiae caught per night in mm - x traps baited with different synthetic blends under semi - field conditions . Numbers with different letter superscripts in the same column differ significantly (glm; p <0.001). N is the number of replicates (nights) and n the total number of mosquitoes trapped . The effect of treatment (p values) on overall mosquito responses is also shownblend (delivery)nnmosquito trap catches (mean se)treatment (p - value)control (no odors)16583.62 0.810.001ib11669143.2 4.40.001sb1652532.8 5.40.001mb1687854.9 8.10.001 mean number se of anopheles gambiae caught per night in mm - x traps baited with different synthetic blends under semi - field conditions . Numbers with different letter superscripts in the same column differ significantly (glm; p <0.001). N is the number of replicates (nights) and n the total number of mosquitoes trapped . The effect of treatment (p values) on overall mosquito responses is also shown the competitiveness of mb over other baits in attracting malaria and other wild mosquitoes was evaluated in kigoche village for 30 d spanning the period 0130 april, 2011 . Funestus, 201 (9.9%) other anopheles species and 283 (14%) culex species were collected . The collections also included one aedes and one mansonia mosquito representing 0.1% of the collection . Gambiae s.l . Collected included 34 male and 1,071 female (92.8% unfed; 5.3% blood fed, and 1.9% gravid) mosquitoes . Funestus species of mosquitoes included 56 male and 377 female (96.8% unfed; 2.1% blood fed, and 1.1% gravid) mosquitoes . The culex sub - sample consisted of 196 (97.5%) unfed and 5 (2.5%) blood fed mosquitoes . Analysis of the data revealed that houses baited with mb caught 31.5% (n = 637) of the mosquitoes (males and females) while those with a human being, ib1, sb, or no host cue collected 26.9% (n = 545), 19.6% (n = 397), 17.4% (n = 352), and 4.6% (n = 93) of the mosquitoes, respectively . (p <0.042), an . Funestus (p <0.014) and culex species (p <the mean number of female mosquitoes with the exception of culex species collected from the five traditional houses did not differ significantly . The numbers of mosquitoes of all species collected from the empty house were significantly lower than those collected from houses baited with mb (p = 0.001), a human being, ib1 (p = 0.001), or sb (p = 0.001). Funestus and culex species than a human being (p = 0.002 and 0.001, respectively) or sb (p = 0.001 and 0.005, respectively). Mosquitoes than ib1 (p = 0.001) and sb (p = 0.001), these numbers did not differ significantly from those attracted by a human being (p = 0.121). Furthermore, although mb attracted more an . Funestus mosquitoes then ib1 (p = 0.001), the number of culex mosquitoes attracted to mb were not different from those attracted to blend ib1 (p = 0.140)table 5total pooled number of female mosquitoes and mean number se per species per night trapped in response to different synthetic attractant blends (dispensed form nylon strips) and a human host in kigoche village, western kenya . Numbers with different letter superscripts in the same column differ significantly . The number of replicates (n) is showntreatmentntotal no . Of female mosquitoes collectedmean (se) of female mosquito catches per nightan . Funestusculex spp.aedes spp.mansonia spp.other anophelinescontrol30811.2 0.410.8 0.280.33 0.15000.37 0.021human305279.9 2.12.93 0.651.17 0.28003.57 0.96ib1303757.13 2.902.0 0.391.7 0.390.03 0.030.03 0.031.60 0.49 sb303336.27 1.402.03 0.59 1.27 0.33001.53 0.41mb3061811.2 2.14.8 1.262.23 0.72002.37 0.80 total pooled number of female mosquitoes and mean number se per species per night trapped in response to different synthetic attractant blends (dispensed form nylon strips) and a human host in kigoche village, western kenya . Numbers with different letter superscripts in the same column differ significantly . The mosquito catches in the screenhouse and the village houses consistently showed a higher number of an . Gambiae when traps were baited with the mbita blend compared to the ifakara blend 1 and the standard blend . In kigoche village, significantly more an . Gambiae s.l . Funestus, the main malaria vectors in western kenya, were caught with mb than with the other two blends, and catches were similar to (an . Funestus) attracted to a human host . In a previous study in tanzania, that used experimental huts, okumu et al . We conclude, therefore, that synthetic blends can be effectively used for sampling african malaria mosquitoes . The odor - baited technology has a distinct advantage over the widely - used cdc trap + human - under - a - bed - net method introduced by garrett - jones and magayuka (1975), which has since been used as the standard method for assessing entomological inoculation rates and other relevant epidemiological parameters for malaria (smith et al ., 2006; bousema et al ., 2010) (1991) and found to sample approximately two - thirds of the mosquitoes attracted to a human host . Later assessments of the cdc trap reported a similar efficiency but with local variations (costantini et al ., 1998). Given the natural variation in attractiveness of humans to mosquitoes (smith, 1956; brouwer, 1960; knols et al ., 1995; qiu et al ., 2006), caused by the variation in human skin odorants and breath (mukabana et al ., 2004; the need for a human host to be present during the all - night collections, the cdc trap plus bed net combination for mosquito trapping has obvious disadvantages . These disadvantages can be overcome by replacing the human host with synthetic bait (over a time frame of at least 1 week), which produces a consistent and constant blend of odorants and hence avoids the variance caused by the human - dependent method of mosquito sampling . Natural variance in human odorants is likely to affect trap catches, and may potentially lead to stronger attractiveness of the natural host than the synthetic blend, but also to considerably lower attractiveness . Odor - baited traps also can be used in large numbers simultaneously across a study area, which avoids bias caused by spatial effects . In this study, we examined the use of ldpe as a material for the slow release of odorants, analogous to the successful use of ldpe for attractants of tsetse flies (green, 1994; torr et al ., 1995). Odorants attractive to tsetse flies and released through ldpe remain active for many months and have been used widely for the mass trapping of tsetse flies in remote areas . Although odorants released through ldpe used in our study proved attractive to anopheline and other mosquitoes, we found that releasing the odorants from nylon strips caused a significantly higher attraction of several of the mosquito species . It seems likely that the size of the ldpe sachets we employed was too small to provide a sufficiently large surface to release the quantity of odorants needed for optimal attraction of the mosquitoes . It is also possible that the carboxylic acids present in the blend disperse in smaller quantities through ldpe than from the nylon strips . The odor baits used for tsetse flies consist of entirely different chemicals (mostly 1-octen-3-ol, 4-methyl phenol, and 3-n - propyl phenol) (bursell et al ., 1988; vale, 1993), which may disperse more readily through ldpe than the mosquito kairomones . From our high throughput work on candidate attractants of an . Gambiae (verhulst et al ., 2011a; smallegange et al ., 2012), we selected isovaleric acid, 4,5-dimethylthiazole, 2-methyl-1-butanol, and 3-methyl-1-butanol because of the increased attractiveness expressed when these compounds were added to the standard blend . It was, therefore, surprising that in contrast to previous results, here under semi - field conditions both isovaleric acid and 4,5-dimethylthiazole caused an inhibitory effect . Even more so, when two or more of these compounds were added to the standard blend, the effect of each compound individually was cancelled out, or the entire blend seemed repellent, causing most mosquitoes to avoid entering any of the traps . With all four compounds added to the standard blend, the overall response of the mosquitoes was significantly reduced . It is possible that when employing higher dilutions of each of these compounds when studying the effect of multiple compounds, the kairomonal potency of the blend might be further enhanced . This compound is known to exist of two isomers (r and s). In our study, we used a racemic mixture . It is possible that only one of the isomers would have evoked a behavioral effect in the mosquito, which should be followed up in a future study . The results from the dose - effect study with 3-methyl-1-butanol show that highly diluted concentrations cause attraction of an . For example, the mosquito repellent deet is repellent over a wide range of concentrations, but becomes attractive at very low concentrations (mehr et al ., 1990), and this principle of concentration - dependent dual action might apply to many other odorant cues that affect insect behavior (smallegange and takken, 2010). We examined the response of mosquitoes to candidate odorant blends in traps placed outdoors, next to a house, and traps placed indoors . A recent study showed that catches from indoor and outdoor mm - x traps were comparable (jawara et al ., 2009), suggesting that the mosquitoes perceived the odorant cues from a distance, and would either be caught while approaching the house or after house entry . Although lwanda and kigoche are approximately 120 km apart, with different ecologies, the mean number of an . Odor - baited traps caught significantly more mosquitoes than unbaited traps, thus demonstrating the attractive effect of the blends under investigation . On average, the trap placed next to a human - occupied bed net caught similar numbers of mosquitoes as the trap next to the dispenser baited with the mbita blend . Unlike in the tanzania study, where ib1 was 23 times as attractive as the human - odor baited trap (okumu et al ., 2010b), here, ib1 was less attractive than the human - baited trap . This difference between these studies may have been caused by different attractiveness of the human volunteers, environmental differences, or both . The differences were small, though, and the overall result shows that the three synthetic blends approached the attractiveness of the human host (table 5), with mb being the most attractive blend . Funestus (96.8%) collected from kigoche village was unfed implies that the blends, more so mb that attracted the highest numbers of mosquitoes, mainly target host - seeking mosquitoes . It is not surprising, therefore, that the numbers of mosquitoes attracted to mb were physiologically not significantly different from those attracted to human subjects . Funestus than the trap next to the human - occupied bed net, the catches of mosquitoes displaying this physiological status as well as gravid ones were small . Anopheles gambiae s.s . Was the species used in the semi - field study, whereas in the field study an . Gambiae s.s . Have declined dramatically, presumably as a result of widespread bed net use, whereas populations of an . The latter species is less affected by the bed nets as it is more exophilic, and less anthropophilic . Arabiensis is attracted strongly to the synthetic blends, as shown by the okumu et al . (2010b) study as well as by the current study (tables 2 and 5). Because an . Arabiensis can be an important malaria vector and is regularly found in human landing catches (port et al ., 1980), the synthetic blends used here can provide a tool for the sampling of this species . Funestus was also caught in both villages, responding significantly more strongly to the mbita blend than to the other blends or the human host . As other, non - anopheline mosquitoes were also collected, the synthetic blends, notably mb, should be considered as attractants for a wide range of mosquito species, including other disease vectors . We conclude that the multiple - component odorant blends described in this study can be considered to replace traditional malaria vector sampling tools such as cdc light traps and the human landing catch . Host, used in multiple locations simultaneously over a study area, is a distinct advantage in providing unbiased data on relative mosquito densities . This will be of advantage for malaria epidemiological studies, but also cost effective . Because the baits are also effective outdoors, they open up a novel avenue for sampling of outdoor biting malaria vectors, which have recently been reported to be a major source of malaria transmission (reddy et al ., 2011; russell et al .,
|
The occurrence of carcinoma in the external auditory canal (eac) is rare, with an annual incidence of one per one million people, accounting for less than 0.2% of all head and neck cancers . Verrucous carcinoma is a well - differentiated variant of squamous cell carcinoma, which is a low - grade malignancy and described as slow growing, locally destructive, and invasive, but not metastatic . Verrucous carcinoma of the head and neck area occurs predominantly in the oral cavity and larynx, and less commonly in the esophagus and genital area . Histologically, verrucous carcinoma displays keratosis, parakeratosis, hyperkeratosis, papillomatosis, and acanthosis . The mass may infiltrate deeply with thickened squamous epithelium pushing borders but not invading the basement membrane . We present a case of squamous cell carcinoma in the eac occurring at a site where verrucous carcinoma had been previously treated . A slowly growing papillomatous lesion of the eac was repeatedly confirmed by biopsies over several years, but aggravation by the growing mass eventually caused otalgia . The patient had surgery, and the mass was histologically diagnosed as verrucous carcinoma . During follow - up after surgery, a slow growing remnant mass was identified . After reviewing the specimen removed at surgery, squamous cell carcinoma was diagnosed . Here a 54-year - old man visited our clinic after 20 days of experiencing intermittent left hearing disturbance, and 1 week of left aural fullness and otorrhea at november 2007 . He had a history of hypertension and diabetes mellitus for which he was on medication, and had received stenting for an acute myocardial infarction 2 years previously . A mass and crust were observed on the inferior portion of the left eac on physical examination (fig . When we removed the crust on the inferior portion of the eac, it bled easily . This left eac mass had been identified at another hospital 1 year previously, and a biopsy performed 6 months later led to a diagnosis of hyperkeratosis . During follow - up with left ear dressings at the other hospital, the tumor in the left eac increased in size and a new protruding mass on the inferior portion of the tympanic membrane was discovered . According to the temporal bone computed tomography (ct) and physical findings, the tumor was considered to be granulation tissue, and the patient was observed for 4 years . When he visited our clinic again because of persistent otorrhea and keratin debris in the left eac at march 2011, ct revealed bony destruction of the inferior eac wall (fig . Another biopsy of the mass was performed, and the lesion was reported as papillomatosis (fig . 2a). During treatment with local 25% podophyllin and intravenous antibiotics, the patient developed left - sided facial palsy . Because of the growth of the mass was identified in temporal bone ct and mr (fig . 3) and aggravation of otalgia, on november 2012, excision via transotic approach was performed . Postoperative follow - up by ct and magnetic resonance imaging revealed invasion of the clivus and meckel's cave by carcinoma (fig . Thirty - one months after the transotic excision of the verrucous carcinoma, a further excision was carried out using a transcochlear approach . The frozen biopsy analysis performed during the surgery identified infiltration of cancer into the middle cranial fossa . Since ackerman first reported a case of verrucous carcinoma in the oral cavity in 1948, its occurrence in the eac was not described until 1981, by woodson, et al . According to the involved site, verrucous carcinoma is variously referred to as oral florid papillomatosis, giant condyloma of buschke - lwenstein, and epithelioma cuniculatum . Verrucous carcinoma is a rare tumor of the head and neck, the most common sites being the oral cavity and larynx . It very rarely involves the ear, and only 15 cases have been reported in the literature . Although the etiology of verrucous carcinoma is not well defined, the human papilloma virus (hpv) is considered one of the etiological factors . Besides hpv, poor hygiene, presence of lichenoid and leucoplakic lesions, chronic irritation and inflammation, smoking, and immunodeficiency are highly associated with verrucous carcinoma of the head and neck . Clinically, verrucous carcinoma is known to be a slowly progressive tumor with locally infiltrative and destructive characteristics, and rarity of distant metastasis . Radiation therapy is considered to be one method of treating verrucous carcinoma, but compared with conventional surgery it is a relatively lower local control rate, and therefore surgery is preferred . Verrucous carcinoma in the oral cavity at an advanced stage can present with lymph node metastasis, for which selective neck dissection should be considered . With a high recurrence rate after surgery, postoperative radiation therapy is recommended for extensive verrucous carcinoma . Histologically, verrucous carcinoma presents as hyperkeratosis, papillomatosis, and acanthosis in the epidermis layer, pushing the margin with broad rete pegs into the dermis . Chronic inflammatory cells are infiltrated around the tumor, and, unlike squamous cell carcinoma, the basement membrane between the epidermis and the dermis appears to be intact . The common wart is histologically similar to verrucous carcinoma, but it is distinguished by koilocytes, keratohyaline granules, and inward bending of rete ridges into the malpighian layer . Sometimes, a more aggressive squamous cell carcinoma may arise in the verrucous carcinoma lesion . Therefore, for differential diagnosis of verrucous carcinoma, full - thickness biopsies of the lesion are needed for histologic confirmation . In this case, for 4 years each biopsy of the tumor was identified as hyperkeratosis and after that the tumor was confirmed as papillomatosis . One year later, the tumor was confirmed as verrucous carcinoma and, after a further 3 years, squamous cell carcinoma was identified . The reason for the occurrence of squamous cell carcinoma in this patient is unknown; however, we can reasonably speculate about the pathology . First, it might be possible that squamous cell carcinoma existed concurrently with verrucous carcinoma . The resected tumor was confirmed as verrucous carcinoma, but squamous cell carcinoma could have remained . Verrucous carcinoma shows a relatively low rate of metastasis to other organs, and surgical treatment after early diagnosis is the most effective treatment modality . If misdiagnosed as a benign lesion clinically and histologically, because of a superficial biopsy, inappropriate treatment will lead to a high recurrence rate . Therefore, any suspicion of verrucous carcinoma should be biopsied with full - thickness of the skin to enable extensive examination of the lesion, and treatment should be excision with a wide safety margin.
|
Acute liver failure (alf) is characterized by an initial devastating hepatic insult followed by gross parenchymal dysfunction, which leads to a multitude of systemic organ failures due to the missing metabolic homeostasis normally provided by the healthy liver . The most common causes of alf are viral hepatitis, idiosyncratic side reactions, chronic liver diseases, autoimmune hepatitis, and dose - dependent drug - induced alf . The disease occurs rapidly and in general requires intensive care with the known high risk of mortality . Whole liver transplantation very often is the only therapy option of choice (ostapowicz and lee, 2000; gill and sterling, 2001; rahman and hodgson, 2001; ogrady, 2005). The incidence of acetaminophen (paracetamol)-induced alf is rather high in the us and in the uk related both to therapy - associated and suicide - driven overdosage of the drug (reuben et al ., 2010; lee et al ., 2011). In the liver acetaminophen is metabolized by the cytochrome p450 enzyme system located predominantly in the hepatocytes surrounding the distal branches of the liver sinusoids, the so - called perivenous hepatocytes (jungermann and kietzmann, 2000; benhamouche et al ., 2006; burke and tosh, 2006; hailfinger et al ., 2006; there are two principle ways of detoxification: (1) conjugation by sulfation and/or glucuronidation followed by elimination and (2) cytochrome p450-dependent oxidation and formation of n - acetyl - p - benzoquinonimine (napqi), which is then conjugated to glutathione and finally eliminated with the bile . Yet, sustained napqi formation eventually causes depletion of glutathione, which then in turn leads to formation of protein adducts as well as reactive nitrogen and oxygen species (figure 1). Very likely mitochondrial dysfunction and increased permeability of the mitochondrial membranes contribute to the formation of reactive nitrogen and oxygen metabolites such as peroxynitrate and hydrogen peroxide besides others, which in turn mediate protein nitration and oxidative stress (jaeschke et al ., 2002; james et al ., 2003; jaeschke and bajt, 2006; doi and ishida, 2009). Obviously, besides the hepatocytes non - parenchymal cells such as kupffer cells and sinusoidal endothelial cells seem to be involved in the generation of reactive nitrogen and oxygen species thus augmenting protein and lipid peroxidation . Since these reactions are ultimately mediated by the perivenous cytochrome p450 enzyme system, apoptotic cell death followed by centrilobular necrosis is a hallmark of acetaminophen - induced hepatotoxicity (figure 2). The inflammatory environment produced during alf is also responsible for the activation of hepatic stellate cells probably mediated by il1, which respond with an increase in expression of -smooth muscle actin and matrix metalloproteinases, mainly mmp9 . This seems to favor the remodeling of the extracellular matrix, thus augmenting hepatocyte cell death (yan et al . Acetaminophen (paracetamol) is detoxified in the liver by conjugation or cytochrome p450-dependent oxidation followed by conjugation to glutathione (gsh). Depletion of gsh leads to formation of reactive nitrogen and oxygen species, which in turn causes cell death . Rats were treated with a repeated oral dose of 4 g / kg body weight of acetaminophen . Dashed lines exemplify initial (area 1) and final necrotic perivenous areas (area 2, cv, central vein) of the liver tissue . Please note that areas around the portal vein (pv) are void of tissue damage . In the normal healthy liver tissue turnover is in the range of 0.01% . Without any challenge this rather low regenerative rate would reconstitute the whole liver parenchyma within about 1 year (steiner et al ., 1966; koniaris et al ., 2003). One might suspect then that the liver had a poor regenerative potential, which is also corroborated by the fact that after partial hepatectomy the liver is rebuilt to the original organ size, only . After 2/3 partial hepatectomy this would be accomplished by the 1.5-times cell division of the remaining hepatocytes . However, this situation does not reflect the real regenerative potential of hepatocytes . It has been shown in serial transplantation experiments in the albumin promoter - urokinase plasminogen activator (upa) transgenic mouse that hepatocytes feature a nearly unlimited regenerative capacity . In this model, the intracellular activation of the protease plasmin causes hepatocyte damage and perinatal lethality (heckel et al ., 1990). Eventually, mice survived due to the substitution of hepatocytes bearing the transgene by healthy hepatocytes, which obviously had a survival advantage . Transplantation of these hepatocytes having escaped the lethal phenotype into the livers of transgenic mice revealed the efficient repopulation of the diseased host liver by the donor hepatocytes, thus rescuing the lethal phenotype . This indicates an enormous mitotic potential of hepatocytes (sandgren et al ., 1991; rhim et al .,, the knockout of fumarylacetoacetate hydrolase (fah) leads to the accumulation of tyrosine intermediates, which cause toxic insult of hepatocytes . Transplanted healthy hepatocytes display a proliferative advantage over the diseased host hepatocytes, thus achieving nearly complete replacement of the original transgenic hepatocytes by the transplanted cells . In this model, serial transplantation of hepatocytes derived from mutant livers colonized with transplanted wildtype cells revealed that 6 rounds of liver repopulation required a minimum of 69 cell divisions (overturf et al . This in turn means, that they have the potential of self - renewal and of functional tissue formation in vivo, which are ultimate stem cell characteristics . Experimentally, alf might be triggered by the use of chemical noxious compounds such as carbon tetrachloride or acetaminophen as mentioned above . As long as the hepatocytes dispose of sufficient metabolic capacity to detoxify the drugs no obvious tissue lesions emerge . Yet, the production of reactive metabolites followed by covalent protein and lipid modification due to metabolic overload as mentioned above finally results in cellular dysfunction, initial cell damage and tissue injury . Depending on the dose applied tissue damage proceeds . The initial insult resulting in injury progression is the mitotic challenge for the hepatocytes to restore the tissue loss by functional hepatocyte progeny . Again, dependent on the dose of the noxious compounds the regenerative potential of the liver is either sufficient for injury regression or overwhelmed resulting in injury progression followed by alf (mehendale, 2005; palmes et al . Tissue regeneration is accomplished by the hepatocytes themselves as long as a minimal liver tissue mass is compliant with a certain threshold of functional tissue loss . Yet, if this threshold is surpassed the regenerative capacity of the hepatocytes does not suffice for functional tissue restoration . In this case a progenitor cell compartment is activated giving rise to so - called oval cells in rodents, which are agreed upon to be the progeny of adult hepatic stem cells in the liver (sell, 2001; kofman et al ., 2005). Oval cells appear in the periportal areas after massive liver injury adjacent to the canals of hering, structural links between the terminal biliary branches and the periportal hepatocytes (fausto, 2004; santoni - rugiu et al . It is noteworthy that both hepatocytes and hepatic progenitor cells may differentiate into hepatocytes and biliary cells as well indicating their bipotent differentiation capacity . Hence, both cell types meet the minimal definition criteria of a stem cell, i.e., the potential of self - renewal to maintain the stem cell reserve, and a multiple differentiation potential giving rise to progeny of at least two different lineages . In the latter case it is self - evident that proliferation and differentiation of the offspring cells provide the functional backup for tissue repair after injury . The regenerative response of the liver after acute intoxication is triggered by the emergence of initial tissue damage and progression . Dependding on the dose of the noxa and the regenerative capacity of the hepatocytes injury regression and regeneration or progression and alf develop . In alf, liver transplantation is the gold standard of treatment . However, about one third of patients on the waiting list for liver transplantation in europe do not profit because of the unavailability of suitable donor organs . The hepatocyte is the smallest functional unit of the liver executing the complete metabolic orchestra, which is provided by the liver as a whole . Therefore, transplantation of hepatocytes might be possible to substitute for the functional tissue loss in alf provided the donor cells take over hepatocyte functions in the deteriorated host parenchyma for at least the critical period in time either required to bridge to organ transplantation or to allow for tissue recovery from the toxic insult (najimi and sokal, 2008; oertel and shafritz, 2008; smets et al ., 2008; ito et al ., 2009; puppi and dhawan, 2009). Technically, in rodent small animal models the cells are delivered to the liver either after intraportal or intrasplenic injection . It is assumed that the cells distribute homogeneously in the liver by passage with the blood stream where they are entrapped in the sinusoids and eventually penetrate the endothelia, integrate, proliferate, and spread into the host parenchyma . This concept has been verified in various rodent animal models of alf (for recent reviews, see fox and roy - chowdhury, 2004; shafritz et al ., 2006; seppen et al ., 2009; weber et al ., 2009). There is one major constraint, which probably seriously hampers the clinical translation of hepatocyte transplantation in alf . Under non - stimulating conditions the repopulation of an acutely injured liver by transplanted hepatocytes is rather low, i.e., in the range of 15% of the total liver mass (ponder et al ., 1991;, 1999; fox and roy - chowdhury, 2004; fisher and strom, 2006). However, if the recipient liver is challenged by a growth stimulus and the proliferation of host hepatocytes is impaired then a significant repopulation by transplanted hepatocytes is achieved . There is an elegant animal model available allowing for the identification of the transplanted cells in the host parenchyma . In this rat model the natural mutation in the cd26 gene leads to the expression of a non - functional protein, however, without obvious pathophysiological consequences . Transplanted wildtype donor cells may then be identified histologically in the host parenchyma by the detection of cd26 . Providing selective pressure conditions by partial hepatectomy as a mitotic stimulus and pre - treatment with alkaloids such as retrorsine to inhibit host hepatocyte proliferation a repopulation rate for up to nearly 100% may be achieved in this rat model (laconi et al ., 1998, 1999). Similarly, high rates were obtained using rat fetal liver epithelial cells but without applying selective growth conditions for the transplanted cells (sandhu et al . . Acute liver failure in mice and rats may be induced under various experimental settings, the most common in use are those acutely applying paracetamol or carbon tetrachloride . In general, when adult hepatocytes or oval cells isolated from donor livers under various inducing conditions are used for transplantation without further selective pressure repopulation of the host liver by the transplanted cells is poor, i.e., in the range of less than 5% . However, cells are functional and survive long - term in the recipient liver indicating support of liver regeneration after acute hepatotoxic injury . If in addition to the acute injury regeneration by host hepatocytes is abrogated by the beforehand treatment with mitotoxins such as the pyrrolizidine alkaloid retrorsine much higher repopulation rates may be achieved, which clearly suffice to substitute for the loss of metabolic capacity due to the toxic parenchymal damage . Similar results were obtained using fetal (ed12.5) rat hepatoblasts . Yet, using ed14 mouse hepatoblasts 10- to 20-fold higher repopulation rates were achieved without applying selective repopulation conditions . A comprehensive summary of models and conditions used to study liver repopulation by transplanted hepatocytes or hepatocyte progenitor cells under normal and injury conditions is available (sancho - bru et al ., 2009; shafritz and oertel, 2011). To summarize, transplanted cells integrate into the host parenchyma and even at low repopulation rates display hepatocyte functions . Thus, hepatocyte transplantation in alf aims at tissue substitution of the recipient liver in order to functionally reconstitute the injured parenchyma by healthy donor cells . In respect to the clinical application of hepatocyte transplantation in alf the major hurdle is probably the scarcity of donor organs to isolate human hepatocytes in sufficient quality and quantity . Therefore, one feasible alternative to human adult hepatocytes is the use of stem cell - derived hepatocytes . The bone marrow harbors adult stem cells, both hematopoietic and non - hematopoietic, which are clearly superior in choice over embryonic stem cells for clinical application because of their less ethical constraints and the lack of teratoma formation after tissue implantation . Adult stem cells may differentiate into hepatocyte - like cells . In the mouse model of fah deficiency, hematopoietic bone marrow derived cells rescued the diseased phenotype by complementation of the defective fah gene with the wildtype gene in the transplanted cells (lagasse et al . It is an open question as to whether hepatocytes derived from the bone marrow are the product of differentiation from hematopoietic stem cells or of the fusion with host hepatocytes (alvarez - dolado et al ., 2003; newsome et al ., 2003; vassilopoulos et al ., 2003; wang et al ., 2003; camargo et al ., 2004; jang et al ., 2004). In recent years studies in rats (wang et al ., 2004; lange et al ., 2005), mice (jiang et al ., 2002), and humans (schwartz et al ., 2002; lee et al ., 2004;, 2005; seo et al ., 2005; talns - visconti et al ., 2007; banas et al ., 2007) verified that mesenchymal stem cells (msc) from various tissues like bone marrow, umbilical cord blood, or adipose tissue may differentiate into hepatocyte - like cells following specified growth and differentiation regimens in vitro . Yet, under acute injury conditions causing either periportal liver damage induced by allyl alcohol (sato et al ., 2005) or perivenous damage by the use of carbon tetrachloride (seo et al ., 2005; banas et al, 2007; yukawa et al ., 2009) or acetaminophen (stock et al ., 2009), msc - derived hepatocyte - like cells integrated into the diseased host liver, though repopulation rates were rather low, i.e., in the range of 1% of the total liver mass . Reasoning that msc feature immunomodulatory functions in that they are able to suppress the immune response mediated through t and b cells, dendritic cells and other immune cells (chamberlain et al . ., 2007; le blanc and ringden, 2007) it might not be surprising that the action of msc in alf is rather paracrine than direct tissue support by the transplanted cells . D - galactosamine - induced fulminant hepatic failure in rats was attenuated by msc - derived molecules through inhibition of apoptosis, stimulation of hepatocyte proliferation, and minimization of the inflammatory response (parekkadan et al . . The paracrine mode of action of msc was also corroborated by the amelioration of systemic inflammation induced by lps or burn indicating in addition pleiotropic effects of the msc (yagi et al . Ectopic recruitment of msc from the bone marrow to the liver has been shown in mice challenged by acute intoxication with carbon tetrachloride or 2-acetylaminofluorene indicating chemotactic activation of the msc very likely mediated by stromal cell - derived factor-1 (jin et al ., 2009; our own data substantiated that msc are able to home to and integrate into an acutely injured liver . Msc derived from rat peritoneal adipose tissue were pre - differentiated into hepatocyte - like cells according to our standard protocol (stock et al ., 2010) and then the cells were administered to the diseased animals via tail vein injection . Eighteen hours after cell delivery donor - derived cells were detected in the liver (unpublished) where they significantly decreased acetaminophen - induced apoptosis as shown immunohistochemically by the tunel assay and stimulated proliferation of host hepatocytes as shown by ki67 staining (figure 4) to regenerate the liver tissue after acute injury (unpublished). Besides their anti - inflammatory and immunomodulatory impact msc seem also to communicate with target cells by the exchange of mrna or mirna molecules (collino et al . Thus, genetic material is exchanged, which then might affect the regenerative response of the host tissue cells on the one and the differentiation of donor msc at the site of their engraftment into the host tissue on the other hand . This, however, means that transplanted cells might be imprinted by their target tissue and the molecular microenvironment induced by a specific type of injury . Acute liver injury may trigger paracrine effects due to the inflammatory environment of the diseased liver, whereas liver regeneration after, e.g., partial hepatectomy is achieved by the engraftment and functional tissue replacement by the msc differentiated into hepatocytes at the site of their engraftment . This potential pleiotropic mode of action makes msc ideal candidates for stem cell therapy of different liver diseases (enns and millan, 2008; haridass et al ., 2008; alison et al ., 2009; flohr et al ., 2009; soto - gutierrez et al ., anti - apoptotic and pro - proliferative action of msc after acetaminophen intoxication of the rat liver . Rats were treated with a repeated dose of 4 g / kg body weight of acetaminophen . Eighteen hours after the last dose the animals were sacrificed and the livers prepared for the detection of apoptotic cells (dark nuclei) by the tunel assay (lower panels) or proliferating cells (dark nuclei) by the ki67 stain (upper panels). Where indicated animals received adipose tissue - derived rat msc pre - differentiated into hepatocyte - like cells (rmsc - hc) 6 h after the last dose of acetaminophen . It is obvious that the number of apoptotic cells was significantly lower but of proliferating cells was higher in the livers with msc (right panels) indicating the anti - apoptotic and pro - proliferative action of the msc . It is obvious that experimental settings in animal models aimed to enhance liver repopulation by transplanted hepatocytes are not suited for clinical translation . Thus, the lack of a survival and/or a proliferative advantage of donor vs. host hepatocytes is probably the mechanistical reason for the poor clinical progress of hepatocyte transplantation . The low success rate is augmented by the fact that human hepatocytes are isolated from marginal donor livers not allocated for transplantation . Yet, as outlined above msc might be an alternate cell resource to generate hepatocyte - like cells . Msc display hepatocyte differentiation potential, which was substantiated both in vitro and in vivo . Even if biological and biochemical differences might exist between msc from various tissues they share typical msc characteristics like marker expression, multiple differentiation capacity, and growth on plastic surfaces, which finally determine quantitative, not qualitative, variability in their hepatocyte differentiation potential . It is feasible to suppose that in respect to ethical, technical and biological aspects the transplantation of stem cell - derived hepatocytes follows the principles of hepatocyte transplantation (fisher and strom, 2006). Msc might even open a broader spectrum of activity compared with primary hepatocytes because of their versatile properties such as low immunogenicity as well as their anti - inflammatory, anti - apoptotic, and pro - proliferative activities, which not only substitute the tissue damaged but also actively might temper the inflammatory response, e.g., after toxic or chronic injury . Recently, a couple of clinical trials most in china has been initiated or even completed to demonstrate safety and efficacy of the site of application of mscs concentrating on autologous stem cell transplantation in patients suffering from chronic liver failure (table 1) or acute decompensation after ample liver resection . Yet, so far no published results are available . In these studies, undifferentiated cells have been used bearing a potential tumor - promoting risk (karnoub et al ., 2007), which, however, has not been verified . Summary of clinical trials involving mesenchymal stem cells of different tissue sources for the treatment of chronic liver diseases . Taking ethical considerations into account these clinical conditions may be adequate to assess safety of hepatic msc transplantation . However, to take advantage of the cells immunomodulatory, chemotactic, and anti - inflammatory properties, alf offering a highly inflammatory environment in the liver may be the disease situation of choice for the use of msc . In this case even the use of allogeneic cell sources may not be a serious problem since only the short - term beneficial actions of the msc might warrant support of liver regeneration in the critical phase of acute poisoning . Immunosuppression may be applied from the beginning of treatment on or even continued as long as the recovering of the liver is ongoing but then may be ceased, thus avoiding the theoretical risks of potential sensitization of the host for future organ grafts or promoting life - threatening septic episodes during long - term stay in the intensive care units . To overcome the shortage of donor organs for liver transplantation in alf cell therapy approaches seem to be feasible, which must achieve two principle goals . (1) the loss of metabolic capacity must be substituted by the healthy donor cells, and (2) the emergence of the inflammatory environment in alf must be decelerated in order to protect hepatocytes from progression into cell death . It is obvious that the first goal might best be reached using primary hepatocytes, which, however, do not have a survival advantage in the deteriorated alf liver . The second goal might best be met by the use of msc taking advantage of their anti - inflammatory and apoptotic as well as pro - proliferative features, which, however, promises no therapeutic benefit in the case that tissue damage has surpassed the lower threshold needed to maintain body metabolic homeostasis . Thus, it might be worthwhile thinking whether a combination of hepatocytes and msc might be the cell therapeutic of best choice . Indeed, there is evidence that the performance of hepatocytes is improved in co - culture with msc (ijima et al ., 2008; chen et al ., 2012), and vice versa msc differentiation into hepatocyte - like cells is promoted by inflammatory liver injury conditions (dong et al . Recent data even demonstrated that not msc themselves but as yet unequivocally unidentified soluble factors secreted by msc exert the beneficial effects on hepatocytes under alf conditions in mice and rats (parekkadan et al ., 2007b; van poll et al ., 2008; zagoura et al ., the anti - inflammatory cytokine il10 secreted by msc seemed to play a major role in alleviating liver damage after acute injury induced by carbon tetrachloride in the nod / scid mouse model (zagoura et al ., 2011). Thus, the identification of these factors might open even cell - free therapeutical options for the treatment of alf with msc - derived molecules . Animal models for cell therapy approaches to treat alf as described above enable us to earn knowledge on the mechanisms of interactions between donor and host cells both on the molecular and cellular level, to identify the hepatotropic effects esp . Mediated by msc and their impact on the noxious challenge in order to optimize integration of transplanted cells into the recipient tissue thereby to support efficacy of cell transplantation and thus optimize the therapeutical outcome . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
For the past 40 years the porcelain - fused - to - metal systems have been extensively used in fixed partial dentures (fpds) and still represents the gold standard.1 the advantages of the pfm systems are to combine the fracture resistance of the metal substructure with the esthetic property of the porcelain . However, recently the increasing demand for esthetic restorations as well as the questionable biocompatibility of some dental metal alloys has accelerated the development and improvement of metal - free restorations.2 in the early 1990s, yttrium oxide partially stabilized tetragonal zirconia polycrystal (y - tzp) was introduced to dentistry as a core material for all - ceramic restoration and has been applied to clinical use through the cad / cam technique . Due to the transformation toughening mechanism, y - tzp has been shown to have superior mechanical properties compared to other all - ceramic systems . (flexural strength of 900 - 1200 mpa, and fracture toughness of 9 - 10 mpam)3 due to its mechanical property, zirconia has enough strength to withstand the high occlusal stress.2,4 therefore, it can be used in extensive all - ceramic fpds having more than 4 units.5 according to clinical studies, the y - tzp core ceramic exhibited high stability as a framework material . No fractures of the zirconia framework have been reported so far.6 - 8 however, delamination or minor chip - off fracture of veneering porcelain was described as the most frequent reason for the failures of zirconia fpds . The incidence of veneer fractures in zirconia fpds was significantly higher compared with those in metal - ceramic fpds.6 therefore, the bond between core and veneer or the veneer material itself is one of the weaknesses in layered zirconia based restorations and plays a significant role in their long - term success.9 the adhesion mechanism between metal and porcelain is believed to be the micro - mechanical bond, compatible coefficient of thermal expansion (cte) match, van der waals force, and mainly the suitable oxidation of metal and interdiffusion of ions between the metal and porcelain.10 data presented in literature has shown the bond strength of ceramic or resin to metal substrates to be in the range of 54 - 71 mpa11, and a sufficient bond for metal - ceramic has been accepted when the fracture stress is greater than 25 mpa.12,13 however, the bonding mechanisms for veneering ceramic to the zirconia are up to now unclear . According to investigations on the wettability of the zirconia core with the veneering ceramic, micromechanical interactions were merely regarded . Moreover, there are less information available on the bond strength values between the all - ceramic core and veneering materials, and there exists no accurate test method for obtaining information on core / veneer adhesion in bi - layered all - ceramic materials in dentistry . Many variables may affect the zirconia core - veneer bond strength; such as the surface finish of the core, which can affect mechanical retention; residual stress generated by mismatch in coefficient of thermal expansion (cte); development of flaws and structure defects at core - veneer interface; and wetting properties and volumetric shrinkage of the veneer.14 the cause of core - veneer bond failure may be related to multiple factor . The purpose of this study was to evaluate the shear bond strength of zirconia and metal alloys with their corresponding veneering porcelains . Scanning electron microscopy (sem) was used to classify the failure pattern, and the interface chemistry was evaluated using energy dispersive x - ray microanalysis (edx). The materials tested for this study were listed in table i. three types of core - veneer combinations (n = 45, n = 15/group) were fabricated by one dental technician according to the manufacturer's instructions . The corresponding porcelains for each core were veneered to zirconia (group i), base metal alloy (group ii), and high noble metal alloy (group iii). Fully sintered cerconblocks (degudent, hanau, germany) (23 15 9 mm) were used for this study . The cercon base blocks were sandblasted with 110 m al2o3 particles at 2.5 bar pressure according to the manufacturer's pre - treatment recommendation . The bars were steam - cleaned and air - dried . After a thin liner (cercon ceram kiss liner, degudent hanau, germany) layer was fired, the veneering ceramic (cercon ceram kiss, degudent, hanau, germany) was built up to the final dimension (thickness of 3 mm) according to the firing program of the manufacturer (austromat 3001, dekema dental - keramikfen gmbh & co, freilassing, germany). Due to the shrinkage of porcelain the blocks were cut in a sawing machine with diamond wheels to 15 bars (4 4 12 mm: 9 mm core / 3 mm veneer) (fig . The bars (4 4 9 mm) were cast in ni - cr base metal ceramic alloy (tillite, talladium inc ., la, usa), high noble metal ceramic alloy (degudent h, degudent, hanau, germany), according to the manufacturer's instructions . The veneering ceramic (vita vm13, vitazahnfabrik, badsckingen, germany) was built up to thickness of 3 mm after degassing, second layer of opaque firing procedures . All specimens were examined and excess porcelain was removed using a high speed diamond bur with a low - speed handpiece . The final dimensions of bars of group ii and iii were identical to those of group i. each bar was embedded in the customized polytetrafluoroethylene (ptfe) mold using pmma resin . Every effort was made to place the core - veneer interface on the same level as the upper plane of the mold (fig . The core - veneer interface of the specimen was placed on the same level as the upper plane of the mold using discs for horizontal plane adjustment . The ptfe molds holding the specimen were first inserted into a custom - made shear test jig (instron, canton, ma, usa), and the jig was secured in a bench vice . Then, the specimens were stressed in shear at a constant crosshead speed of 0.5 mm / min15 until failure occurred using an instron universal testing machine (model 3345, instron, canton, ma, usa). Force was applied to the specimen so that shear load was exerted adjacent to and directly to the bonding interface (fig . 3). Load deflection curves and ultimate load to failure were recorded automatically and displayed by the computer software of the testing machine (bluehill lite software, instron canton ma, usa). Shear bond force was recorded in newtons, and the average shear bond strength (mpa) was calculated through dividing the load (n) at which failure occurred by the bonding area (mm). Shear stress (mpa)= load (n) area (mm) to determine the mode of failure, the broken specimens were examined under scanning electron microscopy (sem) (s-4700, hitachi, japan) under 30 to 1000 magnifications . The definition for failure modes the chemical composition at the fractured core was analyzed using energy dispersive x - ray microanalysis (edx). Statistical analysis was carried out using statistical software (spss 14.0, spss, inc ., the data was analyzed using the one - way analysis of variance test (anova) and the tukey's multiple comparison test . Fully sintered cerconblocks (degudent, hanau, germany) (23 15 9 mm) were used for this study . The cercon base blocks were sandblasted with 110 m al2o3 particles at 2.5 bar pressure according to the manufacturer's pre - treatment recommendation . The bars were steam - cleaned and air - dried . After a thin liner (cercon ceram kiss liner, degudent hanau, germany) layer was fired, the veneering ceramic (cercon ceram kiss, degudent, hanau, germany) was built up to the final dimension (thickness of 3 mm) according to the firing program of the manufacturer (austromat 3001, dekema dental - keramikfen gmbh & co, freilassing, germany). Due to the shrinkage of porcelain, three separate firings were required to establish the correct dimension . The blocks were cut in a sawing machine with diamond wheels to 15 bars (4 4 12 mm: 9 mm core / 3 mm veneer) (fig . The bars (4 4 9 mm) were cast in ni - cr base metal ceramic alloy (tillite, talladium inc ., la, usa), high noble metal ceramic alloy (degudent h, degudent, hanau, germany), according to the manufacturer's instructions . The veneering ceramic (vita vm13, vitazahnfabrik, badsckingen, germany) was built up to thickness of 3 mm after degassing, second layer of opaque firing procedures . All specimens were examined and excess porcelain was removed using a high speed diamond bur with a low - speed handpiece . The final dimensions of bars of group ii and iii were identical to those of group i. each bar was embedded in the customized polytetrafluoroethylene (ptfe) mold using pmma resin . Every effort was made to place the core - veneer interface on the same level as the upper plane of the mold (fig . 2). The core - veneer interface of the specimen was placed on the same level as the upper plane of the mold using discs for horizontal plane adjustment . The ptfe molds holding the specimen were first inserted into a custom - made shear test jig (instron, canton, ma, usa), and the jig was secured in a bench vice . Then, the specimens were stressed in shear at a constant crosshead speed of 0.5 mm / min15 until failure occurred using an instron universal testing machine (model 3345, instron, canton, ma, usa). Force was applied to the specimen so that shear load was exerted adjacent to and directly to the bonding interface (fig . 3). Load deflection curves and ultimate load to failure were recorded automatically and displayed by the computer software of the testing machine (bluehill lite software, instron canton ma, usa). Shear bond force was recorded in newtons, and the average shear bond strength (mpa) was calculated through dividing the load (n) at which failure occurred by the bonding area (mm). Each bar was embedded in the customized polytetrafluoroethylene (ptfe) mold using pmma resin . Every effort was made to place the core - veneer interface on the same level as the upper plane of the mold (fig . 2). The core - veneer interface of the specimen was placed on the same level as the upper plane of the mold using discs for horizontal plane adjustment . The ptfe molds holding the specimen were first inserted into a custom - made shear test jig (instron, canton, ma, usa), and the jig was secured in a bench vice . Then, the specimens were stressed in shear at a constant crosshead speed of 0.5 mm / min15 until failure occurred using an instron universal testing machine (model 3345, instron, canton, ma, usa). Force was applied to the specimen so that shear load was exerted adjacent to and directly to the bonding interface (fig . 3). Load deflection curves and ultimate load to failure were recorded automatically and displayed by the computer software of the testing machine (bluehill lite software, instron canton ma, usa). Shear bond force was recorded in newtons, and the average shear bond strength (mpa) was calculated through dividing the load (n) at which failure occurred by the bonding area (mm). To determine the mode of failure, the broken specimens were examined under scanning electron microscopy (sem) (s-4700, hitachi, japan) under 30 to 1000 magnifications . The definition for failure modes are presented in table ii . And the chemical composition at the fractured core was analyzed using energy dispersive x - ray microanalysis (edx). Statistical analysis was carried out using statistical software (spss 14.0, spss, inc ., the data was analyzed using the one - way analysis of variance test (anova) and the tukey's multiple comparison test . Table iii shows the mean shear strength of the core - veneer interface of 3 groups . The highest mean shear strength was recorded for group iii (38.00 5.23 mpa) followed by group ii (35.87 4.23 mpa) and group i (25.43 3.12 mpa). The one - way anova showed a significant difference for the shear bond strength among the materials tested at the significant level of 0.05 (table iv). The tukey's multiple comparisons of the test were computed to make all pair - wise comparisons among the 3 groups in this study . The p values of the different comparisons did not show significant difference between the metal groups (ii, iii). But the zirconia group (group i) had significantly lower values than group ii and group iii (p <.05). Upon examination under the sem (30), the zirconia group exhibited mixed cohesive / adhesive failures with only small remnants of porcelain attached to the core material . A sem images of the zirconia group under high magnification showed many small pores in the veneering porcelain, where fracture originated and propagated in the veneering ceramics . Also, edx results revealed that fractured zirconia surfaces were mainly covered by liner or veneer material and some zirconia crystals were exposed (fig . Some base metal alloy specimens revealed mixed cohesive / adhesive failures with porcelain attached to the loaded side of the core . But many specimens presented a cohesive failure between the metal oxide and alloy, with a thin metal oxide layer covering areas of the fractured surface . Under high magnification evaluation, there were many pores in veneering porcelain and internal pores acted as the fracture origin (fig . 5a, 5b and 5c). Fractographic analysis by sem showed that the fracture origin in the veneering porcelain was mostly on the loaded surface . Edx results revealed that the fractured core surface mainly failed in oxide layer or at oxide layer / metal interface (fig . Sem image and edx analysis of the fractured surface showed that cohesive failures within the veneering porcelain were predominant (fig . The bond strength measurement of metal ceramic system was standardized by the organization of standardization through the schwickerath crack initiation test (three point bending test), and the mean debonding strength / crack initiation strength should be greater than 25 mpa to meet the iso requirement.13 due to the brittleness of all - ceramic core materials this test setup cannot be applied to all - ceramic multilayered system.16 to date an adequate standardized test set - up and a minimum required bond strength for bi - layered all - ceramic materials has not been determined.17 in a survey of the literature, few articles utilized various bond strength test methods for all - ceramic core and veneering ceramic, such as the shear bond strength test17 - 20, three and four point loading test21, biaxial flexure strength test14, and the microtensile bond strength test.19,22,23,28 however, each test has a common limitation which is the difficulty in determining the core - veneer bond strength from applied force at failure on the sample in the specific test setup . In this study, the shear bond strength test method was selected because of its simplicity, such as the ease of specimen preparation, simple test protocol and the ability to rank different products according to bond strength values . But the sbs test has some disadvantages such as high standard deviations, occurrence of non - uniform interfacial stresses, and the influence from specimen geometry . Therefore, the standardization of specimen preparation, cross - sectional surface area, rate of loading application are important for improving the clinical usefulness of sbs test . The specimens tested in this study were fabricated in rectangular forms so as to standardize the cross - sectional area easily . The first problem lies in the fixation of the test specimens by embedding in the customized ptfe mold using pmma resin . When the strength of pmma resin is weaker than the metal - veneer bond strength (especially the high noble metal - veneer group), failures occurred within the pmma resin . And the other limitation is that the specimens had to be custom fabricated and subjected to grinding, which may have produced some flaws or cutting defects in the specimens . In previous studies, dundar et al.18 reported shear bond strength in the range of 23 - 41 mpa and al - dohan17 reported shear bond strength in range of 22 - 31 mpa for commercially available core - veneer all - ceramic systems . In this study, the sbs value of veneering ceramic to zirconia core was 25.43 mpa, confirming the findings of previous studies . However unlike in al - dohan's study17, our study's results indicate a significant difference in mean sbs values between the zirconia group and metal groups . This difference in findings could be attributed to many factors, such as study design, methodology, skill and experience of the operator, and different properties of different materials . Although there were no significant differences in mean sbs values between base metal alloy and high noble metal alloy to the corresponding veneer, the value of the high noble alloy group(38 mpa) was higher than that of the base metal group (35 . The longevity of metal ceramic restorations depends on reliable bonding between metal and ceramic, primarily produced by the oxide layer.10 if the oxide layer is absent or thin, it would be completely eliminated during ceramic sintering, resulting in poor bonding . However, a heavy oxide layer should be avoided because it has poor cohesive strength24 it would obstruct the mechanical bond . According to the manufacturer, thicker oxide layers occur in nickel- and cobalt - based alloy because they contain elements that easily oxidate during the initial step of oxidation . Initial oxidation step was performed on the both base metal alloy and high noble metal alloy, which may cause the low values of sbs for base metal alloy group . The predominance of cohesive failures of ceramic in the high noble metal group (group iii) suggests that the adhesive zone (opaque ceramic / oxide layer interface, oxide layer and oxide layer / alloy interface) had higher strength than that of the ceramic . In contrast, for the base metal alloys, a predominance of interface failures was noted, suggesting that the oxide layer was weaker than that of the veneering ceramic . Understanding the failure mechanics of dental ceramic is one of the key points in developing stronger ceramic materials . Fractography has always been a powerful tool in understanding the failure mechanics of brittle materials such as dental ceramics . Identifying location, size, and types of crack initiation illustrates how cracks start, propagate, and extend to a macroscopic level, ending ultimately in fracture restoration.25 sem evaluation revealed that the fracture originated in veneering porcelain in both the zirconia and metal ceramic groups . The failure modes of the specimens from the metal ceramic and zirconia groups suggest the importance of the mechanical properties of the veneering porcelain, since cracks initiated in the veneering porcelain . It is possible that pores and internal defects of veneer lead to the initiation of fracture . Thus, the fabrication technique has critical procedures, such as layering, firing, surface finishing, and polishing of veneering porcelain.26 in addition, the strength of the veneering porcelain, which is also related to the degree of crystallinity of the veneering porcelain, is paramount to the longevity of the restorations.27 recently, a new generation of ceramic has been introduced for the veneering zirconia framework adopting the pressing technology . The advantages of this system are simplicity, quickness, and defect - free structures . Also the higher tensile strength of these press - on veneers, in addition to their superior interface quality and higher bond strength with zirconia, makes them optimal materials for application.28 thus further studies comparing different veneering techniques, such as the conventional layering technique and pressed - on veneering technique, are needed . The results of this study are in agreement with the observed clinical behavior of zirconia based system . In some clinical studies, the mechanical failures of zirconia - based systems were in the form of minor cohesive porcelain chipping . Improving the bonding strength of zirconia core - veneer and the strength of veneering porcelain may reduce the failure due to chipping or delamination of veneering porcelain . As the limitation of this study was the fact that a static test was performed in a dry environment . Water would be constantly present in the actual oral environment, which would undergo repeated temperature and ph changes . According to most studies on the bond strength, the actual bond strength would be lower than expected since the bond strength would decrease further with thermocycling or artificial aging.29 therefore thermocycling or artificial aging procedures should be included in subsequent studies . 1 . There was no significant difference among metal - ceramic groups (group ii vs group iii) in the shear bond strength . . There was a significant difference between the metal ceramic groups and zirconia group in the shear bond strength (p <.05). 3 . Surface analysis of failure modes showed combined failure modes: cohesive failures in the veneer (loaded side) and adhesive failures at the core veneer interface (unloaded side). Sem evaluation showed that the fractures originated in the veneering porcelain in both the zirconia and metal groups and the fracture origin in the veneering porcelain was mostly on the loaded surface . In the case of interfacial fractures, a thin layer of the veneering ceramic or oxide layer remained on the core materials.
|
Recently, there has been a growing worldwide interest in marathon running due to recognition of the positive effects of endurance exercise on health and physical strength . In particular, an increasing number of amateur runners are participating in recreational 10- and/or 21-km marathons, because the physiological demand is lower than for full or ultramarathons1 . However, while regular moderate exercise has beneficial effects on health, it has been reported that irregular strenuous exercise could exert a negative effect on health2,3,4 . Oxygen intake through respiration is involved in various metabolic processes as an essential factor for producing atp, an energy source . However, incomplete reduction of oxygen during metabolic processes results in partial changes in the structure of the oxygen molecules in the body, to produce reactive oxygen species (ros), which can show toxicity in the body by inducing excessive oxidative stress5 . Oxidative stress is generated by the disruption of homeostasis when oxidation reactions become dominant in the redox reaction, through which balance is maintained between oxidants and antioxidants6 . Thanks to the antioxidant defense mechanisms of the body, resting ros production in a healthy person is within the capability of the antioxidant defense system . However, in a situation that demands several to dozens of times greater oxygen supply, as during strenuous exercise, ros production increases drastically7, 8 . In particular, prolonged endurance exercise, such as marathon running, increases oxygen intake by the human body by more than 1015 times compared with resting oxygen intake, and such increased use of oxygen can result in excessive production of ros at a ratio that exceeds the human body s ability to recover the normal ratio8,9,10 . Excessively produced ros in turn can cause dna damage and alterations . If there is failure to repair damaged dna, consequent genomic and chromosomal aberrations can alter the activities of genes / proteins and thereby can lead to aging, cancer, arteriosclerosis, neuropathy, and inflammation11 . On the other hand, endurance exercise without a break previous studies13,14,15 suggested that competitive exercise resulted in an increase in creatine kinase (ck) and lactate dehydrogenase (ldh), which are important indices of the extent of skeletal muscle cell damage, and that running distance is associated with muscle damage . Despite the fact that strenuous endurance exercise can have a negative effect on health as described above, long - distance running is increasing in popularity . The effect of long - distance running on health can vary, depending not only on personal physical strength and health but also on exercise intensity including running distance and duration . To reduce the adverse effect of exercise and maximize its positive effect on health, it is essential to understand the physiological response according to exercise intensity and to select a proper exercise method according to personal physical status . Therefore, the purpose of the present study was to investigate the impact of different marathon running distances (10 km, 21 km, and 42.195 km) on muscle and oxidative dna damage by analyzing lymphocyte dna, serum ck, and serum ldh in amateur marathon runners . The subjects were recruited from the participants in the hangang marathon race in seoul, republic of korea . Of those initially recruited, 30 male amateur runners who were nonsmokers and nondrinkers, had no particular medical disease, and who had completed at least 3 full marathons and participated in regular running exercise at least 3 times a week were ultimately selected . The 30 subjects were randomly assigned to 10 km, 21 km, and 42 km groups, with 10 subjects assigned to each group . Physical characteristics are presented in table 1table 1.characteristics of the subjectsvariables / group10 km (n=10)21 km (n=10)42 km (n=10)age (years)36.510.945.07.837.913.6height (cm)173.14.3167.35.2175.99.2weight (kg)68.97.266.66.169.48.8body fat (%) 15.53.817.73.813.92.1volume of training (hours / week)5.01.55.63.66.11.2marathon careers (years)5.94.06.62.27.04.2values are means sd . The study protocol was approved by an institutional ethics review board of the department of physical education at yonsei university . All participants provided written informed consent, and the study conformed to the standards set by the latest revision of the declaration of helsinki . Values are means sd the day before the marathon race, height, weight, and body composition were measured using an impedance analyzer (inbody 4.0, biospace, seoul, republic of korea), and prerace blood samples were collected . The subjects were directed to avoid excessive physical activity from the day before blood collection and to maintain an empty stomach for at least 12 hours after the last meal . Blood samples were collected from a forearm vein before (pre) and after the races (post), and on the 3rd day of recovery (recovery). Postrace blood collection was carried out at the finish line, immediately after completion of the individual marathon courses (10 km, 21 km, and 42.195 km). Blood collection on the 3rd day of recovery was carried out by the same method as used for the prerace blood samples . Subjects were directed not to take vitamin compounds or nutritional supplements from immediately after the marathon race until the 3rd day of recovery . Blood samples were centrifuged at 3,000 rpm for 20 min, stored at 80 c, and directly analyzed . Serum ck and ldh levels were determined using a clinical chemistry analyzer (ektachem dtscii, kodak, usa). Lymphocyte dna damage was determined by using a comet assay, which showed single- or double - stranded dna breaks . For the comet assay, 130 l of whole blood was mixed with 900 l of phosphate buffered saline (pbs) and poured gently over a 150 l lymphocyte separation solution . After centrifugation at 1,450 rpm (4 min), lymphocytes were pipetted out and transferred to another tube . Seventy - five microliters of low melting temperature agarose (lma) was put into the tube and mixed with a pipette . After removing the cover glass from the slide, the mixture was poured over the slide horizontally, covered with a cover glass, put on a freezing plate, and refrigerated for 5 min . When electrophoresis was finished, the nuclei were treated with fluorescence - based staining and observed under a fluorescence microscope (leica, germany). An image of each nucleus was captured with a ccd camera (nikon, japan) and was analyzed with the komet 4.0 comet image analyzing system (andor technology, belfast, uk). Data are presented as the mean standard deviation (sd) unless otherwise stated . To identify differences in normally distributed results, when a significant interaction was apparent, the simple main effects on measured variables were determined using one - way anova . Table 2table 2.comparison of serum ck and ldh levels according to the different running distancesvariablestimegroup10 km21 km42 kmck (u / l)pre136.140.7143.239.2140.656.4cv0.300.270.40post175.052.8177.338.1312.6146.5cv0.300.210.47recovery179.056.7176.551.6320.1179.5cv0.320.290.56ldh (u / l)pre289.333.4290.031.5302.237.4cv0.120.110.12post336.330.5343.832.0427.042.6cv0.090.090.10recovery302.828.4282.528.3327.965.2cv0.090.100.20values are means sd . P <0.05 vs. pre; p <0.05 vs. 42 km shows a comparison of serum ck and ldh levels at rest and in response to different marathon running distances . Serum ck levels were significantly higher at post and recovery than at pre in all groups (p <0.05). In addition, the 42 km group showed significantly higher serum ck levels than the 10 km and 21 km groups at post and recovery (p <0.05). Serum ldh levels were significantly higher at post than at pre and recovery in all groups (p <0.05). In addition, the 42 km group showed significantly higher ldh levels than the 10 km and 21 km groups at post (p <0.05). P <0.05 vs. pre; p <0.05 vs. 42 km table 3table 3.comparison of lymphocyte dna damage according to the different running distancesvariablestimegroup10 km21 km42 kmdna in tail (%) pre7.991.338.231.218.322.21cv0.170.150.27post12.351.9112.201.5213.222.11cv0.150.120.16recovery9.041.608.680.898.860.89cv0.180.100.10tail length (m)pre51.455.6052.284.5052.5010.88cv0.110.090.21post66.135.0864.167.5768.739.87cv0.080.120.14recovery53.616.7450.973.4752.795.79cv0.130.070.11tail momentpre5.891.416.291.346.522.18cv0.240.210.33post9.551.889.491.9313.194.55cv0.200.200.34recovery5.921.875.771.166.621.50cv0.320.200.23values are means sd . P <0.05 vs. pre; p <0.05 vs. 42 km shows a comparison of lymphocyte dna damage (dna in the tail, tail length, and tail moment) at rest and in response to the different marathon running distances . Tail moment was significantly higher at post than at pre and recovery (p <0.05). In addition, the 42 km group showed a significantly higher tail moment level than the 10 km and 21 km groups at post (p <0.05). However, dna in the tail and tail length were not significantly different among the groups and time points . Ck and ldh levels in the blood can be increased by prolonged physical exercise and are generally used as indices of skeletal muscle damage16, 17 . The present study analyzed serum ck and ldh to determine the extent of skeletal muscle damage according to marathon running distance . During prolonged competitive exercise, such as a marathon, membrane permeability increases and larger amounts of the enzymes that reflect muscle damage, such as ck and ldh, short - distance or less - intensive running can achieve muscle tissue exercise without a large change in membrane permeability13 . Thus, many previous studies2, 13, 14 have demonstrated that the duration and intensity of exercise are the main factors affecting the activities of such enzymes . The results of the present study also showed that the 42 km marathon group showed greater muscle damage than the other groups, which ran shorter distances . However, the 10 km and 21 km marathon groups also showed increases in ck and ldh after marathon races compared with the prerace levels . Kim et al.3 reported that the ck concentration began to increase steadily after running 10 km in a 42.195 km marathon race, and jastrzbski14 reported that the ck and ldh concentrations began to increase after running 25 km in a 100 km ultramarathon . Such studies showed that muscle damage could be caused not only by full and ultramarathons but also by marathons of shorter distances, such as 10 km and 21 km half marathons . In addition, the present study showed that the ck levels of all groups were higher even 3 days after finishing a marathon . Kim et al.3 reported that the ck concentration was high until the 4th day of recovery after a 42 km marathon, and until the 5th day of recovery after a 200 km marathon . Tsai et al.19 reported that blood ck activity was high until the 7th day after a 42 km marathon . Therefore, it can be inferred that recovery from muscle damage induced by competitive endurance exercise takes at least 5 days, depending on various factors such as running distance and physical strength . However, if oxidative stress in a tissue exceeds the antioxidant capacity of the cells, damage to biological molecules, such as dna20, can occur . In the present study, the extent of oxidative dna damage according to marathon distance was analyzed using the comet assay, which is considered a sensitive and fast method for detecting dna damage21 . The results were presented as the values of dna in the tail, tail length, and tail moment . It is well known that many kinds of exhaustive high - intensity endurance exercises cause dna damage but that those exercises that do not cause a high level of stress in the body, such as habitual exercise or low- or moderate - intensity exercise, do not cause dna damage8, 22 . In the present study, although the 42 km marathon group showed a higher value for tail moment than the other groups, relatively short distance (10 km and 21 km) marathons were also shown to cause dna damage . This result supports the results of previous studies23, 24, showing that dna damage had a positive correlation with a variety of exercises, such as treadmill running to exhaustion, half marathons, marathons, and triathlons . Increased oxygen intake and oxygen supply to active tissue during strenuous exercise, such as a marathon, result in increased ros, which in turn can cause oxidative dna damage . Ros can also be produced during the process of recovery from tissue damage after exhaustive exercise . That is, exhaustive exercise increases ros production in the vascular system through inflammatory cell infiltration in myofibril injuries and through circulating phagocytes, and increased ros can permeate into peripheral leukocytes, resulting in the modification of nucleic acids9, 25, 26 . In addition, ros may also be produced during the reparative process of tissue damage caused by exhaustive exercise26, 27 . Tsai et al.19 reported that there was a correlation between plasma ck and oxidative dna damage caused by 42 km marathons, and the results of the present study also showed the same pattern of correlation between ck and dna damage after marathons . On the other hand, the present study showed that all 3 groups recovered from a significantly high level of dna damage to a resting level 3 days after a marathon race . Hartmann et al.28 reported that dna migration increased to the maximum level 1 day after multiple step tests on a treadmill and then returned to a resting level 3 days after the test . However, a follow - up study on dna effects of a short - distance triathlon event reported that dna migration began to increase 1 day after the event, reaching the maximum level 3 days after the event, and that such an increase continued until 5 days after the event . Tsai et al.19 reported that dna damage began to increase 24 hours after a 42 km marathon and that such an increase continued until 7 days after the marathon . However, mastaloudis et al.8 reported that a high level of dna damage caused by a 50 km ultramarathon race returned to the resting level 2 hours after the race . It has been reported that the extent and duration of dna damage can vary according to the type, duration, running distance, and intensity of exercise, as well as training conditions and physical strength29,30,31,32,33 . In the present study, the relatively fast recovery from dna damage is presumed to be due to all subjects in the 3 groups, who were all amateur runners, getting regular aerobic exercise and being familiar with long - distance running, as they had participated in marathon races . However, there has been insufficient study of the effect of exercise distance and other factors on the extent and time course of dna damage . Accordingly, future studies should assess dna damage responses according to health, physical strength, training condition, and various exercise distances and intensities.
|
Peripheral blood monocytes were isolated from three buffy coats (blutspende zrich, zurich, switzerland) by density gradient centrifugation (ficoll - paque plus (ge healthcare)) and enriched for co - culture assays using human monocyte isolation kit ii (macs, miltenyi biotech). The breast cancer cell lines mda - mb-231 and t47d cells (kindly provided by dr . Nancy e. hynes, fmi, basel, switzerland) were maintained in dmem (gibco) supplemented with 10% fetal bovine serum (sigma) and penicillin / streptomycin . The breast cancer cell lines were plated 1 10 cells in the lower compartment of 75 mm polycarbonate transwell inserts pore size 0.4 m (corning) in maintenance medium one day prior monocyte isolation . The next day the medium was replaced by rpmi (gibco) on hour before the addition of 4 10 monocytes into the upper compartment of the transwell inserts . The cells were co - cultured for five days in a humidified chamber at 37 c . Control wells contained either cancer cells only in the lower compartment with rpmi in the upper compartment or rpmi in the lower compartment with only monocytes in the upper compartment . The total rna from 17 samples was isolated using the trizol protocol (invitrogen). The rna quantity was determined by nanodrop spectrophotometer and quality assessed on the agilent 2100 bioanalyzer (agilent) using an rna 6000 nano chip . Two samples, donor2 monocytes cultured as single culture (m2c) and with t47d co - culture (m2 t) did not reach sufficient amount of rna and were excluded from further processing . At this point the samples were sent to bgi china where they were processed according to bgi's standard rna - seq sample preparation . Shortly, magnetic beads with oligo (dt) were used to isolate mrna, which was mixed with the fragmentation buffer to fragment it into short fragments . The cleaved rna fragments were synthesized into single - strand cdna using superscript ii reverse transcriptase and random hexamers followed by second strand synthesis with dna polymerase i and escherichia coli rnase h. after the second strand synthesis, with end repair and a - tailing, the synthesized double - stranded cdna fragments were subjected to purification, ligated to illumina adapters using quick ligation tm kit (neb) and dna ligase . The resultant cdna adapter - modified cdna libraries were fractionated on agarose gel, 200-bp fragments were excised and amplified by 15 cycles of polymerase chain reaction . After purification the quality of cdna libraries was checked by bioanalyzer 2100 (agilent). The concentration of the cdna libraries was measured and diluted to 10 nm in tris cluster formation, primer hybridization and sequencing reactions were performed sequentially according to the manufacturer's recommended protocol . In the present study, we used pair - end sequencing by illumina hiseqtm 2000 (illumina, san diego, ca, usa). High - quality reads were aligned to the human reference genome with soapaligner / soap2 . The expression level for each gene was normalized to reads per kilobase per million mapped reads (rpkm) to facilitate the comparison of transcripts among samples . A mean log2 ratio [rpkm of monocytes co - cultured with mda - mb-231 or t47d cells / monocytes cultured alone; rpkm of mda - mb231 or t47d cells co - cultured with monocytes / mda - mb231 or t47d cells cultured alone] of each gene was calculated . To identify genes differentially expressed between groups we used an algorithm based on ref . With a correction for false positive (type i) and false negative (type ii) errors using the fdr method . Further, genes were classified as up regulated when their mean log2 ratio was larger than 0.5 or down regulated when their log2 ratio was less than 0.5 . Peripheral blood monocytes were isolated from three buffy coats (blutspende zrich, zurich, switzerland) by density gradient centrifugation (ficoll - paque plus (ge healthcare)) and enriched for co - culture assays using human monocyte isolation kit ii (macs, miltenyi biotech). The breast cancer cell lines mda - mb-231 and t47d cells (kindly provided by dr . Nancy e. hynes, fmi, basel, switzerland) were maintained in dmem (gibco) supplemented with 10% fetal bovine serum (sigma) and penicillin / streptomycin . The breast cancer cell lines were plated 1 10 cells in the lower compartment of 75 mm polycarbonate transwell inserts pore size 0.4 m (corning) in maintenance medium one day prior monocyte isolation . The next day the medium was replaced by rpmi (gibco) on hour before the addition of 4 10 monocytes into the upper compartment of the transwell inserts . The cells were co - cultured for five days in a humidified chamber at 37 c . Control wells contained either cancer cells only in the lower compartment with rpmi in the upper compartment or rpmi in the lower compartment with only monocytes in the upper compartment . The total rna from 17 samples was isolated using the trizol protocol (invitrogen). See table 1 for sample identity . The rna quantity was determined by nanodrop spectrophotometer and quality assessed on the agilent 2100 bioanalyzer (agilent) using an rna 6000 nano chip . Two samples, donor2 monocytes cultured as single culture (m2c) and with t47d co - culture (m2 t) did not reach sufficient amount of rna and were excluded from further processing . At this point the samples were sent to bgi china where they were processed according to bgi's standard rna - seq sample preparation . Shortly, magnetic beads with oligo (dt) were used to isolate mrna, which was mixed with the fragmentation buffer to fragment it into short fragments . The cleaved rna fragments were synthesized into single - strand cdna using superscript ii reverse transcriptase and random hexamers followed by second strand synthesis with dna polymerase i and escherichia coli rnase h. after the second strand synthesis, with end repair and a - tailing, the synthesized double - stranded cdna fragments were subjected to purification, ligated to illumina adapters using quick ligation tm kit (neb) and dna ligase . The resultant cdna adapter - modified cdna libraries were fractionated on agarose gel, 200-bp fragments were excised and amplified by 15 cycles of polymerase chain reaction . After purification the quality of cdna libraries was checked by bioanalyzer 2100 (agilent). The concentration of the cdna libraries was measured and diluted to 10 nm in tris cluster formation, primer hybridization and sequencing reactions were performed sequentially according to the manufacturer's recommended protocol . In the present study, we used pair - end sequencing by illumina hiseqtm 2000 (illumina, san diego, ca, usa). High - quality reads were aligned to the human reference genome with soapaligner / soap2 . The expression level for each gene was normalized to reads per kilobase per million mapped reads (rpkm) to facilitate the comparison of transcripts among samples . A mean log2 ratio [rpkm of monocytes co - cultured with mda - mb-231 or t47d cells / monocytes cultured alone; rpkm of mda - mb231 or t47d cells co - cultured with monocytes / mda - mb231 or t47d cells cultured alone] of each gene was calculated . To identify genes differentially expressed between groups we used an algorithm based on ref . With a correction for false positive (type i) and false negative (type ii) errors using the fdr method further, genes were classified as up regulated when their mean log2 ratio was larger than 0.5 or down regulated when their log2 ratio was less than 0.5 . We describe here a dataset composed of rna - seq gene expression profiling of macrophage - cancer cell crosstalk using two different breast cancer cell lines with distinct aggressive phenotype . With this data we could show that macrophage response to different cancer cells does not necessarily promote a tumor - supporting inflammatory response since a pro - inflammatory gene signature was activated in macrophages co - cultured with estrogen positive breast cancer cells.
|
The genus pseudoalteromonas was described by gauthier et al . And represents a clade of marine bacteria defined on the basis of 16s rrna gene sequence data . Originally many of the pseudoalteromonas species that are discussed in this review were members of the genus alteromonas [5, 77] but alteromonas was taxonomically re - organized based on phylogenetic analysis . Since 1995, 22 additional pseudoalteromonas species have been described (details available at http://www.bacterio.cict.fr/p/pseudoalteromonas.html). More recently two pseudoalteromonas species have been moved into the genus algicola [50, 74]. 2000/2001) are covered in the 2 edition of bergey s manual of systematic bacteriology . Possessing gram - negative cell walls, all members of genus pseudoalteromonas require na ions, form rod - shaped cells, are motile via sheathed polar and/or unsheathed lateral flagella and possess a strictly aerobic, chemoheterotrophic metabolism . Alteromonad that could be potentially used to now describe other marine genera within class gammaproteobacteria . Genus pseudoalteromonas groups within a larger clade of marine taxa, located under the umbrella of order alteromonadales that inhabit all known non - geothermal marine biomes . One interesting feature of pseudoalteromonas is that the genus can be divided relatively cleanly into pigmented and non - pigmented species clades (fig . The non - pigmented species form a relatively distinct clade typified by phylogenetic shallowness between most member species . Pigmented species show greater sequence divergence and are concentrated within the other 2 major clades making up the genus (fig . 1). With more than 2000 pseudoalteromonas 16s rrna gene sequences available on nucleotide sequence databases (e.g. Www.ncbi.nlm.nih.gov) studies by holmstrm et al . Found deeply pigmented strains within a marine bacterial isolate collection were effective in the inhibition of the settlement of various fouling invertebrates and algae . Based on subsequent analyses some of these isolates lead to the general conclusion that pigmented pseudoalteromonas species possess a broad range of bioactivity associated with the secretion of extracellular compounds, several of which include pigment compounds . This realization provided greater credence to earlier studies of alteromonads that this group of marine bacteria represents a rich source of biologically active substances . Non - pigmented species of pseudoalteromonas do not appear to share the same extensiveness of bioactive compound synthesis and this may reflect their econiche distribution, which is admittedly still poorly defined . Within the limits of existing knowledge non - pigmented clade species tend to possess unusual and diverse enzymatic activities (carrageenases, chitinases, alginases, cold - active enzymes), generally broader environmental tolerance ranges (temperature, water activity and ph) and substantially greater nutritional versatility compared to the pigmented species . The pigmented species also tend to have more exacting growth requirements (some require amino acids) and have peroxidase activity rather than catalase activity . Marine biofilms influence the settlement of a variety of marine invertebrates and algae and may promote cellular metamorphosis . As biofilms can be quite variable in distribution and in species and chemical composition the influence they can have is complex . The activity of marine flora and fauna have been shown to be clearly positively or negatively influenced by experimental monospecific biofilms [17, 82, 98]. This activity is believed to be due mainly to the production of antibiotic compounds as well as stimulatory chemical cues that are so far mostly uncharacterized . Several known pseudoalteromonas species and likely many other described and undescribed bacterial species can influence the reproductive success of various marine fauna and flora due to the production of natural anti - fouling substances (table 1). A survey by holmstrm et al . Found that the effectiveness of different pseudoalteromonas species to prevent settlement of fouling invertebrate larvae and algal spores varies considerably (figure 2). It was generally observed that algal dwelling species were particularly effective in preventing biofouling suggesting the ability is important for their survival in the marine ecosystem and likely required for effective colonization of various surfaces, especially the surfaces of macroalgal species . P. luteoviolacea, p. aurantia; p. citrea [31, 79], p. tunicata, and p. ulvae [2022, 45] are of particular interest as the host of compounds these species form are essentially produced to prevent biofilm residents becoming overwhelmed by other colonizing, potentially fouling species [26, 38]. Species resistant to natural antibiotics have an advantage in colonization though presumably due to the array of compounds that may be formed no one species is likely to have such an edge that they always become numerically dominant in a given econiche . The result could be that antibiotic - producing strains and development of synergisms within biofilm communities may actually encourage the formation of multi - species biofilms . This protects the biofilm community from being overgrown by a single species as well as reducing invasion by other species . The complex community formed has the advantage in that there is an inherent increase in the efficiency of nutrient acquisition, enhanced tolerance to toxic compounds and physicochemical stresses, and presumably excellent opportunities for genetic exchange . Ironically, pseudoalteromonas species are highly effective biofilm formers and thus may potentially cause biofouling issues, however it is still unknown whether their presence controls the type and accumulation level of biofouling species beyond specific habitats such as the surface of marine algal species . Quorum - sensing mechanisms may play an important role in the influencing settlement and subsequent biofilm formation [19, 46] though it is unknown to what extent quorum sensing molecules influence antibiotic production . Pseudoalteromonas species have been found to inhibit the settlement, germination, growth or even directly lyse the cells of various algal species . Thus the interactions pseudoalteromonas strains are involved is intricate dictated by the type of ecosystem involved (planktonic, benthic, surficial etc . ), physiological state populations of the species involved, and prevailing environmental chemical parameters . At this point in time specific aspects of these ecological networks remain largely unexplored . To make the ecological connections even more manifestly complex strains of pseudoalteromonas have also been shown to have promotive affects on various marine eukaryotes in regards to their potential reproductive success . An example of an inhibitory - oriented interaction involves unidentified strains of pseudoalteromonas [18, 62] that were found to inhibit the growth but not kill various diatom species due to production of antibiotic compounds . One of these compounds was identified as 2-heptyl-4-quinolinol (fig 6i) that have been found to possess antibacterial activity . 4 produced unknown substances that impeded the motility and surface attachment of a navicula sp . And this ability could be blocked by enhancing lectin formation by the diatoms leading to stronger biofilm attachment . A further different example involves strain y, closely related to pseudoalteromonas piscicida, which produces unidentified brominated antibiotic compounds as well as an unknown low molecular weight compound that can completely lyse algal cells within a matter of hours [64, 92, 93]. This more aggressive activity was found to be pronounced on bloom - forming toxin - producing dinoflagellates of the genera gymnodinium, chatonella and heterosigma species, however only ecdysis was observed for alexandrium species while diatom and other algal species tested were effectively immune . It was also observed that cells were attracted in a swarm to lysed cells providing the concept that the compound production is used as a means to generate nutrients in a predatory - like manner . Subsequently it was determined that production of the unknown algicidal factor was triggered by an autoinducer quorum sensing system, possibly an ai-2-type peptide and that it is likely that algicidal activity is maximal during the peak of algal blooms and may thus contribute to bloom dissolution . Pseudoalteromonas clearly also positively interacts with higher eukaryotes inducing invertebrate larval settlement and subsequent metamorphosis . P. espejiana was observed to induce the settlement and metamorphosis of the hydrozoan hydractinia echinata possibly due to induction of caspases, suggesting pseudoalteromonas strains may have apoptosis - inducing effects in some marine eukaryotes . Pseudoalteromonas sp . A3, interestingly closely related to p. piscicida, isolated from the crustose coralline algae hydrolithon onkodes clearly encouraged coral larvae settlement and subsequently induced metamorphosis in the planula of the coral acropora . The presumed chemical cue for this induction has not yet been discovered, however methanolic extracts of a3 cultures provided induction that was highly variable . A further example includes an extensive survey of marine bacterial isolates from coralline algae and larvae, from which 12 of 17 pseudoalteromonas strains were found to be effective in inducing the larval settlement of the sea urchin heliocidaris erythrogramma . It was also observed that the larvae metamorphosed in higher numbers on biofilms consisting of p. luteoviolacea a species known to produce several antibiotic and bioactive compounds . Huang et al . Demonstrated that biofilms strongly promoted the settlement of hydroides elegans larvae suggesting that when in the biofilm state chemical cues are actively formed . The direct detection of antibiotic compounds formed from artificial laboratory biofilms has been challenging possibly due to lack of replicability of natural biofilms as well as due to the variable abundance of antibiotic - producing taxa . These examples suggest that chemical substance production may help various pseudoalteromonas species compete in quite different situations . The advantages derived could include increased access to space for growth or for nutrient access and potentially can occur in marine biofilms or planktonically . It is not clear how significant or prevalent these interactions are for planktonic and benthic sediment associated cells or for cells ensconced in sinking marine aggregates . Mechanistically the processes involved are also poorly understood and how these activities contribute to larger networks of ecological interactions . Thus the questions that involve pseudoalteromonas are manifold . Keeping with the theme of antibiotics, a popular subject in microbiology, the significance of cell - to - cell proximity, dilution rate and inherent antibiotic resistance within natural settings in regards to natural antibiotics are still open questions . In marine biology a greater interest may exist on what are the different broadcasted chemical cues produced by bacteria, including pseudoalteromonas that may affect the development or growth of eukaryotes as well as other prokaryotes . Assuming chemical cues can be identified we still need know what they do exactly, why and how . The contribution of many different factors suggests that understanding the ecological ramifications and impact of natural bioactive compounds can only be approached at first by specific, controlled experiments focusing on model species, a necessary simplification that allows important specific ecologically to better conceived and tested . One such model species that has appeared within the last few years is p. tunicata, a species that possesses an unusually extensive capacity for inhibiting other types of microorganisms and larger eukaryotes and is the focus of the prof . Staffan kjelleberg research team at the university of new south wales, sydney, australia . P. tunicata possesses the highest and broadest range of anti - fouling activities observed to date and was first isolated from a tunicate off the coast of sweden and subsequently found to dwell on a number of marine species, especially macroalgae [20, 44]. Transposon mutagenesis analysis demonstrated the pigment production by the species is linked to this activity [22, 23] and includes both purple and yellow pigments that give p. tunicata a distinctly dark green - color . The purple pigments were found to prevent the settlement of invertebrate larvae (balanus amphrtite, hydroides elegans) and algal spores (ulva lactuca, polysiphonia sp .) (figure 2) but remains unidentified . The species p. ulvae, isolated from the surface of the seaweed ulva lactuca, was found to also inhibit the settlement of invertebrate larvae (balanus amphritite) and inhibit algal spore germination and settlement [20, 21]. The purple pigment formed by p. ulvae may be chemically similar to the compound(s) found in p. tunicata and other pseudoalteromonas species . The anti - fouling ability of p. tunicata is linked to its ability to produce a range of inhibitory substances (more details below) including a toxic antibiotic protein (alpp); a heat labile anti - algal substance; violet - colored polar compound(s) of <500 da; an antifungal yellow pigment compound as well as small molecules active against protists and diatoms (unpublished data). Wmpr, similar to the vibrio cholerae cholera toxin regulator toxr, was found to act as a response regulator activating several genes in p. tunicata including pigment and antifouling compound production, biofilm formation, type iv pili, some ubiquinone and amino acid synthetic genes, a putative fe complex tonb - type transporter and also a non - ribosomal peptide synthetase that possibly is involved in fe siderophore synthesis . The wild type strain survives iron starvation better than a wmpr mutant suggesting that the tendency of p. tunicata to colonize surfaces and produce antifoulants is controlled by nutrient related responses, perhaps acquisition of trace iron [23, 96]. P. tunicata appeared to be most effective in colonization when it had access to an exogenous carbon source associated with the colonization surface e.g. Cellobiose derived from degradation of the cellulose surface polymer of the macroalgal species . This may suggest the types and levels of nutrient available for growth may also drive colonization . Population estimates of antifouling species p. tunicata and p. ulvae, able to form toxic protein alpp, has been made by using real - time pcr targeting pseudoalteromonas - specific and p.tunicata/p.ulvae-specific 16s rrna genes as well as detection of the gene coding alpp . It was found that from various samples collected off the danish coast that pseudoalteromonas are abundant, especially in seawater (figure 4). P. tunicata and p. ulvae, however prefer colonization of various cellulose - producing algal species as suggested by the specific abundance of anti - fouling pseudoalteromonas spp, positive detection of the alpp gene (fig . Almost all of the antifouling species found were related to p. tunicata and p. ulvae but these only made up about 1% of the total pseudoalteromonas abundance . This may suggest that other species await isolation that could also have anti - fouling roles on the hosts sampled or the specific populations change over time as the biofilm matures . Based on the compiled data shown in figure 2 the variation in settlement inhibition assays is highly species - specific (and possibly strain - specific) and that marine macrophyta and marine fauna may play host to their own specific anti - fouling microorganisms . Antibiotic substances linked to the genus pseudoalteromonas go back to the very early days of marine natural product discovery . Over the years several pseudoalteromonas strains that have been investigated in this regard have been misidentified or misclassified as pseudomonas, chromobacterium, alteromonas etc . With the current rate of bacterial genus and species descriptions from marine samples, it is difficult if not impossible to be certain of genus identities (let alone species) from the limited taxonomic analyses applied in the times prior to routine sequence based bacterial identification . The information below is based on strains that on the basis of existing data can be attributed at a high level of confidence to the genus pseudoalteromonas . Early discoveries of marine - derived antibiotics included the identification of brominated pyrroles from purple - pigmented alteromonads . Several low weight antibacterial substances were obtained from p. luteoviolacea misclassified initially as chromobacterium marinum . These included 2,3,4,5-tetrabromopyrrole (figure 5a), 2,2,3,3,4,4-hexabromobipyrrole (figure 5b), 2,3,4-tribromo-5(2-hydroxy-3,5-dibromophenyl)pyrrole (also called pentabromopseudilin) (figure 5c), 2,4-dibromo-6-chlorophenol (figure 5d), 4-hydroxybenzaldehyde, and n - propyl-4-hydroxybenzoate [2, 11, 24, 32, 34, 37, 85, 86]. One or more of these substances also seem to also have activity against protists . The seawater species p. phenolica was also found to form a brominated biphenyl compound, 3,3,5,5-tetrabromo-2,2-diphenyldiol (figure 5e) that was inhibitory to methicillin resistant staphylococcus aureus strains . The yellow pigment of p. tunicata has anti - fungal activity and was identified as a tambjamine - like alkaloid, designated yp1 (figure 6a). Tambjamines are 4-methoxypyrrole - containing bioactive compounds previously isolated from marine invertebrates and possess antimicrobial, anti - tumorigenic, immunosuppressive, anti - proliferation and ichthyodeterrent activities and are likely produced as natural defensive compounds against predators . Most evidence points to bacteria, colonizing the surface of higher organisms, as the source of these compounds . Indeed, the biosynthetic pathway for yp1 was elucidated in p. tunicata by burke et al . And is coded by a cluster of 19 genes (tama to tams) that code proteins with homology to prodigiosin biosynthetic genes in various other bacteria, including the formation of a bipyrrole precursor, 4-methoxybipyrrole-5-carbaldehyde (mpc) from proline, malonyl - coa and serine . Yp1 is formed by condensation of mpc with dodec-3-en-1-amine . A related compound to yp1 acts as an ionophore . The bright red pigments of p. denitrificans and p. rubra identified as cycloprodigiosin hcl (figure 6f) [36, 56] also acts as an ionophore blocking proton / chloride ion symporters but have been shown to generally uncouple proton translocation . It has significant potential pharmaceutical impact able to suppress immunoproliferation, has anti - malarial activity and is able to induce apoptosis in several cancer cell lines [13, 80]. In synergy with other drugs substituted phenylalkenoic acids referred to as rubrenoic acids (figure 6e) have also been purified from p. rubra and shown to have bronchodilatatoric activity . The species p. tetraodonis (as well as a number of other bacterial species), isolated from the skin slime of the puffer fish fugu poecilonorus, was shown to form the notorious tetrodotoxin (figure 6j) [27, 91], which is an exceptionally potent blocker of voltage - gated, na ion membrane channels . Production of tetrodotoxin by p. tetraodonis was dramatically stimulated under phosphate - limiting growth conditions . Korormycin (figure 6 g), produced by an unidentified pseudoalteromonas sp ., is a heptylated hydroxyquinonolone that has antibiotic activity against various marine bacteria, especially vibrio spp . It was found to strongly inhibit the respiratory chain - linked na - ion translocating nadh - quinone reductase of vibrio alginolyticus . Butanol extracts of the algal associated species p. issachenkonii cultures were found to inhibit candida albicans and cause hemolysis . Analysis of ethyl acetate extracts revealed that isatin (indole-2,3-dione) (figure 6d) was responsible for the anti - fungal activity . A red - brown haemolytic pigment of 269 da and corresponding to c9h7n3os3 was also discovered and still awaits complete structural analysis . A possibly misidentified pseudoalteromonas species designated alteromonas sp . P7, isolated from the larva of penaeus monodon was found to be vibriostatic with the antibacterial substance recovered in ethyl acetate but not the culture supernatant suggesting the compound may also be a substituted aromatic compound . A potentially misclassified pigmented pseudoalteromonas - like species called alteromonas rava was found to form a substituted 6-amino-4h - dithiolo[4,3-b]pyrrol-5-one called thiomarinol a (figure 6h). Various thiomarinol derivatives have been also synthesized that exhibit potent antibacterial activity [89, 90]. The yellow - pigmented species p. piscicida has been described as being able to produce a neuromuscular toxin able to kill a variety of fish and crab species [7, 39, 72], however no recent studies have re - examined or confirmed this property and the toxin compound has never been detected . P. maricaloris, a close relative of p. piscicida isolated from the coral sea sponge fascaplysinopsis reticulata, forms yellow colored dibromo- and bromo - alterochomides (figure 5f) that possess antimicrobial activity and as well as cytotoxicity against the larvae of a sea urchin . The algicidal strain y, also closely related to p. piscicida, forms broad spectrum antimicrobial yellow brominated substances that lc - ms analysis revealed to comprise 12 different but likely structurally similar compounds . Nmr spectral analysis revealed the presence of bromine, aromatic rings, hydroxyl and carbonyl groups . These still so far unidentified substances may also represent other cyclic or acyclic depsipeptide brominated compounds and may be relevant to the observation of other low molecular weight peptide like substances potentially contributing to anti - fouling activity . A variety of diketopiperazines (dkp) are produced by an antarctic pseudoalteromonas haloplanktis isolate including a novel compound, cyclo-(d - pipecolinyl - l - isoleucine) (figure 6c). Another novel dkp, cyclo-(l - phenylalanyl-4r - hydroxyl - l - proline) (figure 6b) is produced by p. luteoviolacea that exhibited antibacterial activity . The continued examination of peptide like pigment and non - pigment substances from pseudoalteromonas appears to be necessary as these compounds seem to have a potentially important impact in biological interactions . Several pseudoalteromonas species have been found to secrete proteins and other soluble high molecular weight substances with antibacterial activities that are also autotoxic in nature . This included a 100 kda protein produced by p. luteoviolacea, which was likely also observed in the study of kamei et al . . The synthesis of this protein appeared to be induced during late exponential to stationary growth . P. rubra was found to form a strongly anthrone - reactive polyanionic substance, possibly a glycoprotein or polysaccharide, which had antibacterial activity, especially to species that did not naturally possess catalase activity . Subsequently it was found that growth inhibition by the antibiotic was due to induction of oxidative stress in target cells through increased o2 uptake and accumulation of hydrogen peroxide [29, 30]. An alteromonad, designated ncimb 2144, was found to produce an autotoxic, antibacterial 90 kda thermolabile glycoprotein that could be analogous to that found in p. rubra . This protein was found to inhibit a wide range of marine and medically significant bacteria but is particularly potent against strain d2 itself (mic 4 g ml). The autoxicity of alpp appears to provide a dispersal mechanism to biofilm dwelling p. tunicata, working through a process akin to programmed cell death . The alpp - autolysis of cells within biofilm substructures seems to provide nutrients for a subpopulation of cells resistant to alpp with the lysis causing sections of the biofilm to also detach . Survivor cells are actively motile and presumably are dispersed in the water flow and thus can recolonize new surfaces [69, 70]. Observations in other bacteria suggest dispersal mechanisms analogous to this could be relatively common amongst biofilm forming species . An isolate related to p. piscicida, designated x153 has been proposed as an effective probiont, protecting commercial shellfish species from pathogenic vibrio species . X153 was shown to produce a, unstable tetrameric 280 kda vibriostatic protein that also appeared to have broad spectrum inhibitory activity against marine bacteria . P. haloplanktis and p. undina strains have also been found to provide probiotic benefits [66, 84] though it is unknown if antibiotic factors are involved . Some species of pseudoalteromonas have been rarely implicated as opportunistic pathogens of marine animals including fish and crustacea [14, 76, 81]. This pathogenicity may relate to lipopolysaccharide and other heat labile factors and other virulence determinants such as hemolysins and thrombolysins . The structure of o - specific polysaccharides has been determined for a number of pseudoalteromonas species, which are notable in being acidic and containing a variety of substituted sugar and non - sugar subunits . It is unknown if these substances have antibiotic or cytotoxic properties in the marine environment . Early discoveries of marine - derived antibiotics included the identification of brominated pyrroles from purple - pigmented alteromonads . Several low weight antibacterial substances were obtained from p. luteoviolacea misclassified initially as chromobacterium marinum . These included 2,3,4,5-tetrabromopyrrole (figure 5a), 2,2,3,3,4,4-hexabromobipyrrole (figure 5b), 2,3,4-tribromo-5(2-hydroxy-3,5-dibromophenyl)pyrrole (also called pentabromopseudilin) (figure 5c), 2,4-dibromo-6-chlorophenol (figure 5d), 4-hydroxybenzaldehyde, and n - propyl-4-hydroxybenzoate [2, 11, 24, 32, 34, 37, 85, 86]. One or more of these substances also seem to also have activity against protists . The seawater species p. phenolica was also found to form a brominated biphenyl compound, 3,3,5,5-tetrabromo-2,2-diphenyldiol (figure 5e) that was inhibitory to methicillin resistant staphylococcus aureus strains . The yellow pigment of p. tunicata has anti - fungal activity and was identified as a tambjamine - like alkaloid, designated yp1 (figure 6a). Tambjamines are 4-methoxypyrrole - containing bioactive compounds previously isolated from marine invertebrates and possess antimicrobial, anti - tumorigenic, immunosuppressive, anti - proliferation and ichthyodeterrent activities and are likely produced as natural defensive compounds against predators . Most evidence points to bacteria, colonizing the surface of higher organisms, as the source of these compounds . Indeed, the biosynthetic pathway for yp1 was elucidated in p. tunicata by burke et al . And is coded by a cluster of 19 genes (tama to tams) that code proteins with homology to prodigiosin biosynthetic genes in various other bacteria, including the formation of a bipyrrole precursor, 4-methoxybipyrrole-5-carbaldehyde (mpc) from proline, malonyl - coa and serine . Yp1 is formed by condensation of mpc with dodec-3-en-1-amine . A related compound to yp1 acts as an ionophore . The bright red pigments of p. denitrificans and p. rubra identified as cycloprodigiosin hcl (figure 6f) [36, 56] also acts as an ionophore blocking proton / chloride ion symporters but have been shown to generally uncouple proton translocation . It has significant potential pharmaceutical impact able to suppress immunoproliferation, has anti - malarial activity and is able to induce apoptosis in several cancer cell lines [13, 80]. In synergy with other drugs substituted phenylalkenoic acids referred to as rubrenoic acids (figure 6e) have also been purified from p. rubra and shown to have bronchodilatatoric activity . The species p. tetraodonis (as well as a number of other bacterial species), isolated from the skin slime of the puffer fish fugu poecilonorus, was shown to form the notorious tetrodotoxin (figure 6j) [27, 91], which is an exceptionally potent blocker of voltage - gated, na ion membrane channels . Production of tetrodotoxin by p. tetraodonis was dramatically stimulated under phosphate - limiting growth conditions . Korormycin (figure 6 g), produced by an unidentified pseudoalteromonas sp ., is a heptylated hydroxyquinonolone that has antibiotic activity against various marine bacteria, especially vibrio spp . It was found to strongly inhibit the respiratory chain - linked na - ion translocating nadh - quinone reductase of vibrio alginolyticus . Butanol extracts of the algal associated species p. issachenkonii cultures were found to inhibit candida albicans and cause hemolysis . Analysis of ethyl acetate extracts revealed that isatin (indole-2,3-dione) (figure 6d) was responsible for the anti - fungal activity . A red - brown haemolytic pigment of 269 da and corresponding to c9h7n3os3 was also discovered and still awaits complete structural analysis . A possibly misidentified pseudoalteromonas species designated alteromonas sp . P7, isolated from the larva of penaeus monodon was found to be vibriostatic with the antibacterial substance recovered in ethyl acetate but not the culture supernatant suggesting the compound may also be a substituted aromatic compound . A potentially misclassified pigmented pseudoalteromonas - like species called alteromonas rava was found to form a substituted 6-amino-4h - dithiolo[4,3-b]pyrrol-5-one called thiomarinol a (figure 6h). Various thiomarinol derivatives have been also synthesized that exhibit potent antibacterial activity [89, 90]. The yellow - pigmented species p. piscicida has been described as being able to produce a neuromuscular toxin able to kill a variety of fish and crab species [7, 39, 72], however no recent studies have re - examined or confirmed this property and the toxin compound has never been detected . P. maricaloris, a close relative of p. piscicida isolated from the coral sea sponge fascaplysinopsis reticulata, forms yellow colored dibromo- and bromo - alterochomides (figure 5f) that possess antimicrobial activity and as well as cytotoxicity against the larvae of a sea urchin . The algicidal strain y, also closely related to p. piscicida, forms broad spectrum antimicrobial yellow brominated substances that lc - ms analysis revealed to comprise 12 different but likely structurally similar compounds . Nmr spectral analysis revealed the presence of bromine, aromatic rings, hydroxyl and carbonyl groups . These still so far unidentified substances may also represent other cyclic or acyclic depsipeptide brominated compounds and may be relevant to the observation of other low molecular weight peptide like substances potentially contributing to anti - fouling activity . A variety of diketopiperazines (dkp) are produced by an antarctic pseudoalteromonas haloplanktis isolate including a novel compound, cyclo-(d - pipecolinyl - l - isoleucine) (figure 6c). Another novel dkp, cyclo-(l - phenylalanyl-4r - hydroxyl - l - proline) (figure 6b) is produced by p. luteoviolacea that exhibited antibacterial activity . The continued examination of peptide like pigment and non - pigment substances from pseudoalteromonas appears to be necessary as these compounds seem to have a potentially important impact in biological interactions . Several pseudoalteromonas species have been found to secrete proteins and other soluble high molecular weight substances with antibacterial activities that are also autotoxic in nature . This included a 100 kda protein produced by p. luteoviolacea, which was likely also observed in the study of kamei et al . . The synthesis of this protein appeared to be induced during late exponential to stationary growth . P. rubra was found to form a strongly anthrone - reactive polyanionic substance, possibly a glycoprotein or polysaccharide, which had antibacterial activity, especially to species that did not naturally possess catalase activity . Subsequently it was found that growth inhibition by the antibiotic was due to induction of oxidative stress in target cells through increased o2 uptake and accumulation of hydrogen peroxide [29, 30]. An alteromonad, designated ncimb 2144, was found to produce an autotoxic, antibacterial 90 kda thermolabile glycoprotein that could be analogous to that found in p. rubra . This protein was found to inhibit a wide range of marine and medically significant bacteria but is particularly potent against strain d2 itself (mic 4 g ml). The autoxicity of alpp appears to provide a dispersal mechanism to biofilm dwelling p. tunicata, working through a process akin to programmed cell death . The alpp - autolysis of cells within biofilm substructures seems to provide nutrients for a subpopulation of cells resistant to alpp with the lysis causing sections of the biofilm to also detach . Survivor cells are actively motile and presumably are dispersed in the water flow and thus can recolonize new surfaces [69, 70]. Observations in other bacteria suggest dispersal mechanisms analogous to this could be relatively common amongst biofilm forming species . An isolate related to p. piscicida, designated x153 has been proposed as an effective probiont, protecting commercial shellfish species from pathogenic vibrio species . X153 was shown to produce a, unstable tetrameric 280 kda vibriostatic protein that also appeared to have broad spectrum inhibitory activity against marine bacteria . Undina strains have also been found to provide probiotic benefits [66, 84] though it is unknown if antibiotic factors are involved . Some species of pseudoalteromonas have been rarely implicated as opportunistic pathogens of marine animals including fish and crustacea [14, 76, 81]. This pathogenicity may relate to lipopolysaccharide and other heat labile factors and other virulence determinants such as hemolysins and thrombolysins . The structure of o - specific polysaccharides has been determined for a number of pseudoalteromonas species, which are notable in being acidic and containing a variety of substituted sugar and non - sugar subunits . It is unknown if these substances have antibiotic or cytotoxic properties in the marine environment . Pseudoalteromonas though it appears to be only one of many marine bacterial genera (either cultured or uncultured) clearly has been shown to possess ecologically- and pharmaceutically - relevant features that are both unusual and intriguing . Greater understanding of the activities of this genus in the marine ecosystem would represent a boon to microbial and marine ecology . More knowledge of the biologically active chemicals formed by pseudoalteromonas species would also be potentially pharmacologically beneficial . Such research could be performed from a marine biology point of view in order determine the relationships of pseudoalteromonas to the reproductive success of many invertebrates and algal species . Detection and identification of new chemical cues could be valuable in understanding the interactive ecology of marine fauna and their associated microbiota . Negri and colleagues proposed there is a possibility that broadcast chemical producing bacteria like pseudoalteromonas sp . A3 could be used as a means to re - seed reefs with coral species owing to its positive effects on coral larvae settlement and metamorphosis . It is unknown if any of these undiscovered compounds would have pharmaceutical benefit too or would have other applications . In that respect several broad spectrum antibiotic compounds including pentabromopseudilin, korormycin, thiomarinol a, bromo - alterochromides a and b, tambjamine yp1 etc . Various strains also form compounds with intriguing pharmaceutical properties such as the red pigment cycloprodigiosine hcl . Since these substances have been derived from only a small subset of strains the potential pool of natural product diversity possessed by genus pseudoalteromonas is likely mostly unrealized . Proteases from various strains of pseudoalteromonas, in particular from a strain of p. issachenkonii were recently found to be effective in reducing biofouling by the bryozoan bugula neritina . The innovative practical application of small and large antibiotic compounds as well as proteinaceous enzymatic substances to combat marine biofouling is progressing through the use of paints and gel - encapsulation [19, 102]. Thus the extensive enzymatic ability of various pseudoalteromonas (as suggested for some species in table 1) is also worth noting as this generally unexplored facet can be potentially useful in a practical sense to combat biofouling as well as an ecologically relevant feature.
|
Abelson murine leukemia viral oncogene large tumor suppressor runt - related transcription factor peroxisome proliferator - activator receptor gamma 2 transcriptional enhancer activator domain yes - associated protein based on a number of criteria, certain genes are categorized as oncogenes whereas the genes that oppose their function are regarded as tumor suppressors . This categorization is of enormous value in investigating the molecular basis of cell fate determination . By and large, these genes are components or targets of cellular signaling pathways that transmit bimodal on and off instructions . The extent to which this perception is correct forms the basis of our recent study . We investigated the crosstalk between the dna damage response pathway and the hippo pathway and revealed that a proto - oncoprotein switched to behave as a tumor suppressor . Our finding therefore violates the on / off instruction rules by including a third option of opposing antipodal switching . The transcriptional coactivator yes - associated protein (yap) enters the nucleus by default to target specific genes . Yap has been implicated as an oncogene in conjunction with the transcriptional enhancer activator domain (tead) family of transcription factors in human cancers, where it activates proproliferative and antiapoptotic target genes . The activity of yap is blunted by blocking its nuclear entry through the hippo pathway, which is important in regulating cell contact inhibition, organ size control, and cancer development . Under conditions of cell cell contact, upstream elements of the hippo pathway transmit signals through the kinase large tumor suppressor (lats), which phosphorylates yap on serine residues resulting in yap cytoplasmic sequestration, downregulation of its nuclear target genes, and compromised oncogenic potential . A twist was introduced into this coherent picture when it was recognized that yap is also a coactivator of proapoptotic genes . In response to dna damage, yap targets p73, a member of the tumor suppressor p53 family, to induce proapoptotic gene expression and initiate a cellular death axis . The non - receptor tyrosine kinase abelson murine leukemia viral oncogene (c - abl) is activated under conditions of dna damage and phosphorylates tyrosine residues on both p73 and yap . Tyrosine phosphorylated yap promotes the death axis at 2 levels: by enhancing the p73-mediated death axis and by supporting p73 accumulation . Moreover, when coactivating the runt - related transcription factor (runx), yap regulates the expression of itch, the p73 e3 ligase . Upon tyrosine phosphorylation by c - abl, c - abl thus switches yap behavior from activating the e3 ligase that induces p73 degradation to coactivating the accumulated p73 . This regulatory module exemplifies the capacity of c - abl to switch yap behavior to promote the opposing function . A similar behavior was discovered at the level of targeting the tead transcription factor . The nuclear yap tead complex controls the survival axis by inducing transcription of a set of genes involved in 2 major activities: supporting cell proliferation on one hand and inhibiting apoptosis on the other hand . These two yap - regulated activities give rise to a net increase in the cell population . However, when c - abl is activated in response to dna damage, the tyrosine - phosphorylated yap still binds tead but is unable to induce the survival axis . Thus, as modified yap also induces the death axis via p73, activated c - abl switches yap from being an oncogene to becoming a tumor suppressor (fig . These findings exemplify a newly emerging principle in signaling: not only turning on and off, but also dictating an opposing function . 1.yap is switched from oncogene to tumor suppressor function through phosphorylation by c - abl . (a) when the hippo pathway is inactive, as in proliferating cells, yes - associated protein (yap) coactivates the transcriptional enhancer activator domain (tead) transcription factor to express survival genes involved in the suppression of apoptosis . (b) under dna damage conditions, abelson murine leukemia viral oncogene (c - abl) is activated and phosphorylates p73 and yap . These modifications lead to yap - p73 induced transcription of proapoptotic genes and activation of a death axis . Simultaneously, phosphorylation of yap by c - abl inhibits its potential to coactivate tead, resulting in blunting of the expression of antiapoptotic genes and promotion of apoptosis . Yap is switched from oncogene to tumor suppressor function through phosphorylation by c - abl . (a) when the hippo pathway is inactive, as in proliferating cells, yes - associated protein (yap) coactivates the transcriptional enhancer activator domain (tead) transcription factor to express survival genes involved in the suppression of apoptosis . (b) under dna damage conditions, abelson murine leukemia viral oncogene (c - abl) is activated and phosphorylates p73 and yap . These modifications lead to yap - p73 induced transcription of proapoptotic genes and activation of a death axis . Simultaneously, phosphorylation of yap by c - abl inhibits its potential to coactivate tead, resulting in blunting of the expression of antiapoptotic genes and promotion of apoptosis . At first it may appear odd that a cell would use the same protein as an oncogene and as a tumor suppressor . What could be the advantage of one effector controlling 2 opposing tasks? Recent studies revealed that il-2 exhibits paradoxical behavior in the determination of t - cell homeostasis . By applying a mathematical model, it was demonstrated that a single secreted molecule makes the homeostasis more robust against perturbations . In our system the hippo pathway turns yap effector activity on and off whereas the dna damage response switches yap activity to the opposing task . Knows what to do when receiving 2 schizophrenic instructions . We hypothesized that one instruction must be dominant over the other . We found that when the hippo pathway is active, namely under cell cell contact conditions, the dna damage response is inactivated . This is accomplished by a double lock mechanism; on one hand the hippo kinase lats neutralizes yap via its sequestration in the cytoplasm, while on the other hand it inhibits c - abl kinase activity . The next question is why the hippo pathway is dominant over the dna damage response . The hippo pathway is functional at the level of on / off in a reversible manner . Yap enters and exits the nucleus based on received instructions and does not reach a fixed irreversible status . In contrast, c - abl is involved in irreversible nuclear processes, such as inducing the death axis activity of yap . Recently, we found that c - abl promotes adipocyte differentiation, another irreversible process, by phosphorylation of the key adipogenic transcription factor peroxisome proliferator - activator receptor gamma 2 (ppar2) and its subsequent stabilization and activation . It is therefore somewhat intuitive that the reversible processes would be dominant over the irreversible ones . In summary, we attribute signaling to not only the capacity to turn downstream effectors on and off, but also the ability to impose an opposing task on a given effector . The interplay between the hippo pathway and the dna damage response nicely exemplifies this principle . In addition, we think that this model is important to reach rapid homeostasis, provided that the involved pathways are hierarchically designed . 551/11), and from the minerva foundation with funding from the federal german ministry for education and research.
|
Extranodal lymphoma of mucosa - associated lymphoid tissue (malt) can occur throughout the body . While the gastrointestinal tract is the most common site of involvement, research over the past several decades has shown that cancers such as lymphomas are a genetic disease and that particular genetic mutations can lead to a syndrome of different cancer histologies . While many organs including the pancreas, the kidneys and the central nervous system can be involved in this cancer syndrome, no known association has been established between vhl and primary pulmonary cancers . Here, we describe the presentation and management of a woman with pulmonary malt lymphoma with a past medical history significant for vhl disease . An asymptomatic 61-year - old woman with no history of tobacco use presented to thoracic clinic with bilateral pulmonary ground glass opacities . She had a past medical history significant for vhl disease (type 2b exon iii mutation). Manifestations of her vhl syndrome included a pancreatic neuroendocrine tumor, bilateral pheochromocytomas, spinal hemangioblastomas and benign renal cystic lesions . Upon surveillance computed tomography (ct) imaging of the chest, a lesion in the right upper lobe became more solid - appearing (fig . 1a). Positron emission tomography (pet) imaging revealed that the lesion was also pet - avid with a maximum standardized uptake value (suv) of 7.7 (fig . 1b). Figure 1:(a) ct chest revealing right upper lobe solid lesion . (b) pet scan of the chest revealing pet - avid right upper lobe lesion . (b) pet scan of the chest revealing pet - avid right upper lobe lesion . A percutaneous biopsy was performed, but the cytology report was equivocal, demonstrating rare atypical cells in a background of blood and histiocytes . As this lesion was concerning for a primary lung cancer, a video - assisted thoracoscopic (vats) right upper lobectomy was performed in an effort to achieve a complete oncologic resection . The operation was carried out in the usual manner, including isolating and dividing the superior pulmonary vein, artery and bronchus with an endo - gastrointestinal anastomosis stapling device . Furthermore, a lymph node dissection, including specimens from stations 10r and 4r, was performed . The right upper lobe was 194 g and measured 12.5 11 3 cm . Within it, a 3 2.5 2.5 cm yellow tan mass consistent with the area of concern on imaging contained necrotic and hemorrhagic nodules . This was initially diagnosed as a reactive process; but because of the density of the lymphocytic infiltrate and the presence of a mass, molecular studies were performed . These tests revealed a clonal b - cell process consistent with a diagnosis of extranodal marginal zone lymphoma of the malt type . Figure 2:(a) station 10r lymph node with hematoxylin and eosin (h&e) stain under 20 magnification with many lymphocytes apparent . (b) station 10r lymph node with cd-20 staining revealing b cells within a reactive germinal center under 20 magnification . (c) station 10r lymph node with cd-3 staining demonstrating t cells surrounding a reactive germinal center under 20 magnification . Figure 3:right upper lobe lung mass under 20 magnification with staining for cd-20 and cd-3 showing a dense lymphoplasmacytic infiltrate mainly consisting of b cells (a) and fewer t cells (b). (a) station 10r lymph node with hematoxylin and eosin (h&e) stain under 20 magnification with many lymphocytes apparent . (b) station 10r lymph node with cd-20 staining revealing b cells within a reactive germinal center under 20 magnification . (c) station 10r lymph node with cd-3 staining demonstrating t cells surrounding a reactive germinal center under 20 magnification . Right upper lobe lung mass under 20 magnification with staining for cd-20 and cd-3 showing a dense lymphoplasmacytic infiltrate mainly consisting of b cells (a) and fewer t cells (b). She remained in the hospital for 9 days following her surgery secondary to a prolonged air leak, which subsided without intervention . Postoperatively, she will be monitored by both the thoracic surgery and thoracic oncology services for recurrence . Cancer genetic syndromes occur when a single genetic mutation leads to a spectrum of cancer histologies in the same patient . Vhl disease is an example of one such syndrome that is inherited in an autosomal dominant fashion and affects 1 per 35 000 people . Inactivation of the vhl tumor suppressor gene via genetic mutations can lead to the development of several different malignant and benign tumors including renal cell carcinoma, pancreatic neuroendocrine tumors, pheochromocytoma, retinal angiomas and spinal hemangioblastomas . Primary lung lymphoma (pll) is defined as biopsy - proven lymphoma in the lung without the evidence of extra - pulmonary involvement and accounts for <1% of all lung tumors . The most common of the plls is malt lymphoma, which is a low - grade b - cell lymphoma . The diagnosis of pulmonary malt lymphoma can be mistaken for a reactive process, so additional studies such as molecular analyses to identify clonal populations of lymphocytes may be necessary to confirm the diagnosis . Because of the rarity of the disease, there are no definitive treatment guidelines, but surgery has been shown to be beneficial in patients with localized disease . There is no known association between pulmonary malt lymphoma and vhl disease to date, but case reports have documented patients with vhl disease who developed other primary lung cancers including adenocarcinomas and carcinoids . Furthermore, loss of heterozygosity of the vhl gene region has been reported in up to 83% of non - small cell lung cancer specimens . However, given the limited number of reports, it is difficult to find a definitive association between vhl disease and primary lung cancers, including pulmonary malt lymphoma . To our knowledge, this is the first reported case of a patient with vhl disease who developed a pulmonary malt lymphoma . Whereas the initial pathology report suggested a reactive process, further analysis was consistent with this tumor pathology . Surgeons and physicians in general need to have a high index of suspicion when managing patients with vhl disease and other cancer genetic syndromes in general . Furthermore, increased awareness of these tumor types in patients with familial syndromes may help guide surgical intervention in the future, as a lobectomy may not be necessary, and a non - anatomic wedge resection may be adequate.
|
Self - expandable metal stents (sems) are uncommonly used for benign colonic disease because of their lack of removability and their high rate of migration . Histology had confirmed the presence of diverticular disease in the sigmoid colon along with inflammatory changes in the tubes, ovaries and part of the uterus, which was resected en - bloc . The patient subsequently underwent reversal of her hartmann s procedure with a de - functioning loop ileostomy . At a clinic review two months post hartmann s reversal, the patient complained of intermittent discharge from the lower end of her laparotomy wound associated with per - rectal intermittent discharge of mucous and blood . Contrast studies had revealed the presence of an anastomotic stricture complicated with a colo - cutaneous fistula (figure 1). Contrast study showing stricture and fistula tract after a discussion with the patient, taking in account her obesity, the agreed plan was to adopt a non - operative approach rather than surgery that may result in a permanent end - colostomy . Three months post hartmann s reversal a balloon dilatation was carried out successfully via flexible sigmoidoscopy as a joint procedure with a specialist radiologist . Four months post hartmann s reversal it was decided to repeat the dilatation then to insert a colonic stent along with percutaneous ethanol injection (pei) of the fistula . This was followed by injection of 20mls of absolute ethanol through the abdominal fistulous tract whilst, at the same time, normal saline was injected into the stent via a foley s catheter to dilute the alcohol within the lumen of the colon . A month later, contrast studies showed complete resolution of the anastomotic stricture and no evidence of colo - cutaneous fistula (figure 2). One year post hartmann s reversal, the patient remained asymptomatic and the fistula had resolved both clinically and radiologically . Follow - up contrast study a year post hartmann s reversal, patient was admitted for reversal of her loop ileostomy, which was performed without complications . The use of self - expanding metallic stents for benign colorectal diseases has been regarded previously as controversial (1,2). Only 3% of stents placed in 567 patients considered in a systematic review in (2002) were for benign disease, predominantly diverticular disease (3). There has been only a few reports of its use for closure of benign stulae in the colon (4). In our case the presence of a stricture with stulous tracts was an indication for the use of a covered stent for immediate stula closure . Covered sems have a high rate of migration as compared to uncovered sems (2,5). In addition, spontaneous migration of sems for benign strictures occurs frequently, usually within the rst month after insertion (6). Ethanol injection for successful ablation of digestive tract fistula has been mentioned in few case reports in the literature (7). To our knowledge, this is the rst case demonstrating sems combined with pei for benign postoperative stulae . Although longer follow up and future prospective studies are needed,
|
We constructed a decision tree cost - effectiveness model for a target population of 163,000 women who at the time of the intervention are sexually active with a male partner, fertile, not desiring pregnancy within the next 12 months, and not using permanent contraception methods (e.g., tubal ligation and vasectomy) (technical appendix table and figure 1). In the no intervention scenario, no changes in contraceptive use distributions from the status quo are expected to occur . In the intervention scenario, women in puerto rico are assumed to have same - day access to contraception methods, including larc, with no out - of - pocket costs . In addition, healthcare providers would be trained to provide client - centered contraceptive counseling and outreach so that women have the information they need to make an informed choice on the contraception method that is best for them . The model specifies contraceptive method use distribution, unintended pregnancy events, and the frequency of zam (technical appendix figure 1). We assumed an intervention in place throughout a year - long zika virus outbreak in puerto rico . We evaluated the costs and outcomes of increased access to contraception compared with no intervention (i.e., status quo). Output measures included numbers of zam cases prevented, including stillbirths, elective terminations, and live - born infants, and healthy life years (hly) gained . Economic benefits of the intervention included avoided costs from zam cases prevented and costs avoided for monitoring for zika virus exposed pregnancies and infants born from zika virus infected mothers . In addition, the avoided cost of prenatal, delivery, postpartum, and neonatal care associated with avoided unwanted pregnancies was considered an economic benefit . In cost - effectiveness analyses, if total avoided cost exceeds the cost of an intervention that improves health, the intervention is considered cost - saving . For scenarios with positive net costs, we reported the incremental cost - effectiveness ratio (icer), which is the net cost per hly gained in comparison to the status quo . Independent of zika virus exposed pregnancies and zam, unintended pregnancy is associated with adverse maternal and child health outcomes . Because roughly 60% of unintended pregnancies are classified as mistimed, which might result in a delayed rather than avoided pregnancy, with the same costs occurring later (7), we only estimated avoided medical costs from prevention of the 40% of unintended pregnancies presumed to be not desired at a later time irrespective of zika virus infection . We estimated the inputs for the decision - tree model and their sources (table 1). In the no intervention scenario, we took the distribution of women in the target population by use of different types of reversible contraceptives (or no use) from a 2002 survey administered in puerto rico and adjusted it to reflect the 36% decrease in fertility rates in puerto rico during 20022015 (8,23,24). * brfss, behavior risk surveillance system; cdc, centers for disease control and prevention; hly; healthy life years; iud, intrauterine device; larc, long - acting reversible contraceptive; nsfg, national survey of family growth; ondieh, office of noncommunicable diseases, injury and environmental health; zam, zika virus associated microcephaly . Authors calculation based on 2015 puerto rico total population size, 2015 birth rate, and adjusted contraception usage in 2002 brfss in puerto rico (online technical appendix table, http://wwwnc.cdc.gov/eid/article/23/1/16-1322-techapp1.pdf). Less - effective methods include condoms, spermicides, fertility awareness methods, withdrawal, sponge, and diaphragm . Moderately effective methods include oral contraceptive pills, patches, vaginal rings, and injectable contraceptives . The contraception use distribution at baseline (without intervention) is based on adjusting the distribution reported in the 2002 brfss in puerto rico excluding women using permanent contraception by assuming 5 percentage points fewer women using no contraception than in 2002, which is based on a 36% reduction of birth rate among women 1544 years of age in puerto rico from 2002 to 2015 (national vital statistics report for 2002 and 2015 unpublished birth data from puerto rico), and the reported reasons for us teen pregnancy reduction (http://www.cdc.gov/nchhstp/newsroom/docs/factsheets/yrbs-fact-sheet-final-508.pdf); the decline in teen pregnancies was the fastest of any age group in puerto rico during 20102014, as reported in national vital statistics reports . Data from title x clinics in puerto rico also show that the percentage of women of reproductive age served in title x clinics increased from 2.2% in 2006 to 10% in 2015 . We also assume that new contraception users have the same contraception method distribution as contraception users as reported in the 2002 brfss survey (8). We assume 22% dual use among moderately effective method users at baseline (based on nsfg 20112013 data and unpublished analyses supplied by karen pazol, ondieh, cdc; we accounted for the effectiveness of dual - method use in preventing pregnancy but not for preventing sexual transmission of zika virus). We calculated method - specific annual pregnancy rates by multiplying the failure rates of contraception methods under typical use by a calculated correction factor of 0.88 to adjust for the model over - predicting the number of unintended births in 2015 using the typical failure rates only . Multiplying method - specific contraceptive failure rates by numbers of women in each method category typically results in more predicted pregnancies and births than are actually observed, in part because of heterogeneity in sexual behaviors (19). Assuming 50% of no contraception users, 60% of less - effective contraception users, and 100% of moderately effective contraception users will visit a healthcare provider for contraception services under intervention . Based on the nsfg 20112013, among women of reproductive age who did not intend to become pregnant and not using permanent contraceptive methods, 21% of no contraception users, 33% less - effective method users, 97% moderately effective method users had at least 1 visit for contraception services in the last 12 months (personal communication, karen pazol, ondieh, cdc, 2016). Contraceptive services include receiving a birth control method or a prescription, receiving a checkup for birth control, receiving counseling about birth control, receiving a sterilizing operation, receiving counseling about a sterilizing operation, receiving emergency contraception, or receiving counseling about emergency contraception . We assume the intervention will increase the percentage of women visiting their provider for contraception counseling . In the contraceptive choice project (9), 67% of participants who wished to avoid pregnancy chose to use highly effective methods, and 33% chose to use moderately effective methods . For the main scenario, we applied those estimates to 40% of the target population, assuming that 40% of unintended pregnancies are unwanted, and assumed that 20% of the remaining 60% of switchers would choose highly effective methods . #ellington et al . (5) estimated 180 cases (interquartile range 100270 cases) of congenital microcephaly associated with zika virus in puerto rico among an estimated 31,272 births (unpublished birth data, puerto rico department of health, 2015). On the basis of those estimates, we estimated the prevalence of congenital microcephaly: 58/10,000 births (interquartile range 32/10,00086/10,000). * * the pregnancy loss rate in the us zika pregnancy registry as of july 21, 2016, was 35% (14). The termination rate is calculated as the overall pregnancy loss rate minus the assumed stillbirth rate . A range of the main value 20% was used to create upper and lower bounds used in sensitivity analyses . Includes cost for devices and costs for 1 year of injections, pills, patches, rings, condoms, and the cost for related services in the first year . Weighted average cost for hormonal iud (50%, $659), copper iud (25%, $598), and implant (25%, $659), based on contraception choice study (9) and commonly used devices in puerto rico . Weighted average cost for generic contraceptive pill (78%, $370/y), injectable (14%, $240/y plus $130 for consultation for the year), and ring or patch (8%, $964/y), with the distribution of moderately effective methods based on nsfg, 20112013 . ##weighted average cost of moderately effective method plus cost of less - effective method . * * * male condom . Including the cost for checking the placement of iud in the first year of insertion . Weighted average for vaginal and c - section delivery, including prenatal care, delivery, postpartum, and neonatal cost at delivery and in the first 3 months . Assumes additional costs related to repeated zika virus testing by igm (12 tests) for all pregnant women, 4 extra detailed ultrasound examinations, and 25% of women getting amniocentesis during all zika - positive pregnancies (25% infection rate at baseline, range 10%70%) (5), based on oduyebo et al . Assumes 2 zika virus tests (igm and pcr) for serum and placenta, cranial ultrasound, and eye examination for all infants born to zika virus positive mothers based on fleming - dutra et al . ###three pcr tests for zika virus using placenta, cord, and brain tissues of the fetus based on martines et al . (22). * * * * assuming all prenatal care cost, including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . Assuming half of the prenatal care cost, including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . Cost of prenatal care and delivery and extra cost of zika virus associated testing and monitoring during pregnancy and testing of infants for zika virus . Present value of cumulative medical and supportive care cost for infant with zam, discounted at 3% annually and taking into account mortality . Expenditures by employer - sponsored health plans for privately insured children with combined diagnoses of microcephaly and congenital cytomegalovirus enrolled during the first 4 years of life were used to project medical costs for cases of zam . For the main intervention scenario, we assumed that 50% of no contraception users, 60% of less - effective contraceptive method users, and 100% of moderately effective contraceptive method users would visit a healthcare provider during the intervention period and be counseled about contraception use (table 1). The first 2 percentages are roughly twice the percentages of women reported in the 20112013 us national survey on family growth to have received contraceptive services (contraception or counseling) within the past year because we assumed that, during the zika virus outbreak, more women and providers would discuss contraception; virtually all moderately effective method users were assumed to see providers to obtain contraceptive prescriptions . For the main scenario, we also assumed, optimistically, that 50% of women in the target population who receive contraceptive services during the zika virus outbreak would be willing to change to a more effective contraceptive method, evenly divided between moderately effective and highly effective methods . 33% used moderately effective methods) (9) to the 40% of women assumed to not want to be pregnant; we assumed 20% of other women not intending pregnancy would use larc . We further assumed that 30% of moderately effective contraception users would also choose to use condoms (dual - method use) under the intervention, based on a study reporting dual - method use among persons at risk for hiv (25). We calculated method - specific annual pregnancy rates by applying failure rates of contraception methods under typical use (10), in combination with information on estimated numbers of unintended pregnancies, to adjust for other factors influencing pregnancy risk (19). We estimated the proportion of fetal losses among unintended pregnancies from data for the caribbean region, including puerto rico (12), and calculated the proportion of induced abortion among unintended pregnancies from a survey conducted in puerto rico in 2001 (the latest year for which data were available) (11). We assumed that the distribution of fetal loss and induced abortions in unintended pregnancies unaffected by zam would not be altered by the zika virus outbreak or the intervention . For adverse pregnancy and birth outcomes associated with zika virus, we only considered zam and associated brain anomalies, including live births, stillbirths, and terminations attributable to prenatal diagnosis . Although zika virus can cause brain lesions and dysfunction in fetuses and newborns who do not have microcephaly (26), we lacked the data to model their prevalence and cost . In the main analysis, we assumed 58 cases of zam per 10,000 live births (range 3286/10,000) based on a modeling study that considered data from other mosquitoborne illnesses in puerto rico and zika virus outbreaks in other locations (5). We assumed a pregnancy loss rate of 35% among zika virus exposed fetuses with diagnosed birth defects based on cases in the us zika pregnancy registry as of july 21, 2016 (14). We projected gains in hly by multiplying total cases of zam prevented by 30.0, which is the average number of quality - adjusted life - years at birth in the united states for an infant without severe microcephaly (15) and the estimated loss in disability - adjusted life years from microcephaly (27). We multiplied 30.0 by the sum of live births and fetal losses associated with zam to calculate gains in hly . We included fetal losses in the hly calculations because in the absence of zam those pregnancies would have resulted in live births, with the same healthy life expectancy as other children (15). We conducted the analysis from a healthcare system perspective that includes direct medically related costs regardless of payer . We used payments from private insurance because payments from medicaid might underestimate the cost of healthcare (28). Intervention costs included program costs of training providers, patient educational materials, outreach / media campaigns on the availability of contraceptives services, and program coordination and the incremental costs of family planning services . The latter comprised the costs of contraception methods and related office visits and services (e.g., insertion and removal of larc for new method users resulting from the intervention and the cost of more intensive counseling for all women receiving contraceptive services during the intervention). We took the 1-year costs for contraception methods from the literature (16,29) and based the other program costs on the estimated costs for a pilot program planned to increase access to contraception in puerto rico as part of the current zika virus outbreak response (30). We did not apply a discount rate to intervention costs because of the time horizon of 12 months . Zika virus related costs prevented by this intervention were in 2 parts: 1) costs for zika virus testing and monitoring for zika virus exposed pregnancies and infants, and 2) costs of zam cases (table 1). The cost estimates for testing and monitoring presumed 100% adherence by clinicians and patients to recommendations (2022). The lifetime cost per live - born infant with zam includes direct medical and nonmedical costs . Zam is among the most severe types of microcephaly and is associated with loss of brain tissue volume, increased fluid spaces, and intracranial calcifications . All 3 cases of live - born infants with zam in french polynesia demonstrated severe neurologic outcomes with delayed cognitive development (26). On the basis of expert opinion, infants with zam who survive the neonatal period would be expected to have neurologic dysfunction consistent with severe cerebral palsy within 12 years of birth . As a proxy for the medical cost of zam, we used the estimated cost of treating infants with microcephaly associated with a diagnosis of symptomatic congenital cytomegalovirus (cmv). We used the marketscan commercial database (truven health analytics) with a sample of 100 million us residents covered by employer - sponsored insurance at any time during 20092014 . We used average costs for 4 newborn infants with diagnoses of microcephaly and cmv who survived and were enrolled in a health plan for> 3 years . For the direct nonmedical cost of zam, we used the estimated cost for supportive care for children with severe congenital brain injury, both paid care and unpaid care . The total lifetime cost for surviving infants with zam was estimated at $3.8 million per infant, taking into account infant and child mortality and discounting of costs in future years at a 3% rate per year; the sum of undiscounted costs for children who survive to adulthood might reach $10 million . Zika virus related medical costs associated with women s prenatal care, labor and delivery, and postpartum care for pregnancies ending in live birth and neonatal care from a study of us commercial health plan expenditures (17). Estimates for costs associated with pregnancies ending in induced abortion were based on our analyses of commercial claims data (table 1). Because many parameters used in the model are uncertain, we conducted sensitivity analyses on selected parameters, including different scenarios for the baseline and postintervention contraception use distributions in puerto rico . We tested alternate baseline contraception use distributions in puerto rico for women at risk for unintended pregnancy by using the actual distribution of method use reported in 2002 (8) and among women attending title x clinics in puerto rico in 2014 (31). For the postintervention contraception use distribution, we tested scenarios assuming different proportions of women receiving contraceptive services from a healthcare provider, different levels of willingness to switch to a more effective method, and different shares of moderately effective and highly effective methods among switchers . Other parameters evaluated during sensitivity analysis included the incidence of zam during the zika virus outbreak in puerto rico, percentage of pregnancies with zam terminated, the cost of caring for a live - born infant with microcephaly, and the cost of the intervention . We conducted sensitivity analyses in which we altered selected assumptions . In one, we annualized the cost of larc devices considering the expected duration of method use . In another, we adjusted observed data on us healthcare and supportive care costs to the generally lower levels of prices in puerto rico market by applying conversion factors of ratios of healthcare spending per capita and wages of nurse assistants between the united states and puerto rico (32,33). We also conducted a probabilistic sensitivity analysis by using monte carlo simulation (10,000 draws) that assumed different distributions for all the parameters used in the model (table 1). All analyses were conducted using treeage pro 2016 software (treeage software, williamstown, ma, usa) and excel 2013 (microsoft, redmond, wa, usa). All costs were adjusted to 2014 us dollars by using the health component of the personal consumption expenditures price index (34). We estimated the inputs for the decision - tree model and their sources (table 1). In the no intervention scenario, we took the distribution of women in the target population by use of different types of reversible contraceptives (or no use) from a 2002 survey administered in puerto rico and adjusted it to reflect the 36% decrease in fertility rates in puerto rico during 20022015 (8,23,24). * brfss, behavior risk surveillance system; cdc, centers for disease control and prevention; hly; healthy life years; iud, intrauterine device; larc, long - acting reversible contraceptive; nsfg, national survey of family growth; ondieh, office of noncommunicable diseases, injury and environmental health; zam, zika virus associated microcephaly . Authors calculation based on 2015 puerto rico total population size, 2015 birth rate, and adjusted contraception usage in 2002 brfss in puerto rico (online technical appendix table, http://wwwnc.cdc.gov/eid/article/23/1/16-1322-techapp1.pdf). Less - effective methods include condoms, spermicides, fertility awareness methods, withdrawal, sponge, and diaphragm . Moderately effective methods include oral contraceptive pills, patches, vaginal rings, and injectable contraceptives . The contraception use distribution at baseline (without intervention) is based on adjusting the distribution reported in the 2002 brfss in puerto rico excluding women using permanent contraception by assuming 5 percentage points fewer women using no contraception than in 2002, which is based on a 36% reduction of birth rate among women 1544 years of age in puerto rico from 2002 to 2015 (national vital statistics report for 2002 and 2015 unpublished birth data from puerto rico), and the reported reasons for us teen pregnancy reduction (http://www.cdc.gov/nchhstp/newsroom/docs/factsheets/yrbs-fact-sheet-final-508.pdf); the decline in teen pregnancies was the fastest of any age group in puerto rico during 20102014, as reported in national vital statistics reports . Data from title x clinics in puerto rico also show that the percentage of women of reproductive age served in title x clinics increased from 2.2% in 2006 to 10% in 2015 . We also assume that new contraception users have the same contraception method distribution as contraception users as reported in the 2002 brfss survey (8). We assume 22% dual use among moderately effective method users at baseline (based on nsfg 20112013 data and unpublished analyses supplied by karen pazol, ondieh, cdc; we accounted for the effectiveness of dual - method use in preventing pregnancy but not for preventing sexual transmission of zika virus). We calculated method - specific annual pregnancy rates by multiplying the failure rates of contraception methods under typical use by a calculated correction factor of 0.88 to adjust for the model over - predicting the number of unintended births in 2015 using the typical failure rates only . Multiplying method - specific contraceptive failure rates by numbers of women in each method category typically results in more predicted pregnancies and births than are actually observed, in part because of heterogeneity in sexual behaviors (19). Assuming 50% of no contraception users, 60% of less - effective contraception users, and 100% of moderately effective contraception users will visit a healthcare provider for contraception services under intervention . Based on the nsfg 20112013, among women of reproductive age who did not intend to become pregnant and not using permanent contraceptive methods, 21% of no contraception users, 33% less - effective method users, 97% moderately effective method users had at least 1 visit for contraception services in the last 12 months (personal communication, karen pazol, ondieh, cdc, 2016). Contraceptive services include receiving a birth control method or a prescription, receiving a checkup for birth control, receiving counseling about birth control, receiving a sterilizing operation, receiving counseling about a sterilizing operation, receiving emergency contraception, or receiving counseling about emergency contraception . We assume the intervention will increase the percentage of women visiting their provider for contraception counseling . In the contraceptive choice project (9), 67% of participants who wished to avoid pregnancy chose to use highly effective methods, and 33% chose to use moderately effective methods . For the main scenario, we applied those estimates to 40% of the target population, assuming that 40% of unintended pregnancies are unwanted, and assumed that 20% of the remaining 60% of switchers would choose highly effective methods . #ellington et al . (5) estimated 180 cases (interquartile range 100270 cases) of congenital microcephaly associated with zika virus in puerto rico among an estimated 31,272 births (unpublished birth data, puerto rico department of health, 2015). On the basis of those estimates, we estimated the prevalence of congenital microcephaly: 58/10,000 births (interquartile range 32/10,00086/10,000). * * the pregnancy loss rate in the us zika pregnancy registry as of july 21, 2016, was 35% (14). The termination rate is calculated as the overall pregnancy loss rate minus the assumed stillbirth rate . A range of the main value 20% was used to create upper and lower bounds used in sensitivity analyses . Includes cost for devices and costs for 1 year of injections, pills, patches, rings, condoms, and the cost for related services in the first year . Weighted average cost for hormonal iud (50%, $659), copper iud (25%, $598), and implant (25%, $659), based on contraception choice study (9) and commonly used devices in puerto rico . Weighted average cost for generic contraceptive pill (78%, $370/y), injectable (14%, $240/y plus $130 for consultation for the year), and ring or patch (8%, $964/y), with the distribution of moderately effective methods based on nsfg, 20112013 . ##weighted average cost of moderately effective method plus cost of less - effective method . * * * male condom . Including the cost for checking the placement of iud in the first year of insertion . Weighted average for vaginal and c - section delivery, including prenatal care, delivery, postpartum, and neonatal cost at delivery and in the first 3 months . Assumes additional costs related to repeated zika virus testing by igm (12 tests) for all pregnant women, 4 extra detailed ultrasound examinations, and 25% of women getting amniocentesis during all zika - positive pregnancies (25% infection rate at baseline, range 10%70%) (5), based on oduyebo et al . Assumes 2 zika virus tests (igm and pcr) for serum and placenta, cranial ultrasound, and eye examination for all infants born to zika virus positive mothers based on fleming - dutra et al . ###three pcr tests for zika virus using placenta, cord, and brain tissues of the fetus based on martines et al . (22). * * * * assuming all prenatal care cost, including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . Assuming half of the prenatal care cost, including extra cost of zika virus associated testing and monitoring during pregnancy and extra cost for zika virus associated testing for fetus . Cost of prenatal care and delivery and extra cost of zika virus associated testing and monitoring during pregnancy and testing of infants for zika virus . Present value of cumulative medical and supportive care cost for infant with zam, discounted at 3% annually and taking into account mortality . Expenditures by employer - sponsored health plans for privately insured children with combined diagnoses of microcephaly and congenital cytomegalovirus enrolled during the first 4 years of life were used to project medical costs for cases of zam . For the main intervention scenario, we assumed that 50% of no contraception users, 60% of less - effective contraceptive method users, and 100% of moderately effective contraceptive method users would visit a healthcare provider during the intervention period and be counseled about contraception use (table 1). The first 2 percentages are roughly twice the percentages of women reported in the 20112013 us national survey on family growth to have received contraceptive services (contraception or counseling) within the past year because we assumed that, during the zika virus outbreak, more women and providers would discuss contraception; virtually all moderately effective method users were assumed to see providers to obtain contraceptive prescriptions . For the main scenario, we also assumed, optimistically, that 50% of women in the target population who receive contraceptive services during the zika virus outbreak would be willing to change to a more effective contraceptive method, evenly divided between moderately effective and highly effective methods . 33% used moderately effective methods) (9) to the 40% of women assumed to not want to be pregnant; we assumed 20% of other women not intending pregnancy would use larc . We further assumed that 30% of moderately effective contraception users would also choose to use condoms (dual - method use) under the intervention, based on a study reporting dual - method use among persons at risk for hiv (25). We calculated method - specific annual pregnancy rates by applying failure rates of contraception methods under typical use (10), in combination with information on estimated numbers of unintended pregnancies, to adjust for other factors influencing pregnancy risk (19). We estimated the proportion of fetal losses among unintended pregnancies from data for the caribbean region, including puerto rico (12), and calculated the proportion of induced abortion among unintended pregnancies from a survey conducted in puerto rico in 2001 (the latest year for which data were available) (11). We assumed that the distribution of fetal loss and induced abortions in unintended pregnancies unaffected by zam would not be altered by the zika virus outbreak or the intervention . For adverse pregnancy and birth outcomes associated with zika virus, we only considered zam and associated brain anomalies, including live births, stillbirths, and terminations attributable to prenatal diagnosis . Although zika virus can cause brain lesions and dysfunction in fetuses and newborns who do not have microcephaly (26), we lacked the data to model their prevalence and cost . In the main analysis, we assumed 58 cases of zam per 10,000 live births (range 3286/10,000) based on a modeling study that considered data from other mosquitoborne illnesses in puerto rico and zika virus outbreaks in other locations (5). We assumed a pregnancy loss rate of 35% among zika virus exposed fetuses with diagnosed birth defects based on cases in the us zika pregnancy registry as of july 21, 2016 (14). We projected gains in hly by multiplying total cases of zam prevented by 30.0, which is the average number of quality - adjusted life - years at birth in the united states for an infant without severe microcephaly (15) and the estimated loss in disability - adjusted life years from microcephaly (27). We multiplied 30.0 by the sum of live births and fetal losses associated with zam to calculate gains in hly . We included fetal losses in the hly calculations because in the absence of zam those pregnancies would have resulted in live births, with the same healthy life expectancy as other children (15). We conducted the analysis from a healthcare system perspective that includes direct medically related costs regardless of payer . We used payments from private insurance because payments from medicaid might underestimate the cost of healthcare (28). Intervention costs included program costs of training providers, patient educational materials, outreach / media campaigns on the availability of contraceptives services, and program coordination and the incremental costs of family planning services . The latter comprised the costs of contraception methods and related office visits and services (e.g., insertion and removal of larc for new method users resulting from the intervention and the cost of more intensive counseling for all women receiving contraceptive services during the intervention). We took the 1-year costs for contraception methods from the literature (16,29) and based the other program costs on the estimated costs for a pilot program planned to increase access to contraception in puerto rico as part of the current zika virus outbreak response (30). We did not apply a discount rate to intervention costs because of the time horizon of 12 months . Zika virus related costs prevented by this intervention were in 2 parts: 1) costs for zika virus testing and monitoring for zika virus exposed pregnancies and infants, and 2) costs of zam cases (table 1). The cost estimates for testing and monitoring presumed 100% adherence by clinicians and patients to recommendations (2022). The lifetime cost per live - born infant with zam includes direct medical and nonmedical costs . Zam is among the most severe types of microcephaly and is associated with loss of brain tissue volume, increased fluid spaces, and intracranial calcifications . All 3 cases of live - born infants with zam in french polynesia demonstrated severe neurologic outcomes with delayed cognitive development (26). On the basis of expert opinion, infants with zam who survive the neonatal period would be expected to have neurologic dysfunction consistent with severe cerebral palsy within 12 years of birth . As a proxy for the medical cost of zam, we used the estimated cost of treating infants with microcephaly associated with a diagnosis of symptomatic congenital cytomegalovirus (cmv). We used the marketscan commercial database (truven health analytics) with a sample of 100 million us residents covered by employer - sponsored insurance at any time during 20092014 . We used average costs for 4 newborn infants with diagnoses of microcephaly and cmv who survived and were enrolled in a health plan for> 3 years . For the direct nonmedical cost of zam, we used the estimated cost for supportive care for children with severe congenital brain injury, both paid care and unpaid care . The total lifetime cost for surviving infants with zam was estimated at $3.8 million per infant, taking into account infant and child mortality and discounting of costs in future years at a 3% rate per year; the sum of undiscounted costs for children who survive to adulthood might reach $10 million . Zika virus related medical costs associated with women s prenatal care, labor and delivery, and postpartum care for pregnancies ending in live birth and neonatal care from a study of us commercial health plan expenditures (17). Estimates for costs associated with pregnancies ending in induced abortion were based on our analyses of commercial claims data (table 1). Because many parameters used in the model are uncertain, we conducted sensitivity analyses on selected parameters, including different scenarios for the baseline and postintervention contraception use distributions in puerto rico . We tested alternate baseline contraception use distributions in puerto rico for women at risk for unintended pregnancy by using the actual distribution of method use reported in 2002 (8) and among women attending title x clinics in puerto rico in 2014 (31). For the postintervention contraception use distribution, we tested scenarios assuming different proportions of women receiving contraceptive services from a healthcare provider, different levels of willingness to switch to a more effective method, and different shares of moderately effective and highly effective methods among switchers . Other parameters evaluated during sensitivity analysis included the incidence of zam during the zika virus outbreak in puerto rico, percentage of pregnancies with zam terminated, the cost of caring for a live - born infant with microcephaly, and the cost of the intervention . In one, we annualized the cost of larc devices considering the expected duration of method use . In another, we adjusted observed data on us healthcare and supportive care costs to the generally lower levels of prices in puerto rico market by applying conversion factors of ratios of healthcare spending per capita and wages of nurse assistants between the united states and puerto rico (32,33). We also conducted a probabilistic sensitivity analysis by using monte carlo simulation (10,000 draws) that assumed different distributions for all the parameters used in the model (table 1). All analyses were conducted using treeage pro 2016 software (treeage software, williamstown, ma, usa) and excel 2013 (microsoft, redmond, wa, usa). All costs were adjusted to 2014 us dollars by using the health component of the personal consumption expenditures price index (34). In the main scenario, we predict the intervention would prevent 25 cases of zam among unintended pregnancies avoided, of which 16 would have resulted in live births (table 2). The incremental intervention cost of us $33.5 million (i.e., $206 per member of target population) relative to no intervention (status quo) is more than offset by $65.2 million in avoided zika virus associated costs, $2.8 million from extra testing and monitoring for pregnant women and infants for zika virus exposed pregnancies avoided, and $62.3 million from zam cases prevented . The net savings from zika virus the numbers in the columns and rows might not exactly match because of rounding . Target population size: 163,000 women who do not intend to become pregnant during zika virus outbreak . Women of reproductive age in puerto rico who are sexually active with a male partner, fertile, not desiring pregnancy, and not using permanent contraception methods (e.g., tubal ligation and vasectomy). Only including cost of testing for zika virus and monitoring for exposed infants without zam; testing costs for infants with zam are included in the direct costs of zam . From healthcare system perspective, includes direct medical and medical - related costs, including supportive care for persons with zam, even if the cost might not be paid by healthcare payers or delivered by healthcare providers . #total zika virus associated cost avoided (absolute value) minus the additional cost of family planning service under intervention compared with no intervention . * * unwanted pregnancies which are not desired in the future (assuming 60% of unintended pregnancies are mistimed), irrespective of zika virus infection absolute value of net medical cost for unwanted pregnancy plus absolute value of net cost savings from zika virus associated costs avoided . The number of zam cases prevented and zika virus associated costs avoided are sensitive to the proportion of women receiving contraceptive services and the proportion of those women willing to switch to a more effective contraception method during the zika virus outbreak (figure; table 3). If the proportions of women receiving contraception services are assumed to be the same as estimated for the continental united states in the national survey of family growth for 20112013 (i.e., 21% among no contraception users, 33% among less - effective method users, and 97% among all moderately effective method users), 16 cases of zam are prevented, and the net savings is $15.4 million (table 3). If 10% of women receiving contraceptive services switch to a more effective method, 6 cases of zam are prevented, and net saving is $2.8 million . If the intervention only shifts users of moderately effective methods to a highly effective method (no change in non - use or use of less - effective methods), 7 zam cases are prevented, with an icer of $24,608/hly gained . Increasing the proportion of dual - method users increases the number of cases of zam prevented and net savings attributable to higher contraception effectiveness . The results are also sensitive to the prevalence of zam among mid - trimester pregnancies, the percentage of zam cases resulting in live - born infants, lifetime cost per live - born infant with zam, and the intervention cost . If we adjust us cost estimates for lower prices in puerto rico while keeping intervention costs at us prices, net savings are $1.7 million . In all but 1 of the scenarios sensitivity analysis indicating the effect of changes of assumptions on the number of zam cases prevented in a proposed intervention to increase access to contraception to women during the zika virus outbreak, puerto rico, 2016 . Larc, long - acting reversible contraceptive; zam, zika virus associated microcephaly . * brfss, behavioral risk factor surveillance system; cn, cost - neutral; cs, cost - saving; hly, healthy life years; larc, long - acting reversible contraceptive; nsfg, national survey of family growth; up, unwanted pregnancy; zam, zika virus associated microcephaly . Total incremental cost is the additional cost of contraception minus zika virus associated cost avoided . 30% of no contraception users, 60% of less - effective contraceptive method users, 100% of moderately effective contraceptive method users seeking contraceptive services from healthcare provider during the zika virus outbreak . Based on nsfg 20112013, among women of reproductive age who are sexually active, did not intend to become pregnant, and were not using permanent contraceptive methods, 21% of no contraception users, 33% of less - effective contraceptive method users, 97% of moderately effective contraceptive method users, and 94% of dual - method users had at least 1 contraceptive service visit in the last 12 months (in total 50%). Based on title x family planning annual report for 20072015 in colorado, 30% of clients who visited title x clinics switched to a new method . #eighteen percentage points of users of moderately effective methods are assumed to switch to highly effective methods, of whom 21% were dual - method users . * * contraception distribution in puerto rico in 2002 15.9% no method, 41.6% less - effective methods, 40.2% moderately effective methods, and 2.4% highly effective methods . 20% of women at risk for unintended pregnancy used less - effective methods, 77% used moderately effective methods, and 2% used highly effective methods . Intervention cost equals to the medical savings from zam cases prevented . Conversion factor of 0.36 applied to pregnancy and zam medical costs based on the ratio of per capita medical expenditure in puerto rico and in the united states in 2012 as in portela et al . 2015 (32); conversion factor of 0.72 applied to costs of supportive care for live - born infants with zam, based on the ratio of annual salary for assistant nurses in puerto rico and in the united states (33). A probabilistic sensitivity analysis scatter graph shows that most of the model simulations result in icers in the lower right quadrant with lower costs and better health outcomes (technical appendix figure 2). Specifically, the intervention is cost - saving in 92.11% of the 10,000 iterations, and in 98.10% of the iterations, the intervention has an icer of <$20,000/hly gained . The intervention is also predicted to prevent $40.4 million in medical costs from unwanted pregnancies avoided in the main scenario (table 2). In many sensitivity analyses, the cost avoided from these unwanted pregnancies prevented alone is greater than the intervention cost . The larger the numbers of no contraception users and less - effective method users receiving contraceptive services and willing to switch to more effective methods, the greater the magnitude of cost savings from unwanted pregnancies avoided (table 3). The results of our modeling analysis suggest that increasing access to effective contraception in the context of the 2016 zika virus outbreak for women in puerto rico who do not intend to become pregnant could proportionally reduce the number of unintended pregnancies and cases of zam by 25% . The intervention is cost - saving (negative net cost) when considering the benefits from preventing zam and avoiding zika virus exposed pregnancy costs in the main scenarios and in most of the scenarios we tested . In scenarios in which the intervention is not cost - saving, it is still cost - effective relative to accepted cost - effectiveness thresholds (35). The world health organization suggests that interventions that cost <3 times the gross domestic product per capita per hly (equivalent to $150,000 in the united states and $60,000 in puerto rico) are cost - effective and those costing less than gross domestic product per capita are highly cost - effective (36). When considering additional benefits from preventing unintended pregnancies not desired at a later time, the intervention is cost - saving in all scenarios . Previous studies have shown that expanding access to contraception, especially larc, is cost - saving (16,37,38). Likewise, our findings suggest that this intervention could be cost - saving or cost - effective within the context of a public health emergency response . First, we project the effects of a hypothetical intervention in place in puerto rico during the 2016 zika virus outbreak . However second, the baseline contraception use distribution is based on a 2002 survey; the current distribution in puerto rico might be different . Third, uncertainty exists about the effect of the proposed intervention on postintervention contraceptive use distribution; however, the sensitivity analyses indicate that different distributions of larc types among switchers does not have a substantial influence on the results . Fourth, our study assumes that women have full access to healthcare providers . In areas with limited access to providers, the effectiveness of the intervention might be lower, although puerto rico has a similar ratio of physicians to population as the united states as a whole (39), and despite a loss of physicians in recent years, puerto rico has a network of providers, federally qualified health clinics, and title x providers in rural and urban areas . We lack data on miscarriage and induced abortion rates in puerto rico and so did not have sufficient data to model uncertainty in these parameters . The rates of stillbirth and pregnancy termination among pregnancies with zam in puerto rico are also unknown . Our assumed percentage of live births among pregnancies with recognized zam (65%) compares with a 38% rate reported in french polynesia during the 2013 zika virus outbreak (11). Sixth, pregnancy intentions and use of contraception among women in puerto rico might differ during the zika virus outbreak compared to preoutbreak periods . Seventh, our analysis does not consider possibly higher rates of fetal loss and induced abortion among women infected by zika virus during early pregnancy or brain abnormalities or conditions related to zika virus not involving microcephaly . Eighth, the assumed zika virus testing costs assume 100% adherence to recommended testing practices; the actual cost savings taking nonadherence into account would be lower . Ninth, the cost estimates of zam cases in live - born infants do not include costs of managing mental health conditions among parents of affected infants . However, if the cost of zam exceeds $1.9 million, the intervention is still cost - saving . Finally, if efforts to prevent transmission of zika virus in puerto rico are effective, the rate of infection in pregnancy and the incidence of zam relative to that projected could be reduced . Despite its limitations, second, the contraception scenarios are based on real - world programs and have resulted from consultation with subject matter experts . Third, expenditure data from a large sample of us residents with commercial health insurance were used to calculate the potential medical cost of zam on the basis of combinations of diagnostic codes for virus - associated microcephaly, although costs might be lower for similar children with public insurance . Finally, sensitivity analyses give consistent results indicating expected net cost savings associated with an intervention that would increase access to contraception in response to the zika virus outbreak in puerto rico . Zika virus can cause devastating birth defects, and infants born with zam and their families will require lifelong support . Avoiding unintended pregnancies is a critical intervention to mitigate the effects of zam . Efforts to prevent adverse zika virus related pregnancy outcomes in puerto rico are especially important because of limited resources (40). Our analyses suggest that increasing access to a full range of contraception among women in puerto rico who want to delay or avoid becoming pregnant during a zika virus outbreak would be a cost - saving strategy to reduce the effects of zam . The magnitude of cost savings is even greater when considering the avoided cost of unwanted pregnancies prevented . Process for deriving the size of the target population, decision tree structure, and probabilistic sensitivity analysis of cost - effectiveness for a proposed intervention to increase access to contraception to women during the zika virus outbreak, puerto rico, 2016.
|
We evaluated a subset of 1,759 from 2,031 look ahead (action for health in diabetes) participants generally corresponding to the first half of enrollees from 15 of 16 participating clinic sites who had hs - crp determinations and fitness data at baseline and 1 year . Loss to follow - up at 1 year was very low in our eligible participant pool (3.2%), as in the overall look ahead cohort (3.6%). The study design, methods, and subject characteristics of look ahead, an ongoing multicenter clinical trial examining whether a behavioral lifestyle intervention targeting weight loss will reduce cardiovascular events and overall mortality in overweight / obese subjects with type 2 diabetes, have been described previously (8). In brief, subjects were randomly assigned to an intensive lifestyle intervention (ili) arm aiming for a 7% weight loss from baseline or to a diabetes, support, and education (dse) arm, which served as the control . Ili participants attended frequent group and individual sessions in support of behavioral change to increase moderate - intensity exercise progressively to 175 min / week, reduce caloric and saturated fat intake, and change macronutrient composition to improve glycemic control . Look ahead and this ancillary study were approved by the institutional review boards of the participating centers . A latex particle - enhanced immunoturbidimetric assay (equal diagnostics / genzyme) determination of fitness, using submaximal effort on a graded exercise stress test, and procedures for obtaining anthropometrics, a1c, glucose, and lipids in look ahead have been published previously (9,10). Hs - crp changes at 1 year were reported as median change and percent change from baseline . Quartiles of change in bmi, fitness, and parameters of glucose and lipid control were examined against change in log hs - crp in an exploratory approach to evaluate linearity . The associations between changes in variables of interest and hs - crp change (log - transformed to correct for a nonnormal distribution) were examined using multiple linear regression analyses after excluding collinearity (defined as a correlation coefficient> 0.6). A dichotomous indicator for treatment group (ili vs. dse) was included in all models to examine the significance of treatment effect (shown alone in model a). Changes in each of the metabolic variables and/or fitness were entered into a separate regression model, alone (models b j) or in combination with other predictors (models k q), in the presence of the dichotomous treatment group indicator, to evaluate their contributions . All models were adjusted for the effects of demographics, clinic site, history of cvd, current smoking, and treatment with statins and thiazolidinediones (tzds). Treatment effect (ili) and statin and insulin use (tested separately) were evaluated in the full model with the use of interaction terms to evaluate whether either pharmacological therapy modulated the association of ili with change in hs - crp . Analyses were performed using sas (version 9.2; sas institute, cary, nc). A latex particle - enhanced immunoturbidimetric assay (equal diagnostics / genzyme) was used to measure hs - crp . Determination of fitness, using submaximal effort on a graded exercise stress test, and procedures for obtaining anthropometrics, a1c, glucose, and lipids in look ahead have been published previously (9,10). Hs - crp changes at 1 year were reported as median change and percent change from baseline . Quartiles of change in bmi, fitness, and parameters of glucose and lipid control were examined against change in log hs - crp in an exploratory approach to evaluate linearity . The associations between changes in variables of interest and hs - crp change (log - transformed to correct for a nonnormal distribution) were examined using multiple linear regression analyses after excluding collinearity (defined as a correlation coefficient> 0.6). A dichotomous indicator for treatment group (ili vs. dse) was included in all models to examine the significance of treatment effect (shown alone in model a). Changes in each of the metabolic variables and/or fitness were entered into a separate regression model, alone (models b j) or in combination with other predictors (models k q), in the presence of the dichotomous treatment group indicator, to evaluate their contributions . All models were adjusted for the effects of demographics, clinic site, history of cvd, current smoking, and treatment with statins and thiazolidinediones (tzds). Treatment effect (ili) and statin and insulin use (tested separately) were evaluated in the full model with the use of interaction terms to evaluate whether either pharmacological therapy modulated the association of ili with change in hs - crp . Analyses were performed using sas (version 9.2; sas institute, cary, nc). Mg / l) than in men (2.4 [iqr 1.24.7] mg / l). Because of the change in age eligibility criteria during the 2nd year of recruitment in look ahead, subject characteristics in this ancillary study differ slightly from those of the remaining participants; 12% had cvd and 40% used statins, compared with 15 and 45%, respectively, for the remainder of look ahead enrollees (11). Baseline characteristics data are means sd, n (%), or median (iqr). Self - reported prior myocardial infarction, stroke, transient ischemic attack, angioplasty / stent, coronary artery bypass graft, carotid endarterectomy, abdominal aortic aneurysm, or heart failure . As reported for the overall look ahead sample (10), subjects in the ili arm in this study had significant improvements in glucose control and weight loss at 1 year compared with those in the dse arm . A1c decreased by 0.7% with ili and by 0.2% with dse (p <0.001). Subjects in the ili arm had mean weight and bmi reductions of 9 kg and 3.2 kg / m (8.8% of baseline), respectively, compared with respective reductions of 0.8 kg and 0.3 kg / m (0.8% of baseline) in the dse arm (p <0.001). Ili participants had a greater improvement in fitness, with a 19% increase from baseline compared with a 5.9% increase in the dse arm (p <0.001) (table 2). Hdl cholesterol and triglycerides improved with ili compared with dse, but ldl cholesterol change was not different between arms . Changes in metabolic variables, fitness, and hs - crp at 1 year data are means sd or median (iqr) unless otherwise indicated . For difference between ili and dse for change in variable from baseline to 1 year . Median hs - crp at 1 year dropped by 43.6% from baseline in the ili group, compared with a 16.7% decrease in the dse group (p <0.001 for difference in median change between ili and dse) (table 2). Women, who had a higher hs - crp level than men at baseline, had a greater absolute change in median hs - crp level with ili at 1 year but a similar proportional drop in hs - crp levels compared with that in men (table 2). Quartiles of change representing greater improvements in adiposity, fitness, and glucose and lipid control were associated with greater decreases in hs - crp . Pearson correlation coefficients between variable changes (except between measures of adiposity and between fasting glucose and a1c) were all <0.46 . Change in hs - crp (median and iqr) at 1 year in the dse arm vs. the ili arm by quartiles (q) of change in bmi (top) and a1c (bottom). Change in hs - crp is a proportional change, with numbers <1.0 indicating a decrease in hs - crp and those> 1.0 an increase in hs - crp and the horizontal line representing overall mean change . Regression analysis, accounting for potential differences between treatment arms in demographics, smoking, and tzd and statin use, among others, confirmed that each of the ili - induced improvements in adiposity (bmi, weight, and waist circumference), glucose control (a1c and fasting glucose), triglycerides, hdl cholesterol, and fitness predicted a decrease in hs - crp at 1 year (analyzed as log hs - crp, p <0.001 for all) (table 3, models b j). Change in waist circumference with ili contributed slightly less to hs - crp change (r = 0.096) than did change in weight (r = 0.114) or change in bmi (r = 0.115) with ili . Interestingly, the improvement in glucose control with ili contributed to hs - crp change to an extent similar to that for the reduction in adiposity (r = 0.112 and 0.100 for fasting glucose and a1c, respectively). Improvements in fitness with ili explained slightly less (r = 0.086) of the variance in hs - crp change at 1 year than did changes in adiposity or glucose control . Both change in hdl cholesterol and change in triglyceride levels, but not change in ldl cholesterol, predicted hs - crp change with ili at 1 year . Metabolic variables as predictors of hs - crp change with 1-year ili using multiple variable regression analysis each model (a q) was analyzed independently and adjusted for age, sex, ethnicity, clinic site, history of cvd, smoking, and tzd and statin use . The outcome variable, change in hs - crp, was log - transformed to correct for a nonnormal distribution . When change in fitness was evaluated in the regression model with change in a1c (model k), we found that each predicted hs - crp change . However, when change in bmi was added to the model (model l), fitness was no longer a significant predictor, suggesting that the change in adiposity associated with improved fitness partially explained the decline in hs - crp with ili at 1 year . On the other hand, when change in bmi or change in fitness was added to a model containing hdl cholesterol (models m and o, respectively) or triglycerides (models n and p, respectively), both lipid variables remained significant predictors of hs - crp change . A final model (model q), including changes in bmi, a1c, hdl cholesterol, triglycerides, and fitness, revealed that, of the metabolic variables studied, only improvements in glucose control and adiposity could independently account for the decrease in hs - crp at 1 year (p <0.001). The beneficial effects of changes in fitness, hdl cholesterol, and triglycerides on hs - crp were weakened and no longer statistically significant (p = 0.095, 0.106, and 0.068, respectively) when tested in the full model . Statin and insulin use did not modify the association of ili and hs - crp when each was tested separately with the use of an interaction term (statin use ili and insulin use ili) in the full model (p = 0.43 and 0.50, respectively). Mg / l) than in men (2.4 [iqr 1.24.7] mg / l). Because of the change in age eligibility criteria during the 2nd year of recruitment in look ahead, subject characteristics in this ancillary study differ slightly from those of the remaining participants; 12% had cvd and 40% used statins, compared with 15 and 45%, respectively, for the remainder of look ahead enrollees (11). Baseline characteristics data are means sd, n (%), or median (iqr). Self - reported prior myocardial infarction, stroke, transient ischemic attack, angioplasty / stent, coronary artery bypass graft, carotid endarterectomy, abdominal aortic aneurysm, or heart failure . As reported for the overall look ahead sample (10), subjects in the ili arm in this study had significant improvements in glucose control and weight loss at 1 year compared with those in the dse arm . A1c decreased by 0.7% with ili and by 0.2% with dse (p <0.001). Subjects in the ili arm had mean weight and bmi reductions of 9 kg and 3.2 kg / m (8.8% of baseline), respectively, compared with respective reductions of 0.8 kg and 0.3 kg / m (0.8% of baseline) in the dse arm (p <0.001). Ili participants had a greater improvement in fitness, with a 19% increase from baseline compared with a 5.9% increase in the dse arm (p <0.001) (table 2). Hdl cholesterol and triglycerides improved with ili compared with dse, but ldl cholesterol change was not different between arms . Changes in metabolic variables, fitness, and hs - crp at 1 year data are means sd or median (iqr) unless otherwise indicated . * for difference between ili and dse for change in variable from baseline to 1 year . Median hs - crp at 1 year dropped by 43.6% from baseline in the ili group, compared with a 16.7% decrease in the dse group (p <0.001 for difference in median change between ili and dse) (table 2). Women, who had a higher hs - crp level than men at baseline, had a greater absolute change in median hs - crp level with ili at 1 year but a similar proportional drop in hs - crp levels compared with that in men (table 2). Quartiles of change representing greater improvements in adiposity, fitness, and glucose and lipid control were associated with greater decreases in hs - crp . Pearson correlation coefficients between variable changes (except between measures of adiposity and between fasting glucose and a1c) were all <0.46 . Change in hs - crp (median and iqr) at 1 year in the dse arm vs. the ili arm by quartiles (q) of change in bmi (top) and a1c (bottom). Change in hs - crp is a proportional change, with numbers <1.0 indicating a decrease in hs - crp and those> 1.0 an increase in hs - crp and the horizontal line representing overall mean change . Regression analysis, accounting for potential differences between treatment arms in demographics, smoking, and tzd and statin use, among others, confirmed that each of the ili - induced improvements in adiposity (bmi, weight, and waist circumference), glucose control (a1c and fasting glucose), triglycerides, hdl cholesterol, and fitness predicted a decrease in hs - crp at 1 year (analyzed as log hs - crp, p <0.001 for all) (table 3, models b j). Change in waist circumference with ili contributed slightly less to hs - crp change (r = 0.096) than did change in weight (r = 0.114) or change in bmi (r = 0.115) with ili . Interestingly, the improvement in glucose control with ili contributed to hs - crp change to an extent similar to that for the reduction in adiposity (r = 0.112 and 0.100 for fasting glucose and a1c, respectively). Improvements in fitness with ili explained slightly less (r = 0.086) of the variance in hs - crp change at 1 year than did changes in adiposity or glucose control . Both change in hdl cholesterol and change in triglyceride levels, but not change in ldl cholesterol, predicted hs - crp change with ili at 1 year . Metabolic variables as predictors of hs - crp change with 1-year ili using multiple variable regression analysis each model (a q) was analyzed independently and adjusted for age, sex, ethnicity, clinic site, history of cvd, smoking, and tzd and statin use . The outcome variable, change in hs - crp, was log - transformed to correct for a nonnormal distribution . When change in fitness was evaluated in the regression model with change in a1c (model k), we found that each predicted hs - crp change . However, when change in bmi was added to the model (model l), fitness was no longer a significant predictor, suggesting that the change in adiposity associated with improved fitness partially explained the decline in hs - crp with ili at 1 year . On the other hand, when change in bmi or change in fitness was added to a model containing hdl cholesterol (models m and o, respectively) or triglycerides (models n and p, respectively), both lipid variables remained significant predictors of hs - crp change . A final model (model q), including changes in bmi, a1c, hdl cholesterol, triglycerides, and fitness, revealed that, of the metabolic variables studied, only improvements in glucose control and adiposity could independently account for the decrease in hs - crp at 1 year (p <0.001). The beneficial effects of changes in fitness, hdl cholesterol, and triglycerides on hs - crp were weakened and no longer statistically significant (p = 0.095, 0.106, and 0.068, respectively) when tested in the full model . Statin and insulin use did not modify the association of ili and hs - crp when each was tested separately with the use of an interaction term (statin use ili and insulin use ili) in the full model (p = 0.43 and 0.50, respectively). This report contributes information on the effects of a 1-year lifestyle intervention for weight loss on hs - crp in the setting of what is, to our knowledge, the largest randomized clinical trial of its kind in individuals with type 2 diabetes . Most studies evaluating cardiovascular risk reduction in individuals with diabetes have focused on the effects of statins and found a substantial benefit (12). Statins not only decrease ldl cholesterol but they also have anti - inflammatory activity and have been shown to decrease cardiovascular mortality in individuals without diabetes who have elevated hs - crp (4). Our report showed that in obese men and women with type 2 diabetes, 1 year of lifestyle intervention (in addition to usual care), which led to an 8.8% reduction in baseline weight and a 0.7% drop in a1c, resulted in a 43.6% decrease in median hs - crp, whereas usual care alone, which led to reductions of 0.8% in baseline weight and 0.2% in a1c, resulted in a 16.7% decrease in median hs - crp . The improvement in hs - crp achieved with ili in look ahead is comparable to hs - crp reductions with statins in people without diabetes (4). Esposito et al . (5) were the first to present compelling evidence on the benefit of weight loss achieved with lifestyle behavior changes on markers of inflammation . In a 2-year interventional study in 160 obese women without diabetes, they reported a 14% decrease in mean weight and a 34% decrease in median hs - crp from baseline (compared with decreases of 3 and 9%, respectively, in the control group). In the diabetes prevention program (dpp), in which 1,000 of> 3,000 obese participants at risk for diabetes were randomly assigned to a lifestyle intervention arm, behavioral changes in physical activity and diet resulted in a 7.2% decrease in baseline weight and 30% decrease in median hs - crp at 1 year; hs - crp in the placebo group increased by 5% in men and did not change in women (6). The few studies that investigated the effects of weight loss on hs - crp in individuals with diabetes were small, achieved minimal weight reductions, and did not adjust for changes in both fitness and glucose control (13). Our study indicates that moderate weight loss in obese individuals with type 2 diabetes is associated with a substantial reduction in hs - crp levels and that decreased adiposity is an independent predictor of hs - crp reduction after accounting for improvements in fitness, glucose, and lipid control . Debate continues on whether fitness and weight loss have independent effects on inflammation (14). This is of particular interest in the care of obese sedentary individuals with diabetes, in whom an increase in physical activity may occur without associated weight loss . Mechanisms are emerging that explain how increased fitness, via associated improvements in autonomic nervous system function, may decrease macrophage proinflammatory cytokine production independently of weight loss (15). Dpp evaluated physical activity, obtained from participant self - report, and concluded that weight loss, not physical activity, accounted for the changes in hs - crp at 1 year; however, fitness was not assessed (6). Our study showed that the moderate improvement in fitness observed with ili in our generally obese and sedentary participants with type 2 diabetes was associated with a reduction in hs - crp, but the effects were attenuated (p = 0.06) when weight loss was taken into account . Our findings do not exclude the possibility that greater changes in fitness could have a stronger effect on hs - crp change or that the same change in fitness in less obese individuals with diabetes could be associated with hs - crp change independently of weight loss . The predominant role of adiposity on the regulation of the inflammatory response is not surprising . Adipose tissue is in itself a source of crp and a major producer of interleukin-6, a key stimulator of crp secretion (16). In obesity, adipose tissue contains an increased number of resident macrophages and t cells, which interact closely with adipocytes to modulate the inflammatory response (17,18). It was interesting to find that the associations between improvements in hdl cholesterol and triglyceride levels and the decrease in hs - crp with ili were independent of improved fitness, glucose control, and weight loss . Hdl is known to bind to adipocytes (19) and to possess anti - inflammatory properties, including an inhibitory effect on monocyte chemoattractant protein-1 (20), an important player in macrophage recruitment to adipose tissue (21). Elevated levels of hs - crp have been found in individuals with familial hypoalphalipoproteinemia, in whom hdl cholesterol levels are low and the risk of coronary disease is high (22). Triglyceride - rich lipoproteins and nonesterified fatty acids are taken up by neutrophils and monocytes, with generation of reactive oxygen species and production of cytokines (23). In our study, the effects of hdl cholesterol and triglyceride change on hs - crp variance were attenuated and no longer significant when both were included in the same model (model q). The pearson correlation coefficient for change in hdl cholesterol and change in triglycerides (0.26) suggests that this attenuation was not the result of collinearity . The effects of improved glucose control with lifestyle on hs - crp were of particular interest to us in light of the recent study by pradhan et al . (7) in individuals with type 2 diabetes, in whom a 14-week course of insulin glargine was shown to abrogate the hs - crp reduction seen in the placebo group . The mechanisms that would explain this finding are difficult to determine, given that the effects were reported to be independent of weight gain and because it has been previously shown that hyperglycemia stimulates inflammatory cytokine production (24). The report suggested that the deleterious effect of insulin therapy on the inflammatory state could explain the lack of benefit of improved glycemic control on incident cardiovascular events found in recent clinical trials . Our study showed that improved glycemic control with ili was associated with a reduction in hs - crp at 1 year . The favorable association of improved glycemia and hs - crp change was independent of changes in adiposity and persisted after accounting for multiple covariates, including statin and tzd use, and was not affected by changes in insulin therapy with ili (p = 0.50). Our results, in agreement with a previous small study in subjects with diabetes (13) and with experimental evidence linking hyperglycemia with increased cytokine production, indicate that improved glucose control per se does not worsen the inflammatory state in individuals with diabetes . A cross - sectional observation in which the correlation between glycemia and hs - crp was not significant after adjustment for bmi (3) seems to contradict the robust effect of improved glucose control with ili on hs - crp observed in our study . However, findings between studies cannot be compared; the former study evaluated correlation at baseline, whereas this report evaluated variable changes at 1 year . Lowering glucose with improved dietary and physical activity behaviors, as observed in look ahead, may reflect the disruption of the paracrine loop between adipocytes and macrophages that promotes inflammation, both locally and systemically, and insulin resistance (25). Our report supports a substantial benefit of lifestyle intervention for weight loss on the chronic inflammatory state characteristic of diabetes and highlights the contribution of improved glycemic control achieved with lifestyle changes to the reduction of elevated hs - crp levels in obese sedentary individuals with diabetes . Follow - up of cardiovascular outcomes in look ahead will confirm whether the improvement in hs - crp with behavioral changes in lifestyle will translate into a reduction of cardiovascular events.
|
It is a labile protein which is comprised of 393 amino acids, folded and unstructured regions that function in a synergistic manner and responsible for induction of cell cycle arrest or apoptosis based on the cellular damage, stress, and cell type . In cell cycle, it acts as a transactivator that negatively regulates cell division by controlling a set of genes required for this process such as cyclin - dependent kinases, protein kinases, and cyclin - dependent inhibitors . In apoptosis, it is responsible for highly complex and sophisticated processes involving energy - dependent cascade of molecular events . Induction of apoptosis is mediated either by bax stimulation and antigen expression of fas or by repression of bcl-2 expression . Human hsp70 functions as atp - dependent molecular chaperone which plays a crucial role in proteins folding, assembly or disassembly of other protein structures, and protecting from cell stress [3, 4]. Human hsp70 has 640 amino acids and is comprised of two structurally independent domains such as nucleotide binding domain (nbd) and c - terminal substrate binding domain (sbd). Nbd (residues 1380) is responsible for atpase activity while sbd (residues 397641) plays the key role in binding of peptides and folding of nonnative polypeptides . In addition, a hydrophobic linker of 13 residues (384396) that carries a highly conserved leucine - rich motif (eevd) is connected between nbd and sbd . There has been evidence that the xenopus laevis p53 can bind to mammalian hsp70 protein . The formation of p53-hsp70 complex might enhance stabilization of p53 in cancer cells, thus increasing killing efficiency of cancer cells . However, the process of hsp70 molecular chaperone involved in the buffering of p53 conformation and activity is not clear up until now . In this study, we have explored for the first time how the nbd interacts with p53 motif . We then determined the binding affinity and stability of nbd - p53 motif complex structure through molecular docking and dynamics (md) simulation . Therefore, the results could help in designing the structure based drug hsp70 for cancer treatment . The complete amino acid sequence of hspa1a was obtained from rcsb protein databank (pdb: 1hjo). The protein model was visualized using pymol software . Currently, there is no tertiary structure of homo sapiens dna binding domain of p53 available in the protein database . The complete amino acid sequence of dna binding domain of p53 was retrieved from uniprot (uniprotkb: p04637). Blastp against the rcsb protein databank was carried out to find a suitable template for homology modeling . Crystal structure of 1ycs was selected as a template based on maximum identity with high positives and lower gaps percentage . The percentages of query coverage, sequence identity, positivity, and gap between the template and target protein were 100%, 100%, 100%, and 0%, respectively . The three - dimensional structure of dna binding domain of p53 was built using easymodeller 2.1 software, the graphical user interface (gui) of modeller 9.10, and the model was then viewed using pymol software . The three - dimensional model of the dna binding domain of p53 motif (scmggmnr) was created using the built three - dimensional model of dna binding domain of p53 as a template . The gromacs package 4.6.3 adopting the gromos 53a6 force field parameter was employed to perform 50 ns md simulation for the p53 motif before blind docking with the nbd protein . The three - dimensional model of nbd protein was used for molecular docking with the tertiary structure of p53 motif (scmggmnr) using autodock version 4.2 program . In the protein, nonpolar hydrogen atoms were merged and total kollman and gasteiger charge was added to the protein . Kollman and gasteiger partial charges were also assigned to the ligand and all torsions were allowed to rotate during docking . The nbd and p53 motif were converted from the pdb format to the pdbqt format . A grid box was used around the active site to cover the entire protein binding site and allow ligands to move freely; and affinity maps of nbd (74 88 108 containing total grid points of 727575) were calculated by autogrid . One hundred lamarckian genetic algorithm (lga) runs with default parameter settings were performed . The largest docked conformations were clustered at rms of 1.0 nm and played according to the rank of the native autodock scoring function . The interactions of complex nbd protein - p53 motif conformations including hydrogen bonds and bond lengths were analyzed . In the 50 ns md simulation, the docked complex of p53 motif with nbd protein was simulated using the gromacs package 4.6.3 adopting the gromos53a6 force field parameter . We used a cubic box setting a minimal distance of 1.0 between the protein and edge of the box, which was then solvated using periodic boundary conditions and the spc (simple point charge) water model in this study . The ligand topology file was generated using the prodrg server to include the heteroatom due to limitations of gromacs to parameterize the heteroatom group in the pdb file . To make the system neutral the entire system for the nbd protein was minimized using 993 steps of steepest descent, respectively . After energy minimization with particle - mesh ewald algorithm at every step, the system was then equilibrated at a constant temperature (303 k), volume, number of particles in system, and pressure (1 bar) for 50 ps . Under constant volume equilibration moreover, under constant pressure equilibration, the temperature was controlled by berendsen weak coupling method and the pressure was maintained by parrinello - rahman barostat method . After completion of the two equilibration phases, production of md simulation was conducted for 1 ns after taking away the position restraints . Finally, the equilibrated structures were subjected to md simulations for 50 ns (50,000 ps) with linear constrain (lincs) algorithm 2 fs time step to constrain all the bonds . The nonbonded list was generated using an atom - based cut - off of 10 . Root mean square deviations (rmsd), backbone atomic fluctuations (rmsf), secondary structure, hydrogen bonds, and salt bridge between the protein and ligand in the docked complex during the simulation were analyzed through gromacs utilities g_rmsd, g_rmsf, do_dssp, g_hbond, and g_salt, respectively . Homo sapiens hspa1a - p53 interaction was identified using string version 9.1 program . Figure 1 shows that hspa1a either directly interacted with p53 or used intermediate stub1 to connect with p53 . Stub1 is stip1 homology and u - box containing protein 1 which modulates several chaperone complexes' activity such as hsp70, hsc70, and hsp90 . It has e3 ubiquitin - protein ligase activity and targets misfolded chaperone substrates towards proteasomal degradation . It also mediates transfer of noncanonical short ubiquitin chains to hspa8 that have no effect on degradation of hspa8 ., only two experimental studies demonstrated the detection of human hspa1a - p53 complex by affinity capture western assay and in vivo assay . In mammalian cancer lines, hspa1a was found to associate with p53 in the cytoplasm but the complex dissociates upon translocation of p53 into the nucleus . Both of the experimental results show that p53-hsp70 complex formation might be one of the mechanisms of stabilization of p53 protein resulting in its increased levels in potentially malignant and malignant tumors [14, 15]. However, to date, the process of hsp70 molecular chaperone participating in the buffering of p53 conformation and activity is not known clearly, where p53 plays important role in inhibition of tumorigenesis . Based on studies by fourie et al . (2004), it has been described that hsp70 interacts with p53 dbd (dna binding domain) [1618]. P53 dbd contains 191 amino acids (from residue 102 to residue 292). Mutations usually occur in dbd . This causes deactivation of p53 by destroying the ability of the protein to bind to its target dna sequences, thus preventing transcriptional activation of these genes . For example, mutation of p53 dbd at residue 248 (arginine) distorts the protein structure . There are three regions in p53 dbd such as region 1 (from residue 113 to 226) which is required for interaction with fbx042; region 2 (from residue 116 to 292) involved in interaction with ax1n1; and region 3 (from residue 241 to 248) that interacts with the 53bp2 sh3 domain . Scmggmnr (region 3) transmits antiproliferative signals through 53bp2 sh3 domain to antiapoptotic bcl2 family proteins (bcl-2, bcl - w, and bcl - xl). Therefore, molecular dynamics simulation and docking approaches have been used to determine the preferred sites, binding affinity, and stability of the hspa1a - p53 motif complex structure . The docking analysis revealed that nbd had a strong bond with p53 motif due to negative and low binding energy (0.44 kcal / mol). The total intermolecular energy of nbd - p53 motif complex was 9.9 kcal / mol . Other binding parameters of p53 motif such as electrostatic energy (3.70 kcal / mol), internal energy (4.23 kcal / mol), torsion energy (9.55 kcal / mol), unbounded extended energy (4.23 kcal / mol), cluster rms (0.0), and reference rms (61.53) were also determined . In addition, the nbd protein formed four hydrogen bonds with p53 motif (figure 2 and table 1). The nbd - p53 motif complex was run for 50 ns molecular dynamics simulation . The rmsd value of the protein - ligand complex model against the simulation period is shown in figure 3(a). It can be seen that the nbd - p53 motif complex achieved a stable value at 45,000 ps (0.20 nm). Moreover, the rmsd value was less deviated throughout the 50 ns simulation time . Results from rmsf analysis show that all the residues in the protein structure fluctuated between 0.05 and 0.30 nm in the entire simulation period (figure 3(b)). The nbd - p53 complex exhibited a high fluctuation up to 0.54 nm at residue 380 . Furthermore, salt bridges occurring between the nbd protein and p53 motif are demonstrated in figure 3(c). The protein - ligand complex exhibited a stable distance of 2.50 nm throughout the simulation period . The deviation in flexibility was further analyzed by the number of hydrogen bonds formed between the nbd protein and p53 motif during md simulation (figure 3(d)). The hydrogen bond analysis revealed that nbd - p53 motif complex shows four intermolecular hydrogen bonds, which were determined throughout the simulation period . At least 1 - 2 intermolecular hydrogen bonds were kept for the entire 50 ns trajectories, which inferred the stability of nbd - p53 motif complex . In addition, history - independent hydrogen bond autocorrelation function was calculated between the protein and the ligand (figure 3(e)). Furthermore, the secondary structure also plays an essential role in stability of such a system . Figure 3(f) indicates that the alpha-, 5-, and 3-helixes were constant throughout the simulation period which infers that the protein - ligand complex structure was stable . Rmsd, rmsf, salt bridge, hydrogen bond, and secondary structure analyses have proven that the protein interaction between the nbd protein and p53 motif was stable . In addition, nbd of hspa1a had a strong bond with p53 motif (scmggmnr). Therefore, the current data would be highly encouraging for in vitro experiments of gene therapy in cancer treatment . Moreover, a better understanding of in silico interpretations of this protein structure will aid in the development of target - specific anticancer drugs for cancer treatment.
|
In 2014, researchers and medical personnel celebrated the 25th anniversary of the discovery of hepatitis c virus (hcv). The first publication on the new virus genome appeared in 1989.1 after that, comprehensive study of new hcv and related disease began, including diagnostics, pathogenesis, and epidemiology . The official registration of acute hcv (ahcv) infection in the russian federation began in 1994 . The standard case definition for ahcv was adapted from world health organization recommendations.2 it is necessary to diagnose ahcv based on epidemiological and clinicobiochemical findings, such as the presence of newly identified markers of hcv antibodies to hcv (anti - hcv) and hcv rna . Anti - hcv detection has a special diagnostic value for acute hepatitis discrimination in disease dynamic (after 46 weeks) after negative results of this marker in the early stage of the disease . The presence of hcv rna in the phase of serological window is an important diagnostic criterion . Five years later (1999), the registration of chronic hcv (chcv) cases also began in the russian federation . Moreover, since the beginning, all laboratories dealing with virology and clinical diagnostics reported on the testing for anti - hcv and registered all positive results . The aim of the current review was to summarize available epidemiological data and to reveal the main manifestation of the epidemic process of hcv infection in the russian federation in the modern period . Having a territory of 17,098,246 km, russia is the largest country in the world, covering more than one - eighth of the earth s inhabited land area . Russia is also the world s ninth most populous nation with 143 million people as of 2012 . According to the national constitution,3 the country comprises 85 federal subjects, including 46 oblasts (provinces), 22 republics, and nine krais (same as oblasts). Designation is historic, originally given to frontier regions and later also to administrative units that comprised autonomous all federal subjects are grouped into eight federal regions on geographical and economical principles: north - west, central, southern, north - caucasus, volga, ural, siberian, far east . It is important to analyze all types of infection by territories to define the scale of disease distribution and risk regions . We carried out the retrospective epidemiological analysis of morbidity rate (the incidence per 100,000) for ahcv and chcv infections . More than 200,000 cases of ahcv infection and 700,000 cases of chcv infection that were registered in 19942013 in the country were included in the epidemiological analysis . We studied the incidence by year, distribution among different federal territories, age group, risk group, the main route of transmission, and the factors of risk . For analysis, data from the state statistical accounts4,5 of infectious morbidity rate (incidence) in the russian federation and analytical tables sent from the territories for ahcv and chcv were used . For chronic cases, the mean incidence of newly detected patients who were registered in the current year was calculated . For chcv cases, the prevalence rates for different years, age groups, and territories were also calculated . This article also contains characteristics of hcv distribution in the russian federation based on the results of testing of different risk groups for anti - hcv in 20112013 . For testing of the risk groups for anti - hcv, commercial hcv genotyping tests have been available in the russian federation since 2000 . In this review the dynamics of ahcv cases in russia during 19942013 could be characterized by different trends (figure 1), in different periods . For example, in 19942001, the epidemic curve rose, which reflected the active spread of hcv and increase in acute clinical cases . The maximum incidence rate was seen in 2001 reaching 22.2/100,000 . From 2001 up to now, the epidemic curve looks like a descending line that characterizes the annual decrease in incidence due to a significant reduction of hcv infection . In general, dynamics of ahcv incidence in different federal territories of russia was absolutely synchronous during 19942013 . The difference was only in the level of incidence and the year of maximal incidence . During 19992000, the maximal incidence was registered in north - west (44.5/100,000) and ural (37.0/100,000) federal territories (figure 2). Meaning that both territories had similar active risk factors for virus spread . After 2007, the maximum incidence was reported by ural with comparatively high rates reaching 3.33.5/100,000 . Minimal ahcv incidence rates were reported by provinces located in the southern federal region during all years . In these territories, the maximum of ahcv reported was registered in 2001 (10/100,000), ie, three to four times less than in north - west and ural . Since the middle of 2000 the incidence data are available only for the past 4 years and rates were lower than in all other federal regions during this period (20102013). During all years, the ahcv incidence in children aged 014 years was significantly lower in comparison with rates in teenagers (1519 years) and adults . For instance, in the period of active hcv spread in 19992000, the national incidence of ahcv in persons older than 15 years was 25/100,000, but in children less than 14 years this rate was only 3/100,000 . In the present time, the age distribution of ahcv is characterized by very low incidence (<1/100,000) in children and in adults older than 50 years . It is important to note that the third ranking position in the recorded incidence of hcv among children younger than 14 years of age takes into account children up to 1 year . In 2009, the incidence rate in this age group was 4.2/100,000, in 2012 2.8/100,000, and in 2013, it fell to 1.5/100,000 . It should be noted that the proportion of children younger than 1 year in all cases of ahcv among children younger than 14 years does not fall <50% in recent years . It should be emphasized that the diagnosis of a child younger than 1 year can be established only with the appropriate clinical and biochemical parameters and viral rna detection . . The maximal level of ahcv in 2013 was registered in two age groups; 2029 years and 3039 years (figure 3). Owing to such age distribution of ahcv cases, it is important to analyze the possible routes of virus transmission . The information on routes of hcv transmission / risk factors is summarized in figure 4 and includes data on 6,800 patients registered in 20112013 as ahcv cases . In children aged 014 years, the principal significance has been the transmission of hcv from the mother with chcv to her child during pregnancy or labor . The analysis of data about likely routes routes of hcv infection and risk factors the 3 year period showed that the main route of transmission in children younger than 14 years is vertical, which is caused by children younger than 1 year . These materials confirm that the problem of hcv vertical transmission exists on site and medical professional should pay attention to it . In adults the most important risk factor is sexual contact with probable source of infection (32.6%); the second significant risk was connected with sharing needles and syringes during intravenous drug use (21.7%); and the third risk factor was mainly related to cosmetic procedures, including tattooing and piercing (7.6%). It is important to note that in 37.5% of patients, risk factors for hcv transmission remained unknown . This percentage of patients was more than among the children 014 years (21.1%). The poorest results of epidemiological investigations were in adults older than 40 years because risk factors were not determined in 66.7% of cases . In this age group, the most significant risk factors were sexual contacts (17.7%) and cosmetic procedures (9.0%). It should be emphasized that drug use as a risk factor in this age group was reported only in 3.8% of cases almost six times less than in the younger adult group of 2039 years . In general, medical manipulations did not play any visible role in hcv transmission in the modern time . The biggest proportion of this risk factor reaching 2.9% was found in persons older than 40 years . Thus, it is important to emphasize, probable risk factors of hcv transmission in children were vertical transmission, involving children aged younger than 1 year in the russian federation in 20112013 . It required careful justification using modern molecular - biological methods of diagnosis, and the obtained data confirm that the problem of hcv vertical transmission existed in russia . In adults, the most significant risk factor was intravenous drug use in the age group of 2039 years . Iatrogenic transmission played a minimal role and was more visible in the group of persons older than 40 years . The study of hcv routes of transmission and risk factors among children aged 014 years and adults is only preliminary, and requires detailed analysis over a longer period of time . The dynamics of registration of newly diagnosed chcv cases, unlike ahcv, is characterized by an ascending trend since 1999 . The registration rate (incidence) for chcv increased in the russian federation from 12.9/100,000 in 1999 to 39.3/100,000 in 2013, ie, more than three times (figure 1). In general, the morbidity rate maintained at 3940/100,000 in the russian federation since 2008 . Probably meaning that the maximum detection of new chcv cases is already reached . The dynamic of newly detected chcv cases in different federal territories varied significantly by rates and trends of morbidity . In three federal territories (far east, ural, and north - west), the incidence of chcv reached 47.2/100,000 (far east), 48.3/100,000 (ural), and 67.8/100,000 (north - west; figure 5). The registration curve in the north - west has manifested ascending type, but in the ural, the increase was interrupted in 2009 and then the decreasing trend became clear . During the last 2 years (20122013), chcv registration the same as in ural tendency was also registered in the far east territory . Trends of chcv registration in the volga and siberia federal territories are similar to those in the whole country and could be characterized as ascending . In 2013, three other federal territories had chcv level less than the level in the whole country, but dynamic curves look different . For instance, the trend in the central federal territory was ascending with chcv incidence in 2013 equal to 32.6/100,000 . The curve in the southern territory could be described as plateaued with weak tendency to decrease (22.9/100,000 in 2013). Rates in north - caucasus (data available for analysis only for the last 4 years) were stable, 1213/100,000 . The age distribution of newly registered chcv cases is characterized by maximal rates in the age group 2049 years (figure 6). The highest incidence reaching 96.3/100,000 two age groups (2029 years and 4049 years old) have shown the same rates 53/100,000 . Such age distribution of chronic cases reflects the epidemic situation of hcv spread at the end of 1990s . These data support the idea that hcv is not a children s infection . In comparison with newly detected chcv cases (incidence), the disease prevalence (accumulated cases) gives more complete vision of epidemiological situation in the territory . In 2013, the chcv prevalence in the country reached 335.8/100,000 (figure 7). The highest chcv prevalence was registered in the north - west region, ural, and far east (670.4/100,000, 587.5/100,000, and 585.6/100,000, respectively). The chcv prevalence in the volga federal region was higher than the average country level (425.9/100,000) and in the remaining four regions, it was lower than the prevalence found in the whole country (range from 243.8/100,000 in siberia to 142.4/100,000 in north - caucasus). In most administrative territories, the maximal chcv prevalence was reported in the age group 3039 years in 2013 (figure 8). This correlates with ahcv age - specific incidence rates in 19992000 showing the highest levels in the age group 1529 years . In age - specific structure of prevalence in all the main territories in the country, the proportion of persons in the age group 3039 years was the highest among all the chcv cases . The average proportion of this age group was 24% in the whole country with fluctuations from 20% to 29.5% . The far east and north - caucasus regions could be excluded from the mentioned common age - specific structure because in these territories, the second rank among chcv patients belonged to persons in the age group 4049 years . In other territories, the persons of age group 4049 years had only third rank with rates varying from 17% to 23% . The proportion of children up to and including 14 years of age and teenagers 1519 years of age with chcv did not exceed 3% in total . Age - specific rates of chcv designated as prevalence per 100,000 of population look unlike the age structure of cases . In 2013, the highest prevalence was reported in the age group 3039 years . The average prevalence in this age group in the country reached 684/100,000, but in three regions, these rates were even higher: ural region 1,257/100,000, north - west region 1,179/100,000, and volga region 944/100,000 . Such prevalence means that 1% of the population in this age group was infected with hcv . The second rank in half of the territories (north - west, far east, south, north - caucasus) in 2013 belonged to adults 4049 years of age, but in other four territories (ural, volga, siberia, and central) to the age group of 2029 years . Such distribution of territories by age - specific prevalence gives evidence concerning intensity of involvement of different age groups in hcv transmission during previous years . It should be noted that the chcv prevalence in the age group 3039 years was maximal in ural and north - west regions . At the same time, the second rank in the ural region belonged to the age group of 2029 years (842/100,000), but in the north - west region to the age group of 4049 years (878/100,000). It is logical to assume that in the ural region, the intensive spread of hcv took place in younger persons than in the north - west region in previous years . The fourth rank by chcv prevalence belonged to persons of 5059 years of age, but with different levels of rates . Relatively high levels similar to the average rate in the whole territory in the age group of 5059 years were demonstrated by north - west (567/100,000), far east (531/100,000), and south (298/100,000) regions . Annually, 1516 million tests for anti - hcv are performed in 20 different population risk groups in the russian federation . Four risk groups had the highest anti - hcv rates in 20112012 (figure 9): newborns from chcv infected women (10.3%14.3%), persons from correctional facilities (11.8%10.6%), patients with chronic liver diseases (6.9%6.1%), and clients from clinics for sexually transmitted disease patients and drug users (5.8%5.2%). Relatively high anti - hcv rates were detected in patients from hemodialysis settings, units of renal transplantation, cardiovascular and lung surgery, and hematology (2.6%2.9%). This is rather a big group of patients who are under high risk of hcv transmission . In this group, special attention in one independent study revealed that 25%40% of patients in hemodialysis units were anti - hcv positive.6 also patients with different kinds of chronic pathology had high proportion of anti - hcv positivity reaching 2.9%3.1% . Relatively high anti - hcv rates were detected in household contacts of chcv patients (1.8%1.9%) and in patients who were admitted to hospital for planned surgery (1.6%). Pregnant women infected with hcv represent a special risk group because of possible virus transmission to newborns . Overall, in the country, anti - hcv was detected in 1.3% of pregnant women in 20112012 . This rate was similar to the level in patients admitted to hospital for planned surgery or in household contact with chcv patients . It could be suggested that anti - hcv rate of 1% reflected an average frequency of chronic asymptomatic hcv infection in the population of the russian federation . In different territories, for example, high anti - hcv rates (> 2%) were reported in 15 territories of the country in 2010 . These territories also reported chcv incidence and prevalence rates higher than the average rate in the country . It can indirectly indicate the existence of correlation between frequency of anti - hcv and chcv prevalence . Possibly, the rising probability of transmitting hcv from mothers to their newborn children cannot be excluded . It is also very interesting to analyze results of anti - hcv tests in persons admitted to hospital for planned surgery . In 20112013, it is important to note that this index was two times higher than the frequency of hepatitis b surface antigen (hbsag) in the same group of patients . Perhaps, it can be explained by accumulation of more patients chronically infected with hcv in comparison with patients with chronic hepatitis b virus (hbv) infection because of the higher potential of hcv to produce chronic infection . In 20112013, the highest levels of anti - hcv in planned surgery patients were found in the central federal territory (1.7%), far east (2.1%), and ural (3.3%). One of the first important studies concerning hcv genotypes distribution in russia was published by researchers from moscow institute of virology in 1996.7 they demonstrated that five virus subtypes (1a, 1b, 2a, 2b, and 3a) circulated in the russian federation with significant domination of hcv1b (68.9%). These data were confirmed in 1997 by another independent group that revealed hcv1b subtype in 76% of hcv patients who were tested.8 a special study of hcv genotypes in st petersburg in 19992000 showed statistically significant differences in hcv subtype distribution between hcv cases in patients attending infectious diseases clinics and in dialysis patients.6 five subtypes (3a, 1b, 1a, 2a, and 4a [in order of frequency]) were found in outpatients, while three subtypes (1b, 3a, and 2c) circulated in dialysis patients . Subtype 3a was the dominant subtype in outpatients (51% of cases), followed by subtype 1b (40% of cases). It was noted that in st petersburg, 56% of patients with hcv who attended infectious disease clinics were between 11 years and 20 years of age, 63% of whom were infected with subtype 3a and only 33% with subtype 1b . However, among patients older than 20 years, subtype 1b was prevalent (49%), followed by subtype 3a (36%). These data were also confirmed by other authors.9 subtype 1b was dominant in all dialysis patients and accounted for 89% of cases . Later, researchers from st petersburg demonstrated the recombination of natural intergenotypes between subtypes 2k and 1b, designated as rf_2k/1b.10 the finding of a 2k/1b recombinant strain in 5% of hcv - infected patients in st petersburg has shown that this particular recombinant hcv strain was not only viable but had also spread in the city . This hcv strain was also revealed in different regions of russia and other countries evidenced its wide spread.1114 the latest data on distribution of hcv genotypes published in 2012 confirmed results of previous research,15 ie, the domination of hcv1b subtype in general population (57.1%) as in hemodialysis patients (83.6%). The second rank belonged to hcv3a in both studied groups (29.7% and 16.4%, respectively). The dynamics of ahcv cases in russia during 19942013 could be characterized by different trends (figure 1), in different periods . For example, in 19942001, the epidemic curve rose, which reflected the active spread of hcv and increase in acute clinical cases . The maximum incidence rate was seen in 2001 reaching 22.2/100,000 . From 2001 up to now, the epidemic curve looks like a descending line that characterizes the annual decrease in incidence due to a significant reduction of hcv infection . In general, dynamics of ahcv incidence in different federal territories of russia was absolutely synchronous during 19942013 . The difference was only in the level of incidence and the year of maximal incidence . During 19992000, the maximal incidence was registered in north - west (44.5/100,000) and ural (37.0/100,000) federal territories (figure 2). Meaning that both territories had similar active risk factors for virus spread . After 2007, the maximum incidence was reported by ural with comparatively high rates reaching 3.33.5/100,000 . Minimal ahcv incidence rates were reported by provinces located in the southern federal region during all years . In these territories, the maximum of ahcv reported was registered in 2001 (10/100,000), ie, three to four times less than in north - west and ural . Since the middle of 2000, the incidence data are available only for the past 4 years and rates were lower than in all other federal regions during this period (20102013). During all years, the ahcv incidence in children aged 014 years was significantly lower in comparison with rates in teenagers (1519 years) and adults . For instance, in the period of active hcv spread in 19992000, the national incidence of ahcv in persons older than 15 years was 25/100,000, but in children less than 14 years this rate was only 3/100,000 . In the present time, the age distribution of ahcv is characterized by very low incidence (<1/100,000) in children and in adults older than 50 years . It is important to note that the third ranking position in the recorded incidence of hcv among children younger than 14 years of age takes into account children up to 1 year . In 2009, the incidence rate in this age group was 4.2/100,000, in 2012 2.8/100,000, and in 2013, it fell to 1.5/100,000 . It should be noted that the proportion of children younger than 1 year in all cases of ahcv among children younger than 14 years does not fall <50% in recent years . It should be emphasized that the diagnosis of a child younger than 1 year can be established only with the appropriate clinical and biochemical parameters and viral rna detection . . The maximal level of ahcv in 2013 was registered in two age groups; 2029 years and 3039 years (figure 3). Owing to such age distribution of ahcv cases, it is important to analyze the possible routes of virus transmission . The information on routes of hcv transmission / risk factors is summarized in figure 4 and includes data on 6,800 patients registered in 20112013 as ahcv cases . In children aged 014 years, the principal significance has been the transmission of hcv from the mother with chcv to her child during pregnancy or labor . The analysis of data about likely routes routes of hcv infection and risk factors the 3 year period showed that the main route of transmission in children younger than 14 years is vertical, which is caused by children younger than 1 year . These materials confirm that the problem of hcv vertical transmission exists on site and medical professional should pay attention to it . In adults the most important risk factor is sexual contact with probable source of infection (32.6%); the second significant risk was connected with sharing needles and syringes during intravenous drug use (21.7%); and the third risk factor was mainly related to cosmetic procedures, including tattooing and piercing (7.6%). It is important to note that in 37.5% of patients, risk factors for hcv transmission remained unknown . This percentage of patients was more than among the children 014 years (21.1%). The poorest results of epidemiological investigations were in adults older than 40 years because risk factors were not determined in 66.7% of cases . In this age group, the most significant risk factors were sexual contacts (17.7%) and cosmetic procedures (9.0%). It should be emphasized that drug use as a risk factor in this age group was reported only in 3.8% of cases almost six times less than in the younger adult group of 2039 years . In general, medical manipulations did not play any visible role in hcv transmission in the modern time . The proportion of medical manipulations as risk factor was only 1% of cases . The biggest proportion of this risk factor reaching 2.9% was found in persons older than 40 years . Thus, it is important to emphasize, probable risk factors of hcv transmission in children were vertical transmission, involving children aged younger than 1 year in the russian federation in 20112013 . It required careful justification using modern molecular - biological methods of diagnosis, and the obtained data confirm that the problem of hcv vertical transmission existed in russia . In adults, the most significant risk factor was intravenous drug use in the age group of 2039 years . Iatrogenic transmission played a minimal role and was more visible in the group of persons older than 40 years . The study of hcv routes of transmission and risk factors among children aged 014 years and adults is only preliminary, and requires detailed analysis over a longer period of time . The dynamics of registration of newly diagnosed chcv cases, unlike ahcv, is characterized by an ascending trend since 1999 . The registration rate (incidence) for chcv increased in the russian federation from 12.9/100,000 in 1999 to 39.3/100,000 in 2013, ie, more than three times (figure 1). In general, the morbidity rate maintained at 3940/100,000 in the russian federation since 2008 . Probably meaning that the maximum detection of new chcv cases is already reached . The dynamic of newly detected chcv cases in different federal territories varied significantly by rates and trends of morbidity . In three federal territories (far east, ural, and north - west), the chcv incidence was higher than the average level in the country . The incidence of chcv reached 47.2/100,000 (far east), 48.3/100,000 (ural), and 67.8/100,000 (north - west; figure 5). The registration curve in the north - west has manifested ascending type, but in the ural, the increase was interrupted in 2009 and then the decreasing trend became clear . During the last 2 years (20122013), chcv registration the same as in ural tendency was also registered in the far east territory . Trends of chcv registration in the volga and siberia federal territories are similar to those in the whole country and could be characterized as ascending . In 2013, three other federal territories had chcv level less than the level in the whole country, but dynamic curves look different . For instance, the trend in the central federal territory was ascending with chcv incidence in 2013 equal to 32.6/100,000 . The curve in the southern territory could be described as plateaued with weak tendency to decrease (22.9/100,000 in 2013). Rates in north - caucasus (data available for analysis only for the last 4 years) were stable, 1213/100,000 . The age distribution of newly registered chcv cases is characterized by maximal rates in the age group 2049 years (figure 6). The highest incidence reaching 96.3/100,000 two age groups (2029 years and 4049 years old) have shown the same rates 53/100,000 . Such age distribution of chronic cases reflects the epidemic situation of hcv spread at the end of 1990s . It should be noted that chcv incidence in children is very low one to three cases per 100,000 . These data support the idea that hcv is not a children s infection . In comparison with newly detected chcv cases (incidence), the disease prevalence (accumulated cases) gives more complete vision of epidemiological situation in the territory . In 2013, the highest chcv prevalence was registered in the north - west region, ural, and far east (670.4/100,000, 587.5/100,000, and 585.6/100,000, respectively). The chcv prevalence in the volga federal region was higher than the average country level (425.9/100,000) and in the remaining four regions, it was lower than the prevalence found in the whole country (range from 243.8/100,000 in siberia to 142.4/100,000 in north - caucasus). In most administrative territories, the maximal chcv prevalence was reported in the age group 3039 years in 2013 (figure 8). This correlates with ahcv age - specific incidence rates in 19992000 showing the highest levels in the age group 1529 years . In age - specific structure of prevalence in all the main territories in the country, the proportion of persons in the age group 3039 years was the highest among all the chcv cases . The average proportion of this age group was 24% in the whole country with fluctuations from 20% to 29.5% . The far east and north - caucasus regions could be excluded from the mentioned common age - specific structure because in these territories, the second rank among chcv patients belonged to persons in the age group 4049 years . In other territories, the persons of age group 4049 years had only third rank with rates varying from 17% to 23% . The proportion of children up to and including 14 years of age and teenagers 1519 years of age with chcv did not exceed 3% in total . Age - specific rates of chcv designated as prevalence per 100,000 of population look unlike the age structure of cases . In 2013, the highest prevalence was reported in the age group 3039 years . The average prevalence in this age group in the country reached 684/100,000, but in three regions, these rates were even higher: ural region 1,257/100,000, north - west region 1,179/100,000, and volga region 944/100,000 . Such prevalence means that 1% of the population in this age group was infected with hcv . The second rank in half of the territories (north - west, far east, south, north - caucasus) in 2013 belonged to adults 4049 years of age, but in other four territories (ural, volga, siberia, and central) to the age group of 2029 years . Such distribution of territories by age - specific prevalence gives evidence concerning intensity of involvement of different age groups in hcv transmission during previous years . It should be noted that the chcv prevalence in the age group 3039 years was maximal in ural and north - west regions . At the same time, the second rank in the ural region belonged to the age group of 2029 years (842/100,000), but in the north - west region to the age group of 4049 years (878/100,000). It is logical to assume that in the ural region, the intensive spread of hcv took place in younger persons than in the north - west region in previous years . The fourth rank by chcv prevalence belonged to persons of 5059 years of age, but with different levels of rates . Relatively high levels similar to the average rate in the whole territory in the age group of 5059 years were demonstrated by north - west (567/100,000), far east (531/100,000), and south (298/100,000) regions . Annually, 1516 million tests for anti - hcv are performed in 20 different population risk groups in the russian federation . Four risk groups had the highest anti - hcv rates in 20112012 (figure 9): newborns from chcv infected women (10.3%14.3%), persons from correctional facilities (11.8%10.6%), patients with chronic liver diseases (6.9%6.1%), and clients from clinics for sexually transmitted disease patients and drug users (5.8%5.2%). Relatively high anti - hcv rates were detected in patients from hemodialysis settings, units of renal transplantation, cardiovascular and lung surgery, and hematology (2.6%2.9%). This is rather a big group of patients who are under high risk of hcv transmission . In this group, special attention in one independent study revealed that 25%40% of patients in hemodialysis units were anti - hcv positive.6 also patients with different kinds of chronic pathology had high proportion of anti - hcv positivity reaching 2.9%3.1% . Relatively high anti - hcv rates were detected in household contacts of chcv patients (1.8%1.9%) and in patients who were admitted to hospital for planned surgery (1.6%). Pregnant women infected with hcv represent a special risk group because of possible virus transmission to newborns . Overall, in the country, anti - hcv was detected in 1.3% of pregnant women in 20112012 . This rate was similar to the level in patients admitted to hospital for planned surgery or in household contact with chcv patients . It could be suggested that anti - hcv rate of 1% reflected an average frequency of chronic asymptomatic hcv infection in the population of the russian federation . In different territories, for example, high anti - hcv rates (> 2%) were reported in 15 territories of the country in 2010 . These territories also reported chcv incidence and prevalence rates higher than the average rate in the country . It can indirectly indicate the existence of correlation between frequency of anti - hcv and chcv prevalence . Possibly, the rising probability of transmitting hcv from mothers to their newborn children cannot be excluded . It is also very interesting to analyze results of anti - hcv tests in persons admitted to hospital for planned surgery . In 20112013, it is important to note that this index was two times higher than the frequency of hepatitis b surface antigen (hbsag) in the same group of patients . Perhaps, it can be explained by accumulation of more patients chronically infected with hcv in comparison with patients with chronic hepatitis b virus (hbv) infection because of the higher potential of hcv to produce chronic infection . In 20112013, the highest levels of anti - hcv in planned surgery patients were found in the central federal territory (1.7%), far east (2.1%), and ural (3.3%). One of the first important studies concerning hcv genotypes distribution in russia was published by researchers from moscow institute of virology in 1996.7 they demonstrated that five virus subtypes (1a, 1b, 2a, 2b, and 3a) circulated in the russian federation with significant domination of hcv1b (68.9%). These data were confirmed in 1997 by another independent group that revealed hcv1b subtype in 76% of hcv patients who were tested.8 a special study of hcv genotypes in st petersburg in 19992000 showed statistically significant differences in hcv subtype distribution between hcv cases in patients attending infectious diseases clinics and in dialysis patients.6 five subtypes (3a, 1b, 1a, 2a, and 4a [in order of frequency]) were found in outpatients, while three subtypes (1b, 3a, and 2c) circulated in dialysis patients . Subtype 3a was the dominant subtype in outpatients (51% of cases), followed by subtype 1b (40% of cases). It was noted that in st petersburg, 56% of patients with hcv who attended infectious disease clinics were between 11 years and 20 years of age, 63% of whom were infected with subtype 3a and only 33% with subtype 1b . However, among patients older than 20 years, subtype 1b was prevalent (49%), followed by subtype 3a (36%). These data were also confirmed by other authors.9 subtype 1b was dominant in all dialysis patients and accounted for 89% of cases . Later, researchers from st petersburg demonstrated the recombination of natural intergenotypes between subtypes 2k and 1b, designated as rf_2k/1b.10 the finding of a 2k/1b recombinant strain in 5% of hcv - infected patients in st petersburg has shown that this particular recombinant hcv strain was not only viable but had also spread in the city . This hcv strain was also revealed in different regions of russia and other countries evidenced its wide spread.1114 the latest data on distribution of hcv genotypes published in 2012 confirmed results of previous research,15 ie, the domination of hcv1b subtype in general population (57.1%) as in hemodialysis patients (83.6%). The second rank belonged to hcv3a in both studied groups (29.7% and 16.4%, respectively). Hcv continues to remain one of the main problems in the public health sector in the russian federation . Currently, the manifestations of an epidemic process of hcv based on data of registers of acute and chronic forms of hcv has undergone significant changes . It was established that hcv epidemiological features are characterized by: low incidence of ahcv cases in all territories of the country (from 22.2/100,000 in 2001 to 1.5/100,000 in 2013, ie, more than 14 times); increase in registration (incidence) of newly detected chronic cases of infection (from 12.9/100,000 in 1999 to 39.3/100,000 in 2013, ie, more than three times); a significant increase in cumulative rate of chcv cases (prevalence) that reached 335.8/100,00 and in most administrative territories, higher in specific age groups (3049 years); low hcv incidence and prevalence in children in comparison with adults; a rise in hcv rates in specific population groups (newborns from chronically infected mothers, persons from correctional facilities, patients with chronic liver diseases, and clients from clinics for std patients and drug users); the use of molecular - genetic methods in epidemiological diagnostics for hcv, that will make it possible to reliably establish the source of the infection, routes, and factors of transmission; and domination of hcv1b virus subtype and rising importance of hcv3a subtype and newly designated recombinant rf_2k/1b . Low incidence of ahcv cases in all territories of the country (from 22.2/100,000 in 2001 to 1.5/100,000 in 2013, ie, more than 14 times); increase in registration (incidence) of newly detected chronic cases of infection (from 12.9/100,000 in 1999 to 39.3/100,000 in 2013, ie, more than three times); a significant increase in cumulative rate of chcv cases (prevalence) that reached 335.8/100,00 and in most administrative territories, higher in specific age groups (3049 years); low hcv incidence and prevalence in children in comparison with adults; a rise in hcv rates in specific population groups (newborns from chronically infected mothers, persons from correctional facilities, patients with chronic liver diseases, and clients from clinics for std patients and drug users); the use of molecular - genetic methods in epidemiological diagnostics for hcv, that will make it possible to reliably establish the source of the infection, routes, and factors of transmission; and domination of hcv1b virus subtype and rising importance of hcv3a subtype and newly designated recombinant rf_2k/1b . All the aforementioned data are extremely important for planning and implementation of primary, secondary, and tertiary preventive measures for the control of hcv infection in the russian federation.
|
The risks of exaggerated haemodynamic responses during anaesthesia and surgery and development of awareness has been a cause for concern in patients undergoing caesarean section, concurrent to the practice of avoidance of sedatives and anxiolytics until delivery . Laryngoscopy and intubation causes exaggerated haemodynamic responses and monitoring indices, such as the bispectral index (bis) and auditory evoked potential index, have shown these patients to be in lighter planes of anaesthesia . Potential benefit can be obtained by the addition of an agent that could enhance analgesia and amnesia without adverse effects on the mother or foetus . We aimed to assess the efficacy and safety of low - dose ketamine, used as an adjunct analgesic and amnesic, in attenuating the haemodynamic responses to laryngoscopy, intubation and surgery during caesarean section under general anaesthesia (ga). The occurrence of awareness based on clinical signs and the foetal outcome were also assessed . This prospective, double blinded, randomised study was conducted from october 2012 to june 2015 . Following approval from hospital ethical committee, 40 consenting patients aged 1845 years, with> 36 weeks gestation, posted for elective caesarean section, who were not willing for regional anaesthesia, were studied . Exclusion criteria comprised of presence of maternal co - morbidities, foetal distress and patient refusal . The patients were randomly allotted to two groups by computer generated random sequence of numbers . Following a thorough pre - anaesthetic evaluation, the patients were kept fasting for 8 h. the patients were premedicated with metoclopramide 10 mg and ranitidine 150 mg on the night prior to and on the morning of surgery . On arrival in the operation theatre, an 18 g cannula was inserted and lactated ringer's solution was started and a wedge was kept under the right buttock . Pulse - oximeter, electrocardiogram and non - invasive blood pressure (nibp) monitors were attached, and the abdomen was cleaned and draped . Following 3 min pre - oxygenation, the study group (group k) received 0.25 mg / kg body weight ketamine diluted to 5 ml, whereas the control group (group c) received 5 ml normal saline intravenously (iv) just before induction of anaesthesia . All patients underwent rapid sequence induction with thiopentone 5 mg / kg followed by suxamethonium 2 mg / kg and were intubated with 6.5 or 7 mm cuffed endotracheal tube . After confirming correct tracheal placement of the tube, vecuronium 0.1 mg / kg was given iv, and patients were ventilated with oxygen and nitrous oxide mixture (40:60%) with 0.7% endtidal isoflurane maintaining normocarbia and normoxia . Following delivery of the baby, fentanyl 2 /kg and midazolam 2 mg were given iv and oxytocin 20 units in 500 ml ringer lactate was started as an infusion . Heart rate (hr), systolic and mean arterial pressures (map) were documented just before induction (baseline), then at 1, 3, 5, 7, 9, 12, 15, 20, 30 and 45 min after induction of anaesthesia . Patients were intubated immediately, following documentation of the haemodynamic parameters at 1 min after induction . Gas analysis of umbilical vein blood was done and partial pressure of oxygen, carbon dioxide and ph were noted . Time taken from skin incision to delivery of the baby and time from uterine incision to delivery of the baby were also noted . Based on results of the previous study by baraka et al . On the changes in mean systolic blood pressure (sbp) (114 9.0 vs. 127 14), with 95% confidence and 90% power, minimum sample size was calculated to be 17 in each group to get statistically significant results . Whitney test to compare the demographics, hr, blood pressure, umbilical vein ph, po2, pco2, skin incision to delivery time, uterine incision to delivery time and the apgar score between group c and group k. fisher's exact test was applied to find the association of intraoperative lacrimation and hallucinations . The patients in both the groups were comparable with respect to the distribution of age, height, weight and american society of anesthesiologists physical status . The baseline hr, sbp and map of both the groups did not show any significant difference between the groups . However at 3, 5, 7, 9, 12, 15, 20, 30 and 45 min after induction, group c showed a significantly high hr and sbp (p <0.05) [table 1, figures 1 and 2]. The map at baseline, 1, 3 and 12 min in both the groups were comparable . At the same time, map at 5, 7, 9, 15, 20, 30, 45 min showed significant difference with group c having higher values (p <0.05) [table 2]. Comparison of mean heart rate (per min) changes in mean heart rate changes in mean systolic blood pressure comparison of mean map at various time intervals (mm hg) in both groups, the time taken from time of skin incision to delivery of baby (11.25 2.38 and 11.30 1.98 min) and the time for foetal delivery from the time of uterine incision (130.50 36.49 and 112 38.74 s) were comparable [table 3]. Umbilical vein po2, pco2 and ph were also comparable in both the groups [table 3, figure 3]. Though apgar score at 1 min showed a higher values in group k, at 5 min both groups had comparable scores [figure 3]. Comparison of delivery time and foetal outcome comparison of umbilical vein blood gases and apgar scores higher number of the patients in group c had intraoperative lacrimation as compared to group k (50% vs. 0%, p <0.001). Ten percent of the patients in group c had hallucinations / recall of intraoperative events while none of the patients in group k experienced the same, but the difference was statistically insignificant (p = 0.487). Maternal hypotension and drug related foetal depression cause concerns in the practice of obstetric anaesthesia . However, regional anaesthesia remains the preferred choice in obstetric practice on account of its well established maternal and foetal benefits . The major indications for ga are foetal distress, abruption, eclampsia, uterine rupture and a prolonged and obstructed labour . Maternal refusal of regional techniques, inadequate regional block, or any contraindication for regional techniques such as coagulopathies or the presence of local infection may however necessitate administration of ga . The major concerns include difficulty in intubation, increased risk of aspiration, increased blood loss intraoperatively and development of awareness during anaesthesia . Though ga is associated with a higher blood loss as compared to neuraxial anaesthesia, it is considered to be of uncertain clinical relevance . Apart from the added risks associated with physiological changes of pregnancy, the need to withhold sedatives and opioids until delivery of the baby to avoid foetal depression further complicates the management of ga for caesarean section . Exaggerated haemodynamic responses are commonly observed at laryngoscopy, intubation and initial stages of surgery as the depth of anaesthesia will be less compared to other routine surgeries under ga . The incidence of intraoperative awareness is more during caesarean sections under ga . Ensuring an end - tidal concentration of volatile agent> 0.8 mac makes awareness unlikely . However, the lack of availability of advanced respiratory gas monitors in many hospitals makes the accurate titration of the volatile agent concentration difficult . While the administration of high concentrations of volatile agents can result in postpartum haemorrhage, low concentrations result in exaggerated stress responses and awareness . The overwhelming concerns towards foetal well - being results in a tendency to use lower concentrations of volatile agents . This along with the practice of withholding opioids and benzodiazepines until foetal delivery could result in inadequate analgesia . Quite often the only analgesic provided to these patients until the delivery of the baby is nitrous oxide alone, which is a poor analgesic . Along with a decrease in the volatile agents and analgesics, a higher oxygen concentration (fi02 0.5) is often used even though there is no rationale for an inspired oxygen concentration above 0.33 in the absence of foetal compromise . This practice further reduces the analgesic effects of nitrous oxide . In the presence of foetal distress, even higher inspired concentrations of oxygen may be used . In the present study, we used 0.7% isoflurane with 40% nitrous oxide in oxygen for maintenance of anaesthesia till delivery following the existing practice at our institute . We believed that an adequate depth of anaesthesia would be ensured with this concentration as it had been shown that use of 0.7% endtidal isoflurane along with 60% nitrous oxide provided one mac in the age group of 2030 years . Intraoperative hypertension, tachycardia, lacrimation, sweating, coughing and patient movements could indicate development of awareness . Bis monitoring has been proven to be effective for monitoring depth of anaesthesia and scores <60 has been recommended to prevent the occurrence of awareness . However, its availability and cost limit its routine use . As caesarean section is a commonly performed surgery, which is being performed even in hospitals with minimum monitors, bis or auditory evoked potential index monitoring or even endtidal inhalation agent monitoring may not be available . Hence, a practical approach to minimize the problems of inadequate analgesia and awareness in these circumstances will be the use of analgesics with amnesic properties, with proven maternal and neonatal safety, from the beginning of surgery itself . However, use of ketamine as a sole induction agent in caesarean section is not recommended as it causes significant maternal haemodynamic changes . In addition, doses> 1 mg / kg can theoretically increase uterine tone and jeopardise foetal circulation . However, these disadvantages could be overcome by careful dosing and by combining it with other drugs . It was shown that addition of a small dose of ketamine to thiopentone for induction provided reduced analgesic requirement without side effects and was found not to affect maternal or foetal well - being . It has been shown that ketamine when given along with propofol can reduce the hypotensive effects of propofol . Used as an adjunct in doses of 1 mg / kg, 0.5 mg / kg and 0.25 mg / kg, ketamine had resulted in comparable maternal intraoperative haemodynamic parameters, apgar scores and post - operative analgesia . A single bolus dose of ketamine was found to decrease post - operative opioid requirements, and adverse effects were not increased with low - dose ketamine . Hence, low - dose ketamine has been recommended as a safe and useful adjuvant to standard practice opioid - analgesia . The advantage of using lower doses of ketamine is that the incidence of adverse effects can be reduced . Prophylactic iv ketamine 0.25 mg / kg was found to be effective in preventing intraoperative shivering during caesarean sections under subarachnoid block . In our study, patients were intubated immediately after documenting the haemodynamic parameters at 1 min following induction . Therefore, the haemodynamic parameters recorded at this point did not reflect the intubation response . In fact, the haemodynamic parameters recorded following laryngoscopy and intubation actually correspond to the values recorded at 3 min after induction and later . The time interval for nibp measurements was set at 2 min in the initial period so as to minimise distraction of the anaesthesiologist . The blunted haemodynamic responses observed from 3 min onwards extending throughout the study period indicate that ketamine 0.25 mg / kg effectively attenuated the stress response to laryngoscopy, intubation and surgery . The umbilical vein blood gas analysis and apgar score reflect adequacy of the uteroplacental circulation . Better apgar scores observed in ketamine group at 1 min in our study could be because of the attenuated stress response to laryngoscopy, intubation and surgery . As the sympathetic stimulation was less intense in this group, it could have resulted in lower plasma catecholamine levels, less vasoconstriction and normal placental perfusion . Though statistically insignificant, the higher mean po2 and lower mean pco2 observed in the ketamine group support this [table 3]. The main disadvantage of our study was that our observations were linked to the clinical signs for detection of the development of awareness . Though intraoperative lacrimation / tachycardia / hypertension could reflect development of awareness, these signs are not specific . The availability of bis monitoring would have provided more reliable information on the depth of anaesthesia . However, the addition of low dose ketamine to the general anaesthetic regimen can still be considered for reducing the occurrence of intraoperative awareness . Iv ketamine 0.25 mg / kg, when used as an adjunct analgesic and amnesic, attenuates the haemodynamic responses during caesarean section under ga without affecting the foetal outcome.
|
Autonomic dysfunction presents with heterogeneous clinical features and is a multi - system condition affecting nervous, cardiac, gastrointestinal, musculoskeletal and vocal cord function . Autonomic dysfunction is often a result of an imbalance in the sympathetic and parasympathetic nervous system . This case study demonstrates the association of vocal cord disorders in autonomic dysfunction and the role of yoga to modulate autonomic balance . A 23-year - old female with a past medical history of severe gastroesophageal reflux disease presented with shortness of breath and fatigue . I do not feel like i am getting enough oxygen to my brain, being suffocated in closed spaces and with certain smells . Shortness of breath was associated with inspiratory wheeze, fatigue, chest pain, lightheadedness, headache, numbness / tingling in the arms and legs, and exercise intolerance . Alternative lifestyle changes such as using a cold mist humidifier, sleeping flat, and breathing with mouth open were helpful . Orthostatic vitals recorded in the supine, sitting, and standing positions at 3 min intervals were positive [figure 1]. Work - up included normal electrocardiogram, chest x - ray, chest computed tomography, and echocardiogram . Complete blood count, comprehensive metabolic panel, and thyroid - stimulating hormone levels were normal . Arterial blood gas showed respiratory alkalosis with compensatory metabolic acidosis both before and after exercise . Pulmonary function tests showed hyperventilation and flattening of the inspiratory portion of the volume flow loop . Exercise stress test showed an exercise capacity of 59% of normal [figure 2]. She was counseled to increase fluid intake and referred to speech therapy for breathing exercises . Orthostatic vital signs recorded at three - minute intervals volume flow loop and exercise stress test results on follow - up, her shortness of breath improved after 6 weeks of a yoga training program including isometric and diaphragmatic breathing exercises . Initially, she used to have daily symptoms; after the yoga program, she had symptoms only a couple of times a week . At times, when she did have shortness of breath, she took deep breaths with her mouth open (pursed lip inspiration), and her shortness of breath improved . This case report demonstrates the association of vocal cord dysfunction with dysautonomia and the central role of an imbalanced autonomic system in the pathophysiology of both, where yoga may provide a therapeutic role in their management . Autonomic dysfunction was demonstrated by positive orthostatic vitals and a complex of autonomic symptoms, including headaches, lightheadedness, brain fog, chest pain, gastroesophageal reflux, and numbness / tingling . Vocal cord dysfunction was demonstrated by flattening of the inspiratory portion of the flow volume loop and dyskinesia of the vocal cords by laryngoscopy . A multifactorial approach including increased fluid intake, breathing, and isometric exercises resulted in the improvement of symptoms . Vocal cord dysfunction is associated with autonomic disorders, including shy - drager syndrome and multiple system atrophy (msa). Upper airway obstruction due to vocal cord dysfunction has been observed via laryngoscope in 8 of 10 patients with progressive pan - autonomic failure of shy - drager syndrome . The mechanism of the selective involvement of abductor muscle (posterior muscle) of the vocal cord in autonomic dysfunction is unknown . The key to the pathophysiology of both autonomic and vocal cord dysfunction is the role of the vagus nerve in interfacing homeostasis . Vocal cord dysfunction, abnormal adduction of vocal cords, and laryngeal hyper - responsiveness are suggested to be the functions of altered autonomic balance . The vagus nerve influences autonomic functions respiratory, cardiac cycles, and gut motility . An inflammatory insult can disrupt the normal functioning of the vagus nerve resulting in an altered autonomic function with paroxysmal movement of the vocal cords . Stimuli such as exercise or odors induce parasympathetic reflexes causing airway narrowing at the glottis level . Given the central role of the vagus nerve, breathing and isometric exercises may be therapeutic in the management of autonomic dysfunction . Inspiratory muscle training (imt) is therapeutic for both vocal cord and autonomic dysfunction . In a case report of a patient with exercise - induced paradoxical vocal fold motion (pvfm), imt for 5 weeks resulted in no pvfm symptoms at the end of the study . The results showed increased inspiratory muscle strength, improved maximal exercise capacity, and reduced exercise - induced dyspnea . Respiratory maneuvers and isometric exercises are also beneficial in autonomic failure . In a study measuring mean arterial pressure, isometric exercises such as leg muscle tensing reduced orthostatic hypotension . Respiratory maneuvers including inspiratory - pursed lips breathing and inspiratory sniffing reduced orthostatic hypotension in autonomic failure via activation of the respiratory pump . The inter - relationship between vocal cord and autonomic dysfunction may have profound implication in the diagnosis and management of autonomic disorders . More correlative data studying the relationship between vocal cord dysfunction and autonomic disorders need to be analyzed . Given breathing and isometric exercises are therapeutic to both vocal cord and autonomic dysfunction, there is a need for well - designed clinical trials investigating the role of breathing and isometric exercises in the role of autonomic dysfunction . Vocal cord dysfunction is often associated with dysautonomia . Given the central role of the vagus nerve in autonomic and vocal cord dysfunction, breathing and isometric exercises aid in the regulation of physiologic responses and
|
Congenital adrenal hyperplasia (cah) is an autosomal recessive adrenal steroid synthesis disorder that is transferred genetically and is characterized by increased adrenocorticotropic hormone (acth) secretion due to glucocorticoid and mineralocorticoid deficiency . An increase in acth synthesis can result in hyperplasia of acth - sensitive tissues in the adrenal glands and other sites such as the testes, leading to testicular masses widely known as tart, or testicular adrenal rest tumor . Tart is often an asymptomatic benign lesion that frequently occurs in male cah patients with a reported prevalence of up to 94% . Yet, the prevalence, etiology, and functional features of testicular tumors due to 11-hydroxylase deficiency are not clearly known . The present article is a case study of bilateral tart in a patient with 11-hydroxylase deficiency - driven cah . A 16-year - old male patient was referred from the pediatrics clinic to our clinic with a diagnosis of 11-hydroxylase deficiency - driven cah after the determination of bilateral testicular masses . The patient's history revealed a diagnosis of 11-hydroxylase deficiency - driven cah at a young age . Although the patient's laboratory data from an early age were not available, the patient had been using dexamethasone 10.75 mg and spironolactone 1100 mg irregularly . The physical examination revealed multiple bilateral solid nodules in the testes of approximately 0.5 to 1.5 cm . The results of routine hematologic and biochemical tests and the levels of prolactin, luteinizing hormone, and follicle - stimulating hormone were normal . The values of serum markers for testis tumors, such as alpha - fetoprotein (afp), beta - human chorionic gonadotropin (hcg), and lactate dehydrogenase (ldh), were within normal ranges . Cortisol, acth, and dehydroepiandrosterone sulfate levels were likewise normal, unlike the elevated levels of 17-hydroxyprogesterone and 11-deoxycortisol, which were 23 ng / ml (<2 ng / ml) and 238 ng / ml (<8 ng / ml), respectively . Scrotal ultrasonography revealed the following testicular sizes: right, 41 mm21 mm, and left, 43 mm22 mm . Both testes contained multiple solid heterogenic hypoechoic nodules of different sizes ranging from approximately 21 mm15 mm to 14 mm10 mm with well - drawn borders and increased vascularity as indicated by the arrows (fig . Scrotal magnetic resonance imaging revealed multiple solid nodules with the largest diameter being 18 mm in the right testis and 11 mm in the left . After intravenous gadolinium injection, intense homogeneous contrast accumulation was seen in the nodular lesions with contoured lobes and well - drawn borders (fig . The patient's sperms were cryopreserved in case he underwent bilateral orchiectomy on the basis of malignant pathological findings . Because the testicular tumor could not be differentiated as malignant or benign on the basis of the laboratory and imaging findings, the patient underwent a right high inguinal testicular exploration . Because the report of the frozen section analysis was benign, orchiectomy was not performed . After the tunica albuginea was sutured, the testis was placed back into the scrotum . Histopathological analysis revealed that the cells forming the mass were similar to leydig cells with separated fibrous tissue; significant, nucleolus, eosinophilic cytoplasm; and polygonal shapes forming in some areas nests and at other areas layers . Immunohistochemical analysis revealed that the tumor cells totally diffused with vimentin and melan - a but were focally immunopositive to inhibin and creatine . Placental alkaline phosphatase and ae1/ae3 were immunonegative and the tissue was defined as tart (fig . The patient was diagnosed with tart, glucocorticoid treatment was initiated, and the patient was followed up . Moreover, tart is generally seen in insufficiently treated or untreated patients with cah owing to the elevated acth levels . Hence, it is often detected in adolescents and young adults . In the present case, changes in the levels of 11-deoxycortisol to cortisol and 11-deoxycorticosterone to corticosterone were decreased owing to the defect in 11-hydroxylase activity . A decrease in cortisol levels leads to acth stimulation and thus to growth in adrenal tissue and adrenal ectopic tissues . Tarts are very difficult to differentiate from leydig cell tumors (lcts), which are mostly common in stromal testicular neoplasia leading likewise to precocious puberty and testicular masses . The presentation of these two entities is the same, yet the therapeutic approaches differ . Whereas lcts require surgical treatment, most cases of tarts respond to steroid - suppressive therapy . In the diagnosis of tart and malignant tumors, although the initial evaluation of the present case was in favor of testicular malignancy (lcts) or tart, for differentiation, biopsy results are considered to be conclusive . The clinical manifestations of tarts are changes in blood pressure and bilateral tumors accompanied by a family history of tart . The bilateral presence of tart is determinant in diagnosis; however, 3% of bilateral masses consist of lcts . Precocious puberty and gynecomastia might be evident in both; however, gynecomastia is more frequent in lct . The laboratory findings supporting tart are hypokalemia and normal tumor indicators such as hcg, afp, and ldh . In ultrasonography, tart is prevalent in the form of multiple hypoechoic nodules, whereas lcts appear as single hypoechoic nodules . The present case was a 16-year - old male patient with a history of hypertension and multiple bilateral lesions . Therefore, in the present case, a high inguinal testicular exploration with nodal excision was done to analyze frozen sections to determine the prospective treatment modality . In case the histopathological diagnosis was malignant and bilateral orchiectomy was thus unavoidable, cryopreservation was done before the procedure . Because the frozen section report was benign, orchiectomy was not performed ., the patient was enrolled into the follow - up protocol and referred to pediatric endocrinology for glucocorticoid treatment planning . Although tart is not among the prevalent tumors, one of the most important problems is its differentiation from malignant tumors . Despite the fact that clinical, radiological, and biochemical indicators support the diagnosis, histopathological diagnosis is decisive . In patients with cah, early diagnosis and conservative treatment in tart patients is essential because a delayed radical approach will result in prospective infertility and testicular hypofunction . In the present case, clinical, radiological, and biochemical diagnoses supported tart; yet biopsy to make a decisive diagnosis could not be conducted . In conclusion, to prevent irreversible testicular damage, early detection of tart is important . Cah patients should be regularly followed up for tart, and those with nodular testicular lesions should be well evaluated before any invasive treatment and diagnosis modalities are preferred by urologists.
|
Diabetic retinopathy (dr) is a major microvascular complication of diabetes accounting for its leading cause of irreversible blindness worldwide . Assessing the risk factors of dr, particularly modified risk factors, is important for early intervention to reduce the onset and progression of dr . These studies consistently established that a longer diabetic duration, hyperglycemia, and hypertension were associated with increased risk of dr . High lipid levels are known to cause endothelial dysfunction due to a reduced bioavailability of nitric oxide and this endothelial dysfunction was suggested to play a role in retinal exudate formation in dr . It was also reported that the peroxidation of lipids in lipoproteins in the vascular wall leads to local production of reactive carbonyl species that mediate recruitment of macrophages, cellular activation and proliferation, and also chemical modification of vascular proteins by advanced lipoxidation end - products which affect both the structure and function of the vascular wall . Consequently, it was proposed that, hyperlipidemia might contribute to dr and macular edema (me) by endothelial dysfunction and breakdown of the blood retinal barrier leading to exudation of serum lipids and lipoproteins . To determine correlation between severity of dr with serum lipid and other modifiable risk factors in type 2 diabetic patients . To determine correlation between severity of dr with serum lipid and other modifiable risk factors in type 2 diabetic patients . This was a retrospective study done in department of endocrinology and metabolism llrm medical college . A total number of 140 type 2 diabetic patients with dr were recruited from diabetic clinic during may 2011 till june 2012 . Information including age, sex, height, body weight (wt), body mass index (bmi), waist - hip ratio (whr), and systolic and diastolic blood pressure was collected from each patient . Fasting plasma sugar, low density lipoprotein (ldl), triglyceride level (tg), high density lipoprotein (hdl), glycated hemoglobin (hba1c), creatinine, and 24 h urinary albumin excretion was done for each patient . Estimated glomerular filtration rate (egfr) was measured by modification of diet in renal disease (mdrd). Patients were divided in five groups according to retinopathy status based on early treatment dr study (etdrs) disease severity level . Statistical analysis was performed with statistical packages for social sciences (spss) statistical software (version 17.0 for windows). As shown in table 1 there was statistically significant positive correlation between severity of dr and systolic blood pressure p = 0.005 (r = 0.974), diastolic blood pressure p = 0.001 (r = 0.994), ldl p = 0.005 (r = 0.976), tg p = 0.001 (r = 0.990), and 24 h urinary albumin p = 0.004 (r = 0.977). Dr was also strongly positively correlated with smoking p = 0.017 (r = 0.941) and duration of diabetes p = 0.003 (r = 0.981). There was strong negative correlation of dr with hdl p = 0.001 (r = -0.994) and egfr p = 0.002 (r = -0.987). Endothelial dysfunction is a well - known finding in hypercholesterolemic patients and it was proposed that, hyperlipidemia might contribute to dr and me by endothelial dysfunction and breakdown of the blood retinal barrier leading to exudation of serum lipids and lipoproteins . In this study we have evaluated the modifiable risk factor of dr and there correlation with severity of dr . There are conflicting reports in the literature regarding the effect of lipid profile on retinopathy or maculopathy . In etdrs it was shown that patients with high total cholesterol and ldl levels were more likely to have retinal hard exudates compared to patients with normal lipid profile . In our study, we found a significant correlation between serum lipids and dr, but there was no association between hba1c and dr . Similarly, chennai urban rural epidemiology study showed that mean cholesterol, triglyceride, and non - hdl levels were higher in patients with dr compared to those without dr . Hypercholesterolemia, systolic and diastolic blood pressure, renal function, and urine albumin excretion is significantly associated with progression of dr.
|
This cross - sectional study included 229 patients who applied to sleeping centers under the supervision of the neurology and chest diseases clinics of kayseri education and research hospital, kayseri, turkey between june and august 2013 and were given a date for polysomnography (psg) for the first time . We used the socio - demographical data form, the beck depression inventory (bdi), pittsburgh sleep quality index (psqi), and the world health organization quality of life scale (whoqol - bref). The required organizational consent was obtained from the secretary general of the state hospitals association of kayseri and informed consent was obtained from the participants of the study . Hisli19 tested the reliability and validity of the scale, which was developed by beck et al,20 for a turkish society the scale consists of 21 items and each item is given a score between 0 - 3 . The score distribution of bdi is as follows: mild depression (11 - 17 points), moderate depression (18 - 29 points), and severe depression (30 - 63 points). This was developed by buysse et al,21 and was adapted to turkish by agargun et al.22 the psqi is a self - rating questionnaire of 19 items that assess sleep quality and disturbances over the last one - month . It is composed of 24 questions, 19 of which are self - rated, and 5 of which are to be rated by the bed partner or roommate . Eighteen of the scored items comprises 7 components: subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep disturbances, use of sleeping medication, and daytime dysfunction . Each component is rated by 0 - 3 points . The total score of 7 components yields the global psqi score . The whoqol (tr) for turkish people is a questionnaire that assesses how an individual perceives quality of life . Its validity and reliability for a turkish population were studied by eser et al.23 the whoqol - bref (tr) is a short form of the who quality of life for turkish people . The questions asked refer to the last 15 days . In all the questions, except for the first 2 general questions, the scores can be calculated for physical, social, psychological, environmental, and national environment fields . The questions are of a typical 5-level likert item ordinal rating scale type . As the scores increase in the physical, psychological, social, environmental, and national environment fields rated between 0 - 20 points, the quality of life increases . The statistical analysis of the data was conducted using the statistical package for social sciences version 17.0 (spss inc ., chicago, il, usa). To analyze the constant variables, parametric and non - parametric tests were applied after normal distribution suitability test . We used the student t - test for independent groups to compare 2 groups; kruskal - wallis variant analysis (post hoc test: dunn s method) was used to compare more than 2 groups; the chi - square test was used to compare categorical variables . We used the socio - demographical data form, the beck depression inventory (bdi), pittsburgh sleep quality index (psqi), and the world health organization quality of life scale (whoqol - bref). The required organizational consent was obtained from the secretary general of the state hospitals association of kayseri and informed consent was obtained from the participants of the study . Hisli19 tested the reliability and validity of the scale, which was developed by beck et al,20 for a turkish society the scale consists of 21 items and each item is given a score between 0 - 3 . The score distribution of bdi is as follows: mild depression (11 - 17 points), moderate depression (18 - 29 points), and severe depression (30 - 63 points). This was developed by buysse et al,21 and was adapted to turkish by agargun et al.22 the psqi is a self - rating questionnaire of 19 items that assess sleep quality and disturbances over the last one - month . It is composed of 24 questions, 19 of which are self - rated, and 5 of which are to be rated by the bed partner or roommate . Eighteen of the scored items comprises 7 components: subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep disturbances, use of sleeping medication, and daytime dysfunction . Each component is rated by 0 - 3 points . The total score of 7 components yields the global psqi score . The whoqol (tr) for turkish people is a questionnaire that assesses how an individual perceives quality of life . Its validity and reliability for a turkish population were studied by eser et al.23 the whoqol - bref (tr) is a short form of the who quality of life for turkish people . The questions asked refer to the last 15 days . In all the questions, except for the first 2 general questions, the scores can be calculated for physical, social, psychological, environmental, and national environment fields . The questions are of a typical 5-level likert item ordinal rating scale type . As the scores increase in the physical, psychological, social, environmental, and national environment fields rated between 0 - 20 points, the quality of life increases . The statistical analysis of the data was conducted using the statistical package for social sciences version 17.0 (spss inc ., chicago, il, usa). To analyze the constant variables, parametric and non - parametric tests were applied after normal distribution suitability test . We used the student t - test for independent groups to compare 2 groups; kruskal - wallis variant analysis (post hoc test: dunn s method) was used to compare more than 2 groups; the chi - square test was used to compare categorical variables . Based on the psg applied to 229 patients between june and august 2013 at sleep centers, 150 of the patients were found to have osas; 49 had snoring problems; 20 had restless legs syndrome (rls); and 10 had sleep rapid eye movements (rem) osas . The mean age of the individuals in the study group was 49 years (range 18 - 71), 52% were male; 92.1% were married; 38% were secondary school graduates; 63.8% resided in cities, 63.3% were employed (table 1). Among the patients, 44.1% had at least one chronic disease, and 37.8% had diabetes mellitus (dm); 45% had hypertension (ht); 17.2% had congestive heart failure (chf). The mean psqi score of the patients was 7 (1 - 19) and the sleep quality of 60.7% of the subjects was bad, while it was good for 39.3% . The median score (min - max) of the patients was 11 (0 - 47). According to bdi, it was observed that 25.8% of the patients had depressive symptoms, and 38.4% had mild depression, while 21.4% had moderate, and 4.4% had severe depression (table 2). When we compared the good or poorer sleep qualities of the patients in relation to various variables, the mean age of the patients with poorer sleep quality was significantly higher than that of patients with good sleep quality . Patients who were married, unemployed, with chronic disease, and with a moderate depression had significantly poorer sleep quality . Patients with good sleep quality were found to have significantly higher scores in all fields of quality of life than patients with poorer sleep quality (p<0.05) (table 3). Based on the correlation analyses, a significantly negative correlation was found among bdi, psqi scores, and whoqol - bref life quality sub - scale scores (p<0.05). A significantly positive correlation was found between the scores of psqi and bdi . On the other hand, a significantly positive correlation was found between the scores of the whoqol - bref life quality sub - scales (p<0.05) (table 4). The scores of the polysomnography patients in psqi, bdi, and whoqol - bref scales . Median (25 - 75 percentiles), arithmetic meanstandard deviation, psqi - pittsburgh sleep quality index, woqol - bref - world health organization quality of life scale the correlation among sleep, quality of life, and depressive symptom level scores among polysomnography patients . In the study, the mean age of the patients with poorer sleep quality was found to be significantly higher than that of patients with good sleep quality . Sleep problems are common in the advanced age adult population.16,24,25 the main reasons for this are the high prevalence of medical and psychosocial morbidity and frequency of using multiple drugs, rather than aging.25 sleep disorder has a significantly negative effect on the mortality and morbidity of the elderly population in particular.7,26 fadiloglu et al27 reported in their study that as age increases, the quality of sleep gets worse . In our study, we think that the deterioration of sleep with aging may be related to the disruption of sleep rhythm in the form of daytime sleeping and daily life activities associated with social position and age, such as having a lot of medical problems, psychosocial stressors, retirement, staying at home, and so forth . Sleep quality was found to be significantly poorer in married patients than in single patients in this study . In their study a determiner for lower quality of sleep is not seen as a universal factor . Since it is obvious that a good number of variables such as internal marriage affairs and person s partner s health condition may affect one s partner on a positive or negative way . The health of one s partner may have positive or negative effects on the other . The quality of sleep was observed to be worse in unemployed patients than in employed patients . In their studies, saygili et al29 stated that they observed no difference in sleep quality between employed students and unemployed students . Lower sleep quality prevalence was found among the elderly people living in cities.30 good sleep quality is an expected situation for employed patients . Being able to work not only indicates that the individual is physically and mentally more healthy, but also means that the person is engaged in daily activities and thus able to maintain the sleep - awake cycle better . In addition, being able to work is an indicator of self - dependent in both economical terms and life functions; in other words, not needing anyone s help at all may mean being protected from psychosocial stress, which may possibly result in losing sleep . In fact, while the psqi global scores and depression scores of the unemployed patients were significantly higher than those of employed patients, their physical, mental, and environmental fields whoqol - bref scores were significantly lower . We found in this study that patients with a chronic disease had significantly worse sleep quality . In their studies, senol et al28 reported that patients with a chronic disease had higher psqi global scores while they had significantly lower sleep quality . We can list ht, depression, cardiovascular diseases, and cerebrovascular diseases among the diseases that may develop in patients with sleep disorder . On the other hand, individuals with any one of these diseases have a higher risk of developing sleep disorders.25 in fact, in our study, sleep quality was significantly worse in patients with dm and htn than in patients without . Gunes et al31 reported that the sleep quality of 34% of the patients with dm was referred to as bad . Consequently, having a chronic disease may play a role not only in discomfort resulting from pain, movement restriction, and other symptoms related to the type of illness, but also in the decline of sleep quality due to expected lower life quality because of possible mental problems such as depression associated with a chronic disease, which made it more apparent . Patients with depressive symptoms and severe depressive symptoms were found to have significantly poorer sleep quality in the study . Sleeplessness results in difficulty in falling asleep, problems with maintaining sleep, low quality sleep (non - restorative sleep), deterioration in performing functions the next day, and psychological distress . Chronic insomnia is accompanied by several physical and psychiatric causes.32 depression is the greatest risk factor for sleeplessness.31 although depression is accepted as a common reason for sleeplessness, the causal relation between sleep disorder and depression has been controversial in recent times.33 when poorer sleep quality is combined with more than one comorbidity, depression is more likely to occur among these people . Moreover, as this will cause further deterioration in sleep quality, the diagnosis of depression symptoms is of great importance.34 consequently, there is an obvious correlation between depression and sleep quality . Therefore, since restoring one may result in the restoration of the other case, it is highly important to take precautions to closely follow and treat the mental problems and sleep problems of people who are older and have a chronic medical disease in particular . There was a significantly negative correlation among the scores of whoqol - bref life quality subscales, bdi, and psqi, as observed in our study . Sleep disorders are also closely related to changing mental states, decreased life quality, and increased mortality.12 in their studies, schuiling et al35 reported a significant decrease in the sleep quality of patients with severe sleep problems . The negative effect of depression on life quality is suggested in numerous studies.36 - 38 bayar et al39 stated that bad sleep quality results in a decrease in sf-36 scores, that leads to a decrease in the life quality of workers . Karabulutluet al40 found that there was a strongly positive correlation among anxiety, depression levels, and sleep problems experienced by caregivers . Sleep problems, depression, and life quality dimensions may be a possible reason for and a result of each other . Thus, instead of trying to solve all these problems individually, dealing with them together will yield better results . In conclusion, we found significantly poorer sleep quality in patients who were older, married, unemployed, and who had a chronic disease and severe depression symptoms . There was a significantly negative correlation among depression, sleep quality, and life quality, while there was a significantly positive correlation between sleep quality and depression . In addition, we noted the importance of the presence of depression and lower life quality as well as demographic socio - cultural characteristics, which are among the determiners of lower life quality . Furthermore, from a different perspective, since sleep disorders may have a role, not only in a decrease of quality of life, but also in a severer depression process, it is crucial to take depression and life quality dimensions into consideration when dealing with protection and treatment approaches concerning sleep problems.
|
Over the past decade, dementia with lewy bodies (dlbs) has arguably become the second most common form of neurodegenerative dementia behind alzheimer's disease (ad). In addition to progressive decline in cognition, dlb is characterized by fluctuations in cognition with variations in attention and alertness, recurrent formed visual hallucinations, visuospatial dysfunction, and spontaneous parkinsonism . Often, dlb patients also exhibit neuroleptic sensitivity, transient loss of consciousness, falls, and rapid eye movement (rem-) sleep behavior disorder . The clinical separation of dlb from other similar disorders is often difficult resulting in poor diagnostic accuracy, but the relative temporal co - occurrence of parkinsonian features with the typical dlb cognitive and behavioral symptoms such as visuospatial disturbance strongly suggests the diagnosis . Clinical presentation of dlb is also influenced by the amount of ad tau pathology, further complicating the diagnosis . Approximately 2040% of parkinson's disease (pd) patients also eventually develop a progressive dementing illness designated as parkinson's disease dementia (pdd) characterized by a frontal - subcortical clinical presentation . Dlb / diffuse lewy body disease (dlbd), lewy body variant of ad (lbv), and pdd comprise an emerging spectrum of clinical phenotypes from relatively pure motor pd to the more predominant cognitive and behavioral disturbance observed in pdd and dlb, yet the reason for the variability remains unknown . Despite the heterogeneity of their clinical phenotypes, a significant neuropathological overlap is observed among these diseases, hence the term lewy body disorders (lbds) to collectively describe conditions in which lewy bodies (lbs) and lewy neurites (lns) predominate as the hallmark histological lesions . Variation in the distribution of lewy body pathology is present among lbds, with more neocortical and limbic system lb in both dlb and pdd compared to the brains of pd patients without cognitive symptoms and greater neuronal loss in substantia nigra in pdd than dlb . Yet, dlb and overlap disorders such as lbv, more so than pdd, have -amyloid pathology and basal forebrain cholinergic deficit similar to ad patients . As with other forms of dementia, the pathobiological changes in lbd likely occur decades prior to the onset of clinical symptoms and correspond to widespread irreversible neurodegeneration [6, 7]. It is increasingly clear from the ad therapeutic experience that by the time widespread neuronal injury ensues, symptomatic cholinergic treatments are minimally effective at best, and disease - modifying therapeutic approaches in trials have thus far proven ineffective at altering disease course or in rescuing diseased brain [8, 9]. To demonstrate efficacy, any potential disease - modifying therapy in neurodegenerative dementia must be initiated prior to the expression of the clinical phenotype during the initial molecular pathogenetic events before irreversible neuronal damage has occurred . At present, accurately predicting those individuals at risk for developing neurodegenerative dementia is challenging, and this places greater urgency on developing earlier methods of disease detection . Critically important is not only distinguishing the lbd from ad and other forms of dementia, but also separating dlbs and other lbds . Although there are many promising candidates for lbd, no biomarkers have yet been validated for clinical diagnostic use, and thus many opportunities exist to develop such tests . Here, we highlight from the perspective of how major genetic discoveries in the lbd and their corresponding biomolecular processes might translate into useful disease markers in biological fluids . Because of many common pathogenetic features among the lbds, the emerging genetic influences found in pd have readily been translated to dlbs and other lbds, providing clues to rational approaches for selecting future dlb and lbd biomarker targets for exploration . This paper will highlight several pd and dlb genes and their protein products as candidates for biological disease markers (table 1). A, a key component of neuritic plaques in ad brain, is overproduced leading to various degrees of amyloid aggregation and synaptic and neuronal toxicity . As indicated previously, amyloid pathology in the form of neuritic and diffuse plaques can be also found in varying degrees in the brain tissue of patients with dlb, which may interact with lb or synuclein pathology or influence the clinical features of lbds [4, 11]. The genetic mechanisms of a overproduction in ad are well established; the app gene (chromosome 21), the first identified ad susceptibility gene, encodes a transmembranous protein ranging from 695 to 770 residues, which undergoes a process of regulated intramembranous proteolysis ultimately releasing a peptides, primarily a42 and a40, as well as other fragments . A is generated by the concerted action of -secretase and -secretase complex, while the -secretase pathway precludes a formation by cleaving app at a site within the a sequence . Genetic analysis of early - onset familial ad cases revealed numerous mutations in the app gene as well as presenilin 1 (ps1; chromosome 14) and presenilin 2 (ps2; chromosome 1) genes, all of which accelerate the processing of app, leading to increased a generation . Specifically, the app km670/671nl (swedish) mutation affects the -secretase site, a692 g (flemish) mutation alters the -secretase site, and both v717f (indiana) and v717i (london) mutations affect the -secretase processing, leading to elevated a levels . Also important in the notch developmental signaling pathway which is analogous to app processing, the presenilins are thought to be a component of the -secretase enzyme complex, which suggests that missense mutations in the presenilins mechanistically lead to accelerated app processing to a . Therefore, the abnormal proteolytic cleavage of app leads to elevated brain a deposition, and as a result, diminished peripheral levels of a. reflecting a shift from soluble a to insoluble brain deposits, significant decreases in csf a42 levels have been demonstrated in ad and more recently in dlb cases . Parnetti et al . Found that dlb, compared with pd, pdd, and ad patients, showed the lowest csf levels of a42 and, when combined with csf tau, differentiated dlb from pd and pdd, but not from ad . Also, spies and colleagues showed a greater decrease in a40 in clinical dlb and vascular dementia patients compared with control levels and even with ad . Differentiation of non - ad dementias such as vascular dementia and dlb was improved by comparing the ratio of a42 and a40 . More recently, the detection of amyloid in dementia patients has been greatly enhanced by the use of amyloid - binding agents such as pittsburgh compound b, which also demonstrated amyloid burden in dlb . An australian study reported more variable cortical pib binding in dlb patients than in ad, whereas a subsequent examination of pib binding in lbds including dlb, pdd, and pd, compared with ad and normal patients, showed higher amyloid burden in dlb and ad than in pdd, pd, or nc patients . Amyloid load was highest in lbd patients in the parietal and posterior cingulate regions, corresponding to visuospatial impairments on neuropsychological testing, suggesting that amyloid deposition could partly contribute to the clinical presentation of lbds . Mutations in the tau gene on chromosome 17 may also present with phenotypic features of pdd or dlb, but they differ pathologically from these disorders in that lbs are generally absent . Tau - bearing neurofibrillary tangles remain one of the pathological hallmarks of ad but are also central to a diverse group of disorders termed tauopathies which include progressive supranuclear palsy, corticobasal ganglionic degeneration, frontotemporal dementia (ftd) with parkinsonism linked to chromosome 17, and other disorders . Tau is a microtubule binding protein, which acts to stabilize tubulin polymerization in microtubules critical for axonal cytoskeletal integrity and function . In disease, tau protein truncation at glu 391 or hyperphosphorylation causes microtubule destabilization and aggregation of unbound tau into paired helical filaments (phfs) leading to characteristic tangle formations . Unlike the tauopathies, no direct pathogenetic tau mutations have been identified in lbds, but tau pathology appears to be a consistent feature among neurodegenerative dementias including ad and lbds, and given the pathological overlap, they might share similar pathogenetic pathways (reviewed in stoothoff and johnson). The ser / thr kinase and glycogen synthase kinase-3 (gsk3), in concert with other molecules such as fyn kinase, normally regulate tau function but with aberrant activation accelerate the hyperphosphorylation of tau in neurodegenerative disease . Similarly, the cell cycle family kinase and cyclin - dependent kinase 5 (cdk5/p35), active during normal brain development and involved in regulatory tau phosphorylation during mitosis, may also contribute to phf formation . Consequently, both total tau and hyperphosphorylated forms have been widely investigated and detected in csf, but not serum, by enzyme - linked immunosorbent assay methods . In the differentiation of dementia types, arai et al . Initially reported elevated total csf tau levels in ad but not in pd, but subsequently, they showed that total tau was also increased in dlb at similar levels to ad . Yet, others have found differences for both total and phospho - tau (p - tau) in differentiating dlb from ad, and levels of total tau and p - tau 181 were significantly increased in autopsy - confirmed dlb patients . In clinically diagnosed dementia cases, csf p - tau 231 discriminated ad from non - ad dementias as a group, where levels were significantly higher in ad patients compared with dlb, ftd, vascular dementia, other disorders, and control subjects . Separation of dlb from ad, however, was less robust, provided that csf p - tau 231 levels were also increased in dlb . Clinically diagnosed dlb cases also showed elevated levels of csf p - tau 181 compared with controls, and hampel et al . Reported that p - tau 181 provided the best discrimination of dlb from ad yielding a sensitivity of 94% and specificity of 64% . In autopsy - confirmed dlb and ad patients, however, sensitivity decreased to 75% and specificity to 61%, with a diagnostic accuracy reported as 73% . Lbs are filamentous inclusions consisting primarily of the presynaptic protein -synuclein (-syn), which might have several roles in vivo . Studies demonstrate that it is localized to multiple neural tissues, including high expression in neocortex and hippocampus, and that expression increases during acquisition - related synaptic plasticity . Interaction with tubulin suggests -syn could be a microtubule - associated protein similar to tau [32, 33], and it is highly active in various membrane lipid bilayers such as in presynaptic vesicles acting as a chaperone for soluble nsf attachment protein receptor (snare) complex formation, in neuronal golgi apparatus influencing protein trafficking and in the inner membrane of neuronal mitochondrial . The synucleins might act to preserve membrane stability, provide antioxidant function, and assist with membrane turnover, although the actual role of synucleins remains elusive [37, 38]. Because of its association with lb and the tendency to self - aggregate into pathological oligomers and ultimately fibrillar structures, -syn plays a central role in the pathogenesis of lbd, hence the alternate designation synucleinopathies . The degree of -syn immunoreactivity in cortical lbs correlates with cognitive severity and disease progression in pdd and dlb [4, 40]. Also, the protein can be recovered from filaments in purified lewy bodies from pdd and dlb brain, and recombinant -syn tends to form lewy body - like fibrillar structures in vitro . In the past decade, tremendous advances have been made in understanding the genetic factors influencing the pathogenesis of lewy body disorders . Compelling evidence for a genetic basis for pd and dlb followed the discovery of mutations in the -syn gene (park1/4) in patients with autosomal dominant familial parkinson's disease, and subsequently, mutations were identified in patients with both sporadic and familial dlbs . From a susceptibility marker on chromosome 4q21 - 23 that segregated with the pd phenotype in italian and greek kindreds, a53 t and a30p were the first two missense mutations in -syn associated with familial parkinson's disease . Clinical analysis of the italian a53 t mutation revealed phenotypic variability over the disease course with several individuals demonstrating moderate to severe dementia . Subsequently, a case of clinically and pathologically well - characterized dlbd in the united states and a greek proband of dlb with a family history of pd were both determined to have the a53 t -syn mutation [46, 47]. Another mutation, e46k, was discovered in a spanish family presenting with autosomal dominant dlb, and in genetic studies of a large family with the spectrum of lewy body phenotype ranging from pd to dlb, -syn gene triplication was described, causing -syn overproduction similar to the trisomy effect observed in down syndrome patients . Autosomal dominant point mutations are shown to affect the aggregative properties of -syn, which has mechanistic implications for the pathogenesis of lbd . Compared to wild - type -syn, biophysical analyses reveal that -syn aggregation is folding state dependent, where a53 t and a30p mutated proteins cause increased aggregation only from the partially folded intermediate state and not the monomeric state . A53 t -syn transgenic mice have increased oligomerization of the protein in brain regions devoid of inclusions as well as those areas with more abundant lesions and neurodegeneration, and consistent with prior biophysical findings, -syn toxicity in these mice was dependent on the conformation of intermediate species . In fact, the e46k mutation, as well as the others not only increase the tendency toward aggregation, but also promote formation of annular protofibrillar structures, causes pore formation in various membranes and neuronal damage . -syn is a member of a larger family of synuclein proteins which also includes -synuclein (-syn) and -synuclein (-syn). -syn has recently been implicated in pd and dlb pathogenesis, but its precise role in disease is still emerging . Despite having strong homology with -syn, it is not clearly amyloidogenic, but is highly localized to presynaptic sites in neocortex, hippocampus, and thalamus like -syn [53, 54]. Normal -syn may act as a biological negative regulator of -syn . In bigenic -syn/-syn - overexpressing mice and in doubly transfected cultured cells, -syn ameliorated amyloidogenicity, neurodegenerative changes, and motor deficits induced by -syn overexpression alone . On the other hand, mutated -syn leads to neuronal damage and disease and augments neurodegeneration, perhaps through a loss of its natural regulator function . Two novel -syn point mutations, p123h and v70 m, were found in highly conserved regions of the -syn gene in respective familial (p123h) and sporadic (v70 m) dlb index cases, where abundant lb pathology and -syn aggregation was present without -syn aggregation . P123h -syn overexpression in transgenic mice resulted in axonal damage, gliosis, profound memory, and behavioral deficits . These phenomena may involve -syn, since bigenic mice overexpressing -syn with p123h -syn show greater deficits compared with monogenic mice and compared with p123h -syn expressed with -syn knockout, implying that the p123h mutation has a synergistic effect with other synucleinopathies to cause neurodegeneration . P123h as well as v70 m -syn mutations might also injure neurons by disrupting normal lysosomal pathways and corresponding cellular autophagic processes . Unlike the other synuclein family members, -syn or persyn is largely expressed in the cell bodies and axons of primary sensory neurons, sympathetic neurons, and motor neurons as well as in brain . In cancer biology, -syn is associated with abnormally altering cellular mitotic checkpoints in various types of malignancies, making them more aggressively metastatic, but as far as neurodegeneration, it is the most recent synuclein member to be linked to lbd neuropathology and the least well understood . Single - nucleotide polymorphisms in all three synucleins have been associated with sporadic dlbd, most prominently -syn, and in sporadic pd, dlb, and lbv patients, -syn antibodies, as well as -syn and -syn reveal unique hippocampal axonal pathology . In vivo, -syn overexpression in transgenic mice shows age- and dose - dependent neuronal loss throughout the neuraxis, especially in spinal motor neurons, where -syn - bearing inclusions, gliosis, and alterations in heat shock protein and neurofilament structure are found, perhaps suggesting relevance to motor neuron disease associated with dementia . In vitro evidence further supports a cytoskeletal role for -syn in maintaining neurofilament structure; -syn overexpression in cultured neurons causes disruption of the neurofilament network by destabilizing the structural integrity of neurofilament - h allowing degradation by calcium - dependent proteases, which has implications for neurodegeneration . Synucleins are known as intracellular molecules, but they also appear in extracellular and peripheral fluids from active and passive processes . Evidence suggests that turnover and secretion of these proteins might occur during normal cellular processing, releasing synucleins into extracellular space and hence into peripheral sites . In transfected and untransfected cultured neuroblastoma cells, 15 kda -syn is released into surrounding media, and furthermore, not only monomeric -syn but also aggregated forms are secreted in an unconventional exocytic manner into extracellular fluid in response to proteasomal and mitochondrial dysfunction . . Recently showed that neuronally secreted -syn can also be taken in endocytically by other neurons or glia as a means of transmitting pathology . Secreted -syn interacts with various molecules such enzymes; in cultures, matrix metalloproteinase-3 cleaves native -syn to smaller proteolytic fragments that enhance its aggregative properties . Whether -syn and -syn also undergo unconventional exocytosis and secretion remains unknown, but given structural and functional similarity to -syn, the possibility exists . Certainly, synaptic and axonal damage reflecting neurodegeneration may also allow release of synucleins into the extracellular millieu and access to peripheral fluids such as csf and blood . Multiple forms of -syn are released into cerebrospinal fluid (csf) and other biological fluids . Full - length -syn has been recovered from lumbar csf from living normal control, pd and dlb patients [69, 70], and also from postmortem csf from dlb and other neurodegenerative diseases . Comparative findings regarding differences in csf -syn levels among various neurodegenerative diseases, however, are difficult to interpret because of inconsistent observations . In pd, a smaller early study showed that no differences in full - length csf 19 kda -syn have been found in relation to control individuals, but a recent effort using a new luminex assay in a larger sample controlling for extraneous influences showed significantly decreased levels in pd compared to controls with 92% disease sensitivity and 58% specificity . Elevated -syn levels, however, were found in dlb, ad, and vascular dementia with no differences among them . Perhaps more intriguing, higher - molecular weight aggregated -syn species in csf might be associated with pd and dlb . Reduced levels of a 24 kd -syn - immunoreactive band were found in dlb csf and correlated directly with declining cognition . Moreover, using a specific enzyme - linked immunosorbent assay (elisa), soluble aggregated -syn oligomers in csf were significantly increased in pd patients compared against control subjects, ad and progressive supranuclear palsy, and specificity ranged from approximately 85 to 87%, while sensitivity was about 5375% range . Plasma -syn detected by immunoblotting was decreased in pd compared with age - matched control subjects, and those pd patients with age - at - onset prior to 55 years (early - onset) had significantly lower levels than those with onset after 55 years of age (late - onset). In addition, soluble oligomeric -syn detected by specific elisa was significantly elevated in plasma from pd . This test demonstrated a specificity of approximately 85%, a sensitivity of 53%, and a positive predictive value of 0.818 . Although measurement of plasma -syn appears interesting as a biomarker, it was reported that skin cells and platelets are also sources for -syn, and their levels did not correlate with disease presence or severity . Moreover, red blood cells are also a major source of -syn, and thus, plasma could be contaminated by -syn not originating from brain, which might render interpretation of results difficult . One promising consideration for the future exploration of -syn as an lbd biomarker will be the development of novel imaging compounds and techniques, similar to amyloid imaging, to specifically target and visualize -syn distribution in the pd and lbd brain . The availability of such methods will be a significant advance in biomarkers for synucleinopathies . Due to their increasing importance in lbd pathogenesis, -syn and -syn, as much as -syn as such, levels of these synucleins might be altered in the csf of patients with pd / pdd and dlb, reflecting the underlying degenerative processes in brain . No studies to date have examined -syn levels in peripheral fluids in relation to neurodegenerative disease, but a small study reported elevated postmortem ventricular csf -syn levels in dlb, ad, and vascular dementia patients, with the highest levels seen in dlb patients . More detailed examination of both -syn and -syn as a peripheral disease markers in well - characterized populations of pd, dlb, and other disorders is warranted to determine their specificity and sensitivity in the synucleinopathies . Recently, dj-1 (park 7) has emerged as a significant molecular target of interest in lbd principally because of its genetic association with pd and its increasing importance in cellular oxidative neuroprotection . Although its exact role is unknown, multiple functions have been assigned to the dj-1 protein ras - related signaling pathways, it shares structural homology with the carboxy - terminal domain of escherichia coli hpii catalase and is reported to possess catalase activity which reduces oxidative stress in cultured cells . It also binds to and regulates the pias sumo-1 ligase and is itself posttranslationally modified by sumoylation [81, 82]. Of relevance to lewy body formation and neurotoxicity, dj-1 displays redox - dependent chaperone activity conferring proper protein folding and thermal stability, which in fact, also inhibits -syn aggregation . The overexpression of dj-1 in rats protects nigral dopaminergic neurons against degeneration involving 6-hydroxydopamine, while mutant dj-1 in mice causes abnormal dopamine reuptake and susceptibility to 1-methyl- 4-phenyl-1,2,3,6-tetrahydropyridine (mptp) toxicity . Deletion of dj-1 homologs in drosophila renders them sensitive to h2o2, paraquat, and rotenone toxicity . No less than 13 gene mutations have been identified in dj-1 in atypical younger - onset pd patients, but their significance to idiopathic late - onset pd remains uncertain . In autosomal recessive early - onset pd from consanguineous families, a complete dj-1 deletion in a dutch family and a point mutation l166p in an italian case were identified . When expressed in cultured cells, l166p appears to be a loss - of - function mutation which leads to dj-1 functional instability, degradation by the proteasome system [86, 87], abnormal translocation of dj-1 to mitochondria, and loss of chaperone activity . The importance of dj-1 gene alterations in dementia and dlb, however, is uncertain . One report found no impact on dementia risk of the dj-1 14 kb deletion, and analysis of an insertion / deletion variant (g.168_185del) in dj-1 in a larger sample of patients also showed no association with either pd or dlb compared to control patients . Given these early negative findings, the relevance of dj-1 genetic mutations to dlb and other lbd is not known . At present, no patient harboring a dj-1 mutation has come to autopsy, so the precise pathology is not known . Although dj-1 mutant cases may ultimately not be lbds, it is possible that alterations in dj-1 may somehow influence the aggregation of -syn and lb formation or contribute to pathogenesis by other molecular pathways . Dj-1 is found in brain across a wide range of neurodegenerative diseases including pd, ftd, ad, dlb, and lbvad, and demonstrates striking association with neuropil threads and neurofibrillary pathology in neocortex and subcortical brain regions in these disorders . Interestingly, this association with tau pathology was seen in dlb and lbv brains, suggesting that as a chaperone molecule, dj-1 may be involved in tangle formation, and the binding of dj-1 with these lesions could abolish the normally protective effect of dj-1, enhancing oxidative neurotoxicity . Wang et al . Observed that dj-1 knockout mice have markedly abnormal hippocampal long - term depression accompanied by a less severe abnormality in long - term potentiation, which was reversed by the d2/3 agonist quinpirole, indicating that dj-1 has a role in dopamine - dependent signaling in hippocampal plasticity . Given its pathogenetic significance, dj-1 could be a candidate biological marker for dlb and lb and might serve as a means of monitoring in vivo oxidative damage and protein misfolding . Although intracellular and mitochondrial in localization, dj-1 is presumed to be secreted perhaps specifically under disease conditions which induce oxidative damage . Using semiquantitative immunoblotting, we previously identified dj-1 in csf of sporadic pd patients, where levels were significantly elevated compared with controls . Levels were higher in the earlier stage pd cohort (hoehn - yahr stages i - ii) than in the more severe patients (hoehn - yahr stages iii - iv). Similarly, plasma dj-1 levels in pd patients were markedly increased compared to controls, but unlike csf, levels were relatively higher in late stage (iii - iv) rather than early stage pd (i - ii). The reason for this difference between plasma and csf dj-1 is unknown, but we surmised previously that since csf dj-1 originates from a central source produced mainly by reactive glia, early increases in csf dj-1 levels probably represent an early protective response to damage, whereas plasma dj-1, like other plasma disease markers, likely represents peripheral oxidative stress damage . In fact, dj-1 is secreted into blood in breast cancer, melanoma, familial amyloid neuropathy, and stroke [9496]. In the largest study to date, hong et al . Developed a more sensitive and quantitative luminex assay for csf dj-1 to complement immunoblotting mass spectrometric and chromatographic analysis methods and found decreasing rather than increasing levels of dj-1 in pd csf compared with control patients . The 90% disease sensitivity and 70% disease specificity for pd using this method approaches minimal desired parameters for a clinically useful biomarker for pd . Importantly, the study highlighted the fact that dj-1 levels are greatly influenced by such variables as the extent of blood contamination and patient age, which could account for some of the variability across studies . Of note, dj-1 is also subject to oxidative modifications in pd and ad brain tissue, and this might be measured in peripheral fluids as well, as another monitor of oxidative damage . Csf dj-1 remains a promising and perhaps clinically useful biomarker for pd, but as far as dlb and other lbd, it is unknown whether csf levels of dj-1 are altered . Since plasma dj-1 is increased in dlb, it is hypothesized that csf dj-1 may also be elevated . Further investigation will be necessary to clarify the utility of dj-1 as a biomarker in dlb and lbd . Many clinicopathologic parallels can be drawn between the lysosomal storage disorders, such as niemann - pick, sandhoff's, tay - sachs disease and others, and the age - related neurodegenerative disorders, when considering the aberrant accumulation of pathological substances (e.g., lysosomal sphingomyelin in niemann - pick disease versus synucleins in pd and dlb) and the phenotypes of neuronal loss and cognitive deterioration found in both . Common to these diseases are abnormalities in lysosomal and autophagic mechanisms as part of a larger disruption of cellular proteostasis leading to abnormal storage / accumulation of toxic materials and neuronal damage . In the past few years, an altogether unexpected pathogenetic relationship emerged between gaucher's disease (gd), a prototypic storage disease, and the synucleinopathies . Despite its overall rarity, gd is the most common inherited lysosomal storage disease, especially in the ashkenazi jewish population . It is caused by autosomal recessive gene mutations in the glucocerebrosidase (gba) gene (chromosome 1q21), leading to either partial or complete deficiency of gba, and hence, toxic lysosomal accumulation of its substrate, glucosylceramide, in multiple cell types including neurons . Recent reports documented an increased incidence of pd in heterozygous relatives of patients with gd [99, 100], but interest in this phenomenon was propelled by the finding that gba mutations were in fact more common in pd patients of ashkenazi background compared with ad patients and pd patients in the general population [101103]. Moreover, more severe gba mutations such as 84 dupl g and ivs 2 + 1 were associated with a greater degree of pd risk, compared with less severe gba mutations such as n370s . The relationship between pd and gba has now been replicated in much larger international studies with the most common mutations being l444p and n370s, and about 28 gba mutations are presently recognized . Interestingly, in a study of british patients with pd and gba mutations, all 17 carrier patients demonstrated abundant -syn neuropathology with braak stage 5 - 6 severity and common neocortical lb pathology . Clinically, these patients had earlier age at onset, and hallucinations were present in 45% of patients, while 48% had cognitive impairment or dementia consistent with pdd . Greater severity of gba mutation also predicted the presence of cognitive impairment in pd patients; 56% of severe gba mutation carriers had cognitive impairment compared to 25% of mild mutation carriers . These observations suggest a much broader link between gba mutations and the dementia phenotype of lbd . In fact, examination of gba gene alterations in dlb patients, with and without concomitant lbv - type ad pathology, showed that the majority of gba mutations were found in dlb patients rather than in pd, with a mutation rate in dlb ranging from 18 to 23% overall [108, 109]. The proportion of dlb patients with gba mutations was higher in those with pure neocortical lb pathology compared to those with mixed lb and ad pathology and to those with predominantly brainstem lb . A significant association was also found between gba mutation status and the presence of lb, indicating that altered gba might play a role in their formation and in synucleinopathy . Important in neurodegeneration, disrupted cellular proteostasis represents a state in which an imbalance exists between effective functioning of the innate cytoprotective machinery and excessive accumulation and aggregation of abnormally misfolded proteins, leading to neurotoxicity . It is increasingly apparent that chaperone - mediated autophagy (cma) and lysosomal degradation pathways are important in maintaining cellular proteostasis as part of a larger network of cellular actions, with particular relevance for neurodegenerative diseases . Recently, as evidence for cma dysfunction in synucleinopathies, a significant decrease in autophagy markers was reported in substantia nigra from pd brain . Soluble forms of -syn, including monomers, oligomers, and even protofibrils, are normally cleared through the cma / lysosomal degradation by interacting with the chaperone, heat shock cognate-70, and becoming internalized into lysosomes via the lamp-2a membrane receptor [111, 112]. Studies have indicated that -syn shares a common pentapeptide structure with other lysosomal substrates, designating it as a target for removal by this pathway, and the lysosomal structure is critical to maintaining the internal acidic environment, allowing lysosomal hydrolases to degrade -syn into peptides released into the cytosol . Mutant gba could therefore disrupt lysosomal activity leading to abnormal accumulation of nondegraded -syn, which then aggregates to toxic soluble oligomers and protofibrils . Also, abnormalities in the ubiquitin - proteasome system (ups) are present in ad and pd, and gba alterations might secondarily overwhelm the ability of ups to remove accumulated -syn, promoting aggregation and neurotoxicity . Pathologically, in gd with parkinsonism, -syn - positive inclusions were observed in neurons in hippocampal ca2 - 4 regions, while cortical synuclein pathology was identified in other gd cases . Further, parkin, an e3 ubiquitin ligase also implicated in pd, has been shown to affect the stability of mutant gba and increase its degradation causing further lysosomal dysfunction . Because of the importance of mutant gba function to pd and dlb pathogenesis, the issue arises as to whether the measurement of gba activity, or a perhaps other related molecules, might be utilized as a biological marker . The activity of peripherally secreted gba was measured in plasma and csf in a 10-month - old female with gd with the aim of monitoring the effect of experimental cerezyme replacement therapy . Baseline gba activity was detected in both plasma (2.7 10 u/l) and csf (0.096 10 u/l), although csf activity was several magnitudes lower than plasma . Intravenous cerezyme, a macrophage - targeted gba, rapidly raised the plasma activity within 1 hour and csf activity by 2.3-fold at 3 hours, both returning to baseline after 24 hours . This study suggests the intriguing possibility that gba activity, especially in csf and plasma, might be useful in monitoring the efficacy of novel therapies involving cma and lysosomal function . To extend this observation, balducci et al . Determined that multiple lysosomal hydrolases, including gba, are significantly decreased in the lumbar csf of pd patients, perhaps supporting a more widespread lysosomal dysfunction in pd not limited to gba alone . In this regard, other lysosomal enzymes such as mannosidase and -hexosaminidase might be important additional biomarker targets for neurodegeneration . Moreover, in dlb, ad, and ftd patients, lysosomal enzyme activities in csf demonstrated a very specific pattern of decrease, in which only dlb showed significant decreases in csf activity of -mannosidase, -mannosidase, gba, galactosidase, and -hexosaminidase, whereas in ad and ftd, only csf -mannosidase activity was significantly diminished . In dlb, csf gba activity showed the greatest magnitude of decrease, reinforcing its importance in the lbd, but also noteworthy is the fact that ad and ftd showed decreased -mannosidase activity, suggesting that this might be another important factor in lysosomal dysfunction in neurodegeneration . Indeed, these promising candidates need to be investigated further to establish diagnostic accuracy in terms of disease specificity and sensitivity in cohorts of pd, dlb, and other dementing disorders . Polymorphisms in proinflammatory cytokine genes including il-1, il-1, and tnf- are associated with increased risk in ad . In pd, several case control genetic analyses have demonstrated that homozygous carriers of the il-1 511 and tnf- 308 promoter region variants have increased disease risk [120, 121], and that earlier age at onset in pd was associated with il-1 511 homozygosity at allele 1 . But as yet, no such genetic alterations in cytokines genes have been reported in dlb . Similar to a-induced upregulation of inflammatory cytokines in ad, soluble secreted -syn in the extracellular space in lbd might also induce the production of a variety of neuroinflammatory mediators into the extracellular fluid . For instance, microglial activation in response to stimulation by secreted -syn from cultured cells and from overexpression in transgenic mouse models occurs in a dose - dependent manner, causing release tnf-, il-1, and il-6 . Because secreted cns cytokines are readily detected in csf, they have been extensively examined as potential disease biomarkers . Il-1, il-2, il-6, and tnf- are all upregulated in pd brain, as well as in csf from pd patients [124126], and chen et al . Showed that plasma il-6, but not il-1, tnf-, or other acute phase reactants, predicted risk for future pd in males . In terms of dlb, csf il-1 levels, which were relatively low, did not differ compared to ad or normal controls and could not distinguish them apart . Comparable increases in csf il-6 levels were found in ad and dlb, but again not significantly different from each other to be of diagnostic value . Indeed, the neuroinflammatory cytokines may be important as a pathogenetic response to cns injury caused by accumulation of amyloidogenic proteins, but their role as biomarkers for the lbd, especially for dlb, is still unclear . Disorganization and breakdown in the cytoskeletal network occurs in various lbds and other neurodegenerative diseases, and as discussed, gamma - synuclein and proteolytic degradation of the cytoskeleton may be involved . As a result, a failure of normal axonal transport results from the accumulation of disrupted neurofilament molecules within the neuropil, causing neuronal demise . Recently, a mutation in the nefm gene encoding the rod domain 2b of neurofilament m (nf - m) which causes aberrant nf assembly was identified in a single early - onset pd patient . It is recognized that in addition to -syn, three types of nf protein also comprise the structure of lewy bodies . Upon cell death or axonal damage, accumulated neurofilament leaks into the extracellular space, subsequently appearing in csf and perhaps other peripheral fluids . Elevated csf nf protein was reported in msa and psp, but not in pd, and this was suggested to clinically aid in differentiating parkinsonian syndromes . Csf nf protein was also measured in dementia, and although increased levels were observed in dlb, late - onset ad, and ftd, there were no differences among them . Therefore, because cytoskeletal abnormalities are present in many neurodegenerative dementias as well as in pd, nf protein may be more a reflection of nonspecific alterations in neuronal and axonal function, which does not appear to able to clinically separate dlb from other disorders . Severe cortical cholinergic deficits originating from deficiencies in the nucleus basalis of meynert are characteristic of ad brain, but studies have shown that cholinergic deficits are perhaps more severe in dlb brain . This suggests that measurement of cholinergic activity and/or acetylcholine (ach) might be developed into a potential biomarker for the lbds . Indeed, early attempts to quantify ach or its major metabolite, choline, have shown baseline levels to be low and perhaps difficult to measure accurately . In ad, csf ach was reported to be significantly lower than control levels, while in pd and huntington's disease patients, despite some cholinergic deficit, lumbar csf ach and choline levels did not differ from normal . No studies have directly examined csf cholinergic levels in dlb or lbds, but recently, shimada and colleagues employed positron emission tomography (pet) mapping of brain ach activity in dlb and pdd patients and normal controls and demonstrated a marked reduction in cholinergic activity in medial occipital cortex of dlb and pdd, greater than that observed in pd patients without dementia . Some correlation of mapped cholinergic activity with cognitive decline measured by the mini - mental state exam was also found . Although preliminary, this has potential to be a more practical and sensitive cholinergic biomarker for lbd . Because of similar nigrostriatal loss to pd, a relative dopaminergic deficiency also exists in dlb and lbds . Csf dopamine (da) and its metabolites have been investigated previously in pd, and recently, lunardi et al . Showed differences in csf da and its metabolites, homovanillic acid (hva) and dihydroxyphenylacetic acid (dopac), in pd patients, demonstrating early - stage dopaminergic loss and a correlation with the development of dyskinesia . In dlb, similar to cholinergic activity, imaging modalities may also contribute to the assessment of dopaminergic function in the lbds . In a small study, striatal da uptake as measured by f - fluorodopa pet was decreased in both caudate and putamen in dlb as compared with ad patients and controls . Also, da transporter loss was determined across multiple studies using i-2-carbometoxy-3-(4-iodophenyl)-n-(3-fluoropropyl) nortropane ligand with single - photon emission computed tomography (i - fp cit spect) and demonstrated significant loss of caudate and putaminal da transport compared with ad and control levels [139141]. A larger phase iii, multicenter study of i - fp cit spect in possible and probable dlb patients and non - dlb comparators (mostly ad) demonstrated a mean sensitivity of 77.7% for detecting clinically probable dlb, with a specificity of 90.4% and 85.7% overall diagnostic accuracy . I - fp cit spect da transporter imaging greatly enhanced diagnostic accuracy for dlb over clinical diagnosis alone when coupled with autopsy confirmation, raising sensitivity for dlb from 75% to 88% and specificity from 42% to 100% . Furthermore, da transporter loss in the caudate may also be inversely associated with depression, apathy, and delusions in dlb patients . Autonomic failure is a common clinical finding in lbd, including pd and dlb, but not in non - lbd dementias, and therefore it has been investigated as an alternative biomarker for the diagnostic separation of dlb from other dementias . Abnormal autonomic function can be determined using cardiac i - meta - iodobenzyl guanidine (i - mibg) imaging, a technique which assesses cardiac sympathetic nerve function in both cardiac and neurological disorders by measuring the uptake of i - mibg, a norepinephrine analogue . In the last decade, a series of japanese studies consistently demonstrated delayed heart to mediastinum ratio (h / m) of i - mibg uptake in dlb compared with ad and controls [143146]. I - mibg imaging distinguished dlb from other dementias with a sensitivity of 94%, specificity of 96%, and a diagnostic accuracy of 95% . Finally, consistent with autonomic dysfunction in dlb, both early and delayed h / m i - mibg uptake were significantly associated with the presence of orthostatic hypotension in dlb patients and discriminated dlb from ad even in the absence of parkinsonism . Various magnetic resonance (mr) imaging modalities have been explored in dlb and pdd, including volumetric imaging, diffusion tensor imaging, and proton magnetic resonance spectroscopy (reviewed in watson et al . ), and although not directly useful as biomarkers at present, they have revealed insights in the pathobiology of lbds . Using conventional mri techniques such as voxel - based morphometry and region of interest analysis atrophy has been rated at 1.4% per year in dlb brain, 1.31% per year in pdd, and 0.31% per year in pd . Not surprising is the fact that unlike ad brain, medial temporal structures are relatively preserved in dlb and pdd, with global hippocampal loss at about 1020% compared with controls and about 2125% in ad . Diffusion tensor imaging, an mr technique mapping brain microdiffusion of water in the direction of white matter tracts, has shown decreased fractional anisotropy of water movement in dlb in the precuneus and posterior cingulate areas, perhaps highlighting their role in dlb pathogenesis . Brain perfusion spect (tc - hmpao spect) has been evaluated in its ability to diagnostically separate dlb from ad, and in ad, reduced relative cerebral blood flow (rcbf) in the frontal, and medial temporal regions is characteristic, whereas in dlb, occipital hypoperfusion is often observed . Applied statistical parametric mapping to spect imaging of dlb patients, more precisely showing large perfusion deficits in the left medial occipital gyrus and the bilateral central, inferior parietal, precuneate, superior frontal and cingulate regions on the brain, which are functionally consistent with frontal - executive and visuospatial deficits in dlb . Across studies, sensitivity ranged from 65 to 85% and specificity from 8587%, which appears less robust as a potential imaging marker compared with other methods . Aside from -syn and dj-1, numerous other mutations have been associated with familial early - onset pd and possibly lbd (table 1). Among these gene products are parkin (park 2), uchl-1 (park 5), pink1 (pten - induced putative kinase 1; park 6), and lrrk2/dardarin (park 8). Indeed, none of these mutations have yet been associated with prototypic lbd pathology, and it remains to be determined whether they actually represent lbds or separate diseases with parkinsonian phenotype . Furthermore, no studies have addressed their role as biological markers of disease, but since both synucleins and dj-1 are detected in csf and peripheral fluids, it seems plausible that the protein products of other dominant genes in pd could be peripheral biomarker candidates for dlb and other lbd . Parkin, uchl-1, and pink1 genes, like dj-1, all encode proteins important in neuroprotection in terms of maintaining protein homeostasis and preventing stress - related cellular damage, and mutations in these genes cause a loss of these critical functions . Leucine - rich repeat kinase 2 (lrrk2/dardarin), on the contrary, is linked with autosomal - dominant late - onset pd, and mutations result in a toxic gain of function . Lrrk2/dardarin is a kinase consisting of multiple functional domains, and recent evidence suggests that physiologically, its principal function may be to regulate neurite outgrowth . Expression in cultured neurons of several lrrk2 mutations associated with familial pd, such as g2019s, increased kinase activity and significantly reduced neurite outgrowth, whereas expression of a dominant - negative mutation, k1906 m, markedly increased neurite length . Pd - associated mutations also generated tau - positive axonal inclusions in cultured neurons, suggesting that lrrk2 may be linked to abnormalities in tau . Indeed, expression of mutant g2019s lrrk2 in drosophila caused activation of the drosophila gsk-3 homolog and promoted tau hyperphosphorylation leading to microtubule fragmentation and dendritic pathology . Similar tau hyperphosphorylation was also present in transgenic mice expressing g2019s lrrk2, and expression of both wild - type human lrrk2 and g2019s mutant lrrk2 caused abnormal dopaminergic transmission . Lrrk2 may also interact with -syn, another dominantly inherited pd gene, to exert its effect . Lin et al . Showed that overexpression of lrrk2 with a53 t mutant -syn in transgenic mice worsened neurodegeneration, while ablation of lrrk2 expression suppressed -syn aggregation and pathology, and -syn also activates gsk-3 in mice causing tau hyperphosphorylation, indicating that lrrk2, -syn, and tau alterations may all be linked in the same pathway, perhaps with lrrk2 upstream of these events . Although early, evidence has indicated that lrrk2 is also a component of lb in pd and dlb brains, and that lrrk2 and -syn interact in dlb brain and coimmunoprecipitate in cultured cells after oxidative stress challenge, suggesting that the lrrk2 may also be important in dlb pathogenesis . Interestingly, genome - wide association studies (gwass) in a european cohort demonstrated that lrrk2, -syn, and tau are loci associated with pd risk, but examination of tau in a japanese gwas cohort failed to identify it as a pd risk locus, showing a population difference with regard to this locus . Certainly, population differences might apply to all risk loci examined for pd and lbd, and it is important to determine whether the relationship among lrrk2, -syn, and tau in pd, dlb, and other lbd is also influenced by population differences . These findings make lrrk2/dardarin an attractive candidate for examination as a potential biomarker, and if identified in csf or peripheral fluids, they might be used with -syn and tau as combined biomarkers . Furthermore, emerging evidence is redefining the roles of pink1 and parkin in pd pathogenesis . Because energy generation is critical for cellular function, mammalian cells are highly dependent on mitochondria . Depolarization and morphological defects characterize damaged or impaired mitochondria which are targeted for removal through mitophagy, a highly specialized form of autophagy in which parkin and pink1 play a crucial role (reviewed by vives - bauza and przedborski). In this process, pink1 cleavage is inhibited by the loss of mitochondrial membrane potential, causing its lengthening and the recruitment of cytosolic parkin [170, 171]. Voltage - dependent anion channel 1 and other outer mitochondrial membrane proteins are then ubiquitinated in a parkin - dependent manner, and this in turn recruits the binding of adapter proteins such as p62 and histone deacetylase 6 to initiate autophagosome assembly around the damaged mitochondrion and subsequent removal . Of relevance to pd, mutant pink1 and mutant parkin both cause motor dysfunction, dopaminergic loss, and abnormal mitochondrial morphology in drosophila . In this paradigm, loss of function pink1 mutants are rescued by concurrent overexpression with wild - type parkin but not vice versa, indicating that parkin specifically acts downstream of pink1 . Also, parkin mutations have been shown to interfere with ubiquitination and the downstream steps in normal mitophagy . Thus, pd, and possibly related dementias, might be a result, to some extent, of defective mitophagy due to loss of function in pink1 and parkin such as found in autosomal dominant early - onset pd . Although lrrk2, parkin, pink1, and uchl-1 have not yet been identified in peripheral fluids, pink1 and parkin may be a promising candidates . Unexpectedly, both pink1 and parkin, which are normally cytosolic or targeted to mitochondria, were localized extracellularly in ad and multiple sclerosis brain, and colocalized with amyloid plaques, reactive astrocytes, as well as amyloid - affected vessels [174, 175]. This suggests that both pink1 and parkin are actively released from neurons and glia in response to injury and might be upregulated in csf and peripheral fluids during neurodegeneration . Interestingly, given a role in mitophagy, they might also be a csf or peripheral reflection of mitochondrial health and turnover . It remains to be seen whether these gene products can be detected in biological fluids such as csf as potential biomarkers in pd and lbd . As detailed above, traditional methods for molecular biomarker determination have been derived from targeted analyses of candidate genes / mutations and corresponding proteins in brain and body fluids such as csf and blood, with the subsequent exploration of mechanisms in cell culture and animal models . An emerging alternate approach has been to evaluate genomes and proteomes with regard to specific neurodegenerative diseases and their components in an unbiased manner to yield a number of potential pathogenetic, therapeutic, and biomarker targets for further validation . With regard to the genomic analysis of the lbds, scherzer et al ., for instance, examined transgenic drosophila expressing the human -syn gene and performed temporal profiling of resultant gene expression . They demonstrated a number of changes, including a downregulation of phospholipase a2 and other lipid genes, downregulation of several mitochondrial respiratory chain molecules, and alteration in membrane transport and energy genes such as voltage - gated calcium channel and lysosomal atpase, suggesting that mitochondrial integrity might be affected by -syn overexpression . In parkinson's disease brain, rna from populations of mesencephalic dopaminergic neurons with and without lb interestingly, upregulation of the ubiquitin - specific protease 8 in lb - containing neurons indicated cellular damage and increased levels of ubiquitination in lb, whereas non - lb - bearing neurons showed increased expression of novel cytoprotective genes such as bullous pemphigoid antigen 1, an hsp-70-like gene (stch) and kelch - like 1 . Although promising, further genomic profiling studies in dlb, pdd, and other lbd are needed to expand the range of novel gene targets for examination and validation . As a complement to gene expression profiling and genomic methods, proteomic profiling has also assumed a greater importance in biomarker discovery for neurodegeneration with relevance to the lbd . Advances in methodologies such as 2-dimensional gel electrophoresis (2-d ge), liquid chromatography (lc), high - resolution mass spectrometry (ms), and quantitative proteomics allow analysis of static or condition - dependent protein structure and function associated with pd and lbd in a variety of sample types such as brain or body fluids (reviewed in shi et al . 2009). In mice treated with mptp, a specific mitochondrial toxin, isotope - coded affinity tag assay of brain tissue followed by ms analysis revealed 100 proteins with significantly altered levels including many mitochondrial and metabolic molecules, app and dj-1 . First examined the proteome of the substantia nigra from parkinson's disease brain and age - matched controls . Using 2d ge and peptide fingerprinting, of the 44 expressed proteins, 9 proteins differed in pd versus controls, including oxidative and mitochondrial proteins such as peroxiredoxin ii, mitochondrial complex iii, calcium channel, and others . A subsequent study in pd brain showed decreased frontal cortex levels of mortalin, a novel mitochondrial chaperone protein with roles in energy generation . In addition, lbs isolated by laser - capture microdissection, were analyzed by lc / ms and ultimately demonstrated 156 candidate proteins involved in ubiquitin - proteasome system and synaptic function, from which the heat shock cognate-71, a chaperone involved in neurodegenerative disease, was identified and validated as a candidate target . Abdi and colleagues carried out proteomic evaluation of csf from ad, pd, and dlb patients and normal control individuals, using chromatography, ms, and isobaric tagging for relative and absolute quantification (itraq), identifying numerous candidate proteins related to pd and dlb, such as lipoproteins apoc1 and apoh . Lastly, using surface - enhanced laser desorption / ionization - time of flight (seldi - tof) ms analysis of serum from dlb patients compared to ad, a combination of protein peaks provided the ability to separate dlb from non - dlb cases, with a sensitivity of 83.3% and a specificity of 95.8% . Given promising findings, further exploration of the proteomics of the lbds is warranted, and perhaps consideration should be given to determining whether combining various genomic and proteomic methods will be of value . Over the last decade, tremendous advances have been made in understanding the pathogenetics of pd, pdd, and dlb, which has revealed not only the genetic basis of these disorders, but also related mechanisms common to all the lbd . In parallel, these discoveries have been a catalyst for translating and developing many of the involved proteins into promising biomarkers for disease . A common theme centers on genes that drive a complex network of synergistic and opposing cellular actions underlying pathogenesis . Aggregation of -syn, the main constituent of intracellular lbs, results in toxic oligomers and protofibrils which not only act intracellularly, but also are actively and passively released into the extracellular environment causing damage to surrounding tissue . On the contrary, dj-1, pink1, parkin, and perhaps others molecules are upregulated to oppose cellular protein misfolding and oxidative stress and maintain mitochondrial function, while autophagy mechanisms attempt to limit the toxic effect of synucleins and other toxins by lysosomal engulfment and digestion . Much of this is reminiscent of a relatively new concept applied to infectious diseases and mechanical tissue injury termed damage - associated molecular patterning (damp), which is an evolved system to recognize, contain, and repair damage to cells and tissues . It is characterized by the abnormal release of molecules normally confined and operating within healthy cells or from foreign pathogenic agents, that when released into the extracellular space activate receptors and pathways leading to inflammation and multiplying cellular damage (reviewed by bianchi). In this regard, events in the pathogenesis of pd, dlb, and related disorders may represent a novel variation of the damp response, and in a sense, biological fluid markers are therefore a measurement of damp activity as it relates to neurodegeneration . Despite progress in developing biological markers for pd, pdd, and dlb, clinical diagnosis of this spectrum of disorders remains challenging . The need for highly sensitive and specific biomarkers that accurately mirror the underlying pathogenetic features of these disorders demands not only that more advanced detection methods be devised and validated in large sample populations, but also that novel biomarker candidates be selected for evaluation based on rational selection from the multiple - associated gene - mechanism associations in the lbd . Gene products including - and -synuclein, gba, parkin, and pink1 need to be examined in csf, blood, and even urine to confirm their presence in biological fluids and threshold of detection . Alterations in the levels of these putative biomarker candidates in csf and blood can provide further insight into the role these mechanisms may play in disease and also the ability of the potential biomarker to reflect resulting cns changes . To better understand the relationship of gene mutations, mechanisms, and disease biomarkers in lbd, it would be of great interest to determine whether the levels of these putative biomarkers in csf and peripheral fluids are altered in patients with known pd, dlb, and lbd mutations . It is likely that combinations of multiple peripheral biomarkers could be needed to monitor the various mechanistic aspects underlying the lbd, but the optimal combination has yet to be determined . Furthermore, both existing imaging modalities as well as novel imaging techniques to detect specific molecular biomarker targets will greatly complement peripheral biomarkers . New specific therapies for the lbd yet to be developed will probably target one or more of the multiple pathways described above, and indeed, this could determine which biomarker or combination of biomarkers would be appropriate as a therapeutic endpoint . Studies are also needed to establish which biomarkers will fulfill the criteria of minimum sensitivity and specificity for the lbd for consistent and reproducible diagnostic use in presymptomatic disease detection and also serve as robust tracking tools and endpoints in monitoring the efficacy of future lbd therapies.
|
When genetic susceptibility testing for hereditary breast and/or ovarian cancer was introduced in the nineties, professionals were concerned about the psychological consequences of learning one's genetic status . Women carrying a brca1/2 mutation have to deal with considerable health risks [1 - 3] and are confronted with difficult choices concerning risk management . Mutation carriers can opt for regular surveillance, for prophylactic mastectomy and/or prophylactic bilateral salpingo oophorectomy, and/or for chemoprevention trials . Besides important health risks and the far - reaching impact of risk management options many have witnessed the disease in relatives and have lost a mother or sister, possibly leaving young children behind . Furthermore mutation carriers risk to pass or to have passed the mutation onto their children with all the above - mentioned consequences for them . Because of the potentially far - reaching implications of brca1/2 susceptibility testing, the " huntington protocol " was adopted for the counselling of unaffected individuals who wanted to know whether they had inherited a familial brca1/2 mutation . This " huntington protocol " has a long history . As the availability of dna analysis for the hd gene was set to become a reality, the committee of international huntington association and the working group on huntington's disease of the world federation of neurology gave consideration to the manner in which these tests should be carried out (iha / wfn 1994). In general, the guidelines recommend that individuals at risk who participate in predictive testing programmes are seen for two to four counseling sessions, spread over a 3-month period, before disclosure of the test results . Predictive testing requires informed consent by the individual at risk, and the provision of psychological support . If the test is abnormal, counselling must be available for the family and others involved . The starting point is that predictive tests should be offered only to individuals at risk who have had the appropriate counselling, are fully informed, and wish to proceed . Genetic centres providing the predictive test have been committed to the use of the international guidelines . Admittedly, after 15 years, testing centres have developed their own local protocols and guidelines, based on experience and local or national rules, but what they have in common is the requirement for multiple interviews before a test result is disclosed . The number and complexity varies, partly due to the number of associated psychological and other evaluations, but the basic structure involves at least the series shown in table 1 . Predictive testing for huntington's disease * genetic centres differ in the application of neurological examination and psychological assessment the expectation of an increase of test requests for a great variety of hereditary disorders in the near future leads us to reconsider the need for such an extensive, time - consuming protocol in the counselling of individuals at risk, including those who may carry a familial brca1/2 mutation . Several psychological studies have now been conducted to determine the psychological impact of genetic susceptibility testing for brca1/2 . In most studies groups of tested individuals were followed prospectively . Generally, the assessment took place before result disclosure and several weeks or months after result disclosure . Non - mutation carriers reported a decline in psychological distress several weeks and months after result disclosure . Mutation carriers showed a stable or decreasing level of distress shortly after result disclosure [6 - 8] and up to 12 months after result disclosure [9 - 11]. Five years after result disclosure the level of distress increased again in both mutation carriers and non - mutation carriers . On the whole the mean level of psychological distress remained underneath the clinical threshold, indicating little need for intervention [6 - 12]. In women affected by cancer also they reported a decrease in anxiety and no change in depression rates one month after result disclosure . Remarkably, the prospect of undergoing genetic testing was rated as less distressing than the high risk status or the diagnosis of cancer by women at risk and women with a personal and familial history of breast and/or ovarian cancer . No unusually high levels of psychiatric disorder were detected in a group of 315 unaffected individuals from families with a known mutation of brca1/2 . In another study it was concluded that of 211 women with a previous history of breast and/or ovarian cancer and 253 unaffected women at risk remarkably few women reported psychological distress and met criteria for psychiatric disorder like depression, anxiety disorder, or alcohol abuse . Compared to women from primary care and community settings, they had lower rates of psychiatric disorder . In summary, no elevated distress levels and a low prevalence of mental health problems have been observed both before and after brca1/2 genetic susceptibility testing . The participants of the studies described here wanted to know their genetic risk status and may therefore consist of a self - selected and psychologically stable subgroup of at risk individuals . Despite the psychological stability of the majority of the group, we emphasise that a subset of women undergoing genetic susceptibility testing for brca1/2 reports a level of distress that warrants clinical attention . Counselees who were referred for psychosocial help generally had more problems with issues like loss and family or partner relationships than with the concern of developing breast cancer . In the five years following testing about half of the mutation carriers and a third of the non - carriers were found to have asked for professional support for psychological problems . Several efforts have been made to identify counselees who risk suffering from psychological adverse reactions . Women reporting more psychological distress at the time of blood sampling generally continue to report higher distress levels after receiving the result . In the main these women are younger and interested in prophylactic surgery . Unmarried women seeking genetic counselling for a family history of breast / ovarian cancer reported more distress than married women in one study . However another study found equal levels of distress in married and unmarried women, but more distress in women with unhappy marriages . A study by wylie et al evaluated the effects of the support and distress of spouses on brca1/2 mutation carriers . Carriers who perceived their spouse to be anxious and non - supportive had higher distress levels one week after result disclosure than carriers who perceived their spouse to be supportive and anxious or low anxious and non - supportive . Carriers who perceived their spouse to be both supportive and low anxious had the lowest distress levels . In carriers with a non - supportive, anxious spouse at the time of testing, distress remained elevated up to two years after testing . Non - carrier men reported more distress when they had carrier siblings and carrier women reported more distress when tested siblings had mixed results . Several other studies have concentrated on coping, like the anticipation of the feelings following a positive result . Women who underestimated their feelings of distress following a positive test result, reported more psychological distress six months after having received the result . A monitoring coping style, i.e. Being very vigilant to threatening information, resulted in more psychological distress while waiting for the genetic test result, but not after receiving results . Women with high levels of baseline distress who declined genetic testing reported an important increase in depression rates . Another study however did not find any psychological vulnerability in a (small) clinical sample of women at risk who did not opt for genetic testing . If the target group generally has enough psychological resources to cope with genetic testing, our energy should be directed to the individuals who risk being unable to cope with it . Therefore we suggest adapting the huntington protocol to the needs and strengths of our brca1/2 counselees . It comprises at least two sessions with a genetic counsellor and additional counselling suited to the needs of the counselee . This brca1/2 protocol could serve as a model for genetic susceptibility testing of other hereditary cancers such as hnpcc . Genetic susceptibility testing for brca1/2 in the first session, careful exploration of the possible impact of testing upon the individual at risk and others involved enables the counselees and their partners to recognise the potential risk factors for inadequate coping . If there are any such factors, additional professional attention from a psychologist or social worker may be of help to anticipate untoward experiences after disclosure of test results . A second session with the counsellor can be offered when unanticipated information or facts emerge in the first session . This enables the counselee to reflect somewhat longer upon the possible consequences and to be more certain to make a thorough decision . Also after the session in which the test result is disclosed, follow - up support by a psychologist or social worker can be offered if needed . Otherwise a follow - up interview by phone and mentioning the possibilities of additional counselling may be sufficient . It is mandatory for the genetic counsellor to master specific communication skills and knowledge about the psychological risk factors, which enables him to identify those individuals who need additional support . Several centres have already adopted a shortened protocol for counselees who apply for brca1/2 genetic susceptibility testing and in the united kingdom certain centres have shortened the protocol for hnpcc pre - test counselling . Aktan - collan et al evaluated a shortened protocol for predictive testing for hnpcc, that consisted of two sessions and no provision of additional psychological support . The majority (88%) of counselees were satisfied with the procedure and suggested no changes . The counselees who suggested changes generally asked for more written material, not for more counselling sessions . However half of the counselees indicated that they might have used psychological support if it had been offered to them . Given these results, we think it is unlikely that the proposed counselling protocol for brca1/2 genetic susceptibility testing results in an increase in adverse psychological reactions, but more research is necessary to evaluate which aspects of genetic counselling contribute to thorough decision making and to the emotional well - being of counselees and their partners . Future research should also aim at determining the characteristics of individuals who might benefit from additional psychological support and at disentangling the psychological processes resulting in ineffective coping . This knowledge will enable us to identify these individuals as precisely as possible and to adjust our counselling further to the individual needs of the counselees . The authors would like to thank hanne meijers - heijboer for her valuable feedback on the manuscript.
|
The amount of body fat may significantly change over the seasons, particularly in latitudes away from the equator, where seasonal changes in climate, temperature and duration of daylight are greater . These lead to changes in availability of certain foods and in individuals feeding habits and outdoor activity (resulting e.g. In picnics being more common in summer) (reilly and peiser 2006). Plasqui and westerterp (2004) have shown that there is a significant seasonal variation in physical activity and total energy expenditure, with lower amounts in winter, in young dutch adults . The biological significance of such seasonal and daily environmental rhythms has long been appreciated (reinberg 1972) and is best seen in seasonal animals and hibernators, which adjust their physiology both in preparation for, and in response to, changing demands of the environment (ebling and barrett 2008). However, in humans living in modern societies, the impact of seasonality has somewhat diminished following the introduction of artificial lighting and heating and air - conditioning systems . The use of these artificial aids reduces the exposure of individuals to fluctuations in ambient temperature and light, and this is more convenient for practising a modern lifestyle . However, these natural fluctuations contribute to the normal adjustment of the body clock to a 24-h period; their extensive use (artificial aids) will lessen this synchronization and may increase the risk of developing mismatches between the natural environment and the body clock (similar to the problems observed after a time - zone transition or during night work). It has been claimed that these misalignments may lead to alterations in metabolism and thermoregulation that promote obesity (johnson et al . While seasonal rhythmicity in energy storage and expenditure is significantly influenced by changes in the external environment (reilly and peiser 2006), the nature of daily rhythms in metabolism is more complex . In this respect, humans possess internal timing mechanisms which can act independently of daily changes in the environment . All cells show a genetic potential for daily rhythmicity, but in practice, this rhythmicity is manifested in only some regions of the body . These regions include the liver (which possesses a food - entrainable oscillator) and the suprachiasmatic nucleus (scn) paired structures in the base of the hypothalamus . The scn normally coordinates rhythmic activity throughout the body (acting via the autonomic nervous system, temperature regulation, hormone secretion, sleep, and feeding behaviour) and is known as the body clock . Evidence is accumulating to suggest that the disruption of these body clocks may contribute to metabolic disorders and predispose to obesity (eckel - mahan and sassone - corsi 2013). Rhythmicity seen in many processes, including metabolism, reflects both personal habits (e.g. Sleep, activity and mealtimes) and the impact of internal body clocks . Humans, like other organisms, possess a timing system that consists of self - sustained oscillators that are reset by various synchronizers . In the absence of time cues, the dominant component of this system free runs with a period of 2425 h, giving rise to a so - called circadian rhythm (from the latin: circa diem about a day). Normally, this rhythm is entrained or synchronized to a 24-h cycle (called daily in this review), predominantly by natural light dark cycles and, to lesser extent, by cycles of rest and activity or feeding and fasting . External stimuli that can synchronize the body clock to a 24-h cycle are called zeitgebers (from german: time givers) (reilly and peiser 2006). The molecular mechanisms that underlie the function of cellular clocks are the oscillating post - translational modifications of proteins (e.g. Phosphorylation) and the autoregulatory feedback loops that control gene transcription and translation . The main loop comprises a positive and a negative limb that are interconnected (albrecht 2012). It consists of the transcriptional activators clock and bmal1 and their target genes per (period) and cry (cryptochrome). Products of these genes accumulate gradually and inhibit clock - bmal1 transcription . In turn, the feedback loop controlling bmal1 involves nuclear receptors rev - erb and ror/ that inhibit and activate bmal1 transcription, respectively . In addition, the activity of rev - erb links metabolism to the clock system (liu et al . Administration of rev - erb ligands in mice has been found to alter expression of both the clock genes in the hypothalamus and the metabolic genes in the liver, skeletal muscles and adipose tissue, resulting in increased energy expenditure (solt et al . The reader is referred to recent excellent reviews (albrecht 2012; bass 2012; bass and takahashi 2010; mohawk et al . The observation that all cells, tissues and organs contain the molecular potential to manifest a clock gave rise to the concept of peripheral and central (master) oscillators, the former normally being subservient to the latter . The central pacemaker in mammals is located in two hypothalamic clusters of neurons, the scn . These centres control behavioural, metabolic and physiological rhythms and can synchronize the peripheral oscillators (welsh et al . An important peripheral oscillator is the food - entrainable oscillator (feo), which controls food - anticipatory activity (faa) in rodents, the exact location of which is unknown (mieda et al . Faa in rodents is an increase in activity just before the food is regularly available . Daily rhythms of locomotor activity, body temperature and corticosterone secretion can thus synchronize with the rhythm of food availability (stephan 2002), even when food is presented during the resting phase or when the central oscillator is destroyed (mistlberger 2011). These observations indicate that the feo (and, possibly, peripheral clocks in general) can act independently of the scn, at least in some animal . This independence of activity may become important when the master oscillator and lifestyle become misaligned . In normal circumstances, the master clock, the environment and peripheral clocks are synchronized to one another (reilly and peiser 2006). Whereas periodicity of the master clock is controlled mainly through the light dark cycle (acting as a zeitgeber), peripheral oscillators are affected either by behaviour (cycles of rest and activity or feeding and fasting) or by fluctuations in the levels of circulating hormones, such as catecholamines (dibner et al . For example, peripheral oscillators in the pancreas and the liver (marcheva et al . 2010) can be adjusted by regular food intake, even if this intake is timed unusually . The scn produces the endogenous component of the observed rhythm, and the exogenous component is superimposed upon it and corresponds to the environment and lifestyle (e.g. Inactivity and fasting when asleep). In practice, therefore, rhythms measured in the presence of an exogenous component may not give clear information regarding the activity of the internal oscillators, and the implications of this will be considered at the end of this review . However, normally, the endogenous and exogenous components are in phase but may become desynchronized (e.g. By night work), because the scn is rather slow to adjust (reilly and peiser 2006). Under such circumstances, the environment and lifestyle may also adjust the timing of the master oscillator (e.g. By changing the light dark cycle) and of the peripheral oscillators (e.g. By changing feeding times, which will impact on feo). Food intake in humans shows not only a daily rhythm (daytime rather than nocturnal eating) but also a rhythm related to the intake of individual meals with a period of about 45 h. this rhythm is ultradian, having a period of oscillation less than 20 h. such rhythms are probably seen in the activity of all hormones associated with food metabolism . While they are linked directly to food intake (and, as such, can be considered exogenous), other rhythms are likely to be derived from internal oscillators . Episodic release of hormones may exhibit yet another periodicity that lasts for minutes and reflects pulsatile release of a hormone followed by its removal and breakdown . There are also infradian rhythms (with periodicity greater than 28 h) including seasonal rhythms . Since there is no clear evidence that endogenous circannual oscillators exists in humans, seasonal rhythms observed are attributed rather to exogenous factors . As indicated earlier, they include seasonal variations in food intake, physical activity, ambient temperature and the duration of daylight . This lack of information is partly due to the obvious fact that such studies demand a more elaborate protocol which covers the four seasons . Moreover, if any interactions between daily rhythms and seasonal rhythms are sought, then the a full set of data covering the 24 h must be collected four times per year . Daily food intake in humans usually consists of two to three main meals consumed at times that depend largely on lifestyle and social factors . It has been observed that food intake in the morning is more satiating than the same meal eaten in the evening (de castro 2009); it has also been observed that the amount of food eaten shows seasonal variations, with increased meal size and total calorie intake occurring in the autumn (de castro 1991). The hunger and satiety centres in the hypothalamus contain receptors for mediators that affect feeding behaviour . These substances are either orexigenic (stimulate feeding) or anorexigenic (inhibit feeding) (naslund and hellstrom 2007). Short - term regulation of food intake involves cholecystokinin (little et al . 2005), peptide yy, glucagon - like peptide and insulin (suzuki et al . 2012), all of which act anorexigenically, and ghrelin, which stimulates appetite (cummings 2006). These mediators display daily and ultradian rhythms in phase with food intake and some of them (ghrelin, leptin, insulin) are also involved in long - term regulation of body weight and energy homeostasis (stutz et al . The mechanisms controlling seasonal food intake and energy balance in seasonal animals and hibernators differ across the species and reflect different strategies employed to survive in a harsh environment (florant and healy 2012). The seasonal changes are executed through fluctuations in humoral signals, including leptin and ghrelin (adam and mercer 2004; florant and healy 2012). Interestingly, while leptin concentrations in humans do not exhibit consistent seasonal changes, it has been observed that the levels of leptin, cholesterol and triglycerides in obese males are significantly higher in winter (kanikowska et al . 2013). The digestive system shows rhythmicity in many functions, including basal gastric acid secretion, epithelial cell proliferation and gastrointestinal motility (ekmekcioglu and touitou 2011). It is attributed primarily to the timing and the size of meals and exhibits daily and ultradian components . However, some aspects of this rhythmicity may reflect the function of a peripheral clock . For example, it has been demonstrated in animals that rhythmic expression of clock genes within the neurons of the myenteric plexus modulates colonic motility by controlling the expression of neuronal nitric oxide synthetase (nnos) and vasoactive intestinal peptide (vip) (hoogerwerf 2010). Indirect evidence for a role of biological clocks in gastrointestinal functions in humans comes from observations of night workers who have altered appetites and a higher prevalence of constipation, diarrhoea and abdominal discomfort (nojkov et al . 2010). Metabolism of absorbed foodstuffs shows rhythmicity that reflects changes in the release of endocrine regulators . Hormones associated with metabolism (including glucagon, insulin, catecholamines, glucocorticoids and thyroid hormones) show both circadian and ultradian oscillations . These rhythms are dominated by food intake (and as such are exogenous and ultradian) but may also be influenced by the scn that produces daily fluctuations in sympathetic nervous system outflow which may affect hormone secretion (e.g. Insulin). Rhythmicity in clock gene expression and adipocytokine release is seen also in white and brown adipose tissues (wat and bat, respectively) (gavrila et al . 2003). Body temperature in adult humans is about 1 c higher during the day, which is attributed both to the sleep - wake cycle (exogenous component) and to the scn - generated rhythmicity in metabolism and peripheral vasculature tone (endogenous component). In babies, however, these rhythms of temperature regulation are not fully developed, and bat plays an important role in heat production . 2006) and shows a 24-h rhythm of glucose uptake (van der veen et al . 2012). Moreover, bat activity is regulated via the sympathetic nervous system and by several hormones, all of which express daily variations (kriegsfeld and silver 2006). Seasonal changes in bat have been observed in humans, with bat growth induced by exposure to cold and associated with the shorter hours of daylight in the autumn and winter (au - yong et al . It is now clear that several aspects of metabolism show daily rhythmicity related to scn function (bass 2012; bass and takahashi 2010; marcheva et al . However, the scn is also adjusted by feeding behaviour and metabolic products, which results in additional ultradian rhythmicity . Moreover, many organs involved in food metabolism, such as the liver (balsalobre et al . 2000), pancreas (sadacca et al . 2011), intestine and stomach (bostwick et al . 2010) and the adipose tissue (johnston 2012), have autonomous peripheral oscillators (fig . 1). Therefore, it is not surprising that factors altering these interactions might adversely impact on metabolism and be associated with an increased risk of obesity . In this respect, it has recently been shown that the impairment of peripheral clocks may be associated with the development of diabetes (pappa et al . 1interactions between the master clock (scn), peripheral oscillators and the environment interactions between the master clock (scn), peripheral oscillators and the environment however, other lifestyle - related factors that have been implicated in obesity (such as sleep duration, eating habits, shift work) have not always received enough attention (chaput et al . . Short sleep (defined as 6 h of sleep per day) and sleep disorders have been associated with lower concentrations of leptin and higher levels of ghrelin and with increased hunger and appetite (taheri et al . In addition, it has been demonstrated that sleep deprivation may contribute to obesity through modulating plasma levels of leptin (mullington et al . 2003). Also, the lack of orexin, a hypothalamic wakefulness - inducing neuropeptide (sakurai et al . 1998), affects sleep, feeding and metabolism (adamantidis and de lecea 2008) and is associated with increased likelihood of developing obesity (funato et al . Narcolepsy, when patients suffer from extreme daytime sleepiness due to the loss of orexin - producing neurons (tsujino and sakurai 2013), has also been linked with increased body mass and obesity (kotagal et al . Patients with night eating syndrome, in whom the patterns of sleep and eating are disrupted, are often obese (colles et al . 2007) and have altered rhythms of plasma leptin, insulin, cortisol, ghrelin, melatonin and glucose (goel et al . It appears that most overweight and obese people sleep less than normal, and therefore, they have more time to eat (chaput et al . 2011) and snack (nedeltcheva et al . 2009b), and they are also at increased risk of insulin resistance and type 2 diabetes (chao et al . Interestingly, sleep architecture changes with seasons, with increased rapid eye movement (rem) sleep during the winter (kohsaka et al . 2possible effects of altered sleep - wake cycles on metabolic hormones and body weight possible effects of altered sleep - wake cycles on metabolic hormones and body weight the exact mechanism linking sleep disturbances and it has been postulated that loss of sleep reduces glucose tolerance and increases insulin resistance (nedeltcheva et al . On the other hand, sleep deprivation may increase food intake and appetite (brondel et al . 2010) by decreasing leptin or by increasing ghrelin (taheri et al . 2004) and orexin (zeitzer 2013). Since sleep is believed to allow the brain to replenish energy stores, it has been speculated that altered sleeping habits might through the autonomic nervous system and hypothalamic - pituitary - adrenal axis impact on the release of metabolic hormones and the control of food intake (spiegel et al . Eating patterns when to eat, the amount of food eaten and the circumstances leading to finishing a meal affect energy intake (blundell and cooling 2000). An important study on the effect of meal frequency / pattern on body fat and metabolic functions in humans was by fbry and tepperman (1970), who found that excessive weight, hypercholesterolemia, impaired glucose tolerance and ischemic heart disease were more common among persons who ate larger meals less frequently rather than smaller meals more often . Grazers, who eat smaller meals throughout the daytime, may be metabolically advantaged compared to gorgers (who eat fewer but larger meals), since larger meals may lead to increased fat synthesis and storage (verboeket - van de venne and westerterp 1991). It has been demonstrated that the same meal eaten at different times of the day may exert different metabolic effects; thus, it appears that a morning meal is associated with better control of body mass than when the same meal is eaten later in the day (keim et al . Such an effect may be related to the amount of physical work performed during the daytime and endocrine responses to food intake (with the insulin response to food intake being time - of - day dependent, for example). In this respect, it has recently been demonstrated in mice that a feeding regimen that restricted feeding time but not calorie intake showed improved nutrient utilization and energy expenditure (hatori et al . 2012). Patterns of food intake can be determined by the social context, time availability and night work . Binge eating involves food intake greatly in excess of metabolic requirements, often with the loss of control over the amount eaten . It has been observed that breakfast was the least, and dinner the most, common meal associated with this practice, and binge eating was often associated with evening snacking (harvey et al . 2011; stunkard and allison 2003). A positive relationship between appetite and food intake no longer exists for meals eaten during the working day; in these circumstances, a proper meal is often replaced by fast food eaten at amounts reflecting time availability rather than appetite . By contrast, if there is plenty of time and one is with friends, food intake is often in excess of metabolic requirements, particularly if alcohol is drunk as part of the occasion s conviviality (de castro 2009; waterhouse et al . The type of food eaten varies also over the day with greater intake of carbohydrates at breakfast and of fat at dinner (westerterp - plantenga et al . Short and irregular sleeps are associated with consuming more fats, fast foods and sweet beverages, and less vegetables (baron et al . 2011), as well as with more palatable foods high in sugar, fat and salt rather than rich in protein or roughage (st - onge et al . These problems are particularly evident when snacking late at night or during a nocturnal waking episode . The mechanisms linking frequency of food intake and the type of food eaten remain unclear, but it has been suggested that lower leptin and higher ghrelin concentrations are involved (taheri et al . For example, meals with a high fat - to - carbohydrate ratio decrease plasma concentrations of leptin (havel et al . 1999) and ghrelin (monteleone et al . 2003) concentrations . Shift and night work may disturb 24-h rhythms, including endocrine rhythms (morris et al . Night work is associated with an increased risk of metabolic syndrome (esquirol et al . 2009), obesity (pandalai et al . 2013) and sleep disturbances (ohayon et al . 2003) and tend to snack (on foods high in salt and carbohydrate) rather than eat a full meal during the shift . In addition, attempts to eat with their families whenever possible often mean that total daily food intake increases . The combination of these factors increases the likelihood of developing indigestion, obesity and metabolic disorders (karlsson et al . Lack of synchrony between body clocks and lifestyle may change the secretory profiles of metabolic hormones, including ghrelin and leptin (crispim et al . 2011), which may contribute to increased appetite and higher energy intake (spiegel et al . 2004). Gaining weight is more likely if night workers also experience social disturbances due to their abnormal lifestyle (waterhouse et al . 2005). Thus, disturbed expression of clock genes in wat was detected in genetically obese mice of the kk and kk - a(y) strains (ando et al . These mice showed also abnormal leptin secretion, sleep disturbances, altered locomotor activity and changed rhythms of adiponectin and resistin release . Also, mice with adipose tissue - targeted deletion of bmal1 displayed increased adiposity and body weight, impairment of feeding rhythms and alterations in the expression of hypothalamic neuropeptides that regulate appetite (paschos et al . Similarly, obese humans were found to differ in the expression patterns of several clock and metabolic genes in adipose tissue (garaulet et al . 2011), in the rhythms of plasma adipokines (saad et al . 1998) and in daily rhythms of leptin and ghrelin secretion (heptulla et al . 2001; yildiz et al . In addition to being a key component of the body clock, adipocyte bmal1 has also been implicated in adipose tissue differentiation and lipogenesis (shimba et al . 2005). Moreover, the expression of uncoupling protein-1 (ucp1) that is in involved in bat thermogenesis was found to associate with winter accumulation of visceral fat (nakayama et al . The central and peripheral clocks act to coordinate behavioural and metabolic responses with the environment . Light dark cycles entrain the central clock in the scn, which then synchronizes peripheral clocks and the rest of the body through autonomic innervation, body temperature, endocrine signalling and feeding - related cues . Feeding can regulate peripheral clocks independent of the central clock through local metabolites and signalling pathways . Increasing evidence suggests that this harmony may become disturbed either through behavioural misalignment (such as shift work or jet lag) or metabolic challenges (e.g. High - fat feeding) (bass and takahashi 2010). This may lead to further weakening of links between the clocks and result in abnormalities that promote weight gain, obesity and development of metabolic syndrome . Future research will need to elucidate the exact molecular mechanisms linking biological clocks with metabolic homeostasis and nutrient state . Ultimately, such studies may help to prevent metabolic derangement and obesity in individuals with sleeping disorders or working on shifts and to optimize weight loss regimens . Also, whilst there is considerable evidence that altered daily rhythms are associated with obesity and allied problems, there is an interpretive problem associated with such results . As already mentioned, a measured daily rhythm reflects not only the activity of the central and peripheral oscillators controlling metabolism but also exogenous effects directly due to the pattern of food intake (including the period of fasting during sleep). That is, a measured rhythm is not necessarily an accurate reflection of the activities of the internal mechanisms (the oscillators); it might be masked by the exogenous component . It is important to distinguish between these two causes of a rhythm if detailed information regarding the interactions between the internal oscillators and metabolic processes in obesity is sought . One way to separate the effects of these two causes is to minimize the exogenous component; this could be achieved by giving identical meals at equal time intervals throughout the 24 h, also prohibiting sleep . The rhythms observed in these circumstances (when the patterns of food intake and the sleep - wake cycle have been removed) would then reflect those of the internal processes far more closely . Such studies are of fundamental importance to a better understanding of obesity and need to be performed in future research.
|
The lumbar multifidus (lm) muscle is an important local stabilizer of the spinal segments1 . Its main function involves stabilizing the neutral zone of the lumbar spine2 and controlling the extension moment of the lumbar spine3 . A previous study showed that the lm was atrophied on the side of pain in patients with acute4 and chronic unilateral low back pain (lbp)5 . On the other hand, the lumbar erector spinae (les) muscles are global stabilizers of trunk stability; high les activity is associated with increased spinal loading6 and may induce pain or even be harmful in patients with lbp . Lumbar extensor strengthening or stabilization exercises that focus on the lumbar paraspinal muscles are frequently used by physical therapists for the treatment of lbp entailing dysfunction of the lumbar paraspinal muscles7, 8 . In contrast to lumbar extensor strengthening exercises, which involve activation of the paraspinal musculature at high levels of contraction, lumbar stabilization exercises involve low - load, low - intensity isometric or restricted range - of - motion techniques9 . Various exercises have been evaluated to determine whether or not high electromyographic (emg) activity of the lumbar paraspinal muscles influences lbp treatment outcomes . In particular, recent research has shown high emg activity of the lm during prone trunk extension (pte) and four - point kneeling contralateral arm and leg lift (fpkal) exercises . Mayer et al.10 recommended trunk extension exercises with gradually increasing load and intensity to improve lumbar extensor strength and endurance . Imai et al.11 reported higher emg activity of the lm than of the les during contralateral arm and leg lift, but their study did not focus on selective activation of the lumbar paraspinal muscles . Although recent research has suggested that the lumbar paraspinal muscles play a significant role in stabilizing the lumbar spine during exercise12, and previous studies have focused on the effect of lumbar extensor exercises on the lumbar paraspinal muscles, no studies have evaluated the selective activation of the lm muscles during pte and fpkal exercises . Moreover, in the clinical field, because lumbar extensor exercises have been frequently utilized in therapeutic approaches for the recovery of lbp by many physical therapists, an experimental study for baseline data with healthy individuals is needed to assess the efficacy of lumbar extensor exercises aimed at selective activation of the lumbar paraspinal muscles . Because experimental data from patients with lbp may show different emg activity patterns of the lumbar paraspinal muscles, this study examined the selective emg activity of the superficial lm during pte and fpkal exercises in healthy male and female subjects . Twenty healthy individuals (nine male and 11 female subjects) aged 20 to 22 years were recruited for this study . The average age of the subjects was 20.14 0.24 years, and their mean height and weight were 168.90 7.27 cm and 63.29 8.08 kg, respectively . The subjects were healthy individuals without lbp who had not participated in lumbar strengthening or stabilization exercises in the past 6 months . All subjects signed an informed consent form approved by the inje university ethics committee for human investigations prior to participation . The emg data were collected and analyzed using a surface emg system (mp150; biopac systems, inc ., santa barbara, ca, usa). After rubbing the skin at the electrode sites with alcohol swabs, pairs of disposable surface electrodes were unilaterally attached over the left les (2 cm lateral to the l2 spinous process and aligned parallel to the spine)13 and lm (2 cm lateral to the midline on a line through the l5 spinal process and parallel to the muscle fibers)13, and left - side surface emg data were recorded from the les and lm . The raw emg signals were amplified, sampled at a rate of 1,000 hz, band - pass filtered between at 20 to 500 hz, and the root mean square value was calculated . Maximum voluntary isometric contractions (mvics) were performed against manual resistance for all muscles14 . Mvic of the lumbar paraspinal muscles were performed three times for 5 s each . The average muscle activity of the middle 3 s of each of the three trials was used for normalization . The lm / les ratio was calculated to examine selective activation of the lumbar paraspinal muscles during pte and fpkal exercises . The subjects were asked to lie in the prone position while resting their arms on a plinth with the head at the midline . They were then instructed to extend the trunk as far as possible with their hands across the chest and legs resting flat on the plinth . For fpkal, the subjects started from a four - point kneeling posture with their hands on push - up handles shoulder - width apart and knees positioned at hip width and maintained at 90 flexion . They were then asked to lift their right arm and left leg simultaneously as far as possible until both were approximately parallel to the floor while maintaining normal lumbar lordosis . The subjects were asked to maintain this exercise position with isometric contraction for 5 s, and the exercise was performed five times . Emg data of the lumbar paraspinal muscles during the two exercises were compared using the paired t - test . The% mvic of the activity levels of the left les and lm were greater during pte (les, 87.2 11.7; lm, 83.3 15.8) than during fpkal (les, 31.3 14.9; lm, 41.9 20.0; p <0.05), whereas the lm / les ratio was significantly higher during fpkal (mean sd, 1.61 0.51) than during pte (0.96 0.18; p <0.05). The% mvic as determined from the emg activity levels of the left les and lm during the pte and fpkal exercises is shown in table 1table 1.%mvic and the lm / les ratio of the emg activity levels of the les and lm during pte and fpkal exercisesptefpkalleslmleslm%mvic (mean sd)87.2 11.783.3 15.831.3 14.941.9 20.0lm / les ratio0.96 0.181.61 0.51pte: prone trunk extension; fpkal: four - point kneeling contralateral arm and leg lift; les: lumbar erector spinae; lm: lumbar multifidus;% mvic: percentage of maximal voluntary contraction . Pte: prone trunk extension; fpkal: four - point kneeling contralateral arm and leg lift; les: lumbar erector spinae; lm: lumbar multifidus;% mvic: percentage of maximal voluntary contraction this study investigated the selective activation of the lumbar paraspinal muscles during pte and fpkal exercises in healthy male and female subjects performing two lumbar extensor exercise programs . The emg activity level of the les and lm was higher during pte than during the fpkal exercise . On the other hand, the lm / les ratio during the fpkal exercise was significantly higher than that during pte . These findings indicate that fpkal is more beneficial for the selective activation of the lm muscle than pte, although higher les and lm muscle activation was observed during pte than during fpkal . This outcome indicates the need for higher les activation to lift the trunk, a high load, during pte, and the lower requirement for les activation, about half the activity level observed during pte, given the lower load during fpkal . Many researchers have emphasized the safety of exercises for treatment of lbp, with a particular focus on lm and les function . Richardson et al.15 suggested that the multifidus must contract independently of the global muscles, and mcgill et al.16 suggested that excessive spine loading related to high activation of global muscles should be avoided in patients with back pain to prevent structural damage . The lm is a lumbar stabilizing muscle that mainly comprises type i fibers17, and relatively low loads requiring only approximately 3040% of mvic are needed to improve lm muscle performance15 . Additionally, in one study that evaluated joint compression and shear force using an emg - driven model during different exercises, the mean compression values of the lumbar joint (l4/l5) were lower during contralateral arm and leg lift exercises than during trunk extension exercises, 2500 and 4000 n, respectively18 . Another study noted negative l4/l5 anteroposterior joint shear force values on the lumbar spine during contralateral arm and leg lift (values of approximately 200 n) compared with trunk extension exercises (values of approximately 250 n)19 . Thus, the fpkal exercise of our study (appropriate emg amplitude of approximately 40% of mvc) is suitable for exercising the lm muscle function with selective activation of the lumbar paraspinal muscles and is recommended as a safe and effective simple therapeutic exercise for treatment of lbp . An emg recording method that targets the emg site in the lm could be used for intramuscular emg . Second, the measurement of mvic for emg normalization was performed in prone trunk extension, like the biering - sorenson endurance test, and this may have led to the recruitment of other muscles . Third, because we examined healthy young individuals, the results of this study cannot be generalized to older adults or patients with lbp . We may assess the effects of exercise on selective activation of the lumbar paraspinal muscles in older adults or patients with lbp in a further study.
|
Acute renal failure (arf) or acute kidney injury includes a wide range of disturbance in kidney function . Renal ischemia / reperfusion injury (riri) which occurs mainly in different clinical circumstances such as renal transplantation is responsible for high morbidity and mortality rate . Endothelin-1 (et-1) as one of the most known potent vasoconstrictors is up - regulated during renal ischemia, so it increases renal vascular resistance and causes reduction in renal blood flow after reperfusion . Et-1 seems to exacerbate riri, because administration of bosentan (bos) - a dual et-1 receptor antagonist demonstrated protective effects on experimental riri . Et-1 and therefore, et-1 is probably a key mediator in the maintenance of gender - mediated differences after riri . In this short study, groups 1 (male, n = 6) and 2 (female, n = 6) as sham - operated were subjected to surgery without ischemia . The groups 3 (male, n = 6) and 4 (female, n = 6) received saline as vehicle 2 h before induction of ischemia . Groups 5 (male, n = 6) and 6 (female, n = 6) were treated similar to groups 3 and 4 except they received bos (50 mg / kg) instead of vehicle . Twenty - four hours postreperfusion, the animal was anesthetized again, and blood samples were obtained via heart puncture . After sacrificing the animals, the serum levels of creatinine (cr) and blood urea nitrogen (bun) were measured by quantitative diagnostic kits (pars azmoon, tehran, iran). Serum and tissue levels of nitrite were measured by an assay kit (promega corporation, usa) that involves the griess reaction . The data were expressed as mean standard error of mean the groups were compared in terms of the serum levels of bun, cr, nitrite, and mda; and tissue nitrite and mda levels and kidney weight (kw) using the one - way analysis of variance followed by the least significant difference test . The serum levels of creatinine (cr) and blood urea nitrogen (bun) were measured by quantitative diagnostic kits (pars azmoon, tehran, iran). Serum and tissue levels of nitrite were measured by an assay kit (promega corporation, usa) that involves the griess reaction . The data were expressed as mean standard error of mean the groups were compared in terms of the serum levels of bun, cr, nitrite, and mda; and tissue nitrite and mda levels and kidney weight (kw) using the one - way analysis of variance followed by the least significant difference test . Riri significantly increased the serum levels of bun and cr in both genders when compared with the sham operated groups . Serum levels of blood urea nitrogen and creatinine, and kidney weight per 100 g body weight in three experimental groups of sham, ischemia and ischemia treated with bosentan in male and female rats . Star (*) and (#) indicate significant differences (p <0.05) from sham or ischemia group, respectively . N = 6 in each group kw was significantly increased by the riri, and it was significantly decreased by bos in female rats [figure 1]. Body weight change indicated no significant difference between the males and females groups [table 1]. Sn (mole / l) and smda (mole / l), kn (mole / g tissue) and kmda(nanomole / g tissue), and w (g) in three experimental groups of sham, ischemia and ischemia treated with bos in male and female rats there were significant differences in serum and kidney levels of mda in male but not those of female . Neither male nor female groups demonstrated no significant changes in serum and kidney levels of nitrite [table 1]. Riri significantly increased the serum levels of bun and cr in both genders when compared with the sham operated groups . Serum levels of blood urea nitrogen and creatinine, and kidney weight per 100 g body weight in three experimental groups of sham, ischemia and ischemia treated with bosentan in male and female rats . Star (*) and (#) indicate significant differences (p <0.05) from sham or ischemia group, respectively . Kw was significantly increased by the riri, and it was significantly decreased by bos in female rats [figure 1]. Body weight change indicated no significant difference between the males and females groups [table 1]. Sn (mole / l) and smda (mole / l), kn (mole / g tissue) and kmda(nanomole / g tissue), and w (g) in three experimental groups of sham, ischemia and ischemia treated with bos in male and female rats there were significant differences in serum and kidney levels of mda in male but not those of female . Neither male nor female groups demonstrated no significant changes in serum and kidney levels of nitrite [table 1]. Riri is the first most common cause of inpatient's arf . Over the past years, studies have identified a variety of methods to treat renal riri . In the present study, we attempted to investigate the gender - related effect of bos as et-1 blocker on renal riri . Our results showed that renal ischemia - reperfusion induced renal failure that characterized by increasing bun and cr as well as kw in both genders . There are some reports suggesting that et-1 is involved in the development of postischemic arf in clinical transplantation . Recent studies suggest the importance of enhanced renal production of et-1 in the pathogenesis of ischemic arf . For example, plasma et-1 levels are elevated in arf, and renal ischemia increases renal et-1 content and et receptor affinity . Infusion of et-1 decreases glomerular filtration rate, renal blood flow, sodium excretion and increases filtration fraction and renal vascular resistant while co - injection of vml 588 (et - a antagonist) will reduce all sequences except glomerular filtration rate . . Showed that et-1 contributes to experimental renal cold ischemia - reperfusion injury, and bos can attenuate this injury . The present study showed that pretreatment with bos as a nonselective dual eta / etb receptor antagonist could attenuate post - ischemic renal injury in both genders . Moreover, several investigators have noted that exogenous monoclonal or polyclonal antibody to et, eta receptor antagonists, or eta / etb dual receptor antagonists ameliorated declines in glomerular filtration rate and tubular damage in ischemia - reperfusion injury . Bos was shown to have a beneficial effect on experimental ischemia / reperfusion injury in the spinal cord, testis, heart and kidney . It was showed that bos treated rats had higher renal blood flow, cr clearance, glomerular filtration rate and lower plasma cr after riri . Also, administration of an et receptor antagonist 24 h after the ischemic damage was highly effective in reversing arf . Despite sexual dimorphism in the majority of physiological and pathophysiological conditions, the majority of experiments on ischemia - induced arf have been conducted in male animals only . The course of post - ischemic renal failure has not been systematically compared between males and females . Therefore in this study to gain further insights into the role of gender in ischemic renal damage, we compared this process in male and female rats . There is identified that female mice were more resistant to renal insulin receptor (ir) injury compared with male mice . Williams et al . Measured the serum level of bun and cr levels for 0, 0.5, 1, 2, 4, 6, 9, and 24 h and 1 week post - riri, and reported that the earliest renal injury started at the 4 h following ischemia and peaked at the 1 day . Commonly used definitions of arf include an increase in serum cr, a reduction in the calculated cr clearance of 50%, or a decrease in renal function that results in the need for dialysis . However, serum cr production changes significantly according to age, sex, muscle mass and dietary intake . The possible effect of sex on serum cr level might be one of the reasons that we did not infer any significant difference in cr level among different genders . By contrast, mller et al . Suggested that gender has a major impact on ischemia - induced renal damage and sex hormones play a crucial role in this difference . Sex hormones have been reported to have an important role in i / r - induced inflammatory processes in the kidneys . Previous studies have demonstrated that testosterone has an important role in increasing the susceptibility to ischemic renal injury . By contrast, other experimental results suggest that estrogen has a protective effect in ischemic renal injury in female via suppression of et-1 production and activation of the phopsphatidylinositol-3 kinase / protein kinase b signaling pathway . Our result showed no difference in nitrite level between the male and female groups, and kidney mda level reduced only in male, but other study showed that kidney mda level decreased in male and female ischemic animals, and ir decreased serum and kidney level of nitrite . We conclude that bos can be used in both genders to attenuate injury induced in kidney ischemia possibly due to its effect in the renal vascular system.
|
Chronic total occlusion (cto) angioplasty is one of the most challenging procedures remaining for the interventional operator . Recanalizing ctos can improve exercise capacity, symptoms, left ventricular function and possibly reduce mortality . Many strategies, such as escalating wire, parallel wire, see - saw, contralateral injection, subintimal tracking and re - entry (star), retrograde wire techniques (controlled antegrade retrograde subintimal tracking, cart), reverse cart, confluent balloon, rendezvous in coronary, and other techniques, have been described . Selection of the most appropriate approach is based on assessment of vessel course, length of occluded segment, presence of bridging collaterals, presence of bifurcating side branches at the occlusion site and other variables . Today, with significant operator expertise and the use of available techniques, the literature reports a 5095% success rate for recanalizing ctos . We describe the use of a variety of previously described techniques, including star, parallel wire, and contralateral injection techniques to attempt a complex dissected cto . After failure of these techniques, we successfully performed a high - risk maneuver described in peripheral angioplasty literature of aggressive dilation and perforation of the created false lumen to allow access to the true lumen for recanalization without loss of major branches . Although false lumen balloon dilatation is not completely novel in itself (it is, in fact, used in the cart technique) its use to avoid side branch loss and allow earlier or more proximal re - entry into true lumen has, to our knowledge, not yet been described in detail . A 54-year old male smoker with a history of hypertension presented with a 6-month history of progressive angina culminating in admission with prolonged episodes of angina post exercise . He was subsequently referred for coronary angiography . The body of the left anterior descending (lad) and left circumflex (lcx) arteries had minimal disease . Excellent rentrop grade iii collaterals were present to the right coronary artery (rca) branches culminating at the crux (figure 1). The native rca was dominant and had a segment 3 occlusion with the appearance of a possible wedge - like linear dissection and a discreet false lumen observed post occlusion (figure 2). Figure 1rentrop grade iii collaterals from left coronary to distal right coronary artery till crux of vessel . Rentrop grade iii collaterals from left coronary to distal right coronary artery till crux of vessel . Figure 2dissected chronic total occlusion with linear defect followed by weak opacification of distal false lumen . Dissected chronic total occlusion with linear defect followed by weak opacification of distal false lumen . A 6 french jr4 guider was engaged into the rca and then a 5 french diagnostic catheter was placed in the left main coronary artery for contralateral guidance . A whisper ms (abbott vascular inc .) Followed by a fielder xt (asahi, abbott vascular inc .) Wire were unsuccessful in crossing this apparently dissected cto . Subsequently, a miraclebros 6 (asahi, abbott vascular inc .) Cto wire was utilized, and initially crossed into the established proximal false lumen (figure 3). The miraclebros 6 wire was, with significant difficulty, gradually manipulated into the posterior descending vessel branch distally, and a second soft wire was easily tracked along the course of the miracle 6 wire . After a contralateral test shot to ensure luminal placement of both wires, the miracle 6 wire was pulled back in order to avoid distal perforation (figure 4). After balloon dilatation, only thrombolysis in myocardial infarction (timi) grades i - ii flow was achieved . The balloon was not able to traverse the crux of the vessel into the posterior descending artery (pda) even after repeated attempts . On angiography, it appeared that the wire had continued into a false subintimal lumen from the beginning of the cto and then re - entered into the true lumen distally at the crux (star technique without the wire knuckling component) with access to both the pda and posterolateral branches (figure 5). A separate contrast - filled true lumen could be visualized in the distal rca on the inferior border of the vessel below the subintimal plane due to retrograde contrast filling from the pda (figure 5). No balloons were able to reach the crux since all would catch at the distal re - entry site . Multiple parallel wires including miracle wires were used to attempt earlier re - entry to true lumen in the distal rca so as not to compromise the pda or posterolateral branches by shifting the dissection plane across one of the major branches during stent placement . Intravascular ultrasound (ivus) guided earlier pre - crux wire re - entry into true lumen was not thought to be wise at this juncture as no catheter would move beyond the crux region and imaging for re - entry was required fairly distal in the vessel, risking extension of the subintimal plane further into the pda or posterolateral vessel . Figure 4contralateral injection demonstrating second soft wire in true lumen of branch of posterior descending vessel with miraclebros 6 wire pulled back . Contralateral injection demonstrating second soft wire in true lumen of branch of posterior descending vessel with miraclebros 6 wire pulled back . Figure 5right coronary artery after dilation with a 1.25 mm balloon demonstrating the false lumen initial course (thin arrows) of the wire till the crux and subsequent re - entry into true lumen beyond crux (thick arrow), demonstrating true lumen of distal right coronary artery on inferior border of vessel (hyphenated arrow). Right coronary artery after dilation with a 1.25 mm balloon demonstrating the false lumen initial course (thin arrows) of the wire till the crux and subsequent re - entry into true lumen beyond crux (thick arrow), demonstrating true lumen of distal right coronary artery on inferior border of vessel (hyphenated arrow). We had limited operator familiarity with retrograde techniques for the cart or reverse cart techniques, so these were not utilized . Based on previous peripheral angioplasty literature and the retrograde confluence balloon techniques, we attempted to dilate more aggressively with 2.25 and 2.5 mm balloons halfway into the false lumen with the hope of either rupturing / perforating the intima and allowing entry back into true lumen, or disrupting microchannels and loose fibrous tissue and opening a proximal true - distal true lumen connection (figure 6). At this point, the balloon dilations in the false lumen appeared to open a new channel toward the inferior aspect of the vessel allowing easy wiring through a shorter segment of false channel, more proximal to the crux bifurcation, allowing access to the true lumen more proximally in the vessel (figure 7). The first wire was repositioned distally into the posterolateral branch to avoid confusion and the second wire was left in the pda . Further balloon inflations were performed over this second wire as opposed to the first wire, restoring timi iii flow for the first time, since the vessel flow was no longer impeded by a long subintimal channel as before . Over this second wire, the balloons would easily cross beyond the crux into the pda, unlike over the first wire that was caught at the crux in the subintimal plane . Over this second wire, two drug eluting stents (3.028 mm and 3.528 mm) were subsequently deployed in an overlapping fashion obtaining an excellent angiographic result with completely preserved distal branches (figures 8 and 9). Figure 62.5 mm balloon inflation in false lumen to allow rupture into true lumen . Figure 7top wire in posterolateral vessel (double arrow) through false lumen proximally with distal in true lumen, second wire now through earlier re - entry into true lumen in distal right coronary artery positioned distally in posterior descending vessel (bottom arrow); this wire allowed easy tracking of balloons into branches . Top wire in posterolateral vessel (double arrow) through false lumen proximally with distal in true lumen, second wire now through earlier re - entry into true lumen in distal right coronary artery positioned distally in posterior descending vessel (bottom arrow); this wire allowed easy tracking of balloons into branches . Figure 8first stent deployed at crux of right coronary artery over posterior descending vessel wire . First stent deployed at crux of right coronary artery over posterior descending vessel wire . Figure 9result post 2 drug eluting stent implantation over posterior descending vessel wire with completely preserved branches and thrombolysis in myocardial infarction 3 flow . Result post 2 drug eluting stent implantation over posterior descending vessel wire with completely preserved branches and thrombolysis in myocardial infarction 3 flow . Contemporary cto negotiation strategies, techniques and equipment have progressed rapidly over the last few years . With antegrade dedicated cto wires, parallel wire, see - saw, ivus guidance, tornus, star technique and the subsequent surge in retrograde techniques (cart, reverse cart, knuckle wire) and others, the armamentarium for tackling ctos continues to grow . However, the most important factors determining success in complex ctos remain operator experience, patience and perseverance . The intentional creation of false antegrade and retrograde lumens to create subintimal vessel courses is well described in the peripheral angioplasty literature and in descriptions of the star and cart / reverse cart techniques . Some of the disadvantages of the routine star technique may include potential loss of side branches, longer stent length requirement, risk of vessel perforation, and stent thrombosis . It is, however, a unique and very useful tool to tackle difficult ctos and has contributed both technically and conceptually to important advances made in this field, being a potential set - up for the newer cart technique . Histological studies of ctos have shown small microchannels (100200 um) in the center of the occlusion for younger ctos, whereas these microchannels are often found to connect the lumen to the vasa vasorum for older ctos, often leading to subintimal wire tracking with antegrade wiring for these more established occlusions . Other ctos have been found to harbor masses of loose fibrous tissue that may potentially disrupt balloon inflations, allowing wire penetration . Peripheral angioplasty literature has described balloon angioplasty of false lumens for lower extremity star technique angioplasty that may allow rupture of the intima and facilitate re - rentry into the true lumen . The confluent balloon technique described by wu et al . Describes the placement of an antegrade false lumen balloon catheter with a simultaneous placement of a retrograde balloon catheter in a separate false lumen generated retrogradely . After placement of both balloons at the same longitudinal position, the authors describe the creation of a confluent lumen by simultaneous balloon inflation to allow rupture of both false lumens into each other . We have described a novel case of dilation of a false lumen channel to allow rupture into the true lumen and stenting without side branch loss . This is especially important with rca ctos that are distal and may involve the crux where side branch loss is not tolerable, unlike acute marginal loss in the mid- or proximal - rca that is often better tolerated . This is a high - risk maneuver that may cause false lumen extension / enlargement with loss of hetero - collaterals, preventing wire re - entry if intimal rupture or disruption is not successfully accomplished with this method or even, less commonly, perforation . We certainly do not recommend this method as a mainstay or first - line approach and it should be reserved as an end - stage option . Calcification of the intima and degree of rigidity of the cto may determine the success of this maneuver in accomplishing intimal rupture . Operator experience and ability to deal with the possible complications that may ensue, such as perforation, false lumen extension and compromised side branch, is mandatory before attempting such an approach . Ivus guided reentry, if sufficient distal vessel prior to bifurcation is available (not the case here), utilization of other re - entry equipment such as the stingray catheter (bridgepoint medical inc . ), and retrograde recovery techniques, if available at the center, may be more established methods that should be used first . Other techniques that have been well described include the mini - star technique where a microcatheter is advanced to the proximal cap of the occlusion and a fielder family wire (asahi intecc, nagoya, japan) with a 4050 first curve and a 1520 second curve 35 mm proximal to the tip is used to navigate through microchannels or, alternatively, assumes a j - shape configuration and knuckles through a subintimal plane re - entering true lumen distally . In a single center study, an alternative limited antegrade subadventitial technique (last) also limits the amount of subad - ventitial extraluminal tracking to the region of the chronic total occlusion . Furthermore, the venture wire control catheter (st jude, minneapolis, mn, usa) has been used both as a device for wire support at the site of proximal cap entry and, more importantly, due to its ability to form angulation, has been described for distal true lumen re - entry, both with routine cto wires and together with the stingray 0.0035 inch tapered tip stiff wire for luminal re - entry, especially in cases of occlusive instent restenosis ctos . A novel technique described to enter the proximal cap for challenging ctos has been the open sesame technique . There are some similarities between our balloon rupture technique and the plaque shift theorized with the open sesame technique that allows for proximal cap penetration . The open sesame technique essentially requires a stiff wire or balloon to be placed in the ostium or proximal segment of a branch (which is ideally 90 angulated) which is situated at the proximal cap . Saito theorizes that this may favorably shift plaque or create an opening in the proximal cap of ctos with branches to allow subsequent wire penetration with dedicated cto wires . Clearly, our method should only be used as a last resort, as complete collapse of the true lumen may occur making further wiring impossible . We would recommend the use of many of the routine cto techniques, as well as one or a combination of the above more established techniques, prior to embarking on our high - risk no option method described here . Surgical advice and backup is always recommended in complex cases such as these since bailout surgical intervention in case of catastrophic perforation or infarction may be a valuable option . We describe a strategy of balloon dilatation of false lumen subintimal entry to allow intimal rupture and re - entry into true lumen in case of intentional or inadvertent star technique for complex antegrade cto negotiation . The aim was to allow distal side branch preservation for more complete revascularization and to minimize false lumen stenting, hopefully reducing perforation risk . Although false lumen balloon dilatation has been previously described in the cart technique, targeted false lumen inflation to allow earlier re - entry and prevent side branch loss has not yet, to our knowledge, been described . Given the risks involved, this technique should be kept as a last step option in the hands of experienced operators . This report will hopefully make a small contribution to the evergrowing armamentarium of cto techniques and equipment.
|
Propofol is a commonly used drug for induction of anesthesia because of its rapid onset and short duration of action, easy titration, and favorable profile for side effects . However, despite these positive attributes, about 28 - 92% patients experience pain on injection of propofol, with one of three patients reporting severe or excruciating pain . The mechanism of propofol injection pain is still unclear; it has been postulated to be due to either a direct irritant effect giving rise to an immediate sensation of pain or an indirect effect via the release of mediators such as bradykinin leading to a delayed onset . As a result, several interventions have been investigated to alleviate the pain associated with propofol injection with varying results . Numerous physiological and pharmacological methods have been described in literature so as to decrease the incidence of this pain such as selection of a larger vein, decreasing the speed of injection, or diluting the propofol solution, or pretreatment with lignocaine, ondansetron, metoclopramide, opioids, and thiopentone . Tramadol a centrally acting analgesic we also hypothesized that intravenous (iv) administration of butorphanol, a synthetic opioid agonist antagonist can also reduce pain during induction with iv propofol . It is a kappa receptor agonist, as well as a mu - receptor antagonist, resulting in analgesic and sedative properties without profound respiratory depression or euphoria . Hence, we conducted this randomized, double - blind, placebo - controlled study to compare the efficacy of pretreatment with butorphanol and tramadol for alleviation of pain associated with propofol injection . After obtaining approval from the institutional ethical committee and written informed consent of the study subjects, this prospective study was conducted on 90 adult patients belonging to the american society of anesthesiologists (asa) grade i and ii in the age group of 18 - 60 years scheduled for elective surgery under general anesthesia with propofol as an induction agent . Consecutive sampling technique with random assignment was used to allocate to one of the three groups of 30 patients each and respective drugs were given intravenously in the volume of 3 ml prior to injection of propofol . Patients with a history of chronic pain syndromes, thrombophlebitis, neurological disease, and allergy to the study drugs were excluded from the study . The patients were informed of the possibility of a burning sensation in the forearm during induction of anesthesia . The drugs were prepared in identical syringes and in equal volume by the anesthesia technician who was unaware of the study design and were marked with different codes (i, ii, iii) so that even the anesthesiologists who were recording the observations remained blinded to the drug . A detailed preanesthesia checkup was conducted wherein the patients were educated on the use of visual analog scale (vas) for assessment of pain during the perioperative period . All patients were advised to be kept nil per oral for 8 h prior to surgery and received uniform premedication in the form of tablet ranitidine 150 mg and tablet alprazolam 0.25 mg night before surgery . In the operating room, an iv line was secured in a peripheral vein on the dorsum of the hand with an 18-gauge iv cannula . The following monitoring was instituted: electrocardiogram for heart rate and rhythm, systolic blood pressure, diastolic blood pressure and mean arterial pressure, respiratory rate, and oxygen saturation . Recording of these parameters was done before induction, during induction, intraoperatively every 2 min up to first 10 min and thereafter every 5 min until the end of the surgical procedure . Group i patients received injection normal saline 3 ml iv (placebo), while group ii and group iii patients received injection tramadol 50 mg and injection butorphanol 1 mg iv, respectively, made up to 3 ml by adding normal saline in a blinded manner . A tourniquet was applied and inflated to 70 mm hg in which the iv line was secured . Then the study drugs (tramadol, butorphanol, and placebo) were administered through iv cannula at the rate of 0.5 ml / s . After 2 min of injecting the study drug, tourniquet was deflated and immediately injection propofol 2.5 mg / kg at the rate of 0.5 ml / s was administered for induction of anesthesia . Patients were asked about the intensity of pain on propofol injection by using pain vas on a range of scores from 0 to 100 before the loss of consciousness . Side effects such as erythema, pruritus, sensation of heat, and allergic reaction were noted postoperatively immediately after the surgery and then 24 h after surgery . Based on the distribution of pain vas scores in postsurgical patients who described their postoperative pain intensity as none, mild, moderate, or severe the following cut points on the pain vas have been recommended for this study: no pain (0 - 4 mm); mild pain (5 - 44 mm); moderate pain (45 - 74 mm); and severe pain (75 - 100 mm). Based on the results of the previous study and assuming type - i error () at 0.05, type ii error () at 0.1, and power of the study at 80% so as to detect a difference of 20% in the incidence of pain between the study and control groups the sample size was calculated as 26 patients in each group . However, we chose 30 patients in each group considering possible dropouts and for better validation of results . The decoding of drugs was done at the end of the study, and the entire data were compiled and analyzed by using analysis of variance and chi - square test . Analysis was performed using statistical software statistical product for social sciences (spss version 11.0 for windows, chicago, spss inc . ). All the values were expressed as a mean standard deviation (sd); range; or percentage . Based on the results of the previous study and assuming type - i error () at 0.05, type ii error () at 0.1, and power of the study at 80% so as to detect a difference of 20% in the incidence of pain between the study and control groups the sample size was calculated as 26 patients in each group . However, we chose 30 patients in each group considering possible dropouts and for better validation of results . The decoding of drugs was done at the end of the study, and the entire data were compiled and analyzed by using analysis of variance and chi - square test . Analysis was performed using statistical software statistical product for social sciences (spss version 11.0 for windows, chicago, spss inc . ). All the values were expressed as a mean standard deviation (sd); range; or percentage . The incidence of pain in group i was observed in 80% of the patients [table 2]. In group ii, 7 patients out of 30 felt pain accounting for an incidence of 23.33%, while in group iii, 6 patients out of 30 felt pain with an incidence of 20% . In group i, the mean score of pain was (vas sd) 2.27 1.51 while it was 1.14 1.74 and 1.03 1.72 in group ii and group iii patients, respectively [table 3]. On statistical analysis, vas in group i was statistically significant as compared to group ii and iii (p <0.001). The other side effects observed besides pain included pruritus and erythema . In group ii and group iii, pruritus was seen in three (10%) and two (6.7%) patients, respectively, while erythema was observed in four (13.2%) and two (6.7%) patients, respectively, in group ii and iii . The overall incidence of pruritus and erythema was 23.2% and 13.4% in group ii and iii, respectively, which were statistically insignificant [table 4]. Incidence of pain on propofol injection mean score of pain with intergroup comparison side effects of pretreatment drugs in all groups the results of our study imply a significant reduction in pain on propofol administration after pretreatment with tramadol or butorphanol in comparison to the control placebo group . Intergroup comparison revealed that the incidence and severity of pain with propofol injection was less in the study groups (ii and iii) when compared to the control group (i), but comparable efficacy was observed among both the study drugs . We chose a control group in this study by administering a placebo so as to gauge the efficacy of tramadol and butorphanol for the amelioration of propofol injection pain, rather than opting for traditionally established gold standard lignocaine pretreatment . Moreover, with the focus shifting to newer drugs in a quest to find a better alternative to alleviate the pain on propofol injection, it seems reasonable to use opioids as a part of standard induction regime . Opiates were shown to exert peripheral analgesic action in addition to their well - known central effects though a clear - cut discrimination between peripheral and central analgesics is debatable . The analgesia produced by both peripheral and central mechanisms may be additive or even synergistic . Moreover, peripheral opioid receptors have been described and shown to mediate analgesic effect when activated by opioid agonists . The analgesic effect observed in our study with both tramadol and can be attributed to the peripheral analgesic effect secondary to their venous retention for 2 min . The higher incidence of patients (80%) experiencing higher mean vas scores (2.27 1.48) in group i (placebo) are comparable with the 74 - 83% incidence reported by various other studies . Tramadol has also been found to be as effective as lignocaine in reducing the incidence and severity of propofol - induced pain . Tramadol is a centrally acting weak -receptor agonist which inhibits noradrenaline re - uptake as well as promotes serotonin release, potentiates the monoaminergic system and can be used to treat moderate and severe pain . In addition to its systemic effect, the local anesthetic effect of tramadol on peripheral nerves has been shown in both clinically and laboratory studies . Desmeules et al . Confirmed that the analgesic effect of tramadol is apportioned between the opioid and monoaminergic components . Suggested that tramadol affects sensory and motor nerve conduction by a similar mechanism to that of lidocaine which acts on the voltage - dependent sodium channel leading to axonal blockage . After the iv administration, the onset of analgesia occurs within 1 min with a peak effect in about 4 - 5 min . The site of action of butorphanol in reducing the pain of propofol injection is not clear, but it could be either through opioid receptors (central and or peripheral), local anesthetic action, or both . The incidence of pain on propofol injection in this study after pretreatment with butorphanol was observed to be approximately 20% . This incidence is almost similar to the findings of earlier study by aggarwal et al . Who reported an incidence of merely 20% on propofol injection while using butorphanol as pretreatment . The incidence of pain observed in the tramadol group (23.33%) in the our study was comparable to the results of wong and cheong who compared lignocaine with placebo and observed an incidence of 27% and 83%, respectively (p <0.001). Thus, it can be inferred that tramadol is as effective as lignocaine in alleviating propofol injection pain thereby granting the patient a smoother comfortable experience of propofol induction . Fewer side effects, like pruritus and erythema, were observed with tramadol pretreatment (10% and 13.2%, respectively) while this incidence decreased further with butorphanol pretreatment (6.7%). The findings of our study are nearly similar to the results of martin et al . Who reported a similar incidence of pruritus and erythema with tramadol pretreatment . Thus, we conclude that pretreatment with perioperatively used opioids tramadol 50 mg or butorphanol 1 mg effectively reduced the pain of propofol injection with fewer self - limiting mild side effects such as pruritus and erythema . Though statistical significance could not be achieved among both study drugs, we propose future studies exploring use of both tramadol and butorphanol as a pretreatment in relieving pain on propofol injection in large samples of surgical population.
|
Ameloblastic fibro - odontoma (afo) is a benign, slow growing, expansile epithelial odontogenic tumor with odontogenic mesenchyme . It may inhibit tooth eruption or displace involved teeth although teeth in the affected area are vital [13]. Radiography shows a well - defined, radiolucent area containing various amounts of radiopaque material of irregular size and form [4, 5]. The lesions are usually diagnosed during the first and second decades of life [46]. It occurs with equal frequency in the maxilla and the mandible and with equal frequency in males and females . Microscopically, the lesion is composed of strands, cords, and islands of odontogenic epithelium embedded in a cell - rich primitive ectomesenchyme, resembling the dental papilla . Many authors reported that afo is not aggressive and can be treated adequately through a surgical curettage to the lesion without removal of the adjacent teeth [1, 4, 5, 7, 8]. An 11-year - old girl presented to our department on referral from another dentist to have a second opinion about a lesion involving the left mandible . She had radiographic examinations, including panoramic, helical, and cone - beam computed tomography . These examinations were accompanied by a presumptive radiographic differential diagnosis of odontoameloblastoma: complex odontoma and afo . The medical, social and family histories were unremarkable, as were the results of a review of systems and a physical examination . The clinical examination did not display any sign of pain or swelling in the left mandible . The initial panoramic radiography revealed a well - defined radiolucent region, which contained an irregular radiopaque mass 3 cm in diameter . This lesion occupied a zone from the lower left second molar area to the left ramus . Helical and cone - beam computed tomography showed an expansile well - circumscribed lesion containing at the interior a calcified mass compatible with odontogenic tissue (figures 2 and 3). Considering the clinical and radiographic examinations, our presumptive diagnosis was complex odontoma . The patient underwent enucleation of the lesion and careful curettage of the surgical cavity under general anesthesia . The surgical specimen was fixed in neutral buffered 10% formalin and subjected to pathological analysis . Light microscopic examination of sections stained with hematoxylin and eosin revealed strands and islands of odontogenic epithelium showing peripheral palisading and loosely arranged central cells, identical to stellate reticulum, embedded in a myxoid cell - rich stroma resembling the dental papilla (figure 4). In the present case, the patient presented to our department with previous examinations, including panoramic, helical and cone - beam computed tomography . While these radiographic examintions were given a presumptive diagnosis of odontoameloblastoma by the examinaing radiologists, we believed that the findings were more common in this region . Odontoameloblastoma, also known as ameloblastic odontoma, has a more aggressive behavior, similar to an ameloblastoma rather than an odontoma . Afo is a benign tumor that exhibits the same benign biologic behavior as that of ameloblastic fibroma, showing inductive changes that lead to the formation of both dentin and enamel . Conversely, the term odontoameloblastoma (or ameloblastic odontoma) refers to tumors representing a histological combination of ameloblastoma and complex odontoma, which behave in the invasive manner of classic ameloblastoma . According to the revised world health organization (who) classification, ameloblastic fibroma and afo cahn and blum postulated that ameloblastic fibroma (the histologically least differentiated tumor) develops first into a moderately differentiated form, following afo and eventually into a complex odontoma.however, the concept that these lesions represent a continuum of differentiation is not widely accepted, with other researchers suggesting that they are separate pathologic entities [1215]. In some studies, the term afo represents a histological combination of ameloblastic fibroma and complex odontoma [12, 16]. The majority now agrees that afo exists as a distinct entity, but it can be histologically indistinguishable from immature complex odontoma . The arrangement of the soft tissues and the development stage of the involved tooth are useful criteria for diagnosis . Despite numerous efforts, however, there is still considerable confusion concerning the nature of these lesions . Afo is relatively rare, with the prevalence among oral biopsies being about 1% and its frequency among odontogenic tumors being reported at 1% to 3% [3, 18]. This lesion usually occurs in people less than 20 years old, and age is thus an important characteristic in the differential diagnosis . This lesion is usually found in the molar area [6, 12], and the distribution is roughly equal between the maxilla and mandible [6, 12]. Many authors reported that afo can be treated adequately through a surgical curettage without removal of the adjacent teeth [1, 4, 5, 7, 8]. As noted in the literature, not all lesions previously classified as afo are, in fact, aggressive lesions . If there is a recurrence accompanied by a change of the histological pattern toward a more unorganized fibrous stroma with displacement of the epithelial component, then more extensive treatment procedures appear to be indicated . Long - term follow up with short intervals should be maintained in the management of afo.
|
The application of fibrinolytic therapy in acute myocardial infarction is generally practiced to reduce the associated morbidities; however, there are rare reports of pulmonary hemorrhage attributed to the use of fibrinolytic therapy throughout the literature . In this case report, we present a 45-year - old man who developed pulmonary hemorrhage after administration of streptokinase for the treatment of acute myocardial infarction . A 45-year - old male with no history of ischemic heart disease presented to the emergency department 45 min after the onset of retro - sternal chest pain which radiated to the left arm and accompanied with cold sweating . His past medical history was only indicative of cocaine and tobacco abuse for several years . Initial physical examination demonstrated a blood pressure of 145/90 mmhg, heart rate of 94/min, respiratory rate of 18/min, oral temperature of 37.4c and oxygen saturation 95% while he was breathing ambient air . The electrocardiography revealed sinus rhythm and elevated st segment in v1-v4 leads and depressed st segment in ii, iii, avf, v5 and v6 leads, well - suited with the diagnosis of acute antroseptal myocardial infarction . The patient was immediately transferred to the intensive care unit for cardiac monitoring and thrombolytic therapy . An intravenous infusion of 1.5 million units of streptokinase over 50 min, followed by heparin at 900 u / h and one 325 mg tablet of aspirin and one 75 mg tablet of clopidogrel were administered . The blood urea nitrogen level was 16 mg / dl and the creatinine level was 1.3 mg / dl . U / l (reference range: 8 - 40), the aspartate aminotransferase level 180 u / l (reference range: 8 - 30), the alkaline phosphatase level 130 u / l (reference range: 35 - 125), total bilirubin level 0.8 mg / dl (reference range: 0.2 - 1.2 mg / dl), the albumin level 4.4/dl (reference range: 3.7 - 5.5), and the total protein level 7.3 g / dl (reference range: 6.0 - 8.0). The white blood cell count was 11,000/mm, the hematocrit was 45.9% and the platelet count was 218,000/mm . Also, creatinine kinase myocardial bound / creatinine kinase equal to 597/8932 u / l and elevated troponin - i level equal to 29 ng / ml were recognized . After 8 hours of admission, the patient gradually developed shortness of breath, hypoxemia and fever (38.5c) and after 3 h later, cough and hemoptysis developed . Finally, endotracheal intubation and mechanical ventilation was necessitated when hypoxemia (sao2= 78%) and symptoms of respiratory distress were present with a respiratory rate of 40/min . Laboratory tests showed a fall in the hemoglobin level from 15.8 to 12 g / dl within 20 h, and to 9 g / dl within 48 h; so two units of packed cell were administered . Activated partial thromboplastin time was 99 s. in addition, he received four units of fresh frozen plasma and eight units of cryoglobulin with the purpose of pulmonary hemorrhage control . The lab tests of admission time showed normal coagulation, liver and kidney functions tests ., the patient remained febrile (39.0c) with constant and moderate hemoptysis . Due to the increased blood urea nitrogen and creatinine during the 72 h after admission, bed - side hemodialysis according to the nephrology consult bronchoscopy on the 3 day showed no lesion in the bronchial tree and broncho - alveolar lavage was positive for hemosiderin laden macrophages (90%) and negative for acid fast bacillus . Computerized tomography of the chest on the 3 day revealed diffuse alveolar infiltrates [figure 1]. The results of anti - glomerular basement membrane antibody, antinuclear antibodies, anti - double - stranded deoxyribonucleic acid antibody, peripheral antineutrophil cytoplasmic antibodies (p - anca), and cytoplasmic anca were all negative . Computed tomography of the chest taken 3 days after the onset of hemoptysis, revealing diffuse alveolar infiltrates . Patchy consolidations are also seen in horizontal views (a and b) coronal views, (c and d) horizontal views the patient was intubated for 9 days with no significant improvement in his condition and in the 10 hospital day his blood pressure was not detected and cardiac rhythm became asystole; in spite of cardiopulmonary resuscitation for 60 min he remained pulseless and eventually expired . Thrombolytic therapy with streptokinase is generally used in acute myocardial infarction and has obviously diminished morbidity and mortality from this condition . However, it can cause a variety of hemorrhagic and immunological complications . Pulmonary hemorrhage is an uncommon but a potentially life - threatening complication of thrombolytic therapy and should be regarded as one of the differential diagnoses of pulmonary infiltrates or dropping hemoglobin after thrombolytic therapy for acute myocardial infarction with no apparent bleeding site . Hemoptysis, acute anemia and new radiographic infiltrates are considered as the triad of the diagnosis . Pulmonary hemorrhage is usually diagnosed within 12 h to 5 days after initiating the thrombolytic therapy . Some predisposing factors include pneumonia, heart failure and chronic obstructive pulmonary disease that might be related to the development of the pulmonary hemorrhage . A case report of immune - mediated diffuse pulmonary hemorrhage following streptokinase administration for acute myocardial infarction in a patient with pulmonary infection and concomitant cutaneous infection suggested that infections may predispose patients to developing pulmonary hemorrhage . It is noteworthy that cocaine use has been connected with both acute and chronic cardiovascular diseases which comprise acute myocardial infarction as one the acute manifestations . The occurrence of alveolar hemorrhage in our patient after thrombolytic therapy might be associated with the coexisting cocaine and tobacco abuse.
|
The importance of the judicious use of clozapine in patients with schizophrenia in clinical practice is brought to an even sharper focus when it has to be used in combination with other agents that cause myelosuppression, for example, chemotherapy and radiation treatment . Chemotherapy can cause can cause marked bone marrow suppression, leading to neutropenia and thrombocytopenia . The use of clozapine with other agents, which cause leukopenia is a formal contraindication . Clozapine has to be usually discontinued if the white blood cell count drops below 3000 per cubic millimetre . Discontinuation of clozapine, however, may lead to a risk of relapse in those patients with schizophrenia who have been well controlled with this medication . This gives rise to a therapeutic tight spot and the effective management of both schizophrenia and cancer requires an intensive liaison between the oncology and the psychiatry teams responsible for care of the patient . There are a few references till date illustrating the combination of clozapine and chemotherapy and/or radiation therapy . To the best of our knowledge, we report the case of a 39-year - old gentleman with a diagnosis of schizophrenia, remaining psychiatrically stable on clozapine, who underwent combination treatment of chemotherapy and radiotherapy for the treatment of cancer of the tongue, in a tertiary care oncology centre in india . A 39-year - old gentleman was being treated for paranoid schizophrenia since the onset of positive psychotic symptomatology in 1996 and had been on clozapine for 7 years prior to his presentation in our cancer hospital, in the dose of 300 mg (in daily divided doses). He was also on a combination of trifluoperazine 2.5 mg and trihexyphenidyl 1 mg 3 times a day . He did not report any distressing side - effects of the medications except for excess salivation . He was diagnosed with cancer of the tongue t4n2bm0 moderately differentiated squamous carcinoma in august 2009 . Detailed investigations showed that the tumor was borderline inoperable, which led to institution of platinum- and taxane - based neoadjuvant chemotherapy, each chemotherapy cycle lasting for 3 weeks . As a formal nationally co - ordinated clozapine monitoring protocol in india is not present, previous annual complete blood count reports were lacking . However, there was no history suggestive of infection and the complete blood count done in the hospital prior to starting chemotherapy was essentially within normal limits (white blood cell count 10,400 per cubic millimetre (mm) and neutrophils 8,160 per cubic mm, hemoglobin of 13.3 g / dl, platelets 387,000 per cubic mm). The dose of clozapine was reduced by the institute - based liaison psychiatrist to 250 mg in daily divided doses before chemotherapy started in an attempt to reduce the hypersalivation, which was helpful and did not lead to any exacerbation of psychotic symptoms . A decision to continue on clozapine in this dose was taken following a detailed discussion between the liaison psychiatrist with patient and his brother, discussing the benefits and risks associated, with regular monitoring schedules fixed for mental state examination, complete blood counts and medications . Though the white blood cell count monitoring was advised 17 days following the start of the first cycle of chemotherapy, it was decided that it be done earlier than that, in view of the concurrent treatments . A complete blood count done on the 10 day in a private laboratory following start of first chemotherapy cycle revealed a drop in the white blood cell count to 2300 per cubic mm, neutrophils were 79%, platelet count of 250, 000 per cubic mm and hemoglobin of 10.3 g / dl . The patient developed high grade fever and mucositis, for which he was assessed on the 11 day and daily subsequently for the next week by the medical oncologist . The white blood cell count repeated on the 12 day, this time in the hospital laboratory, revealed a further drop to 1000 per cubic mm . Patient was started on antibiotics and granulocyte colony stimulating factor, following which the white blood cell counts improved on the 17 day to 8910 per cubic mm . As the platelet count was low, patient received platelet transfusion . In the course of these events in these 8 days from 10 to 17 day following start of chemotherapy, the liaison psychiatrist after discussing with patient and his brother had earlier reduced the dose of clozapine to 200 mg daily in divided doses on the 5 day, considering the possible synergistic effect of the drug, as reported in literature and a watch was kept on the mental state . But further discussion between the psychiatrist and the consultant medical oncologist and also between the former and the patient with his brother, led to the decision of maintaining patient in the same dose of clozapine, keeping in view the patient's psychiatrically stable condition and to prevent rebound psychosis leading from any further reduction, as this neutropenia seemed to be related to the chemotherapy . By the 18 day, which was originally suggested as the day for monitoring post first chemotherapy cycle, when the complete blood count was repeated, the white blood cell count was 10,800 per cubic mm and neutrophil count 7680 per cubic mm, (essentially within normal limits), but still a low haemoglobin of 10.3 g / dl and a manual platelet count of 100,000 per cubic mm . The pre - planned second cycle of chemotherapy was delayed by just 6 days following completion of the first cycle and a third cycle was added at the scheduled time after imaging and reassessment by the multidisciplinary head and neck joint clinic of the hospital . Growth factors were started on day 6 of each of these cycles as a preventive measure, in view of the experience of the first cycle . The white blood cell and neutrophil counts remained within normal limits after the second cycle but dropped to 2400 per cubic mm and 570 per cubic mm respectively after the third cycle . The dose of clozapine that the patient was on remained unchanged [figure 1]. Third chemotherapy cycle; wk week; d day; pall rt palliative radiation therapy; mt metronomic therapy at this stage, a further reassessment by the head and neck oncology group advised radiation therapy with a palliative intent in view of progressive disease . The psychiatry team liaised with the consultant radiation oncologist prior to scheduling of radiotherapy sessions, with continuation of weekly monitoring protocols for mental state examination and complete blood counts . The patient underwent palliative external radiotherapy to face and neck to a dose of 50 gy in 20 fractions, which led to partial relief in pain and swallowing . During this period, his mental state remained stable and white blood cell counts were maintained within normal limits, continuing so during the 2 months following completion of radiation treatment . To palliate further, metronomic therapy was then advised, which the patient underwent, with regular psychiatric review and weekly complete blood counts over the next 2 months . The white blood cell count increased to 13,600 per cubic mm and later to15,600 per cubic mm . The sequence of events described above underlies the importance of frequent monitoring of white blood cell counts when clozapine and cancer treatments are concomitantly administered . The normal white blood cell count prior to the onset of chemotherapy and subsequent drop following it, with improvements after the chemotherapy cycles, were maintained during and after radiation treatment . This makes the possibility of a synergistic effect less likely in this particular case, and no persistent neutropenia is noted, unlike in other cases reported in the literature . In previously reported cases, clozapine replaced by haloperidol and olanzapine following neutropenia led to a psychotic relapse, which necessitated reintroduction of clozapine . Considering this evidence, the continuation of clozapine despite the steep drop in the total white blood cell and the absolute neutrophil count following the first chemotherapy cycle, though a difficult decision to make, was aided by extensive discussion and shared decision making between the liaison psychiatrist and medical oncologist, and also with the patient and his brother, who was the primary caregiver . The proactive use of colony stimulating factor in the subsequent chemotherapy cycles proved useful, as reported in the literature . It is possible to continue clozapine in a patient with chronic schizophrenia undergoing chemoradiation for cancer with close supervision and collaboration with oncology clinicians . As the evidence in this topic is limited and controlled trials would not be possible, it is important to share the experience and add to the existing literature to facilitate an informed decision making by the clinicians in managing dually vulnerable patients with comorbid schizophrenia and cancer.
|
The surgical removal of an impacted mandibular third molar may injure the inferior alveolar nerve (ian). Neurological complications resulting from this kind of surgery may arise from an insufficient diagnosis of the surrounding anatomical structures or the applied surgical technique . The incidence of these neurological complications ranges from 0.2 to 1% for a permanent injury and from 3.3 to 13% for a temporary injury. [14] the overall risk of permanent impairment during mandibular third molar removal is low, but a considerable number of patients may be involved because many third molars are removed . The incidence of damage to the ian increases to 30% when a close relationship between the third molar and the mandibular canal is observed radiographically. [47] therefore, it is important to evaluate the position of the third molar and determine its relationship with the mandibular canal preoperatively to minimize the risk of nerve damage . Panoramic radiographs are most commonly used for assessing the relationship between these two structures preoperatively . Two - dimensional (2d) panoramic radiographs provide limited information about the buccolingual relationship between the mandibular canal and mandibular third molars, cortication of the mandibular canal and the detailed anatomy of the third molar . Several clinical studies have determined the specific radiographic signs detected in panoramic radiographs, which may suggest the presence of a close relationship between the mandibular canal and mandibular third molars. [468] these radiographic signs include superimposition of the tooth roots on the canal, narrowing of the canal, deviation of the canal, interruption of the radiopaque borders of the canal, darkening of the roots, narrowing of the tooth roots as well as deviation of the tooth roots and the bifid apex . However, opinions vary regarding the frequencies of the above - mentioned signs for predicting exposure of the ian or a clinical complication such as paresthesia as a result of mandibular third molar removal . Computed tomography (ct) may be recommended to verify the close relationship between the third molar and the mandibular canal in a three - dimensional (3d) view . The higher radiation dose, increased financial cost and less accessibility, however, are the negative aspects of ct compared with conventional imaging . 3d images of cone beam ct (cbct) are becoming more readily available for use in maxillofacial applications . Cbct provides better image quality of teeth and their surrounding structures, compared with conventional ct . It reduces the radiation dose as compared with conventional ct and offers high spatial resolution . Thus, it seems that the relationship of the third molar to the mandibular canal is assessed more accurately with cbct imaging modality . According to the dispersion of the data regarding the comparison of panoramic signs with cbct findings, the purpose of this study was to make a comprehensive analysis comparing panoramic signs with cbct findings to study the relationship between impacted mandibular third molars and the ian . Since the risk of an ian injury occurring during the removal of the impacted mandibular third molar is higher than in impacted class c mandibular third molars (the level of cementoenamel junction of impacted third molar located under the level of alveolar crest), we evaluated both the panoramic and cbct images of this group of impacted mandibular third molars . This cross - sectional study was carried out with the cbct images of patients who had one or two impacted class c mandibular third molars and referred us for taking cbct images . In addition, their panoramic features suggested a close relationship between the mandibular canal and the roots of mandibular third molars, and thus the surgeon or dentists predicted the risk of nerve injury . Twenty - nine patients with 43 impacted mandibular third molars were included in this study . The patient group included 13 males and 16 females ranging in age between 18 and 51 years, with a mean age of 28.34 years . We originally obtained the approval of the ethical board of the institutional ethics committee of the guilan university of medical sciences research foundation in rasht, iran, before conducting this investigation (ethics approval number 10229) to ensure our compliance with the recommendations of the declaration of helsinki and tokyo for humans . Cbct images for all patients were obtained with new tom vg equipment (qr srl company, verona, italy) in hires zoom mode at 110 kv, 5.5 ma and 5.4 s. two scout images, i.e. Lateral and posterior anterior views taken in accordance with the patient's position, were initially prepared, and after this a 360 scan was acquired . The total scan time was 1820 s. the time required for the reconstruction of volumetric images after the patient's complete exposure was 4 min . Then, to reconstruct study images from the volumetric images, the plane was selected in such a way to ensure that it was parallel to the jaw . Axial images with a thickness of 1 mm and an interval of 1 mm were prepared . The mandibular canal was color - marked by the show mark tool in the nnt viewer software of the cbct machine in reconstructed panoramic images having a 1-mm slice thickness and interval . Cross - sectional images with a thickness of 1 mm and an interval of 1 mm perpendicular to the mesiodistal and buccolingual axes of third molars were prepared [figure 1a e]. Overall, multiplanar reconstructed images were used to determine the topographic relationship between the impacted teeth and the mandibular canal more accurately . Panoramic view of a left mandibular class c impacted third molar having curved roots and odontoma adjacent to the coronal portion axial cut and reconstructed panoramic view showing colorization of the mandibular canal (colorization is only in panoramic view) cross - sectional and 3-d images reveal a lingual position of the canal having close proximity to the root surface an experienced dentomaxillofacial radiologist evaluated the corresponding panoramic and cbct images to examine the topographic relationship between the impacted third molars and the mandibular canal . Panoramic radiographs were evaluated previously to analyzing cbct images and in separate sessions every 12 weeks to avoid bias and memory effect of repeated viewing at closer intervals . Panoramic radiographs were evaluated for determining the presence or absence of one of several of these radiographic signs mentioned earlier: superimposition of the roots on the mandibular canal, narrowing of the mandibular canal, deviation of the canal, interruption of the radiopaque border of the canal or darkening of the roots . Cbct images were assessed through the nnt viewer software program used with new tom imaging devices . We evaluated these cbct images to identify features described below based on terms defined by hman et al . The course of the mandibular canal as compared with the root of the impacted tooth: the course of the mandibular canal was classified as buccal, lingual, inferior or interradicular.the proximity of the mandibular canal and the tooth roots: the proximity of the mandibular canal to the roots was rated as no contact.the narrowing of the mandibular canal: the observed narrowing of the mandibular canal was classified as narrowing or no change.grooving indicated the presence of concavity or invagination of the root surface wherein the canal was situated.hooks, either completely or partially encircling the mandibular canal, indicated the presence of a deviation of the root apex.the proximity of the mandibular third molar and the cortex: the proximity of the tooth was scored as simple contact, contact and thinning, the course of the mandibular canal as compared with the root of the impacted tooth: the course of the mandibular canal was classified as buccal, lingual, inferior or interradicular . The proximity of the mandibular canal and the tooth roots: the proximity of the mandibular canal to the roots was rated as the narrowing of the mandibular canal: the observed narrowing of the mandibular canal was classified as narrowing or no change . Grooving indicated the presence of concavity or invagination of the root surface wherein the canal was situated . Hooks, either completely or partially encircling the mandibular canal, indicated the presence of a deviation of the root apex . The proximity of the mandibular third molar and the cortex: the proximity of the tooth was scored as simple contact, contact and thinning, contact and perforation or no contact . A chi - square () test was used to compare panoramic signs with cbct findings . All statistical analyses were performed using the statistical package for social sciences (spss) version 16.0 for windows (spss: chicago, usa). An experienced dentomaxillofacial radiologist evaluated the corresponding panoramic and cbct images to examine the topographic relationship between the impacted third molars and the mandibular canal . Panoramic radiographs were evaluated previously to analyzing cbct images and in separate sessions every 12 weeks to avoid bias and memory effect of repeated viewing at closer intervals . Panoramic radiographs were evaluated for determining the presence or absence of one of several of these radiographic signs mentioned earlier: superimposition of the roots on the mandibular canal, narrowing of the mandibular canal, deviation of the canal, interruption of the radiopaque border of the canal or darkening of the roots . Cbct images were assessed through the nnt viewer software program used with new tom imaging devices . We evaluated these cbct images to identify features described below based on terms defined by hman et al . The course of the mandibular canal as compared with the root of the impacted tooth: the course of the mandibular canal was classified as buccal, lingual, inferior or interradicular.the proximity of the mandibular canal and the tooth roots: the proximity of the mandibular canal to the roots was rated as contact or no contact.the narrowing of the mandibular canal: the observed narrowing of the mandibular canal was classified as narrowing or no change.grooving indicated the presence of concavity or invagination of the root surface wherein the canal was situated.hooks, either completely or partially encircling the mandibular canal, indicated the presence of a deviation of the root apex.the proximity of the mandibular third molar and the cortex: the proximity of the tooth was scored as simple contact, contact and thinning, contact and perforation or no contact . The course of the mandibular canal as compared with the root of the impacted tooth: the course of the mandibular canal was classified as buccal, lingual, inferior or interradicular . The proximity of the mandibular canal and the tooth roots: the proximity of the mandibular canal to the roots was rated as the narrowing of the mandibular canal: the observed narrowing of the mandibular canal was classified as narrowing or no change . Grooving indicated the presence of concavity or invagination of the root surface wherein the canal was situated . Hooks, either completely or partially encircling the mandibular canal, indicated the presence of a deviation of the root apex . The proximity of the mandibular third molar and the cortex: the proximity of the tooth was scored as simple contact, contact and thinning, contact and perforation or no contact a chi - square () test was used to compare panoramic signs with cbct findings . All statistical analyses were performed using the statistical package for social sciences (spss) version 16.0 for windows (spss: chicago, usa). The study sample consisted of 43 impacted class c mandibular third molars from 29 patients (13 males and 16 females) having an average age of 28.34 years, ranging from 18 to 51 . Approximately 25 cases (58.1%) showed just one of the panoramic signs, while in 14 cases (32.6%), a combination of two and, in four cases (9.3%), a set of three panoramic signs were observed . Superimposition of the roots on the canal alone was the most frequently detected panoramic finding (14 cases, 32.6%). The combination of radiographic signs indicating superimposition of the roots on the canal and the interruption of the radiopaque border of the canal was the second most frequent panoramic sign (6 cases, 14%). Each of the combined panoramic findings of superimposition of the roots on the canal and narrowing of the canal, superimposition of the roots on the canal and deviation of the canal as well as narrowing of the canal and interruption of radiopaque border of the canal was just found in one case (2.3%). In general, superimposition of the roots on the canal was the most frequent panoramic sign (67.4%), while darkening of the roots was less frequently seen than other panoramic signs (11.6%). This radiographic finding was not observed independently and was associated with one or two other panoramic signs . Panoramic findings concerning 43 impacted mandibular third molars hooks of impacted molar roots were only observed in two cases (4.6%). The panoramic and cbct findings associated with this radiographic sign are shown in table 2 separately, but were not included in further statistical analysis . Panoramic and cbct findings of two cases with hook of the tooth roots the data related to the comparison of the cbct findings to different kinds of panoramic findings are shown in table 3 . A lingual course of the mandibular canal observed cbct finding was the most frequent course detected in all panoramic signs . Contact of the tooth with the canal was observed in all cases in which panoramic signs confirmed deviation of the canal or darkening of the roots . Tooth contact with the cortex was observed in all the cases wherein the panoramic signs of narrowing of the canal or darkening of the roots were found . A significant difference was detected between the frequency of the narrowing of the canal in cbct images as compared to observing the presence or absence of the narrowing of the canal in panoramic radiographs (p=0.01). Significant differences also existed between the frequency of various types of cortical proximity to the tooth root occurring and the frequency of thinning or perforation of the cortex seen in different types of tooth angulation (p=0.001; 0.005 respectively). Comparison of cbct findings to different kinds of panoramic findings the data related to the comparison of panoramic signs with cbct findings are shown in tables 4 and 5 . Superimposition of the roots on the canal was the most frequently detected panoramic finding in all the cbct findings . Mesioangular positioning of the impacted third molar was the most frequent tooth angulation occurring in all cbct findings except for cases in which we can see cortical proximity to the tooth . Frequency of cbct findings of course, contact and narrowing of canal associated with different panoramic signs frequency of some of cbct findings associated with different panoramic signs table 6 shows the mandibular canal course in relation to the third molar in cbct findings . A lingual course of the canal was the most frequent course detected in all cbct findings . The frequency of various courses of the canal occurring in the different types of cortical proximity of the tooth was significantly different (p=0.02). Surgical removal of impacted third molars is one of the most common dentoalveolar surgeries . According to the considerable variety in the relationship of the mandibular canal to an impacted mandibular third molar, preoperative radiographic assessment is required to evaluate the relationship between these two anatomical structures . Panoramic radiography is the most widely used technique for this purpose . Because of the limitations of conventional radiographic techniques, the need for more advanced techniques that could show anatomical relationships three dimensionally increased . Due to the introduction of cbct, 3d images are becoming more easily available for use in dentistry . In our study of panoramic findings, superimposition of the roots on the canal had the highest frequency (67.4%) while darkening of the roots had the lowest (11.6%). These findings are in contrast to the observations of monaco et al . And tantanapornkul et al . In these studies, panoramic signs of the darkening of the roots and the interruption of the radiopaque border of the canal were the most frequent, while panoramic signs of the deviation of the canal and narrowing of the canal were the least frequent, respectively . Our study sample consisted only of impacted class c mandibular third molars, and this limitation can result in such observed differences . The mandibular canal was most often positioned lingually to the third molar (60.5%) than buccally . This is in accordance with the results of several studies,[71517] while other reports stated a higher number of mandibular canals were positioned buccally to the third molar. [141820] the incidence of root contact with the canal was found in 76.6% of the third molars we studied . This frequency is lower than those reported by ghaeminia et al . The differences observed in these studies may be due to the different case selection criteria used for cbct examination . This contact with the lingual cortex was found in 83.7% of the third molars and concurs with the result of the hman et al . A lingual course of the mandibular canal was the most frequent course in all of the panoramic findings . Ghaeminia et al . Showed a significant relationship between the lingual positioning of the canal to the third molar and an ian injury . In the present study, the panoramic sign of darkening of the roots had the highest frequency (80%) of a lingual course that can suggest a higher risk of nerve injury in cases wherein this panoramic sign exists . Various studies[62123] have suggested that anatomical proximity of third molar roots to the neuro - vascular bundle increases the risk of an ian injury . In our study, tooth contact with the canal was observed in all of the cases wherein panoramic signs of deviation of the canal or darkening of the roots were found . This finding concurs with those of the studies by monaco et al . And hman et al . Tooth contact with the mandibular canal was observed in 94% of the cases that showed the presence of more than one of the panoramic signs studied . According to our findings, it seems that the probability of tooth contact with the mandibular canal increases in the presence of deviation of the canal or darkening of the roots and also in the cases in which more than one of the studied panoramic findings exist . Several investigators present the premise that narrowing of the canal, when it passes through lower third molar roots, may be an excellent indicator of high - risk cases for neurological damage . Thus, narrowing of the canal seems synonymous of an intimate contact of the mandibular canal with the third molar . In the present study, the frequency of the narrowing of the canal seen in cbct images as compared to that of the presence or the absence of the narrowing of the canal detected in panoramic radiographs is significantly different (p=0.01); so, this panoramic sign is the best predictor of decreased canal diameter in cbct images . This finding is in contrast with that of mahasantypiya et al . Who reported that a panoramic finding of a deviation of the canal is the best predictor of probable narrowing of the canal . Several studies reported that darkening of the third molar roots where the mandibular canal was superimposed was strongly suggestive of an intimate relationship between the root and the nerve, or of nerve injury following third molar extraction . Various authors believe that this radiographic sign reflects grooving of the root carved by the canal . On the other hand, other investigators have stated that this finding indicates thinning or perforation of the cortex . In the present study, the frequency of grooving of the tooth root in the cases wherein the panoramic sign of the darkening of the roots was observed was higher than in combination with other panoramic findings . Conversely, the frequency of thinning or perforation of the cortex in cases in which this sign, i.e. Root darkening, was present was lower than that detected in combination with other panoramic signs (superimposition of canal 55.2%, narrowing of the canal 40%, deviation of the canal 50% and interruption of the canal 30.8%). No significant relationship between grooving of the tooth roots and thinning or perforation of the cortex and the presence of darkening of the roots was apparent . Tooth contact with the cortex was observed in all cases in which panoramic signs of the narrowing of the canal or the darkening of roots were found . Surgeon awareness of the thinning or perforation of the lingual cortex may decrease the risk of lingual nerve injury or displacement of bone or tooth fragments to the adjacent structures . This frequency was observed in 48.8% of our study sample and is in accordance with those reported by tantanapornkul et al . Tooth contact with the canal in distoangular (100%) and vertical (90%) groups occurred more frequently in our study than in other groups and concurs with the observations by monaco et al . Therefore, in these two positions, the probability of an intimate relationship existing between the impacted third molar and the mandibular canal is higher . A lingual course of the mandibular canal was the most frequent course detected in cases in which tooth contact with the canal (66.7%), canal narrowing (60%) and grooving of the tooth root (63.6%) were detected in cbct images ., respectively . Our study sample consisted of impacted class c mandibular third molars, while in previous and similar studies, the depth of impaction was not considered . A small sample size in several patient groups is one of the limitations of the present study . Availability of surgical findings would have allowed the authors to evaluate the diagnostic accuracy of cbct and panoramic images more precisely . Further investigations with a greater sample size and the consideration of the nerve exposure during surgical removal of impacted third molars and probable neurological complications are required to validate the clinical usefulness of cbct in preoperative evaluation of impacted mandibular third molars . The data acquired by cbct can be useful in assessing the risk of the surgery and increasing patient awareness about potential anatomical complications and making decisions to undergo surgery . Deviation of the canal and darkening of the roots in panoramic view can be helpful to guess the risk of nerve injury.
|
Since the clinical severity ranges from mild to potentially life - threatening, major efforts are currently being made to develop methods to detect patients with these diseases in the neonatal period . In fact, making a diagnosis before vaccines or blood products are administered, as well as before the infection develops, allows the patient to proceed to haematopoietic stem cell transplantation, and receive enzyme replacement and gene therapies . Indeed, the best outcome for the most severe form of primary immunodeficiency, as with many other conditions for which newborn screenings are now performed, is achieved when treatment is given in the first months of life, ideally before clinical presentation . The pilot studies of newborn screenings for severe combined immunodeficiency have demonstrated their cost - effectiveness and have also proved successful in terms of public health resulting from improved quality of life and survival of children with these diseases . The goal of newborn blood screening (nbs) is to identify pre - symptomatic newborns with potentially serious or fatal disorders which could be successfully treated, leading to significant reductions in morbidity and mortality . Nbs debuted as a public health programme in the us in the early 1960s, and has expanded to countries around the world, with different testing options in each country . Nbs has progressively evolved since 1963, when guthrie and susi demonstrated that postnatal testing of dried blood spots on filter paper led to the identification and treatment of infants prior to the development of the cognitive deficits associated with phenylketonuria . More recently, the advent of dna - based technologies has again shifted the paradigm of nbs, offering the potential of screening for numerous disorders at the same time . The american college of medical genetics recommends a uniform panel of 29 disorders that all infants born in every state should be screened for . Therefore, every year, millions of babies in the us are routinely screened for congenital deafness and, using a few drops of blood from the newborn s heel, for blood cell disorders (sickle cell anaemia, sickle cell disease, and hb s / beta - thalassaemia), inborn errors of amino acid metabolism (tyrosinaemia i, argininosuccinic aciduria, citrullinaemia, phenylketonuria, maple syrup urine disease, and homocystinuria), inborn errors of organic acid metabolism (glutaric acidaemia type i, hydroxymethylglutaryl lyase deficiency, isovaleric acidaemia, 3-methylcrotonyl - coa carboxylase deficiency, methylmalonyl - coa mutase deficiency, methylmalonic aciduria, cbla and cblb forms, beta - ketothiolase deficiency, propionic acidaemia, and multiple - coa carboxylase deficiency), inborn errors of fatty acid metabolism (long - chain hydroxyacyl - coa dehydrogenase deficiency, medium - chain acyl - coa dehydrogenase deficiency, very - long - chain acyl - coa dehydrogenase deficiency, trifunctional protein deficiency, and carnitine uptake defect) and miscellaneous multisystemic diseases (cystic fibrosis, congenital hypothyroidism, biotinidase deficiency, congenital adrenal hyperplasia, and classical galactosaemia). In addition, expanded screening programmes have been developed in different states in the us, with some programmes covering almost 50 conditions . In europe, some programmes screen for only one or two conditions, whereas others screen for up to a few dozen . For example, the uk and france national screening committees recommend that all babies in their countries should be screened for phenylketonuria, congenital hypothyroidism, sickle cell disease, and cystic fibrosis, with the addition of medium - chain acyl - coa dehydrogenase deficiency in the uk and congenital adrenal hyperplasia in france . In italy, the application of the nbs programme application differs widely between regions . In some regions, only the three tests listed in the national programme are performed while other regions screen for up to 47 rare metabolic diseases . While developing countries face additional challenges related to poor economies, unstable governments, unique local cultures, geographical extremes, and different public health priorities, all other countries face challenges in implementing nbs because of the identification of the causes of genetic disorders, advances in detection technologies, and the development of better treatment regimens . One of the last nbs tests to be introduced measures the presence of t - cell deficiencies using t - cell receptor excision circle (trec) quantification . They typically manifest during infancy and childhood as abnormally frequent / recurrent or unusual infections, often accompanied by immunoregulatory defects . The vast majority of patients with pid have decreased t- and/or b - cell functions that grossly impair immunity . B - cell defects lead to antibody deficiencies . As a result of a mutation in the btk gene, a subgroup of these patients have x - linked agammaglobulinaemia (xla) due to a b - cell differentiation arrest in the bone marrow and the consequent absence of mature b cells and serum immunoglobulins (ig). More than 30% of these patients develop irreversible organ damage in childhood or early adulthood, mainly in the lungs . Non - xla is characterised by hypo - gammaglobulinaemia with decreased b - cell counts (less than 2% mature b cells) in the absence of the btk gene mutation . In patients with xla and non - xla, recurrent infections appear between three and 18 months of age, whereas the mean age at diagnosis is three years . This delayed diagnosis results in frequent hospitalisations because of pneumonia, sepsis, meningitis, and other bacterial infections, which frequently require the intravenous administration of antibiotics and can be fatal . Thus, early diagnosis and treatment, including periodic intravenous ig replacement therapy, are essential to improve the prognosis and quality of life of these patients . T - cell defects result in combined immunodeficiencies, affecting both cellular and humoral immunity, with severe combined immunodeficiency (scid) being the most serious and lethal form . Scid, which was reported for the first time more than 60 years ago, comprises a heterogeneous group of diseases, characterised by profound deficiencies of t- and b - cell functions, and, in some types, also of natural killer (nk) cells . The overall frequency of scid is estimated to be between 1:50,000 and 1:100,000 live births . These infants develop failure to thrive, chronic diarrhoea, and infections in the first months of life . Infections can occur with common pathogens, but most of the time the infants also suffer from opportunistic infections, such as thrush or pneumocystis jiroveci pneumonia . Graft - versus - host disease caused by maternal t - cell engraftment may occur in these patients, who also show skin rashes and organomegaly . Scid is now known to be caused in humans by mutations in several different genes, such as cytokine receptor genes, antigen receptor genes and others, but there are many other probable causes yet to be discovered . An updated classification of scid is based on the underlying genetics and prevalent molecular pathogenetic mechanisms and includes the following: impaired cytokine - mediated signalling, alterations in v(d)j recombination, impaired signalling through the pre - t cell receptor (tcr), increased lymphocyte apoptosis, absence of the thymus, alterations in thymus embryogenesis, impaired calcium flux, and other mechanisms . They all have a profound t - cell deficiency, and those t cells that are present are usually of maternal origin, having crossed the placenta . B cells can be elevated, normal or absent, depending on the type of scid, and the nk - cell number is variable . Therefore, according to the presence or absence of the t, b and nk lymphocytes, scid can also be phenotypically categorised as the tbnk, tbnk, tbnk, and tbnk (with minus meaning absence or severely reduced counts) subtypes . For example, tbnkscid, accounting for up to 50% of scid cases, is predominantly x - linked, and is caused by mutations in the il2rg gene encoding the interleukin 2 receptor gamma chain . The early recognition of scid should be considered a paediatric emergency because a diagnosis before live vaccines or prior to the development of infections permits lifesaving unfractionated hla - identical or t - cell depleted haploidentical non - ablative haematopoietic stem cell transplantation, enzyme replacement therapy, or gene therapy . However, these infants often appear normal at birth and have no family history of immunodeficiency, and consequently, many of them are not identified until a life - threatening infection occurs . This is important because the long - term prognosis of infants with scid and other serious immunodeficiencies can be markedly improved if the diagnosis is made early, before the onset of severe infections . Indeed, if scid is not detected until the infant is older, there is a much higher likelihood of death from live vaccines, graft - versus - host disease from non - irradiated blood products, or infections, before a successful definitive therapy can be adopted . Because scid is not apparent at birth and early recognition is essential for life - saving treatment, it has, for many years now, been recognised as a candidate for nbs . Indeed, the disease satisfies the criteria that the secretary s advisory committee on heritable disorders in newborns and children recommends for routine inclusion in nbs . These criteria are that: i) the frequency of the disease in the population is high enough to warrant screening; ii) the untreated natural history of the disease is well - defined; iii) the untreated disease clearly confers significant morbidity and/or mortality; iv) the disease is treatable, and treatment significantly improves outcome; v) disease testing is safe, simple, and sufficiently sensitive to detect all cases; vi) specific confirmatory testing is available for the disease; and vii) the test, treatment, and treatment outcomes are cost - effective with respect to the non - treatment of the disease.36 an initial screening test for scid was based on the detection of peripheral blood lymphopenia . However, a complete blood count cannot be performed using filter paper - dried blood spots, making this test unsuitable for nbs . In addition, the quantification of peripheral blood lymphocytes may fail to identify some infants with scid due to the presence of normal b - cell or nk - cell numbers, the maternal engraftment of t cells, and/or the expansion of a few t - cell clonotypes . Therefore, no laboratory test on newborn dried blood spots was available to detect t - cell lymphopenia in infants with scid until 2005 when real - time polymerase chain reaction (pcr) for the quantification of trecs was developed and validated for population - based screening . Trecs are created during the process of lymphocyte differentiation (figure 1a) when tcr rearrangements occur within the thymus . The rearrangement of the tcr alpha (tcra) chain has the peculiarity of involving the excision of delta - coding segments, which encode the delta chain of gamma / delta t cells that, being nestled in the tcra locus between the variable (v) and junctional (j) gene segments, must be excised to generate the tcra chain . Several properties were established for trecs that make them useful markers of thymic output: they are stable, do not degrade easily over time, are not replicated when a cell divides, and are (almost) exclusively of thymic origin, without extrathymic sources of tcr rearrangements . After the demonstration that the trec assay detects scid patients regardless of the genetic cause, the test was modified and refined so it could be performed using blood from dried spots, was highly sensitive and specific for scid, and was cost - effective and reproducible, thereby becoming amenable to high - throughput population - based testing . At that point, pilot studies of nbs for scid, integrated with plans for its definitive diagnosis and management, were established in some us states . In 2008, wisconsin became the first state to implement mandatory nbs for t - cell deficiency, followed by massachusetts in february 2009, and later by new york, the navajo nation, california, puerto rico and louisiana . With the exception of california, where a trec assay kit under development by a medical technology company is being used, all the other states are using in - house modifications of the trec assay . By april 30 2011, these pilot studies had been performed on 961,925 newborns, and had identified 14 cases of scid, 6 cases of scid variants and 40 cases of t - cell lymphopenia that were not related to scid . All infants diagnosed with scid in wisconsin and massachusetts have undergone transplantation or enzyme replacement therapy and no deaths have been reported . Taking advantage of the introduction of the k - deleting recombination excision circle (krec) method to study the replication history of b cells, efforts have recently been made to establish a nbs for b - cell maturation defects . During the process of b - cell maturation, krecs are produced by recombination events that determine the allelic and isotypic exclusion of the kappa chain . Indeed, during b - cell development, krecs are produced in those b lymphocytes that, after the ig heavy chain rearrangement, have failed to productively rearrange the ig light kappa chain genes (igk) on one or both alleles . In these cells, the igk locus becomes non - functional through the deletion of the constant k - gene segment (igkc) by recombination of the k - deleting element (kde), which is a sequence located approximately 24 kb downstream of the constant k - gene segment, with one of the two upstream recombination signal sequences . When the kde recombines with the recombination signal sequence located in the intron between the junction and constant k - gene segments, portions of the dna are deleted, and the ligation of the excised recombination - signal ends generates the circularised dna elements defined as krecs (figure 2a). These products persist in the cell, are unable to replicate, and are diluted as a result of cell division . The frequency of these recombination events in human b - cell malignancies ranged from 31% to 69%; approximately 50% of transformed b cells should contain krecs . Therefore, the quantification of krecs was initially used to determine the number of developing b lymphocytes in the bone marrow of children with b - precursor acute lymphoblastic leukaemia treated with allogeneic human stem cell transplantation . However, as igk gene deletion occurs physiologically in all b lymphocytes that fail to productively rearrange the igk genes on one or both alleles, the number of krecs has been be proposed to be a quantitative marker of bone marrow output in all individuals . Furthermore, because krecs are not supposed to be produced in xla and non - xla patients because their b - cell maturation defects occur before k - deleting recombination occurs (figure 2b), the krec measurement can potentially be applied to identify these types of b - cell deficiencies, which account for approximately 20% of all b - cell defects . In addition, some other types of combined immunodeficiencies show an arrest at the b - cell maturation stage and can also be identified using krec detection . Indeed, more than 200 krec copies/g dna were present in the dried blood spots of healthy children, whereas no krecs were detected in 30 xla and 5 non - xla patients . This suggests that the measurement of krecs in neonatal dried blood spots could be used in an nbs that identifies neonates with early b - cell maturation defects . This early identification of children at risk should improve their future quality of life and help reduce health care costs, considering that the clinical phenotype of agammaglobulinaemia is milder than that of scid . Therefore, the disease would be underdiagnosed in the first years of life in the absence of a screening programme, with patients developing serious organ damage before an accurate diagnosis could be made . In 2010, we improved the methods for trec and krec quantification by developing a duplex quantitative real - time pcr protocol that allows an accurate and simultaneous assessment of both targets . For their absolute quantification, a standard curve is created using serial dilutions of trec and krec signal joint constructs cloned in a bacterial plasmid, together with a control gene, the tcra constant gene (tcrac). The primers and probes used for the duplex real - time pcr assay are listed in table 1 . The main advantage of the combined trec / krec assay is that the variability related to dna quantification is eliminated by the use of the triple - insert plasmid in which the trec, krec and tcrac gene fragments are present in a 1:1:1 ratio . Furthermore, the simultaneous quantification of the two targets in the same reaction contains the reagent costs . The number of trecs or krecs per 10 peripheral blood mononuclear cells (pbmcs) is calculated by dividing the mean quantity of trecs or krecs by the mean number of tcrac gene copies, which has to be divided by 2 because there are two tcrac gene copies in each cell (i.e. One for each chromosome) and then multiplied by 10 . This value, together with the lymphocyte plus monocyte count (which are the cells obtained in the pbmc preparation) in 1 ml of blood, was used to calculate the number of trecs or krecs per ml of blood as follows: using this strategy, we found that in healthy subjects, the number of trecs and krecs is correlated to age (figure 3) and that, in particular, it significantly decreases over time, with a steeper slope in the first three years of life . With this assay, we demonstrated that the t- and b - cell reconstitution in children with different pids who underwent human stem cell transplantation or were cured with enzyme replacement therapy using pegylated bovine adenosine deaminase involves the mobilisation of both t and b cells from the respective production and maturation sites, and that the increase in trecs and krecs can be either strictly associated with or independent from one another . These results demonstrated that knowledge of the numbers of trecs and krecs, obtained with an assay that can be easily introduced into routine laboratory practice, is highly informative and can be used for a more precise identification of patients with pid or for their therapeutic monitoring . Accordingly, this method has been recently validated in a cohort of 2560 anonymised nbs cards and in 49 originally stored guthrie cards from patients diagnosed with different pids, allowing the identification of patients with scid, xla, ataxia - telangiectasia (at) and nijmegen - breakage syndrome . Therefore, the set up of a single assay for the simultaneous quantification of trecs and krecs will permit nbs for both scid and agammaglobulinaemia, which together have a combined estimated incidence of 1:30,000 - 1:50,000 births . Furthermore, this test allows the separation of t - cell deficient cases into b - cell positive and b - cell negative subgroups, guiding additional diagnostics toward either tb or tb scid . The use of the trec assay has identified a large number of subjects that do not meet the criteria for scid . Some of these other conditions, such as digeorge syndrome and down syndrome, are known to result in t - cell lymphopenia, whereas others were unexpected and many remain undefined . In particular, premature babies have been shown to have a lower number of trecs than full - term babies, despite not being immunodeficient . Moreover, the trec and krec assay may identify other forms of immunodeficiency, some of them severe, for which a definitive treatment is not available, e.g. At . Therefore, it is important to emphasise that the identification of scid and agammaglobulinaemia at birth must be based on a two - tier assay, with trec / krec determination only being the first tier . Appropriate second - tier assays must be used to define the disease (if any) that results in the low trec / krec values . For some disorders, such as at, defining the disease at birth may indeed prove challenging because the values of alphafetoprotein in newborns are elevated . This requirement of a two - tiered system may represent an important limitation of the use of the trec / krec assay for the population - based screening of genetic conditions in newborns . Other principal obstacles to the full implementation of nbs for pid could be the costs of setting up the screening test and the possibility that the combined measurement of trecs and krecs may generate higher call rates for newborns to be on clinical follow up, which in turn has an impact on the total screening costs . However, the introduction of the scid nbs in the pilot studies had an approximate cost of less than 1 million dollars, whereas in the us, the cost of treating one baby with scid that is not diagnosed until he or she has a serious infection can easily exceed 2 million dollars . There is also a striking difference with regard to the costs for transplantation in scid infants under 3.5 months of age (approx . 1 million dollars) and the costs for those aged over 3.5 months (more than 4 million dollars). An initial study, performed before the introduction of the trec assay on dried blood spots, demonstrated that a scid screening test that cost approximately 5 us dollars would be considered cost - effective . However, the study incorporated limited information about the care costs or outcome differences between infants identified before and after becoming symptomatic . This limitation was bypassed by a recent study that evaluated the cost - effectiveness of universal screening using a model incorporating the impact of early detection on the natural history of scid . The authors demonstrated that assuming a scid incidence of 1:75,000 births and test specificity and sensitivity of 0.99 each, the screen remained cost - effective up to a maximum cost of 15 dollars per infant screened . Therefore, considering that the trec assay is relatively inexpensive, with a cost of approximately 5.50 dollars per assay, that the incidence of t - cell lymphopenia is relatively high, and that better health outcomes and lower costs are associated with earlier stem cell transplantation, nbs for scid meets the reasonable standards of willingness - to - pay and could be a worthwhile addition to nbs panels . Despite the favourable evaluation of scid based upon the nbs guidelines, national implementation is pending in most countries which have long - lasting traditions of their own nbs programmes . The inclusion of krec detection in the test only slightly increases the cost because it only involves the addition of a single reagent to the assay . Thus, a single assay capable of screening for both scid and agammaglobulinaemia, which together have a combined estimated incidence of 1:30,000 - 1:50,000 births, should further improve the cost - effectiveness of nbs . Additional preventive medical research for other severe pids, including, but not limited to, inherited agammaglobulinaemias and haemophagocytic syndromes, would be advisable . The implications of nbs for pid in countries other than the us cannot be easily established as the attributed value for a quality life - year considerably differs among countries, particularly among the us, europe and other regions . Indeed, although pids are mentioned within those disorders that might be considered for the gradual expansion of nbs in the member states of the european union, developing countries will probably face additional challenges related to poor economies, unstable governments, unique local cultures, geographical extremes, and different public health priorities . Newborn blood screening for scid and other t - cell deficiencies, based on trec quantification, was the first screening introduced for pid, but with the advent of modern molecular technologies, screening for other immune system defects will probably be available soon . One of the most promising candidates for nbs protocols is the combined quantification of trecs and krecs that could support early diagnosis, classification of patient subgroups, and evaluation of stem cell replacement therapy for both t- and b - cell defects . In order to achieve this, clinicians have to play an active role in promoting nbs for pid and other t- and b - lymphocyte abnormalities, and work closely with public health officials and nbs committees . They also have to offer their expertise to advise laboratories that are developing the new techniques . They will have an even more important role in establishing an accurate diagnosis for those infants who have nbs - positive results and in ensuring that these children are given the best possible and most appropriate treatment.
|
Epidermal nevus with hemifacial hypertrophy can occur in schimmelpenning syndrome, phakomatoses pigmentokeratotica, proteus syndrome and type 2 segmental cowden disease . The epidermal nevus syndromes are a group of congenital syndromes comprising epidermal nevi in conjunction with central nervous system (cns), ocular, musculoskeletal, and other organ anomalies . Most epidermal nevi are noticed at birth or develop during the first year of life . Reports of associated hemi hypertrophy of the face are multiple and almost always noticed at birth . We herewith report a patient having an epidermal nevus at 25 years of age with onset of gradually progressing hemihypertrophy of face associated with overlying hypertrichosis . Genetic analysis done from the skin did not reveal fibrobalst growth factor receptor 3 (fgfr3) mutations . A 26-year - old man reported to skin outpatient department with dark warty growth on left side of cheek for past 6 years . He noticed gradual disproportionate enlargement of the left side of face after the onset of the growth . He had no history of seizures, headaches or any other cns events . On examination, there were linear hyperpigmented verrucous papules with overlying hypertrichosis on left side of cheek extending on to the neck [figure 1a]. The left side of the face looked larger than the right [figure 1b]. X - ray skull was suggestive of mandible condylar hyperplasia . However, orthopantogram revealed slight widening of ramus; no other bony abnormality was observed . Computed axial tomography of the cranium and brain showed thickening of the frontal bone on the left side [figure 2]. Skin biopsy of the representative skin lesion (face) showed hyperkeratosis with papillomatosis [figure 3]. Genetic analysis was done from the skin in the area affected by the nevus . On genetic analysis of skin samples taken from the nevus, only wild type alleles were revealed for the hotspot loci on fgfr3 and p110 subunit of phosphatidyl inositol-3 - kinase (pik3ca). (a) verrucous epidermal nevus with overlying hypertrichosis on left side of face and neck, (b)- hemihypertrophy of left side of face and scalp ct scan showing thickening of frontal bone on left side section of skin biopsy showing hyperkeratosis, acanthosis, and papillomatosis . Keratinocytic nevi and sebaceous nevi can be associated with epidermal nevus syndromes (enss). The epidermal nevus syndrome refers to a sporadic neurocutaneous disorder characterized by epidermal nevi, ophthalmological and neurological manifestations . Happle has described multiple phenotypes associated with cutaneous mosaicism and made a strong case for avoiding umbrella terms like epidermal nevus syndrome and organoid nevus syndrome when describing a specific ens . The well - defined syndromes are schimmelpenning syndrome, phakomatoses pigmentokeratotica, nevus comedonicus syndrome, angora hair nevus syndrome, becker's nevus syndrome, type 2 segmental cowden disease, fgfr3 segmental nevus syndrome, and child (congenital hemidysplasia with icthyosiform erythroderma and limb defects) syndrome . Of these, schimmelpenning syndrome, phakomatoses pigmentokeratotica, proteus syndrome, and type 2 segmental cowden disease may be associated with hemi hypertrophy of face or limbs . However patients with hemihypertrophy of face usually are reported to have cortical defects like hemimegalencephaly, focal cortical dysplasia, and neuronal migration defects like pachygyria and polymicrogyria heterotopias in the affected hemisphere . Our patient had relatively late onset of epidermal nevus associated with left - sided progressive hemihypertrophy of the face and hypertrichosis . Hypertrichosis confined to the area of epidermal nevus is described in angora hair nevus syndrome and in a case of epidermal nevus with bony abnormalities described by gobello et al . Gobello et al . Described a 16-year - old boy with non - epidermolytic epidermal nevus, hypertrichosis and follicular hyperkeratosis in addition to hemihypoplasia of limbs, brachydactyly, clinodactyly, and onychodystrophy . Genetic analysis done from the affected skin in this case did not reveal mutations in fgfr3 . In our patient too, only wild type alleles for fgfr3 were seen in affected skin . Our patient had hypertrichosis overlying an epidermal nevus with hemihypertrophy of face . While the features do not exactly match those described by gobello et al . Genetic analysis done from lesional skin showed only wild - type alleles of both fgfr3 and pik3ca genes . Somatic mosaicism for fgfr3 mutations involving skin and other organ systems have been described in patients . If the mutation involves the gonads, such patients are said to be at risk for thanatophoric dysplasia . In many other patients with epidermal nevi, somatic mutations resulting in mosaicism confined to keratinocytes of the affected area have been demonstrated in the fgfr3 gene, specifically at the r248c hotspot, and in the pik3ca gene . Child syndrome is caused by nsdhl (nad (p) h steroid dehydrogenase - like) gene mutations; type 2 cowden disease by pten (phosphatase and tensin homolog) mutations . We report this unique case of late onset epidermal nevus with hypertrichosis and hemihypertrophy as it does not belong to any of the classical epidermal syndromes . A possible association to gobello syndrome cannot be confirmed until more molecular diagnostic techniques are developed and employed . Hemifacial hypertrophy and hypertrichosis can occur in association with epidermal nevus in the absence of fgfr3 mutations . This does not fit into any of the known ens and could be a new entity.
|
It represents the most significant parasitic disorder in the mediterranean countries and leads to major problems through unfavorable effects on the public health and national economy . Hydatid cyst most commonly occurs in the young populationand the herds of sheep - goats raised by the countries and the relation between the humans and dogs are effective on the increased prevalence . Particularly, the eggs swallowed as a result of the human animal contact under rural conditions crack in the intestinal system and reach the liver via portal venous route . The liver (60%) and the lungs (30%) are the most commonly affected organs with the brain, the heart, the kidneys, the ureter, the spleen, the uterus, the pancreas, the diaphragm and the extremity muscles being rarely involved . Localization of the primary cyst hydatid infection in the extremity is rare and biceps brachii localization is also rarely reported in the literature . In this report, a 43-year - old woman, who presented with the complaints of mass and pain in the left arm, and numbness of the hand, and diagnosed as cyst hydatidof the biceps brachii muscle, was presented . A 43-year - old woman presented with the complaints of mass and pain in the left arm, and numbness of the hand . The mass with an indolent course for 7 years had started exhibiting progressive enlargement and pain, resulting in a limitation in daily activities . The physical examination of the patient, who had a history of living in the village and sheep raising, revealed a soft, mobile fluctuating mass of 150 * 100 mm size that extended toward the medial site from the upper middle part of the left arm . The laboratory findings were as follows: leukocytes, crp, sedimentation, eosinophilia and hemoglobin are normal . Images of the left arm revealed a cystic lobulated mass of 150 * 90 * 55 mm size containing septa and minimal soft tissue density and fluid levels, which showed peripheral contrast uptake following ivcm and was located under the skin in anterior adjacency to the biceps muscle, extending from the 1/3 upper middle section anterior toward the medial section (fig ., axial and coronal sections showed close adjacency of the mass to the neurovascular bundle (fig . Was investigated via whole abdominal, thoracic and cerebral computed tomography and no pathological findings were detected . The patient who had numbness in the left hand underwent electromyelography (emg) and was considered to be normal ., we observed that the mass was on the neurovascular bundle and caused compression, but it was not attached to it . The cyst was carefully scraped from the adjacent structures and totally excised without causing any rupture . After excision, the median nerve was seen to be relieved of the pressure it had been exposed to with the effect of the mass . Following irrigation of the cystic cavity with hypertonic sodium chloride solution, the cyst wall was excised . A large number of viscous, gelatinous - appearing cysts with an irregular ragged inner surface were observed macroscopically inside the mass transferred into the investigation container (fig . The histopathological examination of the cyst wall revealed a characteristic eosinophilic ectocyst with a chitin membrane ., high dose albendazole was initiated for 6 weeks, and a favorable response was obtained . The patient had complaints of numbness in the early period, which spontaneously recovered and no recurrence was observed on early or long - term radiographs or usg examinations . The patient was informed that the data concerning his case would be submitted for publication . Cyst hydatid is commonly observed in the mediterranean, baltic states, south america, australia, and the middle east, primarily in sheep - raising countries . The liver and the lungs being the most commonly involved organs, this condition can occur in all organs and tissues . The skeletal system is rarely involved . Because the echinococcus entering the body via intestinal route would pass into the venous circulation system and respectively pass the liver and the lungs, which have a filtering, function . Primary musculoskeletal cyst hydatid generally affects the proximal muscle groups and localizes more commonly in the lower extremity compared to the upper extremity . The patient in our case report presented with the complaints of mass and pain in the left arm, and numbness of the hand, and was diagnosed with cyst hydatid in the biceps brachii . In such cases, peripheral nerve involvement is very rare and there are no reports of peripheral neuropathy secondary to the impact of cyst hydatid mass located in the upper extremity . In our patient, the neuropathic findings were limited to the complaints in the median nerve sensory conduction sites without concomitant motor deficit . Several authors have reported occurrence of motor deficit, sciatic pain and foot drop as well as sensory neuropathies as a result of the effect of compression from the lower extremity - localization hydatid cysts on the sciatic nerve or lumbar plexus . Alimehmeti et al . Reported that a large - diameter hydatid cyst located in the adductor muscle only resulted in hypoesthesia in the lower extremity saphenous nerve distribution without concomitant motor deficit . In addition, they showed the effect of compression from the mass on the neurovascular bundle on mr sections . In our case, we detected a compression of the cystic mass on the neurovascular bundle and their adjacency via mri . Emg was performed to evaluate the nerve conduction functions . However, while the preoperative emg study was considered normal, the potential for positive sensorial clinical findings should also be considered . This is because if there is no impairment in the axonal structure of the peripheral nerves, the axonal signal from the cell body is carried to the peripheral axons without impairment . Our patient was observed to have an improvement in pain and numbness on short - term follow - up following excision . The laboratory findings may be supportive for diagnosis . In the presence of liver and lung diseases, serologic tests are commonly negative . However, serologic tests including indirect immunofluorescent antibody test, elisa, immunoelectrophoresis and immunoblot are commonly used . Our patient was detected to have strongly positive indirect hemaglutination antibody test . Due to the fact that it leads to a mass formation this should be considered in differential diagnosis . Due to the high risk of spreading of infection and the potential for resulting in an anaphylactic shock, needle biopsy should be avoided . In general, usg may yield beneficial data on the dimensions, localization of the mass and the type of the cyst with a 95% sensitivity . Bt may be performed to determine the structure of the adjacent tissues and the surgical technique . However, mr is the golden standard of diagnosis and detection of multilocular polycystic lesions on the cross - sections and the presence of a two - layer membrane of the lesion, which consists of a pericyst vascularized by collagen tissue is also supportive in differential diagnosis . The surgery site should be rinsed with hypertonic sodium chloride and the cyst removed completely without any punctures.in case the cyst content spreads during surgery, anaphylaxis or secondary echinococcus may occur . In this case, the cyst was surgically excised without any complications . Consulting with the infectious diseases clinic, antihelmintic chemotherapy was administered for preoperatif 3 weeks and postoperatif 2 months (albendazol 800 mg / d). While there are literature reports of rare extremity involvements such as supraspinatus, gracilis, adductor magnus, sartorius and biceps brachii, cases of concomitant neurologic findings and complaints secondary to peripheral nerve compression are very rare [2225]. Cases of concomitant neurologic findings and complaints secondary to peripheral nerve compression are very rare . The main treatment for musculoskeletal cyst hydatidosis is surgical excision and the clinical findings should not be ruled out even if the emg result is negative . St, td, sm, and hy were involved in the conception, design, and interpretation . St, md, and se collected data, reviewed relevant published reports and provided the images.
|
Skeletal complications are a major cause of morbidity and mortality in men with prostate cancer (cap). Several factors contribute to the adverse skeletal health in these patients, e.g. Age related osteoporosis, accelerated bone turnover associated with the disease, metastatic bone lesions and androgen deprivation therapy (adt) employed for cap . Adt is associated with progressive decline in bone mineral density (bmd) and an increased risk of fractures. [25] skeletal fractures have been correlated with reduced overall survival in men with prostate cancer . With earlier detection of prostate cancer and increased longevity of the patients, prevention and management of their skeletal related complications has become more important . Screening for the presence of osteoporosis at the time of starting long - term adt is of paramount importance . Life style modification, supplementation of calcium and vitamin d, and bone - directed pharmacotherapy are vital for optimal skeletal care in this group of patients . Recommendations from several specialty groups and expert panels are available for prevention and treatment of adt - associated - osteoporosis. [714] all of them recommend baseline bmd estimation before starting long - term adt . Further treatment strategy and monitoring schedule of the patients the present study was carried out to analyze the practice pattern of indian urologists with regard to bone densitometric assessment and management of fracture risk in men of prostate cancer on androgen deprivation therapy, and their degree of adherence to currently available guidelines . The survey was designed to address physicians practice regarding: (a) monitoring of bmd in men starting adt; (b) counselling of men regarding bone - related adverse effects of adt; and (c) prevention and management of osteoporosis . One hundred and thirty qualified urologists were randomly selected from the updated member database of urological society of india (usi) in september 2011 . Telephonic interview was carried out by one author (m.r.p) with a predefined questionnaire (appendix). The questionnaire was developed by us and was pilot tested in the department of urology and renal transplantation, sgpgims and was modified as per the suggestions . The questions focused on the different aspects of assessment, prevention and management of osteoporosis in men with cap on adt . Data regarding physician practice characteristics (place of practice, type of practice and number of years in practice) were also collected . Place of practice was classified into two categories major cities (delhi, mumbai, kolkata, chennai and bangalore) and non - major cities . Type of practice was categorized as academic (those working in institutions or hospitals imparting postgraduate degree in urology) and non - academic . Years in practice was classified as 5 years or> 5 years of practice after the urology degree . The responses were recorded in a datasheet anonymously, and were analyzed and compared with the available evidences including the recommendations and guidelines pertaining to maintenance of bone health in men with cap on adt . Descriptive statistics was used for data analysis and presentation of results using spss 17.0 for windows statistical software (spss inc ., chicago, ill). For exploratory analyses, we used chi - square test to examine the impact of physician practice characteristics on their practice pattern . Six of them were no longer or very infrequently seeing cancer prostate patients and so were excluded from the study . One fifth (24/108, 22.2%) of them practiced in major indian cities and 40% (43/108) of practitioners resorted to academic centers . They constituted about 6% of the total number of practicing urologists . Using a 95% confidence interval, this response rate resulted in a 9.1% margin of error in estimating the practice of> 1800 practicing urologists in india . Only 19.4% (21/108) of urologists routinely consider the state of their patients bone mineralization and order baseline bmd estimation before starting adt . Another 11% (12/108) of urologists advice baseline bmd in less than 50% of their patients starting adt . Financial status of the patient and presence of skeletal metastasis determines their advice for baseline bmd . However, majority of the interviewed urologists (75/108, 69.6%) never order a baseline bmd prior to starting adt . All the respondents measuring baseline bmd, use zoledronic acid (za) in their patients when indicated; but 42.6% of urologists not doing bmd estimation also regularly use za in their patients on adt [figure 1]. Dual - energy x - ray absorptiometry (dexa) remains the most commonly adopted method (95.3%) for bmd measurement . Sixty seven percent of the respondents doing baseline bmd estimation modify their treatment schedule according to the test result, i.e. T - score . Bmd measurement in follow - up physicians practice of baseline bmd estimation only 50% of the respondents routinely warn their patients of osteoporosis and adverse skeletal events at the time of starting adt . Therapeutic modalities adopted by the urologists for prevention and treatment of osteoporosis in men on adt are presented in table 1 . While most urologists give calcium and vitamin d supplementation, only few of them advice for life - style modification, e.g. Regular weight - bearing exercises and avoiding use of tobacco and excessive alcohol intake . Majority (65/108, 59.6%) of the interviewed urologists frequently use za in their clinical practice . Of them, only one third urologists (21/65, 32.3%) routinely perform a baseline bmd and 18.4% (12/65) urologists do it in less than 50% of their patients . About half of them (32/65, 49.2%) prescribe za to men on adt, without knowing their bmd status [figure 2]. Monthly intravenous infusion of 4 mg of za for six months remains the most commonly adopted (40/65, 61.5%) treatment schedule . Therapies used for prevention and treatment of osteoporosis in men on adt physicians practice of bisphosphonate use in men on adt with better understanding of the disease, the survival of cap patients has increased significantly over the last few decades due to early detection and improved therapy . Improved socioeconomic status and better access to health care therefore, better care of the bone in such patients, has become increasingly important . Skeletal related events (sre) tremendously affect the quality of life and fractures have been shown to increase mortality in men . So, all practicing physicians should be aware of the need of good skeletal care in patients of cap and should update themselves periodically with the available scientific evidences for better patient care . Various guidelines and recommendations proposed by different expert panels and specialty societies are very much helpful in this regard, as they are based on solid scientific background and meticulous scrutiny of the available evidences . Adt is associated with significant decrease in bmd and an increased risk of fractures. [5152416] baseline and periodical follow - up bmd measurement is recommended in patients on adt. [714] in a study done on indian patients, agarwal et al . 18% at 12 months), resulting in an increased incidence of osteoporosis from 24% to 48% at 6 months after orchidectomy . Treatment and monitoring schedule of osteoporosis should be modified according to the t - score in the baseline bmd . An expert panel comprising of urologists, medical oncologists, radiation oncologists, and endocrinologists have recommended for periodic clinical review and serial bmd measurements every 12 - 24 months in patients with normal bmd and every 6 - 12 months in patients with osteopenia . They recommend use of za in patients with osteoporosis and in those with history of bone fracture (irrespective of bmd values), followed by yearly review with bmd estimation . The compliance of medical practitioners for baseline bmd estimation at the start of adt has been shown to be 5 - 36% in various studies. [1821] in our study, only 19.4% of respondents advice it routinely . Though most of them (67%) would modify the treatment schedule as per the bmd report, only few (24%) of them would advice for follow - up bmd . In view of existence of several guidelines and expert panel recommends for baseline bmd measurement, the compliance for bmd estimation was expected to be more among clinicians than the previous reported studies . First, they might not be aware of the severity and consequences of the treatment - related bone loss compared to the other adverse effects of adt . Second, many of them might be unaware of the guidelines and expert panel recommends for baseline and follow - up bmd measurement . Unavailability of dexa scan at local places may be another responsible factor, though only 17.6% of the urologists in our study, practised in places with no facility for dexa scan within reasonable distance . Before starting long - term adt, all probable adverse effects including risk of osteoporosis and fractures should be discussed with the patient . It is done routinely by 50% of the urologists in our study, though previous studies have reported it between 15% to 38.5% . It could be due to increased awareness among the doctors regarding the need of patient education for better treatment compliance . Guidelines on prostate cancer recommend encouraging the patients to adopt lifestyle changes, for e.g. Increased physical activity, cessation of smoking, decreased alcohol consumption and normalisation of their body mass index (bmi). National comprehensive cancer network (nccn) guidelines on prostate cancer endorses the guidelines of national osteoporosis foundation (nof) and recommends supplemental calcium (1200 mg daily) and vitamin d3 (800 - 1000 iu daily) for all men over age 50 years . Though most of the urologists (90.7%) in our study advice calcium and vitamin d supplementation to the patients, only 37.9% advice for life - style modification . In previous similar studies, physicians have been reported to advice calcium and vitamin d supplementation in 8.7 - 64% of patients and lifestyle modification in 11% of patients on adt. [1821] however, it is to be remembered that, though these two agents are an integral part of skeletal - care programme, they have not been shown to be potent enough for the preservation of bmd during adt . Another way to circumvent the skeletal side effects of adt is monotherapy with nonsteroidal antiandrogens like bicalutamide . It has the advantage of maintenance of normal serum testosterone level and preservation of bmd . However, it is not very popular and as per the nccn guidelines androgen monotherapy appears to be less effective than medical or surgical castration and should not be recommended . Bisphosphonates have been shown to protect against adt - related bone loss in both metastatic and non - metastatic prostate cancer. [2426] za is the most potent drug among the bisphosphonates . Though major volume of the work concerning za has been done in metastatic hormone refractory prostate cancer (hrpc), it has also been found beneficial in hormone sensitive and non - metastatic cap. [6713142830] from the available evidences, we infer that, the use of za in patients of cap should primarily be based on the bmd and fracture risk of the patient, with modification of the dose as per the stage of the disease and hormonal status . The who absolute fracture risk model (frax; www.nof.org and www.shef.ac.uk/frax) is an important adjunct in decision making in such patients . The drug concentrate (4 mg) should be diluted in 100 ml of 0.9% sodium chloride or 5% dextrose solution and should be infused over a period of 15 minutes . Serum levels of calcium, phosphate, magnesium and creatinine should be carefully monitored before and following za therapy . In case of hypocalcemia, hypophosphatemia or hypomagnesemia due to its nephrotoxic effects, it should be used with caution with other nephrotoxic drugs and the dose should be modified in patients with renal impairment (creatinine clearance <60 ml / min). It should not be used in patients with serum creatinine of more than 3 mg / dl . Common adverse events associated with za use include fever, flu - like symptoms (e.g. Fever, chills, bone pain, arthralgia, myalgia), anemia, neutropenia, nausea, vomiting, constipation, hypotension, atrial fibrillation, hypertension, blurred vision, uveitis, scleritis, headache, dizziness, dyspnoea, bronchoconstriction, hypomagnesemia, hypophosphatemia and hypocalcemia . However, the most dreaded complications include osteonecrosis of the jaw (onj), atypical subtrochanteric and diaphyseal femoral fractures and renal impairment . Cancer patients should maintain good oral hygiene and should have a dental examination prior to treatment with za . While on treatment, these patients should avoid invasive dental procedures if possible . For patients who develop onj while on bisphosphonate therapy different studies have reported the urologists and radiation oncologists to use bisphosphonates in 5 - 21% of their patients on adt. [182022] in our study, 60% of the interviewed urologists frequently use za in patients on adt, with majority of them being sometimes (18.5%) or always (49.2%) unaware of the baseline bmd, at the start of therapy . The optimal dosage schedule and duration of therapy of za remains uncertain . In metastatic hormone refractory cap, once - every-3 - 4 weeks infusion has been recommended . For prevention or treatment of osteoporosis in men on adt, quarterly iv infusion remains the most studied protocol, though monthly, biannual and annual injections have also been described . In our study, monthly infusion of 4 mg of za for a period of six months was found to be the most commonly followed schedule (40/65, 61.5%). The various schedules adopted by the participating urologists and their indications for use of za have been presented in table 2 . Since monthly infusion of za is recommended only in metastatic hormone refractory cap with quarterly or biannual injections sufficient for rest all scenarios, there appears an overuse of za by indian urologists . Apart from financial burden, this may expose the patients to undue side - effects of the drug . Interviewed urologists indications for use of zoledronic acid on exploratory analysis, years of clinical practice had no bearing on the use of za (p-0.31) or estimation of baseline bmd (p-0.32). Use of za was found to be significantly more among those practising in academic centres (p- 0.031); however, it was not affected by the place of practice (p- 0.072). Clinicians practising in major cities ordered for baseline bmd more often (p-0.002); however, it was not affected by the centre of practice (academic vs non - academic). Strengths of our study include a high response rate and a structured telephonic interview enabling us to garner maximum possible information from the respondents . Direct verbal communication enabled us to clarify our questions, when sought by the interviewee and get clarifications of their answers, when required . We also ensured them to answer all our questions, which may not be possible with a mailed questionnaire . Our sample size constituted about 6% of the practicing urologists in india and the results can be considered to closely represent the prevalent practice pattern . First, it's difficult to determine how closely the respondents answers reflected their actual practice . Second, india being a vast country with widely variable socio - cultural factors affecting physician practice patterns, some geographical areas might have been under - represented . Majority of indian urologists do not adhere to the current evidences and guidelines for bmd measurement in cap . While majority of the respondents prescribe za to patients on adt, most of them do so without knowing the baseline bmd, leading to apparent overuse of the drug . Though the awareness regarding bone - health in patients on adt is better in our survey than the previously reported studies, urologists need to better counsel their patients regarding the bone - related adverse effects of adt and encourage life - style modifications.
|
Essential tremor (et) is a common neurological condition which increases with the age of the population and contributes to significant disability in most affected patients . Previous cross - sectional studies have shown that patients with et may have minor cognitive deficits on formal testing although most of these older studies have been done with advanced et patients being assessed for deep brain stimulation as treatment for tremor [1, 2]. More recently, a population study of et demonstrated that more mildly affected, largely untreated et individuals may be more likely to complain of memory problems and have deficits at testing . This same population was more likely to have prevalent dementia, largely driven by elderly onset et . In those nondemented at baseline, incident dementia was greater in et . This study seeks to compare the risk of developing dementia in subjects with et versus controls without tremor in a large, well - categorized cohort of individuals involved in a longitudinal aging study, the arizona study of aging and neurodegenerative disorders (azsand). Participants without dementia or another neurodegenerative disorder at study entry and who had at least one follow - up visit were selected from the 23 may 2013 version of the azsand database which included 3300 subjects . All participants, both cases and controls, were initially recruited into the study largely as a result of lectures and community awareness within the catchment area of maricopa county, arizona, and provided informed consent approved by banner irb . Beginning in 1997, all participants had an annual updrs and fahn tolosa marin (ftm) tremor scale done by a movement disorder neurologist (holly a. shill, charles h. adler, erika driver - dunckley) who annually classified the subject movement diagnosis based on their current examination and review of medical records . Participants were diagnosed with et if they had carried a clinical diagnosis of et and the examination was consistent with that diagnosis or if they had an isolated head or voice tremor without dystonia . If the participants did not have a diagnosis of et but did have a postural or kinetic hand tremor score of 2 on the ftm scale without secondary cause, then they were given a research diagnosis of et . If the participants had a postural or terminal tremor of the hands <2, they were categorized as having tremor nos . These participants were then reclassified on subsequent annual examinations as et if they had persistent tremor greater than 3 years without secondary cause . All had annual neuropsychological testing which included at a minimum: wais - iii digit span, auditory verbal learning test (rey avlt), controlled oral word association (cowat), category fluency, boston naming test (bnt), clock drawing, judgment of line orientation (jlo), trails part a / b, stroop, and mmse . All clinical information was used to categorize cognitive status at consensus conference staffed by a behavioral neurologist, psychiatrist, and neuropsychologist . Baseline characteristics of both groups were compared using t - test or chi square as appropriate . The incidence of dementia in participants with et was compared to that of controls without action tremor by using cox regression . The incidence of dementia in et with tremor onset at age 65 years or greater was compared to that of et with tremor onset before the age of 65 by using cox regression as previous reviews have suggested subtyping et based on beginning prior to or after the age of 65 . The incidence of dementia in those with tremor duration greater than the median was compared to those with tremor less than the median . The incidence of dementia was compared in participants with et compared to controls after excluding those with mci at baseline . Out of 3300 individuals in the database, 1266 had baseline cognitive and motor testing and 1052 were not demented at baseline . The majority of those who did not have both standardized assessments were enrolled in the program prior to 1997 . Et was present in 141 participants, 679 did not have tremor, and 232 had tremor that did not meet criteria to be included (low amplitude, nonpersisting tremor, or secondary tremor). After excluding participants with another baseline neurodegenerative disorder such as parkinsonism (30 in the tremor group and 160 in the nontremor group) and including only those having at least two movement and cognitive exams, the final analysis included 83 participants with tremor and 424 controls . The proportion of women was lower in the tremor group than the control group (table 1). Mean age was higher in the tremor group at baseline (80 5.9 versus 76.9 8.5, p = 0.002). Age at tremor onset ranged from near birth to 91 years (mean 66 21), and the duration of tremor at study entry ranged from 0 to 72 years (mean 14 19, median 5.2 years). The proportion of apoe 4 carriers was the same in both groups (13/55, 23.6% tremor versus 57/238, 23.9% controls). The incidence of dementia was not different in the tremor group compared to the control group (figure 1). The incidence of dementia within 5 years of study entry was 6% for et and 8% for controls (95% ci 1% to 11% for tremor, and 5% to 11% for controls). The hazard ratio for the association between et and dementia was 0.79 (95% ci 0.33 to 1.85; p = 0.58). Adjustment for age and sex, or for age, sex, and apoe 4, nonsignificantly decreased the hazard ratio for the association between tremor and dementia (hr 0.50, 95% ci 0.21 to 1.20, p = 0.12; or hr 0.46, 95% ci 0.17 to 1.23, p = 0.12). Excluding participants with mci at baseline, the hazard ratio for the development of dementia was 1.06 (95% ci 0.171.23). The sample was too small to assess the relationship between dementia and age of tremor onset or duration of tremor . The hazard ratio for the association between onset at age 65 or over, versus onset before age 65, was 2.1 (95% ci 0.24 to 18). The hazard ratio for the association between tremor duration greater than 5 years, versus tremor duration no more than 5 years, was 0.46 (95% ci 0.08 to 2.6). The main finding of this study was that all subjects with et did not develop dementia at a higher rate than control subjects without tremor in this well - categorized longitudinal study . These results are in contrast to the findings in the spanish population study reported in 2007 where they reported an unadjusted relative risk of dementia of 2.08 (95% ci = 1.243.50) in et . Our study found a relative risk of 0.79 (95% ci 0.33 to 1.85). While the spanish population study enrolled over 3000 subjects, the older age at baseline for our group increases the relative percentages of tremor and dementia making the absolute numbers fairly comparable . Advantages of the current study are that all subjects were followed annually with a more comprehensive standardized motor and neuropsychological test battery, were assessed in the clinic regardless of entry diagnosis, and had longer duration median followup . Further, both the tremor and control groups were more similarly matched in terms of level of education compared with the previous study (although this was corrected for in the final analysis). In an aging study in new york investigators found a higher amount of dementia in their cross - sectional sample but found a nonsignificant adjusted incident dementia risk of 1.64 for dementia in prospectively followed cases . This is similar to our findings with advantages of the current study being prospective, in person assessments of all participants (tremor and controls) by movement disorder and behavioral neurology specialists, similar baseline characteristics of both patient populations, and longer duration followup . Previous study has suggested that older age of onset of tremor might be a higher risk for cognitive decline [4, 5]. We did not have a large enough number of each group to specifically examine this with statistical power (the hazard ratio for the association between onset at age 65 or over, versus onset before age 65, was 2.1 but with very large confidence intervals of 0.24 to 18). However, taken together with the other finding of increased dementia in shorter duration tremor, this suggests that older onset tremor might be at higher risk although more subjects with very long duration tremor are needed to say this with confidence . It is worth considering that the age where this risk goes up might be high as we did not find an increased risk for the group as a whole with a mean age of 80 at study entry and a median tremor duration of 5.2 years . Alternately, dementia in tremor patients develops relatively rapidly after the onset of tremor which would have resulted in exclusion of these subjects from our study (left censorship). If true, this might suggest that some action tremor could be an early biomarker of subsequent cognitive decline . One limitation of our study is that our population may not be representative of the entire et population . However, subjects with et were not typically recruited into our study based on presence of tremor, but rather they were mostly entered in the study as elderly controls for the purposes of comparison to cases of ad and pd and therefore were recruited from a very similar demographic pool as controls . As a result, the comparisons between the two groups based on presence or absence of tremor, rather than a formal medical diagnosis of et, are likely valid for this type of study . The risk of dementia in this entire cohort is similar to other population studies with similar demographics . In summary, we did not find a link between tremor and dementia in the overall group . However, there was suggestion that elderly onset, shorter duration tremor might be at higher risk . While some have proposed separating et into categories based on age of onset of tremor, it is still not clear yet if there are meaningful clinical differences between these groups with respect to risk for cognitive decline or parkinsonism.
|
This was a single - center, retrospective comparative study of eyes treated with the ex - press glaucoma filtration device under a partial - thickness scleral flap in african american and white glaucoma patients . The study protocol was approved by the institutional review board, and informed consent was obtained before surgery . All patients requiring surgical intervention were on maximum tolerated medical therapy and were judged to require additional intraocular pressure (iop) reduction to prevent further progression of glaucomatous optic neuropathy and associated visual field loss . Exclusion criteria included previous standard trabeculectomy and combined cataract and ex - press glaucoma filtration device . A 6 - 0 polyglactin suture (vicryl; ethicon, san angelo, tx) was passed in the cornea superiorly to infraduct the eye . Mmc (0.4 mg / ml) was applied before formation of the scleral flap for 13 minutes duration depending on the patient s underlying conjunctival characteristics, such as hyperemia or thinning . After removing the sponges, the site was irrigated copiously with balanced salt solution . A partial - thickness triangular scleral flap was outlined with a 15 blade and elevated with a 57 blade . A 25-gauge needle was used to enter the anterior chamber slightly posterior to the blue - gray zone under the scleral flap, and the ex - press device (model p50) was introduced into the anterior chamber through the needle track by using a disposable delivery system . The scleral flap was sutured with interrupted 10 - 0 nylon sutures, adjusting the tension on the sutures to maintain anterior chamber depth with slow flow of aqueous humor around the margins of the scleral flap . A subconjunctival injection of steroid and antibiotic was given in the inferior fornix, and the corneal traction suture was removed . The eye was dressed with antibiotic and steroid ointment or solution, a light gauze dressing, and an eye shield . Topical antibiotic (fourth - generation fluoroquinolone) and steroid, generally prednisolone acetate 1%, were given postoperatively and tapered over several weeks . Preoperative information included patient age, sex, race, glaucoma diagnosis, history of laser, glaucoma medications, iop measured by goldmann applanation tonometer, and visual acuity . In terms of glaucoma diagnosis, combined - mechanism glaucoma was designated for patients who had both open and closed components of the drainage angle and had required laser peripheral iridotomy in the past . Mixed - mechanism glaucoma was reserved for patients where a combination of multiple surgeries, inflammation, steroid use, or bleeding may have contributed to the underlying mechanism . The primary outcome measures were iop, number of postoperative glaucoma medications, and surgical success . Surgical success was defined as iop between 5 and 18 mmhg, with or without glaucoma medications, without further glaucoma surgery, or loss of light - perception vision . Laser suture lysis was not considered a failure of the procedure and performed at the discretion of the surgeon depending on the clinical situation . Postoperative complications, including hyphema, choroidal effusions, flat anterior chamber, hypotony, bleb leak, suprachoroidal hemorrhage, endophthalmitis, and device - related complications were assessed . Bleb leak was considered a complication during the late postoperative period (more than 6 weeks after surgery), and early hypotony was defined as iop <5 mmhg during the first postoperative week . The two groups were compared using the two - sample t - test and mann whitney test for continuous variables, and pearson s and fisher s exact tests for categorical data . Since the two - sample t - test and mann whitney test gave similar results, only results from the t - test are reported here . Success rates in both groups were compared using kaplan meier life - table analysis and the log - rank test . All analyses were done using sas 9.2 software (sas institute, cary, nc). The ex - press glaucoma filtration device was inserted in 36 eyes of 36 african americans and 43 eyes of 43 caucasians . The mean follow - up was 31.9 9.8 (range 14.647) months for african americans and 30.7 8.6 (range 14.347) months for whites . There was no difference between the two groups in terms of age, sex, baseline iop, preoperative glaucoma medications, or type of glaucoma . A significant reduction in iop occurred at all time points in both groups compared to baseline iop, and no significant difference in iop lowering was noted between the two groups (table 2). The mean iop before and after insertion of the ex - press device is shown in figure 1 . The preoperative iop for each eye was determined by an average of two iop measurements from previous consecutive visits before surgical intervention . The mean standard deviation (sd) preoperative iop was 23.8 9.1 for the african american group and 23.0 10.0 for the caucasian group (p = 0.72). The mean iop postoperatively was significantly lower in both groups compared with baseline iop at all time points . The mean iop was higher in the african american group when compared with the white group at day 7, month 3, and month 6 with p 0.05 . The mean postoperative iop was not statistically different between the two groups at 1 year (13.9 vs 12.2; p = 0.39), 2 years (12.9 vs 10.7; p = 0.72), and 33 months (11.0 vs 11.3; p = 0.92). The mean number of glaucoma medications preoperatively and postoperatively is shown in figure 2 . At baseline, the mean sd baseline or preoperative glaucoma medications was 2.8 0.5 in each group . There was a significant reduction seen in the number of postoperative glaucoma medications required in both groups compared with baseline medications . The mean number of postoperative medications was higher in the african american group when compared with the white group at months 18 and 27 . The mean number of postoperative medications was not statistically different for the two groups at year 1 (0.56 vs 0.21; p = 0.07), year 2 (0.31 vs 0.10; p = 0.24), and 33 months (0.0 vs 0.05; p = 0.42). The survival analysis is shown in figure 3, with a success rate of 80.0% in the african american group and 83.3% in the white group at 33 months . The survival curves for the two groups were not significantly different (p = 1.00). Reasons for surgical failure included increased iop (three eyes, 3.8%), persistent hypotony with maculopathy (one eye, 1.3%), and further surgery (four eyes, 5.06%). Three patients had high iop of 33, 31, and 20 mmhg at 6, 9, and 6 months after surgery, respectively . Hyphema was observed more in white eyes, and choroidal effusions were more frequent in african american eyes, but these differences were not statistically significant . One patient in each group had late - onset bleb leak, which resolved with conservative therapy . One patient in each group had a blocked device that was successfully treated with an nd: yag laser, resulting in liberation of fibrinous material at the tip of the ex - press device with restoration of aqueous outflow . Eyes requiring laser suture lysis were similar in the african american and white groups (42% vs 33%, respectively; p = 0.40). Early hypotony was also similar in the two groups (8% vs 12%; p = 0.72). Multiple studies have reported racial differences between blacks and whites in response to medical, laser, or surgical therapy for glaucoma . The varied responses in african americans have been attributed to iris pigmentation, corneal thickness, number of preoperative glaucoma medications, cellular profile of the conjunctiva, more exuberant healing response to surgery, and socioeconomic factors.2125 the most notable study that evaluated the differences in treatment outcomes between black and white patients was the advanced glaucoma intervention study (agis).79 patients were randomized to a treatment sequence of argon laser trabeculoplasty trabeculectomy trabeculectomy (att sequence) or trabeculectomy argon laser trabeculoplasty trabeculectomy (tat sequence). The main outcome measures were visual acuity and visual field, although iop, complication rates, and need for adjunctive medications were evaluated as well . Racial differences were reported in the treatment outcomes in white and black patients between the randomized groups at 710 years of follow - up.7,9 the results favored the att sequence in black patients and the tat sequence in white patients, based on preservation of visual function . In addition to race - specific analysis between the two randomized intervention sequences as described above, further analysis was conducted to determine whether the treatment - specific clinical course of glaucoma differs between eyes of white and black patients.8 after baseline differences were adjusted, blacks had lower failure rates with argon laser trabeculoplasty than did whites in the att sequence . This finding conflicted with results of previous laser studies, which demonstrated either higher failure rates in blacks or equivalent results between blacks and whites.26,27 in the tat sequence, blacks had higher failure rates with initial trabeculectomy, and these findings were consistent with previously reported trabeculectomy outcomes in blacks.7,28,29 of note, most initial trabeculectomies in agis were performed without antifibrosis agents . Since adjunctive use of antimetabolites has been reported to improve surgical outcomes of trabeculectomy in blacks, it is possible that extensive use of antimetabolites might have improved the outcomes of trabeculectomy in blacks and enhanced the beneficial effects of trabeculectomy in whites . In the present study, the ex - press glaucoma filtration device is one of the newest modifications of glaucoma filtration surgery . The device is inserted under a partial - thickness scleral flap into the anterior chamber through a needle track created by a 23- or 25-gauge needle . Unlike standard trabeculectomy, sclerectomy and iridectomy are not performed at the time of surgery, minimizing both intraoperative and postoperative inflammation . Also, variations in the fistula size seen with traditional trabeculectomy are avoided, minimizing unpredictable outcomes and adverse side effects . Several retrospective and prospective studies have compared the safety and efficacy of the ex - press device under a scleral flap with standard trabeculectomy and have reported similar or better iop outcomes.3032 many of these studies have demonstrated superiority of this technique over standard trabeculectomy in reducing intraoperative and postoperative complications due to a more controlled outflow of aqueous humor through consistent lumen size . In addition, rapid visual recovery secondary to less inflammation and fewer postoperative visits were reported in one retrospective study.32 in agis 11, analysis of risk factors for failure of trabeculectomy and argon laser trabeculoplasty demonstrated that marked postoperative inflammation increased the risk of trabeculectomy failure by 160% (hazard ratio = 2.60).33 in the present study, similar surgical success was achieved in both races, presumably from no tissue removal and subsequently less inflammation with the ex - press filtration device . In addition to inflammation related to surgical technique, other risk factors have been described for failure of glaucoma filtration surgery.24,25,34,35 a thicker tenon s capsule at the time of surgery or its ability to incite greater inflammatory reaction after surgical trauma was reported to be a risk factor of filtration surgery in blacks, and its removal has been suggested by some investigators.36,37 however, in one comparative study of trabeculectomy with and without tenonectomy, no statistically significant difference was noted in the two studied groups.38 differences in conjunctival cell population have been reported in blacks and whites.24 the conjunctival biopsy specimens from blacks demonstrated more fibroblasts and macrophages compared to those from whites . Since fibroblasts are typically responsible for wound healing, the amplified macrophage activity may result in exaggerated wound healing and may partially explain more surgical failures among black patients . In addition to the cell numbers, variations in cell activation and function have also been postulated to be responsible for the differences observed . Different degrees of postoperative hyperemia and aqueous humor composition have also been proposed as potential risk factors for filtration surgery in blacks when compared to whites.39,40 in one ex - press study, evaluation by the moorfields bleb - grading system demonstrated consistently less vascularity in ex - press blebs compared to standard trabeculectomy blebs; however, these differences were absent at study completion.32 in addition, the number of preoperative medications may influence surgical success after glaucoma filtration surgery.25,41 since glaucoma assumes a more aggressive course in african americans, more medications preoperatively may adversely affect surgical outcomes . Goblet cell population has been reported to be reduced in eyes with long - term use of glaucoma medications.42 although it remains unclear whether fewer goblet cells could incite a more exuberant healing response in blacks, further evaluation is warranted to understand the adverse effect of glaucoma medications on goblet cells in black and white patients . In fact, better results of trabeculectomy were seen in blacks when trabeculectomy was the primary procedure rather than secondary intervention after failure of medical therapy.43 in agis, black patients were also found to be on more glaucoma medications preoperatively than were white patients in both treatment sequences . In the current study, limitations of the current study include its retrospective design with potential for selection bias, modest sample size, and short follow - up time . We also acknowledge that mmc application, ranging from 1 to 3 minutes, may have introduced some variability in our results . The application time of mmc varied depending on conjunctival hyperemia or overall health of the conjunctiva . Unlike many other studies, all cases in our study were done by a single surgeon, controlling some of the confounding factors, such as clinical indications for surgery and surgical technique . The results of this retrospective study merit further evaluation of race influence on outcomes of ex - press glaucoma filtration device in a longitudinal, prospective, randomized study . In summary, our results suggest that insertion of the ex - press glaucoma filtration device augmented by antimetabolite use may be a better surgical option for african americans, given its potential advantages of no tissue removal with reduced inflammation and predictable outcomes related to consistent lumen size and controlled flow that may reduce postoperative complications and overall failure rates . An exaggerated healing response in blacks after glaucoma filtration surgery is known to be a major risk factor for surgical failure . Whether it is due to a thick tenon s capsule, reduced goblet cells, amplified macrophages and fibroblasts, or excessive inflammation from these or other unknown factors, additional research is needed to explore these possibilities . While the inherent characteristics of the conjunctiva cannot be changed, modifications in surgical technique of glaucoma filtration surgery may improve outcomes in blacks.
|
Embryonic development relies upon the precise control of genetic programs to create complex tissues and organs . Mutagenesis screens and the sequencing of multiple genomes have revealed an extensive list of patterning genes, many of which are expressed in a tissue - specific manner within the developing embryo . One of the remaining challenges in developmental biology is to understand how these genes act in space and time to modulate cell proliferation, migration, and differentiation in a stereotypic manner . Toward that goal, several genetic approaches for conditional gene regulation have been developed, such as the flp / frt, cre / lox, and tet - on / tet - off systems, and these technologies have provided key insights into the molecular mechanisms that underlie tissue patterning and function. (1) chemical technologies are also required for surmounting this challenge, especially in biological systems for which reverse - genetic methods are limited . For example, the zebrafish is ideally suited for visualizing vertebrate ontogeny, since its embryos and larvae are optically transparent and develop rapidly ex utero. (2) however, methods for regulating endogenous gene function in zebrafish are underdeveloped relative to those for other model organisms; targeted gene knockouts by homologous recombination and inducible rna interference technologies have not yet been achieved. (3) in lieu of these approaches, synthetic oligonucleotides such as morpholinos (mos) and negatively charged peptide nucleic acids (ncpnas) have been employed as antisense reagents in zebrafish embryos (figure 1). Mo nucleoside analogues display dna bases from a morpholine ring system and are connected by a phosphorodiamidate backbone, while ncpna monomers are composed of alternating trans-4-hydroxy - l - proline / phosphonate polyamides, each functionalized with a dna base . Because of these non - natural structures, both mos and ncpnas are resistant to nucleases and persist for up to 4 days in zebrafish embryos . Thus, when mo or ncpna oligomers are injected into zebrafish prior to the eight - cell stage, they become uniformly distributed throughout the embryo and constitutively block either rna splicing or translation, depending on the targeted sequence . In the case of mos, oligomers containing 25 bases are typically used, while ncpna oligomers are limited to 18 bases . Unlike rna interference technologies, mos and ncpnas do not promote rna degradation. (6) structures of dna, mo, and ncpna oligonucleotides . While mos and ncpnas have been used to interrogate gene function in zebrafish and other model organisms, the utility of these reagents is restricted by their constitutive activity . Gene expression is inhibited immediately after introduction of the antisense oligomers, and because they are typically injected into early - stage embryos, this blockade persists in most, if not all, cell lineages . Conventional mos and ncpnas therefore are less effective for studying genes that are required for embryonic survival and/or have pleiotropic functions at different developmental stages or in distinct tissues . To overcome this limitation, we recently developed caged morpholinos (cmos) that can be activated by light, taking advantage of the transparency of zebrafish embryos and larvae. (7) this was achieved by tethering a complementary mo - derived inhibitor to the 25-base targeting sequence through a dimethoxynitrobenzyl (dmnb)-based photocleavable linker, resulting in a hairpin structure (figure 2). The intramolecular duplex suppresses binding of the targeting sequence to its complementary rna, and the stemloop configuration is significantly less active in vivo . After linker cleavage with 360-nm light, the inhibitor dissociates from the 25-base mo, allowing the antisense reagent to prevent splicing or translation of its rna target . Similar caging strategies have previously been described for regulating dna duplex formation and rna function in vitro, and this general approach differs from complementary oligonucleotide - caging technologies that target individual nucleoside bases, the phosphate backbone, or oligonucleotide termini. (17) schematic representation of the hairpin cmo strategy . As a proof of principle, we first used this methodology to conditionally silence a t - box transcription factor called no tail - a (ntla), which is required for the differentiation of axial mesodermal cells into a transient, chordate - specific organ called the notochord . Embryos lacking ntla function exhibit clear morphological phenotypes in a cell - autonomous manner, providing an ideal system for evaluating the efficacy of cmos in vivo . In particular, ntla mutants or morphants (as mo - injected embryos are commonly called) lack a notochord, are posteriorly truncated, and exhibit u - shaped rather than v - shaped somites . The latter defect is collateral to notochord ablation, since the notochord secretes morphogens to pattern the flanking myotome. (20) mutants or morphants lacking ntla function also exhibit an ectopic medial floor plate, a ventral region of the developing spinal cord, and it is believed that ntla acts as a transcriptional switch between notochord and medial floor plate cell fates . By varying the developmental stage at which we activated the ntla cmo, we found that this transcription factor is required not only for specification of the mesoderm toward notochord cell fates but also for the maturation of notochord progenitors into a highly vacuolated tissue. (7) we also demonstrated our ability to silence ntla expression in a subset of mesodermal cells by activating the ntla cmo in a spatially restricted manner, selectively redirecting these populations to differentiate into medial floor plate cells . A similar caging approach has been applied to ncpnas targeting the chordin (chd) and dharma (dha) genes, although the use of these photoactivatable ncpna hairpins to spatially control gene expression has not been reported to date. (22) while our results established the general principle of using caged oligonucleotides to conditionally regulate in vivo gene expression, there are limitations associated with these initial investigations . First, our previous studies required preparation of the inhibitory oligomer and its appendant dmnb linker through solid - phase chemistries, since conventional mos amenable to terminal hydroxyl modifications were not commercially available at that time . These procedures are laborious and time - consuming, hindering the synthesis and evaluation of other cmos . Second, guidelines for the design of other hairpin cmos were not evident from our findings, as only one inhibitory sequence and structural configuration was tested . Nor could general rules for caged oligonucleotide design be derived from the ncpna study, which limited its analysis to single chd- and dha - targeting reagents with divergent structures and dosages. (22) finally, the reliance of both classes of caged oligonucleotides on nitrobenzyl - based chromophores restricts their use to single - photon irradiation with uv light, which can induce dna lesions and has limited spatial resolution . Photoactivatable mos and ncpnas that are compatible with two - photon excitation could be activated with less coincident damage, deeper tissue penetration, and greater spatial precision. (23) we report herein our resolution of these issues through the development of new hairpin cmos . We have designed and synthesized a dmnb - based bifunctional linker that can be used to conjugate the targeting mo and its complementary inhibitor in only three steps, starting with appropriately functionalized mo oligomers that are now commercially available . We have utilized this optimized synthetic route to prepare a series of ntla - targeting cmos with differing structural configurations, thereby allowing us to systematically analyze how the in vivo efficacy of these reagents correlates with their biophysical properties . Through these studies, we have demonstrated that cmo activity in vivo can be modeled in simplified thermodynamic terms, and we have established guidelines for the preparation of other cmos . These design criteria have enabled us to prepare photoactivatable reagents targeting the zebrafish genes heart of glass (heg),(24)floating head (flh),(25) and endothelial - specific variant gene 2 (etv2). (26) we have further demonstrated the versatility of this approach by replacing the dmnb chromophore with a bromohydroxyquinoline (bhq) group, which has a significantly greater cross section for two - photon excitation . These studies represent the first comprehensive analysis of the structure and in vivo function of hairpin - caged oligonucleotides, providing a foundation upon which future chemical technologies for conditional gene regulation can be based . Since our current cmo design involves the conjugation of a targeting mo to a complementary inhibitor, modifications of the hydroxyl- and amine - functionalized termini of each oligomer (designated as the 5 and 3 ends, respectively) are necessary . At the time of our initial studies, mos functionalized with 3 primary amines were commercially available, but 5-amine oligomers were not . We therefore prepared an inhibitory oligonucleotide conjugated at its 5 end to a photocleavable linker (1; chart 1) using solid - phase chemistry . This required the synthesis of all four mo bases, a linker - modified mo monomer, and multiple rounds of solid - phase coupling (scheme s1 in the supporting information). (7) addition of the linker - functionalized inhibitor to the targeting mo was then achieved through a cu(i)-catalyzed huisgen 1,3-dipolar cycloaddition (click chemistry(29)). Although this approach is ultimately effective, its utilization of time - consuming and labor - intensive procedures hinders the application of hairpin cmos to other developmental genes . To streamline the synthesis of cmos, we developed a new strategy that takes advantage of the recent commercial availability of 5-amine mos . Our goal was to prepare a bifunctional linker that contains the dmnb chromophore, an n - hydroxysuccinimide ester for amine conjugation, and a terminal alkyne for azide cycloaddition through click chemistry . With appropriately functionalized targeting and inhibitory mos, the cmo we first synthesized the bifunctional, photocleavable cross - linker 2a (chart 1 and scheme 1). The dmnb amino alcohol 3a(7) was selectively acylated with methyl adipoyl chloride to give amide 4a, which was then activated by 1,1-carbonyldiimidazole and coupled with 6-amino - n-(prop-2-ynyl)hexanamide(30) to provide the propargyl intermediate 5a . Saponification of 5a and re - esterification of the corresponding acid with disuccinimidyl carbonate then yielded linker 2a, which is orthogonally reactive with azides and amines . Reagents and conditions: (a) methyl adipoyl chloride, dipea, ch2cl2, 86%; (b) 1,1-carbonyldiimidazole, dmf, 88%; (c) 6-amino - n-(prop-2-ynyl)hexanamide, dipea, ch2cl2, 64%; (d) 2 m naoh(aq), thf, meoh, 93%; (e) disuccinimidyl carbonate, pyridine, acetonitrile, 75% . Yields are those obtained for the dmnb derivatives . To prepare a ntla cmo through this synthetic approach, a targeting mo (5-gacttgaggcagacatatttccgat-3) was functionalized with 3-azidopropionic acid succinimidyl ester to yield the azide derivative 6 (scheme 2). Linker 2a was then reacted with the commercially available 5-amine- and 3-fluorescein - functionalized mo (5-tatgtctgcc-3) in 0.1 m sodium borate buffer (ph 8.5) to generate linker - derivatized inhibitory oligomer 7a, and the two mo oligomers were coupled through click chemistry in 0.1 m potassium phosphate buffer (ph 8) containing sodium ascorbate, cui, and tris[(1-benzyl-1h-1,2,3-triazol-4-yl)methyl]amine (tbta). Purification of the final product by ion - exchange hplc using naclo4 as the eluent then yielded the ntla cmo 8a . Reagents and conditions: (a) 2,5-dioxopyrrolidin-1-yl 3-azidopropanoate, 0.1 m sodium borate (ph 8.5)/3:1 (v / v) dmso, 98%; (b) bifunctional dmnb linker 2a or 2b, 0.1 m sodium borate (ph 8.5)/dmso 6:1 (v / v), 7090%; (c) sodium ascorbate, tbta, cui, 0.1 m potassium phosphate (ph 8.0), dmso, 1025% after hplc . The ntla cmos 8ah, 8a, and 8e were prepared through this synthetic route, using the ntla - targeting mo (5-gacttgaggcagacatatttccgat-5) and inhibitory mos having various lengths and sequences (table 1). To evaluate the in vivo efficacy of this reagent, we next injected 8a into wild - type zebrafish embryos at the one - cell stage and globally irradiated approximately half of the embryos with 360-nm light (13 mw / cm) for 10 s at 3 h post fertilization (hpf). The remaining embryos were cultured in the dark as negative controls, and the resulting phenotypes at 1 day post fertilization (dpf) were then scored . As we have described previously, ntla loss - of - function phenotypes can be categorized into four classes according to their severity: class i = a fully penetrant ntla mutant phenotype characterized by no notochord, u - shaped somites, and a lack of posterior structures; class ii = no notochord, u - shaped somites, and some posterior somites; class iii = incompletely vacuolated notochord, v - shaped somites, and a shortened anteriorposterior axis; and class iv = wild - type phenotype (figure 3a). (7) these phenotypes can be recapitulated by injecting early - stage embryos with varying doses of the conventional ntla mo, and classes iiv correspond respectively to doses of 115, 57, 28, and 14 fmol / embryo (figure 3b). Since the class i phenotype can be achieved with ntla mo levels 115 fmol / embryo, we utilized 8a at this minimum dose in this experiment . To our surprise, 8a induced class - ii and class - iii phenotypes in the absence of irradiation (figure 3c), while our original ntla cmo exhibited little activity prior to uncaging. (7) since the targeting and inhibitory mos used in this reagent are identical to those in our previous study, this difference in caging efficiency must reflect changes in the linker structure . Somitic (s), medial floor plate (mfp), notochord (nc), and yolk extension (ye) tissues are labeled . Bright - field (left) and differential interference contrast (right) images of 1 dpf embryos are shown . (b) distribution of phenotypes according to the dose (per embryo) of a conventional ntla mo . (c) distribution of phenotypes for ntla cmo 8a at a dose of 115 fmol / embryo with and without photoactivation . Reasoning that the hairpin cmo efficacy depends on the interplay between inhibitor length, stemloop configuration, and linker formats, we used linker 2a to prepare ntla cmos with differing structures (8ah; figure 4 and table 1). In particular, we varied the length of the inhibitory mo (10, 12, 14, and 16 bases) and evaluated both blunt and staggered stemloops . Each ntla cmo was synthesized, purified by ion - exchange hplc, injected into one - cell - stage zebrafish embryos, and photoactivated as before, except that a dose of 230 fmol / embryo was evaluated in each case . This higher cmo concentration was used for these studies to maximize our ability to identify caged configurations with minimum basal activity . The leftmost panels show schematic representations of staggered (top) and blunt (bottom) cmo configurations (n = number of bases), and the other panels are distributions of phenotypes for each cmo configuration 8ah (see table 1 and figure 3) at a dose of 230 fmol / embryo . The resulting phenotypes confirmed that hairpin cmo activity varies significantly with inhibitor length and stemloop structure . Within a stemloop configuration, increasing the number of bases in the inhibitory oligomer decreased the cmo activity under both basal and photoactivated conditions . System failed to achieve an adequate activity differential between the caged and uncaged forms under any of the conditions we tested . As described above, cmo 8a still exhibited gene - silencing activity in its caged form, even though it successfully induced class - i phenotypes upon photoactivation . The other staggered cmos (8bd) had lower basal activities, but their uncaged forms failed to yield strong ntla mutant phenotypes . Stemloop design provided greater caging efficiency, and two cmos, 8e and 8f, exhibited dynamic ranges appropriate for conditional gene silencing: these two reagents did not induce mutant phenotypes in their caged forms, and photoactivation of the cmos yielded fully penetrant phenotypes in most embryos . Since our linker-1-based ntla cmo utilized the same inhibitory oligomer as the staggered reagent 8a,(7) these results underscore the importance of matching linker and stemloop structures for optimum cmo activity . To better understand how cmo structure dictates in vivo activity we first determined the binding energies for the ntla mo / rna duplex, each ntla mo / inhibitor heterodimer, and various stemloop structures . Thermal denaturation curves for the ntla mo / rna duplex and ntla mo / inhibitor heterodimers were acquired by mixing the ntla - targeting mo with the complementary oligomers in a 1:1 ratio and measuring their temperature - dependent changes in hypochromicity at 260 nm (figure 5 and tables 13). For these studies, we used the commercially available amine - functionalized ntla - targeting and inhibitory mo oligomers prior to their modification for cmo synthesis . The thermal denaturation curves were fit to a two - state oligomer binding model(31) to provide the corresponding g values at 28 c, the standard temperature for culturing zebrafish embryos . These analyses indicated that the binding free energy for ntla mo and its complementary 25-base rna is 28.1 kcal / mol, while binding free energies for the various ntla mo / inhibitor duplexes range from 10.7 to 16.2 kcal / mol . The g values for intermolecular ntla mo / inhibitor complexes correlated with the length and sequence content of the inhibitory mos, independent of the region of complementarity (corresponding to blunt vs staggered hairpins). To assess binding energies for ntla mo / inhibitor interactions within an intramolecular stemloop, we next conducted hypochromicity measurements of blunt and staggered ntla mo hairpins . Since the 260-nm absorbance measurements would photolyze the ntla cmos (8ah), we synthesized two ntla mo / inhibitor hairpins (8a and 8e) (scheme 2) using the bifunctional but nonphotolabile cross - linker 2b, which was prepared from 3-(methylamino)propan-1-ol (3b) in analogy to the dmnb - based reagent 2a (scheme 2). Derivation of the g values from these thermal denaturation curves using a hairpin - binding model(31) revealed that the intramolecular binding free energies of 8a and 8e were 4.9 and 6.9 kcal / mol, respectively (table 4). Representative thermal denaturation curves for mo duplexes corresponding to ntla cmos 8ah (ntla - targeting and inhibitory mos, 0.5 m each) and noncleavable hairpins 8a and 8e. Dimers of mo and inhibitory mo oligomers with 3 and 5 amine modifications, respectively . Melting temperature of the mo / inhibitor dimer . Predicted melting temperature according to eq 10, which is based upon the tm and g values for 8ah . Binding free energy of the dimer at 28 c . Tm and g values were determined from sigmoidal fits of the thermal denaturation curves using the non - self - complementary algorithm in meltwin 3.0b software . Dimers of 25-mer mo and rna oligomers . Binding free energy of the mo / rna dimer at 28 c . Melting temperature of the noncleavable mo hairpin . Binding free energy of the hairpin at 28 c . Tm and ghairpin values were determined from sigmoidal fits of the thermal denaturation curves using the hairpin algorithm in meltwin 3.0b software . Taken together, intermolecular ntla mo / inhibitor interactions with g values lower than 12 kcal / mol are required for low basal activities, and hairpins exhibit higher caging efficiencies than their staggered counterparts because of their greater stabilization of the intramolecular mo / inhibitor duplex (table 2 and figure 4). Surprisingly, the g values for the blunt and staggered ntla mo / inhibitor duplexes correlate with the inhibitor length and sequence in a similar manner, yet the activities of their corresponding ntla cmos upon photoactivation diverge . Ntla cmos 8e and 8f have g values of 12.3 and 13.5 kcal / mol, respectively, and activated forms of these cmos produce strong ntla mutant phenotypes . The other two blunt ntla cmos (8 g and 8h) have g values of 15.5 and 16.2 kcal / mol, respectively, and both induce only partial loss - of - function phenotypes upon linker photolysis . An in vitro ntla mo / inhibitor g value between 12 and 14 kcal / mol therefore represents the optimal balance of basal and induced activities for the blunt ntla cmos . However, the staggered ntla mos (8a and 8b) fail to induce full ntla mutant phenotypes after uncaging, even though their corresponding ntla mo / inhibitor duplexes have g values of 10.7 and 13.3 kcal / mol . Our original solid - phase - chemistry - derived ntla mo(7) and the staggered cmo 8a have identical targeting and inhibitory mo sequences, suggesting that linker elements may contribute to cmo activity after uncaging . In addition, the photolysis products of ntla cmos 8a and 8e are functionalized with linker substituents that are not present in the oligomers used in our binding energy measurements; the targeting mo liberated upon cmo activation is 3-functionalized with a 1,2,3-triazole and an aliphatic amine, while the inhibitory oligomer is 5-functionalized with an aliphatic chain and the dmnb - derived chromophore . We therefore irradiated 8a and 8e with 360-nm light and obtained thermal denaturation curves for the resulting ntla mo / inhibitor heterodimers . Analysis of the photolysis products by hplc confirmed that the two hairpin oligonucleotides are uncaged with comparable efficacies (75% conversion), and the g values for the resulting linker - functionalized ntla mo / inhibitor complexes are similar to those observed for their amine - functionalized counterparts (figure s1 and table s1 in the supporting information). Since we were unable to discern any thermodynamic differences between the intermolecular mo / inhibitor duplexes corresponding to 8a and 8e, we next interrogated whether rna strand exchange rates might account for their divergent activities in vivo . We incubated each ntla mo / inhibitor duplex with complementary 25-base rna for different lengths of time and resolved the resulting mo / rna duplexes by polyacrylamide gel electrophoresis (figure s2 in the supporting information). The rna exchange rates for the staggered and blunt mo / inhibitor duplexes were indistinguishable in this assay; mo / rna hybridization was complete in both cases within the time frame of rna addition . Thus, the activity differences between 8a and 8e cannot be explained by in vitro mo / inhibitor thermodynamics or kinetics alone, and the two cmos might exhibit divergent photolysis, inhibitor dissociation, or rna exchange rates in vivo . While the correlation between mo / inhibitor interaction strength and cmo activity provides qualitative guidelines for reagent design, a quantitative thermodynamic analysis is necessary to predict cmo efficacy with greater precision (figure 6). Prior to photolysis, cmos adopt open and closed states according to the equilibrium constant khairpin (eq 1): with the assumption that the total concentration of cmo prior to uncaging ([cmo]t) significantly exceeds that of its rna target ([rna]t), the basal level of rna bound by the nonphotolyzed cmo, given by ([cmoopenrna]/[rna]t), can be described as a function of [cmo]t, khairpin, and the dissociation constant for the mo / rna duplex (kdmorna) (eq 2): upon photoactivation, the fraction of rna complexed with the released targeting mo is a function of [cmo]t, kdmorna, and the dissociation constant for the mo / inhibitor complex (kdmoinh) (eqs 3 and 4): setting [cmo]t to a value of 4.6 m, which approximates the embryonic concentration of the ntla cmo (230 fmol / embryo, 50 nl embryonic volume at 5 hpf), and using our ntla cmo 8e data to establish g values of 28.1, 12.3, and 6.9 kcal / mol for the mo / rna duplex, intermolecular mo / inhibitor duplex, and intramolecular mo / inhibitor hairpin, respectively, led to the prediction that essentially all of the ntla rna is mo - complexed before and after cmo photolysis . This conclusion clearly deviates from the phenotypes we observed with ntla cmo 8e - injected embryos . Schematic representation of cmo / rna, mo / inhibitor (inh), and mo / rna equilibria . Since these predictions do not take into account the complexity of mo and rna interactions in live organisms, we sought to empirically derive the activity profiles of mos in vivo . We first investigated whether the relationship between ntla rna activity and total ntla mo concentration can still be described as a two - state equilibrium, even though the apparent equilibrium constant for in vivo mo / rna interactions (kappmorna, analogous to kdmorna in figure 6) would include contributions from oligonucleotide - binding proteins, rna secondary structure, and other embryonic factors . We injected the targeting mo into one - cell - stage zebrafish at doses of 0, 14, 28, 57, and 115 fmol / embryo (approximate final concentrations of 0, 0.28, 0.56, 1.1, and 2.3 m, respectively), lysed the embryos at 10 hpf, and then detected the ntla protein by quantitative immunoblotting (figure 7a). The ntla mo reduced the ntla protein levels in a dose - dependent manner that can be modeled as two - state thermodynamic interaction, with the fraction of wild - type rna activity remaining in mo - injected embryos (rnamoact / rnawtact) described as a function of total mo concentration ([mo]t) and kappmorna (figure 7b and eq 5): through this analysis, an apparent free - energy value (gappmorna) of 8.7 kcal / mol for embryonic ntla mo / rna interactions was obtained . (a) ntla protein knockdown in zebrafish embryos injected at the one - cell stage with various ntla mo doses . (b) these data can be modeled as a two - state equilibrium (solid line), yielding an apparent free energy value (gappmorna = 8.7 kcal / mol) that describes mo / rna interactions in live embryos . (c) ntla protein knockdown in embryos injected at the one - cell stage with ntla mo (115 fmol / embryo) and various doses of the 14-base inhibitory oligomer corresponding to ntla cmo 8 g . Ntla and -actin levels at 10 hpf were detected by immunoblotting and quantified as above . (d) modeling of the 8 g data in (c) as a three - state, competitive equilibrium (solid line) yields an apparent free - energy value (gappmoinh = 7.3 kcal / mol) that describes 8 g mo / inhibitor interactions in vivo . The graphical data are means of triplicate samples with error bars representing the standard deviations . It is important to note that this gappmorna value does not reflect the actual binding constant for the ntla mo / rna duplex in zebrafish embryos but instead is an aggregate descriptor of mo / rna affinity, rna accessibility, mo / protein interactions, and the influence of other embryonic factors on mo efficacy . Indeed, the 19.4 kcal / mol difference between gappmorna and the corresponding in vitro g value underscores how significant these other variables can be . Our empirical data, however, suggest that this thermodynamic description can have predictive value, even though it does not explicitly consider mo and rna interactions with other cellular components or possible kinetic contributions to in vivo function . Thus, mo - induced gene silencing can be modeled in these simplified thermodynamic terms . To determine whether cmo activity can also be modeled in simple thermodynamic terms, we next analyzed mo / inhibitor interactions in vivo . We injected zebrafish embryos with the ntla mo (115 fmol / embryo; 2.3 m) and various doses of the 14-base inhibitor corresponding to ntla cmo 8 g (0, 150, 450, and 1350 fmol / embryo; 0, 3, 9, and 27 m, respectively). The resulting ntla protein levels at 10 hpf were then quantified as before (figure 7c). The inhibitory oligomer repressed the ntla mo activity in a concentration - dependent manner that can be modeled as a three - state, competitive equilibrium involving mo, inhibitor, and rna interactions (figure 7d). The fraction of wild - type rna activity associated with each mo and inhibitor dose, rnamo, inhact / rnawtact, can be expressed as a function of the apparent equilibrium constant for mo / inhibitor interactions (kappmoinh; analogous to kdmoinh in figure 6), the total concentration of the inhibitory oligomer ([inh]t), and [mo]t (eqs 6 and 7): through this analysis, we derived an apparent gappmoinh value of 7.3 kcal / mol for 8 g mo / inhibitor interactions . As with the gappmorna value we determined for mo - dependent ntla silencing, this apparent free - energy value does not reflect the actual binding constant for the ntla mo / inhibitor duplex in vivo but instead integrates other interactions between these synthetic oligonucleotides and cellular components . Since the 8.2 kcal / mol difference between gappmoinh and the corresponding in vitro g value is significantly smaller than the 19.4 kcal / mol difference we observed for mo / rna interactions (see table 3 and figure 7b), cellular factors appear to impact rna activity to a greater extent than mo function . To assess the validity of modeling in vivo mo, rna, and inhibitor interactions in these simplified terms, we investigated whether the apparent gappmorna and gappmoinh values can be used to predict how cmo gene - silencing activity will be influenced by changes in inhibitor structure . As discussed above, the fraction of total rna activity inhibited by a complementary mo and the mitigating influence of an inhibitory oligomer can be described by eqs 57 . In the case of a cmo, [mo]t and [inh]t will be equal after photoactivation, and the fraction of wild - type rna activity remaining in the presence of photoactivated cmo (rnacmoact / rnawtact) is therefore a function of kappmorna, kappmoinh, and [cmo]t (eqs 8 and 9): in the case of our ntla cmo experiments shown in figure 4, kappmorna and [cmo]t can be approximated as 0.48 m (gappmorna = 8.7 kcal / mol) and 4.6 m, respectively . If it is assumed that blunt mo / inhibitor interactions generally exhibit a 8.2 kcal / mol difference between gappmoinh and the corresponding in vitro g, the kappmoinh values for mo / inhibitor interactions associated with ntla cmos 8e, 8f, 8 g, and 8h can be estimated as 1100, 140, 50, and 1.6 m, respectively . Using these parameters in the model described by eqs 8 and 9 leads to the prediction that ntla cmos 8e and 8f will be similar in efficacy to the conventional ntla mo, achieving at least a 90% knockdown of ntla protein expression levels (red lines in figure 8a, b). In contrast, ntla cmos 8 g and 8h are predicted to exhibit weaker efficacies at the same embryonic dose, since the inhibitory oligomer interacts more strongly with the targeting mo (red lines in figure 8c, d). Photoactivated cmos and mos inhibit their rna targets with different efficacies, which diverge as the mo / rna interaction strength decreases . Rna activity curves for mos and photoactivated cmos associated with in vivo mo / rna interaction energies of (red) 8.7 and (blue) 7.3 kcal / mol are shown for intermolecular mo / inhibitor interaction energies estimated for the blunt ntla cmos (a) 8e, (b) 8f, (c) 8 g, and (d) 8h, assuming complete uncaging upon irradiation photoactivated cmo and conventional mo activity profiles are drawn as solid and dashed colored lines, respectively . The embryonic ntla cmo concentration used in our structureactivity studies (see figure 4) is indicated in each panel by the vertical black line . Our observations in vivo match these predictions . Photoactivated 8e and 8f yielded the strongest mutant phenotypes of the ntla cmo configurations we tested . Moreover, the predicted efficacies of 8 g and 8h are consistent with their photoinduced phenotypes and the relationship between ntla rna activity and phenotypic class (compare figures 3b, 4, 7a, b, and 8c, d), especially considering that uv light penetrance and therefore cmo uncaging efficiencies in vivo will be attenuated to some degree . On the basis of our in vitro uncaging results (see figure s1 in the supporting information) and the observed phenotypes for irradiated ntla cmo - injected embryos, we estimate that our whole - organism irradiation procedure achieves cmo photoactivation yields of 5075% . Our model also predicts that cmo efficacy will be increasingly compromised as gappmorna increases (compare the blue and red lines in figure 8, which represent a 10-fold change in mo / rna interaction strength), since the concentration of photoactivated cmo required to achieve a given level of rna silencing increases in a manner disproportionate to that of a conventional mo . This latter issue is of particular importance because the mo doses required to induce mutant phenotypes vary significantly between genes, reflecting different rna activity thresholds for wild - type physiology and variable rna sequence accessibilities . In addition, mo doses greater than 1000 fmol / embryo (20 m) are generally avoided to minimize cytotoxicity . In contrast, the mo / inhibitor interaction strength associated with optimum cmo efficacy should not vary significantly between genes . The 25-base targeting mos are typically designed to avoid secondary structures, and they are not known to interact in a sequence - specific manner with dna- or rna - binding proteins . Rather, the binding free energies for the intra- and intermolecular mo / inhibitor duplexes dictate the fraction of targeting mo that is free to anneal to its rna target, thereby establishing the basal and photoinduced activities of a given cmo . Our findings suggest that cmos should have gappmoinh values of approximately 5 kcal / mol or greater for their corresponding intermolecular mo / inhibitor duplexes, as this interaction strength in vivo would allow efficient gene - silencing upon cmo photoactivation for a broad range of targeting mo potencies . Maximizing the cmo activity in this manner, however, is counterbalanced by the need to maintain the closed cmo hairpin state prior to photoactivation . In fact, the gappmoinh value of 4.1 kcal / mol predicted for ntla cmo 8e may represent the optimum thermodynamic parameter for cmo efficacy . Further attenuation of the mo / inhibitor interaction will eventually yield undesirable levels of basal activity, and a small fraction of embryos injected with the ntla cmo 8e exhibited weak mutant phenotypes without irradiation (see figure 4). Taken together, our results demonstrate that cmo activity can be modeled as a competitive three - state equilibrium, even though this approach does not explicitly consider how mo activity and rna accessibility are influenced by cellular proteins, rna structure, and other embryonic factors . Moreover, this analysis does not require the determination of actual mo / rna or mo / inhibitor binding affinities in whole embryos . We therefore sought to establish simple guidelines for the preparation of cmos targeting other genes and to empirically test their validity . Such design criteria would significantly advance the use of cmos in chemical and developmental biology research, especially considering the financial and time investments associated with these studies . The disparate efficacies of the two stemloop structures indicate that blunt cmo hairpins are preferable to staggered configurations, and within our series of blunt ntla cmos 8eh, in vitro mo / inhibitor g values between 12 and 14 kcal / mol yield an optimum balance between caged and uncaged activities . Our modeling of cmo activity in vivo further suggests that the higher mo / inhibitor g value associated with ntla cmo 8e should be preferred, since it would maximize the inducible gene - silencing activity over a broader range of targeting mo efficacies . This binding energy corresponds to a duplex melting temperature of 45 c (see figure 5 and table 2). To facilitate the design of thermodynamically equivalent cmos against other genes, we first determined the relationship between mo duplex sequence and thermal stability . By multiple - regression analysis of the ntla mo / inhibitor pairs listed in table 2, we determined that the melting temperature of mo duplexes (tmmo, in c) is correlated with sequence content according to eq 10 and can be empirically related to its in vitro g value (in kcal / mol at 28 c) by eq 11: in eq 10, each nj (j = a, t, g, c) is the number of times the corresponding base appears in the mo sequence . Using this equation, one can identify an appropriate inhibitor for a given targeting mo, which ideally would generate a blunt this empirically derived algorithm should be most accurate with mo duplexes similar in length to those in this study, since it does not take into account the contribution of nearest - neighbor effects . We next tested the validity of our design criteria by targeting four other zebrafish genes: heg, flh, etv2, and spadetail / tbx16 (spt). The transmembrane protein heg is expressed in the endocardium during embryogenesis, mediating a signal that is required for concentric growth of the heart. (24) embryos lacking heg function exhibit abnormally large heart chambers with walls that are only one cell thick and therefore incapable of sustaining blood circulation . These defects are apparent by 2 dpf and can be recapitulated with the heg - targeting mo (5-gtaatcgtacttgcagcaggtgaca-3) at doses of 230 fmol / embryo (4.6 m) or higher (79%, n = 48). By 4 dpf, heg mutants and morphants exhibit severe cardiac edema (figure 9a). To generate a heg cmo (9a), we conjugated the targeting mo to an inhibitory oligomer 5-caagtacgattac-3 using linker 2a (tables 13). We then injected wild - type zebrafish embryos with 9a at the one - cell stage (460 fmol / embryo; 9.2 m) and either irradiated the embryos with 360-nm light at 2 hpf or cultured them in the dark . By 4 dpf, the irradiated embryos had no blood circulation and exhibited cardiac edema (86%, n = 21), while the nonirradiated zebrafish had normal cardiac patterning and function (98%, n = 44) (figure 9b, c and figure s3 in the supporting information). To further test the predictive value of our cmo design criteria, we evaluated two additional heg cmos: one contained a staggered inhibitor (9b; inhibitor sequence 5-gctgcaagtac-3) with an intermolecular mo / inhibitor g value comparable to that for 9a, and the other contained a shorter blunt inhibitor (9c; inhibitor sequence 5-gtacgattac-3) with a weaker mo / inhibitor interaction strength (tables 1 and 2). In comparison to 9a, these alternative heg cmos were less effective in vivo . The majority of zebrafish embryos injected with an equivalent dose of either 9b or 9c exhibited heg mutant phenotypes in the absence of irradiation (9b: 66%, n = 53; 9c: 62%, n = 45), indicating that these structural configurations do not adequately cage the mo activity (figure s3). Thus, the design parameters established through our ntla cmo structureactivity relationship studies are transferable to other genes . (a) embryos injected with a conventional heg mo recapitulate heg mutant phenotypes, including enlarged heart chambers, no blood circulation, and cardiac edema . (b, c) embryos injected with heg cmo 9a exhibit heg mutant phenotypes upon photoactivation . (d) embryos injected with a conventional flh mo recapitulate flh mutant phenotypes, including notochord ablation and somite fusion through the trunk midline . (e, f) embryos injected with flh cmo 10 exhibit flh mutant phenotypes upon photoactivation . (g) embryos injected with a conventional spt mo recapitulate spt mutant phenotypes, including a loss of trunk somitic tissue and mislocalized mesodermal progenitors in the posterior (spadetail morphology). (h, i) embryos injected with spt cmo 12 exhibit partial spt mutant phenotypes upon photoactivation . Developmental stages: (ac) 4 dpf; (df, gi) 1 dpf . Scale bars: (ac) 400 m; (df, gi) 200 m . The flh homeobox transcription factor is coexpressed with ntla in the zebrafish mesoderm, and loss of flh expression also causes ablation of the notochord . However, mesodermal progenitors normally fated to become the notochord do not transform into medial floor plate cells in flh mutants; rather, these populations differentiate into ectopic muscle to create fused somites . Since no flh - targeting mo had yet been described, we first identified a flh - blocking oligonucleotide (5-gggaatctgcatggcgtctgtttag-3) and demonstrated its efficacy in zebrafish embryos (figure 9d). This antisense reagent is a potent inhibitor of flh function, and a dose of 60 fmol / embryo (1.2 m) is sufficient to cause replacement of the notochord with axial muscle cells in 1 dpf zebrafish (89%, n = 19). On the basis of our cmo design criteria, we synthesized a hairpin flh cmo (10) using linker 2a and a 5-gcagattccc-3 oligomer as the mo inhibitor (tables 13). Wild - type zebrafish were injected at the one - cell stage with 10 at a dose of 100 fmol / embryo (2 m) and either globally irradiated with 360-nm light for 10 s at 2 hpf or cultured in the dark . As expected, the majority of nonirradiated flh cmo - injected embryos developed normally (89%, n = 28), while the irradiated embryos lacked a notochord and had fused somites (100%, n = 11), matching the mutant phenotype (figure 9e, f). The etv2 transcription factor is expressed in the lateral mesoderm during early somitogenesis and then in vascular endothelial cells of the axial, head, and intersomitic vessels. (26) it is believed that these early etv2-expressing cells are endothelial precursors, and etv2 mutants or embryos injected with an etv2-blocking mo (5-cactgagtccttatttcactatatc-3) exhibit disrupted blood - vessel formation and lack circulation. (26) mo doses of 115 fmol / embryo (2.3 m) or higher are sufficient to induce a fully penetrant mutant phenotype (data not shown). We therefore synthesized a hairpin etv2 cmo (11) containing a 5-ggactcagtg-3 inhibitory oligomer and injected it into wild - type zebrafish at the one - cell stage (230 fmol / embryo; 4.6 m) (tables 13). Embryos then irradiated with 360 nm light for 10 s at 3 hpf had limited or no blood circulation by 2.5 dpf (100%, n = 12; see supplementary movie 1 in the supporting information), but most of the etv2 cmo - injected embryos cultured in the dark exhibited normal blood flow (87%, n = 15; see supplementary movie 2 in the supporting information). Finally, we designed and synthesized a cmo targeting spt, which is another mesodermal t - box transcription factor . The ntla and spt genes are expressed in overlapping domains during early embryogenesis and then become restricted to the axial and paraxial mesoderm, respectively . Cells with ntla function become the notochord, while the spt - expressing cells contribute to the skeletal muscle in the flanking somites . A loss of spt function therefore causes a severe deficit in trunk somitic mesoderm as well as a gross mislocalization of the corresponding progenitor cells to posterior regions (hence the spadetail these phenotypes can be recapitulated with a spt - targeting mo 12 (5-gcttgaggtctctgatagcctgcat-3)(34) at doses of 345 fmol / embryo (6.9 m) or higher (61%, n = 23) (figure 9 g). As with the other cmos described above, we prepared the corresponding spt cmo hairpin using linker 2a and the inhibitory oligomer 5-gacctcaagc-3 (tables 13). Wild - type embryos at the one - cell stage were injected with 12, and a subset was globally irradiated with 360 nm light for 10 s at 2 hpf . The majority of embryos cultured in the dark developed normally (87%, n = 24). Zebrafish injected with a dose of 700 fmol / embryo (14 m) exhibited a loss of trunk mesoderm but not posteriorly mislocalized progenitor cells upon cmo photoactivation (31%, n = 16) and also showed nonspecific developmental defects due to general mo toxicity (62%, n = 16) (figure 9h, i). These phenotypes indicate that the photoactivated spt cmo 12 is not able to fully recapitulate the activity of the conventional mo and that this reagent also exhibits greater nonspecific toxicity . Thus, although our design criteria were successful for cmos targeting ntla, heg, flh, and etv2, there can be unforeseen mo or inhibitor interactions with embryonic factors that reduce cmo efficacy in certain situations . In the case of the spt cmo, one possibility is that a 700 fmol / embryo dose of the 35-base reagent approaches the toxicity level of a 1000 fmol / embryo dose of the conventional 25-base mo . To conclude our studies, we investigated the ability of our hairpin cmo design to incorporate other photocleavable groups . While nitrobenzyl - based chromophores such as the dmnb group in our ntla, flh, heg, etv2, and spt cmos have been widely used in biological applications, the uv light required for their photolysis is potentially damaging and difficult to restrict in three - dimensional space . Two - photon excitation typically uses wavelengths greater than 700 nm and affords greater spatial resolution, but the dmnb group and most other caging moieties have small two - photon cross sections and are therefore inefficiently cleaved under these conditions . Two notable exceptions are the bromohydroxycoumarin (bhc)(23) and bromohydroxyquinoline (bhq)(27) groups . Since the low fluorescence of bhq chromophores makes them particularly useful for biological applications, we designed a bhq - based bifunctional cross - linker (13, scheme 3) for the preparation of cmos . As with our dmnb - based linker 2a, this two - photon - sensitive linker incorporates an n - hydroxysuccinimide ester and a terminal alkyne to enable orthogonal coupling to appropriately modified mo oligomers . Reagents and conditions: (a) benzenesulfonyl chloride, dipea, ch2cl2, 97%; (b) seo2, dioxane, 80 c, 91%; (c) in powder, allyl bromide, nh4cl(aq), thf, 96%; (d) k2oso42h2o, lutidine, dioxane, h2o, then naio4, 75%; (e) methylamine(aq), nabh(oac)3, meoh, h2o, 81%; (f) methyl adipoyl chloride, dipea, ch2cl2, 59%; (g) carbonyldiimidazole, dmf then 6-amino - n-(prop-2-ynyl)hexanamide, dipea, dmf, 81%; (h) 0.2 m naoh(aq), thf, meoh, 82%; (i) n - hydroxysuccinimide, edci, dmf, 48% . To synthesize linker 13, we first prepared bhq derivative 14 as previously described(27) and then protected its phenolic hydroxyl group with a benzenesulfonyl moiety to give 15 . The 2-methyl group of 15 was then oxidized with selenium dioxide, and the resulting aldehyde 16 was allylated to give alcohol 17 . Oxidative cleavage of 17 yielded aldehyde 18,(35) which was reductively aminated with aqueous methylamine in the presence of nabh(oac)3 to give the amino alcohol intermediate 19 . In analogy to scheme 1, compound 19 was acylated to form the amide 20, and 1,1-carbonyldiimidazole - mediated coupling of this product with 6-amino - n-(prop-2-ynyl)hexanamide afforded carbamate 21 . Phenol deprotection and ester saponification of 21 were simultaneously accomplished with 0.2 m naoh to give an acid intermediate, which was re - esterified with n - hydroxysuccinimide in the presence of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide to give the two - photon - sensitive linker 13 . The bifunctional linker was then used to assemble fluorescein - conjugated and nonfluorescent ntla cmos (22a and 22b, respectively; chart 2) using the corresponding inhibitory oligomers (23a and 23b), which are analogous to that in the optimum dmnb - containing ntla cmo 8e (figure 4 and table 1). Since the bhq group has not been used previously with carbamates and other bhq - caged compounds have not been tested in cultured cells or live organisms, we first determined whether the bhq carbamate is stable in vivo and can be efficiently photolyzed . We injected ntla cmo 22a into wild - type zebrafish embryos at the one - cell stage (230 fmol / embryo) and irradiated a subset of them with 360-nm light for 10 s at 3 hpf . The embryos were then cultured for another day and scored according to the four phenotypic classes described above . As we hoped, the bhq - based ntla cmo exhibited activity essentially identical to that of the dmnb - based reagent 8e; embryos injected with this reagent developed normally when cultured in the dark but displayed a ntla phenotype upon irradiation (figure s4 in the supporting information). We then examined whether the bhq - based ntla cmo 22b could be activated in targeted regions of the zebrafish embryo using two - photon excitation . These experiments followed studies conducted previously in our laboratory, in which we uncaged a dmnb - based ntla cmo in a subset of mesodermal progenitor cells, selectively inducing them to differentiate into medial floor plate cells rather than the notochord. (7) to identify the irradiated cells in this earlier investigation, we coinjected the zebrafish embryos with mrna encoding kaede fluorescent protein, which undergoes a green - to - red photoconversion upon one - photon excitation . Because kaede is inefficiently converted by two - photon excitation, we utilized a caged coumarin fluorophore conjugated to dextran (dextranhcc - npe) as a cell - autonomous photoactivatable tracer (figure s5 in the supporting information). This new class of caged coumarins is highly sensitive to two - photon irradiation, and dextranhcc - npe has demonstrated efficacy in vivo. (38) we injected dextranhcc - npe into one - cell - stage embryos with either the bhq - based ntla cmo 22b or the bhq - conjugated inhibitory oligomer 23b . An 80 m 60 m 50 m region of the posterior, axial mesoderm at the end of gastrulation was then subjected to two - photon irradiation for 2 min (figure 10ad). These cells normally differentiate into vacuolated notochord cells by 1 dpf, and the embryos injected with the coumarin tracer and bhq - functionalized ntla mo inhibitor 23b contained a cluster of blue - fluorescent notochord cells toward the end of the yolk extension (figure 10a, e). In contrast, embryos injected with both the photoactivatable tracer and ntla cmo 22b exhibited medial floor plate cells with blue fluorescence and few, if any, fluorescently labeled notochord cells (figure 10f). These observations confirm the sensitivity of the bhq - based reagent to two - photon photolysis and illustrate the versatility of the hairpin cmo architecture . (a) schematic representation of embryos injected with the dextranhcc - npe photoactivatable tracer and then two - photon - irradiated within the posterior axial mesoderm at the 10 hpf stage (red square, dorsal view). By 1 dpf, these irradiated cells normally differentiate into vacuolated notochord cells (red rectangle, lateral view) toward the end of the yolk extension . (b) ir gradient contrast image of the posterior axial mesoderm with the targeted irradiation area indicated by the dashed red box (dorsal view). (c) fluorescent image of the same region prior to irradiation (excitation, 820 nm; emission, 525/70 nm). (d) fluorescent image post - irradiation (same conditions as in c). (e) embryos injected with the dextranhcc - npe and oligomer 23b contained a cluster of blue - fluorescent notochord (nc) cells by 1 dpf (lateral view; excitation, 436/20 nm; emission, 480/40 nm). (f) embryos injected with dextranhcc - npe and ntla cmo 22b exhibited medial floor plate (mfp) cells with blue fluorescence and few fluorescently labeled notochord cells (same conditions as in e). Photoactivatable mos are valuable probes of embryonic patterning mechanisms, and their implementation by the developmental biology community will require efficient synthetic procedures and general principles for cmo design . To advance these goals, we have devised a bifunctional linker for the synthesis of hairpin cmos that enables these probes to be prepared in three steps from commercially available reagents . This optimized synthetic procedure has enabled us to prepare several ntla - targeting cmos of differing configurations, and we have used these structural variants to determine how the thermodynamic properties of cmos correlate with their in vivo functions . Our studies reveal that hairpin cmo function is highly dependent on the sequence and location of the complementary inhibitor as well as the linker structure . We further observed that mo / mo and mo / rna binding free energies in vitro differ dramatically from the apparent free energies of their functional interactions in vivo, undoubtedly reflecting the influence of oligonucleotide - binding proteins, rna secondary structure, and other embryonic factors . Although the apparent free - energy values obtained through our in vivo studies cannot accurately describe the true mo and rna binding affinities in zebrafish embryos, our findings demonstrate that these thermodynamic descriptors can be used to predict mo efficacy . Thus, cmo activity in vivo can be modeled as a competitive three - state equilibrium, and the complex interactions between mos and embryonic factors can be treated as an aggregate phenomenon . Our findings establish a metric for cmo design, which we have successfully applied to cmos that target the flh, heg, and etv2 genes, and these empirically derived principles will help guide future applications of cmos in functional genomic studies . Our insights should also be applicable to other caged hairpin reagents, including those based upon ncpnas and 2-o - methyl rnas. (22) although these oligonucleotide analogues interact with complementary oligomers with distinct in vitro and in vivo free energy values, their design and biological application are subject to the same principles outlined in this study . As illustrated by the partial phenotypes we observed with our spt cmo, however, the activity of caged hairpin oligonucleotides can be attenuated in vivo through mechanisms that are not yet understood . We anticipate that our guidelines for cmo design will become more refined as this chemical technology is more broadly utilized in embryological research . Finally, the modularity of our hairpin cmos provides an opportunity for future improvements to this technology, as illustrated by our development of a bhq - based cmo that is compatible with two - photon excitation . For example, linkers that minimize the entropic loss associated with stemloop formation could increase the energetic difference between inter- and intramolecular mo / inhibitor duplexes, thereby improving the dynamic range of basal and photoinduced activities . Alternative approaches might involve incorporating the photocleavable bond within the inhibitory oligomer or caging the mo with two short complementary oligomers rather than one long inhibitor . Investigating these possibilities through organic synthesis will expand the utility of cmo technologies and help shed new light on the molecular mechanisms of embryonic development . All of the reactions were carried out in flame - dried glassware under an argon atmosphere using commercial reagents without further purification, unless otherwise indicated . Reactions were magnetically stirred and monitored by thin - layer chromatography (tlc) using glass - backed silica gel 60f254 (merck, 250 m thickness). Sio2 chromatography was carried out with em science silica gel (60, 70230 mesh) as a stationary phase . H nmr and c nmr spectra were acquired on varian 300, 400, and 500 mhz spectrometers and standardized to the nmr solvent peak . Electrospray mass spectrometry (esi - ms) was performed using a micromass zq single - quadrupole liquid chromatographmass spectrometer (lcms) and a micromass q - tof hybrid quadrupole lcms . An mo oligomer (5-gcctcaagtc-3) with 5-amine and 3-fluorescein modifications was purchased from gene - tools, llc and used without further purification . This oligomer (100 nmol) was dissolved in borate buffer [0.1 m na2b4o7 (ph 8.5), 100 l] and combined with linker 2a (0.76 mg, 1.5 mol) in dmso (15 l). The resulting yellow gum was dissolved in water (0.5 ml), washed three times with chcl3 (0.5 ml), and diluted to 1.5 ml with water . The yellow solution was loaded onto toyopearl super - q resin (400 l), washed three times with wash solution [aqueous 2.5 mm na2b4o7 (ph 8.5), 50% acetonitrile (acn)] and two times with water . Fluoresceinated oligomers were eluted from the resin with 600 l of aqueous 5% hoac/50% acn, washed three times with chcl3 (0.6 ml), and neutralized with 10% nh4oh(aq) (0.3 ml). Solvent was removed in vacuo, and the remaining nh4oac was removed by repeated aqueous solubilization and lyophilization, affording 7e as a yellow solid (70 nmol, 70%). Ms - esi for 7e [m + h] (m / z): calcd for c184h264n69o61p10, 4728; found, 4728 . The inhibitory oligomer 7e (50 nmol) and azide - functionalized ntla mo(7)6 (50 nmol) were dissolved in phosphate buffer [kh2po4 (ph 8.0), 230 l]. To this mixture was added sodium ascorbate (99.0 g, 500 nmol) in 25 l of water followed by tbta (265 g, 500 nmol) and cui (95.2 g, 500 nmol) in 50 l of dmso . The reaction mixture was briefly sonicated and then stirred overnight at room temperature in the dark . Precipitate was removed from the reaction mixture by centrifugation, and the supernatant was split and desalted over two zeba desalt size - exclusion columns (pierce) according to the manufacturer s instructions . The desired product was purified from the reaction mixture by adjusting the solution ph to 11.5 with 1 m naoh(aq) and loading it onto a dnapac pa-100 ion - exchange hplc column (dionex, 9 mm 250 mm). Aqueous running buffers were (a) 0.02 m naoh, 1% acn and (b) 0.375 m naclo4 in 0.02 m naoh and 1% acn . A stepwise gradient was used to separate the product and starting materials, with specific conditions determined by column capacity . A representative purification gradient was the following: 7 to 19% b in 5 min, 19 to 22% b in 10 min, 22 to 50% b in 1 min, and 50% b for 9 min (flow rate 4 ml / min). Elution fractions were collected with the uvvis flow - cell lamp turned off to prevent photolysis . Fractions (1 ml) were collected every 15 s and buffered with 1 m nh4oac(aq) (ph 5.0) (40 l). The fractions containing fluoresceinated product were combined and desalted over a zeba size - exclusion column . The eluent volume was reduced in vacuo to 50 l, and the cmos were precipitated with acetone (400 l). After centrifugation, the supernatant was discarded, and the cmo pellet was washed with acn (100 l) and briefly lyophilized, affording 8e as a yellow solid (7 nmol, 14%). Ms - esi for 8e [m + h] (m / z): calcd for c488h737n219o164p35, 13379; found, 13380 . Adult zebrafish (wild - type ab strain) were acquired from the zebrafish international resource center . Embryos used in these studies were obtained by natural matings and cultured in e3 embryo medium at 28.5 c according to standard procedures. (39) various mo, mo / inhibitor duplex, and cmo solutions containing 0.1% (w / v) phenol red were prepared and microinjected at 1 or 2 nl / embryo . For example, to inject 115 fmol of mo, 2 nl of a 57.5 m solution containing 0.1% (w / v) phenol red was injected into each zebrafish embryo at the one - cell stage . All embryo injections were done according to standard procedures, and the embryos were subsequently cultured in e3 medium at 28.5 c . For two - photon experiments, solutions containing 1.25 mm dextranhcc - npe and 0.1% (w / v) phenol red with or without 57.5 m cmo 22b were injected at 2 nl / embryo . Photolysis reactions were performed by dissolving 1 nmol of cmo hairpin in water (2 l) and irradiating for 1 min using a leica dm4500b compound microscope equipped with an a4 filter cube (ex: 360 nm, 40 nm bandpass) and a 20 water - immersion objective (0.50 na, 13 mw / cm intensity at 360 nm). The solutions were then adjusted to ph 11.5 with 0.02 m naoh and analyzed by hplc using a dnapac pa-200 ion - exchange column (dionex, 4 mm 250 mm). Aqueous running buffers were (a) 0.02 m naoh, 1% acn and (b) 0.375 m naclo4 in 0.02 m naoh and 1% acn . The hplc gradient was 7 to 50% b in 27 min at 1.2 ml / min . Zebrafish embryos between the 64- and 256-cell stages were arrayed in an agarose microinjection template . Mercury lamp light was focused onto the individual embryos for 10 s using a leica dm4500b compound microscope equipped with an a4 filtercube and a 20 water - immersion objective . Two - photon cmo photoactivation in zebrafish embryos was performed on an upright two - photon confocal microscope (ultima xy, prairie technologies, inc ., middleton, wi) equipped with two ti: sapphire lasers (mai tai hp, spectra physics, mountain view, ca) and a 40 (0.8 na) water - immersion objective (lumplanfl / ir, olympus america, center valley, pa). The 820-nm illumination from the first laser (10 mw at the back focal plane of the objective) was used to collect two initial images for each embryo: an epifluorescence image (bandpass: 525 nm center, 70 nm fwhm) and an ir gradient contrast image (820-nm illumination). (40) using the gradient contrast image, an 80 m 60 m 50 m region of interest (roi) was selected for photoactivation . The roi was then illuminated for 2 min at 750 nm (65 mw at the back focal plane of the objective) with the second laser . Following photoactivation, the embryo was reimaged with 820-nm illumination . Following two - photon irradiation, chorions were manually removed from 1 dpf embryos, which were immobilized in e3 medium containing 0.7% (w / v) low - melt agarose and 0.05% (w / v) tricaine . Bright - field images were obtained at 5 with a leica mzfliii fluorescence stereoscope equipped with a leica dc300f digital camera . Differential interference contrast images and time - lapse movies were obtained with a leica dm4500b fluorescence microscope equipped with a 10 (0.25 na) objective and a qimaging retiga - srv digital camera . Fluorescence images were also obtained with this equipment and a cfp filterset (excitation, 436/20 nm; emission, 480/40 nm). For intermolecular mo duplexes, the complementary oligomers (0.5 m, 1:1 molar ratio) in buffer [100 mm kcl, 20 mm hepes, 10 mm mgcl2, 0.1 mm edta (ph 7.0), 1 ml] were denatured at 95 c for 5 min . Thermal denaturation curves were obtained by monitoring temperature - dependent changes in the absorbance of 260-nm light using a varian cary 300 spectrophotometer (annealing at 0.5 c / min). The hypochromicity curves were fitted to a sigmoidal function, and thermodynamic parameters were calculated using the non - self - complementary algorithm in meltwin 3.0b software . For intermolecular mo / rna duplexes, the complementary mo and rna oligomers were used in a 2:1 molar ratio to minimize hypochromicity changes due to rna self - annealing . For intramolecular duplexes, thermodynamic parameters were calculated using the hairpin algorithm in meltwin 3.0b software . At bud stage (10 hpf), wild - type and mo - injected embryos were dechorinated with pronase (1 mg / ml) for 10 min at 28 c . The embryos were transferred to microcentrifuge tubes and homogenized with a pipet in tm1 buffer [180 l / sample; 100 mm nacl, 5 mm kcl, 5 mm hepes (ph 7.0), 1% (w / v) peg-20000] containing protease inhibitors [1 mm pmsf, 5 mg / ml complete mini protease inhibitor cocktail, edta - free (roche)] to remove yolks . Following centrifugation (500 g, 5 min, 4 c), the tm1 solution was replaced, and the pelleted cells were homogenized again with a pipet and recentrifuged . Eighteen deyolked embryos from each set of experimental conditions were vortexed in sds - page loading buffer [50 l / sample; 100 mm tris - hcl (ph 6.8), 330 mm 2-mercaptoethanol, 4% (w / v) sds, 20% (v / v) glycerol, 100 mm dtt], sonicated for 1 min, and heated to 100 c for 5 min . The lysates were resolved on a 412% bis - tris gradient acrylamide gel (five embryos / lane) and blotted onto nitrocellulose according to standard protocols . Anti - ntla antibody was used at a 1:2000 dilution in 1 phosphate - buffered saline containing 0.1% (v / v) tween 20 and 0.2% (w / v) i - block (roche). The anti - ntla antibody was then detected using a horseradish peroxidase - conjugated anti - rabbit igg antibodies (ge) at 1:10000 dilution and the supersignal west dura extended duration substrate kit (pierce) according to the manufacturer s instructions . The chemiluminescence from the membrane was digitally imaged (chemidoc xrs, biorad), and the band intensity was measured with quantity one 4.5 software . The nitrocellulose membranes were then reprobed with mouse anti--actin [sc-8432 (santa cruz biotechnology) at a 1:250 dilution or clone ac-15 (sigma) at a 1:10000 dilution] and horseradish peroxidase - conjugated anti - mouse igg antibodies (ge) at 1:10000 dilution to normalize for loading differences between lanes . Targeting and inhibitory oligomers corresponding to ntla cmos 8a and 8e (5 m, 1:1 molar ratio) in buffer [100 mm kcl, 20 mm hepes, 10 mm mgcl2, 0.1 mm edta (ph 7.0), 28 l] were denatured at 95 c for 2 min and annealed by cooling to 28 c over 15 min . The complementary, 3-fluoresceinated 25-base rna (3 m in the above buffer, 2 l) was then added to the annealed mo duplex solution to achieve a final rna concentration of 0.2 m . The mixture of oligomers was incubated at 28 c for either 1 or 10 min and then chilled to 4 c on ice . Sample was prepared by adding the rna to the annealed mo duplex solution at 4 c, and the mo / rna duplex was prepared by heat denaturation and annealing, as was done for the mo / inhibitor duplexes . All of the samples were then immediately mixed with chilled loading dye [6 stock: 60% glycerol, 0.1 m tris - hcl, 90 mm boric acid, 1 mm edta, 0.9 mm xylene cyanol (ph 8.4)] and resolved on a 15% tris - borateedta acrylamide gel at 200 v for 20 min at 4 c . After electrophoresis, the acrylamide gel was analyzed with a ge typhoon imager (488 nm excitation, 580 nm emission).
|
Complex regional pain syndrome (crps) is a chronic condition characterized by severe pain and motor, sensory, autonomic, and trophic disturbances 1, 2, 3, 4, 5 . The severity of symptoms associated with crps is unrelated to the severity of the trauma that caused the condition 1, 3, 4, 6 . The classic presentation of crps is an exaggerated burning pain, although the pain also has been described as deep pain, provoked by light touch or movement, or similar to an electric shock 2 . Other symptoms include changes in skin temperature and color, edema, sudomotor dysfunction, and tropic changes in nails and bone 2, 3, 4, 6 . Motor disturbances include muscle weakness and wasting, impaired voluntary movements, tremors, and dystonic postures or movements 2, 3, 6 . The onset of crps type i symptoms, also known as reflex sympathetic dystrophy, typically follows trauma to a limb or lesions in remote body areas 1, 4 . The precipitating traumatic event can be minor, such as a sprain or bruise, or major, such as a bone fracture, surgery, or major coronary event 1 . Symptoms tend to spread to areas of the limb beyond the site of injury or the anatomical distribution of a nerve 1, 2, 3, 6 . In crps type ii, also known as causalgia, injury to a specific major peripheral nerve or one of its major branches is the precipitating event that precedes the onset of symptoms 1, 3, 4 . Areas of pain associated with crps type ii may or may not correspond to the anatomic distribution of a peripheral nerve 3 . Currently, no single diagnostic test is used to confirm crps; rather, diagnosis is based on the patient history, physical examination, and differentiation from other possible causes 7 . The underlying pathophysiology of crps is not completely understood, and a number of models have been proposed to describe its etiology 8 . Thus, crps treatment is empirical and varies widely 4, 8, 9; in fact, no definitive treatment exists, and no drug has been approved by the us food and drug administration (fda) for the treatment of crps 7, 8 . In the most recently published treatment guidelines for crps type i, a multidisciplinary task force from the netherlands reviewed the evidence for various treatments and concluded that additional research into therapeutic interventions was needed 10 . Typically, treatment should be initiated early in the course of disease with an individualized, multidisciplinary approach that includes pharmacologic, interventional, and physiotherapeutic measures to achieve pain relief and restore daily functioning [1, 3, 4, 5, 8, 9]. It has been hypothesized that the sympathetic nervous system is involved in the pathophysiology of crps in some patients 1, 4, 6, 8 . Therefore, interruption of the sympathetic supply to the painful area is one treatment approach used for crps 1, 4, 6, 11 . The use of nerve blocks not only may aid in diagnosis but also may be effective therapy in cases of allodynia, burning pain, and temperature and color changes that do not respond to pain medication and hinder progress during physical or occupational therapy 1, 4, 5, 12 . Stellate ganglion block (sgb) is the blockade of the sympathetic ganglia in the lower cervical and upper thoracic region 12 . Crps treatment with sgb is a wellestablished method of nerve blockade 12, 13, but there is no defined protocol for selecting appropriate candidates for this procedure 4 . Spinal cord stimulation and peripheral nerve stimulation may be offered when the response to nerve blocks is shortlived and rehabilitation fails to produce improvement 4 . Destructive interventions, such as surgical, chemical, or radiofrequency sympathectomy, are also used for treatment of crps 11; however, sympathectomy is a controversial approach to treatment because of the possibility of the return of pain, potential for nonresponse or development of new pain syndromes following the procedure, and potential for other complications 5, 11, 12, 14 . Some investigators have recommended that sympathectomy be performed for crps only after a spinal cord stimulation trial or nerve block 5, 12 . Liposome bupivacaine (bupivacaine liposome injectable suspension; exparel, pacira pharmaceuticals, inc ., parsippany, nj) is a multivesicular formulation of bupivacaine indicated for singledose administration into the surgical site to produce postsurgical analgesia 15 . Although liposome bupivacaine has been studied in a number of surgical settings 16, 17, 18, 19, 20, its use in sgb has not yet been reported . This case report describes the successful offlabel use of liposome bupivacaine in sgb for refractory pain associated with crps . A 28yearold female nurse presented to the clinic 3 months after a jobrelated injury that occurred at the longterm care facility where she worked . She described the pain in her left arm, wrist, and hand as a severe, sharp, cuttingtype pain, with cramping and numbness, which was consistent with crps . The diagnostic performance of triplephase bone scan is variable and may produce falsenegative findings, even in the presence of crps 21, 22 . The pain was most severe in the left wrist and forearm, with hypersensitivity and allodynia from the left elbow to the fingertips . Pain and contracture had spread throughout the left arm, from the fingertips to the nape of the neck, and significant guarding of the left arm was observed . The left upper extremity was warmer, had increased pallor, and had more limited range of motion than the right upper extremity . Full flexion and extension at the elbow and abduction at the shoulder were partially restricted; flexion contracture prevented extension of the fingers without pain, except during some occupational therapy sessions . The use of neuropathic pain agents, including tramadol hcl 50 mg, celecoxib 200 mg, and gabapentin 600 mg, provided slight relief and occupational therapy provided moderate relief . The patient agreed to a multicomponent treatment plan of increasing the gabapentin dosage to 800 mg four times per day, continuing occupational therapy, and undergoing a series of left sgbs . The frequency of injections was based on approval of medical treatment related to workers' compensation insurance . A left sgb with 0.5 ml bupivacaine hcl 0.5% and 0.5 ml of lidocaine 2% was performed during her first office visit . The patient tolerated the procedure well and reported significantly less joint stiffness during the therapeutic window of the block . Two more left sgbs were performed, one at 9 days after the first block (0.75 ml of bupivacaine hcl 0.5% and 0.75 ml of lidocaine 2%) and the other 26 days later (1 ml of bupivacaine hcl 0.5% and 1 ml of lidocaine 1%). These procedures also were well tolerated, and joint stiffness was reduced, but pain returned within 1 week after each injection . The patient then agreed to a spinal cord stimulator trial and then implantation of a permanent stimulator . However, the patient experienced a devicerelated infection that required removal of the spinal cord stimulator . The patient subsequently underwent five more left sgbs, spaced 7 weeks, 16 weeks, 3 weeks, and 1 week apart . The injection schedule was based on workers' compensation insurance approval, the fact that the sgb treatment plan was interrupted by a trial spinal cord stimulation, and the need to adjust medications during her treatment . The injections consisted of bupivacaine hcl 0.5% (1.55.0 ml) with or without 2 ml of lidocaine 2% . As before, pain relief lasted approximately 1 week after each sgb procedure . Fifteen weeks after the last sgb, the patient presented with severe pain (10 out of 10 on a visual analog scale) in her left shoulder, arm, and hand . She had experienced extensive burning pain lasting a few minutes, followed by tingling lasting approximately 1 min and then numbness . She noted that, overall, her pain was progressively worsening but was somewhat alleviated by pain medication . Her left arm had a limited range of motion and severe tenderness, and was cooler and edematous compared with her right arm . About 4 months later, she received authorization for a left sgb with liposome bupivacaine . During the procedure, liposome bupivacaine 13.3 mg (1 ml) the treatment goal was to replicate a sympathectomy, for which she was awaiting approval from her insurance provider . At her next followup visit, she reported that she had experienced 3 weeks of pain relief (at least 50% reduction in pain) from the sgb with liposome bupivacaine . The patient was surprised at the degree of improvement in her condition and stated that she was able to function with less discomfort during the 3 weeks of pain relief . However, extreme pain (10 out of 10 on a visual analog scale) had returned in her left arm after the 3week window of relief . As before, the pain was constant and interfered with sleep . Her left shoulder was severely weakened, had extremely limited range of motion (both active and passive), and was sensitive to the touch . Injections consisted of 2.02.5 ml of liposome bupivacaine (266 mg/20 ml [13.3 mg / ml]). All of these procedures were well tolerated, and there was no adjustment in the dosage of gabapentin during any of the sgbs with liposome bupivacaine . The patient continued to experience approximately 3 weeks (1821 days) of pain relief with each sgb with liposome bupivacaine . To the author's knowledge, the current case report is the first published description of liposome bupivacaine use in sgb for patients with crps type i. the diagnosis of crps was strongly supported by clinical presentation, the main criterion to identify the condition 23, 24, 25 . Overall, based on the author's clinical experience with sgb and other blocks, liposome bupivacaine provides an equal degree of analgesia but appreciably longer duration of analgesic effect compared with bupivacaine hcl . A series of eight sgbs with traditional bupivacaine hcl in this patient provided an average of 57 days of pain relief . In contrast, a series of five sgbs with liposome bupivacaine provided approximately 1821 days of pain relief after each block, with similar tolerability and greater patient satisfaction compared with traditional bupivacaine hcl . The duration of pain relief with traditional bupivacaine hcl in sgb observed here (57 days) was similar to that observed in a doubleblind crossover study that included a comparison of sympathetic ganglion blockade (sgb, n = 4; lumbar sympathetic block, n = 7) with local anesthetic (bupivacaine hcl / lidocaine) versus normal saline 26 . In that study, patients served as their own controls, receiving a block with normal saline and a block with local anesthetic 710 days apart . The mean duration of pain relief was 6 days with traditional bupivacaine hcl / lidocaine versus 12 h with normal saline . Given the pharmacokinetics of traditional bupivacaine hcl (halflife of about 3 h 27) and liposome bupivacaine (halflife of about 34 h 15), it is unlikely that either agent was able to maintain a blockade of sympathetic activity from the stellate ganglion per se for the 1 week (bupivacaine hcl) or 3 weeks (liposome bupivacaine) of pain relief experienced by the patient . Instead, the blockade of sympathetic outflow from the stellate ganglion may have been a shortlived event that reset dysfunctional pain pathways, resulting in a prolonged, quiescent period of decreased firing of nociceptive fibers and restoration of daily functioning . Liposome bupivacaine is currently approved by the fda for administration into the surgical site to produce postsurgical analgesia 15 . The benefits and risks of liposome bupivacaine use in sgbs have not been studied in clinical trials, and its use in this setting is considered experimental . Offlabel use should be approached with caution . For the patient in this case report, the treatment sequence consisted of a series of sgbs using traditional bupivacaine hcl, followed by sgbs with liposome bupivacaine, which allowed for a meaningful comparison of the two formulations with the patient serving as her own control . In terms of quality of life, an extended duration of relief from the constant, debilitating pain of crps would be expected to have a positive impact on daily functioning, sleep, and ability to complete routine activities . For this patient, sgb with liposome bupivacaine resulted in improved satisfaction over an extended period compared with traditional bupivacaine hcl . The reduction in discomfort allowed her to return to normal daily functioning for about 3 weeks after sgb with liposome bupivacaine . Administration of sgb should always be considered early in the management of crps because it may abort or help reverse progression if used proactively . The encouraging results of sgb with liposome bupivacaine that were observed in this case study suggest that sgb containing liposome bupivacaine instead of bupivacaine hcl may potentiate and/or prolong the treatment response in patients who respond to sgb . The cost of treatment for crps can be a significant financial burden for some patients . From a health economics perspective, a treatment that provides a prolonged duration of pain relief from crps would be expected to reduce the number of scheduled reimbursable injections and may therefore translate into decreased patient costs . This is the first published report to describe the use of liposome bupivacaine in sgb for the treatment of crps . Liposome bupivacaine produced three to fourfold longer pain relief compared with bupivacaine hcl, which produced up to 1 week of pain relief . Largescale, randomized, controlled studies are needed to confirm the safety and efficacy of liposome bupivacaine in sgb for the treatment of crps . Dr . Ferrillo participated as a paid consultant for pacira pharmaceuticals, inc . In a pain medicine roundtable discussion regarding the study design of a phase i trial for a pain management protocol using liposome bupivacaine
|
There are many reports of paraganglioma diagnosed on fine needle aspiration cytology (fnac) in the literature . Although fnac of a suspected paraganglioma is contraindicated in view of the hypertensive crisis after fine - needle aspiration, this tumor can be an unexpected finding in neck mass fnacs performed in unsuspecting cases . Cytologic features of single cell, loose clusters and occasional acinar configuration of large, oval cells with round to oval nuclei, evenly dispersed chromatin, focally discrete nucleoli, moderate anisocytosis and anisonucleosis have been well described for paragangliomas . In the present case in addition to the acinar and discrete arrangement of cells, smears also showed few large loose clusters of cells enveloped by thin vascular channels the so called zellballen pattern, a diagnostic feature on histopathology . We describe a case of a 42-year - old woman presenting with fever on and off since 1 year and neck swelling of 5 months duration . Ultrasonography (usg) showed a well - defined heterogeneous highly vascular lesion in right cervical region . Clinical examination revealed a solitary 3 cm 2 cm non - mobile non - tender mass present at the right angle of mandible . Fnac was bloody and pap stained smears revealed cells in clusters, microacinar and rosette like formations as well as singly . The cells were monomorphic, round to plasmacytoid with round to oval nuclei and a moderate amount of pale granular cytoplasm . There were in addition, few large loose clusters of cells enveloped by vascular channels on all sides . These cells showed same cytomorphologic features as surrounding cells [figure 1a and b]. (a) cells arranged in compact clusters surrounded by vascular channels on all sides (pap, 100). (b) endothelial cells in vascular channel enveloping tumor cells on one surface of the same cluster seen in (a) (pap, 200). (c) typical zellballen pattern on histopathology of the same case (h and e, 100) in view of monomorphic cells with the absence of necrosis and mucin, metastatic adenocarcinoma was ruled out . Metastasis of medullary carcinoma of the thyroid was considered on cytomorphology, but was ruled out on the basis of a normal thyroid on usg and absence of specific cytologic features . Histopathological examination confirmed the diagnosis of a benign carotid body paraganglioma [figure 1c]. This case report highlights the presence of loose cell clusters enveloped by thin vascular channels on cytology, a feature which has been occasionally described in anecdotal case reports in intraoperative scrape smears . The presence of cell clusters with vascular coats on cytology should lead to high index of suspicion for pheochromocytoma / paraganglioma (adrenal or extra adrenal) in addition to the usual cytological, clinical and radiological features . It is important to diagnose this condition pre - operatively in order to avoid any surgical delay . Clusters and discretely scattered cells, with occasional acinar configuration and fine reddish intracytoplasmic granules are the established facts of a paraganglioma . However cell clusters enveloped by thin vascular channels on cytology the so called zellballen pattern diagnostic of histopathology may be considered as a novel insight and should be sought for in cytology smears when paraganglioma is a high suspicion.
|
Vegf signaling pathways drive the development of the vascular system by regulating three distinct processes: vasculogenesis, angiogenesis, and arteriogenesis . Embryonic vascular development is initiated by vasculogenesis when vegf induces differentiation of endothelial progenitors to endothelial cells that then form a primitive vascular network . This network is then remodeled and expanded through the process of angiogenesis, where endothelial cells respond to vegf - a by sprouting, proliferating, and migrating to form new lumenized vessels . Concurrently, arteriogenesis ensures the formation of arteries through vegf - induced arterial fate specification, lumen expansion, and endothelial cell proliferation . Proper coordination of angiogenesis and arteriogenesis results in a hierarchal vascular network consisting of arteries, capillaries, and veins that provides a means to effectively deliver oxygen and nutrients throughout the body . Disruption of either one of these processes can impair growth and potentially lead to embryonic lethality . In the developed vascular system, angiogenesis and arteriogenesis continue to play unique yet equally important roles in both health and disease . In situations such as wound healing and cancer, hypoxic tissues secrete vegf to induce angiogenesis, thereby expanding the capillary network and increasing nutrient and oxygen supply . Tumor angiogenesis promotes cancer progression by increasing tumor growth and providing a conduit for metastasis . Thus, anti - angiogenic therapies are now a common component of cancer therapies for multiple tumor types . Diseases characterized by vascular occlusion, such as coronary or cerebral artery occlusions, may benefit from therapies that promote arteriogenesis to expand pre - existing collateral anastomosis and induce new arterial growth . When sufficiently developed, collateral vessels function as biological bypasses; artery - to - artery communications bypass the capillary bed to provide blood flow to tissues served by an occluded artery . Vegf signaling is critical for this process, promoting collateral growth and de novo arteriogenesis . Humans and mice with a higher number of nascent collateral vessels display decreased ischemia and improved recovery after occlusion of a major arterial branch . In contrast, therapies that promote angiogenesis after ischemia have had limited success in treating advanced arterial occlusive diseases . Understanding the molecular mechanisms that distinguish endothelial function in arteriogenesis from angiogenesis is of great interest in order to develop targeted and more effective therapies for diseases characterized by inadequate blood flow . However, differences in the growth factor - induced signaling between these two processes remain incompletely understood . A number of studies have suggested that vegf - driven activation of erk1/2 signaling is critical for arterial fate specification in both developmental and adult arteriogenesis [711]. Investigations of the molecular details of vegf activation of erk have revealed a critical role played by the vegfr, nrp1 . Neuropilins are a two - member family of non - tyrosine kinase receptors that bind vegfs and semaphorins through two distinct extracellular domains . In particular, nrp1 is enriched in arterial endothelial cells and binds both vegf - a165 and semaphorin-3a (sema3a), whereas nrp2 is expressed predominantly by lymphatics [1214]. The short cytoplasmic domain of nrp1 contains a c - terminal pdz - binding domain required for interactions with synectin, a cytoplasmic pdz protein, and likely other pdz - binding partners . Mice expressing mutant nrp1 that can bind vegf, but not semaphorin, survive until birth, demonstrating that nrp1 regulation of vegf signaling is critical for vascular function and thus embryonic viability . More recently, studies of a mouse line carrying a knock - in of nrp1 missing its cytoplasmic domain revealed that these animals live but have a profound arteriogenic defect . In contrast, mice carrying a knock - in of nrp1 with a mutated vegf - a - binding site have predominantly perinatal angiogenic defects and display mildly impaired arteriogenesis . These discoveries imply that nrp1 accounts for differential regulation of angiogenic versus arteriogenic signaling by vegf . The different roles played by nrp1 make it an exciting target for developing therapeutics to target diseases that specifically require either capillary or arterial vessel regrowth . Here, we review the function of nrp1 regulation of vegfr2 signaling in both angiogenesis and arteriogenesis . We will then discuss how nrp1 functions as a vegf co - receptor in angiogenesis and as a mediator of vegfr2 trafficking in arteriogenesis . We propose that nrp1 functions as a vegf signaling modulator that imparts unique endothelial cell function required for either arteriogenesis or angiogenesis . Vegfs induce endothelial cell differentiation, proliferation, migration, and survival while promoting vascular permeability . The vegf protein family consists of vegf - a, -b, -c, and -d; placenta growth factor (plgf); vegf - e produced by orf viruses; and a group of snake venom - derived vegf - fs [2527]. Vegfs mediate their effects on endothelial cells by activating cell surface vegfr tyrosine kinases, vegfr-1, -2, and -3 . For example, vegf - a exclusively binds vegfr1 and vegfr2, whereas vegf - c exclusively binds vegfr2 and vegfr3 . Generally speaking, vegfr3 activation by vegf - c regulates the lymphatic vasculature, whereas vegf - a activation of vegfr2 is the main regulator of blood endothelial cell function . Mice heterozygous for vegf - a or homozygous null for vegfr2 die embryonically and display severe vascular defects, demonstrating the critical role played by vegfs in vascular development [3133]. Furthermore, mice carrying a single amino acid mutation that prevents vegfr2-induced activation of erk1/2 die in utero because of vascular defects . In line with vegfr2 being a master regulator of endothelial cell function, activation of vegfr2 initiates multiple signaling pathways that regulate endothelial proliferation, migration, adhesion, lumenization, and survival . Activation of the phosphatidylinositol 3-kinase / akt signaling pathway promotes endothelial cell survival by inhibiting apoptosis, whereas activation of src - fak signaling mediates endothelial cell migration and vascular permeability . Phosphorylation of vegfr2 also activates the raf - mek - erk signaling cascade whereby erk1/2 phosphorylation induces endothelial cell proliferation, network formation, and increased vessel lumen size . In mice, newly formed collateral vessels express elevated levels of phosphorylated erk1/2 after vascular occlusion, and decreased erk signaling has been associated with impaired arteriogenesis . Thus, erk activation in response to vegfr2 signaling is hypothesized to be a critical component of arteriogenesis regulation . In contrast to the standard view of receptor tyrosine kinase (rtk) signaling, which holds that rtks activate second messenger pathways at the plasma cell membrane, vegfr2 activation of erk requires receptor internalization and trafficking [9,4042]. Thus, vegfr2 trafficking through different endosomal compartments adds another layer of regulation to vegfr2 signaling . Vegfr2 is internalized via clathrin - coated pits after ligand - induced receptor dimerization and autophosphorylation . Vegfr2 is then shuttled between different vesicular compartments to eventually be recycled back to the plasma membrane for another round of signaling or sent to the lysosome for degradation . Rab gtpases, found on the surface of vesicles, interact with an array of adaptor proteins in order to direct vesicles to different cellular locations . Specific types of rab gtpases are associated with different vesicular compartments; thus rab proteins can be used to identify the different routes of endosomal transport . After internalization, vegfr2 is first localized to rab5-positive early endosomes, which then recruit the adaptor protein eea1 . At this point, vegfr2 can be either shuttled back to the plasma membrane for receptor recycling via rab11-dependent transport or directed to the lysosome for protein degradation via rab7-positive endosomes . In the absence of vegf stimulation, vegfr2 is constitutively returned to the plasma membrane by rab4-dependent fast - loop receptor recycling . In response to vegf stimulation, vegfr2 is returned to the plasma membrane via slow - loop recycling, which depends on rab11-positive endosomes . The process of slow - loop recycling of vegfr2 via rab11-positive endosomes functions to prolong vegfr2 signaling . During angiogenesis, endothelial cells sprout from pre - existing vasculature to form new capillary networks . Highly migratory endothelial cells, termed tip cells, lead endothelial sprouts . Tip cells extend filopodia into the extracellular environment and are highly responsive to vegf because of high levels of vegfr2 expression . Mice deficient in nrp1 display a reduced number of tip cells in the developing mouse hindbrain . More recently, nrp1 was shown to be enriched in endothelial tip cells during angiogenesis in the embryonic hindbrain . Accordingly, mice chimeric for endothelial - specific nrp1 knockout demonstrate that endothelial cells that maintain expression of nrp1 preferentially take the tip cell position during sprouting angiogenesis . Nrp1 contributes to the tip cell phenotype by regulating the vegfr2 response to vegf stimulation . In cultured endothelial cells, vegf stimulation induces nrp1-vegfr2 complex formation and the presence of nrp1 increases vegfr2 signaling potency to promote vegf - induced chemotactic and mitogenic activity . In zebrafish, nrp1 knockdown causes severe vascular defects, including impaired development of the intersomitic vessels, a process dependent on sprouting angiogenesis . Combined inhibition of nrp1 and vegf - a in the zebrafish embryo demonstrated that nrp1 cooperates with the vegf signaling pathway whereby nrp1 lowers the required concentration of vegf needed to activate vegfr2 and induce angiogenesis . By increasing vegfr2 activation in response to vegf, nrp1 acts as an important regulator of angiogenesis in zebrafish . Antibodies that block nrp1 binding specifically to vegf impair endothelial cell sprouting, both in the mouse retina and in tumor models . Assessment of mice expressing endothelial knock - in mutations of nrp1 that specifically inhibit vegf - a165 binding demonstrates that vegf - a binding to nrp1 is not required for embryonic angiogenesis but instead contributes to postnatal angiogenesis . Mice expressing a knock - in of an nrp1 mutation that inhibits vegf - a165 binding and reduces nrp1 expression are embryonically viable, but display an increased rate of postnatal mortality and impaired angiogenesis in the hindbrain and retina . A second nrp1 vegf - a165 binding - deficient transgenic mouse line that expresses normal levels of nrp1 displayed normal viability and only mildly impaired retinal angiogenesis as characterized by delayed vessel outgrowth . In contrast to endothelial - specific nrp1 knockout mice, which display severely impaired angiogenesis in the hindbrain accompanied by reduced vegfr2 expression and phosphorylation levels, expression of vegf - a165 binding - deficient nrp1 results in normal hindbrain angiogenesis, normal vegfr2 expression, and only mildly reduced vegfr2 phosphorylation levels . These findings suggest that nrp1 promotes angiogenesis independently of its vegf - a165-binding capability . Instead, it is hypothesized that, during angiogenesis, nrp1 functions as a vegfr2 co - receptor to enhance vegfr2 activation . Nrp1 has been shown to mediate endothelial cell adhesion, in part through interactions with 51 integrins [5759]. More recently, it was shown that nrp1 complexes with the non - rtk abl1 to promote endothelial cell motility by stimulating fibronectin - induced actin remodeling . Accordingly, pharmacological inhibition of abl1 by treatment with imatinib impairs angiogenesis, as demonstrated by reduced tip cell number and decreased vessel branching in the developing retina . Thus, endothelial nrp1 functions independently of vegfr2 to provide an additional means of angiogenic modulation . Unlike deletion of full - length nrp1, which results in both angiogenic and arteriogenic defects, transgenic mice expressing a truncated version of nrp1 lacking the cytoplasmic domain (nrp1) do not display embryonic, postnatal, or pathological angiogenic phenotypes . Instead, loss of the nrp1 cytoplasmic domain specifically impairs arteriogenesis . Nrp1 mice display reduced arterial network size and complexity in the kidney, heart, and hindlimb . After femoral artery ligation, blood flow recovery, which depends on de novo arterial formation, is significantly impaired in nrp1 adult mice . Defective arteriogenesis in nrp1 mice was attributed to impaired vegfr2 trafficking from rab5-positive sorting endosomes to eea1-positive endosomes, which resulted in reduced vegfr2 phosphorylation and impaired erk activation . Trafficking of vegfr2 from rab5-positive endosomes to eea1-positive endosomes requires the pdz (psd-95/dlg / zo-1) domain - containing adaptor protein synectin, also termed gaip interacting protein, cooh - terminus (gipc) and neuropilin - interacting protein (nip). Synectin forms a complex with pdz - binding proteins and the actin - based molecular motor myosin vi to promote inward trafficking of endosomes away from the plasma membrane . Vegfr2 lacks a pdz - binding domain, so it cannot directly interact with synectin . Through its cytoplasmic domain, nrp1 can act as a bridge between vegfr2 and synectin to allow for proper vegfr2 trafficking . Thus, endothelial cells lacking either the nrp1 cytoplasmic domain or synectin display impaired vegf2 endocytic trafficking, resulting in diminished erk activation . Nrp1 has also been shown to regulate vegfr2 recycling to the plasma membrane . Under normal conditions, vegf - a stimulation causes vegfr2 localization to rab11-positive endosomes and subsequent receptor recycling to the plasma membrane . In the absence of nrp1, vegfr2 is instead shuttled to rab7-positive endosomes that deliver vegfr2 to the lysosome for degradation . The carboxyterminal sea domain of nrp1 that mediates synectin binding was also shown to be required for vegfr2 recycling via rab11-positive endosomes . Thus, nrp1 amplifies vegfr2 signaling by ensuring proper vegfr2 trafficking to allow for prolonged signal activation . The high levels of erk activation required for arteriogenesis appear to be uniquely dependent on proper vegfr2 trafficking . In this way vegfr2 signaling is required for endothelial cell differentiation, sprouting, and lumen expansion . Yet, how vegfr2 is differentially regulated to contribute to these very different endothelial cell outcomes is only just beginning to be elucidated . Intracellular trafficking of vegfr2 through different endosomal compartments is a relatively new field of study . The data reviewed here show that vegfr2 trafficking critically regulates the cellular outcomes in response to vegfr2 activation . In elucidating the role of nrp1 in endothelial cells, our understanding of endothelial cell biology has been expanded to show that vegfr2 signaling can be differentially regulated to alter two distinct vascular processes: angiogenesis and arteriogenesis . Optimal vegfr2 trafficking, dependent on nrp1, is dispensable for angiogenesis but required for arteriogenesis . This suggests that arteriogenesis requires prolonged vegfr2 signaling, which is accomplished through proper endosomal trafficking, and involves high levels of erk activation . During angiogenesis, endothelial tip cells express exceptionally high levels of vegfr2 and are exposed to high concentrations of vegf - a . In such an environment, sustained vegfr2 signaling may not be required for the cellular migration and network formation required for angiogenesis . In contrast, arteriogenesis involving luminal expansion and de novo arterial fate specification may occur in a setting with reduced vegf - a, thus requiring nrp1-dependent mechanisms that amplify vegfr2 signaling and prolong erk activation, such as receptor recycling and receptor trafficking . Understanding additional levels of vegfr2 signaling regulation, such as vegfr2 trafficking, could help answer multiple outstanding questions in the field of vascular biology pertaining to tip cell selection and lumen formation . Expanding the field of vegfr2 trafficking could shed light on this poorly understood vascular process.
|
Anthocyanins are naturally occurring polyphenolic compounds that give the intense color to many fruits and vegetables such as berries, red grapes, purple sweet potato, and red cabbages [1, 2]. In contrast to the other flavonoids, anthocyanins carry a positive charge in the central ring structure and are thus cations . In plants, they are present exclusively as glycosidic compounds . The number and nature of the different attached sugar moieties are responsible for the high number of anthocyanins, more than 500 compounds . The aglycone (named anthocyanidin) is a diphenylpropane - based polyphenolic ring structure, and is limited to a few structure variants including delphinidin, cyanidin, petunidin, pelargonidin, peonidin, and malvidin (figure 1), that represent the aglycones of most anthocyanins in plants . Based on food composition data, we consume considerable amounts of anthocyanins from crops, fruits, and vegetable - based diets although the range is from several milligrams to several hundred milligrams, depending on the nutrition customs . An enhanced intake of anthocyanin is now increasing because extracts with higher anthocyanin contents from bilberry or elderberry are commercially available . Epidemiological investigations have indicated that moderate consumption of anthocyanins through the intake of products such as red wine or bilberry extract is associated with a lower risk of coronary heart disease . Recent studies indicated that anthocyanins have strong free radical scavenging and antioxidant activities [7, 8, 9, 10, 11, 12, 13], and show inhibitory effects on the growth of some cancer cells [14, 15, 16, 17, 18]. Animal experiments showed that oral intake of anthocyanins from purple sweet potato (ipomoea batatas l.) and red cabbage (brassica oleracea l.) suppressed rat colon carcinogenesis induced by 1,2-dimethylhydrazine and 2-amino-1-methyl-6-phenylimidazo- [4,5-b] pyridine . In addition, anthocyanins can be directly absorbed and distributed to the blood in human and rats after consumption of dietary anthocyanins [18, 19, 20, 21, 22, 23, 24]. Thus, mechanisms behind chemopreventive effects of anthocyanins need to be considered at molecular level ap-1 is a transcription factor and has been shown to play a critical role in promoting carcinogenesis [25, 26]. In mouse epidermal cell line jb6 (), tumor promoters such as 12-o - tetradecanoylphorbol-13-acetate (tpa), epidermal growth factor (egf), and tumor necrosis factor (tnf) alpha can induce ap-1 activity and neoplastic transformation by activating mapk including extracellular signal - regulated kinase (erk), jnk, or p38 kinase [27, 28]. Delphinidin, cyanidin, and petunidin have been shown to inhibit tpa - induced ap-1 transcriptional activity and cell transformation in jb6 cells . Structure - activity studies indicated that the ortho - dihydroxyphenyl structure on the b - ring of anthocyanidins seems essential for the inhibitory action because pelargonidin, peonidin, and malvidin, having no such ortho - dihydroxyphenyl structure, failed to show the inhibitory effects in both ap-1 activity and cell transformation . The results from signal transduction analysis indicated that delphinidin blocked erk phosphorylation at early times and jnk phosphorylation at later times, but not p38 phosphorylation at any time . Moreover, delphinidin blocked the phosphorylation of mapk / erk kinase (mek, an erk kinase), sapk / erk kinase (sek, a jnk kinase), and c - jun (a phosphorylation target of erk and jnk). The data suggest that the inhibition of tpa - induced ap-1 activity and cell transformation by delphinidin involves the blockage of erk and jnk signaling cascades (figure 2). Furthermore, a greater inhibition was observed in combinations of superoxide dismutase (sod) with anthocyanidins that have the ortho - dihydroxyphenyl structure on the b - ring . Multiplicative model analysis suggested that this greater inhibition between sod and delphinidin is synergistic, not additive . Thus, the inhibitory effects of anthocyanidins on ap-1 activation and cell transformation would be due in part to their potent scavenging activity for superoxide radicals and in part to mapk blockage . Sod has been shown to selectively inhibit the tpa - induced activation of protein kinase epsilon and to prevent subsequent activation of jnk2 in response to tpa, thereby delaying ap-1 activation and inhibiting mouse skin tumor promotion . Thus, the signaling pathways blocked by delphinidin or sod may differ in part although both are considered to be important in the cancer prevention activity of anthocyanidins . A schematic molecular view of cancer chemoprevention by anthocyanidins . Anthocyanidins may contribute to cancer chemoprevention through targeting three different signal transduction pathways and downstream genes . Abbreviations: ap-1, activator protein-1; erk, extracellular signal - regulated kinase; jnk, c - jun nh2-terminal kinase; lps, lipopolysaccharide; nf-b, nuclear factor b; ros, reactive oxygen species; tpa, 12-o - tetradecanoylphorbol-13-acetate . Cyclooxygenase (cox) is the rate - limiting enzyme for synthesis of dienoic eicosanoids such as prostaglandin (pg) e2 . Cox-1 is expressed constitutively in many types of cells and is responsible for the production of pgs under physiological conditions . Analgesic / antipyretic drugs such as acetaminophen, phenacetin, antipyrine, and dipyrone can selectively inhibit this enzyme . Thus, inhibition of cox-3 could represent a primary central mechanism by which these drugs decrease pain and possibly fever . Cox-2 is induced by proinflammatory stimuli, including mitogens, cytokines, and bacterial lipopolysaccharide (lps) in cells in vitro and in inflamed sites in vivo . Data indicate that cox-2 is involved in many inflammatory processes and induced in various carcinomas, suggesting that cox-2 plays a key role in tumorigenesis . Interestingly, some antioxidants with chemopreventive effects inhibit the expression of cox-2 by interfering with the signaling mechanisms that regulate the cox-2 gene . Wang et al found that anthocyanins and their aglycone, cyanidin, from tart cherries could inhibit the activities of cox-1 and cox-2 . Seeram et al found that cyanidin showed superior inhibition of the cyclooxygenase activity in vitro . In our laboratory, we used mouse macrophage cell line raw264 to demonstrate the molecular mechanism of anthocyanins in the inhibition of the cox-2 gene . We found that anthocyanin extracts from bilberry or purified delphinidin inhibited lps - induced cox-2 expression at protein and transcriptional levels . Studies on signal pathway indicated that delphinidin at least blocked lps - induced ib degradation and then suppressed nf-b activation and cox-2 gene expression (hou et al, unpublished data). These data demonstrated that the blockage of nf-b signaling pathway is involved in the inhibition of cox-2 gene expression by anthocyanins (figure 2). Apoptosis has been reported to play an important role in elimination of seriously damaged cells or tumor cells by chemopreventive agents [38, 39]. The cells that have undergone apoptosis have typically shown chromatin condensation and dna fragmentation . They are rapidly recognized by macrophages before cell lysis, and then can be removed without inducing inflammation [38, 41]. Therefore, apoptosis - inducing agents are expected to be ideal anticancer drugs of which human promyelocytic leukemia cell line (hl-60) provides a valid model for testing antileukemic or general antitumoral compounds . Delphinidin, cyanidin, and petunidin induced apoptosis of hl-60 cells detected by morphological changes and by dna fragmentation, whereas pelargonidin, peonidin, and malvidin showed no induction of apoptosis . The anthocyanidin glycosides (anthocyanins) extracted from bilberry such as delphinidin glycosides and cyanidin glycosides also induced the apoptosis in hl-60 cells . Structure - activity studies indicated that the potency of apoptosis induction of anthocyanidins is associated with the number of hydroxyl groups at the b - ring, and the ortho - dihydroxyphenyl structure at the b - ring appears essential for apoptosis actions . It is noteworthy that anthocyanidins increased the levels of hydrogen peroxide in hl-60 cells with a structure - activity relationship that depends on the number of hydroxyl groups at the b - ring and appears in the order of delphinidin> cyanidin, petunidin> pelargonidin, peonidin, and malvidin . The mechanistic analysis indicates that the apoptosis induction by delphinidin may involve an oxidation / jnk - mediated caspase pathway . Delphinidin treatment increased the levels of intracellular ros, which may be a sensor to activate jnk . Concomitant with the apoptosis, jnk pathway activation such as jnk phosphorylation, c - jun gene expression, and caspase-3 activation was observed in delphinidin - treated cells . Antioxidants such as n - acetyl - l - cysteine (nac) and catalase effectively blocked delphinidin - induced jnk phosphorylation, caspase 3 activation, and dna fragmentation . Thus, delphinidin may trigger an apoptotic death program in hl-60 cells through an oxidative stress - mediated jnk signaling cascades (figure 2). It is interesting that anthocyanidins produced ros, showing pro - oxidant activities, to induce apoptosis in hl-60 cells, contrary to the antioxidant activities of anthocyanidins in the inhibition of tpa - induced cell transformation in mouse skin jb6 cells . It should be noted that anthocyanidins are the aglycons of the naturally occurring anthocyanins . Most of the molecular results on biological activities of anthocyanins were from anthocyanidins due to the fact that anthocyanidins are easier to be prepared than anthocyanins . Thus, it is not yet known whether the naturally occurring anthocyanins will also activate these molecular pathways . Accumulated results on structure - activity studies have shown that the biological activities of anthocyanins appear to increase with a decreasing number of sugar units and/or with an increasing number of hydroxyl groups at their aglycons . For example, both antioxidant activity and cyclooxygenase inhibitory activity of cyanidin glycosides increased with a decreasing number of sugar units . Cyanidin - rutinose showed better activity than cyanidin - glucosylrutinose, and cyanidin aglycone showed the best activity at much lower concentrations . In our laboratory, we found that the aglycons with ortho - dihydroxyphenyl structure at the b - ring, such as delphinidin and cyanidin [29, 43] and their glycosides (hou et al, unpublished data), possessed the activities of anticarcinogenesis, anti - inflammation, and apoptosis induction . The ortho - dihydroxyphenyl structure on the b - ring appears essential for these actions, and the activities of aglycons such as delphinidin and cyanidin are stronger than that of their glycosides . The molecular mechanisms of anticarcinogenesis, anti - inflammation, and apoptosis induction of malignant cells by anthocyanidins have been demonstrated at molecular level . These data provide a first molecular view of the chemopreventive effects of anthocyanidins . Based on many genes that may be associated with cancer chemoprevention, a genome - wide gene analysis by using microarray technology will be required to get the whole view of molecular mechanisms of cancer chemoprevention by anthocyanidins.
|
A 42-year - old italian man, who had been living in nigeria because of his job since two years, was urgently repatriated following diagnosis of acute plasmodium falciparum malaria . Fourteen days after anti - malarial treatment started, with quick resolution of fever, he suddenly complained of acute left flank pain . Laboratory tests disclosed severe anemia (hemoglobin 7.7 g / dl), moderate leukocytosis, markedly elevated c - reactive protein (232 mg / l), plasma d - dimer (2188 ug / l), lactic dehydrogenase (654 iu / l) and creatine kinase (1255 rapid blood assay tested positive for p. falciparum antigen, with negative blood cultures for bacteria and parasites . Prompt investigation with multi - detector ct [figure 1] allowed confident diagnosis of diffuse, moderately hyperdense peritoneal effusion consistent with hemoperitoneum and splenomegaly with hyperdense, stratified subcapsular and perisplenic clotted hematoma . Axial unenhanced (a) and contrast - enhanced (b) images of the upper abdomen reveal splenomegaly with stratified subcapsular and perisplenic hyperdensity consistent with ruptured splenomegaly and clotted hemorrhage . Axial unenhanced image of the pelvis (c) and post - contrast panoramic coronal - reformatted image (d) show moderately hyperdense (30 - 40 hu) effusion (asterisks) occupying the douglas pouch as well as other peritoneal compartments urgent laparotomic surgery confirmed abundant hemorrhagic peritoneal effusion without detectable active bleeding . Pathology specimen reported 850-g enlarged spleen measuring 17148 cm after fixation, with large capsular interruption and underlying hematoma . Histologically, diffuse parenchymal hemorrhage and markedly hypertrophic red pulp were observed, without follicular structure abnormalities nor signs of malignancy . Although very uncommon, spontaneous (non - traumatic) hemoperitoneum is a life - threatening condition that generally represents a surgical emergency and may prove fatal even if promptly diagnosed and appropriately treated . Its differential diagnosis includes bleeding from liver (mostly hepatocellular adenoma or carcinoma rather than metastases) or kidney (particularly angiomyolipomas) tumors, splenic rupture, visceral aneurysms or pseudo - aneurysms, deep abdominal varices from portal hypertension, excessive anticoagulant treatment, hemodialysis and gynaecological disorders such as ovarian cyst or ectopic pregnancy rupture . Because of its widespread availability and extreme acquisition speed, ct currently performed on multi - detector scanners represents the mainstay diagnostic modality to investigate patients presenting to with acute abdomen and signs of hemodynamic instability . At ct, hemoperitoneum is heralded by higher - than - water density (measuring 30 - 45 hounsfield units, hu) peritoneal effusion, whereas the even more hyperdense (45 - 70 hu) sentinel blood clot is usually observed nearest to the site of hemorrhage; sometimes contrast extravasation indicating active bleeding may be detected, a finding that indicates the necessity for emergency surgical or interventional treatment . As in this case, ct confidently identifies the spleen as the injured organ . Splenic rupture most usually occurs during various systemic infections, mostly including malaria, cytomegalovirus and epstein - barr virus, so a quick but thorough history and laboratory search for infection is required when spontaneous splenic rupture is diagnosed . Uncommonly, rupture may complicate diffuse splenic infiltration such as in amyloidosis or gaucher's disease, or leukemic, lymphomatous, or malignant disorders . Since malaria still represents a major medical problem worldwide (particularly in tropical and subtropical regions of asia and africa and parts of the americas), because of expanding travel and plasmodium resistance clinicians in the western world notably, malaria ranks first among causes of fever among travellers coming back from the tropics . When confronted with acute abdomen with signs of shock in a recent immigrant, tourist or expatriate returning from an endemic nation, malaria complicated by splenic rupture should be strongly suspected . During the course of acute malaria, splenic changes range from asymptomatic, palpable enlargement to serious complications such as infarction, rupture, hematoma, or abscess that occur more frequently in non - immune adults such as western travellers, often despite appropriate prophylaxis or during anti - malarial therapy . Whereas splenic infarction has a favourable course and needs to be treated conservatively to avoid postoperative and asplenic morbidity, splenic rupture represents a life - threatening emergency with a non - negligible mortality (22%) and usually requires immediate or delayed surgical splenectomy. [35] since clinical, laboratory, and ultrasound findings are usually insufficient to correctly differentiate these two complications, patients coming from overseas with suspected or confirmed malaria presenting to with enlarging tender splenomegaly, left upper abdomen, and/or pleuritic lower chest pain and variable - degree hemodynamic compromission require prompt imaging assessment with contrast - enhanced multi - detector ct that allows confident diagnosis and correct therapeutic choice.
|
The scaphoid fossa, triangular fossa of the antihelix, and the cymba concha are typically involved . Various terms for this condition are endochondral pseudocyst, intracartilaginous auricular seroma cyst, cystic chondromalacia, and benign idiopathic cystic chondromalacia . Males are commonly affected and the mean age of presentation is 35 - 40 years . Usually these cysts are asymptomatic but occasionally, minor discomfort and mild inflammatory signs may be present . The size of the cyst ranges from 1 to 5 cm in diameter and contains viscous straw - yellow fluid while sometimes a clear pale yellow may be encountered . The etiology of this condition is unknown but at the same time many investigators believe that repeated minor injuries were responsible for the formation of pseudocysts, particularly in patients with preexisting congenital intracartilaginous defects associated with lymphatic and vascular channels while some believe that the cause is cartilaginous degeneration caused by the release of chondrocyte lysosomal enzymes . Diagnosis is based on the clinical characteristics and no evidence of infection . The differential diagnosis of this condition includes cellulitis, relapsing polychondritis, chondrodermatitis helicis, and subperichondrial hematoma secondary to trauma . The ideal treatment is the preservation of the anatomical architecture of the pinna and prevention of recurrence . Most accomplished results were obtained by incisional drainage, followed by chemical and mechanical obliteration such as pressure dressing with button bolsters and compression suture therapy . Resection of the anterior cartilaginous leaflet of the pseudocysts with repositioning of the overlying skin flap or the so - called deroofing technique followed by buttoning is seen to produce best results in the literature . We present our experience of 26 patients of pseudocyst of auricle diagnosed in our medical colleges from april 2011 to april 2013 in terms of clinical features and its management with surgical deroofing and buttoning . This prospective study was done in the department of ent and head and neck surgery, of skims medical college, srinagar and government medical college, srinagar . Twenty - six patients with pseudocysts of the pinna were enrolled in the study for a period of 2 years from april 2011 to april 2013 after they understood and accepted the procedure . Pseudocysts were diagnosed on the basis of clinical presentation, characteristics of the aspirated fluids, no evidence of infection, and absent signs of inflammation . All patients irrespective of the size of pseudocyst underwent incision and drainage with removal of anterior leaflet of cartilage followed by buttoning for 12 days . About 0.1 - 0.2 ml of fluid was aspirated from all groups by a 1-ml syringe which was physically inspected and sent for culture . An incision was given superiorly over the swelling, and the skin was elevated beyond the margin of the cyst [figure 1]. The posterior cartilage lining of the cyst wall was usually left intact . When the swelling was seen to extend to posterior aspect of pinna, we removed a small window cartilage posteriorly . Incision over the pseudocyst the incision was closed with 5 - 0 prolene, and buttons of appropriate site were applied on the anterior and posterior aspect and tied with through and through 4 - 0 silk sutures [figures 2 and 3]. Buttons tied to pseudocyst buttons being tied to pseudocyst anti - inflammatory and antibiotics drugs were prescribed for 5 days, and the buttons were removed after 12 days . Rebuttoning was done in cases who failed primary butting after a gap of 1 month . About 0.1 - 0.2 ml of fluid was aspirated from all groups by a 1-ml syringe which was physically inspected and sent for culture . An incision was given superiorly over the swelling, and the skin was elevated beyond the margin of the cyst [figure 1]. The posterior cartilage lining of the cyst wall was usually left intact . When the swelling was seen to extend to posterior aspect of pinna, we removed a small window cartilage posteriorly . Incision over the pseudocyst the incision was closed with 5 - 0 prolene, and buttons of appropriate site were applied on the anterior and posterior aspect and tied with through and through 4 - 0 silk sutures [figures 2 and 3]. Buttons tied to pseudocyst buttons being tied to pseudocyst anti - inflammatory and antibiotics drugs were prescribed for 5 days, and the buttons were removed after 12 days . Rebuttoning was done in cases who failed primary butting after a gap of 1 month . Total number of patients enrolled in the study were 26 and only two were females . Maximum numbers (i.e. 11) of patients were in the age group of 31 - 40 comprising about 42% of study population [table 1]. Maximum number (i.e. 10) of patients had swelling involving predominantly triangular, scaphoid, and antihelix [figure 4] followed by triangular fossa (5) [figure 5] while minimum number (3) involved concha [figure 6 and table 2]. Age and sex distribution of patients pseudocyst involving antihelix, triangular fossa, and scaphoid fossa pseudocyst predominantly involving triangular fossa pseudocyst predominantly involving concha culture of the aspirated fluid from pseudocyst was sterile in all cases . The maximum number (10) of patients were laborers by profession while government employees comprised the minimum number [table 3]. Involvement of both right and left ears was seen, but left ear was involved more than right with 16 and 10 cases, respectively . The fluid aspirated was straw serum colored in majority of patients (15) while few of them (2) had serosanguinous fluid . The size of the swelling ranged from 1.5 to 4.5 cm in largest diameter [table 4]. Profession of patients characteristics of pseudocyst pinna reaccumulation of fluid was seen in only one patient after primary incision and drainage and buttoning [table 5]. The success rate was 96% in primary cases . One patient that failed primary i and d and buttoning underwent incision and drainage with removal of anterior cartilage leaflet and buttoning as a secondary procedure after a month's gap and there was no recurrence after this procedure [table 6]. Findings / complications after 10 days of completion of treatment surgical outcome with deroofing and buttoning this procedure was associated with some minor complications . Pain and inflammation of the auricle developed in three patients during the postoperative period that responded promptly to a course of antibiotics and analgesics . In two cases, a mild thickening of the auricle at the site of incision was noticed which persisted . No cauliflower ear developed in patients [table 5]. The first report of pseudocyst of pinna was by hartmann, who described 12 cases of intracartilaginous cyst - like swelling of the pinna . Hansen reported a similar series of six cases in otherwise healthy caucasian males and labelled them as intracartilaginous cysts but agreed that the term pseudocyst is more appropriate . Although our cases were not histologically confirmed, they shared all the characteristics of pseudocysts . However, four children (two boys and two girls) with severe atopic eczema were reported to have the auricular pseudocysts at between 5 and 6 years of age . Majority of the pseudocysts were involving scaphoid fossa, triangular fossa, and antihelix followed by concha . Engel and cohen and grossman also cited the scaphoid fossa and triangular fossa of the antihelix as the main sites of predilection while supiyaphun and decha in contrast noted concha as the most common site of predilection . Pseudocysts occur more commonly on the right side as reported by many authors but we found them more on the left side . Similar to our study, one study noted pseudocyst to occur more commonly on the left side . We did not find any bilateral involvement, but the fact is that bilateral lesions are found in only 13% of the patients and are mainly reported in the pediatric age group . Typically the straw - yellow viscous fluid similar to olive oil is seen in the pseudocysts; however, serosanguineous and serous fluid may sometimes be observed . The volume of the aspirates was reported to have a range between 0.5 and 10 ml and we found it between 1 and 4 ml . Typically, the swelling develops in 4 - 12 weeks . The size ranged from 1 to 5 cm in diameter and we found it between 1.5 and 4.5 cm . Histologically, pseudocyst is characterized by an intracartilaginous cavity lacking in epithelial lining (hence named pseudocyst), and contain thinned cartilage and hyalinising degeneration along the internal border of the cystic space and granulation tissue . The maximum number of patients in our study were laborers by profession followed by businessmen while government employees comprised the minimum number . Although we did not statistically analyzed trauma as a cause of pseudocyst pinna but we are of opinion that trauma to ear as such is more likely to be seen in laborers and businessmen because of the nature of work they do . The ultimate aim of treatment is successful drainage of the pseudocyst without damage to healthy cartilage and to prevent its recurrence . Different formsof treatment have been described in several case reports and small series to overcome the recurrence: simple observation for 3 months; simple aspiration followed by pressure dressing applied on the pinna for 2 weeks; aspiration of fluid followed by injection of various substances such as steroids, 50% trichloroacetic acid, and triamcinolone; oral corticosteroids alone; incision and drainage with curettage and pressure dressing; needle aspiration plus bolstered pressure sutures applied over both aspects of the cyst; surgical curettage and fibrin sealant has been shown to be effective in obliterating the cystic cavity; treatment by incisional biopsy; resection of the anterior cartilaginous leaflet of the pseudocysts with repositioning of the overlying skin flap or the so - called deroofing technique followed by buttoning . Simple punch biopsy followed by the application of a bolster for approximately 2 weeks; cu - vac technique; drainage tube inserted into the pseudocyst using a guide needle; a piece of cartilage removed posteriorly and corrugated drain kept in place; intralesional injections of minocycline hydrochloride (1 mg / ml) two to three times at 2-week intervals have shown efficacy . The most effective technique for pseudocyst is incision and drainage with removal of anterior leaflet of cartilage with approximation of skin followed by buttoning the so - called surgical deroofing technique . The success rate in our study with this procedure was 96% and recurrence was seen in only one patient . Lim et al . In their series found that none of the patients had recurrence following excision and compression buttoning of the pseudocyst . Choi et al . Performed this procedure and the majority of cases they treated by this procedure was successful . Harder and zachary in their series found a normal - appearing auricle with minimal scarring or recurrence . Hoffman et al . And mohammed and jakubikova successfully treated patients with this technique . A previous study in our department by patigaroo et al . Although this procedure is the best, it is associated with minor complications as seen in our study . We did not see any patient with frank perichondritis, the most dreaded complication expected due to the exposure of the perichondrium because we took all possible care to do incision and drainage under aseptic conditions . Proper surgical and postoperative care of the wound can minimize if not prevent most of the complications and hence this procedure can be recommended for treating auricular pseudocysts . Pseudocyst of the pinna is a painless benign condition commonly encountered in middle - aged persons . Many modalities of treatment have been recommended in the literature with varied recurrence and failure rates . Considering the rate of success, we would like to advocate incision and drainage with removal of anterior cartilage leaflet and buttoning (deroofing procedure) as being the best method that can be undertaken in the management of auricular pseudocysts.
|
The prevalence of diabetes mellitus in india, where the total population is 1.25 billion people, is roughly 7.1%, and diabetes is four times more common in urban, compared with rural, india [1, 2]. The proportion of gross domestic product expenditure on health care in india by the government is a meager 1.3% . The economic burden of diabetes care in india is enormous, and about 510% of the national health budget is spent on prevention and treatment of diabetes . Screening programmes for early detection of diabetes mellitus diabetic kidney disease is the most common cause of chronic kidney disease (ckd), according to the indian ckd registry, accounting for 31.3% of ckd cases . Of the patients included in the registry, 25.9 and 48.1% presented to nephrology care with ckd stages 4 and 5, respectively . Of note, most of the diabetic centers are located only in major cities, whereas the majority of the indian population live in villages, and tier 2 and tier 3 cities . Moreover, there are only about 1400 nephrologists in a country with a population of 1.25 billion, which approximates to one nephrologist per 1 million inhabitants . Studies have shown that ckd is much more prevalent in patients with lower socioeconomic status [6, 7]. About 42.7% of the ckd patients in the indian ckd registry have a monthly income of less than rs 5000 (us$74.09), which means that the need for renal replacement therapy (rrt) has an enormous financial impact on these patients . Sustained rrt is available for less than 5% of the low - income group of patients . The high costs of rrt, a lack of government financial support programs for end - stage renal disease (esrd) patients and minimal health insurance coverage all restrict the affordability of rrt services to patients . The most widely used rrt modality is maintenance hemodialysis (mhd), although rrt facilities vary widely among private and government centers, and the prevalence of patients on mhd in india is 86 per million population, as of 2015 . There is a paucity of multicentric data on survival rates of diabetic, compared with non - diabetic, patients on mhd in india . Previously we published limited data on the survival of mhd patients between 1999 and 2006, which showed a significant difference in survival among patients from different socioeconomic groups . The aim of this retrospective analysis was to examine the survival rates of diabetic and non diabetic patients belonging to different socioeconomic groups who were initiated on mhd between 2003 and 2009, using data from five dialysis centers in india . We retrospectively analyzed the outcome of 897 patients (629 males and 268 females; mean age standard deviation 48.69 14.27 years) who were initiated on mhd between 2003 and 2009 at five dialysis centers: madras medical mission hospital (mmm), pondicherry institute of medical science (pims) and three centers of the tanker foundation (http://www.tankerfoundation.org). Of the 897 patients, there were 335 type 2 diabetic patients and 562 non - diabetic patients . However, it is possible a bias might have been present in the diagnosis of diabetic kidney disease in a minority of referrals, as renal biopsies were not performed to rule out other nephropathies . Hence, the type 2 diabetic patients included in this study could have diabetes mellitus either as a cause of renal disease or as a comorbidity . We stratified patients into group 1 (518 patients) and group 2 (379 patients). Group 1 included patients from middle and higher socioeconomic classes who underwent hemodialysis at mmm and pims, both not - for - profit tertiary care centers . Group 2 included patients from lower socioeconomic classes who underwent hemodialysis either free of cost (80%) or at subsidized rates (20%) at three centers of the tanker foundation, a charitable trust . Table 1 shows details of the dialysis membranes used and the frequencies and costs of dialysis at the study centers . Table 1.characteristics of dialysis membranes, dialysis frequencies and dialysis costs in the study centerscentermadras medical mission hospitalpondicherry institute of medical sciencetanker foundationnumber of patients241277379dialysis membrane usedpolysulphone and cellulose acetatepolysulphone and hemothanepolysulphonemembrane surface area (m)1.31.81.21.41.11.3frequency of dialysistwice or thrice weeklytwice weeklytwice weeklycost of dialysis per year (us$)2421322915501705848cost of erythropoietin per year (us$)888465930157 characteristics of dialysis membranes, dialysis frequencies and dialysis costs in the study centers we collected the following clinical and biochemical parameters of the patients at presentation: systolic blood pressure (sbp) and diastolic blood pressure (dbp), body mass index (bmi), hemoglobin level, serum albumin, serum calcium, serum phosphorus, serum bicarbonate, blood urea and serum creatinine . Data on events such as transplantation, transfer to continuous ambulatory peritoneal dialysis (capd) and loss to follow - up were also collected as censored observations . Data analysis was performed using spss version 20 (ibm corporation, armonk, ny, usa). Data for the above parameters were the mean of three readings, each taken before a dialysis session . The independent samples t - test was used to compare the mean values of the different baseline parameters between groups 1 and 2 and between diabetic and non - diabetic patients . We compared the 5-year survival rates of group 1 versus group 2, and diabetic versus non - diabetic patients using the kaplan meier survival estimator . We also compared the survival rates of diabetic versus non - diabetic patients in each socioeconomic group . Table 2 shows the comparison of clinical and biochemical parameters between diabetic and non - diabetic patients at presentation . Diabetic patients had higher age, compared with non - diabetic patients (p <0.001). In addition, diabetic patients had lower dbp (p <0.001), lower serum albumin (p = 0.053), higher bicarbonate (p = 0.047) and lower serum creatinine levels (p <0.001), compared with non - diabetic patients . There were no statistically significant differences in sbp, bmi and hemoglobin, or in levels of serum albumin, serum calcium and serum phosphorus . Table 3 shows the comparison of clinical and biochemical parameters between groups 1 and 2 . There was a trend towards lower dbp (p = 0.057) and higher bicarbonate levels (p = 0.057) in group 1, compared with group 2, though not statistically significant . Table 2.comparison of baseline parameters between diabetic and non - diabetic patientsparametervaluep - valuediabetic patients (n = 335)non - diabetic patients (n = 562)age (years)56.288 9.78744.112 14.575<0.001sex240 males/95 females391 males/171 females0.476sbp (mmhg)147.516 27.223144.784 27.5440.218dbp (mmhg)81.440 14.17187.025 15.754<0.001bmi (kg / m)22.213 5.14521.682 4.2330.368serum albumin (g / dl)3.437 0.9653.719 1.9150.053hemoglobin (g / dl)8.662 1.9478.516 2.1370.388corrected calcium (mg / dl)8.298 1.3008.392 1.4410.480phosphorus (mg / dl)5.536 2.1175.651 2.0790.618bicarbonate (meq / l)20.778 10.98419.176 5.3170.047urea (mg / dl)119.862 66.453122.319 61.9440.643creatinine (mg / dl)7.504 3.5149.466 4.413<0.001data are presented as mean standard deviation . Table 3.comparison of baseline parameters between groups 1 and 2parametermeanp - valuegroup 1 (n = 518)group 2 (n = 379)age (years)50.438 14.18246.257 14.056<0.001sex367 males/151 females262 males/117 females0.625sbp (mmhg)145.335 27.849149.730 24.0420.195dbp (mmhg)84.497 15.82788.108 10.8130.057bmi (kg / m)21.670 4.65522.620 4.2160.168serum albumin (g / dl)3.634 1.6573.286 0.6660.270hemoglobin (g / dl)8.530 2.1008.524 1.8070.976calcium (mg / dl)8.377 1.4118.075 0.8610.233phosphorus (mg / dl)5.625 2.1064.831 1.5050.179bicarbonate (meq / l)20.075 8.55117.735 2.2060.057blood urea (mg / dl)126.388 64.82984.684 30.686<0.001serum creatinine (mg / dl)8.628 4.1528.612 2.6090.969data are presented as mean standard deviation . Comparison of baseline parameters between diabetic and non - diabetic patients data are presented as mean standard deviation . Comparison of baseline parameters between groups 1 and 2 data are presented as mean standard deviation . Of the 897 patients, 166 patients survived, 350 patients died, 234 were lost to follow - up, 137 patients had renal transplant and 10 patients were transferred to capd . Of those patients lost to follow - up, 128 were from pims, 65 from the tanker foundation and 41 from mmm . Table 4 shows the outcomes of the diabetic and non - diabetic patients after initiation of mhd . Table 4.outcomes of diabetic and non - diabetic patients initiated on mhd across study centersdiabetic patientsnon - diabetic patientstotal no . Of patients335562no . Of patients who died160190no . Of patients who survived52114no . Of renal transplants31106no . Of patients transferred to capd64no . Of patients lost to follow - up86148 outcomes of diabetic and non - diabetic patients initiated on mhd across study centers the 5-year survival rate was 20.7% in diabetic patients, compared with 38.2% in non - diabetic patients (p <0.001), as shown by the kaplan the 5-year survival rate of patients in group 2 was 25.5%, compared with 41.8% in group 1 patients (p <0.001), as shown by the kaplan meier curve in figure 2 . Among the lower socioeconomic class patients (group 2), the 5-year survival rate was 7.1% in diabetic patients and 35.3% in non - diabetic patients (p <0.001) (figure 3). Among the higher and middle socioeconomic class patients (group 1), the 5-year survival rate was 38.9% in diabetic patients and 44.3% in non - diabetic patients (p = 0.226) (figure 4). Using the cox proportional hazard model, as shown in table 5, higher age (p = 0.002), the presence of diabetes (p <0.001) and a lower socioeconomic status (p <0.001) were associated with lower survival rates . Table 5.cox proportional hazards regression model for predictors of survival in patients on mhdvariablebstandard errorp - valueexp (b) * hazard ratio95% ci for exp (b)lowerupperage0.0150.0050.0021.0151.0051.024socioeconomic class0.7450.117<0.0012.1071.6752.650diabetes0.5490.123<0.0011.7311.3612.203 fig . 1.survival rates of diabetic, compared with non - diabetic, patients (p <0.001). Fig . 2.survival rates of patients by socioeconomic group (p <0.001). Fig . 3.survival rates of diabetic, compared with non - diabetic, patients in the lower socioeconomic group (p <0.001). Fig . 4.survival rates of diabetic, compared with non - diabetic, patients in the middle and higher socioeconomic group (p = 0.226). Cox proportional hazards regression model for predictors of survival in patients on mhd survival rates of diabetic, compared with non - diabetic, patients (p <0.001). Survival rates of patients by socioeconomic group (p <0.001). Survival rates of diabetic, compared with non - diabetic, patients in the lower socioeconomic group (p <0.001). Survival rates of diabetic, compared with non - diabetic, patients in the middle and higher socioeconomic group (p = 0.226). Data from the indian ckd registry showed that diabetic kidney disease is the most common cause (31.3%) of ckd . In our study, 37.3% of patients initiated on mhd were diagnosed with diabetic kidney disease, thus it is in agreement with the registry data . Using the cox proportional hazard model, we found that a higher age at initiation of dialysis, the presence of diabetes and a lower socioeconomic status were all associated with lower survival rates . For example, the 5-year survival rate was 20.7% in our diabetic patients, compared with 38.2% in the non - diabetic patients . Data on survival rates in patients with diabetic kidney disease in south asia are scarce . A recent indian prospective single - center study of 96 patients on mhd in a private tertiary care center reported a 2-year mortality rate of 19.8% . Another retrospective analysis of 95 patients on mhd showed a median survival period of 410 days . Here, we report 5-year survival rates from a large retrospective analysis of 897 patients from different socioeconomic groups who were initiated on mhd in five centers in south india from 2003 to 2009 . The 2014 united states renal data system reported that only 37.2% of patients with diabetic kidney disease survived 5 years after initiation of hemodialysis . Racki et al . Also reported poorer survival of diabetic, compared with non - diabetic, patients on mhd in croatia (p = 0.0013). Lack of compliance to drug therapy to control the glycemic status, and thereby to slow the progression of kidney disease, is a major factor contributing to an increased mortality in diabetic kidney disease [1618]. Survival rates of diabetic patients on mhd are poorer in india than in developed countries . The best and most cost - effective intervention that can be applied is early diagnosis and management of diabetes in the population, through large - scale screening and follow - up which are lacking in india . Such an interventional strategy is supported by the action in diabetes and vascular disease: preterax and diamicron modified release controlled evaluation (advance) trial and the uk prospective diabetes study (ukpds). In india, strategies to reduce the incidence of diabetic kidney disease include glycemic control, smoking cessation, lifestyle modification, patient education at the primary health - care level, avoidance of alternative medicines and herbs, use of angiotensin - converting enzyme inhibitors (aceis) or angiotensin receptor blockers (arbs) and prevention of acute kidney injury . It is an alarming fact that over 40% of diabetic patients in india fail to attend their regular follow - up appointments . In line with results from our previous study, the 5-year survival rate of patients in group 2 was 25.5%, whereas that of group 1 patients was 41.8% . On analyzing and comparing the survival rates of diabetic and non - diabetic patients on mhd, according to their socioeconomic groups, we found those diabetics belonging to group 2 had the poorest 5-year survival rate of 7.1%, which was lower than that of non - diabetic patients in group 2 at 35.3% . In group 1, although survival rates for diabetic patients seem to be lower in the first 20 months, the overall survival difference, compared to non - diabetic patients in group 1, was not statistically significant . This observation is based on better glycemic control and management of comorbidities provided to patients in the higher socioeconomic group . Diabetic patients on mhd from lower socioeconomic groups have the poorest survival, due to suboptimal care for undiagnosed cardiovascular disease, poor nutritional status, irregular dialysis schedules and poor compliance to dietary restrictions and glycemic management . Also, these patients do not have access to skilled multispecialty services . Patients undergoing mhd in a multispecialty hospital are seen by a nephrologist during every session and undergo detailed cardiovascular evaluation and pharmacotherapy, including beta blockers, aceis, arbs, antiplatelet drugs and statins, with regular follow - up . They also have access to erythropoiesis - stimulating agents (esas), bicarbonate supplements, skilled renal dietitian services and other multispecialty care . In the last couple of years, economically advanced state governments have established free dialysis programs targeting a very small subset of eligible patients . Patients under the care of the tanker foundation fall into this category of patients eligible for free dialysis and esas from the state government of tamil nadu . However, these free dialysis programs can only cater for a very small subset of the population as resource availability is scarce . Malnutrition is prevalent in 4277% of the esrd population in developing countries, which is strongly associated with increased mortality . Serum albumin levels of <3.5 g / dl are associated with poor survival rates . In our study, the mean serum albumin levels in group 2 and diabetic patients were <3.5 g / dl . Hemoglobin levels were also low in patients on mhd, regardless of whether they were diabetic or non - diabetic . An analysis of the cause of death showed cardiovascular disease as the most common cause in 60% of cases; other mortality cases also occurred outside the dialysis units, and hence their exact cause was not known . In the tanker foundation centers, it is likely that the majority of these 65 patients did not have access to rrt elsewhere, due to unaffordability of the treatment . The indian ckd registry does not include data on the follow - up of patients on rrt . Hence, there are very limited nationwide registry data available that examine the causes of death, which constitutes a major drawback in the evaluation of mortality in patients on mhd . Although the federal government has recently declared a policy of setting up hemodialysis centers across all 650 districts in india, the dearth of trained nephrologists will be a handicap in its implementation . In developing countries like india the majority of patients, including those in hospital - based dialysis centers, have to cover the cost of treatment out of their own pocket, and hence the overall cost of assessment for cardiovascular disease, erythropoietin usage and hospitalization puts an enormous burden on the self - paying group of patients [3, 10]. Relative to the population increase of 44% between 1990 to 2013 in india, the number of years lived with disability due to diabetes per million people has increased by 55%, according to the global burden of disease study 2013 . The increasing burden of diabetes, the scarcity of rrt services and poor survival rates of patients with diabetic kidney disease together imply that there is an urgent need to implement large - scale screening and awareness programs on diabetes mellitus in india . Results from our large retrospective multicenter study of patients on mhd from different socioeconomic classes clearly demonstrate that those patients with diabetic kidney disease belonging to a lower socioeconomic group have poorer survival rates . A limitation of this study is that, as this is a retrospective analysis of individuals from different socioeconomic groups, data on cardiovascular comorbidities for patients in the lower socioeconomic group were not readily available . Diabetic ckd patients from lower socioeconomic classes have poor survival rates on mhd . With available rrt resources being grossly inadequate to cater for the patient population requiring such treatment, there is an urgent need to screen diabetics for ckd, improve awareness and take appropriate steps to slow down the progression of ckd . As ckd is becoming a major cause of morbidity and mortality in india, government health - care expenditure must be increased accordingly to improve access to specialized rrt services for economically deprived patients . The results presented in this paper have not been published previously in whole or in part, except in abstract format.
|
Dr . Bawaskar was born in a small village with a population of 500 in rural maharashtra to a poor farmer in the early 1950s . One who is courageous; it was years later that he proved that no other name would have suited him better . His father recognized that education was the only tool that would liberate the family from their sufferings . The determination to educate his children earned his illiterate father the nickname barrister . He had to take up all kinds of jobs from working in the fields, hotels, temples, bookshops, chemist's shop, brick kiln, and many such odd places to support his education . Adversity taught him that he would have to fight for everything in life and nothing would come easy . Misfit in college and with lack of guidance, hard work was the only asset he possessed . He still recounts how he knew complete gray's anatomy by heart and emphasizes his deep study of pathology which has proven useful for his research . However, certain circumstances made him depressed and disillusioned during his college days . He lost his confidence and it was only after the completion of his mbbs degree and a prolonged treatment that he came out of the mental trauma . His strong roots with rural parts prompted him to opt for the position of a medical officer at a primary health centre (phc) rather than a housejob at a medical college . Fighting the red tape he managed to get posting at a small phc in the costal district of raigad . Yet he decided to work there with a great personal interest and slowly reformed the phc . In a short time, he established himself as a dedicated, honest, and a skilled doctor . It was here that he was introduced to the problem of scorpion stings for the first time . He had not heard of deaths due to scorpion stings till then and was surprised to know that such deaths were common in his area of clinical practice . Added to the problems were the superstitions which denied such cases medical care or worsened them even further . This stimulated the scientist within him and he started to collect data on such cases from past records, other doctors, and lay people in general . However, he found this information inadequate and unreliable, so he decided to admit all the cases and study them on his own . The need of the people to have a sure, scientific, and a safe cure for this menace formed the base of his work thereafter . In such a resource poor setting, his only tools were a stethoscope and a modest sphygmomanometer [figure 2]. However, his keen observation, thorough knowledge, and meticulous record keeping compensated for the lack of resources . He spent sleepless nights sitting beside the patients, monitoring them and noting the subtle changes . He found common symptoms of vomiting, hypertension, profuse sweating, cold extremities, priapism, and mild tolerable pain followed by ropy salivation, arrhythmias, hypotension, frothy expectoration and peripheral circulatory failure . Thus, he observed that the immediate cause of death in these cases was pulmonary edema . He tried traditional methods of symptomatic treatments with atropine, beta - blockers, chlorpromazine, aminophylline, etc ., but these methods did not yield the desired results . Tools of research a humble stethoscope and a bp apparatus in the meantime, he realized that his education was inadequate for the needs of his quest . To further his skills and knowledge, he applied for md in medicine at b.j . He mastered advanced techniques and intensive care . In the light of his new found knowledge, he prepared a paper on data of 51 cases of scorpion stings and sent it to an indian journal . He sent the same paper to lancet and received a response within 8 days that the report was accepted with minor changes . Thus, his first individual paper titled diagnostic cardiac premonitory signs and symptoms of red scorpion sting was published in the lancet in 1982 . He recounts how a case of scorpion sting succumbed in the tertiary care hospital where he was working . Thus he wondered, if a person could not be saved in such well - equipped settings, what could a clinician do in a phc like setup? [figure 3] also, he was successful in understanding that heart failure due to the sting was similar to a refractory heart failure like condition . He decided to use sodium nitroprusside for sting - related heart failure and was successful in managing many cases! A makeshift the couple returned to konkan only to find that the problem was the same as he had left it . In oct 1983, a 8-year - old child was admitted with all the symptoms of severe scorpion envenomation . As he developed pulmonary edema his chances of survival started declining . Bawaskar asked for his father's consent to use nitroprusside explaining the dangers of this drug . He postulated that it would decrease both the preload and afterload on the victim's heart with increased cardiac emptying . With the faith and trust invested by the victim'sfather, he administered nitroprusside drop by drop monitoring the child minute by minute . After 4 h, the victim gradually started showing signs of recovery, the blood pressure started rising, pulmonary edema subsided, pulse rate dropped and started oral feeds . 24 h later and almost on the verge of crying, he declared that the boy was saved! When he was monitoring the child, he received a telegram informing the death of his father . He was in a dilemma to choose between his family obligations and his duty as a doctor . He chose the latter and stayed with the child as he believed that there were people who could take care of the funeral, but the child needed him more . The news spread far and wide and patients from all over konkan started pouring in for the cure . Where death was considered a norm after a poisonous sting, in a short span of one month he cured 65 patients of pulmonary edema . Sodium nitroprusside is a dangerous drug which has to be rigorously monitored, and even in icus it is used with apprehension . Therefore, the next challenge was to find a safer alternative which could be easily administered even in peripheral settings . Again dr . Bawaskar was back to the library and started an extensive search in journals . Here, he chanced upon a new drug prazosin, an alpha blocker . It was advocated for refractory heart failure and was used in pheochromocytoma to control the hypertension caused by catecholamine excess . He had already discovered that the pathophysiology in scorpion sting was the pouring of catecholamines in the blood due to the venom's action on the human adrenal gland . Thus, he decided to use this drug . In 1984, he treated 126 patients with prazosin; all of them survived . In 1986, in his paper titled prazosin in the management of cardiovascular manifestations of scorpion sting was published in the lancet he put forward for the first time prazosin as a physiological antidote for scorpion stings . His work started getting recognition internationally as prazosin's success was duplicated all over the world . For this, he arranged various seminars, regularly communicated with other doctors and regularly sent them academic materials on the same issue . The case fatality rate dropped down from 40% to less than 1% with this treatment . He also kept on improvising and standardizing the regimes with regular publications in international journals such as japi, bmj, lancet, and the british heart journal, etc . Another important facet of his research is that all this work was done with out of pocket funding without any funding from government or external agencies . It makes us think, do we need all types of resources and facilities or pure passion to pursue research that could benefit mankind? Dr . Bawaskar is an exemplar for the fact that research truly related to upliftment of human life needs a higher level of dedication! He is considered an international authority on scorpion sting and has even authored two chapters in the api textbook of medicine . Prazosin as a treatment for scorpion sting has been incorporated in satoskar's textbook of pharmacology . The january 2011 issue of the british medical journal includes a full paper of his randomized trial conducted to compare the efficacy of scorpion antivenom + prazosin and prazosin alone . The same issue carries an editorial highlighting the importance of research in resource poor settings and how dr . Bawaskar had overcome the subjectivity and some shortcomings in his study by his dedication and time tested methods of clinical observation . Dr . Bawaskar currently has a private practice in mahad (maharashtra) assisted by his wife . His hospital is well equipped for primary intensive care and the couple attends to all the patients without any nursing staff . His other areas of study are the problems he has encountered first hand in the rural area . Following are some of his areas of studies which have been translated into various publications: what prompted him to study this was the fact that chronic diseases and chds have a high prevalence in this area due to excessive salt consumption, usage of coconut oil for cooking, and other lifestyle - related risk factors.alarmed with the rising cases of chronic renal failure in his native place, he studied the problem and found out that heavy metals in drinking water were an important risk factor for the same.in a small village near mahad, girls left college due to yellowish discoloration of teeth . It was diagnosed as dental fluorosis the source traced to high content of fluoride in the drinking water.based on his experience with thyroid disorders and having himself been a victim of a thyroid ailment, he developed a premonitory score to suspect hypothyroidism in a rural setting.a serendipitous observation during the treatment of scorpion envenomation prompted him to suggest that the venom might prove useful for the treatment of brugada syndrome.another common animal bite discussed in detail by dr . The absence of local reaction in krait bite masks the underlying severity and delays treatment . Thus, he observed that a victim waking up from sleep from floor bed at midnight due to abdominal pain with early ptosis should be diagnosed with krait bite . In villages, women going to toilet in the open early in the morning were seen as a risk factor for russels viper bite in which in 30 - 40% of the cases death was due to acute renal failure (arf). Early administration of asv, mannitol, frusemide, and acetylcysteine prevent arf due to the russels viper bite . Also, he suggested simple remedies as sleeping on a cot and the use of mosquito net as protection against any kind of bites.at present the bawaskar couple is investigating and has found increased levels of lead in petrol pump workers, ganpati idol makers, women using lipstick and surma . He has published a manuscript on thrombolytic therapy in ami in rural settings . What prompted him to study this was the fact that chronic diseases and chds have a high prevalence in this area due to excessive salt consumption, usage of coconut oil for cooking, and other lifestyle - related risk factors . Alarmed with the rising cases of chronic renal failure in his native place, he studied the problem and found out that heavy metals in drinking water were an important risk factor for the same . In a small village near mahad, girls left college due to yellowish discoloration of teeth . It was diagnosed as dental fluorosis the source traced to high content of fluoride in the drinking water . Based on his experience with thyroid disorders and having himself been a victim of a thyroid ailment a serendipitous observation during the treatment of scorpion envenomation prompted him to suggest that the venom might prove useful for the treatment of brugada syndrome . The absence of local reaction in krait bite masks the underlying severity and delays treatment . Thus, he observed that a victim waking up from sleep from floor bed at midnight due to abdominal pain with early ptosis should be diagnosed with krait bite . In villages, women going to toilet in the open early in the morning were seen as a risk factor for russels viper bite in which in 30 - 40% of the cases death was due to acute renal failure (arf). Early administration of asv, mannitol, frusemide, and acetylcysteine prevent arf due to the russels viper bite . Also, he suggested simple remedies as sleeping on a cot and the use of mosquito net as protection against any kind of bites . At present the bawaskar couple is investigating and has found increased levels of lead in petrol pump workers, ganpati idol makers, women using lipstick and surma . Bawaskar remains close to reality and his research is driven by day to day experience from his surroundings for betterment of human life, rather than from lucrative offers from private companies that have made medical research a commercial profession that often renders fewer outcomes for improving human health . Through many of his correspondences in various journals and books, he has voiced the concerns for ethics and principles in medical practice, hiv - related issues and practice and research in rural areas . He is an ardent advocate of importance of clinical skills in practice and community and need based research . He has over 60 publications in international and national journals to his credit including seventeen letters, one manuscript, and three case reports in the lancet . The techniques used by him may not be sophisticated yet the dedication, efforts and knowledge he has put in to sharpen those techniques have turned them into powerful weapons of his work . He proves the golden adage that the most important part of a stethoscope is between the ear pieces! He underlines the fact that research should derive its roots from the real problems of people in the community and it should be directed to solve those problems . An overview of his life finds him demanding do not judge me from where i stand, judge me from where i have come . A message from dr . We owe our learning, earning, and satisfaction to our ancestors (scientists) who blessed us with their research which gave us direction . It is our moral duty to repay them by engaging ourselves in, contributing to and publishing the research for the benefit of our future generations . This can be done only by performing our honest, sincere, and dedicated duty every single day . Never neglect what the patient or his relatives have to say since they are the sole reason of your existence as a doctor.
|
The term odontome by definition alone refers to a tumor of odontogenic origin . In a broad sense, it means a growth with both the epithelial and mesenchymal components exhibiting complete differentiation, with the result that functional ameloblasts and odontoblasts form enamel and dentin . This enamel and dentin were usually laid down in an abnormal pattern because the organization of odontogenic cells failed to reach the normal state of morphodifferentiation . Broca defined the term as tumors formed by the overgrowth or transitory of complete dental tissue . Most of the odontomes are asymptomatic, although occasionally signs and symptoms relating to their presence do occur . These generally consist of unerupted or impacted teeth, retained deciduous teeth, swelling, and evidence of infection . The world health organization defines odontomas as being of two types: complex and compound odontomas . We report an interesting case of here, we report an interesting case of compound composite odontome having tendency to exfoliate . A 21-year - old female patient reported to the department of oral medicine and radiology, with the chief complaint of hard structure inside the oral cavity, located on the posterior part of her palate . Intraoral examination revealed a white colored tooth - like structure erupting into the oral cavity . It was located adjacent to 15 region, 1 cm toward the hard palate [figure 1]. Surrounding mucosa was apparently normal and there were no signs of inflammation, pain or infection, or erythema or ulceration . Clinical photograph showing the odontoma erupting into the oral cavity maxillary occlusal radiograph revealed an abnormal single radiopaque structure [figure 2]. Maxillary occlusal radiograph showing radio - opaque tooth - like structure (arrows) this structure was extracted and it showed no morphological resemblance to any tooth of the normal series . It measured about 0.9 0.7 cm in diameter and 1 cm apico - incisally having two roots [figure 3]. After extraction the specimen was sent for histopathological examination, which was confirmed to be a compound odontoma, having a thin layer of enamel, dentin, and pulp tissue almost in the same order of arrangement as that of a normal tooth . Odontomas are the most common type of odontogenic tumor and they constitute 22% of all odontogenic tumors of the jaws . Some authors prefer to refer to it as hamartoma, not a true tumor . Paul broca in 1867 first used the term odontome . In 1914, gabell, james, and payne grouped odontome according to their developmental origin: epithelial, composite (epithelial and mesodermal), and connective tissue . In 1946, thoma and goldman formulated a classification . Geminated composite odontomes: two or more, more - or - less well - developed teeth fused together.compound composite odontomes: made up of more - or - less rudimentary teeth.complex composite odontomes: calcified structure, which bears no great resemblance to the normal anatomical arrangement of dental tissues.dilated odontomes: the crown or root part of tooth shows marked enlargement.cystic odontomes: an odontome that is normally encapsulated by fibrous connective tissue in a cyst or in the wall of a cyst.according to who classification odontomes can be divided into three groups.complex odontome: when the calcified dental tissues are simply arranged in an irregular mass bearing no morphologic similarity to rudimentary teeth.compound odontome: composed of all odontogenic tissues in an orderly pattern that result in many teeth - like structures, but without morphologic resemblance to normal teeth.ameloblastic fibro - odontome: consists of varying amounts of calcified dental tissue and dental papilla - like tissue, the later component resembling an ameloblastic fibroma . The ameloblastic fibro - odontome is considered as an immature precursor of complex odontome . Geminated composite odontomes: two or more, more - or - less well - developed teeth fused together . Compound composite odontomes: made up of more - or - less rudimentary teeth . Complex composite odontomes: calcified structure, which bears no great resemblance to the normal anatomical arrangement of dental tissues . Cystic odontomes: an odontome that is normally encapsulated by fibrous connective tissue in a cyst or in the wall of a cyst . According to who classification odontomes can be divided into three groups . Complex odontome: when the calcified dental tissues are simply arranged in an irregular mass bearing no morphologic similarity to rudimentary teeth . Compound odontome: composed of all odontogenic tissues in an orderly pattern that result in many teeth - like structures, but without morphologic resemblance to normal teeth . Ameloblastic fibro - odontome: consists of varying amounts of calcified dental tissue and dental papilla - like tissue, the later component resembling an ameloblastic fibroma . The intraosseous odontomas occur inside the bone and may erupt into the oral cavity (erupted odontoma). The extraosseous or peripheral odontomas are odontomas occurring in the soft tissue covering the tooth bearing portions of the jaws, having a tendency to exfoliate . They may be discovered at any age, although less than 10% are found in patients over 40 years of age . Although they are commonly asymptomatic, clinical indicators of odontoma may include retention of deciduous teeth, non - eruption of permanent teeth, pain, expansion of the cortical bone and tooth displacement . Complex odontomas tend to occur in the posterior region of the jaw, and compound odontomas are more common in the anterior maxilla . Odontomas have been associated with trauma during primary dentition, as well as with inflammatory and infectious processes, hereditary anomalies (gardner syndrome, hermann's syndrome), odontoblastic hyperactivity and alterations in the genetic components responsible for controlling dental development . Hitchin suggested that odontomas are inherited through a mutant gene or interference, possibly postnatal, with genetic control of tooth development . In humans, there is a tendency for the lamina between the tooth germs to disintegrate into clumps of cells . The persistence of a portion of lamina may be an important factor in the etiology of complex or compound odontomas and either of these may occur instead of a tooth . In either case, a mutation in the epithelial cells of the persistent lamina or of the tooth germ itself may change the inherent capacity of the odontogenic epithelium to go through the cap and bell stages necessary for tooth formation and still retain its ability to stimulate mesenchymal di - fferentiation necessary for hard tissue formation and to form functional ameloblasts and odontoblasts leading to a composite odontoma . Comparative investigations of odontogenic cells in normally forming teeth and tumors showed that di - fferentiation of both normal and abnormal odontogenic cells is accompanied by the expression of some common molecules . Furthermore, the genes present in normal mesenchymal cells were also found in odontogenic tumor epithelium . A plausible explanation for this is that the odontogenic tumor epithelial cells are recapitulating genetic programs expressed during normal odontogenesis, but the tumor cells demonstrate abnormal expression of these genes . The first case of an erupted odontoma was described in 1980 by rumel et al . To the best of our knowledge, since then only 20 cases have been documented in the literature, except our case . Of these cases 12 (60%) are females and 7 (35%) are males . In one case patient, age and sex the mean patient age was 25.35 years, thus confirming preferential presentation of these lesions between the second and third decades of life . Of the 20 reported cases of erupted odontoma, 9 corresponded to compound odontomas and 11 to complex odontomas . The mechanism of odontoma eruption appears to be different from tooth eruption because of the lack of periodontal ligament in odontoma . Therefore, the force required to move the odontoma is not linked to the contractility of the fibroblasts, as is the case for teeth . Although there is no root formation in odontoma, its increasing size may lead to the sequestration of the overlying bone and, hence, occlusal movement or eruption . An increase in the size of the odontoma over time produces a force sufficient to cause bone resorption . However, for this to occur dental follicle is required, although indirectly, as it provides both the conductance and chemoattraction for the osteoclasts necessary for tooth eruption . Immunocytochemical investigations have indicated that a pattern of cellular activity involving both reduced dental epithelium and the follicles is associated with tooth eruption . The reduced dental epithelium initiates a cascade of intercellular signals by expressing epidermal growth factor and transforming growth factor . These factors, in turn, stimulate the follicular cells to produce colony - stimulating factor, which recruits osteoclasts to the follicle . The reduced dental epithelium also secretes proteases, which assist in the breakdown of the follicle to produce a path of least resistance . Theepithelial signaling could explain the remarkable consistency of eruption times, as it is likely that the dental epithelium is programmed as part of its functional life cycle . However, in the case of odontomas erupting into the oral cavity, the mechanism behind the eruption times remains uncertain as some odontomas erupt at a young age and others at an older age . Thus, it is likely that resorption of the edentulous part of the alveolar process plays a role, but it is also possible that reactive growth of the capsule contributes to this phenomenon . Eruption at a young age is possible through bone remodeling that might have resulted from the presence of dental follicles . The treatment of choice is surgical removal of the lesion in all cases, followed by histopathological study to confirm the diagnosis . In the present case, the patient was 21-year - old, was asymptomatic, with the chief complaint of hard structure projecting from her palate . Based on the clinical, radiological, and histopathological findings, it was diagnosed aserupting compound composite odontome . Supplemental tooth is the one that resembles a normal tooth both morphologically and histologically and is located adjacent to the normal tooth, whereas a supernumerary tooth is a tooth - like structure of variable size and shape . However, histologically it represents the normal organization of the tooth structure, such as enamel, dentin, pulp, and cementum, including the periodontal ligament . Odontomas are considered to be hamartomatous malformation rather than true neoplasm odontomas are considered to be hamartomatous malformation rather than true neoplasm . A case of erupting compound composite odontome is presented, which was located on the palate and was extracted . Most often such cases are diagnosed as supplemental or supernumerary tooth or vice versa and need to be differentiated.
|
Allogeneic hematopoietic stem cell transplantation (allo - hsct) is currently one of the most effective methods of treatment for both hematological malignancies and nonmalignant disorders; it also represents a promising therapeutic approach in some solid tumors . Unfortunately, allo - hsct is not exempt from serious complications, such as acute graft - versus - host disease (agvhd), an immune - mediated condition caused by the attack of donor t lymphocytes against recipient tissues, which represents the primary cause of treatment - related failure . By contrast, alloimmune responses directed against malignant recipient cells have a graft - versus - tumor effect, which plays a major role in permitting the achievement and/or persistence of complete remission of the neoplastic disease . Hence, the recognition of factors involved in the regulation of alloimmune response is an essential step toward a broader and more successful application of allo - hsct . As mentioned above, agvhd is largely the result of donor t - cell alloreactivity against disparate major or minor histocompatibility antigens of the recipient . This process is strongly influenced by a plethora of membrane - bound receptors and soluble molecules capable of either up- or downregulating the duration and entity of the immune response . Among these, the cytotoxic t lymphocyte associated antigen-4 (ctla-4) cell surface molecule plays a prominent role . In humans, the ctla-4 protein is encoded by the homonymous gene located on chromosome 2p22 . The ctla-4 molecule exists as 2 isoforms: a full - length membrane - bound isoform (flctla-4) and a soluble form (sctla-4) lacking the entire transmembrane domain . The alternative splicing that generates these isoforms seems to be regulated by genetic polymorphisms within or in close proximity to the ctla-4 gene it was initially believed that sctla-4 was basally expressed in healthy individuals and, therefore, a decrease in protein expression correlated with susceptibility to autoimmune diseases . However, several studies have demonstrated elevated serum sctla-4 levels in patients with autoimmune disorders compared with healthy individuals [811]. A recent report has uncovered the importance of ctla-4 for regulatory t cell (treg) function by demonstrating that antibody blockade of ctla-4, particularly at the intestinal level, completely abrogates treg function, thus confirming the key role of ctla-4 in the determination of immune tolerance . The role of tregs in tolerance to antigens has been extensively described in a recent review . In recent reports, prez - garcia et al . Reported that the risk for agvhd was significantly increased in leukemia patients receiving a graft from a related donor homozygous for a polymorphism located downstream of the ctla-4 gene (ct60-aa). When patients were transplanted from donors with this genotype this improvement was interpreted by the authors as being the result of an increment in the graft - versus - tumor effect, thus preventing malignancy recurrence . However, the most recent studies on the role of ctla-4 polymorphisms in the outcome of allo - hsct reported different conclusions [1720]. The discrepancies observed in these previously published studies may be explained by patient heterogeneity and differences in conditioning regimens and/or study design . In an attempt to obtain further information on this debated issue, we studied the role of ctla-4 gene polymorphisms in the development of agvhd in thalassemia patients given hsct from an unrelated donor . Thalassemia patients have a competent immune system and constitute a homogeneous cohort in terms of disease, stem cell source, conditioning regimen, and gvhd prophylaxis . This clinical setting facilitates the evaluation of immunogenetic factors and their role in determining the outcome of transplantation . We retrospectively investigated the influence of + 49ag (rs231775), ct60 (rs3087243), and the polymorphic microsatellite marker ctla-4(at)n on the outcome of unrelated hsct in 72 patients affected by thalassemia major . The study was conducted on -thalassemia major patients transplanted in 3 different italian transplant centers . Approval was obtained from the local institutional review board of each participating center; informed consent was obtained from all patients or from their parents or legal guardians . The mean age of patients (41 males and 31 females) was 12.9 7.9 years . The mean age of donors (39 males and 33 females) was 33.2 8.0 years . High - resolution molecular typing of donor and recipient pairs was performed for the human leukocyte antigen (hla)-a, -b, and -c loci and the hla - drb1, -dqb1, and -dpb1 loci, as previously reported . Molecular typing confirmed that all pairs were completely identical for the hla - a, -b, -c, -drb1, and -dqb1 loci . In 33 allo - hsct (46%) both the donor and eight donors (11%) had a mismatch with the recipient for an hla - dpb1 allele . The conditioning regimen was based on the combination of either busulfan or treosulfan (16 mg / kg and 14 g / m administered over 4 and 3 days, respectively) with thiotepa (8 mg / kg) and fludarabine (160 mg / m). The remaining 29 patients were given a modified conditioning regimen with busulfan (14 mg / kg), thiotepa (10 mg / kg), and cyclophosphamide (120 mg / kg). Cyclosporin a and short - term methotrexate were used for gvhd prophylaxis in all patients . Twenty - five patients developed grade ii iv agvhd within 9 to 30 days after allo - hsct . Seven patients rejected, 4 of whom lost the graft within 100 days of transplantation . Briefly, for each sample, 20 to 50 ng of dna was amplified by polymerase chain reaction (pcr) using specific primers . Five microliters of pcr products was purified by exosap and sequenced using the dyenamic et dye terminator cycle sequencing kit (ge healthcare biosciences, piscataway, nj). After a second purification carried out using millipore montage seq (millipore, co, billerica, ma), the reactions were loaded onto a megabace 1000 capillary sequencer (ge healthcare biosciences). The pcr products, obtained using primers fluo - gcc agt gat gct aaa ggt tg-3 and 5-aac ata cgt ggc tct atg ca-3, were loaded onto an automated capillary sequencer for electrophoretic separation and registration of electropherograms . Clinical outcome was analyzed after a median follow - up period of 69 months (range 3155 months). Comparison of cumulative incidence curves in the presence of competing risks were used to assess the statistical distribution of the genotypes of ctla-4 polymorphisms in patients with and without gvhd . Analysis was performed using the publicly available software r, cmprsk package (version 2.8.1, http://www.r-project.org). Departures from hardy weinberg equilibrium and haplotype frequencies were calculated by a markov chain simulation method and the expectation maximization algorithm, respectively, as implemented in arlequin software package v. 3.0 . Chicago, il) was used to test for independence with respect to factors putatively involved in transplantation outcome . To adjust for the effects of each of the factors analyzed, multiple logistic regression was used to discriminate between associations of single polymorphisms and haplotype associations . We genotyped 2 single - nucleotide polymorphisms (49ag, ct60) and 1 microsatellite marker (ctla-4(at)n) within the ctla-4 gene in 72 thalassemia patients and their respective unrelated donors . Initially, we tested both recipients and donors for independence and the eventual presence of hidden sampling stratifications . The ctla-4 genotypes of both donor and recipient groups were in hardy weinberg equilibrium (p> 0.1). We then compared the genotype distribution for each polymorphism versus either the presence or the absence of agvhd . We determined that recipients with the ct60-aa genotype had a significantly higher risk of developing grade ii 1) or grade iii iv agvhd (36.4% vs 7.6%; p = 0.005; fig . Identical association values were obtained for the microsatellite ctla-4(at)n (88-base - pair [bp] allele). As discussed afterward, this finding can be interpreted in the light of the complete linkage disequilibrium between the a allele of ct60 and the 88-bp allele of ctla-4(at)n . Iv agvhd in recipients with the 49ag - aa genotype (23.6% vs 5.6%; p = 0.04). Multinomial cox regression was used to test whether the association observed between recipient ct60-aa genotype and susceptibility to agvhd was influenced by other factors . Both recipient and cox regression analysis demonstrated that the associations observed for ctla-4 polymorphisms were independent of other putative or known risk factors for agvhd, such as donor age, the female donor / male recipient combination, human cytomegalovirus occurrence, and hla - dpb1 mismatch (see table 1 for additional details). Given the association with more than 1 polymorphism reported in this study, we analyzed the distribution of ctla-4 haplotypes in recipients and tested the correlation of the latter with the onset of moderate or severe agvhd . Eleven haplotypes with a frequency higher than 0.02 were present in our cohort of donors and recipients . To distinguish the role of the single alleles encoded by these haplotypes, we applied logistic regression analysis using 1, 2, or 3 loci as dichotomous variables . The results indicate that susceptibility to moderate or severe agvhd is associated with the haplotype carrying the ct60-a and ctla-4(at)n 88-bp alleles . These 2 alleles were reported to be in complete linkage disequilibrium (ds = 1; p = 1 10); thus, any further attempts to dissect the role of these 2 polymorphisms were abandoned . Moreover, each of these 2 alleles can completely explain the association identified in our study cohort, which means that 1 of these 2 alleles is more likely to render the host susceptible to agvhd than the haplotype . Ctla-4 is a member of the immunoglobulin superfamily, encoding a protein that transmits an inhibitory signal to t cells that downregulates their activation . The role played by ctla-4 gene polymorphisms in determining the clinical outcome of patients given allo - hsct remains unclear . In particular, 2 recent studies did not confirm the association of ctla-4 polymorphisms with the risk of agvhd originally reported by prez - garcia et al . . Heterogeneity among studies, low statistical power, and the relatively low risk conferred by the susceptibility alleles (odds ratio <2) were considered to justify the discrepancies between the different studies . From the results of the present study, it would seem that genetic variability of ctla-4 is implicated in the development of agvhd following allo - hsct . Acute gvhd was significantly more frequent in patients homozygous for the ct60-a allele than in patients with the ct60-g allele (genotype ag+gg). Our findings are consistent with those obtained in the study performed by prez - garcia et al . . Even the fact that the association observed in our study is specific for the homozygous genotype (aa) agrees with the dominant effect of the g - allele observed by these authors . By contrast, our data provide evidence that only recipient ctla-4 genotype confers susceptibility to agvhd following allo - hsct . This finding is supported by the results of logistic regression analysis, which excluded the possibility of association with the different genotype combinations among donor and recipient pairs . Our search for loci that influence the outcome of allo - hsct was performed on a cohort of patients and their unrelated donors, which means that, except for the loci of the major histocompatibility complex, recipients and donors form 2 genetically independent groups . This offers a significant advantage over genetic studies of patients transplanted from first - degree family donors in whom the genotypes are expected to be consistent with mendelian probability . For loci not linked to the major histocompatibility complex region, the probability of genotype identity between an unrelated donor and the recipient is given as the square of the genotype frequency within the population, whereas the probability of genotype identity for a related donor is directly dependent upon the degree of kinship . For example, given the frequency of the ct60-aa genotype within our study cohort, the probability of identity with the patient for this genotype would be 1:3 for sibling donors but only 1:14 for unrelated donors . This may have caused bias in previous studies and may also explain why we observed a higher risk for agvhd compared with that observed by prez - garcia et al ., who only considered related donor genotypes . Some of the controversy in the literature may also result from the variability of conditioning regimens and the different disorders studied (thalassemia vs leukemia). It is also possible that the genetic variability of ctla-4 has a stronger impact on the outcome of allo - hsct for thalassemia than for leukemia and lymphoma . Indeed, the immune system of thalassemia patients undergoing allo - hsct is less compromised than that of patients undergoing transplantation for hematologic malignancies . In the latter patients, it is likely that the outcome is influenced by a multitude of genetic and environmental factors and that, in the end, each of these factors contributes to diluting the effect of the others . Although no study can be completely free of bias, we tried to reduce bias to a minimum by recruiting a homogeneous cohort of thalassemia patients, taking care to eliminate any environmental or other factors that could potentially limit the statistical power of the results . The association of ct60-aa genotype with better overall survival reported by prez - garcia et al . Could not be evaluated in the present study . The differences between thalassemia and leukemia, as well as the factors influencing the respective hsct outcomes, make it impossible to compare overall survival rates in these 2 patient groups . Seen from a functional viewpoint, our data support the hypothesis that the g - allele determines protection against agvhd by reducing the expression of sctla-4 . The significantly increased expression of sctla-4 associated with the ct60-aa genotype seems to determine susceptibility to agvhd by impeding or reducing the possibility of binding between b7 and membrane - bound ctla-4 expressed on activated t lymphocytes [1114]. As in autoimmune disorders, this would heighten the reactivity of effector t cells, which fail to efficiently transcribe the inhibitory signals leading to their inactivation . By contrast, our data indicate that the risk factors for agvhd induced by ctla-4 are expressed by cells of recipient origin that persist after myeloablative conditioning treatment . Donor t lymphocytes, although being the effector component of agvhd, do not seem to determine genetic susceptibility to agvhd . Our results are more in line with an alloimmune model, wherein the risk factor for agvhd acts as a single short - term rather than long - term event capable of triggering or repressing agvhd during the conditioning or early phases of the transplantation procedure . Given the present state of our knowledge, it is difficult to explain the mechanisms underlying such an event . It could be that, under inflammatory conditions, residual immunocompetent recipient cells of the intestinal tract trigger the onset of agvhd by expressing high levels of sctla-4 . Ctla-4 is a fundamental receptor for the activity of treg, which, in turn, play a pivotal role in the induction of immune tolerance during allo - hsct . Functional studies on animal models have provided evidence that specialized populations of regulatory t cells play an important role in the control of intestinal inflammation . A ratio of expression (sctla-4:flctla-4) increased for an isoform at the expense of another could have a significant impact on treg, enhancing or reducing their capacity to migrate, expand, and induce tolerance . Understanding the role of genetic factors capable of influencing the outcome is fundamental to the increasingly safer application of hsct . Genetic factors conferring protection or susceptibility to agvhd are particularly important, considering that this complication is the main cause of morbidity and mortality following hsct for thalassemia, but, conversely, can have a beneficial effect on the survival of patients transplanted for leukemias or lymphomas . Within this context, our data suggest that the determination of ctla-4 genotypes in patients is a useful tool for evaluating the pretransplantation risk that, combined with the other currently known risk factors, can form the basis for appropriate tailoring of strategies aimed at preventing the onset of agvhd.
|
Systemic sclerosis (ssc) is an autoimmune disease of unknown etiology that is characterized by vascular dysfunction and cutaneous and visceral fibrosis . Women are more frequently affected than men at a ratio of 4: 11, and the peak incidence occurs in the fourth and fifth decades of life . The prevalence appears to be increasing due to improved survival in recent decades . The symptoms with greater prognostic impact that are the main causes of death in ssc patients are pulmonary fibrosis (pf) and pulmonary arterial hypertension (pah). Although the pathogenesis of ssc remains unclear, genetic factors are thought to contribute to the disease . The hla (human leukocyte antigen) genes have been implicated in the susceptibility to ssc and in its clinical and serological manifestations [410]. Class i (hla a, b, and c) and class ii (hla dr, dq, and dp) molecules are expressed on the cell surface and participate in antigen presentation and t lymphocyte activation . Class i molecules also activate natural killer (nk) cell receptors, and class ii molecules appear to stimulate the secretion of il-6 and monocyte chemotactic protein (mcp-1) by fibroblasts, especially in antibody antitopoisomerase (ata) associated clinical forms . Susceptibility to the disease was found to be associated with the hla - dqa1 * 0501 and dqb1 * 0301 alleles in all ethnic groups . The drb1 * 1104 allele was associated with ssc in caucasian and hispanic patients, whereas drb1 * 0804 was correlated with the disease in african americans and drb1 * 1502 with japanese and koreans . Hla - drb1 * 01 and drb1 * 11 (mainly drb1 * 1101 and drb1 * 1104) were also associated with ssc . A multicenter study (gwas, genome wide association study) established hla - dqb1 as the main allele related to susceptibility . Zhou et al . Found an association of hla - dpb1 and dpb2 with increased susceptibility to the disease, primarily associated with ata . Hla - a*30, a*32, b*57, cw14, drb1 * 0701, dqa1 * 0201, dqb1 * 0202, and drb1 * 1501 were identified as protectors [4, 13]. However, much stronger correlations have been demonstrated between certain hla alleles and each of the ssc - specific autoantibodies, which may be clinically relevant because each autoantibody subset of scleroderma is associated with certain disease features and has different prognostic implications [14, 1822]. Ata antibodies have a higher frequency of the hla - drb1 * 1104, dqa1 * 0501, dqb1 * 0301, and dpb1 * 1301 alleles . Caucasian patients were associated with hla - dr5 [2325], corresponding to drb1 * 05, and japanese patients were associated with hla - dr2, drb1 * 15, or drb1 * 16 in the current nomenclature . The anticentromere antibody (aca) was related to the hla - drb1 * 01, drb1 * 04, dqa1 * 0101, and dqb1 * 0501 alleles [7, 12, 13, 23]. Considering the clinical features, the hla - drb1 allele has been associated with the limited cutaneous form (lcssc) and b*62, drb1 * 11 (drb1 * 1104), and drb1 * 07 with the diffuse cutaneous form (dcssc) [4, 9]. Some previous studies reported a correlation of the internal organ involvement of ssc and autoimmune patterns with different specific serological hla statuses, and these associations appeared to differ according to ethnicity [7, 13]. A high frequency of the drw6 and drb3 alleles related to pah has been described by langevitz et al . Some class i alleles were also related, such as a*30, b*13, b*65, and b*35, which appear to play a role in the production of endothelin-1 (et-1) in ssc [27, 28]. * 01, drb1 * 03, and dqb1 * 0501 were also related to pah and aca [29, 30]. Similarly, the dr52a and cw*0602 alleles were found more frequently in ssc with pf [4, 26]. Other alleles described for pf in the presence of ata are drb1 * 11 (drb1 * 1104) [10, 31], dpb1 * 1301, and dqb1 * 0301 [29, 30]. In brazil, a south american country with a multiethnic population, there has been no study concerning hla and ssc . The aims of this study were to evaluate hla involvement in the disease expression and to correlate the hla alleles with the poor prognostic clinical features in patients diagnosed with ssc at a university referral hospital in the city of campinas, state of sao paulo, brazil . We evaluated patients diagnosed with ssc who were followed for a period of 3 years (20082011) in the rheumatology department at the university of campinas teaching hospital, a tertiary referral hospital located in the state of so paulo, brazil . The clinical data on the patients, who were all unrelated ethnically, were obtained through a records review . The ssc diagnosis was based on the american college of rheumatology (acr) criteria for ssc . All patients were evaluated for gender, visceral involvement, and laboratory test results and underwent a routine rheumatology examination . They were classified according to cutaneous involvement as having the diffuse, limited, or sine scleroderma forms . Gastrointestinal (gi) involvement, pf, and pah were the visceral involvements that were considered . Limited disease was defined as definite skin thickening confined to the distal extremities, whereas diffuse disease showed the additional involvement of the skin proximal to the knees and elbows . The sine scleroderma form was defined according to established criteria [32, 33]. The presence and pattern of the antinuclear antibody (ana) were also evaluated . Gi tract involvement was confirmed by imaging studies (contrast radiography, esophageal emptying scintillography, and intestinal transit) and upper gastrointestinal endoscopy . Pah was defined when the right ventricular pressure was higher than 40 mmhg by doppler echocardiogram . The alteration in the systolic pulmonary artery, as it is an examiner - dependent result, was confirmed with another echocardiogram after a minimum interval of two months . When possible, these patients underwent confirmatory cardiac catheterism (medium pulmonary arterial pressure 25 mmhg). Pf was investigated by pulmonary function testing and high resolution computed tomography (hrct) and was diagnosed when the forced vital capacity or total lung capacity (tlc) was less than 70% of the predicted value . The main ct findings were hyperdense pulmonary nodules, ground glass, reticular opacities, and traction bronchiectasis . Dna was extracted from whole blood using a commercial kit (illustra blood genomic prep mini spin kit / ge healthcare bio - sciences ab, buckinghamshire, uk). Hla classes i and ii genotyping was performed by the polymerase chain reaction amplification (pcr) technique using specific primer sequences (one lambda inc / generic class i and generic class ii, ca, usa). The association among the hla alleles, different clinical features, and gender was investigated using fisher's exact test and pearson's corrected chi - square test . P values 0.05 were considered significant after correction for the number of alleles with a frequency higher than 5% (nonrare allele). The delta method was used to calculate the confidence interval (variance) of the prevalence ratio (pr). This series included 141 patients, with 120 (85.1%) women and 21 (14.9%) men . Regarding the clinical form, 47 (33.3%) had dcssc, 88 (62.4%) had lcssc, and 6 (4.3%) had sine scleroderma ssc . We also classified patients based on the main antinuclear antibody (ana) patterns . The centromeric pattern was present in 25 patients (17.7%), nucleolar in 23 (16.3%), and other patterns in 61 (43.3%). There was no evidence of an association between gender and any of the features considered (clinical forms, visceral involvement, or ana and hla alleles). We found no association of the hla alleles with the clinical forms of the disease (diffuse, limited, and sine scleroderma) or with the main patterns of ana that were considered (centromeric and nucleolar). Concerning the clinical manifestations, evidence of an association was found between pf and pah (p = 0.017)., there was an association with class i hla - a*30 (p = 0.020) and class ii drb1 * 01 (p = 0.004), dqb1 * 05 (p <0.001), and dqb1 * 04 (p = 0.019). The a*30 and dqb1 * 04 alleles were more frequent in patients with pf than in patients without pf . The presence of these two alleles was related to a higher risk for interstitial lung disease (pr = 1.86 and pr = 1.70, resp . ). However, the hla - drb1 * 01 and dqb1 * 05 alleles appeared to be protective (pr = 0.38 and pr = 0.41, resp .) (tables 2, 3, and 4). Pulmonary arterial hypertension was related only to class i b*35 (p = 0.035), c*03 (p = 0.044), and c*04 (p = 0.015) alleles . The hla - b*35 and c*04 alleles were more frequent, resulting in a greater predisposition to this feature (pr = 2.58 and pr = 2.71, resp . ). The c*03 allele was less frequent in these patients and was negatively correlated with this feature (pr = 0.13) (tables 2, 3, 4 and 5). Our study investigated the frequencies of hla class i and ii alleles in ethnically unrelated brazilian patients with ssc and the relationships of these alleles with the main clinical manifestations . Studies involving hla and ssc are important from an etiopathogenic point of view, especially the clinical perspective, as an attempt to identify patients with more severe disease . In our series, there was no evidence of an association between the clinical forms of the disease and the hla alleles . Our results did not support the previous reports of a higher skin score in the presence of the hla - b*62, drb1 * 11, and drb1 * 07 alleles [4, 9]. Concerning the clinical manifestations, there are few reports about the relationship between gi tract involvement and the hla alleles . We did not find any predisposing allele, which may be due to the high frequency of this feature, found in almost 80% of the patients . We found evidence of an association between pf and pah, which are both determinants of poor prognosis . Regarding pah, we found a higher risk in the presence of hla - b*35 and c*04 . The association with hla - b*35 had already been described, and this allele appears to be involved in the upregulation of et-1 and the pathogenesis of pah [27, 28]. Gladman et al . Found a significant association between pah and the hla - a*30, b*13, b*65, and drb1 * 03 alleles . The frequency of these alleles in our sample was 15.8% for a*30, 5.3% for b*13, 21% for drb1 * 03, and 0% for b*65 . In this analysis, c*03 was noted as a protective allele, being absent in all patients with pah . We emphasize that c*04 and c*03 were not previously described to be related to pah . Moreover, the alleles associated with an increased risk for pah, b*35 and c*04, are often interrelated . The previously described associations between pf and hla alleles were usually linked to ata [10, 2931], but we did not consider the autoantibody profiles . The cw*0602 and dr52a alleles were associated with pf [4, 26], but we did not identify these alleles as risk factors in our study . Both hla - a*30 and dqb1 * 04 played a role in the susceptibility to this manifestation . An interesting finding was a*30 as a risk factor in pf but not in pah as described by gladman et al . . In addition, the presence of the drb1 * 01 and dqb1 * 05 alleles was negatively related to pf and, therefore, considered protective . The delta method was chosen due to the study design, a cross - sectional in contrast to case - controlled study, where the odds ratio should be more suitable . The technique used for hla typing (pcr - based sequence analysis using specific primers) does not always provide the gene subtype . Our current study documents the association of some class i and ii hla alleles with the most severe clinical manifestations in a multiethnic case series . Based on these and previous results, there are clearly multiple genetic patterns in ssc, and various hla alleles were associated with different clinical and serological aspects of this disease . In conclusion, new descriptive and multicentric genetic studies are necessary for a better comprehension and definition of the disease expression in brazil.
|
The effects of smoking habits of mother during pregnancy have been studied in the past century or so in various communities and different cultures . One of the earliest studies (1) in birmingham, uk, reported in 1959 shows that infants of mothers who smoked regularly during pregnancy were on the average more than 170 g lighter than the infants of those who never smoked during pregnancy . Despite the association of the children s health with the smoking habits of mother during pregnancy have been investigated for many years and well - documented, the topic is still being studied by various research groups . (2) estimated that about 5% of infant deaths in the united states are attributable to maternal smoking while pregnant, with variations by race / ethnicity . A recently published study (3) reported that an experimental citywide smoking ban in pueblo, colorado, usa, improved maternal and fetal outcomes . (4) discussed not only the relationship of smoking habits of mothers and fetal risks, but the importance of negative impact of smoking on the health of mothers as well . They suggested that smokers have a higher chance of experiencing cardiovascular problems (deep vein thrombosis, myocardial infarction, and stroke) and pulmonary disorders (bronchitis, asthma, pneumonia, influenza) than non - smokers . In the united states, mateja et al . (5) investigated the data from the pregnancy risk assessment monitoring survey (prams) for nine states over a 10-year period (19962005), and revealed the risk factor of maternal alcohol use and smoking habits, in early pregnancy, and congenital heart defects . (6) also suggested the importance of preconception prevention efforts for women who are at dual risk for alcohol and smoking habits . (7) investigated the healthy lifestyle behaviors during pregnancy, from 2001 to 2009, in a survey from 22,604 american pregnant women aged 1844 years, and pointed out the importance of reducing alcohol use, binge drinking, and smoking and increasing fruit and vegetable consumption during pregnancy . This paper describes the association of maternal smoking habits with stillbirths, abortions, neonatal deaths, birth weights, placental weights and the outcomes on the 28 day of life . During 2001 and 2002, the first author had a fellowship at the division of clinical and metabolic genetics, hospital for sick children, toronto, canada, in the late prof . A questionnaire was developed and completed with the hospitals recorded data which have been collected over a period of 5 years from about 47,000 babies born in several hospitals in ontario . The designed questionnaire covered a comprehensive range of information on both mothers and their babies health, which were and will be the source for a series of other articles . The babies, whose records had missing data on any of the maternal or infant variables under study, were excluded from the analyses . For the purpose of this study, the mothers were classified into four categories: non - smokers, light smokers (less than 10 cigarettes per day), moderate smokers (between 10 and 19 cigarettes per day) and heavy smokers (20 or more cigarettes per day). Other groups such as sportive smoking, ex - smokers and mothers who have smoked before pregnancy and ceased during pregnancy were out of the scope of present study . Throughout this study statistical analysis was performed using the spss statistical package, version 15.0 for windows (spss, chicago, usa) and the chi - square test was used to estimate the probable association between the variables, and a p value less than 0.05 was considered statistically significant for all the tables . The odds ratios (or) the present analysis is a cohort study where the maternal smokers during pregnancy are compared with the maternal non - smokers during pregnancy . During 2001 and 2002, the first author had a fellowship at the division of clinical and metabolic genetics, hospital for sick children, toronto, canada, in the late prof . A questionnaire was developed and completed with the hospitals recorded data which have been collected over a period of 5 years from about 47,000 babies born in several hospitals in ontario . The designed questionnaire covered a comprehensive range of information on both mothers and their babies health, which were and will be the source for a series of other articles . The babies, whose records had missing data on any of the maternal or infant variables under study, were excluded from the analyses . For the purpose of this study, the mothers were classified into four categories: non - smokers, light smokers (less than 10 cigarettes per day), moderate smokers (between 10 and 19 cigarettes per day) and heavy smokers (20 or more cigarettes per day). Other groups such as sportive smoking, ex - smokers and mothers who have smoked before pregnancy and ceased during pregnancy were out of the scope of present study . Throughout this study statistical analysis was performed using the spss statistical package, version 15.0 for windows (spss, chicago, usa) and the chi - square test was used to estimate the probable association between the variables, and a p value less than 0.05 was considered statistically significant for all the tables . The odds ratios (or) the present analysis is a cohort study where the maternal smokers during pregnancy are compared with the maternal non - smokers during pregnancy . Previous stillbirths were consisted of three subgroups of no previous stillbirths, 1 previous stillbirth and 2 or more previous stillbirths . Previous abortions were divided into four subgroups of no previous abortions, 1 previous abortion, 2 previous abortions and 3 or more previous abortions . Table 1 shows the incidence of previous stillbirths and previous abortions in regard to smoking habits . It was found, that mothers who smoke have significantly more previous stillbirths (= 60.98, p <0.0001) and also previous abortions (= 290.77, p <0.0001) than mothers who do not smoke . Our data shows that there is no significant difference between non - smokers and light smokers with regard to the number of previous stillbirths (= 2.38, p> 0.30) and also to the number of previous abortions (= 8.51, p> 0.036). The frequency of previous neonatal deaths in relation to smoking habits is given in table 2 . In this study neonatal deaths were scored as being absent or 1, 2 or more . Early neonatal mortality refers to a death of a live - born baby within the first 7 days of life . Late neonatal mortality refers to a death of a live - born baby after 7 days until before 28 days of life . Our results revealed that the proportion of previous neonatal deaths was significantly higher amongst smoker mothers than non - smokers (= 45.02, p <0.0001). The results show that there is no significant difference between no - smokers and light smokers in regard to previous neonatal deaths (= 1.22, p> 0.50). Birth weight was consisted of six subgroups of 2.5 kg or less, (2.6 2.9) kg, (3.0 3.3) kg, (3.4 3.7) kg, (3.8 4.1) kg, and 4.2 kg or more . The data from the present study suggest that mothers who smoke have lighter babies than mothers who do not smoke . The differences were statistically highly significant (= 1689.11, p <0.0001). Placental weight was divided into four subgroups of 400 g or less, (400 599) g, (600 799) g, and 800 g or more . The pattern of results is similar to that found for birth weight results and indicates that those babies born to smoking mothers have significantly lighter placental weight than those born to non - smokers (= 145.20, p <0.0001). The result of smoking habits and outcome with respect to mortality up to 28th days after birth is given in table 5 . This outcome mortality consisted of the perinatal deaths plus the deaths after 7 days until 28th days after birth . It was found that babies born to heavy smokers have the highest mortality rate, and the rate, gradually increases as smoking increases . Our results show that there is no significant difference between non - smokers and light smokers (= 0.01, p> 0.90) and also no significant difference between moderate and heavy smokers (= 0.15, p> 0.60). Kllen (8) reported that maternal smoking during pregnancy is associated with a number of effects such as pre - term birth, intrauterine growth retardation, a small head circumference, and stillbirths and neonatal deaths . The smoking habits of the mothers were recorded in three categories: non - smokers, <10 cigarettes / day and 10 cigarettes / day . The results showed the stillbirths risk estimates are 0.42% and 0.32% for smokers and non - smokers, respectively . Hgberg and cnattingius (9) reported that maternal smoking during pregnancy is causally associated with stillbirth risk . They showed that compared with nonsmokers, women who smoked during the first pregnancy but not during the second do not have an increased risk of stillbirth (or 1.02; 95% ci 0.791.30), while corresponding risk among women who smoked during both pregnancies was 1.35 (95% ci 1.151.58). Gray et al . (10) studied the contribution of smoking during pregnancy to inequalities in stillbirth in scotland from 1994 to 2003 and reported that smoking during pregnancy accounted for 38% of the inequality in stillbirths . It was found that (1). There is no significant difference between moderate and heavy smoking mothers with respect to previous stillbirths where the odds ratios vary from 1.20 (95% ci: 0.64 2.25) to 1.42 (95% ci: 0.69 2.94) for 2 or more previous stillbirths, and (2) there was no significant difference between non - smokers and light smokers (<10 cigs / day) with any previous stillbirths. (= 2.38, p> 0.30) in a study (11) conducted in montreal, quebec, canada, the researchers interviewed approximately 56,000 women who had had a delivery or a spontaneous abortion in 11 montreal hospitals during the two - year period 19821984.the researchers found that 22% of the women had had previous pregnancies that ended in spontaneous abortion . Compared with women who abstained during pregnancy, women who smoked cigarettes had a 20% increase in spontaneous abortion (odds ratio of 1.20) for each 10 cigarettes smoked per day . (12) shows that they found no association between maternal smoking and the risk of spontaneous abortion . Nielsen et al . (13) has also reported that smoking status was only weakly related to spontaneous abortion after adjustment for maternal age . The results of the present study show that the previous abortion is a significant factor for women who smoke 20 or more cigarettes per day . The odds ratios for the previous number of abortions of 1, 2 and 3 are 1.54 (95% ci, 1.42 1.67), 1.97 (95% ci, 1.70 2.28) and 2.86 (95% ci, 2.30 3.55), respectively . No significant difference was observed between the light smokers (<10 cigs / day) and non - smokers (= 8.51, p> 0.036). One of the early studies on smoking and pregnancy (14) reports the prospective survey of almost 7000 women from 11 paris hospitals between 1963 and 1969 . The results show while smokers had a stillbirth rate more than three times as high (28 versus 8 per 1000 births) they found that the neonatal death rates were almost the same for smokers and nonsmokers . In a study (15) conducted in sweden between 1983 and 1985, significant relative risks for early neonatal mortality were found for multiple births (4.9) and smoking (1.2). They concluded that maternal cigarette smoking may be the most important preventable risk factor for late fetal death . The study (16) based on the number of stillbirths or neonatal deaths among infants born in sweden from 1983 to 1995 showed that maternal smoking seems to aggravate the placental abruption because the death risk in the presence of abruption increases when mother smoked (or = 1.74, 95% ci 1.45 2.08). The present results show that there is no significant difference between non - smokers and light smokers with <10 cigarettes per day (= 1.22, p> 0.50). For moderate and heavy smokers the odds ratios are up to or = 1.84, 95% ci 1.05 3.23 . In a study reported by dsouza (17) a total of 452 mothers who attended antenatal clinics regularly at st mary s hospital, manchester, uk, were selected with a normal singleton pregnancy . At each visit the mothers were asked about the number of cigarettes smoked per day, and they were grouped as follows: (a) non - smokers, (b) light - to - moderate smokers, (114 cigarettes / day), and (c) heavy smokers (15 or more cigarettes/ day). In both sexes babies born to non - smokers were heavier, longer, and had larger head circumferences than those born to heavy smokers . Smoking during pregnancy appears to have caused a general retardation in intrauterine growth, resulting in babies born with lower birth weights, shorter lengths, and smaller head circumferences . Dickute (18) reported a case - control study involved 851 newborns with low birth weight (<2500 g) and 851 normal weight newborns . The study started 1 february 2001 and ended 31 october 2002 in six main maternity hospitals in lithuania . The results showed that smoking during pregnancy in combination with the socioeconomic inequalities is significantly associated with the higher risk of low birth weight . The association of socioeconomic status with heath and birth weight has been discussed by some authors (1922). In a study in illinois, usa, keeton et al . (23) suggested that the family case management program may be effective in reducing very low birth weight and low birth weight rates among infants born to low - income women . (24) reported the prenatal smoking status of west virginia, usa, women and the associated changes in infant birth weights . A population - based secondary data analysis was conducted for all singleton infant siblings born between 1989 and 2006 . They found that infants born to women who smoked during pregnancy had significantly lower birth weights than infants born to non - smokers . The results showed that maternal prenatal smoking was the strongest predictor of low birth weight (<2500 g) with an odds ratio of 3.29 (95% ci 2.87, 3.77) for smoking during the recent pregnancy . The odds ratio is significantly reduced from the birth weight of <2.5 kg to => 4.2 kg for smoking mothers . The variation of odds ratio is from 0.95 (95% ci 0.85 1.06) to 0.18 (95% ci 0.14 0.23). Jones et al . (25) reported a study with the objective of determining whether maternal smoking during pregnancy is associated with bone mass and other growth variables in pre - pubertal children in tasmania, australia . They showed that the mothers who smoked during pregnancy had lower placental weight (56 g, 95% ci 95 to 17). (26) reported the study conducted in the county of north jutland, denmark . They examined the association between mothers smoking habits during pregnancy, taking the sex of the offspring into consideration, and the risk and prognosis of placental abruption, placenta previa, and preeclampsia . The results showed that smoking was associated with the risk of placental abruption (or=1.99, 95% ci 1.722.30) and placenta previa (or=1.88, 95% ci 1.153.07). The effect of maternal smoking on placental volume was studied (27) in 80 pregnancies categorized according to cigarette consumption: group a never smoked, b smoking <10 cigarettes / day, c smoking 1020 cigarettes / day, and d smoking> 20 cigarettes / day . The three - dimensional power doppler ultrasonography of the placenta was performed in this study and the results showed no differences in placental volume among different groups . The odds ratios for heavy smokers (> 20 cigs / day) are 0.81 (95% ci: 0.69 0.95), 0.67 (95% ci: 0.57 0.79) and 0.59 (95% ci: 0.49 0.71) for the placental weight groups of 400 599 g, 600 799 g and => 800 g, respectively . The perinatal mortality (pnm) has been defined (28) as the total number of stillbirths and deaths in the first week of life (early neonatal deaths). The sudden infant death syndrome (sids) happens usually with no known illness and typically affecting sleeping infants between the ages of two weeks to six months . Schoendorf and kiely (29) reported the results of a case - control analysis performed on data from the 1998 us national maternal and infant health survey (nmihs). They showed that sudden infant death syndrome (sids) is associated with maternal smoking during pregnancy . (30) have shown that maternal smoking during pregnancy remains the most important risk factor for sids in sweden . In the present study we defined the outcome of pregnancy as whether the infant was alive on the 28 day of life . We considered the total number of infants deaths as the sum of stillbirths and neonatal deaths (early neonatal: within the first 7 days of life and late neonatal: after 7 days until 28 day). The outcomes on the 28 day were 45923 (97.66%) lives and 1100 (2.34%) deaths . The odds ratios were 1.01 (95% ci 0.82 1.24), 1.43 (95% ci 1.23 1.66) and 1.49 (95% ci 1.24 1.79) for light smokers (<10 cigs / day), moderate smokers (10 19 cigs / day) and heavy smokers (20 cigs / day), respectively . It was found, firstly, that babies born to moderate and heavy smokers have the highest mortality rate . Secondly, there were no significant differences between non - smokers and light smokers (= 0.01, p> 0.90) or between moderate and heavy smokers (= 0.15, p> 0.60). Kllen (8) reported that maternal smoking during pregnancy is associated with a number of effects such as pre - term birth, intrauterine growth retardation, a small head circumference, and stillbirths and neonatal deaths . The smoking habits of the mothers were recorded in three categories: non - smokers, <10 cigarettes / day and 10 cigarettes / day . The results showed the stillbirths risk estimates are 0.42% and 0.32% for smokers and non - smokers, respectively . Hgberg and cnattingius (9) reported that maternal smoking during pregnancy is causally associated with stillbirth risk . They showed that compared with nonsmokers, women who smoked during the first pregnancy but not during the second do not have an increased risk of stillbirth (or 1.02; 95% ci 0.791.30), while corresponding risk among women who smoked during both pregnancies was 1.35 (95% ci 1.151.58). Gray et al . (10) studied the contribution of smoking during pregnancy to inequalities in stillbirth in scotland from 1994 to 2003 and reported that smoking during pregnancy accounted for 38% of the inequality in stillbirths . It was found that (1). There is no significant difference between moderate and heavy smoking mothers with respect to previous stillbirths where the odds ratios vary from 1.20 (95% ci: 0.64 2.25) to 1.42 (95% ci: 0.69 2.94) for 2 or more previous stillbirths, and (2) there was no significant difference between non - smokers and light smokers (<10 cigs / day) with any previous stillbirths. (= 2.38, p> 0.30) in a study (11) conducted in montreal, quebec, canada, the researchers interviewed approximately 56,000 women who had had a delivery or a spontaneous abortion in 11 montreal hospitals during the two - year period 19821984.the researchers found that 22% of the women had had previous pregnancies that ended in spontaneous abortion . Compared with women who abstained during pregnancy, women who smoked cigarettes had a 20% increase in spontaneous abortion (odds ratio of 1.20) for each 10 cigarettes smoked per day . (12) shows that they found no association between maternal smoking and the risk of spontaneous abortion . Nielsen et al . (13) has also reported that smoking status was only weakly related to spontaneous abortion after adjustment for maternal age . The results of the present study show that the previous abortion is a significant factor for women who smoke 20 or more cigarettes per day . The odds ratios for the previous number of abortions of 1, 2 and 3 are 1.54 (95% ci, 1.42 1.67), 1.97 (95% ci, 1.70 2.28) and 2.86 (95% ci, 2.30 3.55), respectively . No significant difference was observed between the light smokers (<10 cigs / day) and non - smokers (= 8.51, p> 0.036). One of the early studies on smoking and pregnancy (14) reports the prospective survey of almost 7000 women from 11 paris hospitals between 1963 and 1969 . The results show while smokers had a stillbirth rate more than three times as high (28 versus 8 per 1000 births) they found that the neonatal death rates were almost the same for smokers and nonsmokers . In a study (15) conducted in sweden between 1983 and 1985, significant relative risks for early neonatal mortality were found for multiple births (4.9) and smoking (1.2). They concluded that maternal cigarette smoking may be the most important preventable risk factor for late fetal death . The study (16) based on the number of stillbirths or neonatal deaths among infants born in sweden from 1983 to 1995 showed that maternal smoking seems to aggravate the placental abruption because the death risk in the presence of abruption increases when mother smoked (or = 1.74, 95% ci 1.45 2.08). The present results show that there is no significant difference between non - smokers and light smokers with <10 cigarettes per day (= 1.22, p> 0.50). For moderate and heavy smokers the odds ratios are up to or = 1.84, 95% ci 1.05 3.23 . In a study reported by dsouza et al . (17) a total of 452 mothers who attended antenatal clinics regularly at st mary s hospital, manchester, uk, were selected with a normal singleton pregnancy . At each visit the mothers were asked about the number of cigarettes smoked per day, and they were grouped as follows: (a) non - smokers, (b) light - to - moderate smokers, (114 cigarettes / day), and (c) heavy smokers (15 or more cigarettes/ day). In both sexes babies born to non - smokers were heavier, longer, and had larger head circumferences than those born to heavy smokers . Smoking during pregnancy appears to have caused a general retardation in intrauterine growth, resulting in babies born with lower birth weights, shorter lengths, and smaller head circumferences . Dickute (18) reported a case - control study involved 851 newborns with low birth weight (<2500 g) and 851 normal weight newborns . The study started 1 february 2001 and ended 31 october 2002 in six main maternity hospitals in lithuania . The results showed that smoking during pregnancy in combination with the socioeconomic inequalities is significantly associated with the higher risk of low birth weight . The association of socioeconomic status with heath and birth weight has been discussed by some authors (1922). In a study in illinois, usa, keeton et al . (23) suggested that the family case management program may be effective in reducing very low birth weight and low birth weight rates among infants born to low - income women . (24) reported the prenatal smoking status of west virginia, usa, women and the associated changes in infant birth weights . A population - based secondary data analysis was conducted for all singleton infant siblings born between 1989 and 2006 . They found that infants born to women who smoked during pregnancy had significantly lower birth weights than infants born to non - smokers . The results showed that maternal prenatal smoking was the strongest predictor of low birth weight (<2500 g) with an odds ratio of 3.29 (95% ci 2.87, 3.77) for smoking during the recent pregnancy . The odds ratio is significantly reduced from the birth weight of <2.5 kg to => 4.2 kg for smoking mothers . The variation of odds ratio is from 0.95 (95% ci 0.85 1.06) to 0.18 (95% ci 0.14 0.23). Jones et al . (25) reported a study with the objective of determining whether maternal smoking during pregnancy is associated with bone mass and other growth variables in pre - pubertal children in tasmania, australia . They showed that the mothers who smoked during pregnancy had lower placental weight (56 g, 95% ci 95 to 17). (26) reported the study conducted in the county of north jutland, denmark . They examined the association between mothers smoking habits during pregnancy, taking the sex of the offspring into consideration, and the risk and prognosis of placental abruption, placenta previa, and preeclampsia . The results showed that smoking was associated with the risk of placental abruption (or=1.99, 95% ci 1.722.30) and placenta previa (or=1.88, 95% ci 1.153.07). The effect of maternal smoking on placental volume was studied (27) in 80 pregnancies categorized according to cigarette consumption: group a never smoked, b smoking <10 cigarettes / day, c smoking 1020 cigarettes / day, and d smoking> 20 cigarettes / day . The three - dimensional power doppler ultrasonography of the placenta was performed in this study and the results showed no differences in placental volume among different groups . The odds ratios for heavy smokers (> 20 cigs / day) are 0.81 (95% ci: 0.69 0.95), 0.67 (95% ci: 0.57 0.79) and 0.59 (95% ci: 0.49 0.71) for the placental weight groups of 400 599 g, 600 799 g and => 800 g, respectively . The perinatal mortality (pnm) has been defined (28) as the total number of stillbirths and deaths in the first week of life (early neonatal deaths). The sudden infant death syndrome (sids) happens usually with no known illness and typically affecting sleeping infants between the ages of two weeks to six months . Schoendorf and kiely (29) reported the results of a case - control analysis performed on data from the 1998 us national maternal and infant health survey (nmihs). They showed that sudden infant death syndrome (sids) is associated with maternal smoking during pregnancy . (30) have shown that maternal smoking during pregnancy remains the most important risk factor for sids in sweden . In the present study we defined the outcome of pregnancy as whether the infant was alive on the 28 day of life . We considered the total number of infants deaths as the sum of stillbirths and neonatal deaths (early neonatal: within the first 7 days of life and late neonatal: after 7 days until 28 day). The outcomes on the 28 day were 45923 (97.66%) lives and 1100 (2.34%) deaths . The odds ratios were 1.01 (95% ci 0.82 1.24), 1.43 (95% ci 1.23 1.66) and 1.49 (95% ci 1.24 1.79) for light smokers (<10 cigs / day), moderate smokers (10 19 cigs / day) and heavy smokers (20 cigs / day), respectively . It was found, firstly, that babies born to moderate and heavy smokers have the highest mortality rate . Secondly, there were no significant differences between non - smokers and light smokers (= 0.01, p> 0.90) or between moderate and heavy smokers (= 0.15, p> 0.60). The association of smoking habits of mother during pregnancy investigated with the stillbirths, abortions, neonatal deaths, birth weights, placental weights and the outcomes on the 28 day of life . The smoker mothers were classified as light smokers (less than 10 cigarettes per day), moderate smokers (between 10 and 19 cigarettes per day) and heavy smokers (20 or more cigarettes per day). The results show that even the light smoking habit has an effect on the birth weight and the placental weight but for other characteristics, stillbirth, abortion, and the outcomes on the 28 day of life, there is no significant difference between light smokers and non - smokers . While quit smoking must be the ultimate goal for any smoker, the present study concludes that moderate and heavy smokers should reduce their number of cigarettes per day to at least the level of light smokers to achieve the same results for non - smokers . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
|
Gingival hyperplasia is a bizarre condition causing aesthetic, functional, psychological and masticatory disturbance of the oral cavity . Investigations are in evolution to establish the genetic linkage and heterogeneity associated with it . This condition may manifest as an autosomal - dominant or, less commonly, an autosomal - recessive mode of inheritance, either as an isolated disorder or as part of a syndrome . Autosomaldominant forms of gingival fibromatosis, which are usually non - syndromic, have been genetically linked to the chromosomes 2p21-p22 and 5q13-q22 . In modern times, a mutation in the son - of - sevenless (sos-1) gene has been suggested as a possible cause of isolated (non - syndromic) gingival fibromatosis, but no definite linkage has been established . Familial gingival fibromatosis is a gradually progressive benign enlargement that affects the marginal gingiva, attached gingival and interdental papilla . The fibromatosis may potentially cover the exposed tooth surfaces, thereby hampering the function of the stomatognathic system . Histopathologically, the bulbous increased connective tissue is relatively avascular and has densely arranged collagen - fiber bundles, numerous fibroblasts and mild chronic inflammatory cells . The autosomal - dominant form is often associated with hypertrichosis, corneal dystrophy, nail defects, deafnessand craniofacial deformities whereas in the autosomal - recessive form, facial anomalies with hypertelorism have been observed but most forms are without defects, other than gingival enlargement . Clinical abnormalities most commonly associated with gingival fibromatosis are hirsutism, epilepsy, oliogophrenia, mental retardation, nystagmus, strabismus, cataracts, soft tissue tumors and enlarged facial bones . We report a case of non - syndromic familial gingival fibromatosis along with its management . An 8-year - old female patient had reported to the department of pediatric surgery at the government hospital with the complaint of enlargement of gums [figure 1, 2]. The patient was unable to close her mouth because of severe enlargement of gums in both maxillary and mandibular arches [figure 3]. The patient was referred to the oral surgery outdoor for their opinion . After a detailed history, it was found that the patient's brother also had the same problem [figure 5]. The patient's father was treated for the same condition in his childhood by alveolectomy with removal of primary and permanent teeth or tooth buds . She did not have any associated medical conditions, which ruled out the possibility of any syndromic involvement . An orthopentomogram was advised, which showed all primary teeth to be erupted in alveolar bone and developing permanent teeth [figure 6] the treatment plan was to remove the fibrosed gingiva along with removal of mobile deciduous teeth . Surgery was planned in two stages after considering the age of the patient and duration of surgery . In the first stage, the mandibular arch was operated [figure 7] and the maxillary arch was operated 2 weeks later . After the second surgery, fine periodontal surgery was performed in both arches and the patient was recalled till 2 years [figure 8 and 9]. On histopathologic examination, thickened acanthotic epithelium with elongated rete ridges was seen with densely arranged collagen fibers, numerous fibroblasts and few chronic inflammatory cells, suggestive of gingival fibromatosis [figure 10]. Initially, the patient had difficulty in closure of mouth as new occlusion had to be achieved because the patient did not have any occlusion before the surgery . Right lateral extraoral view pre - operative frontal view extraoral intraoral open mouth view intraoral close mouth view orthopentomogram view post - operative intraoral view post - operative frontal extraoral view histopathology shows thickened, acanthotic epithelium, elongated rete ridges with densely arranged collagen - fibers, numerous fibroblasts and few chronic inflammatory cells gingival overgrowth varies from mild enlargement of isolated interdental papillae to segmental or uniform and marked enlargement affecting one or both of the jaws . Here, we reported a case of non - syndromic familial generalized gingival fibromatosis with multidisciplinary approach . There are multiple causes of generalized gingival fibromatosis, like mouth - breathing gingivitis, drug - induced gingival overgrowth, scurvy, hereditary gingival fibromatosis, wegener granulomatosis, acanthosis nigricans and idiopathic variety . The precise mechanism of familial gingival fibromatosis is unknown, but it appears to be confined to the fibroblasts that harbor in the gingiva . The hyperplastic response does not involve the periodontal ligament, and occurs peripheral to the alveolar bone within the attached gingiva . The growth is linked with eruption of teeth as seen in the present case, and the presence of teeth may be necessary for the commencement of the process . In severe cases, non - eruption of the primary or permanent teeth may be the chief complaint of the patient . The finest and suggested treatment modality for familial gingival fibromatosis is gingivectomy . Literature reports a high - recurrence rate after surgery, and needs a close follow - up.
|
Over the last 2 decades, various molecular imaging technologies, including positron emission tomography (pet), computed tomography (ct), single photon emission computed tomography (spect), magnetic resonance imaging (mri), ultrasound, and fluorescence reflectance imaging, have revolutionized the way that we investigate complex biochemical phenomena . Along with the rapid advances in molecular and cell biology, molecular imaging can greatly enhance the ability for researchers and clinicians to identify novel molecular targets and biomarkers, especially those involved in disease (particularly cancer) initiation, progression, and treatment response . Detection of such biomarkers can lead to faster diagnosis and treatment, better prognosis and staging, and improved management . Molecular imaging is defined as the noninvasive visualization, characterization, and measurement of biological processes at the cellular and molecular level in humans and other living systems . Because molecular imaging provides both anatomical and physiological information, it has become an essential tool in bench - side research, clinical trials, and medical practice . One of the central challenges for molecular imaging is the development of specific imaging probes that have a high target - to - background ratio and improved contrast in vivo . The ideal imaging probe should possess high affinity and specificity for target, adequate retention in the target, low nonspecific uptake, and efficient capillary permeability . To date, many ligand - mediated targeting probes have been explored, and some of them have been approved for clinical use . A few examples are the cyclic octapeptide octreotide, a peptide that targets the somatostain receptor, trastuzumab (herceptin), an antibody that binds to the antiepidermal growth factor receptor 2 (erbb2, her2) receptor, and bevacizumab (avastin), an antibody that binds to the extracellular vascular endothelial growth factor a (vegf - a). Many diseases, especially inflammatory disorders and cancer, result from complex interactions between disease - mediated ligands and growth - promoting receptors . The crosstalk with other signaling pathways complicates the use of ligand - based probes for molecular imaging . Thus, accurate knowledge of the receptor s role in the interaction between cells and their microenvironment is important . Solid tumors, for instance, are usually composed of an assemblage of distinct cell types (e.g., endothelial cells, pericytes, immune inflammatory cells, cancer - associated fibroblasts, cancer cells, cancer stem cells, etc .) That interact through the reciprocal heterotypic signaling pathway to maintain and orchestrate the tumor microenvironment . For example, epidermal growth factor (egf), vegf, other proangiogenic factors (e.g., fibroblast growth factor 2 (fgf2), chemokines, and cytokines) can amplify the inflammatory state and serve as effectors of tumor progression . Additionally, tumor heterogeneity and binding site barriers between ligand and receptor can limit the targeting and therapeutic efficiency of ligands because they are typically monospecific . In fact, mounting evidence has demonstrated that acquired resistance to antibody therapy can occur if the antibody is against a single receptor, and this resistance is often related to pathway switching between receptors . Consequently, multiple targeting, or the ability to bind multiple targets simultaneously, has become a more advantageous approach for the development of ligand - based imaging probes and therapeutics . Over the past few decades, dual targeting with bispecific peptides or antibodies has been explored in clinical trials as an alternative combination therapy for cancer patients (with over 50 ongoing or completed trials listed at clinicaltrials.gov). Heterodimers ligands are composed of two covalently linked targeting subunits and are a simple, beneficial model for the investigation of dual targeting . Recently, many bispecific heterodimers, summarized in table 1, have been developed . Compared with monoreceptor targeting compounds, bispecific heterodimers have several advantages including increased affinity, avidity, and efficacy, which establishes them as strong applicants for use in molecular imaging . In this review, we will discuss the design of bispecific peptide and antibody heterodimers and their applications in molecular targeting and imaging, with special emphasis on antibody heterodimers . We will also briefly discuss the design and application of bispecific heterodimer - conjugated nanomaterials . Two major strategies for the design of heterodimers exist . In the first strategy, the heterodimer is formed by cross - linking two ligands that target two receptors from different cells at a given location (figure 1a). This strategy is commonly used in the design of peptide heterodimers . In the second strategy, this strategy is more applicable in the design of protein - based heterodimers in which the structural integrity is of great concern during their development . Clear advantages of this strategy include greater flexibility, higher production yield, and lower binding affinity loss . Three primary approaches are readily adopted in the production of protein heterodimer: the first approach involves gene fusion and expression in escherichia coli to produce protein heterodimers in a tandem manner (figure 1a). The second approach uses somatic hybridization by two protein - secreting cells (e.g., hybridomas) along with affinity chromatography purification and is employed in the production of bispecific antibodies . The third approach is comparatively rare; it introduces mutations into monospecific proteins and screens bispecific candidates out from the mutant library (figure 1a). In which they introduced an integrin 3 binding capacity into the single - chain vegf (scvegf) by a yeast - displayed mutant library to generate a dual - specific scvegf mutant with high affinity to both vegfr2 and integrin 3 . Compared with monospecific mutants that bind only to vegfr2 or integrin 3, the dual - specific scvegf proteins demonstrated more effective inhibition of vegf - mediated receptor phosphorylation, endothelial cell proliferation, and blood vessel formation both in vitro and in vivo . In the following text (a) synthesis strategies of bispecific heterodimer based on chemical coupling, mutation / screening, and gene fusion . (b) interactions between bispecific heterodimer / monospecific ligand and cellular receptors during the molecular imaging process . After the cross - linking of two peptides, evaluation of binding affinity and specificity is essential for their imaging applications . Generally speaking, there are two primary approaches to evaluate these parameters: the first approach can be carried out in two different cell types in which one cell type overexpresses a single receptor and the other cell type overexpresses both target receptors . In the second approach, binding affinity / specificity is examined in one cell type with high expression of both receptors (figure 1b). Ligands with strong affinity for each individual receptor compete with the heterodimer during its interaction with the target cells . In both of these approaches, the key point is to confirm that the peptide heterodimer has satisfactory a binding affinity and high specificity for each of its target receptors . On the basis of these strategies, heterobivalent ligands (htbvls) were developed that contain both melanocyte - stimulating hormone (msh) and cholecystokinin (cck) peptide ligands tethered with linkers of different rigidity and length . These heterodimers could simultaneously bind melanocortin-4 receptor (mc4r) and cck-2 receptor (cck-2r), which are overexpressed in multiple cancer types including pancreatic cancer . The monovalent binding capacity of these ligands was evaluated in hek293 cells transfected with either mc4r, cck-2r, or both . The binding affinity of the optimized heterodimer to cells expressing both mc4r and cck-2r was over 20-fold higher than for cells expressing only mc4r . More recently, the same research group assessed the in vivo targeting efficacy of one heterodimer compound (named htbvl1) composed of similar peptide ligands and optimized the linker between the two ligands . Flow cytometry analysis indicated that cells expressing both receptors had higher cellular uptake of heterodimer than those expressing either receptor at a concentration of 50 nm . After systemic injection of cy5-labeled htbvl1 in tumor - bearing mice, higher uptake and longer retention were observed in tumors that overexpressed both receptors compared with single - receptor - positive tumors . Blocking with msh, cck, or both reduced the uptake of each target tumor significantly (figure 2a). These studies provide valuable insights into the design of heterobivalent ligands with high avidity: the length and conformation of the linker can be very crucial during the design of peptide heterodimers . Because the binding of one pharmacophore to its corresponding site at the target brings the second pharmacophore in close proximity to that target, the enhanced tumor affinity from heterodimers mainly arises from increases in local ligand concentration . When the pharmacophores of peptide heterodimers overlap, simultaneous binding of two peptide ligands to two different receptors is impossible . (a) molecular structure of cy5-labeled heterobivalent ligand 1 (htbvl1) and representative in vivo fluorescence images showing its specific uptake in target tumor (right flank, target tumor with mc1r and cck-2r expression; left flank, control tumor with only mc1r expression). (b) structure and spect / ct images of i - cmbp - click - c(rgdyk) heterodimer in u87 mg tumor (c - met and integrin 3 positive) at 1 (upper panel) and 4 h p.i . (lower left image). Blocking with crgdyk (lower middle image) or cmbp (lower right image) t, tumor; b, bladder; thy, thyroid; and k, kidney . Adapted with permission from ref (28). (c) pet images of ga - nota - rgd - bbn, ga - nota - bbn, and ga - nota - rgd at 1 h p.i . In pc-3 tumor - bearing mice . Adapted with permission from ref (80). Another important factor for peptide heterodimer design is the careful evaluation of the receptors of interest . The selection of targets is important for the development of bispecific heterodimers with improved tumor uptake . Epithelial transition factor (c - met) binding peptide (cmbp) was conjugated with cyclic rgd (c(rgdyk)) through a click reaction to form a cmbp - click - c(rgdyk) peptide heterodimer . This heterodimer was designed to possess the ability to recognize both c - met and integrin 3 receptors simultaneously . However, biodistribution studies and spect / ct imaging showed that despite the uptake of i - cmbp - click - c(rgdyk) in a u87 mg tumor (positive for both c - met and integrin 3) that could be blocked partially by cmbp or c(rgdyk) (figure 2b), it did not demonstrate any improvement to that of a cmbp - scrambled peptide . Monoclonal antibodies are well - established workhorses for therapeutic and diagnostic purposes, particularly in oncology . Because of their exceptional ability to recognize specific antigens, monoclonal antibodies play a central role in targeted therapeutics . However, targeting only one antigen is usually insufficient in oncology, where tumors can progress after a latency period during antibody treatment . Compared with classic monospecific antibodies, bispecific antibodies can further improve the specificity for particular antigens and serve as more powerful tools for studying the molecular mechanisms of disease and developing more potent therapeutics . By artificial manipulation of antibody genes, bispecific antibody heterodimers are being developed to enable targeting of different epitopes on the same cell surface receptors, targeting two different receptors simultaneously, and enhancing cell cell interactions . Bispecific antibodies can be produced by three main methods: chemical conjugation, hybridoma cell line fusion, and protein engineering involving recombinant dna . Chemical cross - linking of two different fragment - antigen - binding (f(ab)) fragments was the first strategy introduced in 1980s to generate bispecific antibodies . In this method, two different f(ab) a number of bispecific f(ab)2 fragments heterodimers has been produced in this manner, including anti - cea / anti - indium - dtpa, anti - id / anti - hsg, anti - cea / anti - dtpa - in, and anti - mlc1/anti - cd90 . However, chemical modification may cause the inactivation of antibody binding sites or dysfunction of the effector agents . Furthermore, chemical cross - linking requires extra purification compared to homodimer formation and often results in poor dimer stability . The resulting hybrid hybridoma secretes a heterogeneous population of antibodies, including bispecific antibodies . However, this technology also requires extensive purification procedures, and the production efficiency of bispecific antibodies is comparatively low . By far, recombinant dna technology is the most frequently used and trustworthy method for producing bispecific antibodies . This method can produce bispecific antibodies in large quantities, does not involve chemical linkage, and requires minimum purification process . A variety of antibody - based heterodimers, such as knobs - into - holes structure, bispecific f(ab)2, heterodimeric scfv, and heterodimeric fab, have been produced using recombinant dna technology . Detailed examples of bispecific antibody production will be discussed in the following paragraphs . Linear fusion of genes encoding different antibody single - chain variable (scfv) fragments was the initially used technology to produce bispecific antibodies . A recombinant linear cd3/egp-2-directed bispecific monoclonal antibody, bis-1 f(ab)2, was produced by this method . To improve the production yield of heterodimers, leucine zipper sequences were introduced into the c terminus of two different scfv fragments . Bispecific anti - cd3/anti - tac f(ab-zipper)2 heterodimers were produced by this method and demonstrated high efficacy for cytotoxic t cell recruitment . A variety of other linkers have also been used to produce heterodimers, such as the cd3/17 - 1a bispecific antibody and anti - her3/anti - her2 bispecific scfv . By fusing with a helical dimerization domain (e.g., cysteine - containing peptide, helix loop helix motif, and barnse dibarnase domain), the length and 3d structure of the linker between scfv s are closely associated with the expression abundance and immunogenicity of the final heterodimers . At the same time, this gene fusion strategy can also be applicable in the formation of bispecific antibody fragments such as diabody (db), a dimeric antibody fragment composed of the variable region of igg heavy and light chains (vh and vl) connected with a peptide linker . Coexpression of vh vl fusions in the periplasm of e. coli enables the stable production of bispecific diabodies . However, the comparatively short linker between vh and vl inside diabodies may restrict their ability to simultaneously access two antigens on two different cells . Complementary fragments from antibodies can also be used as heterodimerization scaffolds for the production of recombinant fab, spontaneous interactions between heavy chain constant domains 1 (ch1) and light chain constant domains (cl) can result in heterodimerization that forms a covalently linked heterodimer named a chcl miniantibody . One humanized immunoglobulin (igg) ch1 was connected with the cl domains of another antibody in this manner to form a bispecific anti - egfr / anti - cd2 heterodimer that has high avidity for both egfr and cd2 as well as low immunogenicity . When both domains were coexpressed in e. coli, 63% of the total proteins formed were bispecific . Another option is the interaction between fd and l chains of fab and the c terminus of a scfv molecule; in this way, bispecific fab scfv and trispecific fab(scfv)2 can be generated with up to a 90% production yield . The engineering of an antibody s fragment crystallizable (fc) region is another means to produce bispecific antibody heterodimers . In antibodies, fab the fc region of igg mediates antibody effector functions through interactions with fc receptors and serves as an important factor for an antibody s long serum half - life in vivo through interactions with neonatal fc receptors . The fc is often used to generate antibody - like fusion proteins because of its inherent dimeric nature and can be used to create complex heterogeneous antibody mixtures . Methods based on fc engineering, such as knobs - into - holes (kih), have been frequently adopted to generate heterodimeric antibody assemblies . In the kih method, amino acids are mutated within the ch3 domains of antibody heavy chains, forcing complementary heterodimeric assembly between two different heavy chains . A bispecific antibody heterodimer targeting both c - met and vegfr-2 was created by this method and exhibited potent antitumor efficacy in gastric cancer . Mutations induced via the kih method change the charge complementarity at the ch3 domain interface, promoting fc heterodimer formation and suppressing the formation of knob knob or hole unfortunately, the kih method sometimes produces bispecific antibodies with unnatural domain junctions and a loss of natural antibody architecture . Correct association of the light chains and their cognate heavy chains can be achieved by exchange of heavy - chain and light - chain domains within the fab of one - half of the bispecific antibody . Another strategy is to utilize an igg4 antibody, which readily engages in fab - arm exchange with other igg4 antibodies . The sequences essential for arm exchange are present only in the ch3 and core hinge regions of the igg4 isotype . To facilitate arm exchange in antibodies of these isotypes, minimal point mutations were introduced into the ch3 and core hinge sequences of igg1 and igg2 antibodies . The generated igg1 bispecific antibodies had faster clearance than the parental igg1 antibodies in rats, but the impact of these modifications on immunogenicity was not investigated . More recently, a modified kih method that relied on coculture of two bacterial strains (one expressing the knob and the other expressing the hole half of the antibody) was developed for the generation of nonimmunogenic, stable bispecific antibodies . After inoculating with an appropriate ratio of bacteria expressing anti - egfr and anti - met, respectively, the purified bispecific antibodies demonstrated similar monomeric stability and heterodimer purity as the bispecific antibody produced by the half antibody redox method . The resulting bispecific antibody against met and egfr could bind both targets monovalently, inhibit their signaling, and suppress met and egfr - driven cell and tumor growth . Molecular imaging of cancer with peptide ligands has attracted widespread research attention because they have relatively high affinity and excellent tissue penetration . A number of different peptide receptors are massively overexpressed in numerous cancers; examples include, but are not limited to, somatostatin receptor, gastrin - releasing peptide receptor (grpr), cck2/cck - b, glucagon - like peptide-1 receptor (glp-1), and integrin 3 . Measuring receptor expression is crucial for accurate diagnosis as well as for monitoring the response to therapy . Several peptide - based radiotracers have shown promising results in animal studies, and some of them have been investigated in clinical trials . Chemically linked peptide heterodimers, which bind to two different receptors, can increase the functional affinity and binding specificity of the probe . Recently, an integrin 3 and grpr dual - targeted peptide (rgd - bbn heterodimer) was developed and utilized in pet imaging of cancer . Aspartate (rgd) peptides can specifically target integrin 3, a molecular marker of angiogenesis, and have been successfully used for imaging by pet and spect techniques . Bombesin (bbn) is an amphibian homologue of mammalian grp, which can specifically bind to grpr, and has been extensively investigated for the diagnosis and treatment of grpr - positive tumors . Used a glutamate linker to bridge cyclic rgd and bbn and radiolabeled the fused peptide with f (t1/2: 110 min,, 100%) to investigate its dual - receptor - targeting ability in pc-3 prostate tumor xenografts (integrin 3 positive; grpr positive). They found that tumor uptake of f - fb - rgd - bbn was significantly higher than that of f - fb - bbn and f - fb - rgd, respectively . Compared with f - fb - bbn and f - fb - rgd, f - fb one limitation of this study is that the heterodimer was merged by a short glutamate linker, which compromised its simultaneous binding capacity to grpr and integrin 3 . To overcome this limitation, the same group further modified the structure of rgd - bbn by using orthogonally protected fmoc - glu - oall . The optimized rgd - bbn heterodimer was radiolabeled with ga (t1/2: 68 min;, 89%) for pet imaging . Biodistribution studies showed that pc-3 tumor uptake of ga - nota - rgd - bbn was significantly higher than that of f - fb - rgd - bbn . The tumor uptake of ga - nota - rgd - bbn was also evaluated in two different cell types: pc-3 and mda - mb-435 (grpr negative, integrin 3 positive). In the pc-3 tumor model, the tumor uptake of ga - nota - rgd - bbn was slightly higher than that of ga - nota - bbn and significantly higher than that of ga - nota - rgd at 1 h p.i . Mda - mb-435 tumors had significantly lower tumor uptake of the heterodimer compared with pc-3 tumors . In blocking studies with rgd or bbn alone (figure 2c), a partial decrease in tumor uptake was observed . When blocking with both rgd and bbn, tumor uptake of the tracer was reduced to background levels . These results indicated that the dual - targeting tracer could still bind to one available receptor while the other receptor was blocked . Several groups have used the radiolabeled chemotactic peptide cflflfk and its analogues to detect neutrophils as they target the formyl peptide receptor (fpr) on leukocytes . However, poor pharmacokinetic parameters and low detection sensitivity have limited their utility . To address these issues, a heterobivalent peptide was designed using cflflf and tkppr connected with a peg linker . The resulting cflflf-(peg)12-tkppr - tc was able to target the fpr and tuftsin receptor simultaneously . High expression of these two receptors activates polymorphonuclear leukocytes (pmns), and sites of inflammation can be monitored by imaging of pmns with cflflf-(peg)12-tkppr - tc . Spect / ct imaging showed that the accumulation of cflflf-(peg)12-tkppr - tc in the inflamed tissue was 3.15-fold higher than in the control tissue . Bispecific antibody or antibody fragments - based heterodimers have shown potential for the molecular imaging of cancer . The anti - her2 monoclonal antibodies trastuzumab and pertuzumab can inhibit the proliferation of breast cancer by preventing receptor dimerization . In one study, the tumor - targeting efficacy of anti - c - her2 741f8 - 1 (sfv)2 homodimers was compared with that of 741f8/26 - 10 (sfv)2 heterodimers, which has specificity for digoxin and related cardiac glycosides . Skov-3 tumor accumulation of i-741f8(sfv)2 was significantly higher than that of i-741f8/26 - 10 (sfv)2 at 24 h p.i .. the difference in tumor retention between 741f8 - 1 (sfv)2 and 741f8/26 - 10 (sfv)2 might have been caused by the greater effective affinity for 741f8 - 1 (sfv)2 compared with 741f8/2610 (sfv)2 . Later, another bispecific anti - her3/her2 a5-linker - ml3.9 bs - scfv (alm) was engineered with similar selective binding capacity to both target antigens in tumor cells . The accumulation of i - alm in skov-3 tumor xenografts (her2 positive / her3 positive) was significantly higher than that in either the mvm2 tumors (her2 positive / her3 negative) or mda - mb-468 tumors (her2 negative / her3 positive). At the same time, skov-3 tumor uptake of i - alm was statistically higher than either that of a5 scfv or ml3.9 scfv . Together, these results indicate that the similar binding affinity and expression levels of both targeting tumor - associated antigens are important for increasing the overall tumor retention of bispecific antibodies . Antibody fragments fused with other nonantibody proteins is another important category of heterodimers for molecular targeting and imaging . Recently, a novel bispecific radioimmunoconjugate (bsric) consisting of trastuzumab fab fragments and human heregulin-1 (hrg) was developed with the goal of imaging her2/her3 heterodimers selectively . Hrg is the targeting ligand of her3 that promotes the recruitment of her2 to the complex . Found that tumor uptake of the bsric in - dtpa - fab - peg24-hrg in bt-474 human breast cancer xenografts (her2 positive / her3 positive) was higher than that of in - dtpa - hrg in mda - mb-468 xenografts (her2 negative / her3 positive) (figure 3a). Excessive hrg or trastuzumab fab blocking decreased the uptake of in - bsrics in mda - mb-468 tumors, which demonstrated the specificity of in - bsrics for her2 and her3 in vivo . Using a similar strategy, trastuzumab fab fragments were chemically cross - linked with human egf to synthesize bsrics that recognize her2 and egfr . However, the different binding affinity of fab and egf to 231-h2n (her2 positive / egfr positive) human breast cancer xenografts and skov-3 (her2 negative / egfr positive) human ovarian cancer xenografts resulted in similar tumor uptake of in - bsrics in both tumor models . Future studies with bispecific heterodimers need to focus on choosing the correct flexible linker, ligands with similar binding affinities, and receptors that have appropriate expression levels . (a) whole - body spect / ct images of in - fab - peg24-hrg in cd1 athymic mice bearing bt-474 (her2/her3), skov-3 (her2/her3), or mda - mb-468 (her2/her3) tumors (arrows) at 48 h. adapted with permission from ref (90). (b) structure of diphtheria toxin (dt390)/anti - cd19 and anti - cd22 scfv conjugates (dt2219arl) and serial bioluminescence images of mice bearing raji - luc burkitt s lymphomas treated with or without dt2219arl . Bispecific antibodies can also cross - link different target antigens on two different cells and have been used to retarget immune effector cells to tumor cells . Multiple successful studies have demonstrated the capacity of bispecific antibodies to enhance the interactions between malignant cells and cytotoxic t cells (ctls), macrophages, or natural killer (nk) cells . If one binding site specifically recognizes the tumor - associated antigens and the other binding site is oriented against a marker for effector cells of the immune system (e.g., cd3 on t cells and cd16 on nk cells), then immune effector cell retargeting can be achieved . For instance, cd3-directed bispecific antibodies have proven to be beneficial for redirected tumor therapies . De jonge et al . Developed an anti - cd3/anti - idiotype (i d, a tumor - specific antigen) bispecific scfv that could retarget ctls toward bcl1 lymphoma cells and exhibited antitumor activity toward bcl1 . Although bispecific antibodies can trigger direct killing of tumor cells, i d variants are not always tumor exclusive and can lead to destructive immune response . Therefore, a humanized bispecific f(ab)2-her2 cd3 was further developed to retarget cytotoxic cd8 nkt cells for the immunotherapy of her2-expressing tumors . F(ab)2-her2 cd3 was found to substantially enhance cytotoxic activity of cd8 nkt cells . To directly assess the specific cytotoxic activity of cd8 nkt cells in vivo, genetically modified skov-3 tumor cells expressing luciferase were used for monitoring tumor growth and the response to therapy . They found that the bioluminescence from tumors treated with cd8 nkt cells redirected with f(ab)2-her2 cd3 was significantly weaker than that of tumors treated with cd8 nkt cells alone or f(ab)2-her2 cd3 . Additionally, animals treated with cd8 nkt cells redirected with f(ab)2-her2 cd3 had the highest survival rate at week 21 . The cd19 antigen is expressed in virtually all b - cell malignancies . To treat leukemia and malignant lymphomas, a bispecific heterodimeric diabody, cd3 cd19, specific for the -chain of the cd3/tcr complex and cd19 on b cells, was constructed . The cd3 cd19 diabody could specifically interact with both cd3-positive and cd19-positive cells and inhibited the growth of b lymphoma xenografts in immunodeficient mice before preactivated human peripheral blood lymphocytes could . To enhance the selective killing efficiency of tumor cells, antibodies can be also coupled with immunotoxins . Anti - cd19 immunotoxins have reported anticancer effects, and anti - cd22 immunotoxins have been successfully used to treat rare hairy cell leukemia . However, toxin - related side effects limited their clinical application . To address these issues, vallera et al . Fused diphtheria toxin (dt390) with anti - cd19 and anti - cd22 scfv to generate a novel bispecific fusion protein dt2219, which had broader reactivity in recognizing and inhibiting b - cell malignancies . To increase the targeting ability of dt2219, reverse - oriented vh vl domains of anti - cd19 and anti - cd22 sfv seventy five percent of the dt2219arl - treated mice were found to be completely tumor free on day 87 after intravenous injection with raji - luc burkitt s lymphoma (cd22 positive / cd19 positive). Additionally, luciferase bioluminescent imaging of untreated mice showed tumor present in the lung, bone marrow, and spinal cord on day 21 (figure 3b). These data indicate that dt2219arl can prevent and kill malignant b cells in vivo . By retargeting immune effector cells or targeted delivery of immunotoxins to tumor cells, bispecific antibody heterodimers can be used in tumor therapy, and this therapy can be monitored using molecular imaging . Although a number of successful studies have been carried out with bispecific antibodies and antibody fragments, molecular targeting / imaging with bispecific antibody heterodimers is still in its infancy . The careful choice of targets, optimization of protein fusion technology, and improved binding capacity for both of the targets will always be needed during the development of bispecific antibody - based molecular targeting / imaging agents . To meet these requirements, nanomaterials nanoparticles offer the ability to deliver a larger therapeutic payload per target recognition event than traditional probes and are able to carry multiple targeting agents for therapy or imaging of tumor cells . These multispecific nanoparticles can be divided into two categories: nanomaterials conjugated with two different ligands that target their individual receptors or nanomaterials conjugated with bispecific ligands . Although dual - ligand modification of nanomaterials is not readily achievable, mounting attempts have already been devoted to produce bispecific nanomaterials for drug delivery, gene delivery, or combination therapy of cancer . However, molecular imaging research with those types of bispecific nanomaterials is extremely limited, and so far, there is only one report using a bispecific liposome to target integrin v3 and neurokinin-1 receptor in glioblastoma . Unfortunately, there was no observable tumor - uptake enhancement compared with that of an unconjugated liposome in this study, which was monitored by spect / ct (figure 4a). Combined peptide - grafting and phage - display techniques to generate a high - affinity bispecific antibody fragment that can be strongly absorbed onto gold nanoparticles . They designed and constructed multispecific antibodies by joining gold - binding and egfr - binding antibody fragments; these antibodies were used to enhance the surface plasmon resonance (spr) scattering signal from gold nanoparticles followed by their use for spr imaging of cancer cells (figure 4b). Using a similar strategy, an anti - gold antibody fragment, a14p - b2, was fused with an anti - hen egg white lysozyme antibody fragment, hyhel10 fv, to generate a bispecific diabody . The resulting diabody enabled the functionalization of gold nanoparticles and allowed for selective protein accumulation on a gold - patterned silicon substrate . (a) spect / ct images of u87 mg tumor - bearing mice 4 h p.i . Of in - labeled rgd - liposome, rgd / substance p - liposome (bispecific), and nontargeted liposome . Adapted with permission from ref (109). (b) diagram depicting the bottom - up assembly of the zno - binding e32 vhh dimer and surface plasmon resonance (spr) images of a431 cells treated with the gold - binding e32 vhh fragment . Adapted from ref (110). (c) schematic illustration of nanoparticle - mediated coupling between a malignant b cell and a dc and fluorescence image of bjab cells (green cytoplasm) attached to dcs (blue nuclei). Another application for heterodimer - modified nanoparticles is to redirect the immune cells to recognize and eliminate the tumor cells . Bispecific antibody (anti - cd20/anti - cd86)-conjugated gold nanoparticles were recently designed to selectively attach malignant cells (burkitt lymphoma b cells; bjab) to antigen - presenting cells (human monocyte - derived dendritic cells; dcs) (figure 4c). The resulting nanoparticles caused widespread cell fusion and the formation of hybrid cells after femtosecond pulse irradiation . A relatively uniform distribution of the individual gold nanoparticles on the plasma membranes of both cells was observed . After mixing bjab and dc in a 1:1 ratio, the cells formed pairs or small clusters in the bispecific nanoparticle - treated group at levels that were more than 4-fold higher than the single antibody nanoparticle or nonspecific anti - egfr - coated nanoparticle - treated groups . Thus, the anti - cd20/anti - cd86-conjugated gold nanoparticles offer a simple and effective method to boost specific fusion / interaction between different cells . As an interdisciplinary field involving physics, chemistry, engineering, biology, and medicine, nanotechnology has the potential to improve the early detection, accurate diagnosis, and personalized treatment of various diseases, especially cancer ., heterodimers can assist in the functionalization of certain nanoparticles as well as link different nanomaterials, allowing for the generation of new nanomaterials with novel characteristics . On the other hand, nanomaterials provide a versatile platform to enhance the applicability of different types of heterodimers for drug delivery and theranostic purposes . Given the wide range of physiological processes involved in disease progression, a number of promising molecular targets exist for the development of molecular imaging probes . Powerful probes with optimal in vivo biodistribution and imaging characteristics are required for such technologies . Bispecific ligand - based heterodimers have potent binding affinity and efficacy compared to traditional probes, making them promising candidates for molecular targeting and imaging applications . On the basis of the quantitative data acquired from different imaging studies, bispecific heterodimers usually display a significantly improved target - to - background ratio (the ultimate holy grail pursued in molecular imaging) compared with their monospecific peers because of the enhanced specificity brought by the binding of two targets . Bispecific peptide heterodimers can be easily prepared by chemical conjugation of two peptides that bind different targets via a flexible linker . However, the length and rigidity of the linkers play an important role in the in vitro and in vivo characteristics of peptide heterodimers . Thus, the choice of appropriate linkers is crucial for their design and screening . Apart from this, careful analysis of the receptor expression patterns and selection of appropriate imaging labels are prerequisites for the development of suitable bispecific peptide heterodimers for a certain disease . In many scenarios, the cell signaling pathways of two targeted receptors are interconnected, which provides the foundation for bispecific peptides to trigger additive or synergistic biological effects in vivo . Following these guidelines, a number of bispecific heterodimers have demonstrated excellent tumor - targeting capability . Compared with bispecific peptide heterodimers, most bispecific antibodies possess higher affinities for both targets and are readily applicable for the treatment of cancer and inflammatory diseases . Although the use of bispecific antibody heterodimers in molecular imaging is still in a very preliminary stage, their enhanced affinity and ability to target different epitopes make them promising imaging probes . Recent studies have shown that molecules with molecular weights of approximately 60100 kda (i.e., diabodies, triabodies, or tetramers) are ideal for tumor targeting because of their increased tumor penetration and fast clearance . These probes have the potential to make same - day imaging possible for clinical applications . Exploring suitable truncated forms is necessary for the future development and optimization of bispecific antibodies for a variety of molecular applications . For the success of bispecific heterodimers in molecular imaging applications, understanding a receptor s expression pattern and its role in the cross - talk between tumor cells and their microenvironment is crucial . Fine tuning the heterodimer s properties (e.g., size, fusion types, specific amino acid mutations, pharmacokinetic adjustment, etc .) Can also impact its stability, biodistribution, and tumor - to - background ratio . The affinity between ligand(s) and receptor(s) is dependent on a series of parameters such as charge, polarity, aromaticity, residue volume, surface area, or solvent accessibility . Inside a bispecific heterodimer molecule, a ligand with lower affinity could still serve to further improve the binding capacity of a ligand with higher affinity as long as the relevant physical / chemical properties of the high - affinity ligand can be optimized . Through careful analysis of these parameters, bispecific heterodimers with optimized pharmacokinetic and imaging characteristics can be developed, improving both the management of patient s with various diseases and disease - related bench - side research.
|
The immune system is delicately balanced between immunity and tolerance to protect the host from pathogens while minimizing local damage to tissues . Indoleamine 2,3-dioxygenase (ido) is an endogenous molecular mechanism that contributes to this immune regulation in a variety of settings . Ido seems to be critical in limiting potentially exaggerated inflammatory reactions in response to danger signals and in assisting regulatory t - cell effector function . In addition, ido is an important component of a regulatory system that allows long - term control of immune homeostasis as may be required by tolerance to self or during pregnancy . Ido is a major inhibitor of the effector phase of the immune response [45, 50]. Ido expression can suppress effector t cells directly by degradation of the essential amino acid tryptophan . Some of the biological effect of ido is mediated through local depletion of tryptophan, but is in addition mediated via immune modulatory tryptophan metabolites [4, 30]. Thus, regulation of tryptophan metabolism by ido in dendritic cells (dc) is a highly adaptable modulator of immunity . When ido dc are injected in vivo, they create suppression and anergy in antigen - specific t cells in the ln draining the injection site [3, 25]. Effector t cells starved of tryptophan are unable to proliferate and go into g1 cell cycle arrest . An ido - responsive signaling system in t cells has been identified, comprising the stress kinase gc non - derepressing 2 kinase (gcn2). Gcn2 responds to elevations in uncharged trna, as would occur if the t cell were deprived of tryptophan . Another effect of ido is mediated through enhancement of local treg - mediated immune suppression . Constitutive ido expression in dc provides t cells with regulatory properties that block t - cell responses to antigenic stimulation . The b7 receptors on ido dc bind to ctla4 on tregs causing them to proliferate and induce antigen - specific anergy . Thus, ido does not only suppress effector t cells directly but also influence tregs bystander suppressor activity [2, 32, 39]. It has been described that exposure of tregs to pro - inflammatory cytokines like il-6 induce reprogramming of mature tregs to acquire a phenotype resembling pro - inflammatory th17 cells [6, 49, 51]. Ido stimulates treg bystander suppressor activity and simultaneously blocks the il-6 production that is required to convert tregs into th17-like t cells [2, 39]. The phenotype of reprogrammed tregs after ido - blocking have been described as similar to that of polyfunctional t - helper cells co - expressing il-17, il-22, il-2 as well as tnf- . Thus, ido suppression of pro - inflammatory processes may dominantly block effector t - cell responses to antigens encountered . Conversely, absence of ido activity may not elicit local treg suppression even when strong pro - inflammatory stimuli are present . Finally, it was recently shown that ido has a non - enzymic function that contributes to tgf- driven tolerance in non - inflammatory contexts . Ido may contribute in a critical manner to inhibit or terminate inflammation and are highly overexpressed in cancer [14, 22]. In cancer patients, ido elevation occurs in a subset of plasmacytoid dc in tumor - draining lymph nodes . In addition, ido may be expressed within the tumor by tumor cells as well as tumor stromal cells, where it inhibits the effector phase of immune responses . Activation of ido in either tumor cells or nodal regulatory dc each appears to be sufficient to facilitate immune escape of tumors . In this regard, it has been described that expression of ido in tumor cells is associated with an impaired prognosis . In a murine model, it was observed that tumor cells transfected with ido became resistant to immune eradication, even in mice in which a fully protective immune response had been established by immunization . Ido - expressing cd19 plasmacytoid dc isolated from tumor - draining ln mediate profound immune suppression and t - cell anergy in vivo [25, 37], whereas plasmacytoid dc from normal lns and spleen do not express ido . In this respect, it should be noted that very few cells constitutively express ido in normal lymphoid tissue except in the gut . It is believed that constitutive ido expression in dc in tumor - draining ln is induced by stimulation from tregs migrating from the tumor to the draining ln . The induction of ido converts the tumor - draining ln from an immunizing into a tolerizing milieu . All in all, ido is a critical cellular factor contributing to immune suppression and as such is a crucial mechanism in cancer . Hence, ido has become a very attractive target for the design of new anticancer drugs and several ido inhibitors are under investigation in preclinical as well as in clinical studies . In particular, the compound 1-methyl - tryptophan (1mt) has been widely studied as an inhibitor of ido activity . Interestingly, recent studies have shown that the racemer d-1-mt has superior antitumor activity compared to the racemer l-1-mt . Ido2 functions like ido in tryptophan catabolism, but it has been found that d-1mt but not the l-1mt isomer selectively and potently inhibits ido2 activity suggesting that ido2 activity may have a role in the inhibition of immune responses to tumors . In this respect, ido2 expression has been found in human tumors, including gastric, colon, renal, and in pancreatic tumors ido2 expression have been found both in tumor cells as well as in immune cells in tumor - draining ln . It is not yet known to what extent each isoform of ido contributes to tumor - related immune suppression and how much clinical benefit (or autoimmune toxicity) targeting one isoform over another confers . Despite the fact that neoplastic transformation is associated with the expression of immunogenic antigens, the immune system often fails to respond effectively and becomes tolerant toward these antigens . As described above ido plays a critical role in the tolerance induction and immune suppression of anti - cancer immune responses . We sat out to determine if and how ido itself serve as target for specific t - cell responses, which may be exploited for immune therapy . This was done by identifying and characterizing specific t cells spontaneously present among peripheral blood mononuclear cells (pbmc) isolated from cancer patients of different origin . In this regard, we described that peptides comprised in the ido protein sequence are spontaneously recognized by cytotoxic t cells (ctl) in cancer patients (fig . 1principle of the processing pathway of ido peptides by ido - expressing cells (red), for example, tumor cells or dendritic cells and the subsequent recognition by specific cd8 t cells (green; here entitled a supporter t cell (tsup).the epitopes recognized by the t cells are short ido - derived peptides resulting from the degradation of intracellular ido protein, which are presented on the cell surface of hla molecules . T cells receive an activation signal through their t - cell receptor complex, leading to a variety of functional consequences, including release of cytokines and cytotoxic molecules principle of the processing pathway of ido peptides by ido - expressing cells (red), for example, tumor cells or dendritic cells and the subsequent recognition by specific cd8 t cells (green; here entitled a supporter t cell (tsup).the epitopes recognized by the t cells are short ido - derived peptides resulting from the degradation of intracellular ido protein, which are presented on the cell surface of hla molecules . T cells receive an activation signal through their t - cell receptor complex, leading to a variety of functional consequences, including release of cytokines and cytotoxic molecules first, we identified hla - restricted peptides within the ido protein to which spontaneous t - cell reactivity were detected in patients suffering from unrelated tumor types, i.e., melanoma, renal cell carcinoma and breast cancer by flow cytometry using hla / peptide tetramers as well as in elispot assays after in vitro stimulation but also in direct ex vivo assays . Such ido - reactive cd8 t cells were peptide - specific, cytotoxic effector cells . Thus, ido - specific t cells effectively lysed ido cancer cell lines of different origin, such us colon carcinoma, melanoma, and breast cancer as well as directly ex vivo enriched leukemia cells . Ido driven immune suppression is a general mechanism that has been described in a variety of human cancers and the immune responses against ido seem likewise to be relevant in cancers of unrelated origin, which emphasize the immunotherapeutic potential of ido . However, even more distinctive was our finding that ido - specific ctl recognized and killed ido, mature dc; hence, ido - specific t cells were in addition able to kill immune - regulatory cells . We could at first not detect spontaneous responses against ido in the control group of healthy individuals . Thus, although ido has immune suppressive functions, the constitutive up regulation of ido expression in cancer patients seemed to induce ido - specific t - cell responses . Ido is playing a crucial role in immune regulation and is inducible under normal physiological conditions . Thus, we found the apparent lack of tolerance against ido intriguing, since it suggested a more general role of ido - specific t cells in the regulation of the immune system . We hypothesized that such cells could take part in the control of immune homeostasis; ido - specific cd8 t cells could play an important role by eliminating ido cells thereby suppressing and/or delaying local immune suppression . Hence, we continued our search for possible ido - specific t - cell responses in healthy donors and found that circulating ido - specific, cytotoxic cd8 t cells indeed were present in healthy donors although not as frequent as in patients with cancer . Furthermore, we were able to directly link the up regulation of ido with ido - specific t cells by showing that the addition of ido - inducing mediators like ifn- and cpg odn generated measurable numbers of cd8 ido - specific t cells among pbmc . To examine a possible immune - regulatory effect of ido - specific t cells, we examined their effect on t - cell immunity against viral or tumor - associated antigens . In this respect, we found that the presence of ido - specific cd8 t cells boosted cd8 t - cell responses against other antigens probably by eliminating ido suppressive cells (fig . 2). Supporter t cells (tsup) due to their immune enhancing function .fig . 2ido - specific t cells are able to boost specific immunity against virus or tumor antigens in human pbmc . A when stimulating pbmc with a known hla - restricted t - cell virus epitope and il-2, epitope - specific t cells begin to expand due to activation by antigen presenting cells (apc). In response to the subsequent production of cytokines like inf-, ido expression is induced and ido - expressing apc inhibit further expansion of virus - specific t cells both directly and indirectly through activation of tregs . B the addition of cytotoxic, ido - specific t cells (tsup) removes immune suppressive cells from the pbmc culture thereby facilitating further expansion of virus - specific t cells ido - specific t cells are able to boost specific immunity against virus or tumor antigens in human pbmc . A when stimulating pbmc with a known hla - restricted t - cell virus epitope and il-2, epitope - specific t cells begin to expand due to activation by antigen presenting cells (apc). In response to the subsequent production of cytokines like inf-, ido expression is induced and ido - expressing apc inhibit further expansion of virus - specific t cells both directly and indirectly through activation of tregs . B the addition of cytotoxic, ido - specific t cells (tsup) removes immune suppressive cells from the pbmc culture thereby facilitating further expansion of virus - specific t cells ido expression contributes to the strength and duration of a given immune response due to its inflammation - induced counter - regulatory function . Thus, any supportive effect of ido - specific t cells on other immune cells may well be mediated in several direct and indirect manners . In this respect, the level of tryptophan was elevated, the frequency of tregs decreased, and the frequency of il-17 producing cells increased when ido - specific t cells were present, which taken together suggest an overall decrease in ido activity . Furthermore, ido - specific t cells increased the overall production of both il-6 as well as the other pro - inflammatory cytokine tnf-. In contrast, we observed a decrease in il-10 . Another possible effect of ido - specific t cells could be mediated through the metabolites of tryptophan, which have been shown to be directly toxic to cd8 t cells and cd4 th1 cells, but not th2 cells . Hence, increased ido activity seems to tilt helper t - cell polarization toward a th2 phenotype . The presence of activated ido - specific, cytotoxic t cells may screw the th - response in a th1-direction . Finally, it should be noted that ido cells may be immune suppressive by other means than by the expression of ido . Hence, the same cells might express, for example, arginase, pd - l1 or immune - regulatory cytokines (e.g., il-10 and tgf-). Hence, ido - specific, cytotoxic t cells may not only reduce ido - mediated suppression directly but in addition further immune suppression mediated by ido regulatory cells . Recently, we identified spontaneous cd8 t - cell reactivity against the ido analogue ido2 in peripheral blood of both healthy donors and cancer patients . Furthermore, we confirmed that ido2-reactive cd8 t cells were peptide - specific, cytotoxic effector t cells . Hence, isolated and expanded ido2-specific t cells effectively lysed cancer cell lines of different origin, that is, colon carcinoma cells as well as breast cancer cells . However, ido2-specific t cells did not seem to kill melanoma cells although they expressed ido2 . At least, we did not observe killing of three different ido2 melanoma cell lines . Likewise, ido2-specific t cells did not seem to support other immune responses in the same way as ido - specific, cytotoxic t cells . Hence, the function and potential role of the ido2-specific class - i - restricted lymphocytes present in peripheral blood still need to be resolved . We speculated that cd4 ido - specific t cells releasing pro - inflammatory cytokines may play a role in the early phases of an immune response as a counter - response to the induced immune suppression facilitated by ido cells . Hence, ido - specific th1-cells may delay local immune suppression if the activation of an ido - specific cd4 th1-response could overcome the immune suppressive actions of the ido protein, which are otherwise a result of the early expression of ido in maturing dc or macrophages . Indeed, identified detectable numbers of specific cd4 t cells both in cancer patients as well as healthy individuals . We found that such ido - specific cd4 t cells released inf- as well as tnf-. Although, we were able to detect both inf- and tnf- response toward ido in healthy donors, the responses were more frequent in cancer patients . The cancer relevance of these cd4 t cells were further underlined, since ido - reacting t cells in addition react toward dc pulsed with ido tumor lysates . Interestingly, we detected a correlation between patients harboring cd4 and cd8 responses against ido, which that class - i- and class - ii - restricted ido responses co - develop . Furthermore, we detected frequent ido - specific cd4 t - cell responses when examining for il-17 release upon stimulation with the ido - derived cd4 epitope . Il-17 has been the focus of great interest recently since the production of il-17 is characterized to a subset of cd4 t - helper cells (th17 cells). One of the main roles of th17 cells is believed to be promoting host defense against infectious agents . Th17 cells are thought to be particularly important in maintaining barrier immunity at mucosal surfaces such as in the lungs, gut, and skin . Interestingly, ido is expressed at high levels in the gastrointestinal tract, although its precise role in intestinal immunity is not well understood . One could speculate that a fraction of the th17 that are highly prevalent at the mucosal tissues of healthy individuals is recognizing ido; however, this is yet to be established ., th17 cells might have a protective role in tumor immunopathology by promoting antitumor immunity . Tumor - infiltrating th17 cells express other cytokines in addition to il-17, which might be functionally relevant . A large fraction of th17 cells produce high levels of effector cytokines such as il-2, inf- as well as tnf . Ido - specific th17 cells seemed to exhibit a similar effector t - cell cytokine profile . We could in contrast not detect any release of the th2 cytokine il-4 in response to the ido - derived peptide . It was recently suggested that the foxp3 treg cell lineage in addition to immune suppression have an unappreciated helper role . Th17-like effector cells were distinguished by their unique ability to deliver help immediately and spontaneously, without needing prior priming or pre - activation . It was suggested that these cd4 lineage cells correspond to a pool of constitutively primed first responder cells . Ido plays an important role in this conversion of foxp3 tregs to th17-like effector cells [2, 39]. Thus, it is possible that ido - specific t cells could in addition belong to a foxp3 lineage of constitutively primed first responder th17-like t cells; however, it should be strengthen that this is speculation . Naturally, some cd4-positive ido - specific t cells could in addition be immune suppressive tregs . It would be obvious that ido - specific tregs may enhance the ido - mediated immune suppression protecting cells from an immune attack . In this regard, we have previously described specific regulatory cd8 t cells in cancer patients, which recognized the immune suppressive heme oxygenase-1 . Il-10 is mainly expressed by tregs that have been defined as a specialized subpopulation of t cells that act to suppress activation of the immune system and thereby maintain immune system homeostasis and tolerance to self - antigens [34, 35]. We could in addition in some donors detect il-10 release in response to the ido - derived cd4 epitope peptide . Hence, the role of ido - specific cd4 t cells in immune - regulatory networks may be a complex balance between activation and inhibition depending on the microenvironment . Interestingly, in some donors we detected background il-10 release in in vitro pre - stimulated elispot assays . This enabled us to recognize that stimulation with the ido - derived peptide in two healthy donors triggered an overall suppression of il-10 . In this regard, we have previously observed a decrease in il-10 when ido - specific cd8 t cells were present . Ido may exhibit its immune inhibitory functions both in the activation phases (in the draining lymph node) as well as in the effector phases (at the site of the tumor). With regard to the latter, ido may even by induced as an inflammation - induced counter - regulatory mechanism . Counter - regulatory responses are important in the immune system as they help to limit the intensity and extent of immune responses, which otherwise could cause damage to the host . However, with regard to anti - cancer immunotherapy, counter - regulatory responses antagonize the ability to create an intense immune response against the tumor . Counter - regulation differs from tolerance in the sense that counter - regulation is a secondary event, elicited only in response to immune activation . Ido is known to be induced by both type i and ii interferons, which are likely to be found at sites of immune activation and inflammation [31, 36]. In this respect, it should be mentioned that the susceptibility of tumor cells to lysis by ido - reactive t cells were increased by pre - incubation with ifn- . Hence, in cancer immune therapy, the boosting of ido - specific immunity could have both direct and indirect effects (fig . First of all, ido - specific, cytotoxic t cells are able to directly recognize and kill ido cancer cells . In fact, it may even be speculated that the measurable reactivity to this antigen in normal individuals contributes to immune surveillance against cancer . Furthermore, the induction of ido - specific immune responses by therapeutic measures could function highly synergistic with additional anti - cancer immune therapy not only by eliminating cancer cells but in addition immune suppressive cells . By definition, anti - cancer immune therapies aim at the induction of an immunological activation and inflammation . The therapy aims to induce as much immune activation as possible (within the limits of acceptable toxicity), and, accordingly, immune suppressive counter - regulation is not desired.fig . 3vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells (apc) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . Ido may exhibit its immune inhibitory functions both in the activation phases (in the draining lymph node) as wells as in the effector phases (at the site of the tumor). Hence, an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells (apc) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . Ido may exhibit its immune inhibitory functions both in the activation phases (in the draining lymph node) as wells as in the effector phases (at the site of the tumor). Hence, an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells adoptive transfer of ex vivo expanded tumor - infiltrating lymphocytes (til) after host lymphodepletion has the potential to significantly improve the prognosis of patients with metastatic melanoma . The impressive clinical responses associated with adoptive transfer of til urge that this strategy is pursued and investigated for the treatment of other types of cancer . In this regard, patient ido - specific t cells isolated and expanded from pbmc may well be an interesting supplement to the ongoing adaptive t - cell transfer strategies . It goes without saying that the possible introduction of autoimmunity and toxicity are the major worries when targeting a molecule like ido . However, the circulation of a measurable number of ido - specific t cells did not seem to cause autoimmunity . Furthermore, since ido - specific t cells can be introduced by ifn or cpg this appears to be under solid control . In this regard, an interesting aspect of ido is that systemic inactivation at the organism level, either pharmacologically or genetically, does not appear to cause autoimmunity . We believe that the findings that presented here justified and warranted clinical testing to evaluate the efficiency and safety of ido - based vaccinations . Hence, we initiated a phase i vaccination study, which is ongoing (from june 2010) at center for caner immune therapy, copenhagen university hospital, herlev, in which patients with non - small cell lung cancer (nsclc) are vaccinated with a ido - derived peptide with montanide adjuvant (www.clinicaltrials.gov; nct01219348). It has been suggested that ido may rather be involved in tolerance to non - self - antigens than self - antigens in situations where immune non - responsiveness may be important, for example, during pregnancy . In this respect, induction of ido immune - regulatory dendritic cells (dc) have been described to occur during infection of dcs with viruses and intracellular pathogens . In listeria monocytogenes infections, such ido dc seems to be involved in protection of the host from granuloma breakdown and pathogen dissemination in advanced human listeriosis . Likewise, it was recently described that ido is increased in lymph nodes in cutaneous leishmania major infection . Ido is implicated in suppressing t - cell immunity to parasite antigens and ido inhibition reduced local inflammation and parasite burdens, which suggest that ido were of benefit for the pathogen, not the host . During hiv infection, multiple mechanisms involving both viral and cellular components contribute to enhance ido expression and activity in an uncontrolled manner . Among others, furthermore, it was recently described that ido is increased in hemodialysis (hd) patients compared to healthy donors . Furthermore, ido suppresses adaptive immunity in hd patients as it is assessed by the response to hbv vaccination . Hence, the targeting of ido could have synergistic effects in anti - viral immune therapy, for example, in hepatitis b vaccines . The fact that ido may be involved in tolerance to non - self - antigens might have major implications for ido - based immune therapy as boosting immunity to neoantigens, but not normal self - antigens, by triggering ido - specific t cells is very attractive . Since ido - expressing cells might antagonize the desired effects of other immunotherapeutic approaches targeting ido - expressing cells by vaccination however, it was recently described that although ido might play biologically important roles in the host response to diverse intracellular infections like toxoplasma gondii, leishmaniasis, and herpes simplex virus, the nature of this role that being antimicrobial or immunoregulatory might depend on the pathogen . This should naturally been taken into account when exploring the possible use of ido - specific t cells in the clinic . Finally, it should be mentioned that cd14 monocytes are major cmv target cells in vivo . Cmv is the most immune dominant antigen to be encountered by the human immune system . Monocytes are responsible for dissemination of the virus throughout the body during acute and late phase of infection . Cmv has been shown to induce ido expression in monocytes, which has been suggested to confer an advantage to cmv - infected monocytes to escape t - cell responses . The cd8 t - cell response to cmv typically comprises a sizeable percentage of the cd8 t - cell repertoire in cmv - seropositive individuals . In light of this, it is possible that ido - specific t cells might function as support for the constitutive anti - cmv cd8 t - cell response . Naturally, this can only be speculation, but notably we found that the presence of ido - specific cd4 t - cell responses correlated to the presence of cmv - responses . Ido may exhibit its immune inhibitory functions both in the activation phases (in the draining lymph node) as well as in the effector phases (at the site of the tumor). With regard to the latter, ido may even by induced as an inflammation - induced counter - regulatory mechanism . Counter - regulatory responses are important in the immune system as they help to limit the intensity and extent of immune responses, which otherwise could cause damage to the host . However, with regard to anti - cancer immunotherapy, counter - regulatory responses antagonize the ability to create an intense immune response against the tumor . Counter - regulation differs from tolerance in the sense that counter - regulation is a secondary event, elicited only in response to immune activation . Ido is known to be induced by both type i and ii interferons, which are likely to be found at sites of immune activation and inflammation [31, 36]. In this respect, it should be mentioned that the susceptibility of tumor cells to lysis by ido - reactive t cells were increased by pre - incubation with ifn- . Hence, in cancer immune therapy, the boosting of ido - specific immunity could have both direct and indirect effects (fig . First of all, ido - specific, cytotoxic t cells are able to directly recognize and kill ido cancer cells . In fact, it may even be speculated that the measurable reactivity to this antigen in normal individuals contributes to immune surveillance against cancer . Furthermore, the induction of ido - specific immune responses by therapeutic measures could function highly synergistic with additional anti - cancer immune therapy not only by eliminating cancer cells but in addition immune suppressive cells . By definition, anti - cancer immune therapies aim at the induction of an immunological activation and inflammation . The therapy aims to induce as much immune activation as possible (within the limits of acceptable toxicity), and, accordingly, immune suppressive counter - regulation is not desired.fig . 3vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells (apc) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . Ido may exhibit its immune inhibitory functions both in the activation phases (in the draining lymph node) as wells as in the effector phases (at the site of the tumor). Hence, an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells vaccine induced ido - specific t cells might kill ido suppressive antigen presenting cells (apc) as well as ido cancer cells both at the tumor site and in the draining lymph nodes . Ido may exhibit its immune inhibitory functions both in the activation phases (in the draining lymph node) as wells as in the effector phases (at the site of the tumor). Hence, an ido - based cancer vaccine might work directly at the tumor site by the attack of cancer cells as well as stromal cells as well as in the draining lymph node by the attack of ido - expressing regulatory cells adoptive transfer of ex vivo expanded tumor - infiltrating lymphocytes (til) after host lymphodepletion has the potential to significantly improve the prognosis of patients with metastatic melanoma . The impressive clinical responses associated with adoptive transfer of til urge that this strategy is pursued and investigated for the treatment of other types of cancer . In this regard, patient ido - specific t cells isolated and expanded from pbmc may well be an interesting supplement to the ongoing adaptive t - cell transfer strategies . It goes without saying that the possible introduction of autoimmunity and toxicity are the major worries when targeting a molecule like ido . However, the circulation of a measurable number of ido - specific t cells did not seem to cause autoimmunity . Furthermore, since ido - specific t cells can be introduced by ifn or cpg this appears to be under solid control . In this regard, an interesting aspect of ido is that systemic inactivation at the organism level, either pharmacologically or genetically, does not appear to cause autoimmunity . We believe that the findings that presented here justified and warranted clinical testing to evaluate the efficiency and safety of ido - based vaccinations . Hence, we initiated a phase i vaccination study, which is ongoing (from june 2010) at center for caner immune therapy, copenhagen university hospital, herlev, in which patients with non - small cell lung cancer (nsclc) are vaccinated with a ido - derived peptide with montanide adjuvant (www.clinicaltrials.gov; nct01219348). It has been suggested that ido may rather be involved in tolerance to non - self - antigens than self - antigens in situations where immune non - responsiveness may be important, for example, during pregnancy . In this respect, induction of ido immune - regulatory dendritic cells (dc) have been described to occur during infection of dcs with viruses and intracellular pathogens . In listeria monocytogenes infections, such ido dc seems to be involved in protection of the host from granuloma breakdown and pathogen dissemination in advanced human listeriosis . Likewise, it was recently described that ido is increased in lymph nodes in cutaneous leishmania major infection . Ido is implicated in suppressing t - cell immunity to parasite antigens and ido inhibition reduced local inflammation and parasite burdens, which suggest that ido were of benefit for the pathogen, not the host . During hiv infection, multiple mechanisms involving both viral and cellular components contribute to enhance ido expression and activity in an uncontrolled manner . Among others, furthermore, it was recently described that ido is increased in hemodialysis (hd) patients compared to healthy donors . Furthermore, ido suppresses adaptive immunity in hd patients as it is assessed by the response to hbv vaccination . Hence, the targeting of ido could have synergistic effects in anti - viral immune therapy, for example, in hepatitis b vaccines . The fact that ido may be involved in tolerance to non - self - antigens might have major implications for ido - based immune therapy as boosting immunity to neoantigens, but not normal self - antigens, by triggering ido - specific t cells is very attractive . Since ido - expressing cells might antagonize the desired effects of other immunotherapeutic approaches targeting ido - expressing cells by vaccination however, it was recently described that although ido might play biologically important roles in the host response to diverse intracellular infections like toxoplasma gondii, leishmaniasis, and herpes simplex virus, the nature of this role that being antimicrobial or immunoregulatory might depend on the pathogen . This should naturally been taken into account when exploring the possible use of ido - specific t cells in the clinic . Finally, it should be mentioned that cd14 monocytes are major cmv target cells in vivo . Cmv is the most immune dominant antigen to be encountered by the human immune system . Monocytes are responsible for dissemination of the virus throughout the body during acute and late phase of infection . Cmv has been shown to induce ido expression in monocytes, which has been suggested to confer an advantage to cmv - infected monocytes to escape t - cell responses . The cd8 t - cell response to cmv typically comprises a sizeable percentage of the cd8 t - cell repertoire in cmv - seropositive individuals . In light of this, it is possible that ido - specific t cells might function as support for the constitutive anti - cmv cd8 t - cell response . Naturally, this can only be speculation, but notably we found that the presence of ido - specific cd4 t - cell responses correlated to the presence of cmv - responses.
|
Given a renewed public awareness following a recent measles outbreak in iowa, several pregnant women inquired about their measles immunity . While confirmation of measles immunity is not routinely performed, determination of rubella immunity is a routine antenatal test in the united states . Consequently, we questioned whether a woman with known rubella immunity would be likely to have measles immunity as well . A preliminary review of the literature confirmed that measles immunity following vaccination is reported to be from 95% (1 dose) to 99% (2 doses), and rubella immunity is reported to be 85% to 90% among adults . While both vaccines have a high immunogenicity, rubella immunity is shown to be somewhat lower than measles immunity . Thus, depending upon the paired association for immunity, rubella immunity could be useful as a predictor for measles immunity among women with known rubella immune status . While correlation of rubella and measles immunity has been reported, the more rigorous statistical tests to determine paired association have not . Serum was obtained from the iowa state hygienic laboratory from samples collected between january of 2004 and november of 2004 among women seeking antenatal care in iowa and submitted for routine testing (hepatitis b). The sample size for the study was estimated based on the primary outcome measure, agreement between measles and rubella immunity in a population serum sample . The sample size was calculated using mcnemar's test (paired data) with level of significance 0.05, power 80%, rubella immunity 85%, and measles immunity 97%, which determined that 867 samples would be required to determine a paired association of immunity status . Rubella immunity was determined by a commercially available rubella igg enzyme - linked immunosorbent assay (elisa) (bio - quant, inc . Likewise, measles (rubeola) immunity was determined with a commercially available measles igg elisa (bio - quant, inc . ). Statistical analyses were conducted using the statistical analysis system version 9.0 (sas, nc, usa) to describe the rates of measles and rubella immunity . The paired data for each serum sample was evaluated using mcnemar's test to evaluate whether or not there was a paired association between immunity statuses . The wilcoxon rank - sum test was used for nonparametric comparison of the age means between immune and nonimmune individuals . Nine hundred serum samples were obtained and tested for both measles and rubella immunities . The age of the women was known for 785 samples, with the average age 28 (range 14 to 44) years . Demographic data beyond age was unknown . However, the population of iowa is primarily non - hispanic white . As noted in table 1, of the 900 samples tested, 790 were immune, 69 were nonimmune, and 41 were indeterminate to measles . Similar testing found that 883 samples were immune, and 17 were nonimmune to rubella (none of the rubella tests were indeterminate). Immunity to measles and rubella was found to be 88% and 98%, respectively . Measles immunity status was noted for each rubella immune and rubella nonimmune sample groups to determine the association of immunity status . The probability of measles immunity given that a sample was found to be rubella immune was 88% . There was no concordance between immunity statuses, kappa 0.1353 (95% ci 0.0314, 0.2392). Additionally, mcnemar's test rejected a paired association between measles and rubella immunities, p <.0001 . Even if all the serum samples found to be indeterminate for measles immunity were found to be measles immune, neither concordance nor paired association would have been confirmed (kappa 0.1366, mcnemar's p <.0001). The mean age of those women in each rubella group (immune and nonimmune) was the same (28 years). The measles and rubella immunities prevalence identified in the population studied was different than reported in the literature (noted previously). Therefore, a posthoc analysis was performed to determine power for the identified measles and rubella immunities prevalence in our population using mcnemar's exact conditional test, with a computed power of> 0.999, and 0.0458 level of significance . In 2005, the cdc independent panel concluded unanimously that rubella was no longer endemic in the united states . Unfortunately, there is still a significant minority of reproductive age women who are rubella susceptible . The goal of prenatal testing is to identify women for vaccination in the postpartum period as the measles - mumps - rubella (mmr) vaccine is contraindicated in pregnancy . The rubella vaccine was licensed in 1969 . Since 1969, rubella - associated morbidity and mortality and the incidence of congenital rubella syndrome have greatly declined . The rubella vaccine has been administered as part of the mmr vaccination since 1978 . In 1990, a two - dose schedule was adopted (age 15 months and again at age 46 years). Lasting immunity is present in 82% to 90% of those who initially seroconverted using the two - dose regime . The measles vaccine was licensed in 1963 . Since 1963, there has been a 99% reduction in the incidence of measles in the united states . Unlike rubella, antepartum measles infection has no consistent pattern of fetal anomalies . However, there is a known increase in spontaneous abortions, premature births, and maternal morbidity, including pneumonia and encephalitis . We found that rubella immunity did not infer measles immunity in our study population . While correlation has been reported by others [5, 6] and was also noted in this study, correlation does not imply the more rigorous statistical associations of agreement or concordance . The large number of serum samples positive for both rubella and measles resulted in the correlation we identified, as would be expected in an immunized population . Strengths of our study include the large sample size, and prospective data analysis . A limitation of our study was that the serum samples were obtained from midwest (primarily caucasian) pregnant women, which limit generalizability . However, our findings agree with large military studies where participants included both men and women from across the united states with varying ethnic background and race [4, 7, 8]. The immunity rates for measles and rubella may differ within the population we studied compared to those previously reported . Alternatively, the assay for measles antibody could be less sensitive than the assay for rubella antibody . This would be consistent with the high number of measles indeterminate results noted and could be related to the greater number of nonimmune measles results ., rubella immunity did not infer measles immunity in our population . In measles outbreaks as that in 2004, we would be unable to presume a women's measles immunity based on known rubella immunity . Thus, pregnant women exposed to measles should be tested and treated if nonimmune.
|
Royal free ethics committee for retrospective publication of patient data . Written informed consent for publication was obtained from the patients . Ma beckles and t wagner not commissioned; peer - reviewed by vaishali sanchorawala and kaushik sanyal royal free ethics committee for retrospective publication of patient data . Written informed consent for publication was obtained from the patients.
|
The flaviviridae family includes approximately 80 members divided into four genera: flavivirus, pestivirus, pegivirus, and hepacivirus . The flavivirus genus can be further divided into four categories: mosquito - borne, tick - borne, no known vector (nkv), and insect - specific (isf) viruses . Mosquito- and tick - borne flaviviruses, including dengue (with four serotypes), japanese encephalitis virus (jev), yellow fever virus (yfv), saint louis encephalitis virus (slev), west nile virus (wnv), murray valley encephalitis virus (mve), and tick - borne encephalitis virus (tbev), are important pathogens responsible for human diseases, such as encephalitis, fever, and haemorrhagic fever . Isf viruses are restricted to mosquitoes, such as culex and aedes, and include the aedes flavivirus (aefv), calbertado virus, cell - fusing agent virus (cfav), chaoyang virus, culex flavivirus (cxfv), culex theileri flavivirus (ctfv), kamiti river virus (krv), lammi virus, nakiwogo virus (nakv), nounane virus, quang binh virus (qbv), and palm creek virus (pcv) [312]. Mosquito- and tick - borne flaviviruses are transmitted to humans through haematophagous insects during blood meal feeding . Viruses obtained from vertebrate host initially replicate in the midgut within 57 minutes of exposure . After escaping the midgut, the virus spreads to other tissues via haemolymph and can be transmitted through infected salivary glands and saliva [1315]. The period from the initial infection in the midgut to when the vector transmits the virus is termed the extrinsic incubation period (eip), and this time period varies from 7 to 14 days [14, 15]. However, viruses have been detected in the salivary glands of denv - infected aedes aegypti as early as 24 hours . Thus, the eip depends on the virus, the mosquito, and certain environmental factors [14, 15]. These viruses are approximately 11 kb in length, with a single open reading frame (orf) encoding a polyprotein that is co- and posttranslationally processed through cellular and viral proteases into three structural (c, m, and e) and seven nonstructural (ns1, ns2a, ns2b, ns3, ns4a, ns4b, and ns5) proteins . The orf is flanked at the 5 and 3 ends by two untranslated regions (5 and 3 utrs) that are important in viral translation and replication . The capsid (c) protein interacts with the viral genome to form the nucleocapsid, which is surrounded by a lipid bilayer containing the membrane (m) and envelope (e) proteins . Interestingly, flavivirus infections in humans are self - limiting episodes with or without pathological consequences, despite a life - long or persistent infection in the vector, without apparent pathological effects [13, 1820]. In contrast to acute infections, where the virus is eventually eliminated through the destruction of the host or the immune response, in persistent infections, the virus remains in the host cells for long periods of time, can be transmitted to other cells, and is not cleared . Mosquito cell cultures have been used as suitable models to study flavivirus persistence (table 1) because these models are easy to manage, they have several variables and can be controlled, and their results are typically easy to interpret . One of the common features observed in c6/36 persistently infected with denv [2224] is the presence of a cytopathic effect (cpe) during the first 47 weeks of infection, which becomes progressively imperceptible throughout the infection [23, 24]. However, the viral proteins and genome are clearly detected in infected cells [22, 25]. These findings are consistent with the nonpathogenic flavivirus infection in mosquitoes, suggesting the presence of a balance between virus replication and the antiviral host response [26, 27], which results in an infection that is controlled, but not eliminated, and not lethal [21, 28]. The mechanisms underlying the establishment and maintenance of persistent flaviviral infection in insects are not completely understood, but apparently both host and viral factors are involved [2830]. For example, viral titres in the supernatants of c6/36 [22, 24, 31] or tra-171 cells persistently infected with denv display an oscillation pattern during persistent infection, suggesting the presence of defective interfering particles (dis), one of the major self - controlling mechanisms for viral replication . Because dis are more evident after several passages in cell lines, these particles are frequently observed in persistently infected cultures, and the oscillating phenomenon observed in long - term or persistently infected cell cultures reflects a mutual interaction between the parental virus, required for the replication of both defective and standard viruses, and the viral interference induced through dis in the viral titres . A more detailed description of dis is included in a subsequent section of this review . Among the host factors that might participate in the maintenance of persistent infection are those associated with cell antiviral mechanisms, particularly rna interference (rnai) and the innate immune responses that control but do not eliminate viral infections . Viral interference is a phenomenon whereby the infection with one virus (primary) inhibits infection with other viruses (secondary). Superinfection exclusion occurs when the primary virus inhibits the infection of the secondary virus . Additionally, when both viruses reciprocally inhibit their infections, this is referred to as intrinsic interference [35, 36]. When both viruses belong to the same family, the interference is referred to as homologous viral interference [3739]. Heterotypic interference is a variation of this type of interference, and this phenomenon is observed when the viruses involved have different serotypes but belong to the same species, that is, denv serotypes . Heterologous viral interference describes a negative interaction between viruses from different families . In some cases, the infection with two different viruses does not result in viral interference, and both infectious agents can coexist in the same cells . This phenomenon is called viral accommodation . Based on the time of infection, mixed infections can be classified as coinfections when the two viruses interact with the host at the same time or superinfections when one virus invades the host prior to the second virus . Because flaviviral infection persists for the life of the vector, the opportunities for competition or viral interference in the vector are higher than in humans, where the infection is only transient and the evaluation of viral interference during flavivirus infection is relatively easy to detect in cell lines, and it has primarily been examined in mosquito c6/36 cells (from aedes albopictus) [12, 23, 30, 31, 35, 39, 4148], tra-171 (from toxorhynchites amboinensis), sf9 (from spodoptera frugiperda), c7 - 10, and u4.4 cells (from aedes albopictus) [29, 35]. Homologous or heterotypic, but not heterologous, viral interference is frequently observed during superinfections (table 2), and this condition is particularly evident in persistently infected cells [23, 31, 32, 44, 49]. However, some exceptions have been documented [32, 39, 41, 44]. For example, sinv inhibits denv replication in c6/36 cells infected 1 hour prior to denv-4 . The same cells persistently infected with aal dnv and reinfected with denv-2 showed an important reduction in the severity and mortality of the denv-2 infection compared with those of noninfected cells, and denv-2 titres were lower than in nave cells . Interestingly, c6/36 cells persistently infected with three different viruses, including two flaviviruses, denv-2 and jev, result in a stable coinfection with the three viruses without apparent viral interference . These discrepancies indicate that the interference might vary among different flaviviruses and might be influenced through both the type of virus and the cell line used . It has been shown that the interval between the primary and secondary viral infections has an important effect on viral interference . The primary infection of c6/36 cells with either denv-2 or denv-4, followed by a secondary infection 1 or 6 hours later with the opposite virus at the same multiplicity of infection (moi), showed a stronger reduction in the virus titres of the secondary virus when the second infection was performed 6 hours after the first infection . It is likely that denv-4 infection requires more than 1 hour to establish conditions in which this virus will not be affected by sinv . Some studies have reported that cxfv - infected c6/36 cells were reinfected with wnv 48 hours later and display significantly reduced titres of the secondary virus at 108 hours postinfection, indicating the presence of homologous viral interference . However, other studies have reported that when the same cxfv - infected cells were reinfected with wnv two days later, homologous viral interference was not observed . These differences could reflect the time of the secondary infections, but more experiments will be necessary to clarify this point . Flavivirus coinfection experiments have primarily been performed using c6/36 cells [30, 4143, 46, 48, 50], and recently aag2 cells have been used; these infections typically result in homologous or heterologous viral interference (table 3). Experiments in mosquitoes have revealed some similarities to the findings obtained using mosquito cell lines . For example, c6/36 cells infected with denv display heterotypic viral interference [30, 31, 42, 43, 50, 51]. Aedes aegypti mosquitoes orally infected with denv-2 and denv-3 simultaneously showed higher amounts of denv-2 viral rna than denv-3 viral rna, suggesting that the replicative advantage of denv-2 observed in c6/36 also applies to the vector . Aedes aegypti mosquitoes orally coinfected with two clades of denv-2 (ni-1 and ni-2b) showed a higher replicative index for the ni-2b clade than the ni-1 clade . Homologous viral interference has been observed in aedes aegypti mosquitoes infected with denv and yfv or mve and denv, culex tritaeniorhynchus mosquitoes infected with jev and mve, and culex quinquefasciatus mosquitoes infected with other flaviviruses, such as wnv and slev . The absence of heterologous viral interference between denv and chikv has been documented in c6/36 cells [31, 46], and apparently this phenomenon also occurs in mosquitoes . Aedes albopictus mosquitoes intrathoracically inoculated with denv-1 and subsequently with chikv via the oral route at 7 or 13 days later showed the presence of the two viruses, without superinfection exclusion . Mosquitoes orally coinfected with both viruses showed the same results, and the viruses could also be detected in saliva, indicating the absence of heterologous viral interference . However, studies have shown that aedes aegypti mosquitoes orally fed denv and chikv did not exhibit dual infection, either in the same pool or in individual mosquitoes, suggesting the presence of heterologous viral interference . The discrepancy of these results requires further investigation but apparently could reflect the virus strain used in these studies . Interestingly, aedes albopictus mosquitoes coinfected with denv-4 and sinv display a reduction in both the infection and population dissemination rates compared with mosquitoes infected with denv-4 alone, even when the vector used exhibits a low sinv infection rate . Although contradictory results have been reported for wnv and cxfv infections in c6/36 cells, the findings reported for these two groups in mosquitoes are consistent . Culex quinquefasciatus mosquitoes inoculated with cxfv via an intrathoracic route and fed a blood meal containing wnv seven days later (superinfection) do not display superinfection exclusion . When both viruses were simultaneously inoculated (coinfection), both viruses were detected in the same mosquito tissues through immunofluorescence, indicating a physical interaction between these infectious agents . In another study, culex pipiens mosquitoes persistently infected with cxfv and orally challenged with wnv displayed a reduction in the dissemination rates only during the early stages of the infection (7 days), but not during the late stages (14 days), with no effects on the transmission rates . Although both are flaviviruses, the absence of homologous viral interference could reflect differences between these viruses . For example, although the mosquito rnai response might represent an antiviral response, the similarity between both viral genomes is not sufficient to generate a cross - reaction, particularly because the rnai response is based on a highly specific - sequence mechanism . The absence of competition for cellular factors could also be a contributing factor because the 5 and 3 utrs of cxfv have some differences compared with wnv . Moreover, the mechanism of transmission between both viruses could also contribute to the absence of viral interference, as wnv is transmitted to the vertebrate host through saliva, and cxfv is maintained among the vector population through vertical transmission . Unfortunately, the relevance of the viral interference in naturally infected vectors remains unknown, as several studies have demonstrated the presence of flavivirus coinfections that typically compete in both cell lines and mosquitoes . For example, aedes albopictus or aedes aegypti mosquitoes are naturally coinfected with more than one denv serotype [5557]. Although several studies have been performed using pools of mosquitoes where the coinfection in the same individual is difficult to determine [55, 57], other studies have clearly established that one individual can be infected with both denv serotypes for example, the absence of viral interference between chikv and denv in cell lines has been confirmed through the evidence of dual chikv and denv-1 viral infections in aedes aegypti mosquitoes and in a single aedes albopictus mosquito . Il (usa), were naturally coinfected with cxfv and wnv, suggesting that in this vector homologous viral interference does not occur between these two flaviviruses, which are not closely related . The mechanisms involved in viral interference remain elusive, but the inhibition could occur at different levels of the viral replicative cycle, such as binding, entry, replication, and morphogenesis [19, 37]. However, some studies have implicated several factors, such as dis and the rnai response, in homologous viral interference, and the competition for cellular replication factors and the innate immune response for heterotypic viral interference . The heterotypic viral interference against denv-3 observed in c6/36 cells with an acute denv-1 infection is affected through treatments with puromycin (an inhibitor of the protein synthesis) but not actinomycin d (an inhibitor of the cellular transcription), suggesting that the viral interference is predominantly mediated through the virus instead of cellular factors . The competitive success of one virus could reflect the appropriation of the host cellular machinery for replication, which is directly related to the density of the viral genomes in the infected cells . This idea might explain why the heterotypic viral interference between two different denv serotypes is stronger when the interval between the primary and secondary infections is longer (e.g., between 1 and 6 hours) and weaker in a coinfection compared with superinfection . This idea might also explain why this type of viral interference is observed in persistently infected cells . These virions contain a partially deleted genome, encoding generally normal viral structural proteins, with enough genomic information for replication and incorporation into mature virions; however, these viruses cannot perform their own replication . Therefore, they require the assistance of a standard helper virus for this process . Because the genome is shorter, dis are apparently preferentially replicated; therefore, these viruses obtain the viral genome density necessary to specifically interfere with the replication of the parental virus [3335]. Thus, dis represent a major self - controlling mechanism for viral replication, and these particles have been implicated in the establishment and maintenance of persistent viral infections [25, 33]. The generation of dis is a common feature among viruses and has been observed in both rna and dna viruses [20, 33]. The most commonly accepted mechanism for the generation of dis is the participation of the viral polymerase, particularly in rna - dependent viruses that lack proofreading activity . More recently, it has been proposed that drosophila melanogaster cells persistently infected with several nonflavivirus rna viruses generated cdnas from the genomes of defective interfering particles through cellular retrotransposon reverse transcriptase - mediated retrotranscription (figure 1), but this finding requires further investigation . Defective viral genomes have been detected in mosquito cells persistently infected with flaviviruses, such as sle, jev, and denv, and also those that occur in nature, circulating between mosquitoes and human populations . These defective genomes have been implicated as cofactors in reducing the prevalence of denv and the severity of the disease in specific geographic areas . In addition to the participation of defective interfering particles / genomes in viral interference, some mutations have recently been associated with this phenomenon . Culex quinquefasciatus mosquitoes orally superinfected with wnv containing a mutation in the 2k peptide (v9 m) overcome the homologous viral interference typically observed in superinfections . The 2k peptide is a 23-amino - acid peptide located between the ns4a and ns4b proteins, and this peptide is anchored to the membrane of the endoplasmic reticulum (er). The 2k peptide has been implicated in virus replication and the evasion of the rnase l - mediated antiviral response . This point mutation likely confers replication advantages, protection against rna degradation, and/or the ability to compete with wild - type viruses under some circumstances . Recent transcriptomic studies in aedes aegypti mosquitoes infected with denv-2 [16, 6569] and culex pipiens quinquefasciatus infected with wnv have shown that these flaviviruses induce important and complex changes in gene expression . Although these studies have been performed with denv and wnv, some preliminary experiments suggest that the expression of several genes is commonly activated through mosquito - borne flaviviruses [71, 72]. Although different results have been obtained, several studies have suggested that during flaviviral infection genes associated with specific pathways are activated to maintain the proper condition of the cell for viral replication, such as metabolism (nucleotide, lipid, amino acid, and energy) [6568], oxidative stress [67, 68] and transcription / translation [6568], and other pathways associated with the antiviral response [16, 65, 67, 68, 73]. Actually, some genes have been associated with the susceptibility or refractoriness to denv infection in aedes mosquitoes . For example, genes associated with the inhibition of the apoptosis were identified in susceptible and proapoptotic genes in refractory mosquitoes . Some genes associated with the immune response are upregulated in refractory mosquito strains [68, 73]. The requirement for cellular factors for viral replication could represent a homologous / heterotypic viral interference mechanism . The primary virus might sequester the host factors essential for the replication of the secondary virus [35, 37], which might result in viral interference, particularly during a superinfection (figure 1). The absence of heterologous viral interference among nonrelated viruses might reflect the requirements for different cellular and viral factors to complete the viral replicative cycles . For example, denv-2 is an rna virus that assembles in the cytoplasm, while aal dnv is a dna virus that assembles in the nucleus . When the viruses involved in the infection are closely related, the requirements for host factors are the same and the viral interference is stronger . Accordingly, c6/36 cells with a primary nhuv infection and a superinfection with wnv, slev, or jev displayed a significant reduction in the secondary virus titre (homologous interference through superinfection). An analysis of the secondary structure of the nhuv 3 utr revealed similarities with the yfv and jev serogroups and viruses in the tick - borne flavivirus clade, suggesting that the requirements for cellular factors and the mechanism for viral translation / replication might be similar among these viruses, thereby establishing conditions for competition . In aag2 cells coinfected with two denv-2 clades from nicaragua, clade ni-2b showed a replicative preference over clade ni-1 . Both viruses exhibited differences in some amino acids in two structural and four nonstructural proteins and showed four nucleotide variations in the 5 and 3 utrs . These changes could influence some steps of the viral replicative cycle, resulting in advantages of one virus over the other . Interestingly, although aag2 cells are persistently infected with cfav, the denv infection is not affected, probably by the same cause that cxfv does not interfere with wnv replication in mosquitoes [45, 47]. Because members of the flavivirus genus have ssrna+, these viruses use a common strategy similar to other rna viruses to translate the genome (revised in). These viruses release viral rna into the cytoplasm for recognition by both the viral replication apparatus and the translational cell machinery to assemble the rna replication complex on cellular membranes [7678]. Viral translation and replication cannot occur at the same time because the ribosome moves from the 5 end towards the 3 end of the rna to translate the proteins, whereas the rna viral polymerase generally binds to the 3 end of the same rna molecule to initiate replication . Thus, it is necessary to identify a balance between these two viral events [79, 80]. This balance or switch is performed through ribonucleoprotein complexes (rnps) located in subcellular membranes, as described above . The flavivirus rna viral genome contains two utrs that have various functions, such as initiating and regulating viral translation, as well as viral complex replication and assembly at membrane fractions, through interactions with host cellular factors and nonstructural proteins that form rnps (revised in). Most of these factors have been identified in mammalian cells, including bhk21 (for baby hamster kidney), vero (green monkey kidney), hek293a (human embryonic kidney-293), k562 (human erythroleukaemia cells), and u937 (a human monocytic cell line derived from a patient with generalized histiocytic lymphoma) cells . These cellular factors have been identified as elongation factor 1 (ef1), polypyrimidine tract binding (ptb) protein, the autoantigen - la (la protein), calreticulin, and nuclear factor 90 (nf90) [8285]. However, little information is available about the discovery of the cellular factors in mosquito cells, such as c6/36 cells, compared with mammalian cells . Notably, ef1, the la protein, eukaryotic initiation factor 5 (eif5), 40s ribosomal protein s6, and 60s ribosomal protein l4 (table 4) have been implicated in viral replication in mosquitoes [72, 83, 86, 87]. The cellular factors mentioned above, such as ef1 (highly conserved between different host species as mammals, chicken, and mosquitoes), translation initiation factor eif5, and ribosomal proteins s6 and l4, participate in several steps of the translation process [8891], except autoantigen - la, a nuclear protein involved in rna polymerase iii transcription termination [92, 93] and small rna biogenesis, which acts as a chaperone and contributes to the retention of nascent rna in the nucleus or stabilizes the rna structure . The relocalization of this protein to the cytoplasm has been observed in several rna viral infections, including flavivirus infections . Additionally, eif5 functions in cell proliferation, cell viability, and cell - cycle progression, and it is essential for cell survival . A recent study reported that eif5 possesses a higher similarity and shorter evolutionary distance in insects than in other organisms, suggesting that this protein plays an important and common physiological role . The ribosomal protein s6 (rps6) is a component of the 40s ribosomal subunit, while the ribosomal protein l4 (rpl4 or rpl1) is a component of the 60s ribosomal subunit . While the precise function of rps6 is currently under investigation, studies have shown that this protein is involved in regulating cell size, cell proliferation, and glucose homeostasis through the selective translation of particular classes of mrnas . Both ribosomal proteins were discovered using tandem affinity purification assays in mosquito cells infected with wnv and denv . Ef1 is involved in wnv and denv replication and could act as a chaperone targeting the rna to the viral replication compartments, as this protein is associated with the er membrane fraction where rna viral replication complexes are assembled [86, 88]. In infected mammalian cells, ef1 was colocalized with the wnv and denv ns3 and ns5 (the viral rna - dependent rna polymerase - rdrp) proteins . This evidence suggests that ef1 is important for minus - strand rna synthesis through interactions with the viral rna and the replication complex proteins, including ns3 and ns5 [90, 97], and these interactions might be similar in mosquito cells . Furthermore, the shih group results suggested that eif5 is upregulated in denv-2-infected c6/36 cells, and this upregulated expression might play a role in preventing mosquito cell death in response to the viral infection . Thus, eif5 facilitates continued viral growth and potentially persistent infection in mosquito cells, without affecting viral replication . This finding is supported by results in c6/36 cells treated with ciclopirox olamine (cpo), an eif5 inhibitor, which did not affect the viral titres . These results provide evidence that eif5 plays a role in the interactions between the viruses and components of the host cells . However, the interaction between the ribosomal proteins s6 and l4 and the ns2a and ns4b nonstructural viral proteins is likely involved in flavivirus rna translation . This report provided the first evidence of the binding of flaviviral proteins to either 40s or 60s ribosomal proteins . Barr virus noncoding rna eber1, which recruits ribosomal protein l22 during infection, presumably, to aid in viral replication, or the hepatitis c (hcv) ires region, which associates with the ribosomal s5 protein to position the hcv rna on the 40s ribosomal subunit during translation . The requirement of these translation factors during the viral genome processing or viral replication suggests that flaviviral proteins might have evolved mechanisms to bind and localize the proteins in appropriate compartments of the cell . Moreover, the human la protein (47 kda) in mosquito cells has a molecular weight of 50 kda and potentially binds to the sinv rna . Because the la protein might function as an rna chaperone, the human la protein interacts with the viral 3 sl rna, and sirna - mediated downregulation represses jev replication . In addition, in denv, the human la protein interacts with two viral nonstructural proteins that form the denv replicase complex: ns3 and ns5 . However, the mosquito la protein also binds to the 3 utr of positive and negative polarity denv rnas and relocates to the cytoplasm in c6/36-infected cells . These findings suggest a role for the human la protein in flaviviral replication as a component of the rnp . For example, denv can be grown in human, primate, and mosquito cells but first requires viral growth in mosquitoes . Therefore, characterizing the cellular and viral proteins required for denv translation and replication in mosquito cells is essential to understand the replicative cycle of the virus . After analyzing this information, we proposed that the association of ef1 and the la protein, which function as chaperones, with eif5 and ribosomal proteins s6 and l4, components of the translational machinery, could stimulate flavivirus translation in a favourable context . Denv infections induce the drastic rearrangement of the er membranes, resulting in complex membranous structures that promote the switch from translation to viral replication once viral and/or cellular factors facilitate communication of the utrs, thereby maximizing translation and replication as global processes . In addition to stabilizing rna, the formation of viral ribonucleoprotein complexes (vrnps) between the host cell factors and/or the viral proteins, as described above, likely regulates various steps of the viral life cycle . The formation of vrnps might establish the genomic architecture and facilitate various processes in the viral life cycle, and the fact that flaviviruses share several cellular factors for translation / replication might explain the homologous viral interference frequently observed in both co- and superinfections in mosquitoes and mosquito - derived cell lines . The rna interference (rnai) response is one of the most important antiviral mechanisms in insects . This response includes three main pathways to generate small rnas that regulate gene expression: small interfering rna (sirna), microrna (mirna), and piwirna . The sirnas are induced through the presence of double - stranded rna (e.g., as a result of replicative intermediates or secondary structure of genome of rna viruses), which is processed through the rnase iii - like enzymes dicer-1 or dicer-2 (primarily dicer-2), to generate small dsrna (21 to 25 nt). With the assistance of the r2d2 protein, these small rnas are loaded into the rna - induced silencing complex (risc) involving the argonaute proteins (ago-1 or ago-2). The synthesized sirnas perfectly compliment the target rna, resulting in rna degradation through the exosome or the exoribonuclease xrn1/pacman [100, 102]. The participation of the sirna response in the regulation of flavivirus infection has been studied in both mosquito cells lines [74, 103107], aedes aegypti, culex pipiens quinquefasciatus, and even in drosophila melanogaster . Several studies have indicated that the sirna response is activated during denv [74, 104, 106, 107] or wnv [103, 105, 108] infections, and the susceptibility to these flaviviruses increases when components of the sirna pathway are silenced [103, 104, 106]. Moreover, c6/36 cells, which have a deficiency in the activity of the dicer-2 enzyme, are more susceptible to denv infection than dicer-2 competent cells [74, 105, 107], and the natural polymorphism of the dicer-2 gene has been associated with the susceptibility of aedes aegypti mosquitoes to some isolates of denv-1 . Although mosquitoes have a competent rnai pathway to degrade viral rna, flaviviruses have mechanisms to evade the rnai response and establish a persistent and noncytopathic infection in the vector . One of these mechanisms might be the sequestration of the viral replicative complex into endoplasmic reticulum - derived vesicles; thus, the double - stranded viral rnas generated during the viral replication cannot be sensed through dicer-2 [73, 103, 104, 110]. Additionally, flaviviruses mutate at high rates, reflecting the absence of proofreading activity or rna polymerases . Because the rnai response is highly sequence - specific, these mutations in the viral genome might be another mechanism to evade this response . For example, mosquito and mammal cells infected with flaviviruses generate subgenomic rna corresponding to the 3 utr of the viral genome through the participation of the cellular exoribonuclease xrn1, and this subgenomic rna binds to dicer-2 and dicer-1, inhibiting the activity of these enzymes in vitro [1, 102]. In the case of denv moreover, the dis in the sirna pathway could be responsible for the homologous / heterotypic viral interference and persistent infection . Drosophila melanogaster cells persistently infected with several nonflavivirus rna viruses generated cdnas from the genomes of dis through cellular ltr - retrotransposon reverse transcriptase - mediated retrotranscription . These cdnas are apparently transcribed through the cellular transcription machinery to generate small double - stranded rnas via several mechanisms, which are the source of the dicer-2-risc - produced interfering rnas (rnai) [21, 28] that control viral replication (figure 1). Interesting similar results were obtained with the sindbis virus, a member of togaviridae, which shares similarities in the replicative cycle and genome type with members of the flaviviridae family . This finding suggests that a similar process might occur with flaviviruses; however, this idea requires further investigation . Furthermore, several retrotransposons with retrotranscriptase activity have been detected in aedes aegypti [112114], aedes albopictus, and aedes polynesiensis, suggesting that the same mechanism could operate in mosquitoes infected with flaviviruses; however, this hypothesis requires further investigation . The immune response in the mosquito might determine the susceptibility of these insects to arboviruses [115117] and could be implicated in both the viral interference phenomenon and persistence . The immune response in mosquitoes is primarily regulated through three signalling pathways: immune deficiency (imd), which mediates the production of antimicrobial peptides with activity against gram - negative bacteria; the toll - mediated pathway, which is involved in the defence against viruses, gram - positive bacteria, and fungi and also stimulates the secretion of some antimicrobial peptides; and the janus kinase - signal transducer and activator of transcription (jak - stat) pathway, which has been strongly associated with the antiviral response in aedes mosquitoes [118120]. Among the three main pathways involved in the immune response in mosquitoes, the toll [14, 15, 72, 115, 116, 120] and jak - stat [15, 72, 115, 116, 119] pathways are apparently more important for controlling flavivirus infection . However, recent studies have suggested that the imd response could play a secondary role [15, 120]. The participation of the immune response during flavivirus infection has primarily been studied with denv [1416, 115, 116, 119121] in aedes aegypti mosquitoes [1416, 115, 116, 119], and this response has recently been characterized in the aag2 aedes aegypti cell line . However, the transcriptome analysis of aedes aegypti mosquitoes infected with denv, yfv, or wnv showed similar overall gene expression, indicating a conserved transcriptome signature . During infections with denv and other mosquito - borne flaviviruses, the first virus - vector interaction occurs in the midgut, where the immune response, known as the local immune response, is initially activated [15, 115, 119]. However, the systemic immune response represented by the abdominal fat body has also been implicated . More recently, it has been reported that denv upregulates the expression of salivary gland genes in aedes aegypti mosquitoes that encode for proteins involved in the immune response and also induces the expression of a putative antibacterial, cecropin - like peptide, which exhibits activity against the four denv serotypes and chikv . Although the participation of the mosquito immune system has been clearly demonstrated during single flavivirus infection, there are no studies concerning the participation of this response in viral interference during co- or superinfections . Moreover, it is not clear whether immune system activation through a primary virus blocks the infection of a secondary virus . However, there is some indirect evidence suggesting the participation of the immune response in the viral interference phenomenon . Culex quinquefasciatus mosquitoes sequentially infected with wnv and slev through an oral route displayed lowered susceptibility to infection and lower dissemination rates of the second virus, but similar infection rates to the first virus . Some mosquitoes become infected with two viruses, but only one virus escapes to the midgut, suggesting the participation of the midgut infection barrier during secondary infection . Because wnv and slev belong to the same antigenic complex and both viruses are primarily transmitted through culex spp ., the primary virus likely blocks the infection of the secondary virus through the induction of the host antiviral response . However, studies using the mosquito bacterial microflora have suggested that prior immune system activation influences the course of viral infection . The eradication of the endogenous bacterial flora in the midgut of aedes aegypti mosquitoes treated with an antibiotic increased the viral titres in the mosquitoes infected with denv-2 compared with a nontreated group . This effect is coincident with the ability of the bacterial flora to activate the toll pathway and produce several antimicrobial peptides, such as cecropin, defensin, attacin, and gramicidin, in the midgut [15, 121]. A similar result was obtained with mosquitoes previously fed with either blood or sugar meals contaminated with proteus sp . And paenibacillus sp . . Apparently, immune system activation through the microflora is not only limited to the midgut but also present in the abdominal fat body . Interestingly, denv-2 apparently reduces the microbial load in the midgut through the secretion of lysozyme c and cecropin g, indicating an interrelationship between the virus- and bacteria - induced immune responses . A similar mechanism might operate during co- and superinfection with different flaviviruses and in homologous or heterotypic viral interference . However, as previously discussed, equilibrium between the viral replication and the antiviral response exists during persistent infection in mosquito cells [26, 27], and the precise participation of the immune response in persistent infection in mosquito cells and the mechanism used by the flaviviruses to circumvent this response remain unknown . Although 80% of c6/36 cells persistently infected with jev were positive for the ns5 protein based on immunofluorescence analysis, there is typically little correlation between the number of cells positive for the viral antigen and the release of infectious virus particles . This finding has been reported in c6/36 cells persistently infected with denv and in different mosquito cells lines persistently infected with slev, reflecting the inhibition of virus particle production [22, 123] or the fact that initially all cells in culture support virus replication, but some cells stop replicating the virus and become resistant to superinfection during the late stages of infection . Eventually, the cells regain sensitivity to reinfection by the virus in the medium or the residual viral rna in the cell, and thus the culture remains persistently infected . However, another explanation is that a soluble antiviral factor is secreted from persistently infected cells . Pretreatment of tra-171 cells with the supernatant from the same cells persistently infected with denv reduces the viral titres of the four denv serotypes . Similarly, c6/36 cells pretreated with filtered culture medium from the same cells persistently infected with the four serotypes of denv become resistant to reinfection with the same denv viruses (heterotypic viral interference) but remain susceptible to infection with chikv . This effect is eliminated when the culture medium is preheated at 56c for 30 minutes, suggesting the presence of a soluble, thermolabile, anti - denv - specific factor . Consistent with these findings, interferon and interferon - like substances are involved in heterologous interference, and vago, a peptide with antiviral activity, has recently been identified and shown to be secreted from wnv - infected culex mosquito cells, culex pipiens mosquitoes, and denv - infected rml12 cells (from aedes albopictus) [124, 125]. Vago induction is dicer-2-dependent, but rnai - independent through the activation of traf, which cleaves the rel2 protein (a homologue of mammalian nfb) and facilitates the translocation of this protein to the nucleus to activate the vago gene . However, the antiviral activity of vago is mediated through the jak - stat pathway . Although vago expression is decreased in culex pipiens mosquitoes at 8 days postinfection with wnv, the participation of vago in viral interference during persistent infection cannot be excluded and will require further investigation . Flaviviral infection of the vectors is long - lived or persistent, and the mechanisms that participate in the establishment of this type of infection remain unknown . The present data suggest that this type of infection is a multifactorial phenomenon involving factors from the virus, such as defective interfering particles / genomes, and the host, such as the immune response, rna interference, and cellular factors . The characterization of the mechanisms that participate in viral persistence is important to obtain a better understanding of the complex interactions between flaviviruses and mosquito cells to develop new strategies for control . The cocirculation of two or more flaviviruses / alphaviruses in the same geographic area increases the opportunity for interviral interactions, and in most cases, the interaction between two mosquito - borne flaviviruses results in homologous viral interference, indicating that these viruses share mechanisms that regulate replication and several cellular factors required for viral translation / replication, a common requirement for different flaviviruses, which favours the conditions for competition . The studies of viral interference in cell lines typically correspond to the results observed in mosquitoes, but the relevance of these findings to the dynamics of viral infection and transmission in nature requires additional studies . The viral interference experiments have primarily been performed with the aedes albopictus mosquito cell line c6/36, a traditional cell line used as a model to study flavivirus infection in mosquitoes . However, recent studies have shown that this cell line contains a defective rnai pathway, reflecting a defect in the dicer-2 protein [74, 105]. Although the rnai pathway is not the only factor that might participate in maintaining a persistent infection or explaining viral interference, these data indicate that these types of experiments should be performed using other cell lines, such as ccl-125, u4.4, and c7 - 10 cells, and vectors, such as aedes and culex mosquitoes . Moreover, these cell lines should be used to characterize the cellular factors involved in flavivirus replication and the pathways involved in the immune response to provide a cellular model to study the relevance of these phenomena in the transmission and epidemiology of mosquito - borne flaviviruses.
|
Advancements in systemic chemotherapy for colorectal cancer (crc) have improved the clinical response rate and expanded the indications for resection to cases that were previously not operable at the initial visit . In addition, the prognosis of patients who undergo radical surgery for metastasis is clearly better than that of patients with inoperable tu - mors . Several studies have demonstrated the efficacy and safety of capecitabine and irinotecan (xeliri) therapy as a first - line regimen [2, 3, 4, 5, 6, 7, 8]. In the fnclcc accord 13/0503 study, a randomized, non - comparative study, xeliri + bevacizumab (bv) and folinic acid, fluorouracil, and irinotecan (folfiri) + bv were found to be similarly effective treatments as chemotherapy alone for metastatic crc (mcrc) patients with manageable toxicity profiles . Phase ii studies have shown that xeliri therapy is active in mcrc with unresectable liver - only metastases . There are, however, no reports about the use of the xeliri + bv regimen in the neoadjuvant treatment for patients with lung and liver metastases of crc . The patient had previously undergone low anterior resection for uicc stage ii a (t3n0m0) rectal cancer and received tegafur and uracil at a dose of 500 mg / day for half a year . The carcinoembryonic antigen level was 217.8 ng / ml . Tumor recurrence was confirmed on a computed tomography (ct) scan that showed a solitary nodule in the right lower lobe of the lung and multiple liver metastases (in s1, s5, and s7) in february 2011 (fig . The patient was treated with xeliri + bv [bv (7.5 mg / kg), cpt-11 (200 mg / m) on day 1 plus capecitabine (1,000 mg / m) twice daily on days 114, every 3 weeks] after surgery . The carcinoembryonic antigen level decreased to normal, and a ct scan revealed a partial response after four cycles of chemotherapy (fig . Partial resection of s1, s5, and s7 of the liver was then safely performed in august 2011 (fig . The patient underwent postoperative adjuvant therapy consisting of xeliri + bv for four cycles and xeloda (capecitabine) + bv for five cycles . The treatment of mcrc has evolved significantly over the past 10 years . In particular, combination chemotherapy has become the standard treatment for mcrc, often combined with a biological agent . Such therapies have significantly improved clinical efficacy related to overall response rates, time to tumor progression, and median overall survival . Several studies have reported comparable results between xeliri and folfiri bv as first - line treatment for mcrc . In the bicc - c randomized trial, patients treated with folfiri exhibited a significantly longer progression - free survival (pfs) compared to those treated with xeliri . In contrast, in the fnclcc accord 13/0503 study, a randomized, non - comparative study, the median pfs was 9.3 months in the xeliri + bv and 9.0 months in the folfiri + bv arms . In the hellenic cooperative oncology group phase iii trial using collateral biomarkers, the median pfs was 10.2 months in the xeliri + bv and 10.8 months in the folfiri + bv arms . These findings suggest that the xeliri bv regimen for mcrc is effective and equivalent to the folfiri bv regimen . In the bicc - c trial, the incidence of the most prominent grade 34 adverse events with xeliri were the following: diarrhea (47%), neutropenia (32%), dehydration (19%), nausea (18%), and vomiting (6%). Twenty - five percent of the patients discontinued the regimen and the treatment was prematurely terminated . In the cairo trial, patients assigned to the xeliri (combination) arm presented more frequently with diarrhea (27%), nausea / vomiting (9%), neutropenia (7%), febrile neutropenia (7%), and hand - foot syndrome (7%) as grade 34 toxicities . In the eortc 40015 study, patients treated with xeliri demonstrated high rates of grade 34 toxicities: diarrhea (37%), neutropenia (14%), vomiting (7%), and nausea (4%). Fifty - three percent of the patients required dose reduction and 14% succumbed to toxicity . In these three trials, however, in the fnclcc accord 13/0503 study, the dose of irinotecan was 200 mg / m and the incidence of the most prominent grade 34 adverse events with xeliri were lower: diarrhea (12%), neutropenia (18%), general fatigue (14%), nausea (3%), and vomiting (7%). Only 8% of the patients discontinued the regimen, and the treatment was prematurely terminated . In our case, we administered the same regimen, and the patient developed only grade 2 hand - foot syndrome . Neoadjuvant chemotherapy for crc with resectable liver metastasis results in a reduction in tumor size and a safe tumor margin . Mention that the 5-year survival rate of cases in which resection became possible following preoperative chemotherapy is the same as the resection results of cases in which resection was possible at the time of diagnosis . As the recurrence rate following radical resection is high, in our department the basic policy is to carry out a four - course capecitabine and oxaliplatin (xelox) + bv or xeliri + bv treatment regarding preoperative chemotherapy against all colon cancer liver metastasis cases, regardless of whether it is resectable or unresectable, and then resecting it following re - evaluation if possible . There is no unified view on which of the xelox and xeliri regimens should be given priority . According to a report by yoshida et al . . Therefore, in such cases, the irinotecan regimen may also be the first - line regimen, thereby prolonging the prognosis . In the cases treated at our department, preoperative four - course xeliri + bv therapy was carried out as a future1001 trial via the institutional review board (trial registration: umin000005060), and then a radical resection was safely carried out . The promising results presented in this paper suggest that the combination of xeliri + bv may represent a novel, highly active and advantageous regimen for patients with mcrc.
|
The pathophysiology of rheumatoid arthritis (ra) provides numerous cellular, intracellular, and messenger molecule targets, which can all be addressed by biochemical as well as antibody - based biological therapeutic agents . On the other hand, none of the current therapeutic regimens for ra leads to a long - term 100% remission rate, so additional ideas and drugs still need to be continuously developed and tested in clinical trials . These developments also include improvement of current drugs in terms of safety, efficacy, and a more comfortable application for the individual patient . Here, some of the most important developments in this field are presented . A milestone in the development of the therapeutic armamentarium for ra is the modified application form of prednisolone, which consists of prednisolone embedded in an inert hull that disintegrates after 3 - 5 hours of intestinal transit time and releases the prednisolone precisely at the moment of the lowest endogenous steroid production in the early morning hours . When this tempus tablet (figure 1) was applied, significantly reduced morning stiffness could be achieved . Similarly, as shown in a recent study, the disease - modifying anti - rheumatic drug (dmard) gold standard, methotrexate, is significantly more effective when applied subcutaneously and provides a more rapid onset of the therapeutic effect . Another strategy in the small - molecule dmard field is the mitogen - activated protein (map) kinase inhibitor pamapimod . Although map kinases are ubiquitous in inflammatory cells and contribute significantly to the synovial activation, the primary goal of an efficacy that was better than that of methotrexate could not be achieved . As shown recently, targeting other intracellular kinases such as jak and syk might be more promising . The most recently published study, in which masitinib (a potent and selective protein tyrosine kinase inhibitor of c - kit) was tested in the monotherapy treatment of dmard - refractory ra, showed acr20/50/70 (american college of rheumatology 20%/50%/70% improvement criteria) scores of 54%, 26% and 8%, respectively, and a reduction in c - reactive protein level by greater than 50% for approximately half of the patients . The hull of the tablet breaks apart after 4 - 6 hours of intestinal transit time, and prednisolone can act immediately at the time of the lowest endogenous steroid production . Approximately 10 years after the introduction of the first tumour necrosis factor (tnf) inhibitor (infliximab), there is still room for development and improvement (for example, a more rapid response or achievement of remission, or both, and an improvement of application mode for the patient). The first biologic in this group is the pegylated tnf inhibitor certolizumab pegol (cez), which has shown a very rapid response in clinical trials; it has been hypothesized that the pegylation may also lead to a deeper penetrance of the drug into the joints, an idea that still needs to be proven . It is licensed for ra in the us and has just received a positive appraisal from the european medicines agency and is approved for crohn s disease in some other countries (such as switzerland). However, the overall response rates do not differ significantly from those of the other tnf inhibitors . The second novel tnf inhibitor, golimumab (gom), is - aside from adalimumab - the second fully human tnf inhibitor and was developed with the goal of achieving a once - a - month patient - friendly subcutaneous application . As this goal has been achieved in clinical trials with an efficacy comparable to those of the other tnf inhibitors, gom was also recently licensed for ra in the us and is expected to be launched in europe late this year . To improve the earlier approach of a biologic inhibition of the proinflammatory and chondrocyte - activating molecule interleukin-1 (il-1), acz885, a fully human monoclonal antibody that neutralizes the bioactivity of human il-1, was generated in a small proof - of - concept study of 32 patients . A statistically significant reduction in disease activity score was observed after 4 weeks in the 10 mg / kg group, with a rapid onset of action in responders within the first 3 weeks . However, the true value of il-1 inhibition, which is significant in fever syndromes and adult still s syndrome, remains to be proven for long - term ra . With regard to the idea of selectively reducing the activity of the bone - degrading osteoclasts by antagonizing rankl (receptor activator of nuclear factor - kappa b ligand), the addition of twice - yearly injections of denosumab to ongoing methotrexate treatment inhibited structural damage for up to 12 months in patients with ra, with no increase in the rates of adverse events as compared with placebo . The more prominent development, however, was the licensing of the humanized anti - il-6 receptor antagonist tocilizumab (toz) for ra in some countries in europe . (note: in this report, the abbreviations cez, gom and toz are used according to a proposed unifying system for the nomenclature of biologics .) On the basis of the results of the clinical trials, toz, unlike other biologics, has been approved both for monotherapy and for first - line biological treatment similar to first - line tnf inhibitors . The data of the clinical studies show a rapid and persisting effect, which is further supported by the interesting notion that, due to the very early approval in japan for castleman s disease, 5-year efficacy and safety data are already available . However, although in europe several hundred patients have already been treated in the clinical routine, novel side effects also have to be considered in daily practice . First, it needs to be noted that, similar to tnf, il-6 is a pluripotent cytokine with numerous (differing) effects in pathways modulating inflammation and growth, but with fewer effects in the tnf domains of atypical and opportunistic infections and the development of lymphoma . Second, the side effects of il-6 inhibition are important in many other clinically relevant settings [for example, (transient) leukopenia and thrombopenia, the elevation of serum lipids, and hitherto unexplained gastrointestinal perforations]. A milestone in the development of the therapeutic armamentarium for ra is the modified application form of prednisolone, which consists of prednisolone embedded in an inert hull that disintegrates after 3 - 5 hours of intestinal transit time and releases the prednisolone precisely at the moment of the lowest endogenous steroid production in the early morning hours . When this tempus tablet (figure 1) was applied, significantly reduced morning stiffness could be achieved . Similarly, as shown in a recent study, the disease - modifying anti - rheumatic drug (dmard) gold standard, methotrexate, is significantly more effective when applied subcutaneously and provides a more rapid onset of the therapeutic effect . Another strategy in the small - molecule dmard field is the mitogen - activated protein (map) kinase inhibitor pamapimod . Although map kinases are ubiquitous in inflammatory cells and contribute significantly to the synovial activation, the primary goal of an efficacy that was better than that of methotrexate could not be achieved . As shown recently, targeting other intracellular kinases such as jak and syk might be more promising . The most recently published study, in which masitinib (a potent and selective protein tyrosine kinase inhibitor of c - kit) was tested in the monotherapy treatment of dmard - refractory ra, showed acr20/50/70 (american college of rheumatology 20%/50%/70% improvement criteria) scores of 54%, 26% and 8%, respectively, and a reduction in c - reactive protein level by greater than 50% for approximately half of the patients . The hull of the tablet breaks apart after 4 - 6 hours of intestinal transit time, and prednisolone can act immediately at the time of the lowest endogenous steroid production . Approximately 10 years after the introduction of the first tumour necrosis factor (tnf) inhibitor (infliximab), there is still room for development and improvement (for example, a more rapid response or achievement of remission, or both, and an improvement of application mode for the patient). The first biologic in this group is the pegylated tnf inhibitor certolizumab pegol (cez), which has shown a very rapid response in clinical trials; it has been hypothesized that the pegylation may also lead to a deeper penetrance of the drug into the joints, an idea that still needs to be proven . It is licensed for ra in the us and has just received a positive appraisal from the european medicines agency and is approved for crohn s disease in some other countries (such as switzerland). However, the overall response rates do not differ significantly from those of the other tnf inhibitors . The second novel tnf inhibitor, golimumab (gom), is - aside from adalimumab - the second fully human tnf inhibitor and was developed with the goal of achieving a once - a - month patient - friendly subcutaneous application . As this goal has been achieved in clinical trials with an efficacy comparable to those of the other tnf inhibitors, gom was also recently licensed for ra in the us and is expected to be launched in europe late this year . To improve the earlier approach of a biologic inhibition of the proinflammatory and chondrocyte - activating molecule interleukin-1 (il-1), acz885, a fully human monoclonal antibody that neutralizes the bioactivity of human il-1, was generated in a small proof - of - concept study of 32 patients . A statistically significant reduction in disease activity score was observed after 4 weeks in the 10 mg / kg group, with a rapid onset of action in responders within the first 3 weeks . However, the true value of il-1 inhibition, which is significant in fever syndromes and adult still s syndrome, remains to be proven for long - term ra . With regard to the idea of selectively reducing the activity of the bone - degrading osteoclasts by antagonizing rankl (receptor activator of nuclear factor - kappa b ligand), the addition of twice - yearly injections of denosumab to ongoing methotrexate treatment inhibited structural damage for up to 12 months in patients with ra, with no increase in the rates of adverse events as compared with placebo . The more prominent development, however, was the licensing of the humanized anti - il-6 receptor antagonist tocilizumab (toz) for ra in some countries in europe . (note: in this report, the abbreviations cez, gom and toz are used according to a proposed unifying system for the nomenclature of biologics .) On the basis of the results of the clinical trials, toz, unlike other biologics, has been approved both for monotherapy and for first - line biological treatment similar to first - line tnf inhibitors . The data of the clinical studies show a rapid and persisting effect, which is further supported by the interesting notion that, due to the very early approval in japan for castleman s disease, 5-year efficacy and safety data are already available . However, although in europe several hundred patients have already been treated in the clinical routine, novel side effects also have to be considered in daily practice . First, it needs to be noted that, similar to tnf, il-6 is a pluripotent cytokine with numerous (differing) effects in pathways modulating inflammation and growth, but with fewer effects in the tnf domains of atypical and opportunistic infections and the development of lymphoma . Second, the side effects of il-6 inhibition are important in many other clinically relevant settings [for example, (transient) leukopenia and thrombopenia, the elevation of serum lipids, and hitherto unexplained gastrointestinal perforations]. Therapy of ra is still a challenge for the practising rheumatologist, not only because none of the current drugs or combination therapies is able to achieve long - term full remission but also because the majority of patients are currently experiencing a loss of efficacy of the first, second, or even third biologic, so that novel options are urgently needed . The recent developments in the field of tnf inhibitors and the novel il-6 inhibitor toz are potentially an option for these needs . Moreover, the developments in the small - molecule field may be able to provide an applicable drug in the near future, although sustainable efficacy and clinically acceptable side effects still need to be proven in large - scale clinical trials . On the other hand, the novel application form of prednisolone, which has been manufactured according to the circadian need for an in - time delivery of steroids in the early morning hours, may contribute significantly to decrease the steroid load for ra patients . In summary, treatment of ra with respect to products mentioned in this report, um - l has received speaker honoraria from abbott (wiesbaden, germany), amgen (munich, germany), chugai pharma (frankfurt, germany), essex pharma (munich, germany), merck sharp and dohme (munich, germany) and ucb (monheim, germany); iht has received speaker honoraria from abbott; and en has received speaker honoraria from ucb.
|
Attempts to use national or local surveillance data to estimate the risk for sti transmission between women are limited by the fact that many risk classification schemes have either excluded same - gender sex among women or subsumed it under a hierarchy of other behaviors viewed as higher risk . Moreover, few, if any, state or local sti reporting systems routinely collect information on same - sex behavior among women . The available data are derived from two sources: small studies that have directly measured prevalence of common stis, usually among clinic attendees or self - referred study volunteers, and surveys that have queried lesbians about their self - reported sti history . Many of these studies have also assessed lesbians'self - report of sexual practices . Taken as a whole, these data indicate that the risk for sti transmission between women depends on the specific sti under consideration, and the sexual practices involved . Some sexual practices, including oral - genital sex, vaginal or anal sex using hands, fingers, or penetrative sex toys, and oral - anal sex, are commonly practiced by female sex partners (57). Practices involving digital - vaginal or digital - anal contact, particularly with shared penetrative sex toys, present a plausible means for transmission of infected cervicovaginal secretions . This concept is most directly supported by reports of metronidazole - resistant trichomoniasis and genotype - concordant hiv, which have been sexually transmitted between women who reported these behaviors (8,9). Reports of chlamydia trachomatis and neisseria gonorrhoeae transmission between women are anecdotal and largely unpublished; however, approximately 3%5% of respondents to surveys assessing lesbians' lifetime history of these stis indicate that a chlamydial infection had been diagnosed by a healthcare provider . Among 6,146 respondents in the national lesbian and bi women's health survey, conducted in the early 1990s, women reported contracting an sti from a female partner (including herpes by 135 persons, chlamydia by 102, genital warts by 100, gonorrhea by 16, hepatitis by 9, and hiv by 1) (10). Although self - report of sti history is often inaccurate (as is attribution of sti to a specific source partner), these data indicate that the respondents sought care for perceived genitourinary abnormalities and received a diagnosis that indicated the provider had reason to suspect an sti . The most important bacterial sti for which more precise data are needed is c. trachomatis infection . Although the rate of transmission of stis between women is probably low relative to that of transmission from men to women, a substantial proportion of lesbians, including those who self - identify as lesbians, and especially younger women most at risk for chlamydial infection, may continue to have sex with men (11). Transmission of common viral stis, especially human papillomavirus (hpv) and herpes simplex virus (hsv) infections and of treponema pallidum, the causative agent of syphilis, requires only skin - to - skin or mucosa contact, which can easily occur in the context of lesbian sex . Equally important, most lesbians (53%99%) have had sex with men, and many (21%30%) continue to do so (11); they may acquire viral stis from men and subsequently transmit them to female partners . In addition to case reports, two studies have detected hpv dna by pcr - based methods in 13% to 30% of lesbians (6,12). Samples obtained from the cervix, vagina, and vulva all demonstrated hpv dna, and no one anatomic site accounted for most infections . In one study, hpv dna was present in 19% of lesbians who reported no previous sex with men (6). Importantly, both high- and low - grade squamous intraepithelial lesions (sil) were detected on pap smear testing, and they were found in women who reported no previous sex with men . Using capture enzyme - linked immunosorbent assay (elisa) to measure type - specific antibodies to hpv, we found that 62 (47%) of subjects were seropositive for antibodies to hpv 16, and 83 (62%) were seropositive for hpv 6 (6,13). Of note, hpv seropositivity among women who reported previous or current sex with men did not differ from that of women who reported no previous sex with men . Given this, and the fact that sil has been observed in women who reported no previous sex with men, one can conclude that high - risk and low - risk types of genital hpv are sexually transmitted between women and that lesbians should undergo pap smear screening according to current national guidelines . Most cases of genital herpes are caused by hsv-2, although recent reports indicate a consistent trend toward more hsv-1related genital disease (14). When western blot assay was used to detect type - specific antibodies among 392 women in the seattle lesbian health study, antibodies to hsv-1 were detected in 182 (46%), and to hsv-2 in 31 (8%) (15). Most hsv-2 seropositive persons (71%) reported no history of genital herpes, and hsv-1 seroprevalence increased significantly as number of female partners increased . Older age predicted a higher seroprevalence of both hsv types, and hsv-2 seropositivity was associated with a reported history of having had a male partner with genital herpes (but not with number of previous male sex partners). Although genital transmission of hsv-2 between female sex partners occurs in a relatively inefficient manner, lesbians' relatively frequent practice of orogenital sex may place them at somewhat higher risk of genital infection with hsv-1, a hypothesis supported by the association between hsv-1 seropositivity and previous number of female partners . Although t. pallidum infection is relatively uncommon, compared to the viral stis discussed above, sexual transmission between female partners has recently been reported (16). Because some lesbians who choose to have sex with men may be more likely to choose bisexual men for partners (17,18), healthcare providers should keep in mind that the incidence of early syphilis and of fluoroquinolone - resistant n. gonorrhoeae have markedly increased in the last several years among men who have sex with men (19). Bacterial vaginosis, a condition associated with depletion of hydrogen peroxide producing lactobacillus species and the most common cause of vaginitis among women of reproductive age, is associated with pelvic inflammatory disease, increased risk of acquiring gonorrhea and hiv, and adverse outcomes of pregnancy (20). The prevalence of bacterial vaginosis among lesbians is high, and vaginal colonization with hydrogen peroxide - producing lactobacilli is low, relative to that of heterosexual women matched for age and sexual risk behavior (5,7,21,22). Bacterial vaginosis prevalence among lesbians in these studies has ranged from 24% to 51%, compared to 21% for heterosexual clients of sexually transmitted disease clinics and 9%14% for pregnant women . Although bacterial vaginosis is not a classic sti in that a specific microbial precipitant has not been identified, among heterosexual women, report of a new male sex partner and unprotected intercourse are frequently associated (20). Moreover, in early studies of " hemophilus vaginalis vaginitis, " criswell and gardner transmitted bacterial vaginosis from one woman to another by transferring vaginal secretions of women with bacterial vaginosis to noninfected women (23). Indeed, bacterial vaginosis is frequently found in both members of monogamous lesbian couples (7,24). In these women, bacterial vaginosis has been associated with sexual behavior that is likely to result in the transfer of vaginal fluid (7). These observations have prompted some authors to propose that sexual transmission of some etiologic factor, as yet undefined, is responsible (24). Finally, lesbians who are also currently sexually active with men may, in some settings, demonstrate increased sexual risk - taking behavior . Among women attending std clinics, those who report sex with women in addition to sex with men also had a marked increase in hiv - related risk behavior, including sex with gay or bisexual men, use of injection drugs and crack cocaine, and exchange of sex for drugs or money (17,18). In the 1997 college alcohol study, comprised of 14,251 college students, women who reported sex with both men and women were more likely to report multiple sex partners than their peers who had partners of the opposite sex only (25). In addition to sti exposure from male partners, previous or current sex with men has obvious implications for lesbians' reproductive health status . The prevalence of reported lifetime pregnancy among lesbians in the studies that have addressed this issue ranged from 23% to 35% (2628). Among 392 women in the seattle lesbian health study, 1 in 4 participants had been pregnant, and> 50% had used oral contraceptives (mean duration, 40 months) (28). Sixteen percent of all persons and 63% of those previously pregnant reported having at least one induced abortion . The most common pregnancy outcome for women who became pregnant at age <25 years was induced abortion, which occurred in 59% of these pregnancies . Despite the observations that support probable sexual transmission of hpv between women, many lesbians undergo routine pap smear screening less frequently than national guidelines advise . In the seattle lesbian health study, 236 (95%) of respondents believed they should receive pap smears annually or every 2 years after normal smear results, but 90 (36%) provided a reason for not having done so (12). Reasons most commonly cited were lack of insurance, adverse experience at prior pap smear screening, and a belief they did not need it because they were not sexually active with men . Nine study participants were told (by physicians in all but one case) that they did not need a pap smear because they were not sexually active with men . Despite high levels of education and income, women with no previous sex with men were less likely to have ever received a pelvic examination, had their first pap smear at an older age, and had pap smears less frequently than women who reported previous sex with men . Other investigators have also reported a lower rate of recent pelvic examinations or pap smears among lesbians (29,30). Among the few nationally representative surveys, the boston lesbian health project used snowball sampling (participants from the group of interest are asked to refer members of their social or sexual network for consideration for enrollment in the study) to query a national sample of 1,633 lesbians (31). Although the overall screening rates approximated those of the general population, 39% of respondents <20 years and 16% of those 2029 years had never had a pap smear, and 29% of those 3039 years had not had one in> 3 years . One of the few population - based surveys performed with lesbians as the intended audience used a random digit dialing survey to compare the physical and mental health status of 4,135 respondents as a function of self - reported sexual orientation (32). Both lesbians and bisexuals were more likely to report increased rates of poor physical and mental health, as other studies have also noted (33). Potential barriers to preventive care by lesbians include healthcare providers' lack of knowledge about disease risk and indications for screening; providers' failure to obtain a complete sexual history from lesbians when relevant, or to do so in a sensitive, nonjudgmental manner; patients' lack of economic resources (due to lack of insurance in the absence of domestic partner benefits, unwillingness to disclose sexual orientation to obtain such benefits when they are offered, or lower earnings in households without at least one man); and lesbians' perception of low risk for sti acquisition from female partners and of cervical dysplasia . Many lesbians (53%72%) do not disclose their sexual behavior to physicians when they seek care, and disclosures may elicit negative reactions (34). Moreover, among 1,086 lesbians surveyed, only 43% of women with a clear risk factor for hiv perceived themselves to be at risk (35). Similar assumptions about hpv acquisition from female partners may place lesbians at risk for delayed detection of cervical cancer by less frequent pap smear screening or none . Finally, lesbians who do not also have sex with men may not access venues providing hormonal contraception, thus eliminating another routine opportunity for pap smear screening to be sought or offered . Available data strongly suggest that hpv, and probably other stis, are sexually transmitted between women . Thus, recommendations for pap smear screening among lesbians should not differ from those for heterosexual women, a point that should be clearly communicated in national guidelines and relevant training programs . For example, no national guidelines for sti or pap smear screening or treatment mention the existence of lesbians, if even to note that data to direct recommendations are limited or absent (36). Moreover, healthcare providers, particularly those in training, would benefit from education to enhance their skills in taking a thorough, sensitive sexual history from all patients . The recent increases in sti among men who report sex with men but who do not identify themselves as gay also show that simply asking patients their self - defined sexual orientation is not adequate . Assessment of specific sexual risk behaviors and of previous sexual history can provide a more complete tool for assessment and counseling of patients' sexual health status . From the research perspective, high - risk hpv types and sil among lesbians support the need for further investigation . Conditions that could contribute to more infrequent pap smear screening, including perception of low risk, provider behaviors, or economic barriers, should be defined, as should risk for specific sti transmission . Prevalence of common sti, especially c. trachomatis infections, should be systematically studied among young women at highest risk for such infections . Beginning to describe the sexual networks in which lesbians participate particularly as they involve men at potentially high risk for sti, notably hiv should provide much - needed data into the sexual and social dynamics of a highly diverse population . The intriguing observation of bacterial vaginosis concordance within female sexual partnerships should offer an opportunity to decipher the puzzling etiology of this common condition . This information could not only contribute to advances in understanding the microbiologic and sociologic characteristics of stis in general, but more immediately, would inform a cogent approach to counseling lesbians and educating healthcare providers about sti - related risk and prevention.
|
As concerns regarding foot health have risen, foot pressure measurement has been widely used to solve foot problems in patients with foot pain, diabetes mellitus, and rheumatoid arthritis2 . Foot pressure is one of the measurement areas considered most in clinical trials and sports science research, and it has been measured to observe the pressure exerted onto a specific area of the foot while engaging in activities of daily living and functional activities3 . Therefore, foot pressure measurement can be used in various areas to determine the influence of foot problems on abnormal gait in patients with foot deformation, cerebral palsy, arthritis, amputation, and hemiplegia2 . Physical fatigue, injury, and chronic diseases may be caused by repeated impact and the force between the foot and the sole during gait4 . In normal persons, a proper protection mechanism for mechanical stimulation during gait is applied to protect the body, but if the foot pressure is concentrated on one spot, malformations such as hyperkeratosis, pain, hallux valgus, claw toe, and hammer toe arise5 . In addition, patients with neuropathic disorder or peripheral diseases may incur an injury because they cannot properly cope with a stimulus6 . Thus, a sensory deficit in the sole may have a great influence on posture and gait control, and a sensory disability in the sole can lead to neurological diseases such as neural damage, nerve root compression in the spine, or diabetes mellitus7 . The pressure exerted onto a specific part of the foot can be observed by measuring the foot pressure, which can be used to solve foot problems in patients with foot pain, diabetes mellitus, and rheumatoid arthritis2 . It is a proven method of evaluating foot functions, and is also a means of detecting pathological problems like diabetes mellitus and preventing ulcers8 . Also, foot pressure analysis has been used in various areas, including investigation of the influence of foot pressure on foot deformity caused by foot problems9 . A foot pressure measurement system measures the force and pressure applied to a specific position10, and the gait pattern can be determined by examing the distribution of foot pressure during gait11 . Therefore, analyzing foot pressure in relation to the gait pattern is helpful for treating patients with clinical foot problems and for observing their progress12 . Foot pressure data also provide useful information for managing diseases related to the musculoskeletal, integumentary, and nervous systems10 . Several methods of decreasing foot pressure by applying foot orthosisis, wedge, or gait strategies and by evaluating abnormal increases in foot pressure due to various foot diseases are under investigation13 . Studies on foot orthoses, diabetic shoes, and footwear for the elderly have also been conducted recently14 . Seo and park reported that functional foot orthoses intended to resolve foot malformation have been used to treat many biodynamic problems15 . There have been limited studies, however, on orthotic devices such as the metatarsal pad, dome, and wedge . Therefore, in this study, a bar was applied on the metatarsophalangeal joint area in normal persons, and a foot analysis system and measurement of the pressure exerted on the forefoot, midfoot, and rearfoot were used to determine if any changes occurred in spatiotemporal indices and kinematic parameters . The subjects enrolled in this study were women in their twenties who voluntarily agreed to take part in the experiment from june 29 to july 7, 2013, and were attending k women s university in the kwangju region, south korea . Excluded from the study were those who had no gait problem and those who had excessive valgus or varus of the subtalar joint, a foot deformity like hallux valgus, or a foot disease like foot ulcer and sprain . Forty subjects were randomly selected to participate in the experiment before and after placement of a metatarsal bar . The general features of the subjects are presented in table 1table 1.general characteristics of the study subjects (n=40)age(years)height(cm)weight(kg)foot size(mm)meansd20.91.4162.05.152.77.1234.97.4 . All the subjects signed an informed consent form, and the study was approved by k women s university . A foot pressure measuring instrument (gait checker hardware spc ., ghw-1100, south korea) was used to measure the pressure distribution in the sole . The length, width, height, and frequency of the foot pressure measuring instrument were 1.3 m, 0.52 m, 0.055 m, and 5060 hz, respectively . A metatarsal bar with a height of 0.3 cm and a heel insert was attached to the metatarsophalangeal areas ofthe subjects bare feet using a paper bandage . The material, shape, size, and thickness of the metatarsal bars were the same . The static foot regions were divided into the forefoot, midfoot, and rearfoot, and then the maximum, average, and minumum pressures exerted onto each region were measured, along with the static foot pressure distribution ratio . The static foot pressure was measured with the tips of both feet aligned to match the vertical and horizontal lines of the foot pressure measuring plate . The distribution ratio was measured in four regions (front, back, left, and right) using the same method as that used for static foot pressure measurement . Chicago, il, usa) by encoding the measurement data obtained before and after the application of the metatarsal bar based on a repeated - measures design . The subjects were made to stand at the starting point of a gait path, and to walk comfortably in the direction indicated by the measurer for comparison of the foot pressures in the forefoot, midfoot, and rearfoot before and after the application of the metatarsal bar under static conditions . The paired t - test was used to examine the foot distribution ratio . The statistical significance level for all the tests comparison of the repeated - measures sample results for the forefoot between before and after application of the metatarsal bar to the left and right feet showed that the maximum pressure was significantly reduced according to time . The average pressure was also reduced according to the time after the application of the bar to the left and right feet compared with before application, and the minimum pressure was significantly reduced . The left and right feet showed significant differences in average and low pressure (table 2table 2.forefoot pressure comparison after applying a metatarsal bar under static conditions (n=40) (units: n / cm)prepostmaximum pressurer315.533.4310.831.7l284.435.7282.624.6average pressurer175.920.3165.615.7l156.018.2150.212.5low pressurer30.84.9820.42.9l27.63.817.84.4meansd). Comparison of the repeated - measures sample results for the midfoot before and after the application of the metatarsal bar showed that the maximum pressure was significantly reduced in both the left and right feet . The average pressure was also significantly reduced according to the time after the application of the bar to both the left and right feet compared with before application, and the minimum pressure was significantly increased . The left and right feet showed significant differences in maximum, average, and low pressure (table 3table 3.midfoot pressure comparison after applying a metatarsal bar under static conditions (n=40) (units: n / cm)prepostmaximum pressurer168.562.381.281.0l132.566.943.958.6average pressurer86.933.146.648.1l68.134.724.532.7low pressurer 5.46.111.917.4l3.84.35.18.2meansd). Comparison of the two - way anova results with the repeated - measures results forthe rearfoot showed that the maximum pressure was reduced, and the minimum pressure showed no significant difference between before and after application of the bar to both feet . There were significant differences, though, in the maximum and minimum pressures of the left and right feet (table 4table 4.rearfoot comparison after applying a metatarsal bar under static conditions (n=40) (units: n / cm)prepostmaximum pressurer336.934.7310.940.8l343.251.9336.440.4average pressurer176.317.1167.621.5l179.827.4179.920.0low pressurer15.75.724.46.5l16.44.923.35.1meansd). Comparison of the sample t - test results with the distribution ratio showed a significant difference between before and after application of metatarsal bar . Both the left and right distribution ratios showed no significant difference between before and after application of the bar (table 5table 5.distribution ratio comparison after applying a metatarsal bar under static conditions (n=40) (units:%) prepostfore52.08.745.49.6rear47.98.754.69.6left48.52.648.84.6right51.72.150.73.5meansd). In the study entitled comparison of the peak plantar pressure between bare feet and in - shoes in diabetic patients conducted by yang14, the conditions before and after 17 diabetic mellitus patients two kinds of diabetic shoes by were measured and compared . The results showed that, the foot pressure in all the regions of the sole decreased significantly after the subjects wore the two kinds of diabetic shoes . Therefore, the wearing of diabetic shoes for both indoor and outdoor activities was recommended . In addition, in a study conducted by lee et al ., a longitudinal arch and longitudinal arch plus metatarsal pad were added to right - heel and left - heel inserts for 33 normal persons, respectively, and the maximum pressure in the sole was measured . Consequently, the foot pressure was found to be lower in the rearfoot, midfoot, and 3rd, 4th, and 5th metatarsal regions with when a heel insert with a metatarsal pad in the medial longitudinal arch was used compared with when a heel insert with a longitudinal arch was used16 . Like these studies, this study showed a significant reduction of foot pressure in the forefoot, midfoot, and rearfoot, and it was found in this study that application of the metatarsal bar was effective in reducing the pain experienced by the subjects with foot problems . The use of a foot orthosis with a large metatarsal pad resulted in an 820% reduction in maximum foot pressure in the forefoot . Insertion of an extended metatarsal pad reduced the maximum foot pressure in the forefoot from 3 to 23% . This study also showed that the maximum pressure in the forefoot was reduced because an extended metatarsal bar was used rather than a partial metatarsal bar . In the study entitled effects of forefoot rocker shoes with a metatarsal bar on lower - extremity muscle activity and plantar pressure distribution conducted by park et al.17, 10 women in their twenties were asked to wear general metatarsal - bar - type and forefoot rocker shoes . The results showed that, the maximum pressure was significantly reduced in the midfoot, rearfoot, 1st metatarsal head, and 2nd3rd and 4th5th metatarsal heads . In addition, the study was identical to the relevant past studies in that like the past studies, it also showed a significant reduction of the maximum pressure in the forefoot, midfoot, and rearfoot . In the study entitled effect of the use of a metatarsal pad on foot pressure conducted by lee et al.16, a metatarsal pad was attached to the bare foot and shoes of 33 normal persons, and the results were measured . The results showed that the maximum pressure in the foot with the metatarsal pad was significantly low in the rearfoot, midfoot, and 3rd, 4th, and 5th metatarsal regions . The results of the present study showed that application of a metatarsal bar significantly lowered the maximum pressure in the forefoot, midfoot, and rearfoot . As a reduction in foot pressure results in lowering of the arch and an increase in contact surface, effect of the use of a metatarsal pad on the peak plantar pressure of the forefoot during walking conducted by yoon5, general orthotics and five types of metatarsal pad were applied to 21 women in their twenties and fifties, respectively, and the pressure in different areas of their feet was measured . The results showed that when a metatarsal pad was attached to the orthotics, the maximum foot pressure in the forefoot was significantly reduced . The left foot had a higher maximum pressure in the midfoot and rearfoot than the right foot, and the maximum pressure in the right foot was significantly high in the forefoot and metatarsal head . In this study showed significant differences between the left and right feet, but the maximum foot pressure was higher in the right forefoot, midfoot, and rearfoot than in the left foot . This is because the difference in the lengths of the legs in a standing position caused a significant difference in foot pressure between the right and left feet . Therefore, relevant research about the cop (center of pressure) and the length of the legs is needed . A paper by chang et al.18 reported that the factors affecting foot pressure were related to the location and size of the metatarsal pad, and suggested the importance of careful adjustment of the pad position . The study entitled the change in the in - shoe plantar pressure according to the lever point of the metatarsal bar conducted by lee et al.19 reported that when the bar was located at the center of the metatarsal head, the sole pressure was effectively reduced . The results obtained with the bar located at the center of the metatarsal head were the same as those obtained by the previous researchers . In this study suggests that further studies comparing the results of application of a 0.3 cm bar to the metatarsophalangeal region should be conducted, and that such studies should include male subjects in examination of the changes in foot pressure according to the difference in leg length . Therefore, wearing shoes with a bar that can reduce the foot pressure for patients with foot problems like diabetic foot lesions and rheumatoid arthritis and help cure such patients.
|
As a cell or a community of cells, a biological system s hierarchical organization allows for structure formation and system functionality . Alteration of biological processes, such as cell cycle1 or cell division,2 may lead to fundamental disorder at the molecular level and induce activation of genetic changes (figure 1).3 particular hallmarks of cell transformation, tumor initiation, and subsequently progression have been related to the intricacies of cellular regulation.4 similarly, epigenetic alterations inducing inflammation and microenvironment changes (figure 2) have been shown to influence phenotype transformation.5 for instance, previous reports on epigenetic transformation revealed that metastatic properties are related to the abnormal expression of key regulatory genes . Tumor - suppressor genes could, for instance, restrain cell division as well as induce cell death, while loss of gene function could result in abnormal cellular behavior, perturbation of the cell cycle, and lack of cell regulation.6 previous studies have also indicated that limd1 overexpression could retard cell - cycle progression and block s - phase entry, leading to cell accumulation in the g0/g1 phase and subsequent changes in cellular behavior;7 limd1 is a tumor - suppressor gene located at chromosome 3p21.3, a region commonly deleted in many malignancies.6 another study found that deregulation of microcephalin and aspm expression (involved in the regulation of neurogenesis)8 leads to abnormal cell division and subsequently to cancer progression.7 microcephalin is involved in the dna - damage response and has been linked to tumor formation and cancer invasion (figure 3). Other analysis revealed that aberrant hypomethylation - mediated agr2 overexpression could cause an aggressive phenotype in ovarian cancer cells;9 agr2 is developmentally regulated initially discovered as an estrogen - responsive gene in breast cancer cell lines currently linked to tumors with poor outcome.10 with regard to the influence of the microenvironment on cells and how changes in such microenvironments11 could lead to phenotypic progression and cancer transformation,12 analysis showed that alterations in external factors, such as the ph of a tissue, could trigger cellular changes13 and regulate cell transformation.14 an acidic environment (ph 6.56.9 compared with ph 7.27.4) could cause degradation of the extracellular matrix (ecm) and lead to the secretion of vegf, as well as to angiogenesis, which can correlate with tumor transformation and cellular invasion (figure 4).15 analysis also showed that proteins in the ecm could interact directly with tumor cells, eg, via their integrin surface receptors, to influence and subsequently alter cellular behavior, proliferation, apoptosis, migration, or differentiation.16 remodeling of the ecm could occur in tumor - fibroblast cells and subsequently accelerate cancer progression.17 during the remodeling process, the mechanical response of the ecm can change progressively,18 leading to enhanced cell migration19 followed by invasion at specific interfaces.20 also, it was found that extracellular vesicles could regulate and modulate the microenvironment of the cancer cell21 by regulating cellular communication and playing an important role in phenotype transformation22 and cancer progression.23 the malignant transformation is accompanied by changes in cell structure24 and morphology,25 as well as changes in cellular responses to stimuli.26 studies revealed that alterations in cell biophysical properties, especially in their biomechanical characteristics, represent an early indicator of disease progression,2729 with phenotypic events being mostly a result of cytoskeleton remodeling.30 it was observed that brms1 expression in 435 cells caused changes in their architecture, leading to alterations in their biomechanical properties, with such changes being due to the reconstruction of actin cytoskeletal networks.31 however, even though the identification of the molecular link between chronic inflammation and cancer was elucidated through nfb, the initial transformation and activation pathways remain to be clarified and chronic inflammation - induced tumorigenesis to be elucidated . Further, while significant advances have been made toward elucidating the molecular mechanisms that underlie cancer progression, fundamental questions associated with the biomechanical traits that lead to cancer development and subsequently to metastasis remain to be answered . For instance, with tumor progression being a result of the ability of transformed cells to communicate and influence one another, as well as their neighboring healthy cells,32 and with clinical observations of distinct tumors from different organs seeming to be cell - specific,33 it is unclear how and whether transformation of a cell or a community of cells in an organ could lead to different tumor phenotypes or if such transformation is propagated through the microenvironment . With the development of atomic force microscopy (afm) technology, computer - assisted applications for biomedical fields for analyses of biological information in terms of biomechanical characteristics have spiked.3437 obtaining the bio - nano - mechanical signature of cells or tissues has thus been proposed as the next method that could possibly lead to the development of a differentiation tool of pathological conditions from normal ones . As such, nanoindentation or the ability to detect and measure changes in the elasticity or the elastic responses of soft materials, such as cells,38 manifested as a readout in displacement - versus - force curves (figure 5), indicated that cancer cells have different characteristics when compared to healthy cells.26,39 in particular, studies have shown that the stiffness,40 migration ability,41 and morphology42 of cancer cells differ from healthy cells, with single cancer cells showing lower stiffness and higher deformability,43 and with such characteristics being dependent on the type of cell being analyzed.44 further, complex examination of individual cells and their cellular components showed that the different elastic properties of cancer cells are a result of local or global changes that contribute to or induce their transformation.26 analysis of the membranes of both cancer and healthy cells showed that while the surface of the latter revealed brush - like structures of one specific length and were formed from glycocalyx layers with pericellular coatings,45,46 the surface of cancer cells displayed both long and short brushes with significantly different geometries and densities . Such brush - like geometry is known to provide support for cell cell interactions, cell migration, and differentiation.26 paired with changes in the cellular membrane were changes in submembrane or cytoskeletal structures . For instance, analysis of malignant (mcf7) and nonmalignant (mcf10a) breast cells revealed that mcf10a cells had an apparent young s modulus significantly higher than that of their malignant counterparts,47 with topographic images of such cells revealing well - structured microfilaments that were different than the ones observed for the mcf7 cells (figure 6). The differences in cytoskeletal organization were attributed to dissimilarities in the cell mechanical properties, and could possibly explain the increased migration and invasion ability of the malignant cells, especially during metastasis . Studies also showed variations in the stiffness of the cytoskeleton of nonmalignant mcf10a and malignant mdamb231 breast cells resulting from the growth media,48 with analysis revealing that the mean elastic modulus of mcf10a cells was higher than that of the mdamb231 cells cultured in identical conditions . Furthermore, the characteristics of the malignant breast cells and their nonmalignant counterparts in the 27c34c temperature range49 indicated that the malignant cells were softer than their counterparts . The significant difference in the cellular young s modulus between malignant and healthy cells was due to the structural differences recorded, especially in their three - dimensional cytoskeleton, with the cytoskeletal structures of the cancer cells showing a more fluidlike state than the cytoskeleton of the healthy cells.50 membrane and cytoskeletal changes were largely accompanied by nuclear transformations, with afm nanoindentation - based analysis of isolated nuclei of healthy (mcf10a) and malignant (mcf7) human breast epithelial cells showing mechanical changes in relation to individual cell type.51 in particular, the apparent young s modulus of mcf7 cell nuclei was much lower than that of mcf10a cell nuclei, mainly because of the alternation of their underlying lamina (lamin a / c) structure . The study also indicated that the nucleus deformability was tightly related to the softening of cancer cells . Complementary afm nanomechanical - based analysis of several areas of healthy and cancer oligodendro - cytes52 showed that the elastic modulus of the nuclear regions of the cancer cells was lower than that of the cell periphery, with cancer cells being threefold softer than healthy cells . Similar results were obtained for malignant thyroid cells,53 with the elastic analysis showing that such malignant cells were three- to fivefold softer relative to their primary and untransformed counterparts . Nanoindentation enabled detection of cancerous cells from a mixture with healthy cells.44 in particular, the elasticity of human kidney cell lines from different types of tumors (ie, carcinoma [a498] and adenocarcinoma [achn]) was compared with that of a benign cell line (rc124). For this, dozens of individual cells were mapped, and more than 15,000 data points per cell were generated to calculate the sample s viscoelastic properties and the elastic modulus . Systematic comparisons indicated that cancer cells had distinctive elastic properties, with the young modulus of the a498 carcinoma cell line being larger than that of the adenocarcinoma . Similarly, a direct comparison of elastic properties of human breast cancer cells (mcf7) and human cervical carcinoma cells (hela), known to have similar phenotypes,54 showed that hela cells were three times harder than mcf7 cells . Different prostate cancer cells showed distinctive metastatic potential, which was subsequently correlated with variations in their elastic moduli.55 for instance, the elastic modulus of a primary benign prostate hyperplasia cell line was greater than that of the lncap - clone - fgc and pc3 cell lines, with the young modulus of the highly invasive pc3 cells being higher than that of the noninvasive lncap - clone - fgc cells . Such variations point to distinctive clinical behavior and potentially hint at different therapeutic outcomes for such cells . When nanoindentation was used to detect cancer progression in tissue sections originating from patients,56 analysis showed that the apparent young modulus of the cancer region was half that of the nonneoplastic tissue . Moreover, elastic mapping conducted on healthy tissues showed homogeneous modulus profiles characterized by a single distinct peak . In contrast, malignant tissues had a distinctive broad distribution of their young moduli mainly originating from the tissue heterogeneities, with cancer cells revealing prominent low - stiffness peaks.57 further, such differences in cell stiffness could also be related to identification of biomarkers with potential invasive and metastatic characteristics (figure 7).58 bionanomechanical - based afm functional analysis helped detect metastatic tumor cells in bodily fluids,57 with cross et al showing that lung, breast, and pancreas cancer cells displayed significantly decreased stiffness when compared to healthy control counterparts.57 rother et al investigated viscoelastic responses of nine cell lines (ie, nih3t3 fibroblasts, mdckii, nmumg, a549, sw13, mcf7, mcf10a, mdamb231, and caki1 cells) from four different organs, all known to have variable metastatic potential,56 (figure 8) and showed that cells from the organ exhibiting malignancy were generally softer than their benign cell counterparts.59 when elastic moduli and cell - substrate adhesion analyses for lowly (lncap) and highly (cl1, cl2) metastatic human prostate cancer cells were performed,60 results showed that the elastic moduli of cl1 and cl2 were greater than those of lncap, with cl1 and cl2 displaying a significantly larger area to cell - substrate adhesion relative to the lncap cells . The increased elastic moduli found in cl1 and cl2 were attributed to the enhanced tensile stress generated from the actin cytoskeleton anchored on more focal adhesion sites, hinting again at different metastatic potential of such cells . Complementary analysis of late - stage tumors in the lungs of mice indicated that migration and metastatic spreading characteristics were related to the low elasticity of hypoxia - associated cancer cells . In particular, bionanomechanical response experiments on benign mesothelial cells and metastatic cancer cells derived from human body fluids61 showed that the young modulus of metastatic tumor cells was about 80% lower than that of the benign cells . Moreover, cell - adhesion analysis of these malignant cells revealed an overall 33% reduced adhesion when compared to the adhesion of benign cell counterparts . A summary of the changes in elasticity of different types of tissues and cells, all relative to controls (noncancerous cells) is in table 1 . The results suggest that the morphology factor alone was sufficient to explain differences in stiffness for the cell types being considered and hint at mechanisms of cell invasion being based on reduced adhesion of cells to their three - dimensional environment . Nanoindentation enabled detection of cancerous cells from a mixture with healthy cells.44 in particular, the elasticity of human kidney cell lines from different types of tumors (ie, carcinoma [a498] and adenocarcinoma [achn]) was compared with that of a benign cell line (rc124). For this, dozens of individual cells were mapped, and more than 15,000 data points per cell were generated to calculate the sample s viscoelastic properties and the elastic modulus . Systematic comparisons indicated that cancer cells had distinctive elastic properties, with the young modulus of the a498 carcinoma cell line being larger than that of the adenocarcinoma . Similarly, a direct comparison of elastic properties of human breast cancer cells (mcf7) and human cervical carcinoma cells (hela), known to have similar phenotypes,54 showed that hela cells were three times harder than mcf7 cells . Different prostate cancer cells showed distinctive metastatic potential, which was subsequently correlated with variations in their elastic moduli.55 for instance, the elastic modulus of a primary benign prostate hyperplasia cell line was greater than that of the lncap - clone - fgc and pc3 cell lines, with the young modulus of the highly invasive pc3 cells being higher than that of the noninvasive lncap - clone - fgc cells . Such variations point to distinctive clinical behavior and potentially hint at different therapeutic outcomes for such cells . When nanoindentation was used to detect cancer progression in tissue sections originating from patients,56 analysis showed that the apparent young modulus of the cancer region was half that of the nonneoplastic tissue . Moreover, elastic mapping conducted on healthy tissues showed homogeneous modulus profiles characterized by a single distinct peak . In contrast, malignant tissues had a distinctive broad distribution of their young moduli mainly originating from the tissue heterogeneities, with cancer cells revealing prominent low - stiffness peaks.57 further, such differences in cell stiffness could also be related to identification of biomarkers with potential invasive and metastatic characteristics (figure 7).58 bionanomechanical - based afm functional analysis helped detect metastatic tumor cells in bodily fluids,57 with cross et al showing that lung, breast, and pancreas cancer cells displayed significantly decreased stiffness when compared to healthy control counterparts.57 rother et al investigated viscoelastic responses of nine cell lines (ie, nih3t3 fibroblasts, mdckii, nmumg, a549, sw13, mcf7, mcf10a, mdamb231, and caki1 cells) from four different organs, all known to have variable metastatic potential,56 (figure 8) and showed that cells from the organ exhibiting malignancy were generally softer than their benign cell counterparts.59 when elastic moduli and cell - substrate adhesion analyses for lowly (lncap) and highly (cl1, cl2) metastatic human prostate cancer cells were performed,60 results showed that the elastic moduli of cl1 and cl2 were greater than those of lncap, with cl1 and cl2 displaying a significantly larger area to cell - substrate adhesion relative to the lncap cells . The increased elastic moduli found in cl1 and cl2 were attributed to the enhanced tensile stress generated from the actin cytoskeleton anchored on more focal adhesion sites, hinting again at different metastatic potential of such cells . Complementary analysis of late - stage tumors in the lungs of mice indicated that migration and metastatic spreading characteristics were related to the low elasticity of hypoxia - associated cancer cells . In particular, bionanomechanical response experiments on benign mesothelial cells and metastatic cancer cells derived from human body fluids61 showed that the young modulus of metastatic tumor cells was about 80% lower than that of the benign cells . Moreover, cell - adhesion analysis of these malignant cells revealed an overall 33% reduced adhesion when compared to the adhesion of benign cell counterparts . A summary of the changes in elasticity of different types of tissues and cells, all relative to controls (noncancerous cells) is in table 1 . The results suggest that the morphology factor alone was sufficient to explain differences in stiffness for the cell types being considered and hint at mechanisms of cell invasion being based on reduced adhesion of cells to their three - dimensional environment . To advance afm - based technologies for clinical detection of cell transformation, a trained workforce and consecutive probing of cell characteristics are required . However, with reports showing that such consecutive measurements can influence the mechanics of individual cells,62 and with rigorous statistical analyses revealing that sample - preparation conditions need to be accounted for when reliability in cancer diagnosis is envisioned, the heterogeneity and complexity of a transformed cell is more than a mechanical cue indicator that permits evaluation and readability of changes in terms of cellular elasticity . As such, if afm is to be used for advanced diagnosis and for clinical detection, the heterogeneity of the cellular sample needs to be accounted for . In particular, with analysis showing that molecular composition plays a critical role in the mechanics of the tissue,63 for afm to be a viable and useful tool for clinicians, analysis of the plasticity of a cell population64,65 needs to be supported by biochemical assays,66 gene expression,67 and immunofluorescent labeling.68 research combining afm and biochemical assays has already shown that the interaction and bond formation of single p - selectin ligand complexes can be quantified . P - selectin is located on the endothelial cell wall, and helps support the leukocyte when under hydrodynamic flow; the complex formed upon association with glycoproteins was shown to exhibit chain - like elasticity with a 5.3 pnnm molecular spring constant and a 0.35 nm persistence length.69 other studies indicated that dna - dependent protein kinase can bind at the dna termini, with such binding being characterized by afm.70 also, high - speed afm was used to reveal atp - driven motor f1-rotary behavior and quantify its conformational changes, as well as confirm the dependence of the initial rates of atp hydrolysis, as determined through biochemical assay (figure 9).71 lastly, stretching single polysaccharides and proteins in the presence of afm has been demonstrated, thus contributing to the body of work illustrating the biophysics and chemical biology of a protein protein bond or enzymatic reactions related to force applications.72 research combining afm with gene - expression analysis has reported on dna condensation and how this could be used for gene therapy.73 polylysine covalently attached to the glycoprotein asialoorosomucoid was shown to enhance gene expression in the liver of a mouse model, with the enhancement being up to 50-fold higher when compared to polylysine alone . By combing afm with confocal microscopy, scholars evaluated bioeffects of therapeutic ultrasound - mediated dna on cells and nuclei,74 with the therapeutic ultrasound proving to be useful for increasing transfection efficiency . Zhu et al mapped the nucleotide - binding site of uncoupling protein 1 with the help of afm and using both topographic and recognition modes of the mitochondrial membrane to elucidate the mechanism of the nucleotide binding, and thus helped explain how reactive oxygen - species generation can be used for obesity-, inflammation-, neurodegeneration-, or ischemia - related therapies.75 kim et al investigated fundamental structural units in the escherichia coli nucleoid using afm,76 and showed that fibrous structures of 40 nm and 80 nm were found in the different growth phases of the bacteria . Lastly, preliminary research combining afm and immunolabeling has already demonstrated that cytoskeletal structures can be probed by combining afm with stimulated emission depletion (sted)77,78 (figure 10) and/or stochastic optical reconstruction microscopy,79 all to ensure high resolution.80 research has also shown that by combining afm with immunofluorescence, both hdac6 and its role in mediating vimentin s reorganization can be elucidated . Vimentin is known to modify the cytoskeleton structure and thus influence and regulate cellular mechanics.81 specifically, the authors showed that the organization of vimentin fibers in the oncogene - expressing cells was different than in the controls, with sted revealing a more entangled structure and an increase in cellular stiffness relative to controls . Such ultrahigh - resolution analysis also showed increased cellular disorganization, consistent with the possibility that oncogenes induce an hdac6-mediated collapse of the cytoskeletal network to contribute to changes in cellular stiffness and ultimately in cell invasion that could accompany epithelial - to - mesenchymal transition . Further, harke et al demonstrated that by combining afm and sted, a novel advanced nanoscopic tool can be created to allow for fluorescence, topographical, and elastic - modulus analysis of biosamples.82 other studies also revealed cytoskeleton structures (such as actin filaments and microtubules) of living astrocytes in neural cells by coupling afm with confocal microscopy . The results showed that the cytoskeleton fibers had high elastic moduli and demonstrated afm s great potential to differentiate the roles of the cytoskeleton in neurodegeneration.83 cell - wall elongation and cytoskeleton changes have also been observed for gram - negative bacteria using superresolution - fluorescence microscopy combining afm and stochastic optical reconstruction microscopy.84 while this information provides evidence that afm integration with current diagnosis assays might become a useful tool for clinicians, concerns regarding this technique s limited ability to allow for automation and real - time cell - transformation analysis and evaluation, all in the natural viscoelastic conditions of both the cell and its ecm, need to be addressed . In particular, with stiffness being a function of the time scale of the measurement,85 and knowing that well - controlled and tightly regulated balances of forces are required to help maintain homeostasis in a cell or a community of cells,86 and with the ecm controlling survival,87 cellular development,88 migration,89 proliferation,90 shape,91 and ultimately cellular fate and function, quantifying heterogeneity at the level of a single cell or a community of cells makes analysis even more challenging . As such, the next generation of afm - based technologies to be considered for the identification of cell transformation should allow for possible differentiation of the different tumor elements, as well as the capability to assess how such elements can work together synergistically to contribute to or define tumor heterogeneity . Tool should allow for parallel tests to be performed in individual labs on chip rooms, in which immobilized cell samples could permit evaluation of levels of protein expressions, changes in morphology, or changes in cellular elasticity (figure 11). Moreover, an ideal instrument should also allow for real - time monitoring of cellular physiological changes in a nondestructive manner and in a fast and reliable way by combining such physiological changes with the morphological and biochemical cues in a manner that could be easily interpreted by the user, ie, the clinician . Without the complexity of the biology, the analysis of mechanical cues, while perhaps providing behavioral insights, cannot provide a time - dependent cell - transformation analysis nor can it allow for evaluation of heterogeneity based on the individual changes in the cell cycle.
|
Proliferation and prognosis of human breast cancer has been dependent on several factors such as their hormone or estrogen - responsiveness, expression of estrogen receptor (er) and other genes . Hormone - independent (er negative) tumors were more aggressive and development of clinical protocols for treatment of these highly invasive breast tumors has been a major challenge in hormone therapy or chemotherapy protocols (1). Estrogen - responsive and hormone - independent human breast cancer cell lines and in vivo animal models have extensively used for studying the factors responsible for cell growth, differentiation and finally developing new strategies for inducing programmed cell death or studying about breast cancer pathogenesis and treatment (2). Breast cancer cell lines have classified in 5 sub type; laminal a, laminal b, basal, erb2 positive and normal breast like cells that these were different with each other by estrogen receptor (er), progesterone receptor (pr) erbb2, her2neu expression panel (3). Estrogen independent cell lines such as hs578 t, mda - mb-231, mda - mb 435 and mda - mb468 were aggressive and high metastatic (4) and isolated from high grade tumors (5), the cell cycle period in these cell lines was much shorter and aneuploidy disorders were common (6). Estrogen dependent cell lines such as mcf-7, bt474, t47-d, 600mpe and zr-75-i have isolated from invasive or primary ductal or adenocarcinoma tumoral samples (3). Differentiation capability, chemotherapy and endocrine therapy responsiveness and disease prognosis in animal models in er positive cell lines was better than er negative cell lines . Er / pr - positive breast cancer tumors were 60% likely to respond to endocrine therapy . Tamoxifen, fareston, arimidex, aromasin, femara, zoladex / lupron, megace and halotestin were some of endocrine therapy drugs (8). Mcf-7 (michigan cancer foundation-7) has isolated from luminal tissue of patient who has suffered adenocarcinoma which was er / pr positive and her2 negative . Mda - mb468 has isolated from basal tissue of patient who had high metastatic adenocarcinoma which was er / pr and her2 negative (9). Apoptosis induction was one of the major cell death mechanisms that have promoted the suicide of cells, resulting in an advantage, unlike necrosis in cellular immune response . Apoptosis was not the main pathway for the death of cancer cells in response to common treatment regimens (11), but pro apoptotic elements and anti - apoptotic factors had very important role in tumorigenesis (12). Malignant cells were heterogene and apoptosis activation pathway has suppressed in many types of tumoral cells therefore capability of cells to activation of this pathway was very important in tumor prognosis (13). In contrast to apoptosis and autophagy, necrosis has considered as an uncontrolled form of cell death . Morphologically, necrosis has characterized by vacuolization of the cytoplasm, loss of membrane integrity and cellular swelling (14). Tumor cell necrosis could provoke an inflammatory response, and stimulate an immune response towards potentially malignant cells (15). This chemotactic and inflammatory response s function just like tissue damage and bacterial infection that has led to neurotic inflammation that cause to release hypoxia, angiogenesis, cell proliferation and cell movement (invasiveness) signaling factors (16). Additionally multiple lines of evidence has indicated that immune inflammatory cells in necrosis path way could led to tumor promoting by production of egf, vegv, proteases and many types of factors that caused to angiogenesis and metastasis (17). Dna damage caused by uv (ultra violet) radiation has induced pro apoptotic and cell cycle arrest checkpoints expression (18). Low dose of uv - b has caused to dna damage and apoptosis (19), high dose of uv lead to necrosis (20). Cell death was strikingly polymorphic; it could proceed via necrosis (as in complement - mediated cell death) or apoptosis . Capability of apoptosis cascade activation was important in immune response recruitment (21, 22). In this paper we have evaluated serial dose of uv - b exposure on er positive and er negative breast cancer cell lines and its effect on apoptosis or necrosis induction in these cells . Cell culture and irradiation: human breast cancer cell lines, mcf-7 (c10082) and mda - mb468 (c10095) have purchased from iranian biological research center (ibrc) and have cultured 2d for 24 hours in dulbecco s modified eagle medium: ham s f12 (dmem: f12) (gibco #31331 - 028) with 10% heat inactivated fetal bovine serum (gibco #26140111) and 1% penicillin streptomycin (gibco #10378032) in 37c incubator with 5% co2 cell culture incubator . Uv exposure has carried out using uv laboratory lamp at 290 nm and dose of 154 j / m to 18 kj / m . Afterwards uv exposure, cells have incubated for 24 or 48 hours in 37c incubator with 5% co2 and 95% of humidity . Cell lines have detached by treating with 25% trypsin and 5% edta and then have washed with phosphate buffer saline (pbs) (sigma #p4417 - 50tab). Apoptosis analysis have carried out in fl2 and fl3 channels with cyflow flow cytometry (partec, germany) after fitc labeled annexin v and pi (ebioscience #88 - 8005 - 72) staining, 20 minutes in dark condition (figure 1). Cell lines have detached by treating with 25% trypsin and 5% edta and then have washed with phosphate buffer saline (pbs) (sigma #p4417 - 50tab). Apoptosis analysis have carried out in fl2 and fl3 channels with cyflow flow cytometry (partec, germany) after fitc labeled annexin v and pi (ebioscience #88 - 8005 - 72) staining, 20 minutes in dark condition (figure 1). Mcf-7 cells and mda - mb468 harvested after 24 or 48 hours of uv exposure and analyzed by flow cytometry after staining with pi and annexin v (figure 2). The percent of double positive population in both of cell lines after 24 hours incubation was more than 48 hours and the percent of double positive population for mcf-7 cell line after 24 hours was significantly higher than 48 hours in comparison with mda - mb468 cell line (figure 3). Pi positive cells in two cell lines after 48 hours incubation were more than 24 hours incubation . Frequency of pi positive mda - mb468 cells were significantly greater than mcf-7 pi positive cells in both of incubation times (figure 4). Apoptosis rate in mcf-7 cells have increased following uv exposure in a dose dependent manner and in mda - mb468 cells, the percentage of apoptotic cells have not significantly affected by different dose of uv (figure 5, the value for control experiments were subtracted from all tests). Frequency of pi positive mda - mb468 cells has significantly increased in accordance with uv exposure dose . Mcf-7 pi positive cells also increased by increasing of uv dose exposure however frequency of pi positive mda - mb468 cells was significantly more than pi positive mcf-7 cells (figure 6, the value for control experiments have subtracted from all tests). Frequency of the mda - mb468 necrotic cells in response to uv exposure after 24 hours were more than apoptotic mda - mb468 cells, and uv dose scaling up has not shown any effect on apoptosis rate of these cells . The frequency of apoptotic mcf-7 cells after uv exposure in both incubation times were more or equal to pi positive mcf-7 cells (figure 7). The rate of apoptosis in mcf-7 cells in both incubations times, especially in 24 hours, was greater than mda - mb468 cells in the same setting . However pi positive cells percentage in mda - mb468 cells was significantly higher than other mcf-7 . This might indicate that necrosis pathway in mda - mb48 cells and apoptosis pathway in mcf-7 cells were dominant . Mcf-7 cells and mda - mb468 harvested after 24 or 48 hours of uv exposure and analyzed by flow cytometry after staining with pi and annexin v (figure 2). The percent of double positive population in both of cell lines after 24 hours incubation was more than 48 hours and the percent of double positive population for mcf-7 cell line after 24 hours was significantly higher than 48 hours in comparison with mda - mb468 cell line (figure 3). Pi positive cells in two cell lines after 48 hours incubation were more than 24 hours incubation . Frequency of pi positive mda - mb468 cells were significantly greater than mcf-7 pi positive cells in both of incubation times (figure 4). Apoptosis rate in mcf-7 cells have increased following uv exposure in a dose dependent manner and in mda - mb468 cells, the percentage of apoptotic cells have not significantly affected by different dose of uv (figure 5, the value for control experiments were subtracted from all tests). Frequency of pi positive mda - mb468 cells has significantly increased in accordance with uv exposure dose . Mcf-7 pi positive cells also increased by increasing of uv dose exposure however frequency of pi positive mda - mb468 cells was significantly more than pi positive mcf-7 cells (figure 6, the value for control experiments have subtracted from all tests). Frequency of the mda - mb468 necrotic cells in response to uv exposure after 24 hours were more than apoptotic mda - mb468 cells, and uv dose scaling up has not shown any effect on apoptosis rate of these cells . The frequency of apoptotic mcf-7 cells after uv exposure in both incubation times were more or equal to pi positive mcf-7 cells (figure 7). The rate of apoptosis in mcf-7 cells in both incubations times, especially in 24 hours, was greater than mda - mb468 cells in the same setting . However pi positive cells percentage in mda - mb468 cells was significantly higher than other mcf-7 . This might indicate that necrosis pathway in mda - mb48 cells and apoptosis pathway in mcf-7 cells were dominant . Ultraviolet radiation - induced apoptosis has mediated by activation of cd95 (23) and fas pathway activation by uv is a feasible model for induction of apoptosis in malignant cells . On the other hand cytotoxic t lymphocytes and natural killer (nk) cells have killed target cells such as tumor cells by two main mechanisms, namely, the perforin / granzymes and the fas ligand (fas - l) apoptosis pathways (24). Uv irradiation - induced apoptosis of mammalian cells has associated with two key signaling cascades due to activation of cell surface receptors such as the fas and tnf receptors (25, 26). This has included the fas - fadd - caspase-8-axis and the jun n - terminal kinase (jnk) cascade . Both of these signaling events have required for the initiation of the apoptotic machinery (27). There was a good correlation between er expression and fasl pathway in human er positive cells such as monocytes (28), fasl expression has enhanced by estradiol in situ although fasl has expressed in both of er positive and er negative cells (29) however, apoptosis induction by trail pathway in er negative cells was more effective (30). Er expression and autocrine estrogen production or treatment by estradiol increase apoptosis rate in many types of er positive cancers (31). In a similar study on human lymphocytes, necrosis and apoptosis induction have assayed by flow cytometry after uv exposure and results have shown high dose of uv exposure cause necrosis and apoptosis signaling activation started after first hours of uv exposure (20). Our data has shown that cell cycle period of er negative cells was shorter than er positive cells and its sensitivity to uv exposure was different in comparison with er positive cell line, this might be in accordance with tumor cell behavior in vivo, considering the fact that the er negative cancers were often more aggressive and nonresponsive to chemotherapy (7) and these were more metastatic than er positive cells . If the necrosis pathway was predominant in these cells and apoptosis signals was low or lower than er positive cells this could explain the differences in immune pathogenesis of breast cancer in er positive and er negative cells . This difference could affect t helper responses, and natural immune system recruitment has shown different manner . The type of microenvironment might play an important role in fate of cancer and anti cancer cell immune response interaction as has shown in colorectal cancer that necrosis was predominant in poor differentiated colorectal carcinoma and tumors with high necrotic cells frequency has shown very poor prognosis (32). In conclusion we have compared two cell line responses to same dose of uv exposure in er positive and negative cell lines in this study . Apoptosis pathway activation in er positive cells was dominant in comparison with er negative cell line . The difference could be due to early activation of apoptosis pathway in er positive cells, in comparison with er negative cells which needs further investigation.
|
Prominence of the anterior inferior iliac spine (aiis) at the level of the acetabular rim has been recognized as a potential cause of hip impingement (aiis subspine impingement). Accordingly, arthroscopic resection of the bony projection has been reported and has become a commonly performed procedure . The aiis is also the origin of the direct head of rectus femoris (dhrf). Previous studies have reported that such is the area of the bony footprint that avulsion of the tendon is highly unlikely following resection of a portion of the aiis in the treatment of subpine impingement . Whereas proximal avulsions of the rectus femoris are commonly encountered in the paediatric and adolescent populations [46], they are rarely seen in the adult population . This case study documents the first report, to the best of the authors knowledge, of avulsion of the dhrf following the arthroscopic treatment of subspine impingement of the hip . The patient was informed that data concerning the case would be submitted for publication, and he consented . A 23-year - old professional australian football league player presented with sudden onset of severe left proximal anterior thigh pain as a result of an injury sustained 2 weeks following a revision left hip arthroscopy for resection of aiis / subspinal impingement . The mechanism of injury was hyperextension of the left hip as a result of a fall down six steps . The patient heard and felt a pop over the anterior aspect of his left hip . The indication for surgery was anterior hip pain exacerbated by hip flexion beyond 90 which had been refractory to conservative treatment, including intra - articular injection . The primary procedure had been performed 3 years previously at a different institution and consisted of a labral repair and femoral ostectomy no resection of the aiis had been performed at the index procedure . A pre - operative ct scan revealed the presence of a bony prominence at the level of the aiis (fig . 1) and clinical examination confirmed the presence of pain on flexion, adduction and internal rotation of the hip, suggestive of anterior impingement . Diagnostic arthroscopy of the hip revealed a well - healed labrum without evidence of a further tear, a partial tear of the ligament teres, and a bony prominence inferior to the aiis . Resection of the capsule inferior to the aiis was performed using a super multivac 50 arthrowand (arthrocare sports medicine, austin, tx) to expose the bony prominence, which was removed with a 5-mm burr (fig . The hip was flexed under arthroscopic vision to ensure that the impingement had been eliminated . Post - operatively, the patient was instructed to use crutches until he was comfortable walking, which were discontinued after 3 days . The yellow arrow demonstrates the bony prominence on the inferior aspect of the aiis . 2. (a) an arthroscopic image of the left hip demonstrating the bony prominence of the aiis / subspine impingement following removal of the soft tissue . (b) an arthroscopic image of the left hip following resection of the bony prominence . Three - dimensional reconstruction ct - image of the left hip . (a) an arthroscopic image of the left hip demonstrating the bony prominence of the aiis / subspine impingement following removal of the soft tissue . (b) an arthroscopic image of the left hip following resection of the bony prominence . An mri was performed to corroborate the suspected diagnosis of an avulsion of the dhrf . The mri revealed a complete tear of the dhrf proximal to the musculotendinous junction (fig . Notably, the muscle length was maintained, indicating that the indirect head was still attached to the rim of the acetabulum; the tendon was retracted by <2 cm . Repeat physical examination 10 days following the injury revealed a normal straight leg raise, albeit with slight tenderness and 4/5-power on hip flexion, compared with the opposite side . The patient stated that the stiffness in the hip had abated and he was no longer walking with a limp . 3.sagital t2 mri scan of the left hip; the red arrow demonstrates significant oedema at the level of the aiis; the yellow arrow shows the avulsed tendon of the dhrf with minimal retraction . Sagital t2 mri scan of the left hip; the red arrow demonstrates significant oedema at the level of the aiis; the yellow arrow shows the avulsed tendon of the dhrf with minimal retraction . Given the improvement in symptoms over a short period of time, a conservative course of treatment was adopted . Strengthening exercises were avoided for 4 weeks, with the patient concentrating on range of motion, flexibility and avoiding excessive hip extension . At 6 weeks following the injury (8 weeks post - surgery), the patient commenced strength training and running . He returned to full activity and team training at 12 weeks and at the time writing (5 months post - operatively) he remains injury - free . The indication for surgery was anterior hip pain exacerbated by hip flexion beyond 90 which had been refractory to conservative treatment, including intra - articular injection . The primary procedure had been performed 3 years previously at a different institution and consisted of a labral repair and femoral ostectomy no resection of the aiis had been performed at the index procedure . A pre - operative ct scan revealed the presence of a bony prominence at the level of the aiis (fig . 1) and clinical examination confirmed the presence of pain on flexion, adduction and internal rotation of the hip, suggestive of anterior impingement . Diagnostic arthroscopy of the hip revealed a well - healed labrum without evidence of a further tear, a partial tear of the ligament teres, and a bony prominence inferior to the aiis . Resection of the capsule inferior to the aiis was performed using a super multivac 50 arthrowand (arthrocare sports medicine, austin, tx) to expose the bony prominence, which was removed with a 5-mm burr (fig . The hip was flexed under arthroscopic vision to ensure that the impingement had been eliminated . Post - operatively, the patient was instructed to use crutches until he was comfortable walking, which were discontinued after 3 days . The yellow arrow demonstrates the bony prominence on the inferior aspect of the aiis . 2. (a) an arthroscopic image of the left hip demonstrating the bony prominence of the aiis / subspine impingement following removal of the soft tissue . (b) an arthroscopic image of the left hip following resection of the bony prominence . (a) an arthroscopic image of the left hip demonstrating the bony prominence of the aiis / subspine impingement following removal of the soft tissue . (b) an arthroscopic image of the left hip following resection of the bony prominence . An mri was performed to corroborate the suspected diagnosis of an avulsion of the dhrf . The mri revealed a complete tear of the dhrf proximal to the musculotendinous junction (fig . Notably, the muscle length was maintained, indicating that the indirect head was still attached to the rim of the acetabulum; the tendon was retracted by <2 cm . Repeat physical examination 10 days following the injury revealed a normal straight leg raise, albeit with slight tenderness and 4/5-power on hip flexion, compared with the opposite side . The patient stated that the stiffness in the hip had abated and he was no longer walking with a limp . 3.sagital t2 mri scan of the left hip; the red arrow demonstrates significant oedema at the level of the aiis; the yellow arrow shows the avulsed tendon of the dhrf with minimal retraction . Sagital t2 mri scan of the left hip; the red arrow demonstrates significant oedema at the level of the aiis; the yellow arrow shows the avulsed tendon of the dhrf with minimal retraction . Given the improvement in symptoms over a short period of time, a conservative course of treatment was adopted . Strengthening exercises were avoided for 4 weeks, with the patient concentrating on range of motion, flexibility and avoiding excessive hip extension . At 6 weeks following the injury (8 weeks post - surgery), the patient commenced strength training and running . He returned to full activity and team training at 12 weeks and at the time writing (5 months post - operatively) he remains injury - free . Aiis / subspine hip impingement has received increased acknowledgement as a common type of symptomatic extra - articular impingement [8, 9]. A number of studies have described excellent results following arthroscopic aiis / subspine decompression [2, 913]. In fact, a failure to recognize or treat this condition has been implicated in recalcitrant postoperative pain following hip arthroscopy and has been associated with the requirement for revision surgery . Whereas the potential for injury to the dhrf during resection of the bony prominence on the aiis has been highlighted, this is the first report, to the authors knowledge, to describe avulsion of the tendon post - operatively . Injuries to the rectus femoris are rare in the adult population and most commonly occur in athletes . Typically, they occur in kicking athletes during a forceful contraction of the quadriceps from the hip - extended / knee - flexed position to the hip - flexed / knee - extended position . An abrupt arrest of the kicking motion can result in rectus femoris avulsion in kicking players; e.g. When a kick is blocked by an opponent s foot on the ball or direct contact with a body . This injury has also been reported in non - kicking athletes, where a sudden deceleration during sprinting has been proposed as a mechanism for injury [7, 15, 16]. A further mechanism of injury, as seen in this case, is hyperextension of the hip with a flexed knee . In this report, the patient slipped down some steps and in an attempt to right himself he lunged forward with his uninjured leg and hyperextended the affected hip . An understanding of the variable morphology and anatomy of the aiis is crucial when performing arthroscopic aiis / subspine decompression . The rectus femoris tendon has two heads proximally, which take origin from the ilium: the direct and reflected heads . The direct head arises from the superior facet of the aiis just above the origin of the iliofemoral ligament and iliocapsularis on the inferior facet . The reflected head is attached more laterally superficial to the capsule on the periphery of the acetabulum . The quantitative anatomy of the bony footprint has been defined in a number of studies [3, 8, 17]. Also, three morphological variants of the aiis have been described based on the relationship of the aiis with the acetabular rim ., in their cadaveric study, demonstrated that the direct distance to the nearest point of the inner rim of the acetabulum from the inferolateral corner of the direct head of the rectus femoris footprint was 19.2 mm (95% ci 18.020.4 mm). Interestingly, they also reported that the iliofemoral ligament has the widest capsular footprint and is located inferior to the aiis . In addition, the iliocapsular muscle has a bony and capsular origin immediately inferior to the rectus femoris tendon; the inferolateral aspect of the footprint being located just 12.5 mm (95% ci 10.115.0 mm) from the inner rim . It should therefore be considered that to achieve access to resect bony prominence of the aiis and requires release of a portion of the iliofemoral ligament as well as the overlying iliocapsularis . The actual dimensions of the dhrf tendon were reported by hapa et al . And were recorded as having a mean proximal - distal and medial - lateral distance of 2.2 0.1 cm (range 2.12.4 cm) and 1.6 0.3 cm (range 1.22.3 cm), respectively . In their study, they contended that the broad origin on the aiis was protective against direct head detachment with subspine decompression . Although the bony prominence that necessitated resection was minimal and located inferior to the footprint of the dhrf tendon, the soft tissue debrided required to access was enough to weaken the tendinous insertion . It is equally important to consider that while the inflamed tendon was subjected to a supra - physiological load, it is unlikely that the same force would have caused a similar result in the absence of recent surgery with a well - tethered tendon . Larson et al . In their report of arthroscopic revision hip surgery showed that aside from residual cam - type femoral deformity, a high percentage of cases also demonstrated aiis / subspine impingement . They concluded that, at a mean follow - up of 26 months, of all independent variables in the revision surgical population, treatment of subspine / aiis impingement was one of the factors that were predictive of greater improvement in mhhs values from pre - operative baseline . It stands to reason, therefore, that one needs to take particular caution in the revision setting given the potential for altered anatomy and the presence of scar tissue, particularly between the capsule and the labrum and at the level of aiis where the previous capsulotomies are often located ., in a series of 10 injuries to the musculotendinous junction of the rectus, reported that only two patients underwent surgical debridement and repair . Operative and non - operative treatments have been described in the high - level adult athlete [7, 15, 16]. . Reported on a series of 11 professional american football players who were treated conservatively and returned to the same level of sporting participation . Documented the return to play of two professional american football kickers with 1 and 3.5 cm of retraction of the dhrf, who were treated conservatively and returned to kicking during at 6 weeks . Operative treatment was reported by irmola et al . In five cases of rectus femoris avulsion found in four professional soccer players and one hurdler surgical repair was carried out between 18 and 102 (mean 53) days post - injury . The tendon was reattached with two to four suture anchors and the patients were protected with hip bracing at 45 of flexion for 1 week . Although running was initiated at 8 weeks, the players took an average of 9 months to return to sport . In addition, two of the five patients had lateral femoral cutaneous nerve palsy post - operatively . In the current case, conservative treatment was chosen due to the lack of significant retraction, the preservation of power and the proximity to his recent surgery . Whereas this post - operative injury caused something of a setback initially and gave rise to increased post - operative pain, it did not delay the return to sport in this patient, which occurred at 3 months . This case highlights a case of avulsion of the dhrf due to a hyperextension injury of the hip following arthroscopic resection of subspinal impingement, a previously unreported complication . Although a rare occurrence, this diagnosis should be considered in the event of post - surgical injury . Resection of soft and bone from the aiis may weaken the insertion of the dhrf . In particular, care should be taken during post - operative rehabilitation to avoid trauma and excessive forces on the dhrf tendon, which may lead to rupture.
|
Pyoderma gangrenosum (pg) is a rare inflammatory disease of the skin often associated with systemic inflammatory disease or immunodeficiency . Although rare, it is known to occur following trauma or operative procedures . To date nine cases we report a delayed presentation of pg in a patient undergoing mitral valve replacement who was discharged home on postoperative day seven with a normal healing incision and presented two days later with a necrotic - appearing lesion which was later diagnosed as pg . His prior medical history included repair of a cleft palate and a heart murmur . On admission, echocardiogram revealed severe mitral regurgitation with a flail and ruptured posterior mitral leaflet, a patent foramen ovale, pulmonary hypertension, and a markedly dilated left atrium without any vegetations . Mitral valve repair and closure of patent foramen ovale were undertaken via a median sternotomy utilizing a short skin incision . His recovery was uneventful, and he was discharged home on postoperative day seven with a normal healing incision . Physical examination revealed a stable but alarmingly swollen sternal wound with necrotic margins along the entire length (fig . The patient was afebrile and hemodynamically stable but was admitted with a presumed wound infection and was started on intravenous vancomycin and cefepime . Laboratory work demonstrated a normal white blood cell count of 8.7, elevated c - reactive protein of 8.8 mg / dl (normal: 0.01.0), and an elevated erythrocyte sedimentation rate of 44 mm / h (normal: 013). The following day, his two chest tube sites demonstrated similar lesions . The wounds failed to improve, and after three days of antibiotics, the sternal wound was opened at the bedside and negative pressure wound therapy was initiated . Similar lesions blossomed at the sites of previous internal jugular line and subcutaneous heparin injection . On hospital day five, the patient was taken to the operating room for debridement . Interestingly, the wound demonstrated minimal purulence, a healing sternum, and persistent superficial necrosis . All sternal wound cultures remained negative; however, the chest tube wound grew methicillin - resistant staphylococcus aureus . Due to the lack of response to debridement and antibiotics, an 8-mm punch biopsy demonstrated granulation tissue with detached acute inflammatory exudate and marked reactive change (fig . A diagnosis of pyoderma gangrenosum was made, and the patient was started on oral prednisone 80 mg daily . Prednisone was slowly tapered starting ten days after initiation, and the patient was discharged home on a tapering dose of oral steroids . The diagnosis of pg in a postoperative setting is difficult as the wound may mimic an infection . In fact, a recent case report shows a death resulting from pg when the disease involved the saphenous vein graft . To date, all ten case reports of pg after cardiac surgery have occurred in the initial week postoperatively (table 1). What makes our case unique is the delayed presentation (postoperative day nine), just 2 days after he was discharged with a seemingly normal healing wound . The clinical challenge in pg involves (1) making a prompt diagnosis and (2) choosing the appropriate treatment . Pg in the postoperative period should be considered when the characteristic ulcerative lesions are seen diffusely in all surgical wounds and show minimal improvement with antibiotic treatment or debridement . This was the case in our patient, who presented with necrotic lesions not only all along on his sternotomy wound, but also involving his chest tube sites and his central venous catheter site . These did not show any improvement after a course of antibiotics nor after debridement in the operating room . Once suspected, prompt dermatology consultation and skin biopsy aids in confirming the diagnosis . The second challenge is selecting the appropriate treatment as there is no established standard . In previous reports of pg after cardiac surgery, treatments with prednisone, cyclosporine a, or a combination of both have been successful . Our patient was treated with a course of oral prednisone alone and showed rapid and marked improvement . Although the pathology of pg is not infectious, the lesions compromise the skin barrier significantly, and pg is known to be associated with an underlying immuno - deficient state . In our patient, antibiotics were administered for a presumed wound infection . In fact, one of the wounds from our patient grew methicillin - resistant staphylococcus aureus . While there is no evidence to initiate antibiotics, we do recommend coverage for super - infection in conclusion, pg is a rare complication after cardiac surgery, yet an important entity to recognize as prompt diagnosis is necessary to initiate appropriate treatment . While all other reported cases have occurred within the first week of postoperative period, our case demonstrates that pg can present in a delayed fashion . Pg should be suspected when ulcerative lesions appear acutely and diffusely in all surgical wounds and respond minimally to debridement and antibiotic treatment . Dh was involved in study design and writing.key learning pointspyoderma gangrenosum can occur following cardiac surgery and can mimic wound infection.making the clinical distinction between pyoderma gangrenosum and wound infection is very important as the treatment is different . Pyoderma gangrenosum can occur following cardiac surgery and can mimic wound infection.making the clinical distinction between pyoderma gangrenosum and wound infection is very important as the treatment is different . Pyoderma gangrenosum can occur following cardiac surgery and can mimic wound infection . Making the clinical distinction between pyoderma gangrenosum and wound
|
An elevated arterial pressure is an important public health problem in developed countries, as well as in india . Hypertension is the most common modifiable risk factor for coronary artery disease, stroke, congestive heart failure, end - stage renal disease, and peripheral vascular disease . Metabolic syndrome (ms) is the fertile soil, and is strongly predictive of developing diabetes mellitus and cardiovascular diseases and subsequent mortality in future . No studies on estimation of ms in hypertensive patients from native population living either at moderate altitude or in plains of india have been done so far to the best of our knowledge . Higher altitude is an environment which provides natural experimental setting to study the series of adaptive changes like lower blood glucose, better utilization of glucose in peripheral tissue, higher insulin sensitivity, and greater caloric expense due to chronic hypobaric hypoxia . To assess the prevalence of ms among newly diagnosed hypertensive patients, the present study was designed and was conducted in a tertiary care hospital in the northern hilly state of himachal pradesh, india, located in western himalayas at a moderate altitude of 2200 m above mean sea level a total of 118 patients of hypertension, above the age of 20 years, were included in the study . Patients with secondary hypertension, secondary cause of obesity, pregnant women, with any acute illness, on steroidal medications or any other medications likely to cause elevated plasma glucose and patients not willing to participate in the study were excluded from the study . Participants were subjected to detailed history, clinical examination, standard anthropometry measurements, and biochemical investigations on the day of presentation . Well - established definitions and criteria of ms, i.e., international diabetes federation (idf) definition and national cholesterol education program - adult treatment panel iii (ncep - atp iii) criteria modified for asian subjects, were used for estimating the prevalence . Student's t - test was used to compare the mean of the continuous variables . The prevalence of ms was 68.6% (modified ncep - atp iii criteria) and 63.6% (idf criteria). The prevalence of ms in men, women, and both combined is shown in table 1 . The most common phenotype of ms with the component of hypertension was the coexistence of waist circumference (90.1%), low high - density lipoprotein (hdl; 70.4%), and high triglycerides (67.9%) as per the modified ncep - atp iii criteria . As per idf, the most common phenotype of ms with the component of hypertension in coexistence with obligatory waist circumference was low hdl (76.2%) and high triglycerides (66.4%). Fasting blood glucose (33.2% with modified ncep - atp iii and 32.6% with idf criteria) was the least significant factor having an association with ms [figure 1]. Idf values were not significantly different from those of modified ncep - atp iii criteria . The results of demographic profile and risk factors of hypertensive patients with or without ms are shown in table 2 . Prevalence of metabolic syndrome by modified ncep - atp iii and idf criteria frequency distribution of components of metabolic syndrome baseline characteristics of hypertensive patients with and without metabolic syndrome the findings of our study indicate that 68.6% and 63.6% of hypertensive patients had ms according to the modified ncep - atp iii criteria and idf criteria, respectively . The prevalence rates for the two sets of criteria (modified ncep - atp iii and idf) used in our study were 58.1% and 50% in males and 86.3% by both criteria in females, respectively . The prevalence of ms in hypertensive patients was high and is consistent with previous reports from other parts of the world . The increased prevalence found in our study may be the true reflection of the impact of changes in lifestyle, improvement in socioeconomic status, and urbanization of community living at this altitude . In addition, the idf and modified ncep - atp iii definition, the mean age of the study sample, and the fact that the data were obtained from an analysis of hypertensive patients in a reference hospital are also contributory . The prevalence is overwhelmingly predominant in women probably due to their lifestyle including sedentary habits and staying at home . Higher prevalence in women at high altitude has been reported in the past with similar explanation . Older age was an independent risk factor associated with ms and is consistent with other studies . In the present study, 72% of the patients had central obesity and 73.7% were overweight / obese . Impact of altitude on the prevalence of central obesity has been studied by one of the authors (pcn) and others also, and they have shown contradictory results in the past . Higher body mass index (bmi) as a strong predictor of hypertension has been reported in various studies from india and abroad . Reduced hdl was the commonest lipid abnormality recorded among the hypertensive patients (56.8%), followed by increased triglycerides (50%), increased total cholesterol (36.4%), and increased low - density lipoprotein (ldl; 20.3%). These results are consistent with previous observations from india and other parts of the world . Lipid profile estimation in the natives at high altitude revealed that the total cholesterol decreased with increasing altitude, whereas hdl increased . Another study revealed a high prevalence of hypercholesterolemia (34.3%), hypertriglyceridemia (53.9%), and low hdl (45.3%) in high - altitude natives . In our study patients, the parameter that was found to be rather weak in hypertensive patients was that 23.7% had impaired fasting glucose, which is consistent with previous reports . Mean systolic blood pressure and diastolic blood pressure of patients with ms were significantly higher than those without ms in our study . Mean blood pressure in patients with ms has been documented to be higher; however, it was not always the case . Poor control of blood pressure has been established in hypertensive patients with the components of ms present . To summarize, the high prevalence of ms among hypertensive patients establishes the epidemiological transition experienced in this region of moderate altitude, and ms has emerged as a significant health concern and indicates the need for metabolic screening in all hypertensive patients at the first diagnosis.
|
Los intentos a la hora de ayudar a dejar de fumar rara vez resultan mejores que simplemente efectivos parcialmente . Describir un estudio observacional de un programa ya existente y de gran xito para dejar de fumar, ofrecido por un consejero de salud como intervencin primaria . Los componentes bsicos del diseo del programa y la informacin se presentan y pueden servir como modelo en otros centros de salud pblicos . Se presentan tres componentes complementarios del programa y un consejero de salud (auriculoterapia, estimulacin elctrica de ondas alfa y tcnicas de relajacin). Las tasas de abandono a los 6 meses de 161 pacientes a lo largo de 3 aos se presentan por cada 30 das de abstinencia y en valores de intencin de tratamiento . Se proporcionan comparaciones de las consultas telefnicas frente a consultas mdicas en la clnica, de libre eleccin frente a la participacin obligatoria y se facilitan los costes del programa . La prevalencia puntual de la tasa de abandono fue de un 88,7% mientras que la tasa de abandono ms conservadora del grupo con intencin de tratamiento fue de un 51,6% . La asistencia sanitaria telefnica y la asistencia en la clnica no fueron significativamente diferentes en ningn momento . Las tasas de abstinencia total al tabaco a los 6 y 12 meses fueron de 76,9% y 63,2%, respectivamente . Se observa una prevalencia puntual (30 das) por encima de un 80% y un efecto duradero en el tiempo . Las cargas personales y sociales (de salud y econmicas) implcitas en el tabaco podran verse considerablemente afectadas si dichos programas se pusiesen en prctica a mayor escala . Between 2009 and 2011, 161 patients (87 male and 74 females, mean [sd] age: 44.4 11.8 y) entered the mtcp . Patients were included in a treatment cohort if they had smoked at least five cigarettes (or chewed tobacco 30 min) daily for at least 6 months . These patients, largely employees of (n=82) or dependents of employees (n=41) of the mercy hospital system, were supported by an outside employer (n = 26) or came through word - of - mouth referral (n = 9). Some mtcp patients participated because of an offer by their employer to achieve a $600 insurance premium reduction . Participants reported average smoking of 18.9 (11.5) cigarettes / day at the outset of treatment and had smoked for an average of 23.8 years (12.9). Most (88.1%) had tried to quit smoking previously, averaging 2.9 (2.8) quit attempts . On enrolling, each patient initially received a quit plan to consider and a questionnaire asking about tobacco use and motivation for behavior change . Data are presented anonymously and were collected as part of routine clinical practice . For these reasons, informed consent was not collected and the mercy springfield hospital institutional review board did not believe retrospective project review was necessary before dissemination . The project design was a single - site, prospective, non - randomized, observational study of an existing practice (ie, mtcp) with multiple follow - ups examining the effects of an hc tobacco cessation intervention . There was no control group, but the ineffectiveness of non - coaching tobacco cessation efforts are well known and described later . It made little sense to turn away patients who wanted to quit smoking for the establishment of a control group . The flow of patient enrollment and progress through the mtcp is illustrated in figure 1 . In addition to hc, in - clinic patients received alpha - electrical stimulation (aes), relaxation techniques, and auriculotherapy . Of 161 patients, 93 (57.8%) utilized in - clinic services while 68 used only telephonic hc . Hc involved establishing an individualized quit plan while acknowledging the participant as the final decision maker in when to quit . After an in - clinic session, each patient continued with in - clinic visits or chose remote treatment using only telephonic health coaching . Initial visit . This first session was with an experienced tobacco cessation rn educator and planned to last 45 minutes . Patients returned a completed questionnaire on smoking habits, worked on a co - created quit plan, and determined if they would use complementary therapies . Hc was delivered by two registered nurses with wellcoaches training (wellcoaches corp, wellesley, massachusetts). This approach emphasizes relationship development, is patient - centered, and encourages a self - discovery process while using mindfulness and motivational interviewing techniques . The initial hc visit was followed by subsequent visits planned to last 20 to 25 minutes . Hc could be delivered telephonically or patients could elect for in - clinic, face - to - face appointments . Telephonic hc patients were given information about and often participated in relaxation techniques (see below). The amount of hc was patient determined; however, 6 to 8 sessions over 3 months were recommended . In following a true health coaching paradigm, patients were supported when considering any additional or complementary therapies and were permitted to use them as desired . All patients had the option of using aes, relaxation techniques, and auriculotherapy as complementary treatment to hc (unless travel distance precluded it). Before hc, in - clinic patients typically completed 20 minutes of relaxation techniques while receiving aes prior to engaging in a 15-minute session of auriculotherapy . Aes enhances alpha - wave activity with the intention of inducing a calmer and more relaxed state . Aes is delivered in 10 s waves of 0.5 hz in a pattern range of 100 to 300 micro - amps via earlobe - located electrodes . Alpha - stim scs (electromedical products international, mineral wells, texas) is a class iia, type b medical device with federal law restricting its use . A physician's orders were required for including aes in a patient's quit plan . Relaxation techniques involving deep breathing and progressive muscle relaxation [pmr] were initially taught to patients by staff . Several minutes of deep breathing were followed by several minutes of pmr using standard jacobsen techniques . By the third visit, most patients practiced self - guided relaxation techniques for 20 minutes . Auriculotherapy is a micro - current stimulation to reflex and acupuncture points on the ear delivered using the electro medical stim flex (electro medical inc, tulsa, oklahoma). Site selection followed the national acupuncture detoxification association (nada) 5-point protocol, and these sites are related to treatment for addiction, relaxation, and anxiety . Auriculotherapy was administered in 15 to 30minute sessions, and as an acupuncture - like process, is reported to assist with diminishing nicotine addiction . Medications (particularly those acting at the nicotinic receptor) were a prevalent health coaching topic, but such treatment was a personal choice reached in consultation with a primary care physician . A large minority of mtcp patients (43.7%) used some form of nicotinic receptor therapy (bupropion hcl [wellbutrin, 3%]; varenicline [chantix, 17%]; and nicotine replacement therapy [nrt, 24%]) during the program . Additional treatments, as well as monetary incentive to participate provided by an employer, are potential confounders of the hc effect . Confounding variables such as nrt, employer mandate, and the prevalent use of complementary therapies are addressed statistically in the results section . The goal of the mtcp was to follow a true coaching model, employing maximum therapeutic flexibility to empower cessation of tobacco use . Participants were defined as those completing at least one hc session and grouped as free choice or mandated (employer required five visits for insurance premium reduction). Patients indicated importance of change of tobacco use on a simple 10-point likert scale along with readiness to change . Readiness to change is based on the transtheoretical model, which allowed classification of patients into one of five stages (ie, precontemplation, contemplation, preparation, action, maintenance). Smoking quit rates were calculated as the number of patients who reported smoking cigarettes at baseline but not at follow - up . Self - reported cessation (7 mo, 30-d point prevalence) is currently the standard used by the north american quitline provided a 50% response rate can be achieved . Smoke - free rates examined follow - up on those who initially quit and were determined at 1, 3, 6, 12, 18, and 24 months after quit date . Intent - to - treat was calculated as all patients who quit smoking at 6 months divided by all participants who reported smoking at baseline . Patients lost to follow - up were presumed to have relapsed for the conservative intent - to - treat calculation . For 30-day point prevalence calculation, patients reporting that they were smoke - free for 30 days at 7 months determined the numerator while all patients reporting smoking at baseline was the denominator, excluding those not completing at least four hc sessions, those whose participation was mandated, or those who were lost to follow - up . Statistical analysis . Program impact on tobacco use (quit and smoke - free rates) was compared between coaching groups using chi - square . The influence of coaching on quit rates and smoke - free rates was examined in conjunction with motivational variables and covariates (smoking history and nrt use). Due to the number of logistic analyses conducted (one for each time point), the criterion for statistical significance was set at p<.007 based on a bonforroni correction (.05/7). Two additional tests were conducted to examine reduction in tobacco use: a t - test was used to examine pre - to - post program changes in tobacco use, and a regression examined predictors (coaching, motivational variables, history of smoking behavior, and nrt) on reduced tobacco use . Data analyses were conducted in spss v21 (ibm corp, armonk, new york). Between 2009 and 2011, 161 patients (87 male and 74 females, mean [sd] age: 44.4 11.8 y) entered the mtcp . Patients were included in a treatment cohort if they had smoked at least five cigarettes (or chewed tobacco 30 min) daily for at least 6 months . These patients, largely employees of (n=82) or dependents of employees (n=41) of the mercy hospital system, were supported by an outside employer (n = 26) or came through word - of - mouth referral (n = 9). Some mtcp patients participated because of an offer by their employer to achieve a $600 insurance premium reduction . Participants reported average smoking of 18.9 (11.5) cigarettes / day at the outset of treatment and had smoked for an average of 23.8 years (12.9). Most (88.1%) had tried to quit smoking previously, averaging 2.9 (2.8) quit attempts . On enrolling, each patient initially received a quit plan to consider and a questionnaire asking about tobacco use and motivation for behavior change . Data are presented anonymously and were collected as part of routine clinical practice . For these reasons, informed consent was not collected and the mercy springfield hospital institutional review board did not believe retrospective project review was necessary before dissemination . The project design was a single - site, prospective, non - randomized, observational study of an existing practice (ie, mtcp) with multiple follow - ups examining the effects of an hc tobacco cessation intervention . There was no control group, but the ineffectiveness of non - coaching tobacco cessation efforts are well known and described later . It made little sense to turn away patients who wanted to quit smoking for the establishment of a control group . The flow of patient enrollment and progress through the mtcp is illustrated in figure 1 . In addition to hc, in - clinic patients received alpha - electrical stimulation (aes), relaxation techniques, and auriculotherapy . Of 161 patients, 93 (57.8%) utilized in - clinic services while 68 used only telephonic hc . Hc involved establishing an individualized quit plan while acknowledging the participant as the final decision maker in when to quit . After an in - clinic session, each patient continued with in - clinic visits or chose remote treatment using only telephonic health coaching . This first session was with an experienced tobacco cessation rn educator and planned to last 45 minutes . Patients returned a completed questionnaire on smoking habits, worked on a co - created quit plan, and determined if they would use complementary therapies . Hc was delivered by two registered nurses with wellcoaches training (wellcoaches corp, wellesley, massachusetts). This approach emphasizes relationship development, is patient - centered, and encourages a self - discovery process while using mindfulness and motivational interviewing techniques . The initial hc visit was followed by subsequent visits planned to last 20 to 25 minutes . Hc could be delivered telephonically or patients could elect for in - clinic, face - to - face appointments . Telephonic hc patients were given information about and often participated in relaxation techniques (see below). The amount of hc was patient determined; however, 6 to 8 sessions over 3 months were recommended . In following a true health coaching paradigm, patients were supported when considering any additional or complementary therapies and were permitted to use them as desired . All patients had the option of using aes, relaxation techniques, and auriculotherapy as complementary treatment to hc (unless travel distance precluded it). Before hc, in - clinic patients typically completed 20 minutes of relaxation techniques while receiving aes prior to engaging in a 15-minute session of auriculotherapy . Aes enhances alpha - wave activity with the intention of inducing a calmer and more relaxed state . Aes is delivered in 10 s waves of 0.5 hz in a pattern range of 100 to 300 micro - amps via earlobe - located electrodes . Alpha - stim scs (electromedical products international, mineral wells, texas) is a class iia, type b medical device with federal law restricting its use . A physician's orders were required for including aes in a patient's quit plan . Relaxation techniques involving deep breathing and progressive muscle relaxation [pmr] were initially taught to patients by staff . Several minutes of deep breathing were followed by several minutes of pmr using standard jacobsen techniques . By the third visit, most patients practiced self - guided relaxation techniques for 20 minutes . Auriculotherapy is a micro - current stimulation to reflex and acupuncture points on the ear delivered using the electro medical stim flex (electro medical inc, tulsa, oklahoma). Site selection followed the national acupuncture detoxification association (nada) 5-point protocol, and these sites are related to treatment for addiction, relaxation, and anxiety . Auriculotherapy was administered in 15 to 30minute sessions, and as an acupuncture - like process, is reported to assist with diminishing nicotine addiction . Medications (particularly those acting at the nicotinic receptor) were a prevalent health coaching topic, but such treatment was a personal choice reached in consultation with a primary care physician . A large minority of mtcp patients (43.7%) used some form of nicotinic receptor therapy (bupropion hcl [wellbutrin, 3%]; varenicline [chantix, 17%]; and nicotine replacement therapy [nrt, 24%]) during the program . Additional treatments, as well as monetary incentive to participate provided by an employer, are potential confounders of the hc effect . Confounding variables such as nrt, employer mandate, and the prevalent use of complementary therapies are addressed statistically in the results section . The goal of the mtcp was to follow a true coaching model, employing maximum therapeutic flexibility to empower cessation of tobacco use . Participation and motivational variables . Participants were defined as those completing at least one hc session and grouped as free choice or mandated (employer required five visits for insurance premium reduction). Patients indicated importance of change of tobacco use on a simple 10-point likert scale along with readiness to change . Readiness to change is based on the transtheoretical model, which allowed classification of patients into one of five stages (ie, precontemplation, contemplation, preparation, action, maintenance). Smoking quit rates were calculated as the number of patients who reported smoking cigarettes at baseline but not at follow - up . Self - reported cessation (7 mo, 30-d point prevalence) is currently the standard used by the north american quitline provided a 50% response rate can be achieved . Smoke - free rates examined follow - up on those who initially quit and were determined at 1, 3, 6, 12, 18, and 24 months after quit date . Intent - to - treat was calculated as all patients who quit smoking at 6 months divided by all participants who reported smoking at baseline . Patients lost to follow - up were presumed to have relapsed for the conservative intent - to - treat calculation . For 30-day point prevalence calculation, patients reporting that they were smoke - free for 30 days at 7 months determined the numerator while all patients reporting smoking at baseline was the denominator, excluding those not completing at least four hc sessions, those whose participation was mandated, or those who were lost to follow - up . Statistical analysis . Program impact on tobacco use (quit and smoke - free rates) was compared between coaching groups using chi - square . The influence of coaching on quit rates and smoke - free rates was examined in conjunction with motivational variables and covariates (smoking history and nrt use). Due to the number of logistic analyses conducted (one for each time point), the criterion for statistical significance was set at p<.007 based on a bonforroni correction (.05/7). Two additional tests were conducted to examine reduction in tobacco use: a t - test was used to examine pre - to - post program changes in tobacco use, and a regression examined predictors (coaching, motivational variables, history of smoking behavior, and nrt) on reduced tobacco use . Data analyses were conducted in spss v21 (ibm corp, armonk, new york). For the 161 participants in this study, an average of 6.20 (2.71, range=2 - 15) hc sessions were recorded . The initial consult was 42.1 min (9.80) with 35.8 min (13.37) per subsequent session . A total of 119 patients (73.9%) demonstrated program adherence of four or more coaching sessions . Patients were motivated to change tobacco habits (7.862.17) and most (88.8%) were at least contemplating change (precontemplation 11.2%; contemplation 26.7%; planning 28%; action 34.1%). There were 65 participants (40.4%) whose participation was considered employer - mandated (ie, motivated to take part by an insurance premium reduction). Intent - to - treat quit rate at 6 months was 51.6% (83 of 161). Thirty - day point prevalence quit rate at 7 months was 88.7% (47 of 53). Overall smoke - free rates at 1, 3, 6, 12, 18, and 24 months were 95.3% (102 of 107), 89.9% (98 of 109), 76.9% (83 of 108), 63.2% (67 of 106), 51.8% (44 of 85), and 40.5% (30 of 74), respectively . Figure 2 shows no difference in smoke - free rates between patients receiving in - clinic care (hc plus complementary therapies) vs telephonic hc . Treatment / coaching style . In - clinic patients received health coaching face - to - face in combination with complementary therapies while telephonic patients remotely received health coaching and no complementary therapies . Note that the zero (0) time point reflects the average smoke - free rate for the subgroups . Values below the x - axis reflect the number of patients responding at each time point . The predictors, coaching subgroup (in - clinic / telephonic), motivational factors (premium reduction mandated participation, importance, and stage of change) and covariates, smoking history (average amount smoked per day and years of use), and nrt, reliably distinguished between quitters and non - quitters as seen in the table . These variables explained a significant, small - moderate effect in smoking cessation ((8)=48.81, p<.001; nagelkerke's r=.39; 79% prediction success). Insurance mandate and stage of change significantly contributed to prediction . Specifically, when patients participated freely (ie, without a premium reduction mandate), they were 6.26 times more likely to quit smoking (p<.001). A unit increase in stage of change (eg, from precontemplation to contemplation) saw patients 3.18 times more likely to quit smoking (p<.001). The table also details the predictive ability of this model for smoke - free rates at 1, 3, 6, 12, 18, and 24 months . It appears that the farther removed participants are from coaching, the more their initial rates of smoking influence remaining smoke free, with those who smoked the most at baseline having the most difficulty remaining smoke - free . Logistic regression predictors of smoking cessation and smoke - free rates abbreviation: nrt, nicotine receptor therapy . Participants significantly reduced tobacco use rates to an average of 3.52 (7.45) cigarettes per day (t(134) = 17.94, p<.001). Tobacco reduction was predicted by one's history of smoking (quantity smoked per day b[se] = 0.27 (0.05), p<.001; years smoked b[se] = .09[0.04], p=.04; number of previous quit attempts b[se] = 0.01[.18], p=.97; nrt (b[se] = 0.33[1.00], p=.74; motivational variables (importance b[se] = 0.38[0.25], p=.13; stage of change b[se] = 2.26(0.55), p<.001; insurance mandate b[se] = 1.64[.97], p=.10; and their coaching group (in clinic / telephonic [se]=2.73[1.04], p<.01), f(8,155) = 11.82, p<.001; r = .39). Every additional cigarette smoked at baseline related to .42 more cigarettes smoked at follow - up; every additional year patients had smoked led to an additional .15 cigarettes smoked; with every increase in stage of change, .31 fewer cigarettes were smoked; and patients in the telephonic coaching group smoked .18 cigarettes fewer than those receiving in - clinic coaching . Quitting successful quit rates are at a meager 4.4% when examining programs over a 20-year period (1991 - 2010). This poor rate of success exists despite well - funded and widely accessible smoking cessation interventions implemented after the 1998 master settlement agreement . Cold turkey and unassisted quitting reveal a success rate of about 5% while some programs using behavioral therapy with nrt claim quit rates exceeding 40% . Accordingly, the mtcp 30-day point prevalence (88.7%) and intent - to - treat (51.6%) success rates are remarkable . According to longitudinal (5 - 8 y) data, the overall quit rate (57%) achieved by mtcp patients at 12 months is a very good predictor of long - term success . Telephonic coaching (or counseling) is a process widely used for tobacco cessation programs, particularly by accessible government - supported quit lines (eg, 1 - 866 ny - quits or 1 - 800-quitnow). Previous studies of coaching reported quit rates above 30%, but sometimes below 15% . However, the training and background of coaches in previous studies is poorly described and unlikely to meet the hc paradigm recently forwarded by wolever et al . Mtcp health coaches were registered nurses with extensive coach training who delivered hc compatible with the wolever et al definition . Others have called for further study of such coaching methods because of preliminary success in smoking cessation . We speculate the care and techniques provided by mtcp coaches accounted for the outstanding rate of successfully achieving tobacco independence in the present report . Adding complementary therapies did little to enhance mtcp quit rates . Telephonic - only coaching quit rates were not significantly different than in - clinic treatment that included aes and auriculotherapy . Cranial stimulation and acupuncture are accepted clinical procedures with effectiveness in addiction / smoking cessation . In the present study, however, providing these procedures before each hc session did not improve effects of hc alone on quit rates . While these procedures may be effective, combining them with hc likely removed their influence on the quitting process . It seems that whether hc was administered with or without complementary therapies, it was the primary treatment explaining smoking cessation in these patients . The question of coaching effectiveness when delivered telephonically vs face - to - face is of great interest with ease and cost - effectiveness of remote coaching, making it preferred assuming it is equally effective . The absence of facial expressions and body language are considered shortcomings of the telephonic method . Our results, however, demonstrated telephonic coaching to be equally effective as in - clinic, face - to - face sessions . It may be speculated that many patients are less inhibited speaking on the phone than in person, making them inclined to more fully tell their stories, contributing to hc success . Our tobacco cessation results are not surprising given that telephonic coaching sessions apparently are also effective for weight loss and treatment of depression . Our data lend further credence to remote, telephonic delivery of coaching processes as an effective behavior change intervention . The use of readiness - to - change scores appears extremely valuable for health coaches working with patients attempting to quit smoking . Moving a patient one behavior - change category (eg, from contemplation to preparation) more than doubled chances of quitting and equally affected chances of remaining smoke - free . With such a large influence on outcome, monitoring, and influencing, stage of behavior change seems to be a critical hc strategy . This is an account of an existing practice; therefore, these data are not from a prospectively designed, randomized, controlled trial (rct). These data were systematically collected; however, conclusive assessment of the mtcp coaching process may require an experimentally designed study . While ideal, designing such a project may not be ethically pragmatic given it requires withholding an apparently effective treatment from a (control) group of patients who need to be as motivated to quit smoking as those assigned to treatment . As a description of an existing practice and not an rct, this project did not control for other factors that may impact smoking cessation and might have augmented the hc effect . For example, nrt is a controversial intervention sometimes described as effectively assisting with quitting a tobacco habit . Our analysis found that hc patients using nrt were no more likely to quit tobacco than patients without nrt . Many mtcp patients employed nrt (44% at one point or another) though hc was the only treatment consistently applied for all patients . In standard practice, a health coach using a patient - centered approach encourages patients to seek other strategies, aids, or social supports to optimize positive behavior change . The goal of the mtcp was to follow a true coaching paradigm allowing maximum therapeutic flexibility . Undoubtedly, a high level of treatment flexibility was achieved; however, hc was the common and primary intervention for all patients in this highly successful, tobacco cessation program . Smoking has huge economic implications with a $96 billion cdc estimated annual us health cost burden shared by smokers and tax - payers in general . This number has recently been translated to a corporate cost of greater than $5000 per smoking employee with additional costs for human pain and suffering immeasurable . Finding a strategy to incentivize smoking cessation is economically imperative and many employers attempt to provide such motivation . Our observations revealed coercing smoking cessation through an insurance premium reduction mandate is not a good strategy . Patients required to participate to avoid an insurance - premium penalty were about six times less likely to quit smoking than those participating freely . Program compliance (> 4 visits) improved success for these mandated participators, but they were still about twice as likely to continue smoking as free - choice patients . Nearly twice as many mandated participants were in precontemplation (ie, not considering quitting) compared to those freely entering mtcp . Providing an insurance premium upcharge apparently may not be a good strategy to augment smoking cessation . However, a recent study indicates other employer - organized programs, using financial incentives, are viable to motivate behavior change . Programs for smoking cessation can be expensive while claiming efficacy rates of 25% to 30% . The mtcp in - clinic program had quitting success rates exceeding 70% and smoke - free rate above 60% at 1 year with patient cost of $38 per visit ($266 for seven visits) and total staff labor costs of $204 for the average patient who had about seven visits . More impressively, patient cost for the equally effective telephonic - only hc was $32 per session with labor costs of only $112 for (on average) seven sessions . In practice, implementing a hospital - based, hc smoking cessation program is highly feasible . Allied healthcare personnel (existing staff, eg, nurses) building on their knowledge base, with as little as 50 to 200 hours of training in relational and communication skills, may become qualified as an hc . Once an hc staff exists then adding the program into existing departments (eg, cardiac rehabilitation or employee/ community wellness) becomes a matter of best logistical fit . Given the potential economic and societal benefit, adding an hc - grounded smoking cessation program to the menu of patient treatment options should be a primary consideration for many public healthcare settings . Furthermore, government sponsorship of such programs deserves careful investigation and deliberation given the prospects for reducing national healthcare costs . For the 161 participants in this study, an average of 6.20 (2.71, range=2 - 15) hc sessions were recorded . The initial consult was 42.1 min (9.80) with 35.8 min (13.37) per subsequent session . A total of 119 patients (73.9%) demonstrated program adherence of four or more coaching sessions . Patients were motivated to change tobacco habits (7.862.17) and most (88.8%) were at least contemplating change (precontemplation 11.2%; contemplation 26.7%; planning 28%; action 34.1%). There were 65 participants (40.4%) whose participation was considered employer - mandated (ie, motivated to take part by an insurance premium reduction). Intent - to - treat quit rate at 6 months was 51.6% (83 of 161). Thirty - day point prevalence quit rate at 7 months was 88.7% (47 of 53). Overall smoke - free rates at 1, 3, 6, 12, 18, and 24 months were 95.3% (102 of 107), 89.9% (98 of 109), 76.9% (83 of 108), 63.2% (67 of 106), 51.8% (44 of 85), and 40.5% (30 of 74), respectively . Figure 2 shows no difference in smoke - free rates between patients receiving in - clinic care (hc plus complementary therapies) vs telephonic hc . Treatment / coaching style . In - clinic patients received health coaching face - to - face in combination with complementary therapies while telephonic patients remotely received health coaching and no complementary therapies . Note that the zero (0) time point reflects the average smoke - free rate for the subgroups . Values below the x - axis reflect the number of patients responding at each time point . The predictors, coaching subgroup (in - clinic / telephonic), motivational factors (premium reduction mandated participation, importance, and stage of change) and covariates, smoking history (average amount smoked per day and years of use), and nrt, reliably distinguished between quitters and non - quitters as seen in the table . These variables explained a significant, small - moderate effect in smoking cessation ((8)=48.81, p<.001; nagelkerke's r=.39; 79% prediction success). Insurance mandate and stage of change significantly contributed to prediction . Specifically, when patients participated freely (ie, without a premium reduction mandate), they were 6.26 times more likely to quit smoking (p<.001). A unit increase in stage of change (eg, from precontemplation to contemplation) saw patients 3.18 times more likely to quit smoking (p<.001). The table also details the predictive ability of this model for smoke - free rates at 1, 3, 6, 12, 18, and 24 months . It appears that the farther removed participants are from coaching, the more their initial rates of smoking influence remaining smoke free, with those who smoked the most at baseline having the most difficulty remaining smoke - free . Logistic regression predictors of smoking cessation and smoke - free rates abbreviation: nrt, nicotine receptor therapy . Participants significantly reduced tobacco use rates to an average of 3.52 (7.45) cigarettes per day (t(134) = 17.94, p<.001). Tobacco reduction was predicted by one's history of smoking (quantity smoked per day b[se] = 0.27 (0.05), p<.001; years smoked b[se] = .09[0.04], p=.04; number of previous quit attempts b[se] = 0.01[.18], p=.97; nrt (b[se] = 0.33[1.00], p=.74; motivational variables (importance b[se] = 0.38[0.25], p=.13; stage of change b[se] = 2.26(0.55), p<.001; insurance mandate b[se] = 1.64[.97], p=.10; and their coaching group (in clinic / telephonic [se]=2.73[1.04], p<.01), f(8,155) = 11.82, p<.001; r = .39). Every additional cigarette smoked at baseline related to .42 more cigarettes smoked at follow - up; every additional year patients had smoked led to an additional .15 cigarettes smoked; with every increase in stage of change, .31 fewer cigarettes were smoked; and patients in the telephonic coaching group smoked .18 cigarettes fewer than those receiving in - clinic coaching . Successful quit rates are at a meager 4.4% when examining programs over a 20-year period (1991 - 2010). This poor rate of success exists despite well - funded and widely accessible smoking cessation interventions implemented after the 1998 master settlement agreement . Cold turkey and unassisted quitting reveal a success rate of about 5% while some programs using behavioral therapy with nrt claim quit rates exceeding 40% . Accordingly, the mtcp 30-day point prevalence (88.7%) and intent - to - treat (51.6%) success rates are remarkable . According to longitudinal (5 - 8 y) data, the overall quit rate (57%) achieved by mtcp patients at 12 months is a very good predictor of long - term success . Telephonic coaching (or counseling) is a process widely used for tobacco cessation programs, particularly by accessible government - supported quit lines (eg, 1 - 866 ny - quits or 1 - 800-quitnow). Previous studies of coaching reported quit rates above 30%, but sometimes below 15% . However, the training and background of coaches in previous studies is poorly described and unlikely to meet the hc paradigm recently forwarded by wolever et al . Mtcp health coaches were registered nurses with extensive coach training who delivered hc compatible with the wolever et al definition . Others have called for further study of such coaching methods because of preliminary success in smoking cessation . We speculate the care and techniques provided by mtcp coaches accounted for the outstanding rate of successfully achieving tobacco independence in the present report . Adding complementary therapies did little to enhance mtcp quit rates . Telephonic - only coaching quit rates were not significantly different than in - clinic treatment that included aes and auriculotherapy . Cranial stimulation and acupuncture are accepted clinical procedures with effectiveness in addiction / smoking cessation . In the present study, however, providing these procedures before each hc session did not improve effects of hc alone on quit rates . While these procedures may be effective, combining them with hc likely removed their influence on the quitting process . It seems that whether hc was administered with or without complementary therapies, it was the primary treatment explaining smoking cessation in these patients . The question of coaching effectiveness when delivered telephonically vs face - to - face is of great interest with ease and cost - effectiveness of remote coaching, making it preferred assuming it is equally effective . The absence of facial expressions and body language are considered shortcomings of the telephonic method . Our results, however, demonstrated telephonic coaching to be equally effective as in - clinic, face - to - face sessions . It may be speculated that many patients are less inhibited speaking on the phone than in person, making them inclined to more fully tell their stories, contributing to hc success . Our tobacco cessation results are not surprising given that telephonic coaching sessions apparently are also effective for weight loss and treatment of depression . Our data lend further credence to remote, telephonic delivery of coaching processes as an effective behavior change intervention . The use of readiness - to - change scores appears extremely valuable for health coaches working with patients attempting to quit smoking . Moving a patient one behavior - change category (eg, from contemplation to preparation) more than doubled chances of quitting and equally affected chances of remaining smoke - free . With such a large influence on outcome, monitoring, and influencing, stage of behavior change seems to be a critical hc strategy . This is an account of an existing practice; therefore, these data are not from a prospectively designed, randomized, controlled trial (rct). These data were systematically collected; however, conclusive assessment of the mtcp coaching process may require an experimentally designed study . While ideal, designing such a project may not be ethically pragmatic given it requires withholding an apparently effective treatment from a (control) group of patients who need to be as motivated to quit smoking as those assigned to treatment . As a description of an existing practice and not an rct, this project did not control for other factors that may impact smoking cessation and for example, nrt is a controversial intervention sometimes described as effectively assisting with quitting a tobacco habit . Our analysis found that hc patients using nrt were no more likely to quit tobacco than patients without nrt . Many mtcp patients employed nrt (44% at one point or another) though hc was the only treatment consistently applied for all patients . In standard practice, a health coach using a patient - centered approach encourages patients to seek other strategies, aids, or social supports to optimize positive behavior change . The goal of the mtcp was to follow a true coaching paradigm allowing maximum therapeutic flexibility . Undoubtedly, a high level of treatment flexibility was achieved; however, hc was the common and primary intervention for all patients in this highly successful, tobacco cessation program . Smoking has huge economic implications with a $96 billion cdc estimated annual us health cost burden shared by smokers and tax - payers in general . This number has recently been translated to a corporate cost of greater than $5000 per smoking employee with additional costs for human pain and suffering immeasurable . Finding a strategy to incentivize smoking cessation our observations revealed coercing smoking cessation through an insurance premium reduction mandate is not a good strategy . Patients required to participate to avoid an insurance - premium penalty were about six times less likely to quit smoking than those participating freely . Program compliance (> 4 visits) improved success for these mandated participators, but they were still about twice as likely to continue smoking as free - choice patients . Nearly twice as many mandated participants were in precontemplation (ie, not considering quitting) compared to those freely entering mtcp . Providing an insurance premium upcharge apparently may not be a good strategy to augment smoking cessation . However, a recent study indicates other employer - organized programs, using financial incentives, are viable to motivate behavior change . Programs for smoking cessation can be expensive while claiming efficacy rates of 25% to 30% . The mtcp in - clinic program had quitting success rates exceeding 70% and smoke - free rate above 60% at 1 year with patient cost of $38 per visit ($266 for seven visits) and total staff labor costs of $204 for the average patient who had about seven visits . More impressively, patient cost for the equally effective telephonic - only hc was $32 per session with labor costs of only $112 for (on average) seven sessions . In practice, implementing a hospital - based, hc smoking cessation program is highly feasible . Allied healthcare personnel (existing staff, eg, nurses) building on their knowledge base, with as little as 50 to 200 hours of training in relational and communication skills, may become qualified as an hc . Once an hc staff exists then adding the program into existing departments (eg, cardiac rehabilitation or employee/ community wellness) becomes a matter of best logistical fit . Given the potential economic and societal benefit, adding an hc - grounded smoking cessation program to the menu of patient treatment options should be a primary consideration for many public healthcare settings . Furthermore, government sponsorship of such programs deserves careful investigation and deliberation given the prospects for reducing national healthcare costs . The mtcp features a carefully defined program of hc, and reports a very high quit rate (72.7%) and excellent smoke free rates at 6 mo (76.9%) and 12 mo (63.2%). Habitual tobacco use is a very difficult addiction to overcome, is widely recognized as primary risk factor for chronic diseases, and is a scourge on public health . Most smoking cessation programs report quit rates that rarely exceed 30% at 6 mo and unassisted quitting efforts have success rates well below 10% . For scientific purposes, greater experimental controls on our data would be ideal, but these results are highly encouraging and the success of mtcp practices for many individuals that were struggling with tobacco addiction is clear . Within the limitations of this study, health coaching (when defined by strict patient - centered standards) other clinical and public healthcare settings should consider adapting and implementing this cost efficient model to assist their patients with tobacco abstention.
|
Body mass index (bmi) is the most commonly used anthropometric method to define human obesity . Bmi is a complex trait affected by many environmental (eg, diet, age, physical activity) and genetic factors, with heritability estimates that vary from 4080% in twin studies, 2050% in family studies and 2060% in adoption studies . Recent genome - wide association (gwa) studies have successfully identified numerous single - nucleotide polymorphisms (snps) that are robustly associated with obesity related traits, including bmi . They shed light on the biological basis of obesity and suggest a role for neuronal influences on the regulation of appetite and/or energy balance . However, the identified genetic variants jointly explained only a small proportion of the trait variation and thus had limited predictive value for obesity risk . For example, in a recent meta - analysis (249 796 individuals) 32 identified and replicated snps together explained only 1.45% of the inter - individual variation in bmi where the strongest snp accounted for just 0.34% of the variance . The 32 bmi snps map to 32 different genes that are referred to as bmi loci hereafter . Gene gene interactions (epistasis) are thought to be potential sources of the unexplained genetic variation, but they remain largely unexplored in the gwa studies conducted for bmi so far . A major hurdle for analysing epistasis in gwa studies was the lack of fast methods to enumerate billions of interaction tests in a full pair - wise genome scan to map different types of epistasis (eg, with or without main effects) while keeping false - positive rates under control . Another hurdle for studying epistasis is the relatively small sample size in many existing gwa cohorts that may limit the power of detection and replication of epistasis signals unless the epistatic effects to be detected are large . It was showed in simulation that more than 4000 case control pairs were needed to achieve 80% power of detection of epistasis with an odds ratio of 3.0 in complex diseases . For quantitative traits, the major hurdle is gradually easing and full pair - wise genome scans are beginning to be applied to gwa populations individually . Meta - analysis of epistasis as applied in gwa studies could be a good way to overcome the sample size hurdle but requires new methods to accommodate imputed snp genotype data . Various approaches in search space reduction (ie, less stringent significance thresholds as result of the much reduced number of tests) can be applied to improve the power of detection of epistasis in individual gwa populations . Testing interactions involving genome - wide significant loci (of marginal effects) with a threshold corrected for the actual number of tests has been suggested and applied successfully in recent studies . Another approach is to select snps based on existing biological knowledge (eg, protein protein interactions) and test interactions among them only . However, cautions should be taken when making the snp selection because biological knowledge may not be directly related to the trait studied and any biases in the pre - identified loci could lead to false - positive epistatic signals . Here we demonstrate a different approach to exploit the value of genome - wide analysis of epistasis using multiple populations . First we performed full pair - wise genome scans for epistasis in bmi in four gwa populations to which we had direct access: the scottish orcades, the croatia - vis and croatia - korcula, and the italian micros study cohorts . Each of these cohorts has a relatively small sample size and is sampled from distinct european regions with widely differing lifestyles and diets . Second, we identified common and potentially important gene gene interactions using the epistasis signals uncovered in each cohort and their gene ontology (go) enrichment across populations . In addition, we also identified a set of interactions involving the bmi loci (as prior knowledge) in different cohorts . Third, we tested the identified interactions in each cohort for replication and then the replicated signals in the northern finland birth cohort 1966 (nfbc1966). We aim to address the question whether epistasis analysis is of value for the dissection of the genetic regulation of bmi in these study cohorts ., the scottish orcades cohort was recruited from a subgroup of 10 islands of the archipelago of orkney . This study was approved by the nhs orkney research ethics committee and the north of scotland rec . The croatia - vis and croatia - korcula cohorts were recruited from the island of vis and the island of korcula, respectively . Both studies were approved by the ethical committee of the medical school, university of zagreb and the multi - centre research ethics committee for scotland . The italian micros cohort was recruited from villages in an isolated highland area of the south tyrol . All participants gave written informed consent and were measured for a number of traits, including weight and height from which bmi values were calculated . Dna samples were genotyped with illumina infinium humanhap300v1/v2 (for croatia - vis by the wellcome trust clinical facility in einburgh, uk) or humancnv370v1 snp bead microarrays (for croatia - korcula, orcades and micros by the helmholtz zentrum munchen in munich, germany) and analysed using the beadstudio software (illumina). Quality control of the genotype data was performed for each cohort using the r / genabel package (version 1.6 - 7) based on a common set of criteria: individual call rate at 97%, snp call rate at 95%, p - value for deviation from hardy weinberg equilibrium at 1.0e-10, minor allele frequency at 2% . The nfbc1966 data were provided by the database of genotype and phenotype (dbgap) via specific data use certification and used as the replication cohort . Nfbc1966 includes nearly all individuals born in 1966 in the two northernmost finnish provinces that were genotyped with humancnv370v1 snp bead microarrays and was put through the same quality control procedure as above . The summary information of each cohort after quality control and excluding individuals without bmi or age records or with extremely high bmi (ie, bmi>50 kg / m) is given in table 1 . The raw bmi data in each of the four study cohorts were corrected for age and sex and normalised using the rntransform function that is implemented in the genabel package performing quantile normalisation of residuals from a generalised linear model analysis . The normalised bmi residuals were then analysed using a linear mixed model to correct for polygenic effects due to relatedness using the polygenic function in the genabel package and the resultant environmental residuals (ie, pgresidualy in genabel) were used as the trait to test for association . The original gwa study, in the nfbc1966 cohort individuals with pregnancy and/or self reported bmi measures were excluded, and the raw bmi values were corrected for the sexocpg factor (recoded according to gender, status of taking oral contraception and pregnancy) and then normalised and corrected for relatedness as above . A single - snp based gwa scan was performed in each population using a score test method (based on the additive model) implemented in the mmscore function in the genabel package . The consensus gwa threshold of 7.3 (log10(5.0e08)) was applied to identify gwa significant snps . We also performed a full pair - wise genome scan using the regression models described below . Considering a pair of snps denoted as snp1 and snp2, the following genetic models were used to detect epistasis where genotypes of each snp (ie, homozygote of the minor allele, homozygote of the major allele and heterozygote) were fitted as fixed factors: where y is the trait of interest, is the model constant, snp1 (or snp2) is a fixed factor with three levels (genotype classes), snp1snp2 is the interaction term, e is the random error term . The f ratio test of model 1 against model 3 evaluates the whole pair effect, including interaction (ie, fpair, 8 degrees of freedom). The f ratio test of model 1 against model 2 evaluates the interaction between the two snps (ie, fint, 4 degrees of freedom). P - values were calculated based on the f distribution with relevant degrees of freedom and transformed to the log10 scale (ie, log10 ppair for the fpair test, log10 pint for the fint test). Genome - wide significant thresholds (all in the log10 scale) were derived based on bonferroni correction for multiple tests, that is, the 5% nominal p value corrected by the number of tests performed . Considering 300 000 snps, a full pair - wise genome scan perform 4.5e+10 association tests and thus the 5% genome - wide threshold is 11.95 (ie, log10(0.05/4.5e+10)). After each pair - wise genome scan, results were evaluated using the predefined threshold to identify genome - wide significant interaction signals . Each snp in the results was annotated to the nearest gene within a window of 20 kilobases flanking the snp (based on the physical distance to either the start or end of transcription of a gene; the distance is considered as zero if the snp is within a gene). A go enrichment analysis was conducted for each study cohort using the running mode of two unranked lists of genes' in gorilla based on the standard hyper geometric statistics, where the annotated epistatic genes were used as the target with the full list of human genes as the background . For simplicity, we chose to use the same log10 p value as the consensus gwa threshold (ie, log10 pint> 7.3) to select snp pairs of each cohort and used their gene annotations as the input for the go enrichment analysis . The go terms enriched (p<1.0e03) were compared across study cohorts to identify firstly common go terms and then their member genes shared by the cohorts . The shared epistatic genes were examined further for biological functions via literature mining and their associated interactions in the retained results of each cohort to identify potentially important interactions for replication tests . The bmi loci involved snp pairs (log10 pint> 7.3) in each study cohort were also identified as potentially important interaction signals for replication tests . Genome - wide significant snp pairs and those identified as potentially important interactions were tested for replication across the four study cohorts . Each replication test was done at both the snp and region levels . At the snp level, each replicated snp was exactly the same as the corresponding epistatic snp and thus the 5% nominal significance threshold (ie, log10(0.05)=1.30) was used because only one replication test was needed . At the region level, interactions between each of 10 adjacent snps (ie, five upstream and five downstream) of the first epistatic snp and each of those of the second were tested, to accommodate the situation where multiple snps may tag a same mutant of a gene . Permutation was used to derive significance thresholds for replication of each epistatic pair at the region level, where phenotypes were permuted and the highest log10 pint value of 121 (ie, 11 11) interaction tests was recorded in each of 1000 iterations . The replicated snp pairs were fitted together into the full model to calculate the proportion of phenotypic variance explained in each study cohort ., the scottish orcades cohort was recruited from a subgroup of 10 islands of the archipelago of orkney . This study was approved by the nhs orkney research ethics committee and the north of scotland rec . The croatia - vis and croatia - korcula cohorts were recruited from the island of vis and the island of korcula, respectively . Both studies were approved by the ethical committee of the medical school, university of zagreb and the multi - centre research ethics committee for scotland . The italian micros cohort was recruited from villages in an isolated highland area of the south tyrol . All participants gave written informed consent and were measured for a number of traits, including weight and height from which bmi values were calculated . Dna samples were genotyped with illumina infinium humanhap300v1/v2 (for croatia - vis by the wellcome trust clinical facility in einburgh, uk) or humancnv370v1 snp bead microarrays (for croatia - korcula, orcades and micros by the helmholtz zentrum munchen in munich, germany) and analysed using the beadstudio software (illumina). Quality control of the genotype data was performed for each cohort using the r / genabel package (version 1.6 - 7) based on a common set of criteria: individual call rate at 97%, snp call rate at 95%, p - value for deviation from hardy weinberg equilibrium at 1.0e-10, minor allele frequency at 2% . The nfbc1966 data were provided by the database of genotype and phenotype (dbgap) via specific data use certification and used as the replication cohort . Nfbc1966 includes nearly all individuals born in 1966 in the two northernmost finnish provinces that were genotyped with humancnv370v1 snp bead microarrays and was put through the same quality control procedure as above . The summary information of each cohort after quality control and excluding individuals without bmi or age records or with extremely high bmi (ie, bmi>50 kg / m) is given in table 1 . The raw bmi data in each of the four study cohorts were corrected for age and sex and normalised using the rntransform function that is implemented in the genabel package performing quantile normalisation of residuals from a generalised linear model analysis . The normalised bmi residuals were then analysed using a linear mixed model to correct for polygenic effects due to relatedness using the polygenic function in the genabel package and the resultant environmental residuals (ie, pgresidualy in genabel) were used as the trait to test for association . The polygenic heritability was estimated at the mixed - model step . Following the original gwa study, in the nfbc1966 cohort individuals with pregnancy and/or self reported bmi measures were excluded, and the raw bmi values were corrected for the sexocpg factor (recoded according to gender, status of taking oral contraception and pregnancy) and then normalised and corrected for relatedness as above . A single - snp based gwa scan was performed in each population using a score test method (based on the additive model) implemented in the mmscore function in the genabel package . The consensus gwa threshold of 7.3 (log10(5.0e08)) was applied to identify gwa significant snps . We also performed a full pair - wise genome scan using the regression models described below . Considering a pair of snps denoted as snp1 and snp2, the following genetic models were used to detect epistasis where genotypes of each snp (ie, homozygote of the minor allele, homozygote of the major allele and heterozygote) were fitted as fixed factors: where y is the trait of interest, is the model constant, snp1 (or snp2) is a fixed factor with three levels (genotype classes), snp1snp2 is the interaction term, e is the random error term . The f ratio test of model 1 against model 3 evaluates the whole pair effect, including interaction (ie, fpair, 8 degrees of freedom). The f ratio test of model 1 against model 2 evaluates the interaction between the two snps (ie, fint, 4 degrees of freedom). P - values were calculated based on the f distribution with relevant degrees of freedom and transformed to the log10 scale (ie, log10 ppair for the fpair test, log10 pint for the fint test). Genome - wide significant thresholds (all in the log10 scale) were derived based on bonferroni correction for multiple tests, that is, the 5% nominal p value corrected by the number of tests performed . Considering 300 000 snps, a full pair - wise genome scan perform 4.5e+10 association tests and thus the 5% genome - wide threshold is 11.95 (ie, log10(0.05/4.5e+10)). After each pair - wise genome scan, results were evaluated using the predefined threshold to identify genome - wide significant interaction signals . Each snp in the results was annotated to the nearest gene within a window of 20 kilobases flanking the snp (based on the physical distance to either the start or end of transcription of a gene; the distance is considered as zero if the snp is within a gene). A go enrichment analysis was conducted for each study cohort using the running mode of two unranked lists of genes' in gorilla based on the standard hyper geometric statistics, where the annotated epistatic genes were used as the target with the full list of human genes as the background . For simplicity, we chose to use the same log10 p value as the consensus gwa threshold (ie, log10 pint> 7.3) to select snp pairs of each cohort and used their gene annotations as the input for the go enrichment analysis . The go terms enriched (p<1.0e03) were compared across study cohorts to identify firstly common go terms and then their member genes shared by the cohorts . The shared epistatic genes were examined further for biological functions via literature mining and their associated interactions in the retained results of each cohort to identify potentially important interactions for replication tests . The bmi loci involved snp pairs (log10 pint> 7.3) in each study cohort were also identified as potentially important interaction signals for replication tests . Genome - wide significant snp pairs and those identified as potentially important interactions were tested for replication across the four study cohorts . Each replication test was done at both the snp and region levels . At the snp level, each replicated snp was exactly the same as the corresponding epistatic snp and thus the 5% nominal significance threshold (ie, log10(0.05)=1.30) was used because only one replication test was needed . At the region level, interactions between each of 10 adjacent snps (ie, five upstream and five downstream) of the first epistatic snp and each of those of the second were tested, to accommodate the situation where multiple snps may tag a same mutant of a gene . Permutation was used to derive significance thresholds for replication of each epistatic pair at the region level, where phenotypes were permuted and the highest log10 pint value of 121 (ie, 11 11) interaction tests was recorded in each of 1000 iterations . The replicated snp pairs were fitted together into the full model to calculate the proportion of phenotypic variance explained in each study cohort . The mean bmi was similar across the croatia - vis, croatia - korcula and orcades cohorts but lower in micros (table 1). The polygenic heritability estimates varied from 0.356 (croatia - vis) to 0.514 (orcades). The inflation factor lambda (computed by regression of observed association p - values against the expected) of each gwa scan was very close to 1 (table 1), suggesting the family relatedness in each cohort was well accounted for . Only 8 out of the 32 bmi snps previously identified were genotyped in the four study cohorts and none of these showed a strong association with bmi (supplementary table s1). Full pair - wise genome scans found no snp pairs that passed the genome - wide threshold (log10 pint=11.95) in any of the four study cohorts (figure 1). Considering interaction signals with log10 pint> 7.3, micros had the least number of snp pairs and consequently the least number of annotated genes, whereas the remaining three cohorts had relatively similar numbers of snp pairs and annotated genes (table 2). Five out of the 32 bmi loci (but not the bmi snps) were involved in 7 epistatic pairs in croatia - vis: fto, kctd15, lrp1b, negr1 and prkd1 . Similarly, three bmi loci (negr1, nrxn3 and prkd1) were involved in croatia - korcula, two (fto and mtch2) in orcades and two (fto and lrp1b) in micros . Go terms enriched by epistatic genes (log10 pint> 7.3) in each cohort were compared (supplementary table s2) and identified 9 common in all four cohorts (table 3) that might indicate common regulation mechanisms (eg, go:0008038 neuron recognition). Among the epistatic genes that enriched the 9 go terms, we found 19 epistatic genes shared by the four cohorts of which 15 are previously published gwa loci (mostly not genome - wide significant) associating with various phenotypes (supplementary table s3). Most of the 19 shared epistatic genes interacted with one another despite their interactions being relatively weak (log10 pint<7.3, supplementary table s4) in general, including cdh13 (cadherin 13) associated with height and sorcs2 (sortilin - related vps10 domain containing receptor 2) associated with circulating insulin - like growth factor 1 and insulin - like growth factor - binding protein-3, which are important for anthropometric traits and risk of cancer and cardiovascular disease . We further tested replication of the snp pairs involving either bmi loci (19, table 2) or two shared epistatic genes across the study cohorts (50, supplementary table s4). Despite none of the 69 snp pairs being genome - wide significant, eight of them had a replication in one or more cohorts at the snp level (ie, log10 pint>1.30; table 4). The best replicated pairs at the snp level were rs2202167 (nrxn3) rs11150880 (log10 pint was 8.19, 1.68 and 1.43 in croatia - korcula, croatia - vis and orcades, respectively) and rs1474056 (mtch2) - rs7250947 (plin4) (log10 pint was 8.08 in orcades and 2.44 in croatia - korcula). The rs11150880 snp is near the rph3al gene, which is known to have a key role in insulin secretion by pancreatic cells . The eight replicated snp pairs together explained the phenotypic variance of bmi by 4, 4, 2 and 0.5% in croatia - vis, croatia - korcula, orcades and micros, respectively . By testing replication at the region level, we found the pair of rs9858278 (naaladl2) - rs7198915 (cdh13) replicated in croatia - vis, croatia - korcula and micros (exceed the 5% thresholds, table 4 and supplementary table s5). Further testing the nine replicated snp pairs in the nfbc1966 cohort found none replicated at either the snp or region levels . However, seven out of the nine pairs had log10 pint>2, of which three exceed the 20% thresholds (table 4 and supplementary table s5). Gene gene interactions have been suggested as sources of the hidden genetic variations in gwa studies, but the extent of their role in this regard has yet to be demonstrated . One big challenge is that the sample sizes of many gwa data sets are relatively small (eg, less than 4000 individuals) and hence the power to detect epistasis could be low . Therefore studying epistasis in a single gwa population this is certainly true in our case where exhaustive genome scans in the four study cohorts found no genome - wide significant epistasis associated with bmi . We suggest to tackle the challenge by looking for common (thus potentially important) gene gene interactions from sub genome - wide significant epistatic signals (log10 pint>7.3) in multiple gwa populations . We showed that go enrichment analysis could be used to identify common go terms (ie gene function groups) enriched by the epistatic signals in the four study cohorts from which 19 shared epistatic genes were identified . Most of the 19 shared epistatic genes are previously identified gwa loci associating with phenotypes other than bmi and interacted with one another . Their interactions were considered potentially important because they belong to one or multiple commonly enriched go terms . Interactions involving at least one of the 32 bmi loci with log10 pint>7.3 were also considered potentially important assuming the bmi loci are likely interactive . Being aware of possible noises in those potentially important interactions, we used replication to identify the most reliable epistatic signals across the study cohorts . Eight epistatic pairs involving either the bmi loci or two shared epistatic genes showed replication at the snp level in at least one cohort (table 4). The eight epistatic pairs together could indeed explain a considerable proportion of the bmi variation in each individual cohort . Nevertheless, caution is recommended in light of the potential overestimation of the effects due to the winner's curse' . Besides, none of the eight epistatic pairs were replicated in all of the four study cohorts, or in the replication cohort nfbc1966 . Further replication tests in other populations and/or functional assays are useful to confirm whether they are true signals . Statistical replication has been used as the golden rule to prevent reporting false positives in gwa studies . This however appears to be far more difficult for epistatic signals than for single snp signals for reasons, including power, minor allele frequency change, and linkage disequilibrium between epistatic snp and mutant for both loci . The moderate log10 pint values of the epistatic pairs tested for replication suggest that the linkage disequilibrium between epistatic snps and mutants is not high so replication of these pairs will be difficult . Furthermore, different environments may cause different phenotype distributions in the discovery and replication cohorts . The lack of replication in the nfbc1966 cohort could be due to two important environmental factors of bmi: age (ie, 31 vs a range between 18 and 90 in the study cohorts) and diets . Gene interactions in multiple gwa populations is an effective solution to the issue of limited power of detection of epistasis . It is just a partial solution though because some ignored interactions may be important as well . Comparison of sub genome - wide significant epistatic signals across multiple populations can be made at either the snp, or gene or pathway level and seem more fruitful at the gene or pathway level than the snp level . The approach may become more useful if better annotation methods (considering only gwa signals without interactions) can be adapted to epistasis . For example, not all epistatic snps were annotated to genes in the study and hence did not contribute to the enrichment analysis . The approach will likely remain important even once new tools for meta - analysis of epistasis in gwa data sets become available to increase power for detection of epistasis.
|
As part of continuous national avian influenza virus surveillance, we performed a monthly collection of cloacal swabs from various poultry species (chicken, duck, goose, quail, and pigeon) at a wholesale live - bird market (lbm) in yangzhou, jiangsu province, in eastern china . Birds offered for retail sale in the lbm were mainly from local farms in jiangsu and the neighboring provinces in eastern china; some were transported from regions in southern or northern china . Virus isolation and identification were conducted as described (4). During december 2009september 2012, avian influenza virus isolates belonging to 8 ha subtypes (h1, h3h6, h9h11) were identified; 7 of the isolates were subtype h5n1 (table 1). * re-5 and k0602 antiserum were generated by vaccinating specific - pathogen free chickens with the commercial re-5 vaccine (qingdao yebio bioengineering co., ltd, qingdao, china) and the oil - emulsified inactivated a / chicken / northern china / k0602/2010(h5n1) vaccine, respectively . Qingdao yebio bioengineering co., ltd, china . To characterize these 7 isolates, we sequenced the ha genes to determine clade distribution . In the reconstructed phylogenetic tree (figure) using reference sequences retrieved from the genbank database and partially recommended by who / oie / fao (2), the 7 isolates belonged to clade 2.3.4 (the fujian - like sublineage), which has been prevalent in china since 2005 (5). However, none of the isolates could be further classified into previously identified subclades 2.3.4.1, 2.3.4.2, or 2.3.4.3 . Six of the viruses closely resembled a / peregrine falcon / hong kong/810/2009, and the remaining virus was highly homologous with recent h5 viruses bearing various neuraminidase (na) subtypes (n1, n2, n5, and n8). Phylogenetic tree of the hemagglutinin (ha) genes of the diverged avian influenza h5 subtype clade 2.3.4 variants from china and reference sequences retrieved from the genbank database and partially recommended by the world health organization / world organisation for animal health / food and agriculture organization of the united nations h5n1 evolution working group the neighbor - joining tree was generated by using mega 5.1 software (www.megasoftware.net). Numbers above or below the branch nodes denote bootstrap values> 60% with 1,000 replicates . Numbers on the right are existing (2.3.3, 2.3.4.1, 2.3.4.2, 2.3.4.3, 2.5) and proposed (2.3.4.4, 2.3.4.5, 2.3.4.6) virus subclades . Black triangles indicate the 7 variants identified in this study; genbank accession numbers for their ha genes are kc631941kc631946 and kc261450 . Scale bar indicates nucleotide substitutions per site . According to who / oie / fao guidelines (13), new clades (including subclades) were specified not only with a bootstrap value of> 60 at the clade - defining node in which sequences monophyletically arose from a common ancestor but also with average between - clade and within - clade nucleotide divergences of> 1.5% and <1.5%, respectively . Apart from subclades 2.3.4.1, 2.3.4.2, and 2.3.4.3, we found 3 additional monophyletic categories the a / peregrine falcon / hong kong/810/2009-like viruses, the hpai subtype h5n5like reassortants, and the hpai subtype h5n2/h5n8like reassortants that grouped clearly within the tree (figure). The bootstrap values and average within - clade and between - clade distances for these 3 groups were 81, 1.0%, 4.2%; 100, 1.0%, 5.2%; and 100, 1.3%, 5.3%, respectively . Because of the compulsory vaccination practice against hpai in china (6), we examined serologic cross - reactivity between the 7 subtype h5n1 isolates and the diagnostic antigen of the widely used inactivated reassortant h5n1/pr8 vaccine re-5 (table 1). Although re-5 derived its ha and na genes from a clade 2.3.4 representative virus a / duck / anhui/1/2006, the hemagglutination inhibition (hi) titers of re-5 antiserum against the 7 subtype h5n1 viruses were as much as 67 log2 lower than that against the homologous antigen . In contrast, the antiserum of a / chicken / northern china / k0602/2010 (k0602) showed limited reaction to re-5 and a / chicken / eastern china / ah/2012 . Moreover, antigenic variation also existed among the 6 a / peregrine falcon / hong kong/810/2009-like viruses, as highlighted by the hi assay using k0602 antiserum (table 1). To explore whether these antigenic variations can be translated into protection efficacy difference in vivo, we selected a / chicken / northern china / k0602/2010 (k0602) and a / chicken / shandong / k0603/2010 (k0603) viruses to evaluate the bivalent inactivated reassortant h5n1/pr8 vaccine re-4/re-5 (the ha and na genes of re-4 are from a clade 7 virus a / chicken / shanxi/2/2006). This vaccine has been extensively used to control the prevalence of clade 2.3.4 and clade 7 viruses in china since 2008 (6). In addition, a reassortant rk0602 virus, which carries the ha and na genes of k0602 virus and the internal genes of pr8, was recovered by using reverse genetics and the inactivated rk0602 vaccine was applied to evaluate the homologous protection . Four - week - old specific - pathogen free chickens were vaccinated with re-4/re-5 or the rk0602 vaccine and readily developed specific antibodies against the component viruses by day 28 after vaccination (table 2). The birds were then intranasally challenged with 10 50% egg infectious dose of k0602 or k0603 virus . During the 10-day observation period, the re-4/re-5 vaccinated birds displayed clinical signs including severe depression, ruffled feathers, huddling, decreased feed and water consumption, and diarrhea; moreover, only 14.3% (1/7 birds in the k0602 group) and 10% (1/10 birds in the k0603 group) of the challenged chickens survived, reflecting poor protection by the re-4/re-5 vaccine . In addition, shed virus was detected in tracheal and cloacal swabs from most of the tested chickens on 3 and 5 days postchallenge . By contrast, the rk0602-vaccinated chickens all survived the challenge, and no virus was recovered from tracheal and cloacal samples (table 2). * chickens were immunized with the re4/re5 or the inactivated rk0602 vaccine (the ha and na genes of rk0602 were derived from subtype h5n1 k0602 virus; the internal genes were from pr8), and hi antibody titers were determined on day 28 postvaccination . Hi, hemagglutination inhibition assay; dpc, days postchallenge; nd, not done . Birds were challenged with 10 50% egg infectious dose (eid50) of k0602 or k0603 virus; virus titers are expressed as log10 eid50/0.1 ml . Two groups of 5 mock - vaccinated chickens served as controls; all died within 3 dpc . The location of the 7 hpai a(h5n1) virus variants in the ha gene tree (figure) suggests that novel monophyletic subclades other than the previously identified 2.3.4.1, 2.3.4.2, and 2.3.4.3 subclades continue to emerge within clade 2.3.4 . As a result of our findings, we suggest that these groups should be assigned new fourth - order clades of 2.3.4.4, 2.3.4.5, and 2.3.4.6 to reflect the wide divergence of clade 2.3.4 viruses . In china, 1 of the 6 countries to which subtype h5n1 virus is endemic (7), multiple distinct clades (2.2, 2.5, 2.3.1, 2.3.2, 2.3.3, 2.3.4, 7, 8, and 9) were identified by surveillance during 20042009 (5). In particular, clades 2.3.2, 2.3.4, and 7 viruses have gained ecologic niches and have continued circulating by further evolving into new subclades (2). In addition, various na subtypes of h5 viruses (h5n5, h5n8, and h5n2) bearing the genetic backbone of clade 2.3.4 a(h5n1) viruses have been detected in ducks, geese, quail, and chickens (812). These findings highlight the importance of periodic updates of the who / oie / fao classification of asian a(h5n1) viruses by continuous surveillance to better understand the dynamic nature of the viral evolution . Our findings have implications for the effectiveness of vaccination of chickens against hpai a(h5n1) viruses . The results of cross - hi assays (table 1) and vaccine efficacy experiments (table 2) indicate antigenic drift in subtype h5n1 variants, as compared with the vaccine strain specifically designed to control the prevalent clade 2.3.4 virus infection in poultry . Although previous studies by tian et al . (14) proposed that vaccinated chickens with hi antibody titers of> 4 log2 could be protected from virus challenge, our data demonstrate that vaccine efficacy is substantially influenced by antigenic matching between the vaccine strain and circulating viruses in preventing the replication and transmission of influenza virus, especially when the induced antibodies are of moderate titers.
|
Age- or injury - induced muscle weakness leading to frailty is a major public health problem that is predicted to escalate in the future as the number and proportion of older adults increase in the general population (berger and doherty 2010). There is an unmet need for therapeutic strategies that can slow the effects of aging on muscle function in the frail elderly so as to maintain or improve their quality of life . Identifying suitable therapeutic targets and testing candidate drugs for the ability to improve muscle function require cell - based model systems that reliably predict in vivo effects in both pre - clinical rodent models and human patients . A number of useful rodent cell lines such as mouse c2c12 or rat l6 myoblasts are available (sultan et al . 2006). These cell lines, and others, have been used extensively to explore the molecular mechanisms of muscle differentiation and function (mcfarlane et al . In addition, they have been used in some drug discovery screens (baudy et al . However, because immortalized cell lines often are genetically abnormal, and have been maintained under artificial conditions in culture for very long periods of time which can cause them to deviate from normal function, a potentially more predictive screening strategy would use primary human muscle cells . Such cells have recently become available from a number of commercial vendors, but only limited characterization of these various primary cells has been reported (janowski 2011). Therefore, we examined several primary human skeletal muscle cell preparations from different vendors and characterized each for their capacity to reproducibly differentiate into multinucleated myotubes . Those that reproducibly differentiated into myotubes were further examined for the expression of various markers of skeletal muscle cells such as myogenic differentiation-1 (myod), myocyte enhancer factor 2c (mef2c), myogenin (myog), troponin t type 1 (tnnt), and myosin heavy chain-2 (myh2). We also tested known inducers of skeletal muscle atrophy (myostatin and dexamethasone) and hypertrophy (insulin - like growth factor-1) for effects on the differentiated myotubes derived from the primary cells . In addition, we found that myostatin - induced activity on the myotubes can be blocked by treatment with a soluble myostatin receptor, similar to one that is currently in clinical trials for diseases associated with muscle wasting (lee et al . Finally, we show that both the undifferentiated primary muscle cells as well as the myotubes they give rise to can be infected with adenovirus . This observation suggests the potential for using these cells in genetic screens (both over - expression and knock - down) to identify factors that play a role in muscle differentiation and function . Hsmm (catalog #cc-2580, lot #6f4528, sourced from quadriceps muscle of a 16-yr - old male cadaver) and skmc - l (catalog #cc-2561, lot #6f3791, sourced from human fetal skeletal muscle) were purchased from lonza (walkersville, md). Skmdc (catalog #sk-1111, lot #p101014 - 50m2, sourced from rectus abdominus muscle of a 50-yr - old male caucasian with a body mass index (bmi) of 21, non - diabetic, smoker for 20 yr) came from cook myosite (pittsburgh, pa). Skmc - p (catalog #c-12530, lot #8121902.17, sourced from unspecified skeletal muscle of a 21-yr - old male caucasian) was obtained from promocell (heidelberg, germany). Hsmm differentiation medium was prepared by adding 2% horse serum to dmem - f12 medium (both from invitrogen, grand island, ny). The vendor stated that hsmm would differentiate in all horse serum lots, so no pre - screening was required . Skmdc differentiation medium (ready to use) was supplied by the vendor (catalog #md-5555). Recombinant human myostatin (mstn) and actriib - fc were generated in - house as previously described (thies et al . Recombinant human igf-1 and tweak were purchased from r&d systems (minneapolis, mn), while dex was obtained from sigma (st . Hsmm and skmdc were maintained in growth medium with supplements and fetal bovine calf (fbs) serum provided by the vendors . Skmdc were passaged when they reached 50% confluence, (about every 23 d). When passaging, the culture medium was warmed to 37c and the cells were seeded at 5,0007,500 cells / cm and incubated in a humidified incubator at 37c, 5% co2 . Hsmm were passaged when they reached 5070% confluency (about every 3 d). The culture conditions for these cells were the same as those for skmdc except they were seeded at 3,500 cells / cm . For both cell types, cultures were used for experiments after no more than seven population doublings because the cells rate of differentiation declined after higher population doublings . To induce differentiation, cells were plated at 20,000 cells / cm in 12-well polystyrene cell culture plates (vwr) and incubated overnight in growth medium in a cell culture incubator (37c, 5% co2). The following morning, the growth medium was replaced with differentiation medium and the cultures were incubated for 3 d, during which time myotube differentiation occurred . To examine effects on differentiation, agents to be tested were added at the time of medium change and cultured for 3 d. to examine effects on differentiated myotubes, agents to be tested were added on day 3 of differentiation, after myotube formation had occurred, and then cultures were incubated for another 23 d. for analysis, to unambiguously identify myotubes, the cultures were fixed and immuno - stained with an antibody against myosin heavy chain-2 protein (myh2), as described below . Cells were fixed with 10% formalin for 20 min at room temperature (rt). Following 23 rinses with pbs, cells were permeabilized with 0.5% triton x-100 (sigma) in pbs for 15 min at rt . Non - specific binding was blocked with 2% bsa (sigma), 0.25% triton x-100 in pbs at rt for 30 min . Cells were then incubated with anti - skeletal myosin fast primary antibody, my-32 (sigma), diluted 1:200 in blocking buffer for 2 h at rt . After rinsing with blocking buffer without triton 2 times for 10 min each, cells were incubated with alexa 488 (green) or alexa 555 (red) conjugated anti - mouse igg secondary antibodies (both from invitrogen) at 1:400 dilution along with hoechst nuclear stain (#33342; sigma) at 1:5,000 dilution in blocking buffer at rt for 1 h. finally, cells were washed with pbs 3 times, 5 min each, before mounting with vectashield containing hoechst stain . Images were processed with nis - elements br 3.10 software (micro video instruments, avon, ma). For quantitative analysis of immuno - stained samples, briefly, 5 images were captured from each of 3 replicate wells for each treatment group, for a total of 15 images per condition . A fluorescence intensity threshold was set such that only the myh2-positive areas were measured by the software . The mean area for the untreated group (media only) was used to calculate the percent increase or decrease in myotube area for each treatment . This method allows a relatively rapid assessment of a compound s effect on myotube size . For western blot analyses, antibodies against phosphorylated - smad2 (ser465/467) (psmad2), smad2, phosphorylated - akt (ser473) (pakt), akt, and alpha - tubulin were purchased from cell signaling technologies (danvers, ma). They were detected with peroxidase - labeled goat anti - rabbit igg from pierce (rockford, il). Cells were washed in ice cold pbs before lysis in a buffer comprised of 40 mm mops ph 7, 4 mm egta, 10 mm edta with 2% triton x-100, containing protease and phosphatase inhibitors (30 mm sodium fluoride, 60 mm -glycerophosphate, 20 mm sodium pyrophosphate, 1 mm sodium orthovanadate, and 1% protease inhibitor cocktail, plus 1 mm phenylmethylsulfonylfluoride (pmsf), all from sigma . Supernatants were collected and protein contents were measured using the dc protein assay from biorad (hercules, ca). Samples were diluted in sds - page sample buffer and denatured for 5 min at 95c . Tris for nupage gels, invitrogen, electrophoresed, and then transferred on to nitrocellulose membranes . Membranes were blocked in tris - buffered saline with 0.1% tween 20 (tbs - t) with 5% (wt / vol) non - fat milk powder . Primary antibodies were diluted in tbs - t with 5% bsa and secondary antibodies were diluted in tbs - t with 5% non - fat milk . Immuno - reactivity was detected by supersignal west pico chemiluminescent substrate (thermo scientific, rockford, il) and exposed to film . Rna was isolated using an rneasy kit (qiagen, valencia, ca), following the manufacturer s protocol . Quantitative real - time pcr (rt - pcr) was performed using an applied biosystems 7900 ht fast real - time pcr system . The human taqman probe sets for myosin heavy chain, myh2 (hs00430042_m1), troponin t type 1, tnnt (hs00162848_m1), myocyte enhancer factor 2c, mef2c (hs00231149_m1), myogenic differentiation 1, myod (hs00159528_m1), myogenin, myog (hs01072232_m1), and beta-2 microglobulin, b2 m (#4333766f), were purchased from applied biosystems (wilmington, de). An adenovirus expressing gfp (adeno - gfp) was purchased from viraquest (north liberty, ia) (vqad cmv egfp titer: 5.0 10 pfu / ml). For infection of myotubes, undifferentiated cells were plated at 20,000 cells / cm into 96-well polystyrene cell culture plates and incubated overnight in growth medium and then switched to differentiation medium . After myotubes appeared (23 d), infection with adeno - gfp was performed . Several different ratios of viral particles to cells were tested (multiplicity of infection, or moi, of 100, 250, 500, 700, and 1,000). Infections were performed in growth medium and incubated with the cells overnight (18 h). The following morning, this medium was removed and replaced with fresh growth medium and the cells were cultured for an additional 6 h before switching back to differentiation medium for 48 h. the cells were then fixed for immuno - staining and visualization of gfp . For infection of undifferentiated cells, the cells were plated at 20,000 cells / cm in 96-well tissue culture plates and incubated for 24 h in growth medium . For infection, the same mois and procedure described above were utilized . In some cases, to observe the effects of infection on myotube differentiation, cells were returned to differentiation medium for 6 d after a 6 h recovery period in growth medium . Four different primary human muscle cell preparations from three different commercial vendors were screened for the ability to differentiate into multinucleated myotubes in cell culture . We tested human skeletal muscle myoblasts (hsmm; lonza), human skeletal muscle cells (skmc - l; lonza), human skeletal muscle - derived cells (skmdc; cook myosite), and human skeletal muscle cells (skmc - p; promocell). Initial experiments found that two of these preparations (skmc - l and skmc - p) showed little, if any, evidence of morphological differentiation into myotubes when cultured according to the recommendations of the suppliers . In addition, skmc - p grew very poorly as undifferentiated cells in growth medium . However, hsmm and skmdc demonstrated robust myotube differentiation, and could be readily cultured as undifferentiated cells in growth medium, using polystyrene cell culture plates . Thus, we focused on these two primary cell preparations for the remainder of our studies presented here . Hsmm were provided as a stock of myoblasts cryopreserved at passage 2 and characterized by the vendor to display greater than 60% desmin - positive cells at first passage out of cryopreservation . Skmdc were characterized as displaying 92% desmin - positive cells and a gene expression analysis provided by the vendor showed that these cells expressed several markers of muscle cell precursors such as pax3, pax7, myod1, myog, and myf5 . This marker analysis therefore suggests that the skmdc population is a committed myoblast cell population . For both hsmm and skmdc, the vendors recommend that these cell populations should be used for experiments at a population doubling (pd) less than 10 . In our initial studies, we evaluated cell growth and differentiation of cells through 15 pds . Skmdc had a pd time of 24 h for up to 45 passages, after which their doubling time slowed gradually until 15 pds were reached . Hsmm were slower to recover from cryopreservation compared to skmdc . For the first 5 d, their pd time was approximately 40 h, after which it decreased to 24 h for about 7 d and then increased to 48 h up to 15 pds . In general, above 10 pds, both cell types took longer to differentiate and their differentiation was not as robust, compared to cells at pd <10 (data not shown). For the studies described in this paper, we used cells that had undergone no more than 7 pd . Cells were also plated on several different extracellular matrix protein (ecm)-coated culture plates to assess their effect on cell growth and differentiation . The following human ecms were screened using millipore s millicoat ecm - coated strips: fibronectin, vitronectin, laminin, collagen type i, and collagen type iv . In addition, we also screened bd purecoat amine (bd biosciences, san jose, ca) and polystyrene plates coated in - house with 2% gelatin (sigma). No obvious improvement in cell growth or differentiation was detected with any of these matrices compared to regular tissue - culture treated polystyrene plates . Therefore, standard cell - culture grade polystyrene plates were used throughout these studies . Both hsmm and skmdc differentiated into myosin heavy chain (myh2)-positive multinucleated myotubes within 3 d when cultured on polystyrene cell culture plates in differentiation medium (fig . In general, the undifferentiated cells cultured in growth medium did not express myh2, although occasional myh2-positive cells were seen in growing cultures, possibly resulting from cell confluence associated contact - dependent cell differentiation (see skmdc in fig . 1a). To minimize this issue, care was taken to subculture growing cultures of cells before they became confluent . It was noted that the organization of nuclei within the myotubes was different between hsmm and skmdc . In hsmm myotubes, the nuclei tend to be arranged as singlets, or small groups, in linear arrays . In contrast, the nuclei in skmdc myotubes were often clustered together in large groups (fig . This difference may be caused by differences in the mechanisms of cell fusion during myotube generation, or by differences in the regulation of nuclear dynamics in the myotubes, or other unknown factors . To further characterize the differentiation process of hsmm and skmdc, rna was prepared from cells harvested on day 0 through day 6 of culture in differentiation medium . Gene expression analyses were performed using quantitative rt - pcr for various markers of muscle cell differentiation, (fig . Gene expression levels were normalized to beta-2 microglobulin (b2 m) expression levels in order to assess changes in relative expression . Myod and mef2c, transcription factors that play important roles in specifying the myogenic lineage, represent two early markers of myoblast differentiation into myotubes (megeney and rudnicki 1995; black and olson 1998; zammit et al ., there was a transient, modest upregulation of myod at day 1 (although it was statistically significant for hsmm only) which returned to baseline levels by day 2 . Mef2c was also upregulated by day 1 in both cell populations, reaching statistical significance by day 2, but unlike myod, the expression of this gene remained elevated throughout the 6-d culture period . Myogenin (myog), troponin t (tnnt), and myh2 represent late markers of muscle cell differentiation (burattini et al . Myog was upregulated approximately tenfold by day 1 of differentiation and that expression level remained significantly elevated from day 2 to day 6 of culture . Tnnt was significantly upregulated by day 1 of differentiation in hsmm and by day 2 of differentiation for skmdc . Tnnt expression remained at least tenfold upregulated through day 6 of differentiation in both cell populations . Myh2 was also expressed at least fivefold above control expression levels by day 1 of differentiation for hsmm and by day 2 of differentiation for skmdc . Then, myh2 expression reached greater than tenfold above control levels through day 6 of differentiation . Thus, hsmm and skmdc undergo morphological differentiation in culture into multinucleated myotubes and express characteristic molecular markers of muscle cell differentiation.figure 1.hsmm and skmdc differentiated into multinucleated myosin heavy chain-2 (myh2)-positive myotubes . (a) representative phase contrast and dark - field images of myh2-immunostained cells (green), with hoechst - labeled nuclei (blue) after 1 d in growth medium (phase contrast images) or 3 d in differentiation medium (dark - field images; magnification 10; scale bar = 100 microns). Plots show gene expression of early (myod, mef2c) and late (myog, tnnt, and myh2) muscle cell markers, normalized to b2 m gene expression, relative to expression levels at day 0 (time at which differentiation media was added to the cells); * p <0.05 vs. day 0 using student s t test . Hsmm and skmdc differentiated into multinucleated myosin heavy chain-2 (myh2)-positive myotubes . (a) representative phase contrast and dark - field images of myh2-immunostained cells (green), with hoechst - labeled nuclei (blue) after 1 d in growth medium (phase contrast images) or 3 d in differentiation medium (dark - field images; magnification 10; scale bar = 100 microns). Plots show gene expression of early (myod, mef2c) and late (myog, tnnt, and myh2) muscle cell markers, normalized to b2 m gene expression, relative to expression levels at day 0 (time at which differentiation media was added to the cells); * p <0.05 vs. day 0 using student s t test . Dexamethasone, a synthetic steroid, and myostatin, a growth factor which is a negative regulator of muscle mass, are well - characterized inducers of myotube atrophy, as shown for c2c12 myotubes (lee 2004; stitt et al . 2004). Also, c2c12 myotubes display a hypertrophic response following treatment with insulin - like growth factor-1 (igf-1; semsarian et al . Therefore, to examine the response of primary human skeletal muscle cell cultures to these factors, myotubes derived from hsmm and skmdc were treated with various concentrations of dex, mstn, or igf-1 for 48 h and then fixed and immuno - stained for myh2 . Representative images of untreated myotubes or those treated with mstn (1 g / ml) or dex (50 m) are shown in fig . 2a and with igf-1 (1 g / ml) are shown in fig . Hsmm and skmdc undergo an atrophy - like response to both mstn and dex treatment, while only hsmm display a hypertrophy - like response to igf-1 . (2010) and results were plotted as the percent decrease or increase in myotube area compared to untreated control cultures (fig . The plots show that mstn and dex induced statistically significant decreases in myotube area over untreated control cultures at all concentrations (except for the hsmm 250 ng / ml mstn - treated group which showed decreased myotube area but failed to reach statistical significance; fig . Quantification of igf-1 effects on both cell populations confirmed that only hsmm cultures responded with a hypertrophic response, with significant increases in myotube area at 100 and 1,000 ng / ml igf-1, (fig . 2c). Statistical significance, using student s t test was performed by comparing the total myotube area in multiple untreated cultures with the total myotube area in treated cultures and then assigning statistical significance (*) if p <0.05.figure 2.induction of atrophy and hypertrophy in hsmm and skmdc myotubes . (a) differentiated myotubes were treated with a concentration series of mstn or dex for 48 h. representative images of myh2/hoechst - labeled myotubes treated with 1 g / ml mstn or 50 m dex for 48 h. plots of the percent decrease, from untreated cells, in myotube area at each concentration of test agent are shown . (all plots represent means sem, n = 15 . * p <0.05 vs. untreated using student s t test . All images at 10 magnification; scale bar = 100 microns). (b) differentiated myotubes were treated with a concentration series of igf-1 for 48 h. representative images of myh2/hoechst - labeled myotubes following treatment with 1 g / ml insulin - like growth factor-1 (igf-1). Plots show the percent increase, from untreated cultures, in myotube area at each concentration of igf-1 . (all plots represent means sem, n = 15 . * p <0.05 vs. untreated using student s t test . All images at 10 magnification; scale bar = 100 microns). (c) western blots of myotube lysates from cultures treated with 1 g / ml mstn, 50 m dex, or 1 g / ml igf-1 for 48 h and probed with antibodies to phosphorylated- and total smad2 and phosphorylated- and total akt . (a) differentiated myotubes were treated with a concentration series of mstn or dex for 48 h. representative images of myh2/hoechst - labeled myotubes treated with 1 g / ml mstn or 50 m dex for 48 h. plots of the percent decrease, from untreated cells, in myotube area at each concentration of test agent are shown . (all plots represent means sem, n = 15 . * p <0.05 vs. untreated using student s t test . All images at 10 magnification; scale bar = 100 microns). (b) differentiated myotubes were treated with a concentration series of igf-1 for 48 h. representative images of myh2/hoechst - labeled myotubes following treatment with 1 g / ml insulin - like growth factor-1 (igf-1). Plots show the percent increase, from untreated cultures, in myotube area at each concentration of igf-1 . (all plots represent means sem, n = 15 . * p <0.05 vs. untreated using student s t test . All images at 10 magnification; scale bar = 100 microns). (c) western blots of myotube lysates from cultures treated with 1 g / ml mstn, 50 m dex, or 1 g / ml igf-1 for 48 h and probed with antibodies to phosphorylated- and total smad2 and phosphorylated- and total akt . Anti - alpha tubulin was used as a loading control . To examine the signaling pathways that were activated during these treatments, cell lysates were prepared at the end of the 48 h treatment period and then probed with antibodies to phosphorylated- and total smad2, and phosphorylated- and total akt, since these molecules are involved in the earliest stage responses to the mstn and igf-1 ligands (rebbapragada et al . The myostatin - receptor complex directly phosphorylates the signaling molecules smad2 and smad3, rebbrapragada et al . In addition, mstn reduced the level of phosphorylated - akt (pakt) in hsmm and skmdc (fig . 2c). Inhibition of akt phosphorylation is consistent with an atrophic response, since pakt activity is a known positive regulator of muscle protein synthesis and growth (duan et al . In contrast to myostatin, dex treatment induced downregulation of the control levels of psmad2 in skmdc (fig . Psmad2 was not detectable in untreated hsmm cultures, so it is unclear if dex affected psmad2 levels in these cultures . In our studies overall, these results suggest that at least for skmdc, mstn and dex operate through separate pathways to induce an atrophy - like response . Finally, igf-1 binding to its receptor is known to stimulate the phosphorylation of akt, which stimulates protein synthesis and cell growth (duan et al . Igf-1 treatment of skmdc, but not hsmm, increased pakt levels (fig . These results are puzzling since only hsmm, and not skmdc, showed a morphological response to igf-1, with a substantial increase in myotube area (fig . This could be due to the relatively high pakt levels in untreated hsmm compared to skmdc which may help prime the cells hypertrophic response to exogenous igf-1 . It is also possible that igf-1 acts through an akt - independent mechanism to induce a hypertrophy - like response in hsmm and is insufficient to cause such a response in skmdc . In addition to mstn and dex, the cytokine tnf - related weak inducer of apoptosis (tweak) has been reported to be a potent inducer of muscle atrophy (dogra et al . 2007a) and blocks the differentiation of c2c12 myoblasts into myotubes (dogra et al . 2006, 2007b). In our studies, treatment of hsmm and skmdc myotubes with tweak had no observable effects (data not shown). However, when added to the culture at the start of myotube differentiation, the differentiation of skmdc was completely blocked, while it had no effect on hsmm differentiation (fig . Expression of the tweak receptor, fn14, has been demonstrated on human muscle satellite cells (girgenrath et al . 2006), but it is possible that fn14 is not expressed by hsmm which would explain the absence of an effect of tweak in these cultures . We examined fn14 expression in both cell populations by real - time rt - pcr and found that it was expressed in both myoblasts and myotubes and showed no changes during differentiation (data not shown).figure 3.effect of tweak on hsmm and skmdc . Representative images of myh2/hoechst - labeled myotubes from cultures differentiated for 4 d in differentiation medium with tweak (1 g / ml). Representative images of myh2/hoechst - labeled myotubes from cultures differentiated for 4 d in differentiation medium with tweak (1 g / ml). As shown above, mstn induced an atrophy - like morphological response in both hsmm and skmdc where the myotubes showed a substantial decrease in size compared to untreated cultures (fig . We and others are working to target myostatin with inhibitors to block its negative regulation of muscle mass as a treatment for frailty . One such inhibitor consists of a fusion between the ligand - binding domain of actriib, the high affinity receptor for mstn, and the fc region of immunoglobulin g (actriib - fc). This molecule is a potent inhibitor of mstn activity in vivo (lee et al . 2005). To assess its activity in hsmm and skmdc, myotubes were treated with mstn in the presence of various concentrations of actriib - fc for 48 h. images of myh2-positive myotubes were captured and myotube areas were quantified as described above . As expected, the images showed that mstn alone induced a significant decrease in myotube area, and this atrophy - like response was blocked by actriib - fc in both cell populations (fig . The rescue of mstn - induced atrophy by actriib - fc was quantified and plotted as the percent change from untreated myotubes (fig . 50 g / ml actriib - fc induced a significant percent change in area compared to cells treated with mstn (1 g / ml) alone (0 g / ml actriib - fc). The plots demonstrated that actriib - fc blocked mstn - induced atrophy in these cultures, such that the myotube area was significantly different to that measured in cultures treated with mstn alone . At lower concentrations of actriib - fc, statistically significant effects were shown in skmdc cultures only, suggesting that these cells were more sensitive to the rescue effect . Thus, hsmm and skmdc may be used to identify and characterize inhibitors of myostatin activity.figure 4.actriib-fc (a myostatin inhibitor) blocks myostatin - induced atrophy in hsmm and skmdc . Myh2/hoechst - labeled myotubes differentiated for 3 d and then treated with 1 g / ml myostatin a dilution series of actriib - fc for 48 h. representative images of untreated myotubes and those treated with 1 g / ml mstn alone and 1 g / ml mstn + 50 g / ml actriib - fc . Plot shows the mean percent change in myotube area from untreated myotubes sem, n = 15, * p <0.05 vs 1 g / ml mstn using student s t test). Actriib - fc (a myostatin inhibitor) blocks myostatin - induced atrophy in hsmm and skmdc . Myh2/hoechst - labeled myotubes differentiated for 3 d and then treated with 1 g / ml myostatin a dilution series of actriib - fc for 48 h. representative images of untreated myotubes and those treated with 1 g / ml mstn alone and 1 g / ml mstn + 50 g / ml actriib - fc . Plot shows the mean percent change in myotube area from untreated myotubes sem, n = 15, * p <0.05 vs 1 g / ml mstn using student s t test). The ability to genetically manipulate cells in culture provides powerful tools for analysis . Lipid - mediated transfection reagents were largely ineffective (we estimated that <20% of the cells were transfected as assessed by the number of gfp - positive cells), although hsmm appeared to be slightly more susceptible to transfection by this method than skmdc (data not shown). In addition, we observed that most lipid transfection reagents significantly slowed down the differentiation of myotubes, requiring 6 d for full differentiation compared to 23 d for untreated cultures (data not shown). Similar results were obtained using electroporation methods with the undifferentiated cells (data not shown). To investigate an alternative method of gene delivery to hsmm and skmdc, myotubes were identified by staining with anti - myh2 and detected with alexa fluor 555 goat antimouse igg secondary antibody (red), while the infected cells were detected by gfp fluorescence (green). Infected myotubes were orange (red plus green), uninfected myotubes were red, and infected, undifferentiated cells were green . Although not quantified, it was noted that almost all the myotubes were orange . In addition, most of the undifferentiated (non - myotube) cells in the cultures were also successfully infected, displaying mostly gfp - positive cells (fig . Finally, undifferentiated cells were also effectively infected by the adenovirus, although the infection efficiency varied from experiment to experiment from 30% to 80%, quantified by visual inspection only (data not shown). However, infection of the undifferentiated cells slowed down myotube differentiation by about 34 d (data not shown). In general, adenoviral infection was found to be the most efficient method for gene delivery into both cell populations.figure 5.infection of hsmm and skmdc with adenovirus . Representative images of myh2/hoechst - labeled myotubes differentiated for 2 d and then infected with adeno - gfp at 500 moi . Myh2 stained red (not infected images) in this experiment and adeno - gfp is green . The overlap results in a yellow / orange color which demonstrates expression of gfp in myh2-positive myotubes (ad - gfp images). Representative images of myh2/hoechst - labeled myotubes differentiated for 2 d and then infected with adeno - gfp at 500 moi . Myh2 stained red (not infected images) in this experiment and adeno - gfp is green . The overlap results in a yellow / orange color which demonstrates expression of gfp in myh2-positive myotubes (ad - gfp images). These studies were performed to screen several commercially available sources of primary human skeletal myoblasts for their capacity to reproducibly differentiate into myotubes and respond appropriately to inducers of atrophy and hypertrophy . Out of the four cell types that were screened, only two demonstrated these features (hsmm from lonza and skmdc from cook myosite). Although hsmm and skmdc both differentiate into myotubes, we observed several marked differences between them . First, for hsmm there were notably fewer cell nuclei that were not incorporated into myotubes after culturing in differentiation medium compared to skmdc (see darkfield images in fig . 1). For example, although both cell populations were plated at the same density, differences in the rate of cell proliferation prior to the induction of differentiation could be responsible, as could different myoblast fusion efficiencies . Alternatively, greater cell death during the 3-d differentiation period in the hsmm cultures could cause this effect, or the unincorporated nuclei may represent another cell type that the skmdc can generate during differentiation . Second, as noted in the results, the organization of nuclei within the myotubes was different between hsmm and skmdc . For example, skmdc did not undergo a morphological hypertrophy response when treated with igf-1 while hsmm showed distinct increases in myotube size . These cells die when exposed to 100 m dex whereas hsmm do not (data not shown). The finding that dex had no effect on pakt levels in either cell population (see fig . 2c) was surprising because it has been shown that dex treatment reduced pakt levels in c2c12 myotubes (zhao et al . However, in those experiments, c2c12 myotubes were treated with only 100 nm dex overnight . In our studies, myotubes were treated with 50 m dex for 48 h. such culture conditions induced visible and quantifiable myotube atrophy, whereas 100 nm dex failed to induce a visible atrophy . It is possible that the absence of dex - regulated pakt levels in our studies may be due to the higher dex concentration and longer incubation time compared to previous studies with c2c12 myotubes, or that this is a novel feature of primary human skeletal muscle cells . Finally, the cytokine tweak inhibited the differentiation of skmdc but not hsmm (fig . 3) and had no effect on differentiated skmdc and hsmm myotubes (data not shown). Tweak has been shown to induce atrophy in differentiated c2c12 myotubes (dogra et al . 2007a) and prevent the differentiation of c2c12 myoblasts into myotubes (dogra et al . However, we are not aware that similar effects of tweak on primary human skeletal muscle cells have been examined . Our findings with tweak were not explained by the absence of the appropriate tweak receptor (fn14) on these cells, both as myoblasts and myotubes (data not shown). Therefore, we are unable to explain the absence of an effect of tweak on the differentiation of hsmm and the absence of tweak - induced atrophy in the myotubes derived from both cell populations at this time . It is possible that all of these differences may be due to the origins of the cells . Hsmm were derived from the quadriceps muscle of a young adult male (16 yr old) cadaver, while skmdc came from the rectus abdominus muscle of an older male (52 yr old) living donor . It is possible, even likely, that the precise characteristics of primary human skeletal muscle cells will be affected by numerous donor factors, such as age, gender, and general health . Thus, comparison of results from experiments using cells from different donors may be challenging . During our analyses, we noticed differences in the gene expression profile for myod and myog in both cell populations compared to what has been published for primary skeletal muscle cells (cornelison and wold 1997; zammit et al ., it was shown that myod expression is typical of a transcription factor with a rapid significant increase in expression upon commitment of satellite cells to the muscle lineage . This expression is then followed by rapid downregulation of expression, at the same time as myog expression is turned on . In our studies, we failed to demonstrate a significant upregulation of myod after 24 h of culture in differentiation medium . It is possible that myod was upregulated within 10 h and so we were measuring the down regulation of its expression at 24 h. it is also possible that both cell populations represent committed muscle precursors, which already express myod, so the fold change in expression upon switching to differentiation medium would be minimal . Indeed, the skmdc vendor (cook myosite) has shown that as myoblasts, these cells already express myod (janowski 2011). In our cultures, myog expression was maximal between 24 and 48 h in differentiation medium . Expression of myog has been shown as early as 10 h after switching to differentiation medium, with highest expression levels seen before 48 and 60 h in differentiation medium (bigot et al . It is possible that our cultures also upregulate myog expression at earlier time - points in differentiation medium, but we did not harvest rna at time - points earlier than 24 h. the prolonged expression profile of myog from the 24 h time - point in our cultures agrees with what has been shown for primary human muscle cells (bigot et al . We have identified two commercially available sources of primary human skeletal muscle cells that can reproducibly differentiate into multinucleated myotubes in culture . Myotube differentiation occurs rapidly upon shifting the cells into differentiation medium, within 23 d, and they express characteristic molecular markers of muscle differentiation . The myotubes derived from these cells can be induced to undergo morphological atrophy- and hypertrophy - like responses . We have also shown that the atrophy response can be blocked with a pharmacological inhibitor of myostatin, a known negative regulator of muscle mass . Finally, these myotubes can be efficiently infected with adenoviruses, providing a method for genetic modification . Such modifications would potentially allow adenoviral - shrna knock - down screens for muscle atrophy targets which could then be targeted for inhibition by small or large molecule compounds . Taken together, our results indicate that these primary human skeletal muscle cells may be a useful system for studying skeletal muscle cell differentiation and may also provide tools for studying new therapeutic molecules such as myostatin inhibitors.
|
Refractory status epilepticus (rse) is defined as seizures that are nonresponsive to adequate initial anti - epileptic therapy and require a continuous infusion of an antiepileptic medication or administration of inhalation anesthetic agent to stop the seizure activity . The care of children with rse is largely based on extrapolations of limited evidence derived from adult literature and supplemented with case reports and case series in children . The use of a pentobarbital infusion in the management of rse has shown to be associated with a high morbidity and mortality . The current study describes a single center experience of management of rse with the use of midazolam and pentobarbital . In this retrospective cohort study, children (age: 0 - 21 years) admitted to a tertiary - care pediatric intensive care unit with rse, over a 3-year period, were identified and included . Demographic and clinical data were collected from the hospital administrative database and electronic patient healthcare records . All children who continued to have either clinical or electrical seizure activity despite initial treatment with lorazepam, diazepam, phenytoin, and phenobarbital and required a continuous anti - epileptic medication infusion to control their seizure activity children who had recurrent seizures and required a continuous infusion of anti - epileptic medication were included . Patients who were admitted with status epilepticus and did not require a continuous infusion to control their seizures were excluded from the study . Patients who were transferred from an outside institution, intubated and on a benzodiazepine infusion, and whose seizures had terminated were also excluded . All children who receive pentobarbital were monitored with a continuous electroencephalogram (eeg) recording . Outcome of children who required continuous pentobarbital infusion to control rse were compared with those who were controlled with continuous benzodiazepine infusion alone . Continuous data were analyzed with the mann - whitney u test, and binary data were analyzed using fisher exact test . Of 28 admissions, 4 (14%) were admitted with new onset of seizures and all others had a known seizure disorder and were taking multiple antiepileptic medications . All children in this cohort received continuous infusion of a benzodiazepine (midazolam = 25; lorazepam = 4; both = 1) for seizure control . Eleven patients (39%) required pentobarbital infusion in addition to benzodiazepines to control seizures while others (61%) received only a benzodiazepine infusion . The mean maximum pentobarbital infusion dosage was 5.2 1.8 mg / kg / h with a median duration of treatment of 14 (interquartile range [iqr]: 12 - 76) days . Twenty - five patients received a continuous midazolam infusion with a mean maximum dosage of 0.41 0.43 mg / kg / h for a median duration of treatment of 4 (iqr: 1 - 16) days . Only one child died who did not receive pentobarbital and the death was not related to seizure management . Demographic, resource utilization, and complications of children with refractory status epilepticus were treated with and without pentobarbital all patients in our study received a benzodiazepine infusion as an initial anticonvulsant continuous therapy . Complications and resource utilization were less frequent in children whose seizures were controlled with only a benzodiazepine infusion . A meta - analysis of 111 children concluded that midazolam was as effective as other coma - inducing medications and involved a lower mortality (zero with midazolam), however, morrison noted that breakthrough seizure activity is common with midazolam . A standardized protocol for escalation or weaning of anti - epileptic infusion therapy was not utilized in our cohort . Pentobarbital infusion was titrated to achieve a burst suppression pattern during continuous video - eeg monitoring; the required degree of burst suppression (number of burst patterns per unit time) was not standardized . An aggressive step - wise approach to maximize benzodiazepine prior to initiating a pentobarbital infusion may have prevented some patients from requiring pentobarbital, thus limiting their complications . Developing a protocolized treatment plan similar to abend et al . May have been beneficial in limiting the side effects that we noted in our patients . Recent guidelines for the management of status epilepticus do not recommend preference to any one drug among midazolam, propofol, and pentobarbital for the management of rse . In a meta - analysis, pentobarbital treatment was associated with a lower incidence of short - term treatment failure, fewer breakthrough seizures, and decreased need for additional anti - epileptic medications, but was associated with a significantly higher frequency of hypotension as seen in our study . Studies of pentobarbital therapy for rse in children have reported an efficacy of 74 - 100% . The loading dose of pentobarbital is generally 5 mg / kg administered over an hour, followed by an infusion at a rate of 1 mg / kg / h, which can be increased as needed to 3 mg / kg / h . Continuous blood pressure monitoring is important because hypotension may occur with dose escalation . In our cohort, a loading pentobarbital bolus was used inconsistently, often requiring a higher continuous dose to achieve a therapeutic effect . Our study noted two unexpected complications associated with prolonged pentobarbital treatment: movement disorders that developed during weaning or after discontinuation of pentobarbital infusion therapy and hypertension, which required medical therapy . Low mortality in our cohort may be due to lower percent of new onset rse . However, children with a known seizure disorder presenting with rse had a low morality and their neurologic status did not worsen in spite of prolonged therapy with benzodiazepines with or without pentobarbital . Patients who required pentobarbital to control rse had a longer hospital stay with more complications . Whether aggressive escalation of midazolam therapy will reduce the use of pentobarbital and reduce complications warrants a prospective examination.
|
Treatment of cancer pain is one of the most important goals of palliative medicine . However, opioid drugs are the principal agents used to control pain in cancer patients [3 - 5]. If pain in patients with progressing cancer is worsened or constant, medical staff needs to recognize the necessity of increasing the analgesic dose of opioids . However, despite the world health organization (who)'s recommendation, the reality is that pain is not satisfactorily controlled in 30% to 50% of patients complaining of cancer pain . The most likely reason for not using sufficient analgesics is the fear of analgesic - induced adverse events or shortening of patients' life expectancy . The answer can be found in a study of end - stage patients receiving hospice treatment at home . With regard to life expectancy of cancer patients, as well as their demographics, clinical data, and especially their pathology, the study researched correlation with necessity of high - dose morphine administration . According to the results, use of a high - dose of morphine did not have an effect on shortening the life expectancy of patients and could be safely used as pain treatment . In general, strong opioid analgesics do not have a ceiling effect . Thus, clinicians can increase the dose without limit, if and when they determine that it is beneficial to control the pain . Combined use of opioid analgesics is not generally recommended in real practice, and this method of opioid analgesic use may be due to the fear of high - dose opioid analgesic use or is considered a sign of wrong clinical judgment . Although the baseline chronic pain is well controlled, some cancer patients suffer from transient exacerbation of pain, known as episodic or breakthrough pain . In general, breakthrough pain is managed by a search of the factors and removing them as much as possible, and short acting opioid drugs may be added to a regular opioid treatment . On the other hand, if sustained analgesic drugs cannot sustain efficacy, it can result in induction of breakthrough pain . This is known as end - of - dose failure (eod), which is one type of breakthrough pain . From clinical experience, results of a survey of patients with chronic pain provided clarification that eod of long - acting oxycodone is the primary reason that patients take more analgesic than recommended by the manufacturer . In a study of patients with chronic pain, who were taking long - acting oxycodone, methadone, or morphine, gallagher et al . Found that many patients were taking more analgesics than the recommended dose in their package inserts, and in addition, were taking a rescue opioid analgesic 3 to 4 times more that the recommendation, but still could not sufficiently control pain . Fentanyl matrix is a transdermal drug delivery system that provides continual delivery of fentanyl for 72 hours . The use of fentanyl matrix, if needed in higher dosages, is known to be effective in controlling pain in patients with chronic cancer pain . Therefore, in this study, we evaluated the effectiveness of a single dose escalation of the fentanyl matrix on pain control in patients whose pain was not sufficiently controlled with the use of previous analgesic in real practice via the investigator's discretion . The results of this study will strengthen the basis for clinical usefulness of the fentanyl matrix for controlling cancer pain . This multicenter, open - label, prospective, observational study was conducted at 30 sites in korea, from august 2008 to december at 2008 . The study protocol was approved by the institutional review board of each site, and the study was conducted in accordance with the korean requirement for execution of clinical trials, international conference on harmonisation good clinical practices guidelines, and decalaration of helsinki . The study population included patients who visited study center during the study period with a complaint of cancer pain and were receiving a monotherapy or combination therapy of sustained - release oral strong opioid analgesics, but failed to control pain sufficiently and needed an increase in their dose of the fentanyl matrix via the investigator's discretion . In order to participate in this study, subjects were required to satisfy the following criteria: 1) patients aged 20 years or older; 2) patients complaining of pain with a score of 4 or more on the numeric rating scale (nrs), requiring administration of opioid analgesic; 3) patients who were not satisfied with pain control despite a monotherapy of a sustained - release oral strong opioid analgesic or combination therapy of a sustained - release oral strong opioid analgesic and fentanyl matrix; and 4) patients who signed the informed consent form . On the first visit day (visit 1), we changed the previous opioid drug to fentanyl patch of equivalent dose . Demographic data, patients' primary tumor, metastasis, and stage, as well as other disease characteristics, such as previous analgesics including name, dosage, pain intensity, frequency of eod, and degree of sleep disturbance were documented . Sleep disturbance was described according to the nrs from 0 (not disturbing at all) to 10 (very disturbing). Over a period of approximately one month, we adjusted the patients' daily dose of fentanyl matrix depending according their pain control by national comprehensive cancer network (nccn) guidelines . On visit 2 (day 297), any adverse events that the subject had experienced since visit 1 were recorded . In addition, pain intensity applied the fentanyl patch dosage, frequency of eod, and degree of sleep disturbance and evaluated the effectiveness of the study drug in patients during the study period according to the investigator's judgment (investigator's global assessment) and patient's judgment (patient's global assessment), and how the patients' condition was improving, compared to visit 1 (clinical global impression - improvement [cgi - i]) (fig . The primary objective of the study was to demonstrate the clinical usefulness of the fentanyl matrix by measuring its pain control effects after an increase of a single dose of fentanyl matrix in patients whose pain was not sufficiently controlled with the use of previous analgesic in real practice via the investigator's discretion . The secondary objective was to observe improvement in the following variables after treatment with fentanyl matrix: sleep disturbance caused by pain, investigator's and patient's global assessment, patient's satisfaction, and cgi - i . T - test, wilcoxon rank - sum test, and chi - square test were used for testing the statistical differences in demographic data and health condition . Differences between before and after administration of the study drug were tested using a paired t - test, wilcoxon signed rank test, wilcoxon rank - sum test, chi - square test, and etc . According to the characters of endpoints . Therefore, a total of 404 patients completed the study . Characteristics of patients are shown in table 1 . Of the 452 enrolled patients, the principal primary diagnosis was lung cancer (24.3%), colorectal (11.7%), and pancreas (11.7%). The majority of these patients were stage iv (85%); 46% of patients kept pace with cancer treatment: chemotherapy (84%) and radiotherapy (11%). The mean pain intensity at the first visit was 5.27 (1.953), and 3.37 (1.986) at the second visit day . A significant difference was observed in pain intensity between the first and second visits (p<0.001) (fig . In addition, we evaluated sleep disturbance of pain according to the scale (not disturbing at all in 0, very disturbing in 10). Sleep disturbance scale for the first visit was 3.69 and for the second visit was 2.55 . The percentage of patients who woke up one or more times decreased from the first to the second visit (71.5% vs. 59.9%). The prevalence of patients who experienced an eod at the first visit was 73% of the 452 enrolled patients . The oxycodon medication group accounted for the largest portion of patients who experienced the eod (65%). The oxycodone with the fentanyl patch group and the morphin controlled release (cr)-treated group accounted for 26.9% and 6.5% of patients, respectively, who experienced an eod . The oxycodon or oxycodone combination group showed a larger portion of eod than the morphin or morphin combination group (approximately 70% vs. 50%). At the second visit pain intensity in patients with eod was 5.64, in patients without eod was 4.27 at the first visit; the difference was statistically significant (p<0.01). On the second visit, pain intensity in patients with eod and without eod was 4.02 and 2.54 (fig . The sleep disturbance scale was 4.15 in patients with eod at the first visit, and 2.43 in patients without eod (fig . Patients with eod had less satisfaction with pain control than patients without eod (satisfaction rate 9.4% vs. 32.8%), and it was statistically significant (p<0.01). The mean initial dose of fentanyl matrix was 45 mcg / day (range, 12 to 350 mcg / day) on the first visit . On the second visit, of the 404 completed patients, a mean dose of fentanyl matrix was 55.6 mcg / day (range, 12 to 625 mcg / day). The number of patients who increased the dose of fentanyl patch was 93; otherwise, the number of patients decreased dose of fentanyl patch was 6 . A statistician rate of investigator's global assessment was 66.0%, and that of the patients' global assessment was 63% (fig . Of the 404 patients, 64 patients (14.2%) reported adverse events (aes), the most frequent aes of associated drugs included nausea, asthenia, constipation, and diarrhea (table 2). Other saes included another cancer occurrence and neutropenia, also not related to the fentanyl patch . Therefore, a total of 404 patients completed the study . Characteristics of patients are shown in table 1 . Of the 452 enrolled patients, the principal primary diagnosis was lung cancer (24.3%), colorectal (11.7%), and pancreas (11.7%). The majority of these patients were stage iv (85%); 46% of patients kept pace with cancer treatment: chemotherapy (84%) and radiotherapy (11%). The mean pain intensity at the first visit was 5.27 (1.953), and 3.37 (1.986) at the second visit day . A significant difference was observed in pain intensity between the first and second visits (p<0.001) (fig . In addition, we evaluated sleep disturbance of pain according to the scale (not disturbing at all in 0, very disturbing in 10). Sleep disturbance scale for the first visit was 3.69 and for the second visit was 2.55 the percentage of patients who woke up one or more times decreased from the first to the second visit (71.5% vs. 59.9%). The prevalence of patients who experienced an eod at the first visit was 73% of the 452 enrolled patients . The oxycodon medication group accounted for the largest portion of patients who experienced the eod (65%). The oxycodone with the fentanyl patch group and the morphin controlled release (cr)-treated group accounted for 26.9% and 6.5% of patients, respectively, who experienced an eod . The oxycodon or oxycodone combination group showed a larger portion of eod than the morphin or morphin combination group (approximately 70% vs. 50%). At the second visit, pain intensity in patients with eod was 5.64, in patients without eod was 4.27 at the first visit; the difference was statistically significant (p<0.01). On the second visit, pain intensity in patients with eod and without eod was 4.02 and 2.54 (fig . The sleep disturbance scale was 4.15 in patients with eod at the first visit, and 2.43 in patients without eod (fig . Patients with eod had less satisfaction with pain control than patients without eod (satisfaction rate 9.4% vs. 32.8%), and it was statistically significant (p<0.01). The mean initial dose of fentanyl matrix was 45 mcg / day (range, 12 to 350 mcg / day) on the first visit . On the second visit, of the 404 completed patients, a mean dose of fentanyl matrix was 55.6 mcg / day (range, 12 to 625 mcg / day). The number of patients who increased the dose of fentanyl patch was 93; otherwise, the number of patients decreased dose of fentanyl patch was 6 . A statistician rate of investigator's global assessment was 66.0%, and that of the patients' global assessment was 63% (fig . Of the 404 patients, 64 patients (14.2%) reported adverse events (aes), the most frequent aes of associated drugs included nausea, asthenia, constipation, and diarrhea (table 2). Other saes included another cancer occurrence and neutropenia, also not related to the fentanyl patch . Since the who cancer treatment guidelines were announced (1986), pain management for cancer patients has shown steady progress . Many opioid drugs have been developed, and adequate relief of cancer - related pain has been reported in 70 - 97% of cancer patients [17 - 20]. Some studies have reported that although analgesics were administered at the physician's discretion, many patients felt pain prior to the next dose of medication (that is eod). Investigated the frequency of sustainedrelease opioid dosing in patients with chronic benign pain: dosing more frequently than every 12 hours was documented in 70.6% and 86.8% of morphin cr - treated and oxycodon treated patients, respectively . However, only 23.9% of patients in the transdermal fentanyl patch - wearing group were self - medicated every 48 hours, rather than every 72 hours . According to the results of another study conducted for investigation of dosing frequency of sustained - release opioids in patients with chronic, nonmalignant pain, 91% of oxycodone cr - treated patients, 86% of morphin cr - treated patients, and 50% of fentanyl patch - treated patients were self - medicated more frequently than the manufacturer's recommendation . Regarding chronic malignant cancer pain, another group recently conducted a survey of dosing frequency of oral sustained - release opioids or transdermal fentanyl; 26.2% of oral sustained - release oral opioid patients took their medication more than twice per day, and 11.2% of fentanyl patch wearing patients wore the patch every 48 hours, rather than 72 hours . The results of these surveys suggest that despite controlling pain using opioid drugs, many patients felt pain, and especially complained of eod, also, suggesting that eod caused an increase in dosing frequency, and patients treated with the fentanyl patch had lower incidence of eod than those treated with an oral opioid drug . Therefore, we thought that the fentanyl patch may be helpful in the management of uncontrolled cancer - related pain . Thus, we evaluated the effectiveness of fentanyl matrix in patients whose pain was not sufficiently controlled by investigating the pain intensity, frequency of eod, degree of sleep disturbance, and degree of satisfaction with pain control after the use of fentanyl patch . Our data indicate that the fentanyl patch was effective for the management of patients with uncontrolled cancer - related pain via a statistically significant reduction of pain intensity . Also, in our study, the rate of patients who experienced eod was 73% with administration of oral opioid or oral combination of opioid and fentanyl . Patients who experienced end - of dose failure were intended to have score higher on the pain intensity scale (5.64 vs. 4.27) and sleep disturbance scale (4.15 vs. 2.43) than patients without eod . Therefore, the results of our study suggests that eod may have an association with the quality of life, and thus, decreasing eod is helpful to supportive care of cancer patients . After the use of fentanyl patch, the eod rate appeared to diminish (73% to 56.2%), and pain intensity showed a significant decrease, from 5.27 to 3.37 . These facts suggest that the fentanyl patch may be effective, and can be considered as another option for treatment of poorly controlled cancerrelated pain . The satisfaction rate of investigator's global assessment was 66.0%, and that of the patients' global assessment was 63% . The rate of pain improvement was 33.7% by cgi - i . According to the results described above, the use of fentanyl patch may result in a decrease in eod and pain intensity, as well as an increase in the rate of satisfaction with pain control . This fact, that satisfaction rate increases after the use of fentanyl patch, suggests that the fentanyl patch may be helpful in enhancing the quality of life . The observed adverse events associated with the use of fentanyl patch were mainly nausea, asthenia, constipation, and diarrhea . However, the side effects were not much different from the use of an opioid with use of an opioid, and were manageable . We concluded that the fentanyl patch is a useful treatment option in patients with insufficient pain control . However, our study was limited due to its open - label, observational design . Therefore, a future double - blinded randomized trial to evaluate the effectiveness of the fentanyl patch is warranted . The results of this study suggest that the fentanyl patch may be an effective drug for controlling cancer - related pain in patients whose pain was previously not controlled sufficiently with morphine only or morphine combination . In addition, the fentanyl patch may be helpful in reducing eod with an improvement of quality of life.
|
The serum anion gap is a helpful parameter in the clinical diagnosis of various conditions . The commonest application of the anion gap is to classify cases of metabolic acidosis into those that do and those that do not have unmeasured anions in the plasma (table 1). In this article, we briefly review the significance of the anion gap and the approach to the use of the serum anion gap . As charge balance precluded the existence of any gaps, the more accurate term should really be' difference between unmeasured anions and unmeasured cations' which obviously lacks the brevity requisite for practical communication . Clinically, anion gap is equal to the difference between the plasma concentrations of the major cation (na) and the major measured anions (cl+hco3). It is important to understand that this entity actually equals [anionic proteins+inorganic phosphate+sulphate+organic anions]-[potassium+calcium+magnesium+cationic proteins] (fig . Since there are more unmeasured anions than unmeasured cations, the value of anion gap is usually positive . Meq / l, when sodium was determined by flame photometry (based on the principle of flame atomic emission spectrometry) and chloride by a colorimetric assay (mercuric - nitrate - thiocyanate colorimetric assay). Since the 1980s, ion - selective electrodes for specific ionic species were used for the measurement of serum electrolytes . The difference between the ionic concentration in the electrode (known) and the sample creates an electrical potential (measured) and the sample ionic concentration the measurement by ion - selective electrodes has caused a shift of the anion gap from 124 meq / l down 63 meq / l2). It is worthy for clinicians to understand the range of normal anion gap and the measuring methods for serum sodium and chloride in the laboratories that support their practice . It is important because an increased anion gap usually is caused by an increase in unmeasured anions, and that most commonly occurs when there is an increase in unmeasured organic acids, that is, an acidosis3, 4). Acids (eg, lactate and pyruvate) are protons donors and must be buffered by bicarbonate . The consumption of bicarbonate by the unmeasured anions will increase the anion gap by lowering the serum bicarbonate level . The total numbers of anions and cations are still equal, but the gap is increased because of a lowering of a measured anion, serum bicarbonate . The most common ones can be remembered by the mnemonic mudpiles: methanol, metformin, uremia, diabetic ketoacidosis, ethylene glycol, salicylates and starvation5, 6). These conditions produce an acid load that consumes bicarbonate, increases the anion gap, and lowers serum ph . If the patient is acidotic and has an elevated anion gap, it is almost certainly caused by one of these conditions, each one with us characteristic signs, symptoms, and laboratory values . Whereas the presence for a high anion gap educes the consideration of a differential diagnosis by reflex in daily clinical practice, a low anion gap often does not elicit the same warning to clinicians and hence often remains either undiscovered or neglected . The classical differential diagnosis of a low anion gap has changed since the ion - selective electrode has been introduced . First, it can be an early and sometimes only sign of an underlying disease process such as paraproteinemia . In addition to displacement of sodium - containing water from serum by large amounts of non - sodium - containing paraproteins, some paraproteins (eg, igg in multiple myeloma) can have a net positive charge at physiological ph . This leads to an increase in unmeasured cations and a low anion gap7, 8). Concomitant severe hypercalcemia and hypoalbuminemia are often contributing factors to a low anion gap in multiple myeloma9). Since the only cation included in the anion gap calculation is sodium, severe hyperkalemia, hypercalcemia, hypermagnesemia or lithium intoxication theoretically can also lead to a significantly decreased anion gap . Second, at normal serum ph of 7.4, the majority of plasma proteins are anionic . Albumin with an average negative charge of 18 per mole at physiological ph has been shown to be responsible for approximately 75% of the unmeasured anions of the normal anion gap . A drop in albumin by 10 g / l therefore will cause the anion gap to fall by approximately 2.5 meq / l at constant ph10, 11). Third, a low anion gap can mask an underlying high anion gap acidosis and potentially delay intervention . While an increase in the anion gap is almost always caused by retained unmeasured anions, a decrease in the anion gap can be generated by multiple mechanisms . In this short review, emphasis is placed on the fact that the serum anion gap is the difference between the unmeasured anions and the unmeasured cations, and any numerical analysis of this entity needs to take this equation into consideration . By exploring all the possible factors that can influence unmeasured cations and unmeasured anions it is advisable for the clinician to know the normal range of the anion gap and the assays used in measuring na and cl in the laboratories supporting their practice.
|
It was estimated that there were 1,500,000 new cancer cases and approximately 560,000 deaths out of cancer in 2009 . Chemotherapy is an important treatment option for patients with cancer, however chemotherapy drugs suffer from numerous problems including nonspecific uptake by healthy tissue, poor circulation times, and suboptimal accumulation in the tumor . Often, a large percentage of cytotoxic drug administered to the patient does not reach the tumor environment, but rather is distributed throughout the body, resulting in the many toxic effects associated with chemotherapy and a narrowing of the drug's therapeutic window . The delivery of chemotherapeutic drugs to tumors is still a major hurdle in the eradication of cancer, and the continual development of drug delivery technologies is vital to future breakthroughs in chemotherapy . Polymer micelles offer a promising approach to achieving these goals due to their inherent ability to overcome multiple biological barriers, such as avoidance of the reticuloendothelial system (res). Due to their unique size range (20150 nm), micelles are able to avoid renal clearance (typically less than 20 nm) and uptake by the liver and spleen (particles greater than 150 nm). These micelles can also preferentially accumulate in solid tumors via the enhanced permeation and retention (epr) effect [3, 4]. The epr effect is a consequence of the disorganized nature of the tumor vasculature, which results in increased permeability of polymer therapeutics and drug retention at the tumor site . Due to these promising aspects, a number of groups have developed various polymer micelle motifs, encapsulating a wide range of therapeutic classes [517]. Colon cancer is the third most common cancer in men and women in most of the developed world . Irinotecan, a topoisomerase i inhibitor, is approved in the clinic for colorectal cancer first - line therapy in combination with 5-fluorouracil / leucovorin / oxaliplatin (folfox) regimen or for monotherapy in second - line therapy following a failed folfox regimen . Sn-38, the active metabolite of irinotecan, is about 5001000 times more cytotoxic than irinotecan [1820]. Although irinotecan has demonstrated clinical utility, it is highly inefficient in delivering active sn-38 to tumor tissue . Studies in humans have shown that only three to four percent of the administered irinotecan is actually converted to sn-38, which is reliant upon activating carboxylesterase enzymes localized in the liver and gastrointestinal tract . In addition, up to 95% of sn-38 is bound to circulating proteins such as albumin, which drastically reduces its bioavailability . Irinotecan treatment also is accompanied by dose - limiting toxicities of grade 3 and 4 diarrhea and neutropenia . These limitations of irinotecan result in poor exposure of sn-38 to the tumor environment and severe side effects in the patient . A major limitation, however, of free sn-38 is that it is hydrophobic and is unable to be used as a free drug in the clinic . Several groups have addressed the solubility problem of sn-38 by covalently attaching sn-38 to a polymer or peptide [2426]. In particular, a polymeric micellar formulation of sn-38 based on peo - poly (glutamic acid) block copolymers through chemical conjugation of sn-38 to the free carboxyl groups present on the poly (glutamic acid) backbone has been developed . This formulation, known as nk012, as well as a peglyated sn-38 formulation (ezn-2208), is currently in clinical trials [27, 28]. While polymer - drug conjugates effectively address solubility of hydrophobic drugs, this prodrug approach is dependent on enzymatic or chemical cleavage of the bond to release the active drug . To develop an encapsulated formulation of sn-38, sn-38 was loaded into a polymer micelle, resulting in aqueous solubility of sn-38 without modification of the drug . This polymer micelle (termed it-141) was evaluated for pharmacokinetics and antitumor activity compared to irinotecan . The data reported herein support it-141 as a promising new antineoplastic agent for the treatment of colorectal cancer . Azido - poly(ethylene glycol)-t - butyl carbonate - amine (n3-peg - nh - boc) was prepared as described previously . N - carboxy anhydrides (ncas) were prepared according to previously published procedures [30, 31]. N3-peg12k - nh - boc (150 g, 12.5 mmol) was dissolved into 1 l of ch2cl2/difluoracetic acid (dfa) (70/30) and was allowed to stir at room temperature overnight . The product was precipitated twice in diethyl ether and was recovered as a white powder (yield 90%): h nmr (d6-dmso) 7.77 (3h), 5.97 (1h), 3.833.21 (1050 h), 2.98 (2h) ppm . N3-peg10k - nh3/dfa (95 g, 7.92 mmol) was weighed into an oven - dried, 2 l - round - bottom flask and was left under vacuum for three hours before adding the nca . Asp(obu) nca (17.04 g, 79.2 mmol) was added to the flask; the flask was evacuated under reduced pressure, and subsequently backfilled with nitrogen gas . Dry n - methylpyrrolidone (nmp) (560 ml) was introduced by cannula, and the solution was heated to 60c . The reaction mixture was allowed to stir for 24 hours at 60c under nitrogen gas . Then, d - leu nca (24.88 g, 158 mmol) and tyr (obzl) nca (47.08 g, 158 mmol) were dissolved under nitrogen gas into 360 ml of nmp into an oven - dried, round bottom flask, and the mixture was subsequently added to the polymerization reaction via a syringe . The solution was allowed to stir at 60c for another three days at which point the reaction was complete (as determined by hplc). The solution was cooled to room temperature, and diisopropylethylamine (dipea) (10 ml), dimethylaminopyridine (dmap) (100 mg), and acetic anhydride (10 ml) were added . The polymer was precipitated into diethyl ether (10 l) and isolated by filtration . The solid was redissolved in dichloromethane (500 ml) and precipitated into diethyl ether (10 l). The product was isolated by filtration and dried in vacuo to give the block copolymer as an off - white powder (134.6 g, yield = 73%): h nmr (d6-dmso) 8.437.62 (50h), 7.35 (100h), 7.1 (40h), 6.82 (40h), 4.96 (40h), 4.633.99 (50h), 3.743.2 (1500h), 3.062.6 (60h), 1.36 (90h), 1.270.47 (180). N3-peg12 k - b - poly(asp(obu)10)-b - poly(tyr(obzl)20-co - d - leu20)-ac (134.6 g, 6.4 mmol) was dissolved into 1000 ml of a solution of pentamethylbenzene (pmb, 0.5 m) in trifluoroacetic acid (tfa). The solution was precipitated into a 10-fold excess of diethyl ether, and the solid was recovered by filtration . The polymer was redissolved into 800 ml of dichloromethane and precipitated into diethyl ether . An off - white polymer was obtained after drying the product overnight in vacuo (111.8 g, yield = 93%): h nmr (d6-dmso) 12.2 (10h), 9.1 (10h), 8.517.71 (50h), 6.96 (40h), 6.59 (40h), 4.693.96 (60h), 3.813.25 (1500h), 3.062.65 (60h), 1.00.43 (180). H nmr (d6-dmso) 171.9, 171, 170.5, 170.3, 155.9, 130.6, 129.6, 127.9 115.3, 114.3, 70.7, 69.8, 54.5, 51.5, 50, 49.8, 49.4, 36.9, 36, 24.3, 23.3, 22.3, 21.2 . Ir (atr) 3290, 2882, 1733, 1658, 1342, 1102, 962 cm . Sn-38-loaded micelles were prepared by dissolving 1 g of itp-101 in 200 ml of water and 100 mg of sn-38 in 8 ml of methanol and 16 ml of toluene . The water was mixed with a silverson lt4r shear mixer at 10,000 rpm at 4c, and the organic solution was added dropwise . The solution was mixed for 30 minutes, then the resulting emulsion gently stirred on a magnetic stir plate overnight, allowing the toluene to evaporate . The sn-38-loaded micelle solution was filtered through a 0.22 m pes filter, then lyophilized to give a slightly yellow powder . The hplc instrumentation consisted of a waters alliance separation module (w2695) equipped with a lichrosphere select b (5 m), 250 4.6 mm column coupled with a waters multi - wavelength fluorescence detector (w2475) with excitation at 355 nm and emission at 515 nm . Mobile phase consisted of a 70: 30 phosphate buffer (10 mm nah2po4, 0.1% tea, ph 3.5)/acetonitrile . Flow rate was isocratic at 0.8 ml / min . Elution time for sn-38 was determined to be 11.6 minutes, while camptothecin internal standard was 4.2 minutes . Particle sizes were determined using dynamic light scattering on a wyatt dynapro (santa barbara, calif). Micelle solutions were prepared at 1 mg / ml in filtered water and were centrifuged at 2,000 rpm to remove any dust prior to analysis . All cells were purchased from american type tissue collection (atcc) and maintained in the following media: rpmi 1640 with 10% fbs, 2 mm l - glutamine, and 100 units / ml penicillin / streptomycin (lncap, pc-3, mg-63, bxpc-3, mcf-7, and bt-474), dmem with 10% fbs, 2 mm l - glutamine and 100 units / ml penicillin / streptomycin (mda - mb-453, mda - mb-231), f12k with 10% fbs, 2 mm l - glutamine and 100 units / ml penicillin / streptomycin (a549), and mccoy's 5a with 10% fbs, 2 mm l - glutamine, and 100 units / ml penicillin / streptomycin (ht-29 and hct116). All media, fbs, and supplements were purchased from mediatech (manassas, va) or hyclone . Female athymic nude mice weighing about 2025 g were obtained from charles river laboratories (wilmington, mass). For assessing cytotoxicity, cancer cell lines the following day, when the cells were 50% confluent, the cells were treated with it-141, free sn-38, or irinotecan in complete growth medium . The drugs remained on the cells for 72 hours without media change . At this timepoint, cell viability was determined using the cell titer glo kit and measured using a luminescent plate reader (bmg labtech, cary, nc). Ht-29 cells were subcutaneously injected into the right flank of nude mice at a concentration of 5 million in 0.1 ml pbs . When the tumors were approximately 300 mm, mice were randomly divided into two groups of eight and injected with 30 mg / kg (sn-38-equivalent) of it-141 or 30 mg / kg irinotecan . Injection occurred by a fast iv bolus into the tail vein in a volume of 0.2 ml . The delivery vehicle for it-141 was isotonic saline and acidified (ph 3.5) isotonic saline for irinotecan . Mouse blood was collected at timepoints of 5 minutes, 15 minutes, 1 hour, 4 hours, 12 hours, 24 hours, and 72 hours . Plasma was processed for hplc analysis by protein precipitation in ice - cold, acidified methanol (10% perchloric acid / methanol) with 100 ng / ml camptothecin as internal standard, at a ratio of 1: 4 plasma to methanol . Tumors were homogenized in 20 mm ammonium acetate, ph 3.5 and extracted in acidified methanol as described above . Samples were vortexed for 10 minutes, centrifuged at 13,000 rpm for 10 minutes, and the supernatant was transferred to hplc vials for analysis . Ht-29 cells were subcutaneously injected into the right flank of nude mice at a concentration of 5 million in 0.1 ml pbs . When the tumors were approximately 300 mm, mice were given both single and multidose (q4d 3, day 0, 4, 8) intravenous injections of it-141 at doses ranging from 1090 mg / kg . The mtd was defined as a dose that caused no greater than a 10% loss in body weight and no treatment - related deaths . Ht-29 and hct-116 colon cancer cells were harvested and resuspended in sterile pbs at a concentration of 2 million (ht-29) or 4 million (hct-116) cells per 0.1 ml pbs and injected subcutaneously into the right flank of athymic nude mice . Tumors were allowed to establish logarithmic growth (714 days), and the animals were randomly divided into six to eight mice per group . Drug was administered by a fast bolus injection of 0.2 ml into the mouse tail vein on a schedule of q4d 3 . Tumor volume was calculated according to the formula: v = (short diameter)(long diameter)/2 . Percent inhibition was calculated using the following formula: (1)100vgroupvgroup 0vctlvctl 0100, where vgroup is the tumor volume on the final day of the study, vgroup 0 is the tumor volume of the group on day 0, vctl is the tumor volume of the control group on the final day of the study, and vctl 0 is the tumor volume of the control group on day 0 . Tumor regression was calculated using the following formula: (2) vgroup 0vgroup100100, where vgroup is the tumor volume on the final day of the study and vgroup 0 is the tumor volume of the group on day 0 . Statistical differences in tumor volume between groups were calculated using the student's t - test using microsoft excel, whereby p <0.05 was considered statistically significant . Itp-101 is a triblock copolymer consisting of poly(ethylene glycol)-b - poly(aspartic acid)-b - poly(d - leucine - co - tyrosine). The hydrophobic amino acids provide a core region into which a hydrophobic drug can reside, and the amphiphilic peg block forms a protective corona around the micelle, giving the delivery system stealth - like properties to avoid protein opsonization and res uptake (figure 1). The use of both d and l stereoisomers of amino acids in the leucine / tyrosine core block disrupts the secondary structure of the polypeptide . Replacing the rodlike helical nature of the polypeptide with the flexibility of a random coil the middle aspartic acid block allows for a hydrogen - bonding segment which can be further stabilized with the use of metal ions, an aspect that is not utilized for it-141 . It-141 was formulated using itp-101 with various concentrations of sn-38, ranging from 1 to 14% (w / w), achieving greater than 90% loading efficiency . Formulations of it-141 reconstituted in water or saline resulted in a homogeneous solution free of precipitate for up to four days at room temperature, and the lyophilized powder is stable for months . Following formulation, the aqueous solubility of sn-38 in it-141 was 30 mg / ml, which is about a 6,000-fold increase in solubility of sn-38 . . Dynamic light scattering (dls) experiments demonstrated that the micelle size was approximately 130 nm, with a standard deviation of 6 nm . Thus, the average size of it-141 falls within the desired range to avoid renal clearance (above 20 nm) and escape uptake by the res (below 150 nm). Zeta potential measurements from electrophoretic light scattering experiments demonstrated that the surface charge of the micelle is overall neutral, with a range of readings from 5 to 5 mv . The sensitivity of various cancer cell lines to free sn-38, it-141, and irinotecan was compared in a cytotoxicity assay . As shown in table 1, both free sn-38 and it-141 were extremely potent, and the sensitivity of the cells to it-141 was similar to free sn-38 across the cell lines . Certain cell lines (pc-3, mda - mb-231, and bt-474) were insensitive to both free sn-38 and it-141 . To determine the mtd of it-141, ht-29 tumor - bearing nude mice were given both single and multidose (q4d 3) intravenous injections of it-141 . These studies demonstrated that the multidose mtd of it-141 in tumor - bearing animals was 45 mg / kg and single dose mtd was 60 mg / kg . Using 30 mg / kg of it-141 as a safe dose, the pharmacokinetic (pk) profile and tumor accumulation of sn-38 delivered from it-141 then compared to irinotecan in nude mice bearing ht-29 tumors (table 2). Mice receiving a single injection of 30 mg / kg it-141 achieved a significant improvement in sn-38 plasma concentration and exposure compared to 30 mg / kg of irinotecan (figure 2(a), table 2). The cmax for both groups was achieved by the first measured time point of 5 minutes, with> 200-fold higher sn-38 concentration in mice treated with it-141 (209 g / ml) compared to irinotecan (1.0 g / ml). Sn-38 exposure as measured by area under curve (auc) from irinotecan was 2.5 ghr / ml, while sn-38 exposure from it-141 was 13.8-fold greater at 34.6 ghr / ml . No data could be obtained for irinotecan plasma concentrations beyond 12 hours as the concentration fell below the limit of detection . The concentration of sn-38 in the tumor over time is plotted in figure 2(b). The tumor auc of it-141 was determined to be 16.4 gh / g, which was significantly higher than irinotecan at 1.9 gh / g . It-141 also had a 47-fold higher cmax in the tumor than irinotecan (9.4 g / ml versus 0.2 g / ml). Based on the pharmacokinetic data, it was hypothesized that it-141 would show superior antitumor efficacy in colon cancer xenograft models compared to irinotecan . To test the antitumor efficacy of it-141, ht-29 tumor - bearing mice were treated with either itp-101 alone at 300 mg / kg, irinotecan at 60 mg / kg, or it-141 at 30 mg / kg (figure 3(a)). Treatment with irinotecan at 60 mg / kg, which is near its mtd on this dosing schedule, did not inhibit ht-29 tumor growth significantly compared to polymer alone [26, 32]. However, treatment with it-141 at half the dose of irinotecan induced significant tumor regression by day 18, ultimately resulting in complete inhibition of tumor growth compared to itp-101 control and 35% regression from initial tumor volume (p = 0.002). Dose - ranging studies were then performed to determine if the antitumor efficacy of it-141 is dose dependent (figure 3(b)). Ht-29 tumor - bearing mice were intravenously administered it-141 at doses of 1, 5, 10, 15, 30, and 45 mg / kg via tail vein injection . Treatment with 1, 5, or 10 mg / kg did not result in a statistically significant inhibition of tumor growth compared to control mice receiving only saline . By day 20, treatment with 15 mg / kg it-141 resulted in a 54% inhibition of tumor growth, respectively, compared to mice treated with saline (p = 0.028). Treatment with 30 and 45 mg / kg resulted in complete tumor growth inhibition compared to saline control, with tumor regression of 59 and 87%, respectively (p = 0.005 for both). Similar results were found using another colon cancer xenograft model, hct116 (figure 3(c)). In this model, a dose of 5 mg / kg resulted in a 59% inhibition of tumor growth (p = 0.008) compared to the itp-101-treated group . Treatment with it-141 at 15 and 30 mg / kg in this model resulted in complete inhibition of tumor growth compared to the itp-101 polymer control, with 15% and 51% regression, respectively (p = 1.0 e and 8.1). Taken together, these data demonstrate that it-141 achieved significantly greater antitumor efficacy, compared to irinotecan, and dose - dependent tumor regression in two colorectal cancer xenograft models of colon cancer, with effective doses between 15 and 30 mg / kg . A final study was performed whereby it-141 formulations with different weight loadings of sn-38 were compared to each other . It-141 formulations were prepared with 11% (it-141 - 11%) and 4% (it-141 - 4%) sn-38 (w / w), and equivalent doses of sn-38 were administered i.v . In an ht-29 colon cancer xenograft model (figure 4). There were no statistical differences in efficacy between the two formulations at either 30 mg / kg (p = 0.292), 15 mg / kg (p = 0.119), or 5 mg / kg (p = 0.138). These data demonstrate that the percent loading by weight of sn-38 into the micelles does not affect antitumor activity . In this report, a novel triblock copolymer was used to encapsulate and solubilize the hydrophobic drug, sn-38, which is the active metabolite of irinotecan . Although irinotecan is used in the clinic as a prodrug, its efficacy is reliant upon carboxylesterase enzymes localized in the liver and gastrointestinal tract for conversion to the active metabolite, sn-38 . Irinotecan treatment is often followed by late - stage diarrhea with 24% grade 4 incidence and can require antidiarrheal premedication . This limits the dose of irinotecan that can be administered safely in subsequent administrations, thereby reducing response rates in these patients [34, 35]. Sn-38 is a potent cytotoxic compound that, by itself, cannot be used in the clinic due to its extreme hydrophobicity . Have effectively addressed the solubility problem of sn-38 by conjugating sn-38 to peg - poly(glutamic acid), forming a micelle called nk012, which is currently in clinical trials . Other nanocarriers for sn-38 have been developed involving conjugation of sn-38 to a polymer or peptide [24, 25]. As an alternative approach to direct sn-38 conjugation, a novel triblock copolymer was used to encapsulate sn-38 into a polymer micelle, precluding the need to modify the drug and for cleavage of the bond to release the active drug . The itp-101 triblock copolymer was developed to efficiently encapsulate hydrophobic molecules and release them at the site of disease (in the tumor) without drug conjugation . Encapsulation of sn-38 to create it-141 resulted in a 6,000-fold increase in solubility of sn-38 and a micelle size of 130 nm, which is ideal for accumulation in tumors due to the epr effect . In vitro, it-141 was found to possess potent cytotoxic activity, which was similar to that of free sn-38 but several fold more potent than irinotecan . Cell lines that were resistant to killing by it-141 were also resistant to free sn-38, which may indicate a natural insensitivity of these cell lines to inhibition of topoisomerase i. this could arise through alterations in the expression of, or mutations in, the gene encoding topoisomerase i or the activity of drug efflux pumps . It has been shown that the drug efflux pump abcg2 is overexpressed in cells resistant to sn-38 . The pharmacokinetic profile of it-141 demonstrated significant improvement in exposure and cmax for sn-38, with a modest improvement in half - life, compared to sn-38 derived from irinotecan . Importantly, the plasma auc from it-141 exposure was 14-fold higher than the sn-38 exposure from irinotecan administered at the same dose (34.6 ghr / ml versus 2.5 ghr / ml). Similarly, it-141 demonstrated higher exposure in ht-29 tumors, as measured by auc, than irinotecan . The higher auc of it-141 in the tumor indicated that it would potentially be more efficacious than irinotecan in xenograft models . Indeed, it-141 was found to be superior to irinotecan in an ht-29 xenograft model and was potent in dose - range finding studies in both ht-29 and hct-116 xenografts . In both models, tumor regression was observed at 30 mg / kg in the ht-29 model and 15 mg / kg in the hct116 model . During the development of it-141, it was found that it-141 could be formulated with sn-38 with weight loadings in the range of 114% . Different it-141 formulations were prepared with varying weight loadings of sn-38 and were evaluated in an ht-29 xenograft experiment . It was found that it-141 - 4% w / w had equivalent antitumor activity to it-141 - 11% w / w, demonstrating no differences in efficacy between these formulations . It can be speculated, therefore, that despite sn-38 loading differences between the micelle, equivalent or similar overall concentrations of sn-38 are being delivered to these tumors . In summary, it-141 is a novel sn-38-loaded polymer micelle with superior pharmacokinetics and antitumor activity compared to irinotecan . Although irinotecan is effective in the clinic, the ability to deliver sn-38 could be a superior treatment option for many patients . It-141 increased the solubility of sn-38 by 6,000-fold and had a diameter of 130 nm . It-141 demonstrated superior pharmacokinetics to irinotecan and potent antitumor activity in ht-29 and hct-116 colorectal cancer xenograft models . In summary, it-141 is a promising new therapeutic agent for colorectal cancer that warrants clinical investigation.
|
Human respiratory syncytial virus (hrsv) is the most important infectious agent of serious acute respiratory illnesses in infants and young children worldwide[1, 2]. Hrsv causes brochiolitis and pneumonia during the first few months of life in the late fall and winter . It is responsible for 1800075000 hospitalizations and 901900 deaths in the united states annually, whereas hrsv is responsible for 2796% of hospitalized cases caused by viral infections in developing countries . Hrsv is also recognized as an important respiratory pathogen in individuals with cardiopulmonary disease, immunocompromised patients and the elderly . Hrsv, a member of the genus pneumovirus, family paramixoviridae, is an enveloped virus with nonsegmented negative - strand rna genome . The attachment g glycoprotein and f protein are important hrsv antigens that stimulate the protective response . Hrsv strains have been divided into two subgroups a and b on the basis of the reactions with monoclonal antibodies directed against the g protein . Sequencing studies have revealed that the g protein is the most variable hrsv protein both between and within the two subgroups . The g protein gene consists of two variable regions in ectodomain separated by a central, conserved motif . Most frequently, hrsv genotype classification makes use of the second variable region in the g protein gene . Also most studies of molecular epidemiology of hrsv are based on the nucleotide sequencing of this region in the g protein . The aim of the present study was to investigate hrsv genotypes in iran by rt - pcr for second variable region of the g protein, because understanding of hrsv genotypes distribution patterns will be beneficial for the development of effective vaccines or antiviral therapy . In this cross - sectional study, 107 throat swabs were collected from children aged less than 5 years suffering from acute respiratory symptoms, such as wheezing, cough, and fever from october to december 2009 . The respiratory samples were obtained from hospital and sentinel sites from several provinces: tehran, isfahan, hamadan, zanjan, kordestan, lorestan, and wet azarbayjan by ministry of health and medical education (mohme). Detailed clinical histories were collected on admission and in all cases parents or guardians signed an informed consent . All respiratory specimens were transported to the department of virology, tehran university of medical sciences, and were stored at 80c until further examination . This study was approved by the medical faculty ethics committee of tehran university of medical sciences . The viral rna to be used as a template for cdna synthesis was extracted directly from throat swabs by using the high pure nucleic extraction kit (roche diagnostic, manheim, germany). The extracted viral rna was dissolved in 50 l of elution buffer . For cdna synthesis, 17.5 l of extracted rna added to the reaction mixture, consisting of 6 l rt buffer, 2.5 l dntp, 2.5 l random hexamer primers, 1 l rt enzyme of moloney murine leukemia virus, and 0.5 l rnase inhibitor in a total volume of 30 l, and incubated at 37c for 45 min . For the external pcr, gpa (nt511 - 530, 5'- gaagtgttcaactttgtacc-3') for subgroup a and gpb (nt 494 - 515, 5'-aagatgattaccattttg aagt-3') for subgroup b were used as forward primers . Hemi - nested pcr was carried out with subgroup a - specific forward primer, nrsag (nt 539 - 558, 5'- tatgcagcaacaatccaacc-3'), and subgroup b - specific forward primer, nrsbg (nt 512 - 531, 5'-gtggcaacaatcaactctgc-3'). In the external and hemi - nested pcr, primer f1 (nt 3 - 22, 5'-caactccattgttatttgcc-3') was used as reverse primer for both subgroups a and b. the external pcr for the amplification of the g protein was performed by adding 10 l of the synthesized cdna to 40 l of the reaction mixture containing 23 l distilled water, 5 l 10x pcr buffer, 4 l dntp, 2.5 l mgcl2, 2.5 l forward primer, 2.5 l reverse primer, and 0.5 l of taq dna polymerase . Amplification conditions consisted of 2 min at 95c, 30 cycles of 94c for 1 min, 50c for 1 min, and 72c for 2 min, and a final extension at 72c for 7 min . Five l of external pcr product was used for hemi - nested pcr with the same conditions . The external and hemi - nested pcr amplicons were 450 and 400 bp, respectively . Both subgroups a and b were analyzed by electrophoresis on a 1.5% agarose gel and visualized under uv light . The hemi - nested primers, nrsag for subgroup a and nrsbg for subgroup b, were used as forward primers and f1 was used as the reverse primer for sequence determination . The purified pcr products were sequenced in the forward and the reverse directions in an abi prism 310 genetic analyzer (pe applied biosystems inc ., foster city, ca) by using an abi prism bigdye terminator cycle sequencing ready reaction kit (pe applied biosystems inc). The nucleotide sequences obtained from second variable region of the g protein gene were aligned with hrsv sequences from genbank database by using the clustal x program (version 1.83). All hrsv sequences were submitted to the genbank database; the accession numbers are hm063447-hm063470 . The viral rna to be used as a template for cdna synthesis was extracted directly from throat swabs by using the high pure nucleic extraction kit (roche diagnostic, manheim, germany). The extracted viral rna was dissolved in 50 l of elution buffer . For cdna synthesis, 17.5 l of extracted rna added to the reaction mixture, consisting of 6 l rt buffer, 2.5 l dntp, 2.5 l random hexamer primers, 1 l rt enzyme of moloney murine leukemia virus, and 0.5 l rnase inhibitor in a total volume of 30 l, and incubated at 37c for 45 min . For the external pcr, gpa (nt511 - 530, 5'- gaagtgttcaactttgtacc-3') for subgroup a and gpb (nt 494 - 515, 5'-aagatgattaccattttg aagt-3') for subgroup b were used as forward primers . Hemi - nested pcr was carried out with subgroup a - specific forward primer, nrsag (nt 539 - 558, 5'- tatgcagcaacaatccaacc-3'), and subgroup b - specific forward primer, nrsbg (nt 512 - 531, 5'-gtggcaacaatcaactctgc-3'). In the external and hemi - nested pcr, primer f1 (nt 3 - 22, 5'-caactccattgttatttgcc-3') was used as reverse primer for both subgroups a and b. the external pcr for the amplification of the g protein was performed by adding 10 l of the synthesized cdna to 40 l of the reaction mixture containing 23 l distilled water, 5 l 10x pcr buffer, 4 l dntp, 2.5 l mgcl2, 2.5 l forward primer, 2.5 l reverse primer, and 0.5 l of taq dna polymerase . Amplification conditions consisted of 2 min at 95c, 30 cycles of 94c for 1 min, 50c for 1 min, and 72c for 2 min, and a final extension at 72c for 7 min . Five l of external pcr product was used for hemi - nested pcr with the same conditions . The external and hemi - nested pcr amplicons were 450 and 400 bp, respectively . Both subgroups a and b were analyzed by electrophoresis on a 1.5% agarose gel and visualized under uv light . The hemi - nested primers, nrsag for subgroup a and nrsbg for subgroup b, were used as forward primers and f1 was used as the reverse primer for sequence determination . The purified pcr products were sequenced in the forward and the reverse directions in an abi prism 310 genetic analyzer (pe applied biosystems inc ., foster city, ca) by using an abi prism bigdye terminator cycle sequencing ready reaction kit (pe applied biosystems inc). The nucleotide sequences obtained from second variable region of the g protein gene were aligned with hrsv sequences from genbank database by using the clustal x program (version 1.83). All hrsv sequences were submitted to the genbank database; the accession numbers are hm063447-hm063470 . A total number of 107 respiratory specimens from children with acute respiratory infection were examined . Of these 24 (22.24%) were positive for hrsv, of which 16 (66.6%) belonged to subgroup a and 8 (33.4%) to subgroup b. phylogenetic analysis revealed that subgroup a strains fell in two clusters, 15 strains in genotype ga1, and 1 strain in genotype ga2 (fig . All subgroup b strains clustered in a genotype ba with a 60-nucleotide insertion in the second variable region of the g protein (fig . Phylogenetic tree constructed with the hrsv subgroup a nucleotide sequences of based on the second variable region of the g gene . The nucleotide sequences were aligned with the clustal x (version 1/83), and phylogenetic tree were prepared with treecon software with a neighbor - joining algorithm . The following reference sequences were used to construct tree: mo48, al19471 - 5, and ny108 (ga1); ab4026b01, tx69564, mo55, and sal/87/99 (ga2); mo16,cn2395, and tx68481 (ga3); sa97d1289, mo01, cn2708, tx67951, al19556 - 3, sal/173/99, ab5076pt01, and ng/009/02 (ga5); al19452 - 2 and ny20 (ga6); mo02, sa99v360, and cn1973 (ga7); sa98v603and sa99v1239 (saa1). Phylogenetic tree constructed with the hrsv subgroup b nucleotide sequences of based on the second variable region of the g gene . The nucleotide sequences were aligned with the clustal x (version 1/83), and phylogenetic tree were prepared with treecon software with a neighbor - joining algorithm . The following reference sequences were used to construct tree: wv10010, wv15291, and ch10b (gb1); ch93 - 9b (gb2); mo35, and tx69208(gb3);mo30, ny01, and sa98v602 (gb4); sa98d1656, sa0025, and ken/2/00 (sab1); sa99v800, moz/204/99, and moz/205/99 (sab2); sa99v429, sa98v192, mon/7/99, and mon/2/99 (sab3): s71/02, que/85/02 - 03, be/12370/01, and be/12817/03 (ba). Genotype ga1 was detected in 15 (62.5%) hrsv - positive samples, so ga1 was the predominant genotype during the season 2009 . In the present study, 21 (87%) in developing countries one - third of all deaths in young children are due to acute respiratory infections, with hrsv responsible for 2796% of hospitalized cases caused by a viral infection . Therefore, genetic diversity of hrsv has been studied in many parts of the world including south africa, belgium, india, argentina, and jordan . The studies on genetic variability of hrsv revealed that subgroup a strains should be classified into 8 genotypes (ga1 - 7,saa1) and subgroup b strains into 8 genotypes (gb1 - 4,sab1 - 3,ba). Infectivity of the virus, the development of immunological resistance in the community, and viral genetic drift due to spontaneous mutation may be important in the patterns of seasonal circulation and genetic evolution of hrsv strains . Although several studies on prevalence of hrsv were carried out in iran[18, 19], the present study has determined hrsv genotypes by sequencing of the second variable region of the g protein during the season 2009 . In this study 107 respiratory samples were examined, of which 24 (22.24%) were positive for hrsv . This finding is similar to that found in studies in both developing and industrialized countries: 25.46% in jordan, 18.4% in malaysia, 16/2% in germany, 28% in brazil, 21% in austria and 27.08% in india . 16 (66.6%) hrsv - positive samples belonged to subgroup a and 8 (33.4%) to subgroup b. therefore, our results revealed that subgroup a strains were the most common finding and subgroup b strains infections appear to have been less frequent during the season 2009 . It has been speculated that strains of subgroup b may cause less severe disease, so may be recognized less often . Another possibility is that infections with b strains may produce longer - lasting subgroup - specific immunity . Also infants infected with viruses of subgroup b strains induce a greater antibody to the glycoprotein g than do their counterparts infected with a strains . Phylogenetic analysis revealed that subgroup a strains fell into two clusters, namely 15 strains in genotype ga1, and 1 strain in genotype ga2 . Ga1 was predominant genotype during the season 2009, whereas this genotype was obtained in several cities (isfahan, hamedan, tehran, zanjan, khoy, aligodarz, sanandaj, and miandoab). All hrsv - positive samples of subgroup b clustered in genotype ba . For the first time, new genotype ba was reported from buenos aires (buenos aires [ba] virus) in 1999 . This genotype appears to be spreading globally and has been reported from india, kenya, japan, spain canada and united kingdom . Antigenic changes in g protein and avoidance of host immune responses maybe the cause of rapid global spread of ba viruses . This is the first report of genotype ba detected in iran . In this study, 21 (87.5%) positive samples were obtained from children under one year of age . Hence our results, as those of others[1, 2], revealed hrsv as a major viral agent in infants and young children . Finally, this study supported that rt - pcr for second variable region of g protein is an effective method for further studies of hrsv genotype designation in iran . Also our results may be useful for designing hrsv vaccines in future as well as developing novel prevention or treatment strategies . We conclude that multiple genotypes of hrsv (ga1,ga2,ba) cocirculated during the season 2009 in iran . Also we suggest further studies to determine hrsv genotypes over longer periods of time for better understanding of the distribution patterns of hrsv genotypes in iran.
|
Disasters are either man - made or natural events (1, 2) whose general consequences include disruption of social and psychological order of communities, destruction of infrastructure and residential houses, deaths and injuries, destruction of assets and properties and disruption of social life of communities (3). Major disasters require a different form of management . In the case of a major disaster, management process may be very complex and full of problems because disasters have very chaotic situations (4). Iran is subject to a broad range of natural and man - made disasters (5) and has historically been damaged a lot by natural disasters (6). Over the past century, hundreds of thousands of people have died due to disasters like war, earthquake, flood and drought . Bam deadly earthquake in 2003, in south eastern iran, is claimed to have taken the lives of more than 30,000 people (7). Zarand earthquake in 2005 in central iran, silakhor earthquake in 2006 in western iran (8), eastern azerbaijan earthquake in 2002, bushehr earthquake and southern khorasan earthquake in 2003 are some of the natural disasters occurred in iran in the recent decade . Management in natural disasters has various and different aspects, one of which is related to mental issues at individual and social levels . Mental health programs during and after a disaster have recently been very controversial (9). Natural disasters are situations that need high social and psychosocial support (10). Every year, millions of people are affected by natural disasters . Research has shown that exposure to disasters exacerbates traumas (2). Among the effects of disasters, consequences which damage the health and lives of people are of great importance (11). Since some countries, including iran, are disaster - stricken, having comprehensive and dynamic disaster management structures is essential in coping with disasters . In times of disaster, an approach that addresses physical, mental and social needs of individuals is very crucial (12). Psychological needs of victims and taking measures to deal with the psychological effects of disasters are among the needs mentioned above . Psychological responses must not be limited to disaster period but rather must continue long after disaster due to long - term effects disaster has on victims . Although number of studies related to psychological support in natural disasters is growing, there is still a shortage of these studies (13). The breadth and severity of medical problems among patients with mental illnesses are not well known (14). People s mental and physical health and behavior are closely linked together (15). Psychological support in disasters focuses on identification of individuals who are at risk of long - term psychological effects and on development of effective strategies to cope with stress after disaster (17). Psychological intervention is one of the important aspects in the comprehensive chain of mental health cares after disasters and is considered an important factor in preventing mental health problems after disasters and in creating suitable social support (13). New research focuses on transforming mental health systems in order to recognize the long - term psychological effects of a disaster (19). Integrating mental response and mental health programs with humanitarian assistance programs can bring about an opportunity to present a model to centralize mental health in public health structures of a country (20). (2012) considered psychological consequences a priority for preparing for and responding to disasters and presented a conceptual framework for managing the consequences of disasters in order to guide hospitals and clinics . This model consists of structural components (internal organizational structure and a chain of command, resources and infrastructures and knowledge and skills) and process components (coordination with external organizations, assessing and monitoring risk, psychological support and sharing information and communication) (21). A systematic intervention includes three stages: preparation before the disaster, psychological first aid, monitoring and evaluation . Training is required, in all three phases, before assessing the disaster, verbal intervention, individual and group social support, providing sufficient information and sensitivity to cultural and situational diversity (13). Successful disaster management requires a holistic view on the effects and aspects of the disaster . Therefore, success of disaster management depends on analyzing conditions correctly and reviewing consequences comprehensively in the light of social areas . The aim of the present study was to identify the most important shortcomings of dealing with the psychological effects of natural disasters and the problems related to this field . This study is of qualitative type; statistical universe consists of 26 disaster managers who have had experience in managing natural disasters over the last decade . Information was gathered using in - depth interviews with semi - structured open - ended questions . Interview questions were designed to identify the most important shortcomings and problems related to dealing with psychological effects of previous natural disasters in iran . These face - to - face interviews lasted for approximately 30 minutes . Qualitative and quantitative content analysis was used to analyze the results . For qualitative analysis,, the interviews were studied several times to obtain an overall understanding and determine codes and meaning units . Then, the codes, that were semantically similar, were matched and the most important concepts were extracted . Contingency analysis was used for quantitative content analysis . Thereby, the frequency of each concept was determined . In the next step, to obtain guidelines and solutions, focus group meetings were held with six scientific and practical experts in disaster management and the solutions were extracted . Analyses showed that interviewees pointed to nine main problems in this regard; they are shown in table 1 . Frequency distribution of managers viewpoints regarding shortcomings of dealing with psychological effects in disasters as shown in table most of the interviewees expressed three other shortcomings that had nearly the same frequency were: insufficient training, shortage of experts and ignoring needs of specific groups with 92.3% frequency . Lack of suitable communications of organizations in the field of providing mental services and discontinuation of psychological support after disaster also gained the same frequency (76.9%). Unfamiliarity with native language and culture of the area, little attention of media to psychological principles in broadcasting news and people s long - term dependence on governmental aid were noted as the three least common weaknesses that has lowest frequency in content analysis of interviewees viewpoints (69.2%, 57.6%, 38.4% respectively). The results of this study identified nine problems that had most effect on the psychological consequences management of disasters . In continued, these problems are analyzed, some experiences are mentioned, and some guidelines are presented . When a terrible natural disaster occurs, all relevant organizations and authorities try to save the victims and to provide their basic welfare needs . Viewpoints of disaster managers reveal that psychological support has been taken into less consideration than other factors including houses and meeting physical needs . Unfamiliarity with principles of psychological support results in increased mental problems of people and even rescuers . Meeting mental needs after disasters requires familiarity with principles of psychological support in disasters . The way rescuers and authorities treat victims, look at them and speak to them and the way words are selected are all important keys which must be taught and taken into account . It is not enough for people who are in charge of preparing profile of the injured and dead people to only know how to work with computer and to search information; they must also be familiar with principles of emotional support in treating survivors who are looking for some information about their relatives, especially when they are going to be informed of their relatives deaths . Knowing the basic principles of psychological support is also emphasized by other researchers (2224). Specialized responses to the mental needs, shortage of experts or ignoring the presence of mental health specialists in disaster management teams have worsen the situation . The most important measure in preventing the injured people s illogical and irrational decisions and behaviors in disasters is to support them mentally and psychologically; if it is done correctly by experts, it will help victims, rescuers and the related authorities . Education and training about immediate responses are important for all mental health providers of immediate and continuing services to assist victims in the aftermath of disasters (25). Not employing experts to teach these principles to rescuers and to supervise psychological supports will also worsen mental problems in disasters . A part of this training is specialized and is used to train psychologists, while other part must cover public education for victims and rescuers . In this case, interviewees mentioned the way physicians and nurses treat patients and the way rescuers treat the injured . Psychological support is not limited to the victims in a disaster area and in the disaster time . In disaster conditions, it is necessary to pay attention to the psychological needs of different groups (13). Survivors need the most attention and support, but other groups should not be ignored . Identifying needs of different groups such as women, children, adolescents, the elderly, the disabled and patients is crucial . Thus, in selecting rescuers, their emotional personalities must be taken into huge consideration . Obviously, sensitive and emotional people will find it difficult to respond to painful tragedies . Numerous studies have emphasized specific groups in disasters, especially children (26), women (27) and the elderly (28). Rabiee & pourhosseini (2014), have added addicts to this groups and have stated that attention to their needs is necessary (23). Kohn et al . (2012), have stated some people have different needs and vulnerability to disasters; they must be taken into huge consideration in national policymaking and programming (29). Lack of proper coordination is a main problem and challenge for natural disaster management which is caused by undefined disaster activities (30). Different organizations like the red crescent, welfare organization, charities and international organizations such as unicef play an important role in presenting counseling and psychological support to the victims of disasters; however, experience has shown that there is no certain rela tionship among these organizations and they perform some isolated services . Establishing effective inter - organizational communications and holding regular meetings between organizations that provide psychological supports in disasters in order to share information and to coordinate with each other must be considered during disaster . 2012), pointed to the lack of central cooperation and psychological intervention programs in responding to disasters in east europe and regarded programming and presenting post - disaster mental cares as key needs in this regard (31). Although post - disaster traumas decline over time, they will be still visible (32). When it comes to psychosocial support in disaster situations, the first thing that comes to mind is to comfort and console the survivors . It is done and thus can be beneficial until there are different groups in the disaster area . However, mental problems are not short - term and temporary conditions which can be healed as soon as the disaster finishes . Losing family members, seeing painful events and scenes and many other problems can cause lifelong problems for people . If the psychological support programs are limited to disaster times, the feelings of fear, anxiety, isolationism, and other mental illnesses will remain long after the disaster . A common issue in all disasters is that basic needs are provided and finished in a certain time, while psychological and mental needs will remain for years and will hurt the survivors . Continuing psychological support until victims return to their mental and emotional equilibrium through establishing psychological support centers and letting them work long after disaster can be effective . Another problem found in some areas was unfamiliarity of rescuers with the native language of people of that region . Absence of a common language will not lead to understanding the real needs . Considering the customs, religious beliefs of people and employing rescuers who are familiar with the disaster area and with the language, culture and customs of that area is very important . Although there is a plethora of literature associated with psychosocial aspects of disaster, very little of it specifically relates to culture (33). (2008), one of the principles of psychological intervention have stated attention to cultural differences (13). Observing principles of psychological support media also plays an important role in causing or preventing the disturbance in the public, and can affect victims and people s morale . Showing harrowing scenes does not help control disaster; dissemination of essential information, announcing real needs of people, asking for suitable aid and spreading health, safety and comforting messages can be useful activities of media in disaster times . (2014), also believes that if the social media play their role properly, they will have more psychological benefits (34). Previous disasters have shown that although much time has passed since some disasters, people still have not returned to their equilibrium condition of life . One of the most important consequences of disasters is people s dependent on government assistance . Government s support should make people return to their previous daily lives in a short period of time . Providing employment and financial independence in a shortest possible time can eliminate most of people s mental disturbances and can help them gain their mental and psychological equilibrium . Concerning the issues and problems introduced in this research, some measures and planning must be started to deal with psychological effects of disasters . Although some measures were taken after bam earthquake, they were not sufficient . Planning must be considered prior to disaster so as to have fewer problems in the time of disaster . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or fal sification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
|
Skin aging is a complex process that affects all its layers and structure and changes the functional properties of the intracellular matrix . A wide range of biomimetic peptides with different mechanisms of action can be applied to solve this problem . By imitating the action of naturally occurring growth factors and cytokines, they are able to bind to the specific receptors, regulate gene transcription, and provide a stimulating effect on keratinocytes and fibroblasts . However, the target genes of different peptides are different; hence, the maximum effect is achieved only by the combined application of several biomimetic peptides.1 caregen co., ltd . (anyang - si, gyeonggi - do, south korea) has developed biomimetic peptides based on extensive studies of growth factors since 2002 . The term biomimetic peptide as used herein relates to a synthetic agonist of naturally occurring growth factors and completely mimics the action of the parental molecules . The biomimetic peptides are oligopeptides consisting of ten to 15 amino acids and can provide clinical benefits similar to recombinant growth factors, reduce costs, and have greater chemical stability . In the production system uses a unique mass production of growth factors provided by transformed bacteria (escherichia coli system), containing synthetic human genes . Double - layered encapsulation technology improves penetration of active ingredients into skin and protects the molecules from endogenous proteases, which provides higher efficacy.2 biomimetic peptides have a wide range of applications such as increasing the efficacies of any cosmetic and meso - formulations, including dermal fillers, in antiaging, antipigmentation, hair growth, body fat reduction, and many inflammation - related products, which are also applicable for pharmaceutical purposes.3,4 in addition, in the recent decade, an interest in synthetic oligopeptides and their use in diagnosis and treatment of different pathologies has increased dramatically; for example, investigation devoted to influence of short peptides on endothelial growth5 or protection of kidney during the cisplatin - induced acute renal failure.6 in this study, we identified several molecules associated with aging and skin regeneration, such as ki-67, type i procollagen, sirt6, and ap-1 . In aging, the number, quality, and quantity of collagen fibers are modified; they become thin, lose their clear organization, and are resorbed . Matrix metalloproteinases (mmp-1, mmp-2, and mmp-3) are key signaling molecules of collagen expression . Many studies have shown that their activity is regulated by ap-1.79 in parallel, with the degradation of the existing collagen, the activation of factor ap-1 is accompanied with a decrease in procollagen types i and iii . Ap-1 regulates a number of cellular processes, including differentiation, proliferation, and apoptosis.10 there is a decrease in the proliferative activity of fibroblasts during aging . Using the cultivation method, it was shown that fibroblasts of young donors are characterized by twice as many mitoses, whereby one cell (there are 60% of such type of cells) is able to form a colony of 256 fibroblasts, while in the case of older donors, only 2% of cells form colonies of similar volume.11 the hayflick phenomenon can be a substantiation of fewer cell divisions, whereby somatic cells without telomerase expression are capable, on average, of only 50 doublings of population, but fibroblasts of older donors have already passed a number of cell cycles prior to isolation in vitro.12 there is a correlation between donor age and the replicative lifespan of human cells in culture.13 for accuracy, it is better to investigate one serially cultured sample at different periods of time than to examine several different cultured samples.14 the protein ki-67 is present in all active phases of the cell cycle (g1, s, g2, and mitosis), and it is a recognized marker for determining the growth of the cell population . Sirt6 is a recently identified factor associated with skin aging . Dna repair and control of proliferation are its main functions in the skin, and this protein also participates in inflammation processes . Thus, hyperexpression of sirt6 leads to increase in tnf- synthesis through posttranscriptional mechanisms.15 sirt6 modulates telomeric chromatin by lys-9 deacetylation of histone h3 and thus prevents telomeric dysfunction and early cellular aging.16 the aim of this study was to investigate the influence of biomimetic peptides on the reparation processes in the dermis by the cell culture model in vitro and in vivo . In the human study, we investigated the effect of revofil aquashine (aq) that possesses all physical, structural, and biocompatibility properties that are required of a superior gel for use in skin restoring and has a encumbrance certificate . During the clinical study done for encumbrance certification, no major side effects requiring medical attention were observed . Aq contains biomimetic peptides (cg - cgc2, cg - cgc3, rejuline, boostrin), free hyaluronic acid, amino acids, multivitamins, and minerals . Aq was administered to the patients (n=5, age: 4548 years) 1 month prior to the abdominoplasty by means of intradermal microinjections into skin of the right half of anterior abdominal wall below the navel (in areas of localized fat deposits that are to be subsequently removed). The samples were received from caregen research center (seoul, south korea). As a control, pure (not containing biomimetic peptides) hyaluronic acid was injected simultaneously into a symmetric area to the left . The treatment and study details were fully explained to the subjects, all of whom signed written informed consent forms pertaining to treatment and participation in this study, which included consent to injection of cosmeceutical product and skin biopsy . A total of 2 ml of aq was expected to hold a single procedure; this volume was recommended by caregen . Aq was injected to a depth of 46 mm (depending on skin thickness) and at an angle of 4590 to the surface of the skin . During the abdominoplasty, skin samples were taken from the injected areas of the abdomen and fixed in 10% formalin solution . The study was conducted with caregen research ethics committee approval and patients provided written informed consent . In the cell culture model, we investigated complex of biomimetic peptides that were part of fillers revofil aq and aq brightening (br). The complex of biomimetic peptides was provided by the supplier in ampoules and was clear, colorless aqueous sterile solution . The subcultivation of normal human diploid fibroblasts as a model of aging was used in this study in vitro . The biopsy was taken from a middle - aged donor (42 years); when the culture reach 7 passage, we classified it as a mature cells, meaning that all processes as energy exchange, cell growth, biosynthesis are in a highest stage, and passage 15 as a senescent culture, thus all the processes mentioned above regress . The senescent cell line was proved by staining for -galactosidase (anti--galactosidase antibody; abcam, cambridge, uk) as a technique to label senescent cells . Isolation of fibroblasts with enzymatic digestion was carried out using dispase ii (thermo fisher scientific, waltham, ma, usa) at the concentration of 2.4 iu / ml for 18 hours at 4c, and then the epidermis was mechanically separated from the dermis . To obtain a suspension of fibroblasts, the dermis was minced with scissors into pieces of 34 mm and placed in a solution of type i collagenase (thermo fisher scientific) in minimum essential medium (biolot, saint - petersburg, russia) for 30 minutes at 37c . The obtained culture was tested to specific molecular fibroblast marker vimentin (antivimentin monoclonal antibody; dako denmark a / s, glostrup, denmark), which confirmed that the investigated culture was skin fibroblasts . We studied three groups: 1) control group (physiological solution); 2) aq group with addition of biomimetic peptide components of aq (acetyl decapeptide-3 [rejuline], oligopeptide-24 [cg - egp3], oligopeptide-34 [cg - tgp2], oligopeptide-72 [boostrin]) in concentration of 2 g / ml; and 3) aq br group with addition of biomimetic peptide components of aq br (oligopeptide-23 [flatin], oligopeptide-34 [cg - tgp2], oligopeptide-51 [purilux], oligopeptide-72 [boostrin]) in concentration of 2 g / ml . At passages 7 and 15, cells were seeded on coverslips (15 mm, thermo fisher scientific) fixed with paraformaldehyde (sigma - aldrich co., st louis, mo, usa) and incubated with antibodies . The confocal microscope olympus fv1000 (olympus corporation, tokyo, japan) was used for visualization of the nuclear markers ki-67 and sirt6 in fibroblast culture samples by applying secondary antibodies conjugated with a far red - emitting dye (alexa fluor 647; abcam). In both studies (in vivo and in vitro), we used primary monoclonal antibodies to markers ki-67 (1:75; dako denmark a / s), ap-1 (1:200; sigma - aldrich co.), type i procollagen (1:100, lifespan biosciences, seattle, wa, usa), and sirt6 (1:200, alexa fluor 647) and biotinylated anti - mouse immunoglobulins (dako denmark a / s) as secondary antibodies to provide the immunohistochemical reaction . Visualization of the reaction was carried out using the envision detection system kit (dako denmark a / s). In both cases, morphometric investigation was carried out by using a system of computer analysis of microscopic images, which includes a microscope olympus bx46, a digital camera (olympus corporation), and a personal computer based on intel pentium 5 and software morphology 5.2 (videotest, saint - petersburg, russia). We measured the optical density (in cu) and the area of immunopositive expression, which was calculated as the ratio of the area occupied by immunopositive cells (or nuclei) and the total area of cells (or nuclei) in the field of view (in%). Statistical analysis of experimental data included calculation of the arithmetic average, the standard deviation, and the confidence interval for each sample, which was performed using the program statistica 8.0 . (dell; statistica, round rock, tx, usa). To analyze the distribution of species nonparametric procedures, including one - way analysis of variance (kruskal wallis), were used to verify the statistical homogeneity of several samples . In cases where the variance analysis revealed a statistically significant heterogeneity of multiple samples for subsequent detection of heterogeneous groups (through their pairwise comparisons) in the human study, we investigated the effect of revofil aquashine (aq) that possesses all physical, structural, and biocompatibility properties that are required of a superior gel for use in skin restoring and has a encumbrance certificate . During the clinical study done for encumbrance certification, no major side effects requiring medical attention were observed . Aq contains biomimetic peptides (cg - cgc2, cg - cgc3, rejuline, boostrin), free hyaluronic acid, amino acids, multivitamins, and minerals . Aq was administered to the patients (n=5, age: 4548 years) 1 month prior to the abdominoplasty by means of intradermal microinjections into skin of the right half of anterior abdominal wall below the navel (in areas of localized fat deposits that are to be subsequently removed). The samples were received from caregen research center (seoul, south korea). As a control, pure (not containing biomimetic peptides) hyaluronic acid was injected simultaneously into a symmetric area to the left . The treatment and study details were fully explained to the subjects, all of whom signed written informed consent forms pertaining to treatment and participation in this study, which included consent to injection of cosmeceutical product and skin biopsy . A total of 2 ml of aq was expected to hold a single procedure; this volume was recommended by caregen . Aq was injected to a depth of 46 mm (depending on skin thickness) and at an angle of 4590 to the surface of the skin . During the abdominoplasty, skin samples were taken from the injected areas of the abdomen and fixed in 10% formalin solution . The study was conducted with caregen research ethics committee approval and patients provided written informed consent . In the cell culture model, we investigated complex of biomimetic peptides that were part of fillers revofil aq and aq brightening (br). The complex of biomimetic peptides was provided by the supplier in ampoules and was clear, colorless aqueous sterile solution . The subcultivation of normal human diploid fibroblasts as a model of aging was used in this study in vitro . The biopsy was taken from a middle - aged donor (42 years); when the culture reach 7 passage, we classified it as a mature cells, meaning that all processes as energy exchange, cell growth, biosynthesis are in a highest stage, and passage 15 as a senescent culture, thus all the processes mentioned above regress . The senescent cell line was proved by staining for -galactosidase (anti--galactosidase antibody; abcam, cambridge, uk) as a technique to label senescent cells . Isolation of fibroblasts with enzymatic digestion was carried out using dispase ii (thermo fisher scientific, waltham, ma, usa) at the concentration of 2.4 iu / ml for 18 hours at 4c, and then the epidermis was mechanically separated from the dermis . To obtain a suspension of fibroblasts, the dermis was minced with scissors into pieces of 34 mm and placed in a solution of type i collagenase (thermo fisher scientific) in minimum essential medium (biolot, saint - petersburg, russia) for 30 minutes at 37c . The obtained culture was tested to specific molecular fibroblast marker vimentin (antivimentin monoclonal antibody; dako denmark a / s, glostrup, denmark), which confirmed that the investigated culture was skin fibroblasts . We studied three groups: 1) control group (physiological solution); 2) aq group with addition of biomimetic peptide components of aq (acetyl decapeptide-3 [rejuline], oligopeptide-24 [cg - egp3], oligopeptide-34 [cg - tgp2], oligopeptide-72 [boostrin]) in concentration of 2 g / ml; and 3) aq br group with addition of biomimetic peptide components of aq br (oligopeptide-23 [flatin], oligopeptide-34 [cg - tgp2], oligopeptide-51 [purilux], oligopeptide-72 [boostrin]) in concentration of 2 g / ml . At passages 7 and 15, cells were seeded on coverslips (15 mm, thermo fisher scientific) fixed with paraformaldehyde (sigma - aldrich co., st louis, mo, usa) and incubated with antibodies . The confocal microscope olympus fv1000 (olympus corporation, tokyo, japan) was used for visualization of the nuclear markers ki-67 and sirt6 in fibroblast culture samples by applying secondary antibodies conjugated with a far red - emitting dye (alexa fluor 647; abcam). In both studies (in vivo and in vitro), we used primary monoclonal antibodies to markers ki-67 (1:75; dako denmark a / s), ap-1 (1:200; sigma - aldrich co.), type i procollagen (1:100, lifespan biosciences, seattle, wa, usa), and sirt6 (1:200, alexa fluor 647) and biotinylated anti - mouse immunoglobulins (dako denmark a / s) as secondary antibodies to provide the immunohistochemical reaction . Visualization of the reaction was carried out using the envision detection system kit (dako denmark a / s). In both cases, morphometric investigation was carried out by using a system of computer analysis of microscopic images, which includes a microscope olympus bx46, a digital camera (olympus corporation), and a personal computer based on intel pentium 5 and software morphology 5.2 (videotest, saint - petersburg, russia). We measured the optical density (in cu) and the area of immunopositive expression, which was calculated as the ratio of the area occupied by immunopositive cells (or nuclei) and the total area of cells (or nuclei) in the field of view (in%). Statistical analysis of experimental data included calculation of the arithmetic average, the standard deviation, and the confidence interval for each sample, which was performed using the program statistica 8.0 . (dell; statistica, round rock, tx, usa). To analyze the distribution of species nonparametric procedures, including one - way analysis of variance (kruskal wallis), were used to verify the statistical homogeneity of several samples . In cases where the variance analysis revealed a statistically significant heterogeneity of multiple samples for subsequent detection of heterogeneous groups (through their pairwise comparisons), we used multiple comparison procedures such as the mann whitney u test . It was shown that in a control sample, with the saline injected, the size of the matrix prevailed in relation to the area of collagen and elastic fibers (figure 1a). A moderate increase in the matrix was revealed without any change in the structure of the fibers after administration of hyaluronic acid (figure 1b). During the histological study, it was revealed that the maximum area of the fibers relative to the matrix was observed in the samples after administration of aq (figure 1c) that was determined by the increase in the thickness and density of collagen fibers . The study of the extracellular matrix component expression of the type i collagen precursor type i procollagen was conducted to explore the synthetic activity of dermal fibroblasts . The optical density of expression was measured, as it is the most informative for this marker and characterizes the intensity of immunohistochemical reaction in the samples . Indirectly, it gives an indication of the amount of test substance in the samples . The maximum value of optical density of the type i procollagen expression was observed in the sample with double injection of aq, which was 0.285 cu, it was also high in the other three samples with a single administration (0.260 cu, 0.273 cu, and 0.278 cu, respectively), indicating a dose - dependent stimulation of the procollagen synthesis and a noticeable effect with an increase in the number of treatment sessions . The minimum value of optical density was observed in the control group and in the samples treated with hyaluronic acid (0.175 cu and 0.194 cu). The obtained data were confirmed using the confocal laser scanning microscopy studies . The three - dimensional reconstruction of collagen fibers was formed by means of thick slices of the specimens and fluorescent labels conjugated with antibodies to type i procollagen . By comparing the volume ratios, it was found that the area of newly synthesized type i procollagen with the injection of aq is two times larger than that in the comparison groups (figure 2). The formation and maintenance of collagen fibers not only promotes the synthesis of procollagen by skin fibroblasts but also slows down the process of collagen degradation . The transcription factor ap-1 is one of the main factors regulating the destruction of collagen fibers . In terms of the area of the transcription factor ap-1 expression, there was a tendency to reduce it in the samples with the aq administration, where it ranged between 2% and 6%, while in the samples with the introduction of hyaluronic acid and in the control group, it was within 7%14% . We studied the protein sirt6 to evaluate the activity of skin protective mechanisms from premature aging . It is known that this protein is involved in many processes in the cell, such as dna repair, telomere elongation, and glycolysis . The area of immunopositive nuclei was assessed by marker for sirt6 in relation to the total number of nuclei in the dermis in the field of view and expressed as percentage . The analysis of the data by the area of immunopositive nuclei expression to sirt6 revealed that there was an increase in the number of immunopositive nuclei compared with that in the control samples even after a single injection of aq . Thus, aq could improve skin aging by affecting bioactive molecules such as sirt6 and ap-1, promoting division of fibroblasts and expression of collagen de novo . The skin on a skin is rejuvenation through reducing wrinkles and improving skin elasticity by generating new skin cells . Comparative analysis of the injectable preparation effect on the synthetic activity of fibroblasts of mature and senescent skin models showed a significant increase in the area of type i procollagen expression in groups with the administration of aq and aq br compared to the control group (table 1). The introduction of the investigated preparations promotes the synthesis of collagen by skin fibroblasts de novo . However, the response of fibroblasts was weaker at passage 15 than in younger passages . These findings were confirmed by experiments in vivo, when the synthesis of collagen in the ultraviolet - protected skin of old people (80 years) was reduced by ~75% in relation to collagen synthesis of young people (1829 years).17 stimulating effects of aq and aq br cosmeceutical products on the proliferative activity of human skin fibroblasts were detected in cell culture . Even in aging cell cultures, the parameter of the relative number of immunopositive nuclei to ki-67-marker was two times higher than that in the control group (figure 3). The study of the transcription factor ap-1 in the cell culture of the skin fibroblasts revealed a statistically significant decrease in the area of expression in groups with the introduction of aq and aq br by 2.1 and 3.1 times, respectively, than that in the control group . Statistically significant differences were identified only at the effect of aq, indicating dermatogenic protective action of the investigated substances, realized through antidegradation of collagen fibers . The expression of sirt6 protein was revealed by cell cultivation of skin fibroblasts in all the three groups . The maximum amount of immunopositive nuclei was observed in the culture of fibroblasts incubated with aq br at passage 7, but this value was not statistically different from the data of the group with the introduction of aq . Biomimetic peptides contributed to an increase in the area of immunopositive nuclei by 79% after incubation with aq br and by 77% with the introduction of aq (table 1). This indicates the start of the mechanisms of dna stability maintenance, protection of telomeres, and other processes preventing aging . In the future investigation, it will be interesting to use real - time polymerase chain reaction and enzyme - linked immunosorbent assay methods to confirm data obtained in this study and expand knowledge of action of biomimetic peptides on skin aging processes . The immunohistochemical studies revealed the molecular mechanisms of the clinical effects (lifting effect, remodeling of the dermis with filling of small wrinkles, dermoprotective effect on the elastic matrix of the skin, improvement in skin resistance to aggressive environmental factors and mutations) observed with intradermal administration of aq both in vitro (in cell culture of human fibroblasts) and in vivo (in biopsies of human skin).
|
Dyes are a group of additives used to improve the appearance of foods, textiles, and medicine allowing the homogenizing and the assertion of the color, which is the most important sensory characteristic . Synthetic dyes have been used because they are more resistant to changes in temperature and acidity than natural dyes . All of these compounds contain a chromophore group and different substituents resulting in a large group of synthetic dyes, each with particular chemical properties . The main feature of these compounds is the presence of an azo group (n = n) and aromatic groups, resulting in a substance with high electron conjugation and a high molar absorption coefficient, making it useful at low concentrations . Tartrazine, also known as yellow 5 or e 102 dye, is one of the most important synthetic azo dyes used in the food industry to confer a yellow color to food . It is soluble in water (14 mg/100 ml) giving a yellow color to the solution . It is usually applied in pastries, baked goods, snacks, drinks, biscuits, ice cream, and other sweets . In spite of its useful qualities, tartrazine has also been associated with allergenic effects, hyperactivity, and attention deficit disorder . For this reason, the toxicity of tartrazine was studied in the early 60s by the expert committee on food additives of fao / who, which established an acceptable daily intake (adi) of 7.5 mg kg of body weight per day . Moreover, since 2010, foods containing tartrazine must carry the warning may alter the activity and attention in children . In mexico, this dye is regulated according to the official mexican standard nom-218-ssa1 - 2011 which allows 100 mg l as the maximum amount of tartrazine in commercial beverages . In general, the methodology for the quantification of dyes involves a sample treatment, identification, and quantification steps . The chosen method depends on the type of food and the lipid, protein, and carbohydrate content . Other properties such as acid - base properties of the analyte and the interferences present in the sample matrix are also important . Thus, when liquid chromatography, capillary electrophoresis, and electrochemical techniques are used, it requires a simple treatment of the sample, usually dilution and subsequent filtration . However, these instrumental methods have certain disadvantages such as the high cost of analysis (equipment and reagents) and lower analysis rate (24 samples per hour) [8, 9]. On the other hand, if the determination of dyes is completed using a quick and simple spectrophotometric technique, it must be considered that the presence of preservatives (sodium benzoate or citrate) and proteins may interfere significantly during the quantification step . According to this, the isolation of the sample dye using different extraction materials is critical during the analytical process . Anion exchange, where acid dyes are retained by sulfonic groups present in the polymer structure, and liquid - liquid extraction (n - butanol - water) based on the formation of ion pairs with trimethyloctadecylammonium salts have been proposed . The solid phases used for this purpose were zeolite or silica c18; the retained dye was eluted from the solid phase with methanol [12, 13]. Additionally, activated carbon has been proposed as colorant adsorbent because it has an excellent surface area and a well - defined pore structure that favors the retention of the analyte [1417]. Despite its versatility, the activated carbon has the disadvantage of being difficult to separate from the aqueous matrix where it was dispersed . In order to facilitate separation of the extraction support from the liquid phase, afakov and afak mspe is based on the use of magnetite - modified activated carbon as the solid phase with paramagnetic properties . For this reason, the support can be easily isolated from the dispersion medium by applying an external magnetic field . The main advantages of mspe are as follows: (1) presenting the possibility of using large volumes of samples, greatly reducing the time of pretreatment and the analysis result; (2) having great interaction between analytes and the solid phase with the full dispersion of the adsorbent in the sample; and (3) providing easy isolation of the adsorbent from the analytical matrix, reducing the risk of loss of analyte . In spite of their promising qualities, the mspe has been used mainly for the separation of antibiotics and other organic molecules . The use for the extraction of dyes has been limited to the determination of reactive red 198, and methylene blue . In all cases, the main advantage of the adsorbent support was its selectivity in the extraction of the analyte and the possibility of using volumes from 100 to 1000 ml, providing shorter analysis times as compared to conventional techniques . According to the above - mentioned, the purpose of this work is to design a methodology based on magnetic solid phase extraction using magnetite - modified carbon for the spectrophotometric analysis of tartrazine . The method was used for the analysis of this dye in a complex matrix of nonalcoholic beverages . For the synthesis of the magnetite - modified carbon, a commercial activated vegetable carbon from clarimex s.a . The synthesis was performed in two stages: in the first stage, magnetite was obtained by precipitation and its partial oxidation of iron (ii) sulfate heptahydrate feso47h2o (3.6 g). The iron precursor was dissolved in 100 ml of deionized water, stirring constantly and keeping at 60c . The ph solution was adjusted to 10.0 0.2 and a stream of air was passed through the reaction mixture . The initial green precipitate (fe(oh)2xh2o) turned black after 40 minutes of reaction as a consequence of the partial oxidation of fe(ii) to fe(iii) by the action of the o2 from the air stream; the black color of the precipitate is characteristic for fe3o4 . In the second step, 1.0 g of activated carbon was added to the reaction vessel and the mixture was stirred for 30 minutes . The magnetic phase was separated with a magnet and washed three times with distilled water . The solid phase was dried at 60c for 24 h. the solid phase was pulverized in an agate mortar and stored in a desiccator until use . In order to carry out the characterization of the synthesized magnetite - modified carbon, various instrumental techniques were used . X - ray powder diffraction analysis was performed in a philips pw1710 instrument equipped with a copper anode and an automatic divergent opening . The conditions for the analysis were 1.54 cuk radiation; 40 kv voltage tube; 30 ma current tube; 0.500 intensity ratio (a2/a1); 1 divergence slit; 0.1 receiving slit; (2) 5 initial angle; (2) 70 end angle . Morphological analysis of the solid was performed in a scanning electron microscopy (sem) jeol jsm-820 . Qualitative analysis and determination of the distribution of magnetite in the solid were performed with a link qx-2000 analyzer by energy dispersive x - ray spectroscopy . All spectra were obtained at 15 kv, a distance of 39 mm, and 2,500 counts; the detector angle relative to the sample in all cases was 45. for the extraction studies, 0.05 g of magnetite - modified carbon was mixed with 20.0 ml of aqueous solution of tartrazine and stirred mechanically for 30 minutes . The ph value for tartrazine solution was varied using acetate (ph = 5.0), phosphate (ph = 7.0), and borate (ph = 9.0) solutions at 1.0 mol l concentration . After the extraction, the solid phase was separated using a neodymium magnet and the remaining liquid phase was analyzed by spectrophotometry at a wavelength of 434 nm in a uv - vis spectrophotometer hach dr-2700 with a quartz cell with 1.0 cm of path length . Thus, the remaining tartrazine was quantified by interpolation in a calibration line constructed with standard solutions of tartrazine (10.0100.0 mg a control experiment was carried out using activated carbon in order to evaluate the effect of the magnetic modifications in support of the tartrazine extraction . For the elution of the retained tartrazine from the synthetized support, several eluting systems were evaluated following this procedure in triplicate: 50 mg of solid phase containing tartrazine was mixed with 2.0 ml of eluent and stirred using ultrasound for 5 minutes . 2 ml of the resulting solution was transferred to a 10 ml volumetric flask and filled with eluent solution up to the mark . The eluted tartrazine was quantified by interpolation in a calibration line constructed with absorbance values of standard solutions of tartrazine (10.0100.0 mg six samples of commercial beverages containing tartrazine were analyzed in triplicate following this protocol: 10 ml aliquot of the drink was mixed with 2.5 ml of 1.0 mol l acetate buffer solution and transferred to a 25 ml volumetric flask and then deionized water was added up to the mark . Later, 20.0 ml of this solution was placed in a polypropylene tube containing 75 mg of magnetic support and mechanically stirred for 30 minutes in order to extract the dye . After the extraction, the solid phase was removed from the aqueous matrix using a neodymium magnet . The solid phase was then mixed with 1.0 ml of eluent and stirred for 5 minutes using ultrasound to remove the extracted tartrazine . The liquid phase was transferred to a 10 ml volumetric flask and filled with elution solution up to the mark . The concentration of tartrazine in the last solution was determined spectrophotometrically . In order to evaluate the proposed methodology, this method considers a calibration line using standard solutions of tartrazine from 5 to 20 mg l. samples were prepared as follows . An aliquot of 0.5 ml was diluted adding a mobile phase up to 5 ml . In order to introduce the samples to the chromatographic system, it was necessary to filter it using membranes of 0.45 m pore size . Instrumental techniques were used to provide information about the composition and structure of the magnetic modified carbon . Thus, the x - ray diffraction (xrd) studies were performed in order to determine the iron oxide form present in the solid . The xrd diffractograms from figure 1(a) show the signals labeled as m that correspond to the characteristic diffraction lines of fe3o4 (2 = 30.1, 35.5, 43.1, 53.4, 57.0, and 62.6) according to the joint committee on powder diffraction standards . The broadband signal observed between 20 and 30 for the 2 angle (figure 1(b)) is characteristic of amorphous carbon, the raw material . The morphological study with scanning electron microscopy (sem) for activated carbon shows a uniform phase with inhomogeneous particle sizes greater than 20 m (figure 2(a)). The micrograph is consistent with sem studies performed without modifying the activated carbon . In the case of the synthetized support, it can be seen that the activated carbon is covered by a phase with a smaller size (figure 2(b)). This was confirmed with the energy dispersive spectrum (figure 2(c)) that shows a larger amount of carbon for the section (i), while the fe - content is greater for the area (ii), so it is concluded that the magnetite phase is covering the activated carbon . The extraction of tartrazine from standard solutions using the synthetized modified carbon is shown in figure 3 . The capability of the synthetized modified carbon for the extraction of tartrazine was also evaluated at different ph values . The results shown in figure 4 correspond to acidic, basic, and neutral medium adsorption isotherms constructed by plotting the concentration of tartrazine in the solution at equilibrium (m) against the concentration of the sorbate on the solid phase (mmol kg) after adsorption . Additionally, table 1 shows the maximum quantity of adsorbate on the solid support at different ph values . According to figure 4 and table 1, the decrease of ph values results in the increase of the amount of absorbed tartrazine . This is consequence of the interaction of tartrazine in its anionic form with the acid form of the magnetite at low ph values . In basic medium a repulsion between the negative charges of tartrazine in solution and the support is reflected in the reduction of the adsorbate retention . Based on these results, ph of 5.0 was selected as the most suitable value for the retention of dye . As part of the characterization of the mspe - dye system, the analysis of the isotherm values using a scatchard plot demonstrates the value of the affinity constant k d for the following dissociation reaction: (1)tst+s, where ts corresponds to tartrazine adsorbed on the support, t is the tartrazine in solution, and s is the magnetic modified carbon support . Logk d values are shown in table 2, observing a linear trend which is associated with the homogeneity of the support . Because this is a dissociation constant, it follows that the support with a higher affinity is the activated carbon; however, the synthetized support has a suitable logk d value because in the retention - elution methodologies design, it is recommended that the support has an average affinity to the substrate with logk d values between 7.0 and 4.0 . Additional studies on the selection of the best chemical conditions for the tartrazine elution adsorbed on the magnetic modified carbon were performed . Thus, several eluting systems were evaluated for the elution step: methanol, acetonitrile, basified methanol, and basified acetonitrile [28, 29]. After the spectrophotometric analysis of the eluted tartrazine, it can be seen that basified methanol provides the greater signal (table 3) as a consequence of removing a greater amount of tartrazine . For this reason, this eluent was chosen for elution of tartrazine in the following experiments . To optimize the conditions for the retention and elution of tartrazine involved in the mspe system the main advantage of this technique is that it provides useful information with minimal experimentation using matrices of special design (orthogonal arrays), in which columns (factors or controllable parameters) and rows (experiments) are accommodated in such a way that a combination of factors and levels of each experiment are indicated . The selected response factor was the percentage of recovery for the analysis of 20 ml of a solution of 30 mg l tartrazine . The selected control factors (parameters), each at 3 levels, were sample volume, volume of eluent, mass of magnetic modified carbon support, and naoh concentration in the eluent . Based on an l9 (34) taguchi orthogonal array, figure 5 shows a typical graph obtained by plotting the average percentage of recovery for each factor against each of its levels . According to this, the most suitable conditions for tartrazine adsorption - elution were 20 ml sample, 1 ml of eluent, 75 mg of magnetic modified carbon, and a concentration of 0.25 mol l naoh for the basified methanol solution . These conditions correspond to experiment number 4, which has the highest percentage of dye recovery . Additionally, the contribution percentage of each variable was determined by ascertaining that naoh concentration in the eluting solution has the greater effect (45.4%), followed by the sample volume (23.6%), the mass of adsorbent (20.4%), and the eluent volume (10.6%). The higher contribution of the eluting solution in the tartrazine elution step confirms the theory of charge - repulsion between support and analyte, which is favored at a higher concentration of naoh . Under the optimized conditions described above, calibration lines using tartrazine standard solutions in the concentration range of 5.0 to 30.0 mg the obtained signal (au) was measured in triplicate and the calibration lines were plotted using the average signal of the eluted tartrazine . Calibration lines show a linear dependence between the average signal and the concentration of tartrazine present in the initial standard solution . Reported in table 5, it can be seen that the proposed methodology allows for the quantification of tartrazine in drinks at levels established by the official mexican standard nom-218-ssa1 - 2011 which allows 100 mg l as the maximum amount of tartrazine in commercial beverages . Several nonalcoholic beverages containing tartrazine also have additives as proteins and preservatives that improve physical appearance and shelf life . For this reason, the tartrazine adsorption - elution method was evaluated adding several interfering compounds . The evaluated interferents included casein, egg albumin, acesulfame k, sodium benzoate, aspartame, sodium citrate, glucose, and sucrose . Solutions of each interfering compound were prepared dissolving 10 mg in 10 ml acetate buffer . To perform the test, 75 mg of magnetic modified carbon was mixed with 20 ml of 30 mg l tartrazine solution and 3 ml of interferent solution . After this absorption step, 1 ml of basified methanol with naoh 0.25 mol l was used to elute tartrazine . Then 0.5 ml of the eluted solution was transferred to a 5 ml volumetric flask and filled up to the mark . Results did not show a% rsd value higher than 5% of the analytical signal in a similar experiment without interferents . According to this, the main components of every beverage that were reported by the manufacturer are listed in table 6 . Following the developed and optimized method, additionally, in table 7 it is possible to observe the results for the analysis of samples using the hplc reference method and mspe - hplc (figure 6). For each beverage, the average concentration of tartrazine obtained using both methods was compared using a t - test with 2 degrees of freedom and 95% of confidence (t tab = 4.3). Additionally, the mspe is a robust preconcentration technique that can be coupled even to spectrophotometry or hplc . In the present work, an activated carbon covered with magnetite support was synthesized; this support has magnetic properties that allow its separation by applying an external magnetic field . The best conditions for the extraction and elution of tartrazine were an initial sample volume of 20 ml, buffered with acetate buffer solution, at ph 5, and mixed with 75 mg of magnetic modified carbon, tartrazine elution with 1 ml of naoh 0.25 mol l in methanol . Thus, the proposed sample treatment coupled to spectrophotometric analysis is an alternative to the analysis of azo dyes in the food industry because the parameters, analytical precision, and accuracy are similar to hplc methodologies . However, the proposed methodology saves time and is less expensive than the reference method.
|
A 44-year - old female without any previous medical history visited our clinic because of the sudden onset of intermittent blurred vision in her left eye . Her best - corrected visual acuity (bcva) was 20 / 22 and fundus examination revealed multiple retinal, preretinal, and subretinal hemorrhages throughout the retina with tortuous retinal veins in her left eye (fig . Arteriovenous transit time was slightly prolonged to 19 seconds and there was faint leakage in the late phase, but no signs of any vascular non - perfusion (fig . Cardiologic and neurologic work - up and laboratory tests (homocysteine, protein c and s, fibrinogen, anticardiolipin antibodies, and lupus anticoagulants) were normal except for weakly positive anticardiolipin igm and mild iron deficiency anemia . We decided to observe the patient for the following two weeks without making a diagnosis . Two weeks later, her bcva was slightly decreased to 20 / 25, and an increased number of retinal hemorrhages with severe disc swelling were noted (fig . At this time, the patient preferred to undergo medical intervention to improve her subjective symptom . We discussed with her that the drainage site of the retinal vein is located in the lamina cribrosa within the optic nerve and an intravitreal dexamethasone implant may help alleviate the progression of the vein occlusion by reducing optic nerve edema . The patient agreed to the treatment and an intravitreal dexamethasone implant 0.7 mg was injected . Five days later, her bcva was 20 / 22 and there were improvements in disc swelling and retinal hemorrhage (fig . One month later, her bcva improved to 20 / 20 and her subjective visual symptom was completely improved . Fundus examination revealed marked improvement of retinal hemorrhages and vascular tortuosity along with almost complete resolution of disc swelling (fig . A compartment syndrome at the site of the lamina cribrosa is thought to be the key mechanism in the pathophysiology of crvo . The current treatment strategy for crvo is typically directed to complications such as me or neovascularization rather than the venous occlusion itself . Although many studies have already shown the benefits of anti - vascular endothelial growth factors or steroids for the treatment of crvo - associated complications, this case suggests that even in early crvo, if associated with optic nerve swelling, steroid treatment could decrease disc swelling, thereby relieving compartment obstruction and improving vascular hemorrhage . Steroids may reduce the disc swelling, which subsequently decreases the pressure of the scleral ring and may improve the venous outflow . This may potentially change the natural course of disease progression of crvo and its various subsequent complications.
|
Meningitis is the inflammation of meninges that results in many signs and symptoms . A wide variety of causes include infectious and noninfectious are important . Among the infectious causes of meningitis, some result in chronic meningitis that defines as the signs of meningitis last for weeks to months . In this group, fungal and tuberculosis (tb) are important causes; and tb meningitis is the commonest cause . Central nervous system (cns) infection due to tb includes three clinical categories: meningitis, intracranial tuberculoma, and spinal involvement . All these forms of cns infection are encountered frequently in regions where the incidence of tb is high . Central nervous system tb accounts for about 5% of all cases of tb . Among various forms of extrapulmonary tb, tuberculous meningitis (tbm) is the most severe form and remains a major global health problem with a high mortality rate . Early recognition of tb meningitis is of paramount importance because the clinical outcome depends greatly upon the stage at which therapy is initiated . According to the serious complications and sequels of tbm, it is important to be aware of the prevalence of these entities in any region and also to diagnose rapidly and properly and avoid from inappropriate treatment . One of the new methods that could provide important aids for the diagnosis of tb meningitis is cerebrospinal fluid (csf) polymerase chain reaction (pcr). Pcr as a diagnostic test for tbm has a sensitivity of 50% and a specificity close to 100% . Use of real - time pcr for tb results in early diagnosis and treatment, therefore, results in decreasing mortality and morbidity . Our country is in the neighborhood of the area with endemic tb, and we have a lot of immigrants from those countries repeatedly . Because of the pcr is so specific and considerably better than tb culture and smear our study was designed to evaluate tb pcr positive rate in patients who present with fairly long symptoms of meningitis . To answer this question: is there any tb pcr positive in cases with nontypical clinical picture of meningitis? Patients were recruited at alzahra hospital and kashani hospital, top referral hospitals in isfahan, iran . They had symptoms compatible with cns infection (for example fever, headache, loss of consciousness, nausea, etc .) With or without meningeal sign(s) in physical examination (neck stiffness, kernig's sign, brudzinski's sign). The patients with more than 1-week of symptoms initiation were evaluated; in the other hand the patients were in the subacute phase . If there was no contraindication for performing a lumbar puncture (lp), lp was done . Patients with pleocytosis in the csf (csf white blood cell> 5) entered the study; also these patients were received no more than one dose of antibiotics . Although in typical tb meningitis there is significant pleocytosis with lymphocyte predominance and high csf protein levels and significant decrease of csf glucose levels (hypoglycorrhachia), but in the first 2 - 3 weeks of symptom initiation, typical csf pattern of tb meningitis may be absent . So not only typical or suggestive tb meningitis csf patterns entered, but also patients with normal or mildly increased levels of csf protein, normal or mildly decreased csf glucose levels, neutrophil predominance were entered the study . In the other hand, patients with mass - like lesion in imaging, brain abscess, hiv positive, posttraumatic, abrupt onset of symptoms, postsurgery and children were excluded . Was obtained from the patient or a close relative for those who are unstable or unconscious at the time of presentation . Required information including age, gender, main complaint, other symptoms of the disease, duration of the symptoms onset before hospitalization, records of close contact, patients underwent a detailed workup for meningitis including blood investigations, imaging (chest x - ray, computed tomography [ct] scan and/or magnetic resonance imaging as and when indicated). Following a lumbar puncture with standard and sterile method, about 10 ml csf was obtained, transported to the laboratory within 1 h, and divided into two tubes: 1 (1 - 2 ml) for csf cells, protein and glucose, bacterial smear and culture and 1 (8 - 10 ml) for tb pcr testing . Dna was purified from 200 l of centrifuged deposit of csf sample using dna extraction kit (roche, germany) with standard dna extraction protocol . Three sets of primers targeting different regions of the mycobacterium tuberculosis genome were: primer 1(5-ggctgtgggtagcagacc-3), primer 2(5-cgggtccagatggcttgc-3), probe(5-fam - tgtcgacctgggcagggttcg - tamra-3). Then pcr was performed in real time pcr (qiagen - rotor gene - q) system with the thermal cycling according to the following program: 95c for 6 min 1 time then ended by temperature cycling 95c for 15 s and 58c for 20 s and 72c for 10 s in 40 times . In each run all statistical analyses were performed by student's t - test and fisher's test . Patients were mostly male (69.8%), with a mean age of 43.69 22.67 years . No statistically significant difference was detected between age of men and women by student's t - test (p = 0.2). In figure 1, the most common age group of patients hospitalized with the diagnosis of meningitis was 20 - 29 years (33 patients-20/4%). Frequency of age group in this study cerebrospinal fluid reverse transcription - pcr results in 6 patients (3.7%) were positive for tb dna . In other words, the frequency of positive tb dna was in male 5.3% and female 1.4%, respectively . According to fisher's test, there was no significant difference between the sexes (p = 0.99) [table 1]. Distribution of tb dna by sex the mean age of patients with tb pcr positive was 43.6 26.39 years, and tb pcr negative was 45.31 22.15 years . Using t - test, no significant difference was observed between the two groups (p = 0.87). In figure 2,, there were an estimated 8.8 million incident cases of tb (range, 8.5 million-9.2 million) in 2010, 1.1 million deaths (range, 0.9 million-1.2 million) among hiv - negative cases of tb and an additional 0.35 million deaths (range, 0.32 million-0.39 million) among people who were hiv - positive . In the latest report, who determined 22 high tb burden countries (hbcs) that have been prioritized at a global level since 2000 . Afghanistan and pakistan are in hbcs list, and we have a lot of immigrants from those countries repeatedly . The exact incidence and prevalence of tbm in the most parts of the world are not precisely known . Some epidemiological details of extrapulmonary tb are available from developed countries . In developed countries, despite an overall decrease in numbers of tb cases, the proportion of extrapulmonary tb and tbm cases has increased . In 2005 in iran, the incidence rates of tb had been 25 - 49/100000 population . According to our study, no statistically significant difference was detected between age of men and women . In accordance with previous studies, age and sex, tbm is the most severe form and remains a major global health problem with a high mortality rate . Although national public health services follow a rigorous tb surveillance and treatment regimen to improve the impact of the disease, a better diagnostic test remains to be developed for the prescribed treatment regimen to be followed effectively . Though the detection of mycobacterium by microscopy and culture remains the criterion standard for tubercular diagnosis, poor sensitivity in detection of low microorganism densities in csf and mixed infections pose a significant challenge . In addition, the time required for lowenstein - jensen cultures is about 8 weeks, which makes it unsuitable as a routine technique for rapid confirmatory diagnosis . Thus, diagnosis basically remains presumptive and is based on clinical symptoms, neurologic signs, csf findings, ct scans, and response to anti - tb drugs . The csf pcr assay represents a significant advance in the diagnosis of microbial diseases and tbm is no exception . The detection of mycobacterium tuberculosis dna in csf samples using pcr is widely used diagnostic method because of its speed . A proper selection of mycobacterium tuberculosis - specific dna and a caution against contamination of csf specimens are important for obtaining high specificity . Entirely the most studies found low sensitivity for this test in tbm diagnosis (about 50%) however, the specificity was as high as 98% . The overall all of them believe in high specificity of pcr, so we designed this study to evaluate tb pcr positive rate in patients who present with fairly long symptoms of meningitis . Other studies such as in thailand found that tbm was the second most important cause of chronic meningitis in their survey reflecting the importance of infectious diseases in tropical countries . In a series of 83 cases of chronic meningitis from new zealand, the most common diagnosed entity was tbm, which was found in 40% of the patients that is higher than our study finding . Cases in our study were patients that their symptoms had not been started so acute or sudden, whereas they have investigated chronic meningitis that defines as suffering meningitis signs and symptoms for at least 4 weeks . Tuberculous meningitis is both an insidious disease, and it can have an atypical clinical picture so that the onset of tbm may manifest as acute or subacute meningitis . Identification of patients according to standard case definitions is important because early recognition and treatment of the disease is believed to be able to reduce the burden of this disease, lowering complication and mortality . First, due to budget limitations and few numbers of cases with lasting symptoms of meningitis, we could only select 162 samples . Second, determining tb on acid fast bacilli (afb) staining smear needs a large amount of csf, but according to our patient's conditions, it was impossible to provide large csf sample . Third, as tb culture lasts 6 - 8 weeks to be positive and has low sensitivity, we did nt perform this test . Further study with evaluating pcr, afb smear and tb culture with larger sample size may be needed . There are some important limitations to our study . First, due to budget limitations and few numbers of cases with lasting symptoms of meningitis, we could only select 162 samples . Second, determining tb on acid fast bacilli (afb) staining smear needs a large amount of csf, but according to our patient's conditions, it was impossible to provide large csf sample . Third, as tb culture lasts 6 - 8 weeks to be positive and has low sensitivity, we did nt perform this test . Further study with evaluating pcr, afb smear and tb culture with larger sample size may be needed . Given that we live in iran and in the vicinity of the tb endemic countries, if we face a meningitis case with lasting symptoms and tendency to be chronic, tbm should be considered . Ksh was contributed in concept, design, definition of intellectual content, clinical studies, manuscript preparation, manuscript editing, and manuscript review . Zti was contributed in literature search, clinical studies, data acquisition and manuscript preparation . Fkh was contributed in design, definition of intellectual content and manuscript editing and manuscript review.
|
Glaucoma is the second leading cause of blindness globally.1 from 1991 to 1999, primary open - angle glaucoma prevalence increased from 4.6% to 13.8% among the elderly.2 its treatment is aimed essentially at lowering intraocular pressure (iop) by eye drop instillations, reserving surgery or laser surgery for the most severe cases . Several classes of medicine are available, ie, prostaglandin analogs, miotics, beta - blockers, alpha - adrenergic agonists, and carbonic anhydrase inhibitors . Glaucoma treatment principles and options have been reported by the european glaucoma society.3 successful treatment depends upon strict lifetime adherence to the instillation schedule . Thus, higher adherence is associated with better iop control, on average,4 and a lower risk of eventual blindness.5 however, patients perceive few symptoms in the early stages, whereas eye drops (with potential side effects) are needed daily and may become a burden, leading to poor treatment adherence.6 adherence to treatment schedules has been examined by numerous studies in glaucoma, using various methods . For example, the medication possession ratio, determining the mean proportion of days during a given period when patients possess medication, was calculated from insurance claims or prescription databases,79 and from electronic devices capturing drop counts.10 alternatively, patients self - declared compliance was obtained from interviews1113 or standardized questionnaires.8,1418 another difference between studies were noncompliance criteria, eg, patients who missed more than two doses per week18 or possessed insufficient drops for the specified period (medication possession ratio <1).5 with this array of methodology across different drug classes and countries, compliance rates varied from 59% to 77%.7,11,14,16,1821 more informally, imperfect compliance is consistently reported among glaucoma patients . To improve glaucoma care, it is critical to identify patients who may not adhere to treatment . Factors conducive to noncompliance have been explored . For example, complex dosing regimens have an impact on compliance.19,22 however, barriers cited by most studies relate to patients perception and knowledge about their illness and its treatment.7,11,16,18 these considerations prompted the development of an eye - drop satisfaction questionnaire (edsq) which asks patients to self - report their satisfaction and compliance with topical ophthalmic treatments.23 replies to these questions should be relevant to an exploration of noncompliance in glaucoma patients . A suitable technique for analyzing such data is a bayesian network (bn) which facilitates the representation and manipulation of information . A bn is a directed acyclic graph representing relationships between variables (nodes in the graph) with a related set of conditional probability tables that characterize local dependencies between the various nodes . Hence, it provides a powerful tool to study interdependencies between complex processes, such as patient behavior . The objective of this study was to identify poorly compliant glaucoma patients by exploring edsq data . The protocol was reviewed and approved by the comit consultatif sur le traitement de linformation en matire de recherche dans le domaine de la sant and the commission nationale informatique et libert.2426 this research was conducted according to the tenets of the declaration of helsinki.27 this multicenter study was conducted in france by 17 ophthalmologists (at 17 sites) specializing in the treatment of glaucoma, who also prescribed travalert, a computerized device that reminds patients to instill eye drops, assists with instillations, and records dosing times . The accuracy of travalert for measuring treatment adherence has been described elsewhere.28,29 ophthalmologists recruited patients who used the device and gave informed consent before participating . At the inclusion visit, general comorbidities (cardiovascular, central nervous system, hepatic diseases, diabetes, pulmonary diseases, digestive diseases, others) and eye comorbidities (macular degeneration, diabetic retinopathy, retinal detachment, cataract, uveitis, others) were collected . Patients included used the travalert device for at least eight weeks, were 18 years of age or older, and diagnosed with either primary open - angle glaucoma (including juvenile glaucoma, exfoliative glaucoma, pigmentary glaucoma, or normal - tension glaucoma) or high iop . Patients with secondary glaucoma (congenital glaucoma, inflammatory glaucoma, angle - closure or narrow - angle glaucoma following cataract surgery), or took an anticoagulant three times per day or more, and patients with chronic eye dryness requiring instillations of more than five drops a day, were excluded . According to a previous clustering analysis, data collected with the travalert device allowed the patient sample to be categorized according to three compliance profiles, ie, high compliance, moderate compliance, or low compliance.4 the edsq is a self - assessment questionnaire that assesses patient satisfaction and compliance with eye - drop treatment for glaucoma or iop . First, patient and clinician interviews were conducted to determine an appropriate conceptual model and obtain patients ratings . Second, a comprehension evaluation was undertaken to ensure the questionnaire s clarity, ease of comprehension, and cultural equivalence.23 the questions are scored on a 15 likert scale . A scoring algorithm for the 21-item questionnaire was also developed and shown to have satisfactory validity and reliability.30 the edsq algorithm computes scores (0100) for six dimensions of attitudes towards eye - drop treatment, ie, treatment concern (five items), disease concern (two items), satisfaction with the patient clinician relationship (five items); positive beliefs (three items), treatment convenience (three items), and self - declared compliance (three items). Edsq data were collected at the follow - up visit when the travalert data were collected from the patient . Patients who completed the edsq and provided sufficient travalert data to define their compliance profile were included in the analysis . An oversampling method was adopted to increase the ability of the bn to identify risk factors for noncompliance.31 this involved randomly selecting patients from the smallest group (low compliance) as successive replacements to create a sample equal to the largest group (high and moderate compliance). A uniform (all patients had the same probability to be sampled, without site stratification) sampling method was used because the small sample size did not authorize strong distribution estimates . The objective was to achieve a ratio of one patient with low compliance to one with high or moderate compliance . A bn is a form of probabilistic graph, representing a joint probability distribution of a set of variables with explicit independency assumptions . It is a directed acyclic graph, ie, without cycles and has edges that are orientated . It is composed of a set of nodes (each node represents one variable modeling the process of interest) and a set of conditional probability tables encoding local dependencies between the nodes / variables . Bns are often used to identify structure of the information when very few hypotheses could be identified a priori . A bn was constructed to identify poor compliers by discriminating between low - compliance and moderate- or high - compliance patients . Center was not included in the bn due to the numbers of patients per center being too small . Algorithm to scores derived from the bn learning algorithm.32 a score denoted the minimum description length, and was two fold; the first part qualified the network with respect to its structural complexity and the second part measured the goodness - of - fit between the network and the data . With a given order of nodes, it is simple to determine the best bn, because each node looks to its best parent, ie, its immediate predecessor amongst all available nodes . The goal of taboo order is to search for the order of nodes resulting in the best bn value (highest minimum description length score), and to this end uses taboo search.33 this algorithm is fully driven by the data, is fully inferential, and with no clinical expert input . Missing data were inferred according to the expectation - maximization structural method . Because bn requires categoric variables, edsq scores were categorized by dichotomizing (thresholds were determined while estimating the bn) them according to a decision tree - based algorithm aimed at maximizing the detection of low compliance . Descriptive analyses were performed using sas for windows v9.2 (sas institute, inc ., cary, nc) and bn was obtained using bayesialab v4.6.1 (bayesia, mayenne, france). This multicenter study was conducted in france by 17 ophthalmologists (at 17 sites) specializing in the treatment of glaucoma, who also prescribed travalert, a computerized device that reminds patients to instill eye drops, assists with instillations, and records dosing times . The accuracy of travalert for measuring treatment adherence has been described elsewhere.28,29 ophthalmologists recruited patients who used the device and gave informed consent before participating . At the inclusion visit, general comorbidities (cardiovascular, central nervous system, hepatic diseases, diabetes, pulmonary diseases, digestive diseases, others) and eye comorbidities (macular degeneration, diabetic retinopathy, retinal detachment, cataract, uveitis, others) were collected . Patients included used the travalert device for at least eight weeks, were 18 years of age or older, and diagnosed with either primary open - angle glaucoma (including juvenile glaucoma, exfoliative glaucoma, pigmentary glaucoma, or normal - tension glaucoma) or high iop . Patients with secondary glaucoma (congenital glaucoma, inflammatory glaucoma, angle - closure or narrow - angle glaucoma following cataract surgery), or took an anticoagulant three times per day or more, and patients with chronic eye dryness requiring instillations of more than five drops a day, were excluded . According to a previous clustering analysis, data collected with the travalert device allowed the patient sample to be categorized according to three compliance profiles, ie, high compliance, moderate compliance, or low compliance.4 the edsq is a self - assessment questionnaire that assesses patient satisfaction and compliance with eye - drop treatment for glaucoma or iop . First, patient and clinician interviews were conducted to determine an appropriate conceptual model and obtain patients ratings . Second, a comprehension evaluation was undertaken to ensure the questionnaire s clarity, ease of comprehension, and cultural equivalence.23 the questions are scored on a 15 likert scale . A scoring algorithm for the 21-item questionnaire was also developed and shown to have satisfactory validity and reliability.30 the edsq algorithm computes scores (0100) for six dimensions of attitudes towards eye - drop treatment, ie, treatment concern (two items), satisfaction with the patient clinician relationship (five items); positive beliefs (three items), treatment convenience (three items), and self - declared compliance (three items). Edsq data were collected at the follow - up visit when the travalert data were collected from the patient . Patients who completed the edsq and provided sufficient travalert data to define their compliance profile were included in the analysis . An oversampling method was adopted to increase the ability of the bn to identify risk factors for noncompliance.31 this involved randomly selecting patients from the smallest group (low compliance) as successive replacements to create a sample equal to the largest group (high and moderate compliance). A uniform (all patients had the same probability to be sampled, without site stratification) sampling method was used because the small sample size did not authorize strong distribution estimates . The objective was to achieve a ratio of one patient with low compliance to one with high or moderate compliance . A bn is a form of probabilistic graph, representing a joint probability distribution of a set of variables with explicit independency assumptions . It is a directed acyclic graph, ie, without cycles and has edges that are orientated . It is composed of a set of nodes (each node represents one variable modeling the process of interest) and a set of conditional probability tables encoding local dependencies between the nodes / variables . Bns are often used to identify structure of the information when very few hypotheses could be identified a priori . A bn was constructed to identify poor compliers by discriminating between low - compliance and moderate- or high - compliance patients . Center was not included in the bn due to the numbers of patients per center being too small . Algorithm to scores derived from the bn learning algorithm.32 a score denoted the minimum description length, and was two fold; the first part qualified the network with respect to its structural complexity and the second part measured the goodness - of - fit between the network and the data . With a given order of nodes, it is simple to determine the best bn, because each node looks to its best parent, ie, its immediate predecessor amongst all available nodes . The goal of taboo order is to search for the order of nodes resulting in the best bn value (highest minimum description length score), and to this end uses taboo search.33 this algorithm is fully driven by the data, is fully inferential, and with no clinical expert input . Missing data were inferred according to the expectation - maximization structural method . Because bn requires categoric variables, edsq scores were categorized by dichotomizing (thresholds were determined while estimating the bn) them according to a decision tree - based algorithm aimed at maximizing the detection of low compliance . Descriptive analyses were performed using sas for windows v9.2 (sas institute, inc ., cary, nc) and bn was obtained using bayesialab v4.6.1 (bayesia, mayenne, france). Patients who completed the edsq and provided sufficient travalert data to define their compliance profile were included in the analysis . An oversampling method was adopted to increase the ability of the bn to identify risk factors for noncompliance.31 this involved randomly selecting patients from the smallest group (low compliance) as successive replacements to create a sample equal to the largest group (high and moderate compliance). A uniform (all patients had the same probability to be sampled, without site stratification) sampling method was used because the small sample size did not authorize strong distribution estimates . The objective was to achieve a ratio of one patient with low compliance to one with high or moderate compliance . A bn is a form of probabilistic graph, representing a joint probability distribution of a set of variables with explicit independency assumptions . It is a directed acyclic graph, ie, without cycles and has edges that are orientated . It is composed of a set of nodes (each node represents one variable modeling the process of interest) and a set of conditional probability tables encoding local dependencies between the nodes / variables . Bns are often used to identify structure of the information when very few hypotheses could be identified a priori . A bn was constructed to identify poor compliers by discriminating between low - compliance and moderate- or high - compliance patients . Center was not included in the bn due to the numbers of patients per center being too small . The network structure (relationships between variables) was based on data by applying the taboo order algorithm to scores derived from the bn learning algorithm.32 a score denoted the minimum description length, and was two fold; the first part qualified the network with respect to its structural complexity and the second part measured the goodness - of - fit between the network and the data . With a given order of nodes, it is simple to determine the best bn, because each node looks to its best parent, ie, its immediate predecessor amongst all available nodes . The goal of taboo order is to search for the order of nodes resulting in the best bn value (highest minimum description length score), and to this end uses taboo search.33 this algorithm is fully driven by the data, is fully inferential, and with no clinical expert input . Missing data were inferred according to the expectation - maximization structural method . Because bn requires categoric variables, edsq scores were categorized by dichotomizing (thresholds were determined while estimating the bn) them according to a decision tree - based algorithm aimed at maximizing the detection of low compliance . Descriptive analyses were performed using sas for windows v9.2 (sas institute, inc ., cary, nc) and bn was obtained using bayesialab v4.6.1 (bayesia, mayenne, france). Of the glaucoma specialists, 88.2% were male, 29.4% worked in a public hospital setting, and had qualified on average 16.5 years earlier . They declared 36.7 visits per week for primary open - angle glaucoma and 11.4 for ocular hypertension . Among one hundred and forty patients (78.2%) used the travalert, brought it back to the visit, with successful data transfer to the investigator computer . Among the 140 transferred files, 113 (80.7%) provided reliable data (compliance fully documented for at least eight weeks) sufficient for the classification algorithm . Technical criteria to participate to the clustering algorithm have been published elsewhere.4 the characteristics of patients meeting the inclusion criteria are presented in table 1 . The gender ratio was balanced, mean age was 65.1 years, 16.6% had undergone surgery for primary open - angle glaucoma, and 10.1% had received laser therapy . At the inclusion visit, worst eye mean iop was 16.4 mmhg and best eye mean visual acuity was 8.80 . The frequency of high compliance (56.6%) was much greater than that of low compliance (22.1%). The bn (figure 1) shows three nodes directly related to travalert - identified compliance, ie, patient treatment concern has three drivers, which are disease concern, gender, and positive beliefs, and itself impacts on the patient . Two subgroups of patients had a noticeable distribution across groups defined according to treatment concern score (table 2). 47.018 were markedly more likely to have a treatment concern score of> 24.197 than the total population . Second, patients with a disease concern score of <47.018 and a positive beliefs score> 61.335 were also more likely to have a treatment concern score of> 24.197 . When compared with the total population, a higher percentage of patients with a treatment concern score <24.197 had a patient more patients with a treatment convenience score of <69.397 had a positive beliefs score <61.335 compared with the total analysis population (table 4). A higher percentage of patients with a positive beliefs score <61.335 had a self - declared compliance score <89.583, as compared with the analyzed population (table 5). Compliance identified by travalert was related to three variables, these being age, patient three different combinations of these characteristics were relevant to low or high compliance, compared with the total sample (figure 2). Low compliance was associated with two combinations; first, age <77.5 years, a self - declared compliance score <89.5, and a patient clinician relationship score <67.5 and, second, age> 77.5 years, a self - declared compliance score of> 89.5, and a patient by contrast, high compliance was associated with age <77.5 years, a self - declared compliance score> 89.5, and a patient the gender ratio was balanced, mean age was 65.1 years, 16.6% had undergone surgery for primary open - angle glaucoma, and 10.1% had received laser therapy . At the inclusion visit, worst eye mean iop was 16.4 mmhg and best eye mean visual acuity was 8.80 . The frequency of high compliance (56.6%) was much greater than that of low compliance (22.1%). The bn (figure 1) shows three nodes directly related to travalert - identified compliance, ie, patient treatment concern has three drivers, which are disease concern, gender, and positive beliefs, and itself impacts on the patient two subgroups of patients had a noticeable distribution across groups defined according to treatment concern score (table 2). 47.018 were markedly more likely to have a treatment concern score of> 24.197 than the total population . Second, patients with a disease concern score of <47.018 and a positive beliefs score> 61.335 were also more likely to have a treatment concern score of> 24.197 . When compared with the total population, a higher percentage of patients with a treatment concern score <24.197 had a patient more patients with a treatment convenience score of <69.397 had a positive beliefs score <61.335 compared with the total analysis population (table 4). A higher percentage of patients with a positive beliefs score <61.335 had a self - declared compliance score <89.583, as compared with the analyzed population (table 5). Compliance identified by travalert was related to three variables, these being age, patient three different combinations of these characteristics were relevant to low or high compliance, compared with the total sample (figure 2). Low compliance was associated with two combinations; first, age <77.5 years, a self - declared compliance score <89.5, and a patient clinician relationship score <67.5 and, second, age> 77.5 years, a self - declared compliance score of> 89.5, and a patient by contrast, high compliance was associated with age <77.5 years, a self - declared compliance score> 89.5, and a patient the primary objective of this study was to identify glaucoma patients who adhered poorly to treatment by recording their daily instillation times and eye drop counts objectively, with a computerized bottle holder (travalert). In a previous analysis, patient demographics and baseline clinical parameters failed to discriminate between patients showing high, moderate, or low compliance.4 this second attempt enquired about attitudes towards treatment that might characterize poor compliers . This was explored with the edsq that examines patients views about eye drop treatments, with aspects relevant to glaucoma, in order to explore compliance profiles . The analysis identified two subgroups of patients at high risk of poor compliance when measured objectively; first, patients younger than 77.5 years of age with low self - declared compliance and an unsatisfactory relationship with their physician and, second, patients older than 77.5 years of age with high self - declared compliance and an unsatisfactory relationship with their physician . Physician relationship that provides education for patients about glaucoma and its treatment is essential for compliance.8,1113,16 conversely, because patients rely strongly on their doctor for such information, a poor relationship was identified as a major barrier to compliance.8,11,12,1618 interestingly, our results are not fully consistent with previous publications with respect to age and other factors associated with compliance . First, we found a relationship between age and compliance that was not observed in several studies.11,14,18,20,34 however, in contrast with customary statistical methods, we used bn based on association tables and inevitably model interaction effects between variables . Consequently, age was included with other factors (patient clinician relationship and self - declared compliance), and was thereby related to objectively identified compliance (travalert). Second, trust in the efficacy of treatment (closely related to our positive beliefs score) has been previously related to compliance,8,12 as have been concerns about disease5 and treatment convenience.12,34 our bn analysis linked no equivalent edsq item directly to compliance . This difference may be explained by specific features of bn . In our study, the absence of direct links between travalert - identified compliance and previously identified components of compliance can be explained by the notion of conditional independence . Clinician relationship scores were linked directly to compliance indicates that compliance was conditionally independent of other bn variables . In fact, bn showed these scores to be indirect components of compliance by linkage through other variables . Thus, bn may provide a more precise description of the compliance process, and may show how different conceptions of compliance, finally impact on the behavior of glaucoma patients . The rationale for bn was that patients satisfaction and compliance with treatment is a multidimensional phenomenon calling for methods that take complexity into account . Also, an oversampling strategy had to be introduced . The numeric imbalance between compliant patients and poorly compliant patients jeopardized the quality of our results, so we considered possible simple solutions to the problem, ie, oversampling (artificially increasing the size of the smallest group by random sampling and replacement), and undersampling (reducing the size of the largest group by randomly deleting cases). Despite evidence that undersampling has previously shown better results35,36 and that oversampling may increase the risk of overfitting,37 the latter method had to be used because of our very small dataset, ie, only 113 patients provided sufficient data to construct a compliance profile, and the low - compliance group included only 25 patients . The age and gender ratios of our sample are close to those of glaucoma - treated patients in france.38 whether these results could apply to other countries (within or even outside the european union) is debatable, especially when some factors appeared to be culture - dependent, such as confidence in the doctor . For example, reimbursement status in france is almost independent of retirement, which is not the case in other countries . On the one hand, the edsq was developed according to a conceptual model and it was tested that this model applied in other countries . On the other hand, patient data collection will be requested to check whether this hypothesis will remain empirically valid . Also, only 113 (63.1%) patients of 179 were investigated for both edsq and compliance, possibly leading to selection bias, although internal validity (explored by the bn) might be less affected . We have not performed sample size estimation for a protocol aimed at confirming our findings without using the oversampling method . Microsimulation based on the bn described and accounting for the prevalence of poor compliance might be useful to fix the size of a future experiment . Second, we followed up patients who were willing to use travalert, and these patients might have different behavior from that of the general population . Third, the results reported were observed in patients treated either by travatan or duotrav, so extrapolation of the bn results to other drugs needs to be documented . The small sample size of our survey did not allow for a test - retest - validation process . Hence, the resulting structure should be viewed with caution, and new surveys should be conducted to validate our findings . Also, it might well be worthwhile to undertake a validation of the structure, replicating our analysis with other structural learning algorithms and larger datasets . Electronic devices have been recognized as an efficient way to assess compliance,19 but they may have limitations . In particular, one reason for poor compliance encountered by some patients is difficulty with instilling eye drops correctly.13,18 because travalert counts only the number of drops dispensed by a bottle, and cannot verify that they are correctly instilled, our study could not control this aspect of the research . Moreover, patients knew they were being observed, which might have impacted on their behavior . However, in a previous paper, we reported that these poor compliers had a significant increase in iop (by about 2 mmhg) in comparison with good compliers . Therefore, this observational bias might have underestimated the impact of compliance on iop control . Consequently, this bn identified poor compliers who had a lack of iop control of at least 2 mmhg, which is a clinically relevant difference . Our sample size was not big enough to explore both the impact of clinician and patient characteristics on identifying poor compliers . In this approach, we favored data collected at a patient level . Additional research might be useful for identifying the correct information to be collected at an ophthalmologist level . These limitations warrant a cautious interpretation of our results and further work with a larger sample size and test - retest methodology to confirm the findings . In conclusion, the application of bn to edsq data made it possible to re - examine the complex process of treatment compliance in glaucoma patients and to identify reasons for poor compliance . The crucial message for physicians from our results is that, before switching glaucoma treatments because of poor iop control, they should consider the patient s age, self - declared compliance, and how best to educate the patient about glaucoma and its treatment.
|
Type 1 diabetes (t1d) is an immune - mediated disease in which insulin - producing -cells are destroyed (1). A number of studies have used various forms of immune intervention in recent - onset t1d, usually initiated within 3 months of diagnosis, in an attempt to preserve residual -cell function . We previously reported that costimulation modulation with abatacept administered for 2 years slowed decline of -cell function over this period in patients with recent - onset t1d (2). Longer - term, chronic therapy designed to alter the immune response may carry untoward effects that outweigh the benefits of therapy . Moreover, the therapeutic window for effect of such approaches may be limited to the peri - diagnosis period . In addition, transient alteration of the rate of -cell dysfunction early in diagnosis may have long - term clinical benefits (3,4). Thus, this trial was designed for 2 years of therapy, with continued follow - up to evaluate risks and benefits after the prespecified primary study outcome at 2 years . Herein, we report the effect of abatacept in t1d 1 year after discontinuation of the study drug . In our earlier report (2), we described the study design and patient characteristics . Figure 1 depicts the consort diagram, showing randomization / enrollment and retention of subjects during the study through 36 months of follow - up . A total of 112 patients were enrolled in a double - masked parallel - group design and were randomized in a 2:1 ratio, with 77 subjects receiving abatacept and 35 subjects receiving placebo . Abatacept (ctla4-ig, orencia; bristol - myers squibb) was given as a 30-min intravenous infusion at a dose of 10 mg / kg (maximum 1,000 mg / dose) in 100 ml 0.9% sodium chloride on days 1, 14, and 28 and then every 28 days, with the last dose on day 700 (total 27 doses). The prespecified primary outcome of this trial was a comparison of the area under the curve (auc) of stimulated c - peptide response over the first 2 h of a 4-h mixed - meal tolerance test (mmtt) conducted at the 24-month visit . Four - hour mmtts were performed at baseline and at 24 months; 2-h mmtts were performed at 3, 6, 12, and 18 months . After completion of the 2-year treatment phase, subjects entered a follow - up phase to continue to assess safety and efficacy, including the performance of 2-h mmtts at 30 and 36 months . The study protocol is available at the type 1 diabetes trialnet public web site: www.diabetestrialnet.org . Details of the statistical plan are included in our earlier report (2). In summary, all analyses were based on the prespecified intention - to - treat (itt) cohort with known measurements . The p values associated with the itt treatment comparisons of the primary and secondary end points are one - sided . The prespecified analysis method for c - peptide mean auc, hba1c, and total daily insulin dose was an ancova model adjusting for baseline age, sex, baseline value of the dependent variable, and treatment assignment . In the protocol design, a normalizing transformation ofwas prespecified for c - peptide auc mean, and normal plots of the residuals indicated that it was adequate transformation in order to fulfill the assumptions of the linear model used in the analysis . The c - peptide mean auc equals the auc divided by the 2-h interval (i.e., auc/120). The auc was computed using the trapezoidal rule from the timed measurements of c - peptide during the mmtt . Means that are calculated on this normalizing scale and then inverse transformed back are referred to as geometric - like means . The time to peak c - peptide falling to <0.2 nmol / l was analyzed using the cox proportional hazards model, which assumes a constant hazard ratio for treatment group . The data would suggest that this ratio is not constant, and the estimate provides an approximate average over the follow - up period . Note that 95% cis are more akin to two - sided tests while all p values reported are one - sided in accordance with the design, which is based on a one - sided hypothesis test . Details of the statistical plan are included in our earlier report (2). In summary, all analyses were based on the prespecified intention - to - treat (itt) cohort with known measurements . The p values associated with the itt treatment comparisons of the primary and secondary end points are one - sided . The prespecified analysis method for c - peptide mean auc, hba1c, and total daily insulin dose was an ancova model adjusting for baseline age, sex, baseline value of the dependent variable, and treatment assignment . In the protocol design, a normalizing transformation ofwas prespecified for c - peptide auc mean, and normal plots of the residuals indicated that it was adequate transformation in order to fulfill the assumptions of the linear model used in the analysis . The c - peptide mean auc equals the auc divided by the 2-h interval (i.e., auc/120). The auc was computed using the trapezoidal rule from the timed measurements of c - peptide during the mmtt . Means that are calculated on this normalizing scale and then inverse transformed back are referred to as geometric - like means . The time to peak c - peptide falling to <0.2 nmol / l was analyzed using the cox proportional hazards model, which assumes a constant hazard ratio for treatment group . The data would suggest that this ratio is not constant, and the estimate provides an approximate average over the follow - up period . Note that 95% cis are more akin to two - sided tests while all p values reported are one - sided in accordance with the design, which is based on a one - sided hypothesis test . In the primary analysis at 2 years, those subjects assigned to abatacept had a population mean stimulated c - peptide 2-h auc, adjusted for age, sex, and baseline c - peptide, of 0.378 nmol / l (95% ci 0.3280.431) vs. 0.238 nmol / l (95% ci 0.1670.312) for those assigned to placebo (p = 0.0014). At 3 years, 1 year after discontinuation of treatment, population mean stimulated c - peptide 2-h auc, adjusted for age, sex, and baseline c - peptide, was 0.217 nmol / l (95% ci 0.0710.215) in the placebo group (p = 0.046). Figure 2a displays the adjusted population c - peptide mean 2-h auc over 3 years . Subjects who received abatacept had a significantly higher mean auc of 28%, 30%, 38%, 59%, 48%, and 54% compared with placebo subjects at 6, 12, 18, 24, 30, and 36 months, respectively . The geometric - like means of the unadjusted values for mean stimulated c - peptide 2-h auc at 2 years were 0.375 nmol / l in the abatacept group and 0.266 nmol / l in the placebo group and at 3 years were 0.214 nmol / l in the abatacept group and 0.156 nmol / l in the placebo group . A: population mean of stimulated c - peptide 2-h auc mean over time for each treatment group . The estimates are from the ancova model adjusting for age, sex, baseline value of c - peptide, and treatment assignment . Y - axis is on a log(y + 1) scale . The significance level at 36 months is 0.046 . B: predicted population mean of stimulated c - peptide 2-h auc mean over time for each treatment group . Estimates are from the analysis of mixed - effects model adjusting for age, sex, baseline value of c - peptide, and treatment assignment and including a fixed effect for time as a linear line on the log(y + 1) scale . The predicted population mean of c - peptide auc by treatment group over time was calculated to display the impact of treatment on delaying the decline of c - peptide (fig . 2b). Considering the entire 3-year observation period, the estimated lag time in the means of the abatacept group to drop to the same level as the placebo group is 9.5 months (95% ci 3.4415.7), p = 0.0011 . At 2 years, this was 9.6 months, indicating a consistent parallel separation when including the third - year data . After the 36-month assessment, 35% of subjects in the abatacept group continued to have a peak stimulated c - peptide> 0.2 nmol / l compared with 30% among placebo subjects (fig . 2c); the difference (5%) is considerably smaller than 13% observed at 2 years . Nmol / l for the abatacept group was initially less but increased after year 2 and is close to that in the placebo group . However, the adjusted relative risk estimate of the peak c - peptide falling to <0.2 nmol / l (based on proportional hazards model and adjustment for age, sex, and baseline c - peptide) was 0.60 (abatacept to placebo group; 95% ci 0.341.1; p = 0.043). At 2 years, the adjusted mean hba1c was lower in the abatacept group (7.21 [95% ci 6.967.46]) than in the placebo group (7.87 [95% ci 7.488.26]). During the extended follow - up, the abatacept group continued to have a lower adjusted mean hba1c than the placebo group, with the values at 3 years being 7.64 (95% ci 7.287.99) in the abatacept group and 8.55 (95% ci 8.009.11) in the placebo group (fig . Noteworthy for hba1c is that the significance levels are <0.005 for all 6-month interval group differences . However, insulin doses in the two groups were nearly the same at 3 years (difference: 1%), with a nonsignificant difference of 4% at 2 years and only significantly less use in the abatacept group at 6 and 12 months (fig . The population mean of hba1c (significance levels are <0.005 for all 6-month interval group differences) (a) and insulin use over time (b) for each treatment group (only statistical significance for less use in the abatacept group was at 6 and 12 months). The estimates are from the ancova model adjusting for age, sex, baseline value of hba1c, and treatment assignment . The homogeneity test of treatment effect was significant for dr3 allele status (p = 0.025) and race (p <0.001). The significance level of the qualitative interaction between dr3 allele and treatment was adjusted for multiple comparisons and remained significant (p = 0.014). The significance level of the homogeneity test for race may be spurious, stemming from the small sample nonwhites assigned placebo (n = 3) and the potential lack of normally distributed c - peptide values required for a valid model - based test . The ratio (abatacept to placebo) of treatment effect on 3-year stimulated c - peptide (c - pep .) Auc mean within categories of prespecified baseline factors . The estimates are from the ancova modeling log of c - peptide adjusting for age, sex, baseline value of c - peptide, the indicated categorized factor, treatment assignment, and treatment interaction terms . No new safety issues emerged during the extended follow - up (supplementary table 1). Those results demonstrated that 2 years of costimulation modulation with abatacept slows the decline of -cell function, measured by c - peptide as an index of endogenous insulin production, in recent - onset t1d . The current report, which extended follow - up of subjects for an additional year without further abatacept therapy, shows that the difference between the abatacept and placebo groups is maintained, with the delay in decline of -cell function estimated to be 9.5 months virtually identical to the estimated delay of 9.6 months seen after 2 years of abatacept therapy . Thus, it would appear that postcessation, the autoimmune response did not rebound to a more aggressive state, but rather, the subjects previously treated with abatacept experienced a gradual and continued loss of -cell function at a rate similar to that seen in the placebo group . These data suggest that costimulation blockade initiated within 3 months of diabetes onset transiently alters the natural history of disease progression . At the time of onset of diabetes, when there is an ongoing autoimmune response, costimulation blockade appears to arrest or diminish t - cell mediated effects on -cell function . Subsequent, monthly treatment may maintain this effect but does not appear to extend or amplify it . At a mechanistic level, such an outcome could be ascribed to modulation of costimulation - dependent autoreactive t - cells that are specifically recruited in the peri - diagnosis period, perhaps as a component of epitope spreading . There is evidence to indicate that at the doses used in the current study, abatacept is highly effective in limiting priming of t - cell and b - cell responses to newly encountered antigens (5,6). However, after the initial postdiagnosis response abatacept treatment does not alter further the tempo of the underlying, progressive loss of -cell function . . This would also be consistent with the observation that cessation of costimulation blockade does not result in acceleration of decline in -cell function . Also, an unanswerable question, from the current data alone, is whether a shorter treatment protocol would be sufficient to maintain the slowed decline of -cell function . This is a particularly important issue, since abatacept is a potential candidate to be tested in a trial for prevention of t1d in individuals determined to be at high risk for the disease . Abatacept also is a candidate to be a component of a combination therapy protocol in recent - onset t1d . The apparent lack of effect of abatacept in hla - dr3negative subjects needs further study . It is not related to age, as the mean age in hla - dr3 positive subjects was 14.5 years and the mean age in hla - dr3negative subjects was 14.9 years, with no statistically significant shift in age distribution . Four recent randomized trials with adequate sample size that have demonstrated some preservation of -cell function in t1d as evidenced by stimulated c - peptide secretion, including the earlier report from this trial using abatacept for costimulation modulation . The other trials have used anti - cd3 (7,8), and anti - cd20 (9). Interestingly, in all of these trials the treatment effect diminished with time, such that after an initial effect, c - peptide secretion subsequently declined parallel to the control group in all of these studies . Yet, continued effects on insulin dose were seen after 4 years in one of the anti - cd3 trials (10). Whether a transient change in the natural course of the disease will have long - term clinical benefit is unknown . In this regard, it is important to reflect upon the results from the diabetes control and complications trial (dcct). In that trial, after the primary end point was met and all individuals were offered intensive therapy, there were no longer differences between the two groups with regard to hba1c (1113). Yet, the previously intensively treated group had less retinopathy and nephropathy even after the hba1c levels converged (11,12) and less macrovascular disease> 15 years later (13). These observations suggest that a short - term treatment close to diagnosis had a clinically important effect many years later (1113). Remarkably, in our trial the significantly improved hba1c persisted in the abatacept - treated group even after discontinuation of the therapy . In the light of the dcct trial results, this may translate into reduction of micro- and macrovascular complications at later stage . In the current study, we demonstrate that treated subjects as a group maintain better hba1c and still have more insulin secretion 3 years after diagnosis than the placebo - treated subjects, although the number maintaining c - peptide> 0.2 nmol / l diminished . Even if the eventual course of -cell destruction in these individuals results in essentially absent -cell function over time, this early preservation may, like the dcct treatment, have long - term benefits . Continued long - term follow - up of these cohorts will be needed to address this important question . Moreover further studies are indicated to clarify the role of costimulation blockade in altering the course of recent - onset diabetes and in preventing the disease in individuals at risk thereof . To that end,
|
The lens of the eye is recognized as one of the most radio - sensitive tissues in the human body, and radiation - induced cataract is a well - known adverse effect . From a review of epidemiologic data, the threshold dose for cataract formation may be judged to be 0.5 gy [1, 2]. A recent draft report by the international commission on radiological protection (icrp) documented that better techniques for detecting, quantifying and documenting early radiation - associated lens changes, as well as better dosimetry, have potentially contributed to recent findings of radiation cataract risk at lower exposure levels than previously considered . For occupational exposure, a new icrp positional statement recommended that an equivalent dose limit for the lens be reduced from 150 msv / year to 20 msv / year, averaged over defined periods of 5 years, with no single year exceeding 50 msv . The cross - sectional data from astronauts and matched subjects found using an automated anterior eye segment analysis system (eas-1000, nidek, aichi, japan) were analyzed and revealed a small deleterious effect of space radiation for cortical cataracts and possibly for psc cataracts . We hypothesized that interventional radiologists (irs) are exposed to low - dose scattered radiation, which may cause radiation - related lens changes well before they would otherwise be appreciated by slit - lamp examination, and may therefore be picked up by directed objective scoring systems [5, 6]. Even recent studies [7, 8] lack quantitative assessment of radiation - induced lens changes utilizing the metric variable of light scattering intensities (lsis). We and others believe that lsis represent focal aggregated proteins that form from various effects, such as radiation exposure, and that an increase in lsis might be predictive of cataract formation [9, 10]. To evaluate minimal lsi changes in specific regions in the lens of the eye, we carried out a pilot study on our described exposed subjects and unexposed subjects using eas-1000 . Following institutional review board (irb) approval, written informed consent was obtained from all participants . All exposed subjects were japanese volunteer male irs in the japanese society of interventional radiology (jsir), and all unexposed subjects were japanese volunteer male employees of medical service companies with no history of occupational radiation exposure . Exposed subjects' examinations were conducted during the annual jsir meeting in osaka, japan, on 1819 may 2006, and unexposed subjects' examinations took place in tokyo, japan, 31 may and 1 june 2007 . Examiners were aware of the status of the two groups, specifically whether they were exposed or unexposed subjects . Eye examinations were performed following a health survey questionnaire inquiring about eye health, general medical health and lifestyle . Questions included age, radiation exposure in interventional procedures (yes / no), smoking (smoking index = cigarettes smoked per day years of smoking), drinking (ever / never), wearing glasses (ever / never) and solar ultraviolet ray exposure during working hours (working indoors only, versus working both indoors and outdoors). For the exposed subjects of irs the survey also included a self - report of professional experience as an ir . A team of ophthalmologists performed all initial examinations . To screen suitable subjects for pharmacologic mydriasis, an ophthalmologist performed an initial screening slit - lamp examination (slit lamp bq 900 haag - streit, koeniz, switzerland) of the left eye anterior eye segment, in addition to intraocular pressure measurement (non - contact totometer nt-4000, nidek, aichi, japan). One hundred and sixty exposed subjects and 326 unexposed subjects were included following screening and mydriasis safety assessment, and subsequently underwent examination of the left eye with pharmacologic pupillary dilation using a drop of midrin - p (tropicamide and phenylephrine; santen pharmaceuticals, japan). Because the examinations were performed in the daytime while exposed subjects were attending their annual professional society meeting, and during the daytime while the unexposed subjects were also working, only single eye pharmacologic dilations were performed . Therefore only examination of the left eye was conducted . The left side was specifically chosen since the ir's left eye is closer than the right eye to the x - ray tube in the vast majority of instances . In addition a recent study showed that the dose on the side nearest to the x - ray tube was three to five times greater than for the farthest side of the head . For all qualified subjects the lens of the left eye was examined with scheimpflug slit images obtained using eas-1000, with a representative slit image shown in fig . 1 . Scheimpflug photography and densitometric image analysis are techniques applied to light scattering measurement and biometry in the anterior eye segment . They reproducibly characterize the anterior eye and allow discrimination of minimal light scattering changes, using a grading system from otherwise aging, disease or toxic effects . These tools help quantify threshold levels or maximum allowable dosages of physical and chemical noxious factors, which are causative or associative with opacifying ocular pathologies . Therefore, most epidemiological studies dealing with ocular pathologies in the lens use either cataract scoring or the scheimpflug technique . Fig . 1.scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section, the front of the cornea is at the top of the image . The seven numbers depicted on the axis sequentially indicate the cornea (1), anterior capsule (2), most transparent layer of the anterior superficial cortex (3), anterior adult nucleus (4), anterior fetal nucleus (5), central clear zone (6) and posterior subcapsular region (7). The peak light scattering intensity for each segment is demonstrated to the right of each respective layer . Scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section, the front of the cornea is at the top of the image . The seven numbers depicted on the axis sequentially indicate the cornea (1), anterior capsule (2), most transparent layer of the anterior superficial cortex (3), anterior adult nucleus (4), anterior fetal nucleus (5), central clear zone (6) and posterior subcapsular region (7). The peak light scattering intensity for each segment is demonstrated to the right of each respective layer . One experienced technician performed all examinations using the eas-1000 . The highest quality scheimpflug photograph obtained in one session was recorded, and quantitative analysis of the crystalline lens lsis was provided and saved as an 8-bit digital value . The data of exposed and unexposed subjects were analyzed at the same time, although the technologist was not blinded to the condition of exposure status . The peak lsi value was measured in each of the six layers of the lens automatically and measured points were confirmed manually . These six layers included the anterior capsule, the most transparent layer of the anterior superficial cortex, the anterior adult nucleus, the anterior fetal nucleus, the central clear zone and the posterior subcapsular region (psr) (fig . Subjects with cataract risk factors other than occupational radiation exposure were excluded from analysis to increase the comparability of the groups and reduce the influence of group bias risk . Such other factors included a history of diabetes mellitus (exposed subjects n= 4; unexposed subjects n= 6), eye trauma (exposed subjects n= 0; unexposed subjects n= 1), ophthalmic surgery (exposed subjects n= 1; unexposed subjects n= 4) and ocular inflammation (exposed subjects n= 0; unexposed subjects n= 2). Subjects with uncorrectable factors causing poor - quality photographs on the eas-1000 were also excluded (exposed subjects n= 15; unexposed subjects n= 35). Poor photographic factors included insufficient pupillary dilation (exposed subjects n= 44; unexposed subjects n= 62), congenital cataracts (exposed subjects n= 5; unexposed subjects n= 9), excessive myopia by a spherical equivalent (se) of less than 6.00 diopters (exposed subjects n= 31; unexposed subjects n= 61), excessive hypermetropia by an se larger than 5.25 diopters (exposed subjects and unexposed subjects n= 0), ocular hypertension (tonometer pressure> 20 mmhg) (exposed subjects n= 8; unexposed subjects n= 7), corneal abnormalities (exposed subjects n= 2; unexposed subjects n= 15) and miscellaneous contributory congenital ocular abnormalities (exposed subjects n= 4; unexposed subjects n= 7). Subjects with an insufficient number of lens images to permit proper tabulation were also excluded . After consideration of the above exclusion criteria, 92 of the 160 exposed subjects and 155 of the 326 unexposed subjects were excluded . In the final count, many excluded subjects had more than one exclusion criterion . The eligible population for quantitative analyses consisted of 68 exposed subjects and 171 unexposed subjects . None of the selected subjects had any visual complaints or any subjective decrease in visual acuity . Age - related increases in lsis have been demonstrated in prior investigations as a physiological change . To reduce the effect of aging, the eligible subjects were matched and selected with a chosen ratio of one ir to two randomly selected unexposed subjects within 1-year difference . The age - matched group consisted of 54 exposed subjects and 108 unexposed subjects . For intergroup comparison, student's t - test was performed for descriptive characteristics and light scattering intensity in the six lens layers . Multiple regression analyses were carried out using the stepwise method to evaluate lsis in the six layers of the left lens adjusting for age, smoking, drinking, wearing glasses, sunlight exposure during working hours and scattered radiation exposure during working hours . The selected variables were evaluated with an automatic model selection procedure using a sequence of f - tests in the stepwise method (the pvalue for additional variables was 0.25 and for removal of variables was 0.10). Comparison of the average lsis between the age - matched groups was performing using analysis of variance (anova). Following institutional review board (irb) approval, written informed consent was obtained from all participants . All exposed subjects were japanese volunteer male irs in the japanese society of interventional radiology (jsir), and all unexposed subjects were japanese volunteer male employees of medical service companies with no history of occupational radiation exposure . Exposed subjects' examinations were conducted during the annual jsir meeting in osaka, japan, on 1819 may 2006, and unexposed subjects' examinations took place in tokyo, japan, 31 may and 1 june 2007 . Examiners were aware of the status of the two groups, specifically whether they were exposed or unexposed subjects . Eye examinations were performed following a health survey questionnaire inquiring about eye health, general medical health and lifestyle . Questions included age, radiation exposure in interventional procedures (yes / no), smoking (smoking index = cigarettes smoked per day years of smoking), drinking (ever / never), wearing glasses (ever / never) and solar ultraviolet ray exposure during working hours (working indoors only, versus working both indoors and outdoors). For the exposed subjects of irs the survey also included a self - report of professional experience as an ir . A team of ophthalmologists performed all initial examinations . To screen suitable subjects for pharmacologic mydriasis, an ophthalmologist performed an initial screening slit - lamp examination (slit lamp bq 900 haag - streit, koeniz, switzerland) of the left eye anterior eye segment, in addition to intraocular pressure measurement (non - contact totometer nt-4000, nidek, aichi, japan). One hundred and sixty exposed subjects and 326 unexposed subjects were included following screening and mydriasis safety assessment, and subsequently underwent examination of the left eye with pharmacologic pupillary dilation using a drop of midrin - p (tropicamide and phenylephrine; santen pharmaceuticals, japan). Because the examinations were performed in the daytime while exposed subjects were attending their annual professional society meeting, and during the daytime while the unexposed subjects were also working, only single eye pharmacologic dilations were performed . Therefore only examination of the left eye was conducted . The left side was specifically chosen since the ir's left eye is closer than the right eye to the x - ray tube in the vast majority of instances . In addition a recent study showed that the dose on the side nearest to the x - ray tube was three to five times greater than for the farthest side of the head . For all qualified subjects the lens of the left eye was examined with scheimpflug slit images obtained using eas-1000, with a representative slit image shown in fig . 1 . Scheimpflug photography and densitometric image analysis are techniques applied to light scattering measurement and biometry in the anterior eye segment . They reproducibly characterize the anterior eye and allow discrimination of minimal light scattering changes, using a grading system from otherwise aging, disease or toxic effects . These tools help quantify threshold levels or maximum allowable dosages of physical and chemical noxious factors, which are causative or associative with opacifying ocular pathologies . Therefore, most epidemiological studies dealing with ocular pathologies in the lens use either cataract scoring or the scheimpflug technique . Fig . 1.scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section, the front of the cornea is at the top of the image . The seven numbers depicted on the axis sequentially indicate the cornea (1), anterior capsule (2), most transparent layer of the anterior superficial cortex (3), anterior adult nucleus (4), anterior fetal nucleus (5), central clear zone (6) and posterior subcapsular region (7). The peak light scattering intensity for each segment is demonstrated to the right of each respective layer . Scheimpflug slit image obtained using an anterior eye segment analysis system digitalized anterior eye segment image is demonstrated at a mid - sagittal section, the front of the cornea is at the top of the image . The seven numbers depicted on the axis sequentially indicate the cornea (1), anterior capsule (2), most transparent layer of the anterior superficial cortex (3), anterior adult nucleus (4), anterior fetal nucleus (5), central clear zone (6) and posterior subcapsular region (7). The peak light scattering intensity for each segment is demonstrated to the right of each respective layer . One experienced technician performed all examinations using the eas-1000 . The highest quality scheimpflug photograph obtained in one session was recorded, and quantitative analysis of the crystalline lens lsis was provided and saved as an 8-bit digital value . The data of exposed and unexposed subjects were analyzed at the same time, although the technologist was not blinded to the condition of exposure status . The peak lsi value was measured in each of the six layers of the lens automatically and measured points were confirmed manually . These six layers included the anterior capsule, the most transparent layer of the anterior superficial cortex, the anterior adult nucleus, the anterior fetal nucleus, the central clear zone and the posterior subcapsular region (psr) (fig . Subjects with cataract risk factors other than occupational radiation exposure were excluded from analysis to increase the comparability of the groups and reduce the influence of group bias risk . Such other factors included a history of diabetes mellitus (exposed subjects n= 4; unexposed subjects n= 6), eye trauma (exposed subjects n= 0; unexposed subjects n= 1), ophthalmic surgery (exposed subjects n= 1; unexposed subjects n= 4) and ocular inflammation (exposed subjects n= 0; unexposed subjects n= 2). Subjects with uncorrectable factors causing poor - quality photographs on the eas-1000 were also excluded (exposed subjects n= 15; unexposed subjects n= 35). Poor photographic factors included insufficient pupillary dilation (exposed subjects n= 44; unexposed subjects n= 62), congenital cataracts (exposed subjects n= 5; unexposed subjects n= 9), excessive myopia by a spherical equivalent (se) of less than 6.00 diopters (exposed subjects n= 31; unexposed subjects n= 61), excessive hypermetropia by an se larger than 5.25 diopters (exposed subjects and unexposed subjects n= 0), ocular hypertension (tonometer pressure> 20 mmhg) (exposed subjects n= 8; unexposed subjects n= 7), corneal abnormalities (exposed subjects n= 2; unexposed subjects n= 15) and miscellaneous contributory congenital ocular abnormalities (exposed subjects n= 4; unexposed subjects n= 7). Subjects with an insufficient number of lens images to permit proper tabulation were also excluded . After consideration of the above exclusion criteria, 92 of the 160 exposed subjects and 155 of the 326 unexposed subjects were excluded . In the final count, many excluded subjects had more than one exclusion criterion . The eligible population for quantitative analyses consisted of 68 exposed subjects and 171 unexposed subjects . None of the selected subjects had any visual complaints or any subjective decrease in visual acuity . Age - related increases in lsis have been demonstrated in prior investigations as a physiological change . To reduce the effect of aging, the eligible subjects were matched and selected with a chosen ratio of one ir to two randomly selected unexposed subjects within 1-year difference . For intergroup comparison, student's t - test was performed for descriptive characteristics and light scattering intensity in the six lens layers . Multiple regression analyses were carried out using the stepwise method to evaluate lsis in the six layers of the left lens adjusting for age, smoking, drinking, wearing glasses, sunlight exposure during working hours and scattered radiation exposure during working hours . The selected variables were evaluated with an automatic model selection procedure using a sequence of f - tests in the stepwise method (the pvalue for additional variables was 0.25 and for removal of variables was 0.10). Comparison of the average lsis between the age - matched groups was performing using analysis of variance (anova). In the screening examination for all subjects without exclusion, slit - lamp examination of the left eye under pupillary dilation showed posterior subcapsular cataract (psc) in three (1.9%) of 160 exposed subjects (45, 62 and 63 years) and one (0.3%) of 326 unexposed subjects (51 years). One exposed subject showed a dense patchy opacity and two showed vacuoles in the psr on retroillumination images . All four subjects were excluded from quantitative analyses because they met other predetermined exclusion criteria (two had excessive myopia and one had poor pupillary dilation in the exposed subjects, and one had excessive myopia in the unexposed subjects). 8539.8 690.0059smoking (yes), n(%)40 (58.8)115 (67.2)0.180smoking index1770 28.5211.7 18.00.06drinking (yes), n(%)53 (77.9)147 (85.9)0.080wearing glasses (yes), n(%)54 (79.4)120 (70.5)0.101workplace (indoors only), n(%)68 (100)82 (48.0)<0.0001years of interventional experience,15.6 7.8na median (minimum maximum)14 (132)total number of angiographies,1846.1 1998.6na median (minimum maximum)1500 (010 000)total number of interventions,1982.3 2056.5na median (minimum maximum)1200 (1012 000)irs = interventional radiologists, values are means sd, na = not applicable . Descriptive characteristics of the study subjects who met the eligibility criteria irs = interventional radiologists, values are means sd, na = not applicable . The characteristics of the study subjects for quantitative analysis are shown in table 1 . There was a significant difference in the ages of the two groups, with the exposed subjects showing a greater age than the unexposed subjects . There were significant differences in the lsis in five out of six eye layers when comparing exposed subjects with the unexposed subjects . Table 2.light scattering intensity in the six lens layers between exposed and unexposed group (8-bit grayscale value)layer of lensirscontrolspvalue(n= 68)(n= 171)anterior capsule63.0 7.860.3 7.90.020most transparent layer of the anterior superficial cortex41.1 8.339.5 7.70.157anterior adult nucleus96.6 33.081.3 25.50.0002anterior fetal nucleus50.7 11.547.4 10.90.039central clear zone38.3 9.635.3 8.40.018posterior subcapsular region39.7 light scattering intensity in the six lens layers between exposed and unexposed group (8-bit grayscale value) values are means sd . The results of the stepwise method for lsi assessment in each of the six layers of the eye lens are shown in table 3 . In all six layers of the eye lens, the variable of age was statistically significant for increased lsis . In the layer of the central clear zone, smoking was also significant for increased lsis (p= 0.002). In the psr, radiation exposure from interventional procedures was significant (p= 0.012) for increased lsis following adjustment for the other variables including age . Table 3.evaluation of light scattering intensity in the six lens layers by multiple regression analysis using the stepwise method in all subjects (n= 239)layer of lensvariableparameter estimate (95% ci)pvalueanterior capsuleage0.691 (0.6160.766)<0.0001most transparent layer of the anterior superficial cortexage0.153 (0.0350.270)0.011workplace0.580 (0.2911.452)0.191smoking0.003 (0.0070.001)0.094anterior adult nucleusradiation exposure2.307 (0.6205.233)0.122age2.644 (2.2882.999)<0.0001work place1.793 (0.9104.496)0.192anterior fetal nucleusage1.405 (1.2351.574)<0.0001smoking0.003 (0.0020.008)0.290wearing glasses1.072 (2.7850.641)0.219central clear zoneage1.132 (1.0571.207)<0.0001smoking0.004 (0.0010.006)0.002posterior subcapsular regionradiation exposure2.089 (0.4663.711)0.012age0.307 (0.528 to 0.086)0.007smoking0.004 (0.0100.003)0.277wearing glasses0.925 (0.7352.586)0.273ci = confidence interval . Evaluation of light scattering intensity in the six lens layers by multiple regression analysis using the stepwise method in all subjects (n= 239) ci = confidence interval . The mean age standard deviation (sd) of age - matched exposed subjects and unexposed subjects were 39.5 6.9 and 39.4 6.9, respectively . In the age - matched comparison, there was a significant difference in lsis in the psr (table 4). Table 4.evaluation of light scattering intensity in the six layers between exposed and unexposed group by age - matched comparison (8-bit grayscale value)layer of lensirscontrolspvalue(n= 54)(n= 108)anterior capsule61.3 7.359.4 7.30.10most transparent layer of the anterior superficial cortex41.1 8.838.7 7.60.07anterior adult nucleus87.6 26.982.2 26.90.23anterior fetal nucleus47.7 10.347.2 11.10.80central clear zone35.6 8.435.1 8.60.75posterior subcapsular region40.5 13.434.5 7.20.0031values are means sd . Evaluation of light scattering intensity in the six layers between exposed and unexposed group by age - matched comparison (8-bit grayscale value) values are means sd . Lens opacities were classified into three types according to their anatomical location: cortical region, nucleus and psr . It has been demonstrated that high - dose ionizing radiation primarily associated with psc can also induce cortical cataract formation [12, 13]. In the widely used grading system for radiation - induced cataracts by slit - lamp examination, the early stage of psc shows a lens change consisting of the formation of small dots and vacuoles . In a cross - sectional study in interventional cardiologists, pscs were significantly more frequent among interventional cardiologists than the control subjects . The increased lsis in exposed subjects compared with unexposed subjects analyzed by multiple regression analysis and age - matched comparison suggest a potential adverse effect on the lens with low - dose radiation exposure . In spite of the minimal increased lsis, the functional effect of these increased lsis on visual acuity and undesirable risk is unclear . This phenomenon may be a predictor of a primary effect of low - dose radiation on the eye . Smoking is independently recognized to correlate with a higher risk of incident nuclear cataract development . Our findings regarding smoking reinforce previous studies and suggest that the increase in lsis in the central clear zone may be an early sign of nuclear cataracts . In our study, the variable of age was significant for lsis in all six layers of the eye lens . We performed multiple regression analyses including exposed subjects and unexposed subjects to adjusting the variables . Other factors such as ultraviolet light exposure, diabetes, renal failure, drug intake and malnutrition also individually and collectively contribute over time to further increase light scattering and cannot be readily separated from aging . Lsis in the six layers of the lens increase in the anterior five layers and decrease in the psr in a linear manner with aging . This decrease in apparent lsis in the psr over time is likely related to age - related reduction in lens transparency . In the exposed subjects, therefore radiation exposure shows a positive relation to lsis in the psr . In the most transparent layer of the anterior superficial cortex, lsis did not show a significant difference between irs and controls, and the parameter estimate of age was relative lower than for the other layers . This may be related to the fact that the age - related cortical cataract began on the outer edge of the lens cortex and slowly extended to the center . Regarding ir dose, the average lens dose received by japanese radiologists measured by thermoluminescent dosimeters (tlds) during hepatocellular carcinoma embolization has been calculated at an average dose per procedure of approximately 0.04 msv . The average estimated cumulative dose in exposed subjects was 79.3 msv (mean number of interventional procedure = 1982.3). The estimated annual dose was 5.1 msv (mean annual number of interventional procedure = 127.1). A multi - center study with continuous 2-month dose readings demonstrated extrapolated annual radiation doses at the collar badge of 48 msv in the mean annual number of interventional procedure of 972 . The estimated average lens dose in interventional cardiologists with estimated cumulative occupational dose considering eye protection was 6.0 6.6 sv (0.127 sv) and 3.7 7.5 gy (0.0243 gy) [7, 8]. It is estimated that the lens dose of exposed subjects in our study is lower than that of previous reports . In our screening examination, the detection rate of the psc in the exposed subjects is 1.9%, considerably lower than the 38% and 52% reported in interventional cardiologists [7, 8]. This lower incidence of psc may also be a collateral finding of lower radiation exposure . Lens dosimetry was not performed in this retrospective study since two categories of information were unavailable; first, collar - badge readings were not uniformly available for all practitioners and second, existing under - apron individual monitoring data were unreliable due to inconstant usage of personal dosimeter, employment changes and also the fact that full versus part - time employment was not noted, neither was individual positioning and wearing of protection devices . Due to the aforementioned challenges, we chose not to include estimated lens dose, which cannot be considered in such circumstances as objectively quantifiable, and we therefore chose to simply register presence or absence of radiation exposure status (yes or no) as the categorical variable . Individual dosimetry remains problematic, and alternative strategies will be needed in order to more precisely evaluate the effects of radiation in specific occupational situations, since strict individual monitoring and strategic management will be necessary . One of the largest study limitations is our choice of a single left - eye examination for the purposes of this study; the laterality of lsis of the lens could not be assessed . In the oramed (optimization of radiation protection for medical staff) project, the dosimeter on the near side eye to the x - ray tube showed a higher dose than the dosimeter in the region between the eyes . And, in the study of dose distribution with ten tlds on the eyebrow ridge, the dose on the side nearest to the x - ray tube was three to five times greater than those on the farthest side . It was recommended that dosimeters for the monitoring of eye dosage should be positioned on the side of the brow ridge adjacent to the x - ray tube . Because the majority of exposed subjects were primarily abdominal oncologic vascular interventionalists and the physician's left eye was commonly closer to the x - ray tube, we believed that the left - sided eye examination in this study was more likely to evaluate the side with the highest exposure . Further study is required that includes lens dosimetry and evaluation of lsis on each side . Our study limitations include our group choices for exposed subjects and unexposed subjects; a more comparable control group may have been physicians without radiation exposure . Similarly, we had numerous exclusion criteria that were only answered and served as exclusions following initial screening ophthalmologic examination . We felt that rigid adherence to the exclusionary criteria was necessary for the purposes of data integrity, although it resulted in a large number of exclusions reducing the sample size . The questionnaire was also imperfect; unfortunately questions regarding any medical history of ionizing radiation exposure to the head and neck, such as head computed tomography, were not included . Our single meridian cross - sectional analyses by eas-1000 were performed in the mid - sagittal plane of the eye lens, therefore, there were no data obtained for off - center, off - angle and off - axis portions of the lens . As has been previously reported with the eas-1000, the correlation coefficient in scatter light intensity measurement as measured over a 2-week interval may be greater than or equal to r= 0.9, additionally interoperator measurement error has previously been measured to range from 8 to 10% . In order to confirm the reproducibility of the eas-1000, mean individual coefficient of variation was segmentally measured in four different lens regions with a 1-week interval in measurements, and the variation was measured as between 3.6 and 5.1%, in keeping with the previously described examination . As previously alluded to, a potential limitation of our study is also that the technologist was unblinded, although the automated nature of the lsi measurements for data collection, and the reliable proscriptive nature of mid - sagittal plane selection, suggests this is an unlikely cause for concern . In conclusion, we found that there were minimal increased lsis in the psr of the lens in exposed subjects as compared with the unexposed subjects in this pilot study . Such findings will need to be longitudinally followed to establish their predictive value as far as cataractogenesis is concerned . Further quantitative studies concerning minimal radiation - related lens changes may additionally be required especially in low - dose exposure groups.
|
Neuroendocrine tumors (nets) represent a spectrum of rare tumors originating from diffuse endocrine cells throughout the body . In the usa, nets comprise 0.73% of all diagnosed cancers, with an incidence of about 5 cases/100,000/year . The most prevalent of these (55% of nets) are in the gastrointestinal tract; however, about 30% of all nets originate in the lung [considering only typical carcinoids (tcs) and atypical carcinoids (acs)]. Since net is a rare disease, data from randomized clinical trials addressing questions of diagnosis, treatment, and therapy some groups such as the european society for medical oncology (esmo), the national comprehensive cancer network (nccn), and the european neuroendocrine tumor society (enets) have formulated guidelines on these issues . Most guidelines are consensus texts and few recommendations reach level a evidence . While nets in most organs arise from the same group of neuroendocrine cells, nets of the lung represent a specific subgroup comprising different entities . Thus, the available data on gastrointestinal nets cannot simply be extrapolated to the lung . Case reports are an important tool for directing future research and current treatment strategies for rare diseases . Here, we present a case of net of the lung for which we achieved long - term disease control in a patient with limited therapeutic options due to considerable comorbidity . The patient's quality of life was preserved . A 65-year - old patient was admitted to hospital (summer 2009) to receive an implantable cardioverter defibrillator (icd) for ischemic coronary disease and ischemic cardiomyopathy with a left ventricular ejection fraction of 40% . The patient had previously received a drug - eluting coronary stent for acute myocardial infarction in early 2009 . The patient suffered from dyslipidemia, type 2 diabetes mellitus with existing end organ damage (atherosclerosis, diabetic nephropathy resulting in end stage renal disease, and retinopathy), and stage 2 [global initiative for chronic obstructive lung disease scaling system (gold)] chronic obstructive pulmonary disease (copd). His chronic medication consisted of acetyl salicylic acid, clopidogrel, molsidomine, ranitidine, lisinopril, bisoprolol, metformin, insulin, simvastatin, tiotropium inhaler, salmeterol, and fluticason inhaler . Routine pulmonary x - ray showed a mass in the upper lobe of the left lung . Icd implantation was complicated by an acute episode of ventricular arrhythmias and bronchospasms . In further work - up, a bronchoscopy was performed and again complicated by severe bronchospasm, arrhythmia, and an acute hypertensive crisis, resulting in acute pulmonary edema . The patient was admitted to intensive care to receive supportive therapy and overcame this acute incident . Due to the complications during bronchoscopy, the investigation was inconclusive . Given that the patient had a relatively good quality of life before this acute episode (karnofsky score 70/100), further investigations were planned . Positron emission tomography - computed tomography (pet - ct) confirmed a metabolically active lesion in the upper lobe of the left lung (4 cm), extending to within the proximity of the left hilar region, compatible with a neoplastic process (fig . The diagnosis was impeded by the fact that no lesions could be visualized during the bronchoscopy and a blind biopsy and lavage did not show any abnormalities . Further bronchoscopy was refused due to the two episodes of cardio - respiratory distress during the previous invasive procedures . A ct - guided biopsy could not be performed because the patient was on antiaggregant therapy, which was mandatory for a minimum of 1 year after receiving a drug - eluting stent . The risk of a pneumothorax during such a procedure was substantial due to the anatomic localization of the lesion . A neuroendocrine tumor was suspected based on the two acute episodes during the icd implantation and bronchoscopy procedures, indicating a potential carcinoid crisis . An octreotide scan showed a tumoral mass accumulating in the radiotracer, confirming the presence of somatostatin receptors in the neoplastic lesion (fig . Serum chromogranin a (cga) was elevated (3 times upper normal limit) and 5-hydroxyindole acetic acid (5-hiaa) was normal . A dose of 60 gy was delivered in 30 sessions using 3d - conformal radiotherapy (from november 12 to december 24, 2009). The patient received 90 mg lanreotide autogel every 4 weeks during and up to 1 month after completion of the radiation therapy . The patient tolerated the treatment well and started to become active once again in social life and in domestic duties . Between december 2009 and may 2010, the pneumologist noted six exacerbations of the known copd, and a further two episodes requiring hospitalization (gold stage 3). A radiological evaluation showed infiltrates at the site of the primary tumor, expanding towards the mediastinum . . The patient did not show signs of infection (the medical history was negative, there was no fever and no elevation of inflammatory parameters in the patient's serum). A new octreotide scan revealed new lesions in the upper lobe of the left lung and activity in the irradiated mass [5.5 cm width; response evaluation criteria in solid tumors (recist)] (fig . 2a). Lanreotide autogel was reintroduced (90 mg every 4 weeks). Over the following 6 months, there was a significant decrease in copd exacerbations (gold stage 2) and performance status improved (karnofsky score 80/100). This was not attributed to the use of lanreotide, but was probably due to changes in the large pulmonary bronchi following radiation treatment . Ct imaging documented a stable disease (recist criteria); absolute measurements of the lesions showed a slight decrease in the diameter of the upper lobe of the left lung . The patient was treated with tranexamic acid for the hemoptysis, and lanreotide autogel was continued at 120 mg per month . At the time of the patient's last visit, a slight increase in episodes of hemoptysis from december 2011 was noted, without impacting daily activities (ctcae grade 1). Imaging (june 2012) showed some tumor growth (6.0 cm longest diameter) (fig . The disease was stable according to recist criteria when compared to imaging at the time of relapse, with the patient scoring 80/100 on the karnofsky scale . They comprise different tumor types sharing a number of neuroendocrine features and include small cell lung carcinoma (sclc), large cell neuroendocrine carcinoma (lcnec), tcs, and acs . The prognosis of tcs is good and these indolent tumors have a low rate of recurrence after adequate resection, even if metastasis in regional lymph nodes is present . Acs are less common, are considered intermediate in grade, and are associated with a poorer prognosis . Currently, the work - up and identification for surgery are the same as for non - sclc . The role of adjuvant chemotherapy for these tumors has not been defined . A 5-year survival rate of 90% has been reported for tc and 60% for ac . These figures differ from those for lcnec and sclc, which are associated with a poor prognosis and 5-year survival rates of <35% for lcnec and 5% for sclc [5, 6]. A number of strategies have been proposed for diagnosis and treatment by pulmonary and oncologic consensus panels . Histological classification of nets and adequate staging of the tumor are key to defining an optimal therapeutic strategy . Various histological classifications and definitions have been proposed . The world health organization classification system was proposed in 2004 and provides standard definitions concerning the diagnosis and management of nets of the lung (table 1). Recent histology, immunohistochemical and molecular studies suggest that the lung carcinoid group is distinct from the more malignant lcnec and sclc groups [8, 9]. The major challenge in the case presented here was obtaining histological evidence for diagnosis of net . Indirect evidence, including the clinical presentation, cga levels, and octreotide scan, gave a good indication of the diagnosis . A review of the literature does not reveal any major differences in sensitivity between these methods (up to 90%). An octreotide scan detects tumors expressing serotonin receptors, with the uptake of octreotide supporting the potential use of therapeutic agents targeting these receptors . However, tumors not expressing these receptors, such as acs, would be missed by an octreotide scan [7, 10]. Due to the risk of complications, we did not carry out further invasive procedures to acquire histological material, and therapy was initiated without definite pathology . Although this would not be the treatment of choice in fit patients, esmo practice guidelines describe external radiotherapy as an option for selected cases in which surgery cannot be performed . Delineation of the target volume and subsequent dose distribution could not provide optimal coverage of the target volume towards the mediastinum, due to the proximity of a pre - existing weakened heart . Bronchopulmonary nets are also generally considered to be more resistant to treatment than the more common lung neoplasms (e.g. Carcinoma of the lung) [5, 7]. Radiotherapy can induce inflammation in the irradiated area; thus, lanreotide autogel was administered during radiation treatment to avoid carcinoid crisis . There is no evidence in the literature that adjuvant treatment in bronchopulmonary nets is beneficial, thus this was not indicated [6, 11]. Net diagnosis could not be confirmed at the time of relapse due to the patient being on antiaggregation therapy following previous insertion of drug - eluting stents . The patient showed clinical deterioration with copd exacerbations, and an octreotide scan showed high uptake of octreotide . We did not choose to use chemotherapy because response rates in nets of the lung are low and the toxicity profile in a diabetic patient with copd, heart failure, and impaired renal function would not be favorable . The majority of patients with bronchopulmonary nets are symptomatic, although up to 45% of cases may exhibit no signs . The most common symptoms are cough (32%), pneumonia (26%), and hemoptysis (24%) [5, 7]. Our patient experienced an increase in copd exacerbations, which may be explained by the production of serotonin and other neuropeptides, by changes induced in the lung following radiotherapy, or by disease progression with irritation of central bronchi by tumor nodules . The fact that the use of lanreotide autogel abruptly stopped copd exacerbations in this case suggests that blocking the serotonin receptors had major benefits for this patient . During the course of the disease, this is a sensitive marker of nets, but may be normal in small lesions . It can also be elevated in a number of situations, including in the use of proton pump inhibitors (cga levels 23), steroid use, and renal impairment (in end stage renal disease, cga levels are raised up to 10). Octreotide scan and imaging were used for diagnosis, while only imaging was used for disease follow - up in this patient . Lanreotide autogel was selected among commercially available somatostatin analogs (ssas) based on its action in symptom control and its potentially antiproliferative effect . There is currently no reported difference in clinical outcome between the different types and formulations of ssas . Additionally, practice guidelines from medical societies (nccn, esmo, and enets) do not differentiate between them for use in this indication [6, 11, 14]. Recent in vitro studies, however, have shown that net cell lines, from different sites and arising from different types of neuroendocrine cells, respond differently to individual ssas . One study showed substantially different cell surface expression profiles for somatostatin and dopamine receptors in lung and gastrointestinal cell lines . Being differently coupled to microtubule - associated protein kinase (mapk)/extracellular signal - regulated kinase (erk) and c - jun amino - terminal kinase (jnk) signaling pathways, these receptors can differently influence tumor cell proliferation . In that study, ssas and somatostatin / dopamine chimeric compounds exhibited different inhibitory effects on cell lines of different organs (lung vs. gastrointestinal), as well as on cell lines from the same organ (lung: tc vs. ac). Lanreotide was the most effective inhibitor in the ac and small intestine carcinoid cell lines . In contrast, none of the tested molecules in the study, despite the expression of somatostatin receptors, inhibited the proliferation of tc . Synthetic derivatives of somatostatin, such as octreotide, are effective in inhibiting the biosecretion of bioactive products, but have been disappointing as antiproliferative agents in vivo . However, these findings suggest that secretory regulation is an intrinsic property of net cells, whereas the proliferative drive may involve a different mechanism . Thus, rather than adopting a global strategy based purely upon histological characterization or classification, therapeutic strategies should be individualized according to the receptor profile of a specific lesion . Until such data are available this case suggests that lanreotide can control the disease . Following a relapse observed 6 months after radiotherapy with curative intent and the reintroduction of lanreotide autogel treatment, objective scoring using the recist criteria showed disease stabilization for up to 2 years . One could conclude that current treatment not only has an effect on symptom control, but also has an impact on disease progression . These data are in line with findings suggesting an antiproliferative effect of certain ssas in specific (lung) nets . We are unfortunately unable to match the histological diagnosis (ac) as we have been unable to obtain tissue samples from our patient . Net diagnosis could not be confirmed at the time of relapse due to the patient being on antiaggregation therapy following previous insertion of drug - eluting stents . The patient showed clinical deterioration with copd exacerbations, and an octreotide scan showed high uptake of octreotide . We did not choose to use chemotherapy because response rates in nets of the lung are low and the toxicity profile in a diabetic patient with copd, heart failure, and impaired renal function would not be favorable . The majority of patients with bronchopulmonary nets are symptomatic, although up to 45% of cases may exhibit no signs . The most common symptoms are cough (32%), pneumonia (26%), and hemoptysis (24%) [5, 7]. Our patient experienced an increase in copd exacerbations, which may be explained by the production of serotonin and other neuropeptides, by changes induced in the lung following radiotherapy, or by disease progression with irritation of central bronchi by tumor nodules . The fact that the use of lanreotide autogel abruptly stopped copd exacerbations in this case suggests that blocking the serotonin receptors had major benefits for this patient . During the course of the disease, this is a sensitive marker of nets, but may be normal in small lesions . It can also be elevated in a number of situations, including in the use of proton pump inhibitors (cga levels 23), steroid use, and renal impairment (in end stage renal disease, cga levels are raised up to 10). Octreotide scan and imaging were used for diagnosis, while only imaging was used for disease follow - up in this patient . Lanreotide autogel was selected among commercially available somatostatin analogs (ssas) based on its action in symptom control and its potentially antiproliferative effect . There is currently no reported difference in clinical outcome between the different types and formulations of ssas . Additionally, practice guidelines from medical societies (nccn, esmo, and enets) do not differentiate between them for use in this indication [6, 11, 14]. Recent in vitro studies, however, have shown that net cell lines, from different sites and arising from different types of neuroendocrine cells, respond differently to individual ssas . One study showed substantially different cell surface expression profiles for somatostatin and dopamine receptors in lung and gastrointestinal cell lines . Being differently coupled to microtubule - associated protein kinase (mapk)/extracellular signal - regulated kinase (erk) and c - jun amino - terminal kinase (jnk) signaling pathways, these receptors can differently influence tumor cell proliferation . In that study, ssas and somatostatin / dopamine chimeric compounds exhibited different inhibitory effects on cell lines of different organs (lung vs. gastrointestinal), as well as on cell lines from the same organ (lung: tc vs. ac). Lanreotide was the most effective inhibitor in the ac and small intestine carcinoid cell lines . In contrast, none of the tested molecules in the study, despite the expression of somatostatin receptors, inhibited the proliferation of tc . Synthetic derivatives of somatostatin, such as octreotide, are effective in inhibiting the biosecretion of bioactive products, but have been disappointing as antiproliferative agents in vivo . The reasons for this are unknown . However, these findings suggest that secretory regulation is an intrinsic property of net cells, whereas the proliferative drive may involve a different mechanism . Thus, rather than adopting a global strategy based purely upon histological characterization or classification, therapeutic strategies should be individualized according to the receptor profile of a specific lesion . Until such data are available this case suggests that lanreotide can control the disease . Following a relapse observed 6 months after radiotherapy with curative intent and the reintroduction of lanreotide autogel treatment, objective scoring using the recist criteria showed disease stabilization for up to 2 years . One could conclude that current treatment not only has an effect on symptom control, but also has an impact on disease progression . These data are in line with findings suggesting an antiproliferative effect of certain ssas in specific (lung) nets . We are unfortunately unable to match the histological diagnosis (ac) as we have been unable to obtain tissue samples from our patient . This case shows that, even in patients with considerable comorbidity, adequate treatment can promote survival with good quality of life in the absence of side effects from active treatment . Besides excellent symptom control, this patient had fair overall survival when using lanreotide, given the fast relapse of disease (within 6 months of radiotherapy with curative intent). This and other similar cases treated at our institute with similar results support the use of lanreotide in cases of lung nets . Pending results of further research, we would encourage new case reports to confirm or refute the use of lanreotide in lung nets, particularly as a potential active treatment line in carcinoids of the lung . Given the sporadic occurrence of lung nets, centralization would be recommended to ensure standardized treatment by experienced physicians and to create the opportunity for further research in this specific pathology.
|
Recent advances in endoscopic resection techniques, such as endoscopic submucosal dissection (esd), allow for en bloc curative resection of early gastric cancers (egcs) with a minimal risk of lymph node metastasis (lnm), regardless of tumor size or presence of submucosal fibrosis . Esd has several merits over gastrectomy: it leads to a more accurate histopathological diagnosis, it is a minimally invasive procedure, and it demonstrates a high rate of curative resection and a low rate of local recurrence . Thus, esd has been accepted as a standard and safe treatment modality for egcs in eastern asia including korea and japan [1 - 4]. Esd for egcs with absolute and expanded indications is accepted as a safe treatment strategy, according to recent long - term follow - up studies on esd for egcs in eastern asia . However, the results for esd of egcs with specialized histologies are somewhat different from those of egcs with common histologies . Furthermore, there have been few reports on the safety and outcomes of esd for egcs with specialized histologies . Here, i summarize the outcomes of esd for egcs with two rare specialized histologies on the basis of my experience . It demonstrates well - differentiated structures and its histopathologic characteristics are epithelial projections which are scaffolded by a central fibrovascular core . Until now, the biological behavior and prognostic significance of pac are unclear due to the rare incidence of pac . At present, pac is classified into intestinal - type adenocarcinoma using the lauren classification, and as a differentiated - type adenocarcinoma using the japanese classification of gastric carcinoma . However, it is reported that pac has higher rates of liver metastasis and lnm, and a lower 5-year overall survival rate than non - papillary gastric adenocarcinomas, such as tubular adenocarcinoma . Considering that pac has a more aggressive nature compared with other gastric adenocarcinomas, an inevitable question occurs whether it could be treated under the same esd indication criteria as tubular adenocarcinomas . It is unlikely that the same esd indication criteria can be rationally applied to gastric adenocarcinomas with and without considerable pac components [10 - 12]. According to data from my hospital (pusan national university hospital, busan, korea), 49 patients underwent surgery for egc with pac between january 2005 and may 2013 . The lnm rate was 7.1% (1/14) in mucosal cancers, which was higher than that in differentiated - type mucosal cancers (0.4%), but similar to that in undifferentiated - type mucosal cancers (4.2% to 7.3%). When the current esd indication criteria were applied to these 49 patients, 17 patients met the esd indication criteria, as follows: six patients in the absolute indication criteria (mucosal cancer 20 mm in size without ulcerative findings) and 11 patients in the expanded indication criteria (four patients, mucosal cancer> 20 mm in size without ulcerative findings; two patients, mucosal cancer 30 mm in size with ulcerative findings; and five patients, minute [<500 um from the muscularis mucosa] submucosal cancer 30 mm in size). Among the 17 patients with egc who met the esd indication criteria, two patients (11.8%) had lnm (table 1). During the same period, 24 patients having egc with pac underwent esd as a primary treatment at the same hospital . In the pre - esd diagnostic work - up, 10 patients met the absolute esd indication criteria and 14 patients met the expanded esd indication criteria . In the final post - esd histopathologic examination, 13 patients (54%) achieved an out - of - esd result, nine had lymphovascular invasion or deep submucosal invasion, three had mucosal cancer> 30 mm in size with ulcerative findings, and one had minute submucosal cancer> 30 mm in size . Of these patients, nine (37.5%) underwent additional gastrectomy with lymph node dissection for non - curative resection . The frequency of additional gastrectomy in patients with pac is higher compared to the previously reported frequency of additional surgery after esd (2.1% to 14.6%). Therefore, considering the higher frequency of lnm and additional surgery associated with this technique, esd should be more carefully performed for egcs with pac, even in cases with suspected esd indications after the pre - esd work - up, compared with other differentiated - type adenocarcinomas . Gastric carcinoma with lymphoid stroma (gcls) is a rare histological variant of gastric cancer, according to the 2010 world health organization classification system, and it accounts for 1% to 4% of all gastric carcinomas . Typically, the characteristic histopathologic features of gcls include poorly developed tubular structures and prominent lymphoid infiltrates in non - desmoplastic stroma . However, there are no standardized diagnostic criteria and the histolopathological diagnosis for gcls is obscure . Gcls has distinct clinicopathologic characteristics and it is generally accepted that patients with gcls have a favorable prognosis with a low lnm rate . It has been reported that an increase in the number of tumor - infiltrating lymphocytes, which are reflective of the host s immune response to tumor cells, is significantly associated with reduced metastasis and improved survival . However, gcls has histopathologically poorly developed tubular structures, and, therefore, it tends to be regarded as undifferentiated - type adenocarcinoma in the esd indication criteria . According to the data from my hospital, out of 59 patients with egc with gcls who underwent surgery between january 2007 and december 2014, two patients (3.4%) demonstrated lnm . The lnm rates are 0.0% (0/9) in mucosal cancers with gcls and 4.0% (2/50) in submucosal cancers with gcls, respectively . In particular, the lnm rate in submucosal cancers with gcls (4.0%) was significantly lower than that in submucosal cancers with differentiated - type and undifferentiated - type adenocarcinoma (19.4%, 140/722) (fig . 1). Egc with gcls is a specific type of gastric cancer that has a favorable outcome, and is associated with a very low lnm rate despite deep submucosal invasion . Therefore, patients with egc with gcls, including those with deep submucosal invasion, may be good candidates for esd as like well - differentiated neuroendocrine tumor . However, further investigation is needed to establish new recommendation criteria for esd for egcs with gcls . The current esd indications for egcs are based on the differentiation degree of the tumor . Although egc with pac is one of differentiated - type adenocarcinomas and so treated according to the same esd indication criteria as for other differentiated - type adenocarcinomas, the lnm rate under the current esd indication criteria was higher compared with other differentiated - type cancers . Furthermore, more than half of the patients undergoing esd for egc with pac ultimately came to achieve out - of - esd indication . On the other hand, egc with gcls this outcome is associated with a very low lnm rate in patients having egc with gcls, even in patients with deep submucosal invasion . This suggests that patients with egc with gcls, even those with deep submucosal invasion, may be potential candidates for esd . Although large - scale prospective multi - center studies with longer follow - up periods will be required to determine the optimal esd criteria for these tumors, clinicians should be aware of these rare disease entities.
|
The administration of intravenous tissue plasminogen activator (tpa) has been shown to improve prognoses after acute ischemic stroke . This treatment was approved in october 2005 in japan but is still infrequently used because appropriate tpa administration is time dependent and limited to patients within a few hours of acute ischemic stroke onset . Additionally, regional differences for the use of tpa have been reported . Because the use of this treatment is dependent on the time elapsed from stroke onset, emergency medical services use and geographical factors several studies have reported the benefits of ambulance use for stroke care, and educational campaigns to promote the calling of an ambulance for suspected stroke patients have been carried out in australia and japan . Some studies have reported an association between patient distance and delayed hospital arrival, whereas another study found no association . However, these studies have generally been conducted using relatively small sample sizes and were performed at the hospital or regional level . Another geographical factor that should be considered is the degree of urbanization of a region, as hospitalseeking behavior may differ depending on the availability and proximity of hospitals . From this perspective, a large interregional database is necessary for an indepth analysis of factors associated with tpa use . Recent advances in computing capabilities have increased the potential for various analytical methods . In japan, the diagnosis procedure combination perdiem payment system (dpc / pdps), which was introduced to acute care hospitals in 2003, requires that hospitals generate standardized dpc data for each patient per hospitalization . These data are collected by the national government, which conducts an annual review at the individual hospital level; the reports of these results, including that of data quality, are available to the public . This periodic review for the data quality assurance system has continued to be conducted, thereby ensuring a high standard of quality for the data . Since july 2010, dpc / pdps requires the collection of additional information, such as each patient's residence postal code, neurological deficits, and date of stroke onset . The uniform formatting of dpc / pdps data forms allows the collection, handling, and analysis of large quantities of administrative data from numerous hospitals located nationwide . This database also allows analyses that take into account critical differences in patient case mix . The objectives of this study were to investigate the relationship between tpa administration and ambulance use and to investigate how distance and population density differences affect the use of this treatment . Analyses that not only use a large database but also account for case mix and regional differences can offer more useful evidence than previously available . This study used data extracted from the dpc database for patients hospitalized between july 2010 and march 2012 . The data were collected by the dpc study group, which is funded by the japanese ministry of health, labour and welfare . Approximately 3 million inpatients each year, or 40% of all acute care hospital admissions in japan . Driving times to the admitting hospitals were calculated using geographical information system software for the shortest path via open road from each patient's home postal code location . These times reflect driving at speeds set for specific road categories based on road width . Although traffic conditions were not taken into consideration in calculating drive times, regular waiting times at intersections en route were included in the estimates . We calculated driving times up to 90 minutes, and a preliminary analysis showed that 99.2% of national population resided within 90 minutes from the nearest acute hospital . We selected patients of at least 18 years of age who were admitted for acute ischemic stroke, and had complete information available for the variables of interest . Acute ischemic stroke was identified by the international classification of diseases 10th edition diagnosis code, both medical staff and individuals can call for an ambulance without incurring additional charges for patients . Ambulance use in dpc data is defined as the direct transportation from the scene of the event to the hospital by ambulance . We further limited our analysis to hospitals that had discharged 1 patients who had been administered tpa during the study period, because tpa is only available at hospitals that meet certain criteria . Consciousness levels were determined using the japan coma scale (jcs), which uses the following grades: grade 0 (alert), grade i (awake without any stimuli), grade ii (arousable), and grade iii (unarousable). The level of physical impairment was determined using the modified rankin scale (mrs) scoring system . The mrs is principally used to evaluate activities of daily living (adls) for assessing disability and dependence of a patient after stroke, but dpc data include patient mrs scores at admission as a substitute for assessing physical impairment for acute ischemic stroke patients . The mrs was selected because its assessment is relatively easy and the uniformly formatted data of the dpc database require a common scale of input for any type of stroke . We reduced the mrs from the original 6 classes to the following 3: 0 to 2 (mild), 3 to 4 (moderate), and 5 (severe). Because population density is one of the most widely used and accepted indicators of the level of urbanization, we categorized hospitals according to the population density of the secondary medical area of each hospital to identify relatively rural and urban areas . Secondary medical areas in japan are governmentdesignated subprefectural regional units that are autonomously capable of supplying inpatient medical services to meet the demand within that region . These services include the majority of general medical and surgical services, excluding some specialized treatments . We calculated population density using data provided by the government in 2010 and generated 3 classes according to these data: <300 persons / km, 300 to 1000 persons / km, and> 1000 persons / km . We used mixedeffects logistic regression models with a random intercept for patients nested within hospitals to identify independent factors associated with tpa administration . A multilevel approach was taken to account for possible clustering of tpa administration in hospitals . The analysis included a total of 4 regression models: 1 for each of the 3 population density categories and 1 with all cases in this study . A 2tailed test was performed with p values <0.05 considered significant using spss software version 20.0.0.2 (ibm). This study was approved by the ethics committee, kyoto university graduate school and faculty of medicine . This study used data extracted from the dpc database for patients hospitalized between july 2010 and march 2012 . The data were collected by the dpc study group, which is funded by the japanese ministry of health, labour and welfare . Approximately 3 million inpatients each year, or 40% of all acute care hospital admissions in japan . Driving times to the admitting hospitals were calculated using geographical information system software for the shortest path via open road from each patient's home postal code location . These times reflect driving at speeds set for specific road categories based on road width . Although traffic conditions were not taken into consideration in calculating drive times, regular waiting times at intersections en route were included in the estimates . We calculated driving times up to 90 minutes, and a preliminary analysis showed that 99.2% of national population resided within 90 minutes from the nearest acute hospital . We selected patients of at least 18 years of age who were admitted for acute ischemic stroke, and had complete information available for the variables of interest . Acute ischemic stroke was identified by the international classification of diseases 10th edition diagnosis code, both medical staff and individuals can call for an ambulance without incurring additional charges for patients . Ambulance use in dpc data is defined as the direct transportation from the scene of the event to the hospital by ambulance . We further limited our analysis to hospitals that had discharged 1 patients who had been administered tpa during the study period, because tpa is only available at hospitals that meet certain criteria . Consequently, the analysis included a total of 114 194 cases from 603 hospitals . Consciousness levels were determined using the japan coma scale (jcs), which uses the following grades: grade 0 (alert), grade i (awake without any stimuli), grade ii (arousable), and grade iii (unarousable). The level of physical impairment was determined using the modified rankin scale (mrs) scoring system . The mrs is principally used to evaluate activities of daily living (adls) for assessing disability and dependence of a patient after stroke, but dpc data include patient mrs scores at admission as a substitute for assessing physical impairment for acute ischemic stroke patients . The mrs was selected because its assessment is relatively easy and the uniformly formatted data of the dpc database require a common scale of input for any type of stroke . We reduced the mrs from the original 6 classes to the following 3: 0 to 2 (mild), 3 to 4 (moderate), and 5 (severe). Because population density is one of the most widely used and accepted indicators of the level of urbanization, we categorized hospitals according to the population density of the secondary medical area of each hospital to identify relatively rural and urban areas . Secondary medical areas in japan are governmentdesignated subprefectural regional units that are autonomously capable of supplying inpatient medical services to meet the demand within that region . These services include the majority of general medical and surgical services, excluding some specialized treatments . We calculated population density using data provided by the government in 2010 and generated 3 classes according to these data: <300 persons / km, 300 to 1000 persons / km, and> 1000 persons / km . We used mixedeffects logistic regression models with a random intercept for patients nested within hospitals to identify independent factors associated with tpa administration . A multilevel approach was taken to account for possible clustering of tpa administration in hospitals . The analysis included a total of 4 regression models: 1 for each of the 3 population density categories and 1 with all cases in this study . A 2tailed test was performed with p values <0.05 considered significant using spss software version 20.0.0.2 (ibm). This study was approved by the ethics committee, kyoto university graduate school and faculty of medicine . Table 1 shows the baseline characteristics and tpa use of the study sample by population density of the secondary medical area served by each hospital . In general, each category had similar baseline characteristics, but there were more elderly patients and patients residing further from hospitals in lower population density areas (p<0.05 using test). For the 3 population density categories of <300 persons / km, 300 to 1000 persons / km, and> 1000 persons / km, the percentages of patients aged 75 years or older were 61%, 55%, and 51%, respectively; and the percentages of patients who had a driving time of 30 minutes were 36%, 29%, and 17%, respectively . A total of 5.1% (5797/114 194) of the patients received tpa during hospitalization, and the tpa use rates by baseline characteristics were similar among the 3 population density categories . Administration of tissue plasminogen activator (tpa) to acute ischemic stroke patients by patient variables and population density of hospital secondary medical areas table 2 shows the results of the mixedeffects logistic regression analyses . Elderly patients received tpa less frequently than younger patients, and stroke severity was found to be positively associated with tpa administration up to a certain level . On the other hand, driving times from home to hospital were not associated with tpa use . After adjusting for all other factors, ambulance use showed significant association with tpa administration . The discrimination of the regression models was high, with cstatistics for each model having values> 0.82 . Results of multivariable logistic regression analyses with tissue plasminogen activator administration for acute ischemic stroke patients as the dependent variable, classified by population density of hospital secondary medical areas the administration rate of tpa for acute ischemic stroke patients in this study was 5.1% (5797/114 194). Patient baseline characteristics such as age and driving time differed among the population density categories and were consistent with expectations for rural and urban areas . The associations of each factor on tpa use were similar across the categories after adjustment in each regression model . Notably, ambulance use was significantly associated with tpa use, whereas driving time from home to hospital was not . A novel finding of our study is that distance from home to hospital was not associated with tpa use . These results were strengthened by the similar findings regardless of the level of urbanization, given by population density . However, this may be characteristic of countries with relatively few inhabitable regions, such as japan, where a greater proportion of the population may live closer to hospitals compared with more expansive countries . As a result, the number of patients residing far from hospitals in this study was so small that they would likely have little effect in the regression models . Most of the independent variables had similar coefficients among the 3 population density categories, suggesting that the results were consistent in regions regardless of the level of urbanization . However, it should be kept in mind that the geographical situation may be different in other countries; in more expansive countries, driving times of> 90 minutes may be more common and such cases should be included in analyses . Despite this, we believe that the findings demonstrated in this study may not be unique to japan (eg, 79% of adults in the united states have been shown to reside within 60 minutes of a hospital that provides acute cardiac therapy) and that our results may also have applications in other countries . Another novel finding is that ambulance use showed significant association with tpa administration even after adjustment for variations in patient characteristics . Ambulance use may affect transportation time and reduce delays in work flow during the admission process at the hospital, thereby increasing the chances of a patient being eligible for tpa administration . This association was confirmed in this study using administrative data and available clinical information from the dpc database, which allowed a largescale analysis . As our results show, it is important to adjust for factors such as patient age and stroke severity when analyzing tpa use . Furthermore, because this analysis had taken geographical differences into account, our findings that the adjusted effects of each factor on tpa use were similar in every population density category may have considerable external validity . These results emphasize that promptly calling for an ambulance without hesitation can be important for suspected stroke patients, as our study showed that only 55% of stroke patients used an ambulance despite the fact that their use is free of charge in japan . Educational campaigns to help people recognize stroke symptoms in themselves and others are favorable as these have shown to increase the number of ambulance calls for acute ischemic stroke . Because the decision to call for an ambulance may be influenced by factors other than those included in this study, further research should be conducted to investigate these possible relationships . In addition to promoting ambulance use, it is important to review and improve ambulance availability in each community . Another notable finding of this analysis is that the odds ratios for patient background characteristics were consistent both with guidelines and our clinical experiences . Here, older patients and those with the lowest stroke severity were less likely to receive tpa . On the other hand, an ambulance call is more likely to be delayed for an elderly individual, which may also affect their eligibility for tpa administration . Similarly, guidelines do not recommend tpa use for patients with minor neurological symptoms, and these patients are also associated with delayed calls for an ambulance . Although we cannot determine any causal relationships from our analysis, our findings are consistent with those from previous reports . One limitation of this study is that we only included hospitals that discharged at least 1 patient who was administered tpa during hospitalization . Consequently, this study does not address why some hospitals never used tpa for acute stroke patients, nor can it shed light on the circumstances of hospitals or regions that did not administer tpa . Another limitation is the use of mrs as a measure of physical impairment at admission . Although this is not an orthodox application, these assessments were actually carried out to assess stroke symptoms, and dpc data included no other scale for evaluating physical impairment . Consequently, we found this measurement to be significantly associated with tpa use, and it may therefore have applications as a proxy indicator of physical impairment severity in acute stroke patients for predicting tpa use . Next, although the database provides information on the date of stroke onset, it lacks information on the time of onset, which precluded us from investigating the detailed time lags from onset to hospital arrival . However, we limited our analysis to stroke patients whose onset was the day of admission, thereby minimizing these time lags . Although further analyses using time data are desirable, we believe our findings still have validity in showing the association of factors with tpa use . Data from a large administrative claims database showed that tpa was administered in 5.1% of acute ischemic stroke cases . Analysis of factors affecting tpa administration using case mix adjustment methods showed that the distance from home to hospital was not associated with the use of this treatment, whereas ambulance use was highly associated with tpa administration, regardless of population density . Our study further supports and emphasizes that ambulance calls may represent one of the most important factors for suspected stroke patients.
|
Transgenic zebrafish (danio rerio) tg(gfap: egfp)mi2002 and tl strain wild - type zebrafish were maintained using standard husbandry protocols . All procedures were approved by the institutional animal care and use committee (iacuc) at the university of michigan and abided by the arvo statement for the use of animals in ophthalmic and visual research . The regenerative response in mller glia was induced as previously described by exposing free - swimming, adult tg(gfap: egfp)mi2002 zebrafish (811 months old) to intense light (> 120,000 lux) from an exfo x - cite 120w metal halide lamp (exfo photonic solutions, quebec city, qc, canada) for 30 minutes (fig . This acute light lesion results in the selective death of photoreceptors, with peak cell death response at 24 hpl . Retinas from nonlesioned and light - lesioned tg(gfap: egfp)mi2002 zebrafish were surgically removed and dissociated into single cells (figs . Green fluorescent protein (gfp)-positive (gfp+) mller glia cells were collected by facs (fig . Nonlesioned, wild - type zebrafish were used as gfp - negative (gfp) controls for sorting . We collected mller glia at 0 (nonlesioned), 8, and 16 hpl, prior to their initial asymmetric, stem cell like division . These times were chosen to avoid including the rapidly dividing rpcs in the neurogenic clusters that begin to appear after the initial asymmetric division of the mller glia at 20 to 36 hpl . Although the glial - specific promoter (gfap) is no longer active in rpcs, they retain the egfp label through perseverance of the fluorescent protein for several days . Therefore, gfp+ cells isolated after 20 hpl inevitably include a heterogeneous mixture of mller glia and rpcs (a) photoreceptors were ablated in free - swimming tg(gfap: egfp)mi2002 fish using an acute light - lesion paradigm . (b) retinas were dissected from unlesioned controls (0 hpl) and 8 and 16 hpl tg(gfap: egfp)mi2002 fish . Retinas were also dissected from unlesioned, wild - type (nontransgenic, gfp) control fish . (d) dissociated samples were subjected to fluorescence - activated cell sorting (facs), and gfp+ cells were collected . The facs plots shown are representative images from the final gating and collection of actual samples . (e) rna was isolated from the sorted cells and checked by bioanalyzer for quality and concentration . Samples with an rna integrity number (rin) above 7.0 were advanced to library preparation . The bioanalyzer electropherogram shown is a representative plot from an actual sample with a rin of 8.6 . The y - axis shows fluorescent units (fu), corresponding to the amount of rna . (g) the rna - seq libraries were then sequenced on an illumina gaiix . (h) the sequencing data were processed with bioinformatic tools for differential expression analysis, gene ontology analysis, and pathway analysis . Rna was extracted from the sorted cells and the quality was checked with bioanalyzer (agilent technologies, santa clara, ca, usa) (fig . . Samples with an rna integrity number (rin) of acceptable quality (> 7.0) were used for illumina rna - seq library preparation (fig . Rna - seq libraries were subjected to deep sequencing on an illumina gaiix sequencer (illumina, inc ., san diego, ca, usa) (fig sequencing data were analyzed for differential gene expression, gene ontology enrichment, and enriched pathways (fig . Additional methodological details and a complete description of the bioinformatic analysis pipeline are in the supplementary methods . Supplementary data s1, s2, and s3 contain complete datasets for differential gene expression data, gene ontology enrichment, and enriched pathways, respectively . To identify genes that were differentially expressed at each time point, we used the commonly accepted threshold values for differentially expressed genes of |log2 fold change| (fc) 1 and a false discovery rate (fdr) 0.05 . This analysis identified 2690 genes differentially expressed in mller glia isolated from light - lesioned zebrafish retinas at 8 or 16 hpl compared with mller glia from control (unlesioned) retinas (fig . The number of genes differentially expressed at 8 hpl (n = 2221) is almost 2.5 times greater than at 16 hpl (n = 923) (fig . 2a), although the total number of genes expressed above a threshold of 1 fpkm (fragment per kilobase of exon per million reads mapped) did not differ among the samples (fig . A venn diagram plot reveals 1767 differentially expressed genes specific to 8 hpl, 469 genes specific to 16 hpl, and 454 genes common to both (roughly 20% of the genes differentially expressed at 8 hpl remain differentially expressed at 16 hpl) (fig . Figures 2c and 2d display the log2fc in expression as a function of log2 counts per million (cpm) mapped reads from rna - seq data for all differentially expressed genes at 8 hpl and 16 hpl, respectively . The top 20 positively and negatively regulated known zebrafish genes are labeled in blue (log2fc values for 8 hpl are listed in supplementary table s2 and for 16 hpl in supplementary table s3). (a) the total number of expressed and differentially expressed genes at each sample time point . Genes considered to be expressed were those with a fragment per kilobase of exon per million reads mapped (fpkm) value 1 . (b) the number of expressed genes in each group is based on entrez geneid, which were used for further analyses . Differentially expressed genes are those with an absolute log2 fold change (|log2fc|) 1 and a false discovery rate (fdr) 0.05 . (c, d) transformed log ratio and mean average (ma) plot [log2fc versus log2 counts per million (cpm)] at 8 hpl and 16 hpl, respectively . Dots represent genes: red for genes with a fdr 0.05 and blue for genes of interest . (e, f) validation of rna - seq data for selected genes at 8 hpl and 16 hpl, respectively, with reverse transcription quantitative polymerase chain reaction (rt - qpcr). The x - axis shows the target gene and the y - axis shows the log2fc versus unlesioned control . Rna - seq log2fc data are denoted by blue bars, and rt - qpcr log2fc data are denoted by red bars . Error bars for the rt - qpcr data represent the standard error of the mean for three biological replicates . The table lists the log2fc values for selected differentially expressed genes previously identified in microarray profiling studies and/or implicated in zebrafish retinal regeneration . Many of these genes belong to specific categories of biological processes, including stress response (hspd1), immune response / cytokines (stat3, lepb), secreted factors (hb - egf), mller glial cell dedifferentiation and acquisition of stem cell properties (tgif1, lin28, apobec2b), and cell adhesion (cdh2). A few of the known regeneration genes with small or below criterion values of differential expression in this rna - seq dataset (table) are primarily implicated in processes that occur later than those assayed here, such as cell fate specification (ascl1a, sox2) and progenitor proliferation (fabp7a, insm1a). Log2fold changes (fc) of selected regeneration - associated genes in mller glia at 8 and 16 hours post lesion (hpl) validation of expression levels with rt quantitative pcr (qpcr) confirmed the rna - seq data for several genes of interest tgf-induced factor homeobox 1 (tgif1), cytokine receptor like factor 1a (crlf1a), heat shock protein family d member 1 (hspd1), complement component 7 (c7), prostaglandin e synthase (ptges), and matrix metallopeptidase 9 (mmp9) at 8 hpl (fig . 2e) and 16 hpl (fig . 2f)many of which have experimentally confirmed roles in zebrafish retinal regeneration . We next performed gene ontology (go) and pathway - level analyses with kegg and reactome tools as described in more detail in the supplementary methods . Reactome data agreed with kegg data, yet were highly redundant and thus not included in figures presented here . To provide a global overview of the rapid and dynamic transcriptional changes in mller glia as they respond to photoreceptor loss and prepare to generate retinal progenitors, we discuss the results by classifying these data into eight general, nonexclusive, categories: stress response, prostaglandins, circadian rhythm, wnt signaling, nuclear factorb (nf-b) signaling, immune response, cytokines, and pluripotency . To illustrate dynamic transcriptional changes in mller glia as they prepare for an asymmetric stem cell like mitotic division, figure 3 plots the log2fc differential expression of genes in each of these categories at 8 vs. 16 hpl . For each category (each part of figure), log2fc at 8 hpl (y - axis) is plotted versus log2fc at 16 hpl (x - axis) for top differentially expressed genes (|log2fc| 1 and fdr 0.05) within each category . Dashed line represents equivalent values of differential expression of a given gene at both sample times (slope = 1 and y - intercept = 0). The top positively regulated annotated gene at 8 hpl with 7.75 log2fc is heme - binding protein soul 5 (soul5), an oxidative stress induced protein (figs . 2c, 3; supplementary table s2). Other evidence of a strong oxidative stress response includes elevated expression of biliverdin reductase a (blvra), heat shock protein alpha - crystallin - related b11 (hspb11), and heat shock 60-kda protein 1 (hspd1) (figs . The enriched go terms and kegg pathways in figure 4 similarly show strong positive regulation of redox and biological processes and pathways indicative of a stress response . Enrichment map of enriched kegg pathways and biological process go terms (with redundancy reduced) with fdr 0.05 . Circular node color reflects positive (red) or negative enrichment (blue); color intensity reflects the significance of the enrichment; and area reflects the size of the gene set . Lines (green) represent significant overlap in genes within linked sets, and line thickness represents degree of overlap . Two categories of biological responses that are rapidly activated in mller glia, but have not previously been associated with retinal regeneration, are prostaglandin metabolism and circadian rhythm (figs . Metabolic processes and pathways, in general, are very highly enriched at 8 hpl (fig . 4); especially prominent are pathways associated with lipid metabolism, including icosanoids (also called eicosanoids), fatty acid derivatives, and arachidonic acid . These metabolic changes are reflected in the increased expression of zebrafish orthologs of prostaglandin e synthase (ptges, ptges1), prostaglandin endoperoxide synthase (ptges, ptges1), and prostaglandin d2 synthase (ptgdsb) genes in the biosynthetic pathway for the eicosanoid prostaglandin e2 (pge2) (fig . Somewhat unexpectedly, several core circadian clock genes are included in the top 20 positively regulated genes at 8 hpl (figs . S2a; supplementary table s2), and the go terms associated with circadian and biological rhythms are positively enriched (fig . 4). With the exception of period 1a (per1a), which is negatively regulated (fig . 2c; supplementary table s2), several core clock genes are positively regulated (figs . S2a), including period 2 (per2), cryptochrome 5 (cry5), neuronal pas domain protein 2 (npas2), and orthologs (arntl1a, arntl1b) of aryl hydrocarbon receptor nuclear translocator - like (arntl1), also known as bmal1 . Enrichment analyses reveal that wnt signaling is negatively regulated at 8 hpl and remains repressed at 16 hpl (figs . 3, 4) with reduced expression of wnt target genes such as lymphoid enhancer binding factor 1 (lef1) and frizzled class receptors (fzd7b, fzd9b) (fig . Activity is likewise dampened in the notch and bone morphogenetic protein (bmp) signaling pathways (fig . 4), and the notch target hairy - related 4, tandem duplicate 1 (her4.1) is among the top negatively regulated genes (fig . 2c; supplementary table s2). Negatively expressed genes and negatively enriched go terms and kegg pathways at both 8 and 16 hpl include several indicative of photoreceptors and neural functions, including sensory transduction and synaptic mechanisms (figs . 2c, 2d, 3, 4, 5; supplementary tables s2, s3). Some of the negatively regulated photoreceptor - specific genes have relatively high log2cpm, such as the rod photoreceptor gene nuclear subfamily 2 group e member 3 (nr2e3) at 8 hpl (fig . 2c) and cone photoreceptor genes g protein subunit alpha 2 (gnat2) and cone opsins (opn1mw2, opn1sw2) at 16 hpl (fig . These results suggest that the preparations of facs - isolated mller glia are contaminated with photoreceptor transcripts, as has been noted in previous microarray profiling studies of sorted mller glia from zebrafish (supplementary figs . S3b, s3c; supplementary tables s4, s5), as well as microarray and rna - seq expression profiles of facs - isolated gfp+ mller glia from adult mouse retina (supplementary figs . Even single mller glial cells hand - picked from young and adult mouse retinas can show significant levels of photoreceptor - specific transcripts (supplementary figs . This unavoidable photoreceptor contamination is likely attributed to the dense network of mller glial processes that enwrap the photoreceptor cells . As this tight physical association would predict, the inverse is also true specific transcripts (retinaldehyde binding protein 1; supplementary table s5) are found in facs - isolated rod and cone photoreceptors from adult mouse (supplementary figs . Specific transcripts such as rhodopsin and gnat1 (supplementary table s5) are abundantly present in 97.5% pure cone photoreceptor preparations (supplementary fig . Contaminating transcripts are avoided only when the offending cell type is not present; for example, rods are absent in the nrl mouse (supplementary fig . The negative enrichment values of transcripts related to photoreceptors at 8 or 16 hpl versus unlesioned samples in our dataset (figs . 4, 5, sensory perception) are consistent with a reduction in cross - contamination caused by concurrent degeneration of light - damaged photoreceptors . Pathways and biological processes enriched at 16 hpl in zebrafish mller glia . Enrichment map of enriched kegg pathways and redundancy - reduced biological process go terms (with redundancy reduced) with fdr 0.05 . Circular node color reflects positive (red) or negative enrichment (blue), color intensity reflects the significance of the enrichment, and area of the circle reflects the size of the gene set . Lines (green) represent significant overlap in genes within linked sets, and thickness represents degree of overlap . Activation of biological processes and pathways indicative of oxidative stress and the regulation of redox homeostasis, which were already evident at 8 hpl (figs . 3, 4), continue to be enriched at 16 hpl, but with a clear shift toward more prominent activation of signaling pathways related to inflammation, including both innate and adaptive immune responses (figs . 3, 5). The nf-b signaling pathway is activated by both oxidative stress and proinflammatory cytokines, and it regulates cell survival, cell proliferation, and inflammation . 3), including tumor necrosis factor receptor superfamily orthologs (tnfrsf1a, tnfrsf11a), mitogen - activated protein kinase kinase kinase 14 (map3k14), and growth arrest and dna - damage - inducible 45 beta orthologs (gadd45ba, gadd45bb). Notably, two of the upregulated prostaglandin synthetases (ptgs2a and ptgs2b) mentioned previously are also in the nf-b signaling pathway (fig . 3). A number of pathways associated with cytokine - mediated signaling and immune processes, including janus kinase - signal transducer and activator of transcription (jak - stat) and tumor necrosis factor (tnf) signaling pathways (fig . 5), are positively enriched at 16 hpl, as reflected by upregulation of genes (fig . 3) such as janus kinase 1 (jak1), signal transducer and activator of transcription 3 (stat3), suppressor of cytokine signaling 3b (socs3b), cytokine inducible sh protein orthologs (cish, cishb), and interferon regulator factor 9 (irf9). Activation of immune responses mediated by the complement cascade is also very prominent at 16 hpl: several complement component genes (c4a, c6, c7a, c7) show a log2fc> 2.0 (figs . The most highly enriched gene at 16 hpl is leptin b (lepb), a hormone that signals via jak - stat and modulates the immune system . In addition to cytokine signaling and immune responses, the jak - stat signaling pathway is also implicated in regulation of pluripotency in stem cells (fig . Other pluripotency - related enriched genes are associated with several growth factor signaling pathways: fibroblast growth factor receptor 1 orthologs (fgfr1a, fgfr1b), wingless - type mmtv integration site, family member 7a (wnt7a), glycogen synthase kinase 3b (gsk3b), inhibin beta aa (inhbaa), and chromatin modifier polycomb group ring finger 5 orthologs (pcgf5a, pcgf5b). Whereas biological processes associated with cell growth and differentiation (e.g., cell movement, biological adhesion, tissue development, insulin secretion) were negatively regulated at 8 hpl (fig . 4), by 16 hpl evidence for positive enrichment of proliferation processes and pathways (e.g., cell proliferation, negative regulation of cell differentiation, regulation of epigenetic gene expression, locomotion and cell migration, regeneration, growth) was very strong (fig . 5), suggestive of the transition to cell cycle entry and production of rpcs . Consistent with this interpretation is that signaling pathways regulating pluripotency of stem cells were positively enriched at 16 hpl (fig . 5). To identify transcriptional changes that distinguish regeneration - competent zebrafish mller glia from mammalian mller glia, which lack the ability to regenerate retinal neurons, we analyzed a publicly available microarray dataset of single isolated mouse mller glia from two different mouse models of retinal degeneration, pde6b and rho, which vary in their degeneration kinetics . We used data only from the initial major rod death phase (postnatal day 13 and postnatal week 8 for pde6b and rho, respectively) as these were most comparable to our zebrafish dataset, which focused on the initial response of mller glia to photoreceptor loss . We performed a parallel differential expression analysis of biological processes and pathways, as illustrated in figures 6a and 6b and described in more detail in supplementary methods . (a) schematic showing the methodology for the pathway analysis based on rna - seq data for the initial stages of mller glia (b) schematic showing the methodology for the pathway analysis of microarray data from single mller glia isolated from mouse (mus musculus) photoreceptor degeneration models, and the comparison between d. rerio and m. musculus . Columns from left to right: signaling pathway or biological process, zebrafish mller glia at 8 hpl, zebrafish mller glia at 16 hpl, mouse mller glia from pde6b retinal degeneration model at postnatal day 13, mouse mller glia from rho retinal degeneration model at 8 weeks postnatal . Arrows and corresponding colors represent the overall direction of regulation according to the legend at the right; gray dashes represent pathways or processes that were not enriched compared with controls . Direction of regulation for 8 and 16 hpl zebrafish mller glia is based on data from figures 4 and 5, respectively . Direction of regulation for pde6b and rho mller glia is based on data from figures 6a and 6b, respectively, with the exception of wnt signaling . Pde6b is based on results from reactome analysis (positive enrichment of formation of the beta - catenin: tcf transactivating complex, supplementary data s3) and biological process go terms (positive enrichment of regulation of canonical wnt signaling pathway, supplementary data s2). Rho is based on biological process go term analysis (negative enrichment of regulation of canonical wnt signaling pathway, supplementary data s2). Pathway enrichment analysis in the pde6b retinal degeneration model revealed strong positive regulation of metabolic responses in mouse mller glia (fig . 7a), but in contrast to zebrafish mller glia, the nf-b signaling pathway, cytokine signaling and immune system responses were negatively enriched (figs . 6c, 7a). In the rho mouse retinal degeneration model, a strong metabolic response 7b); but in contrast to the pde6b model, the complement cascade pathway was positively enriched (fig . Genes in the biosynthetic pathway leading to pge2, which were strongly upregulated in fish mller glia at both 8 and 16 hpl (figs . 3, 6c, supplementary fig . S1b), although several genes in the arachidonic acid metabolism pathway are differentially but inconsistently regulated in both mouse degeneration models (supplementary fig . S1b). Similarly, the positive regulation of core circadian clock genes seen in zebrafish mller glia, including per2, clock, and arntl (fig . S2a), is not replicated in mouse mller glia; instead, negative regulators of per1 (beta - transducin repeat containing e3 ubiquitin protein ligase, btrc, and s - phase kinase - associated protein 1a, skp1a) are strongly upregulated, and per1 and arntl (bmal1) are downregulated (fig . 6c, supplementary fig . Wnt signaling is repressed in zebrafish mller glia and variably regulated in the degeneration models (fig . Unlike in zebrafish, in the rho model, signaling pathways regulating pluripotency in stem cells were negatively enriched (figs . Enrichment map of kegg pathways with fdr 0.05 in (a) pde6b and (b) rho degeneration models . Circular node color reflects positive (red) or negative enrichment (blue); color intensity reflects the significance of the enrichment; and area reflects the size of the gene set . Lines (green) represent significant overlap in genes within linked sets, and line thickness represents degree of overlap . To identify genes that were differentially expressed at each time point, we used the commonly accepted threshold values for differentially expressed genes of |log2 fold change| (fc) 1 and a false discovery rate (fdr) 0.05 . This analysis identified 2690 genes differentially expressed in mller glia isolated from light - lesioned zebrafish retinas at 8 or 16 hpl compared with mller glia from control (unlesioned) retinas (fig . The number of genes differentially expressed at 8 hpl (n = 2221) is almost 2.5 times greater than at 16 hpl (n = 923) (fig . 2a), although the total number of genes expressed above a threshold of 1 fpkm (fragment per kilobase of exon per million reads mapped) did not differ among the samples (fig . A venn diagram plot reveals 1767 differentially expressed genes specific to 8 hpl, 469 genes specific to 16 hpl, and 454 genes common to both (roughly 20% of the genes differentially expressed at 8 hpl remain differentially expressed at 16 hpl) (fig . Figures 2c and 2d display the log2fc in expression as a function of log2 counts per million (cpm) mapped reads from rna - seq data for all differentially expressed genes at 8 hpl and 16 hpl, respectively . The top 20 positively and negatively regulated known zebrafish genes are labeled in blue (log2fc values for 8 hpl are listed in supplementary table s2 and for 16 hpl in supplementary table s3). (a) the total number of expressed and differentially expressed genes at each sample time point . Genes considered to be expressed were those with a fragment per kilobase of exon per million reads mapped (fpkm) value 1 . (b) the number of expressed genes in each group is based on entrez geneid, which were used for further analyses . Differentially expressed genes are those with an absolute log2 fold change (|log2fc|) 1 and a false discovery rate (fdr) 0.05 . (c, d) transformed log ratio and mean average (ma) plot [log2fc versus log2 counts per million (cpm)] at 8 hpl and 16 hpl, respectively . Dots represent genes: red for genes with a fdr 0.05 and blue for genes of interest . (e, f) validation of rna - seq data for selected genes at 8 hpl and 16 hpl, respectively, with reverse transcription quantitative polymerase chain reaction (rt - qpcr). The x - axis shows the target gene and the y - axis shows the log2fc versus unlesioned control . Rna - seq log2fc data are denoted by blue bars, and rt - qpcr log2fc data are denoted by red bars . Error bars for the rt - qpcr data represent the standard error of the mean for three biological replicates . The table lists the log2fc values for selected differentially expressed genes previously identified in microarray profiling studies and/or implicated in zebrafish retinal regeneration . Many of these genes belong to specific categories of biological processes, including stress response (hspd1), immune response / cytokines (stat3, lepb), secreted factors (hb - egf), mller glial cell dedifferentiation and acquisition of stem cell properties (tgif1, lin28, apobec2b), and cell adhesion (cdh2). A few of the known regeneration genes with small or below criterion values of differential expression in this rna - seq dataset (table) are primarily implicated in processes that occur later than those assayed here, such as cell fate specification (ascl1a, sox2) and progenitor proliferation (fabp7a, insm1a). Log2fold changes (fc) of selected regeneration - associated genes in mller glia at 8 and 16 hours post lesion (hpl) validation of expression levels with rt quantitative pcr (qpcr) confirmed the rna - seq data for several genes of interest tgf-induced factor homeobox 1 (tgif1), cytokine receptor like factor 1a (crlf1a), heat shock protein family d member 1 (hspd1), complement component 7 (c7), prostaglandin e synthase (ptges), and matrix metallopeptidase 9 (mmp9) at 8 hpl (fig . 2e) and 16 hpl (fig . 2f)many of which have experimentally confirmed roles in zebrafish retinal regeneration . We next performed gene ontology (go) and pathway - level analyses with kegg and reactome tools as described in more detail in the supplementary methods . Reactome data agreed with kegg data, yet were highly redundant and thus not included in figures presented here . To provide a global overview of the rapid and dynamic transcriptional changes in mller glia as they respond to photoreceptor loss and prepare to generate retinal progenitors, we discuss the results by classifying these data into eight general, nonexclusive, categories: stress response, prostaglandins, circadian rhythm, wnt signaling, nuclear factorb (nf-b) signaling, immune response, cytokines, and pluripotency . To illustrate dynamic transcriptional changes in mller glia as they prepare for an asymmetric stem cell like mitotic division, figure 3 plots the log2fc differential expression of genes in each of these categories at 8 vs. 16 hpl . For each category (each part of figure), log2fc at 8 hpl (y - axis) is plotted versus log2fc at 16 hpl (x - axis) for top differentially expressed genes (|log2fc| 1 and fdr 0.05) within each category . Dashed line represents equivalent values of differential expression of a given gene at both sample times (slope = 1 and y - intercept = 0). The top positively regulated annotated gene at 8 hpl with 7.75 log2fc is heme - binding protein soul 5 (soul5), an oxidative stress induced protein (figs . 2c, 3; supplementary table s2). Other evidence of a strong oxidative stress response includes elevated expression of biliverdin reductase a (blvra), heat shock protein alpha - crystallin - related b11 (hspb11), and heat shock 60-kda protein 1 (hspd1) (figs . The enriched go terms and kegg pathways in figure 4 similarly show strong positive regulation of redox and biological processes and pathways indicative of a stress response . Enrichment map of enriched kegg pathways and biological process go terms (with redundancy reduced) with fdr 0.05 . Circular node color reflects positive (red) or negative enrichment (blue); color intensity reflects the significance of the enrichment; and area reflects the size of the gene set . Lines (green) represent significant overlap in genes within linked sets, and line thickness represents degree of overlap . Two categories of biological responses that are rapidly activated in mller glia, but have not previously been associated with retinal regeneration, are prostaglandin metabolism and circadian rhythm (figs . Metabolic processes and pathways, in general, are very highly enriched at 8 hpl (fig . 4); especially prominent are pathways associated with lipid metabolism, including icosanoids (also called eicosanoids), fatty acid derivatives, and arachidonic acid . These metabolic changes are reflected in the increased expression of zebrafish orthologs of prostaglandin e synthase (ptges, ptges1), prostaglandin endoperoxide synthase (ptges, ptges1), and prostaglandin d2 synthase (ptgdsb) genes in the biosynthetic pathway for the eicosanoid prostaglandin e2 (pge2) (fig . Somewhat unexpectedly, several core circadian clock genes are included in the top 20 positively regulated genes at 8 hpl (figs . S2a; supplementary table s2), and the go terms associated with circadian and biological rhythms are positively enriched (fig . 4). With the exception of period 1a (per1a), which is negatively regulated (fig . 2c; supplementary table s2), several core clock genes are positively regulated (figs . S2a), including period 2 (per2), cryptochrome 5 (cry5), neuronal pas domain protein 2 (npas2), and orthologs (arntl1a, arntl1b) of aryl hydrocarbon receptor nuclear translocator - like (arntl1), also known as bmal1 . Enrichment analyses reveal that wnt signaling is negatively regulated at 8 hpl and remains repressed at 16 hpl (figs . 3, 4) with reduced expression of wnt target genes such as lymphoid enhancer binding factor 1 (lef1) and frizzled class receptors (fzd7b, fzd9b) (fig . Activity is likewise dampened in the notch and bone morphogenetic protein (bmp) signaling pathways (fig . 4), and the notch target hairy - related 4, tandem duplicate 1 (her4.1) is among the top negatively regulated genes (fig . 2c; supplementary table s2). Negatively expressed genes and negatively enriched go terms and kegg pathways at both 8 and 16 hpl include several indicative of photoreceptors and neural functions, including sensory transduction and synaptic mechanisms (figs . 2c, 2d, 3, 4, 5; supplementary tables s2, s3). Some of the negatively regulated photoreceptor - specific genes have relatively high log2cpm, such as the rod photoreceptor gene nuclear subfamily 2 group e member 3 (nr2e3) at 8 hpl (fig . 2c) and cone photoreceptor genes g protein subunit alpha 2 (gnat2) and cone opsins (opn1mw2, opn1sw2) at 16 hpl (fig . These results suggest that the preparations of facs - isolated mller glia are contaminated with photoreceptor transcripts, as has been noted in previous microarray profiling studies of sorted mller glia from zebrafish (supplementary figs . S3b, s3c; supplementary tables s4, s5), as well as microarray and rna - seq expression profiles of facs - isolated gfp+ mller glia from adult mouse retina (supplementary figs . Even single mller glial cells hand - picked from young and adult mouse retinas can show significant levels of photoreceptor - specific transcripts (supplementary figs . This unavoidable photoreceptor contamination is likely attributed to the dense network of mller glial processes that enwrap the photoreceptor cells . As this tight physical association would predict, the inverse is also true specific transcripts (retinaldehyde binding protein 1; supplementary table s5) are found in facs - isolated rod and cone photoreceptors from adult mouse (supplementary figs . Specific transcripts such as rhodopsin and gnat1 (supplementary table s5) are abundantly present in 97.5% pure cone photoreceptor preparations (supplementary fig . Contaminating transcripts are avoided only when the offending cell type is not present; for example, rods are absent in the nrl mouse (supplementary fig . The negative enrichment values of transcripts related to photoreceptors at 8 or 16 hpl versus unlesioned samples in our dataset (figs . 4, 5, sensory perception) are consistent with a reduction in cross - contamination caused by concurrent degeneration of light - damaged photoreceptors . Enrichment map of enriched kegg pathways and redundancy - reduced biological process go terms (with redundancy reduced) with fdr 0.05 . Circular node color reflects positive (red) or negative enrichment (blue), color intensity reflects the significance of the enrichment, and area of the circle reflects the size of the gene set . Lines (green) represent significant overlap in genes within linked sets, and thickness represents degree of overlap . Activation of biological processes and pathways indicative of oxidative stress and the regulation of redox homeostasis, which were already evident at 8 hpl (figs . 3, 4), continue to be enriched at 16 hpl, but with a clear shift toward more prominent activation of signaling pathways related to inflammation, including both innate and adaptive immune responses (figs . 3, 5). The nf-b signaling pathway is activated by both oxidative stress and proinflammatory cytokines, and it regulates cell survival, cell proliferation, and inflammation . Positive enrichment of this pathway (fig . 3), including tumor necrosis factor receptor superfamily orthologs (tnfrsf1a, tnfrsf11a), mitogen - activated protein kinase kinase kinase 14 (map3k14), and growth arrest and dna - damage - inducible 45 beta orthologs (gadd45ba, gadd45bb). Notably, two of the upregulated prostaglandin synthetases (ptgs2a and ptgs2b) mentioned previously are also in the nf-b signaling pathway (fig . 3). A number of pathways associated with cytokine - mediated signaling and immune processes, including janus kinase - signal transducer and activator of transcription (jak - stat) and tumor necrosis factor (tnf) signaling pathways (fig . 5), are positively enriched at 16 hpl, as reflected by upregulation of genes (fig . 3) such as janus kinase 1 (jak1), signal transducer and activator of transcription 3 (stat3), suppressor of cytokine signaling 3b (socs3b), cytokine inducible sh protein orthologs (cish, cishb), and interferon regulator factor 9 (irf9). Activation of immune responses mediated by the complement cascade is also very prominent at 16 hpl: several complement component genes (c4a, c6, c7a, c7) show a log2fc> 2.0 (figs . The most highly enriched gene at 16 hpl is leptin b (lepb), a hormone that signals via jak - stat and modulates the immune system . In addition to cytokine signaling and immune responses, the jak - stat signaling pathway is also implicated in regulation of pluripotency in stem cells (fig . Other pluripotency - related enriched genes are associated with several growth factor signaling pathways: fibroblast growth factor receptor 1 orthologs (fgfr1a, fgfr1b), wingless - type mmtv integration site, family member 7a (wnt7a), glycogen synthase kinase 3b (gsk3b), inhibin beta aa (inhbaa), and chromatin modifier polycomb group ring finger 5 orthologs (pcgf5a, pcgf5b). Whereas biological processes associated with cell growth and differentiation (e.g., cell movement, biological adhesion, tissue development, insulin secretion) were negatively regulated at 8 hpl (fig . 4), by 16 hpl evidence for positive enrichment of proliferation processes and pathways (e.g., cell proliferation, negative regulation of cell differentiation, regulation of epigenetic gene expression, locomotion and cell migration, regeneration, growth) was very strong (fig . 5), suggestive of the transition to cell cycle entry and production of rpcs . Consistent with this interpretation is that signaling pathways regulating pluripotency of stem cells were positively enriched at 16 hpl (fig . To identify transcriptional changes that distinguish regeneration - competent zebrafish mller glia from mammalian mller glia, which lack the ability to regenerate retinal neurons, we analyzed a publicly available microarray dataset of single isolated mouse mller glia from two different mouse models of retinal degeneration, pde6b and rho, which vary in their degeneration kinetics . We used data only from the initial major rod death phase (postnatal day 13 and postnatal week 8 for pde6b and rho, respectively) as these were most comparable to our zebrafish dataset, which focused on the initial response of mller glia to photoreceptor loss . We performed a parallel differential expression analysis of biological processes and pathways, as illustrated in figures 6a and 6b and described in more detail in supplementary methods . (a) schematic showing the methodology for the pathway analysis based on rna - seq data for the initial stages of mller glia (b) schematic showing the methodology for the pathway analysis of microarray data from single mller glia isolated from mouse (mus musculus) photoreceptor degeneration models, and the comparison between d. rerio and m. musculus . Columns from left to right: signaling pathway or biological process, zebrafish mller glia at 8 hpl, zebrafish mller glia at 16 hpl, mouse mller glia from pde6b retinal degeneration model at postnatal day 13, mouse mller glia from rho retinal degeneration model at 8 weeks postnatal . Arrows and corresponding colors represent the overall direction of regulation according to the legend at the right; gray dashes represent pathways or processes that were not enriched compared with controls . Direction of regulation for 8 and 16 hpl zebrafish mller glia is based on data from figures 4 and 5, respectively . Direction of regulation for pde6b and rho mller glia is based on data from figures 6a and 6b, respectively, with the exception of wnt signaling . Pde6b is based on results from reactome analysis (positive enrichment of formation of the beta - catenin: tcf transactivating complex, supplementary data s3) and biological process go terms (positive enrichment of regulation of canonical wnt signaling pathway, supplementary data s2). Rho is based on biological process go term analysis (negative enrichment of regulation of canonical wnt signaling pathway, supplementary data s2). Pathway enrichment analysis in the pde6b retinal degeneration model revealed strong positive regulation of metabolic responses in mouse mller glia (fig . 7a), but in contrast to zebrafish mller glia, the nf-b signaling pathway, cytokine signaling and immune system responses were negatively enriched (figs . 6c, 7a). In the rho mouse retinal degeneration model, a strong metabolic response was also seen the mller glia (fig . 7b); but in contrast to the pde6b model, the complement cascade pathway was positively enriched (fig . Genes in the biosynthetic pathway leading to pge2, which were strongly upregulated in fish mller glia at both 8 and 16 hpl (figs . 3, 6c, supplementary fig . S1b), although several genes in the arachidonic acid metabolism pathway are differentially but inconsistently regulated in both mouse degeneration models (supplementary fig . Similarly, the positive regulation of core circadian clock genes seen in zebrafish mller glia, including per2, clock, and arntl (fig . 6c, supplementary fig . S2a), is not replicated in mouse mller glia; instead, negative regulators of per1 (beta - transducin repeat containing e3 ubiquitin protein ligase, btrc, and s - phase kinase - associated protein 1a, skp1a) are strongly upregulated, and per1 and arntl (bmal1) are downregulated (fig . 6c, supplementary fig . Wnt signaling is repressed in zebrafish mller glia and variably regulated in the degeneration models (fig . 6c; supplementary material s2, s3). Finally, unlike in zebrafish, in the rho model, signaling pathways regulating pluripotency in stem cells were negatively enriched (figs . 6c, 7b). Enrichment map of kegg pathways with fdr 0.05 in (a) pde6b and (b) rho degeneration models . Circular node color reflects positive (red) or negative enrichment (blue); color intensity reflects the significance of the enrichment; and area reflects the size of the gene set . Lines (green) represent significant overlap in genes within linked sets, and line thickness represents degree of overlap . The inability of mammals to endogenously regenerate neurons is in marked contrast to the highly regeneration - competent zebrafish . The objectives of the current study were to determine a more complete catalog of transcript expression changes during the early steps of mller glia response to neuronal loss and to compare gene regulatory responses of regeneration - competent zebrafish mller glia with those of mller glia in mouse models of retinal degeneration . To help identify regeneration - relevant factors that are missing from mammalian mller glia, which fail to regenerate retinal neurons, we compared transcriptional changes in zebrafish mller glia to publicly available transcriptome data from single mouse mller glia isolated from two genetic models of retinitis pigmentosa in which rod photoreceptors degenerate . (1) the photoreceptor injury models were not equivalent (acute photic damage of cones and rods in zebrafish versus genetically induced rod degeneration in mouse). (2) the methods for isolating mller glia were different (facs isolation of gfp - labeled zebrafish mller glial cells versus single mouse mller glial cells selected based on morphology). (3) the methods for transcriptome analysis were different (rna - seq for zebrafish mller glia versus microarray analysis for mouse mller glia). Despite these limitations, the comparison highlighted several potentially important differences between regeneration - competent mller glia in zebrafish and mller glial responding to retinal degeneration in mice . Previous gene expression studies of the zebrafish retinal response to injury have shown a rapid induction of stress response transcripts and proteins, and many of the genes identified in those studies were also present in our dataset . Although the transcriptional responses of mller glia from pde6b and rho mice show some evidence of gene expression changes associated with gliosis and stress responses, these pathways were not among those identified by the kegg enrichment analyses of these data . However, single - cell transcriptomic data on this heterogeneous population of mller glia result in a lack of statistical power, which might account for this observation . Another potential explanation for this apparent difference in activation of stress response pathways is that the mouse models represent chronic photoreceptor degeneration, whereas the zebrafish model is an acute, traumatic injury . For example, hspb11 is a top upregulated gene at 8 hpl in zebrafish mller glia; hspb11 is required for hedgehog signaling in mice, and this pathway has been shown to promote the stem cell potential of mller glia in mammalian and chick retinas . Constitutive hedgehog signaling in developing zebrafish retinas results in an increase in the number of reactive mller glia, although its role has not been studied in the context of zebrafish photoreceptor regeneration . In the mouse hippo signaling also induces drosophila neural stem cell quiescence, inhibits zebrafish rpc proliferation, and promotes differentiation, but again, this pathway has not been examined in retinal regeneration . Another signaling pathway responsive to stress is nf-b signaling pathway, which was strongly activated in zebrafish mller glia, but repressed in pde6b mouse mller glia . Inhibition of nf-b signaling in neural stem cells results in symmetric division and accumulation of nestin / sox2/gfap - expressing cells, reminiscent of gliosis . Nuclear factorb signaling is reactive oxygen species (ros) responsive and stimulates an immune response by activating transcription of cytokines and ligands of known importance in retinal regeneration, such as interleukin-6 (il-6), tnf - alpha, activin a, and in zebrafish tail fin regeneration, such as mmp9 . Several genes in the complement cascade (c4b, c6, c7, c7a) are also upregulated in zebrafish mller glia, and related complement fragments (c3a and c5a) can directly induce retinal regeneration in the embryonic chick model through transdifferentiation of retinal pigmented epithelial cells . Complement activation can also induce il-6 and tnf - alpha, resulting in nf-b and stat-3 activation, and stat3 activation is critical for retinal regeneration in zebrafish . The role of the immune system in regeneration is increasingly recognized, and an interaction between stem cells and immune cell derived factors is necessary for effective tissue regeneration . In the zebrafish brain, inflammation is both necessary and sufficient to trigger neurogenesis that resembles a regenerative response, but additional studies are needed to understand the role of the immune system in retinal regeneration . Several other signaling pathways whose activity is altered in zebrafish mller glia and that have previously been implicated in regulating retinal regeneration include wnt, notch, and tgf/bmp . Both wnt and notch signaling are necessary for zebrafish retinal regeneration, so the early repression of these signaling pathways that we observed is somewhat puzzling, although the requirement for activation of wnt signaling is at a later stage, to promote proliferation of rpcs and regeneration of neurons . Activation of notch signaling in the mature retina maintains differentiated mller glial fate, inhibits stat3 and ascl1 expression, and prevents progenitor proliferation; hence the initial rapid downregulation of notch signaling might promote mller glial dedifferentiation and cell cycle reentry . Signaling through the tgf/bmp pathway also promotes mller glia differentiation, and zebrafish mutants with impaired capacity to negatively regulate tgf signaling show reduced rpc proliferation and diminished regenerative capacity . Interestingly, inhibitors of tgf can replace two of the classic pluripotency factors, c - myc and sox2, in reprogramming fibroblasts to ipscs . Surprisingly, circadian rhythm related terms and pathways were among the most positively enriched in our dataset . Disruption of the circadian - regulated, heparin - binding cytokine, midkine a (mdka), in the injured zebrafish retina results in altered cell cycle kinetics, rpc proliferation, and diminished rod photoreceptor regeneration, but no investigations have directly addressed the role of core clock genes . Recent studies of stem cell division and differentiation implicate clock genes in functions that have no clear link to the circadian rhythm itself . For instance, per2, which is upregulated in our dataset, is nonrhythmically expressed in neural stem cells (nsc) in the adult hippocampus, and regulates their proliferation and neurogenesis in mice . Recent work showed that mouse and human mller glial cells in vitro have an endogenous circadian clock, but in the microarray dataset from mouse degeneration models that we analyzed, the core clock genes were downregulated . A strong metabolic response to photoreceptor degeneration was evident in both fish and mouse mller glia pathway enrichment analyses . The injury - induced metabolic responses in zebrafish mller glia associated with regeneration are largely unexplored, in contrast to extensive investigations of metabolic profiles associated with reactive gliosis in mammalian mller glia . The essential role of metabolism in directing cell proliferation, differentiation, and cell fate determination is increasingly recognized, and levels of glycolysis, oxidative phosphorylation, and oxidative stress provide a metabolic signature that distinguishes pluripotent stem cells, rapidly dividing progenitor cells, and differentiated cells . The initial metabolic state and energy metabolism of zebrafish mller glia in response to photoreceptor injury includes enhanced oxidative phosphorylation and lipid metabolism, similar to neural progenitors, which are characterized by high levels of aerobic glycolysis, oxidative phosphorylation, ros, and eicosanoid and fatty acid biosynthesis . Within a few hours, the profile of zebrafish mller glia shifts to negative regulation of metabolic pathways, decreased glycolysis, and enrichment of the foxo signaling pathway, which more resembles nsc . Fox - o signaling mediates ros suppression, and inhibiting foxo - mediated ros suppression results in a depleted nsc population in mice . The rapidly shifting profile of energy and metabolism in zebrafish mller glia toward a stemness - like profile may reflect preparation for the asymmetric, self - renewing division that initiates the regenerative process . An in - depth, comparative metabolomic study of zebrafish mller glia and mammalian mller glia could reveal metabolic pathways that regulate the regenerative response in zebrafish retina, and the relevant enzymes might be excellent therapeutic targets for pharmacologic treatments to enhance endogenous regeneration . Of particular interest are changes in fatty acid metabolism, which play an important role in the regulation of neural stem cell proliferation . Icosanoid (also called eicosanoid)-derived metabolites, including pge2, can regulate nf-b, differentiation, and inflammation in stem cell populations, and inhibitors of pge2-degrading enzymes potentiate tissue regeneration in mice . The addition of pge2 to rat mller glia in vitro enhances their dedifferentiation, stem cell like properties, and proliferative abilities . Our transcriptome analysis suggests that pge2 levels in zebrafish, but not in mouse, mller glia are increased after loss of photoreceptors . Whether pge2 promotes mller glia dependent retinal regeneration is unknown, but if so, this may be a promising therapeutic target . A final and critical difference is that zebrafish mller glia demonstrate positive enrichment of pluripotency factors and cell proliferation, whereas mouse mller glia show reduced pluripotency factors and no evidence of cell proliferation in response to photoreceptor loss . Although mammalian mller glia express some genes associated with rpcs and have latent neurogenic capabilities, these attributes are not enhanced in response to neuronal loss . In conclusion, a comparison of transcriptional profiles from regeneration - competent zebrafish mller glia and gliotic mouse mller glia has revealed several novel, previously unexplored, categories of biological responses that could act to promote endogenous retinal regeneration: nf-b signaling, pge2 synthesis, expression of core clock genes, and signaling pathways and metabolic signatures associated with stem cells . These and other candidates can be explored in future investigations and may provide potential therapeutic targets that could enhance endogenous mller glial dependent regeneration of retinal neurons in humans . The datasets supporting the conclusions of this article are available in the national center for biotechnology information sequence read archive and gene expression omnibus repository (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse86872), and are included within the article or the supplementary material.
|
At an sbv information meeting, 60 shepherds> 18 years of age were recruited for this study . After obtaining written informed consent, we administered a standardized questionnaire . We collected information about age, sex, sbv infection in their livestock, exposure to sick lambs, frequency of insect bites, personal health, and categories of signs of disease after exposure . We developed an indirect fluorescent antibody test (ifat) for primary testing of human serum . Conjugated secondary antibodies against sbv - specific igm or igg (antibovine for positive control) were used . For the ifat, all heat - inactivated serum specimens were tested in dilutions of 1:20 and 1:80 on glass slides with noninfected and sbv - infected vero cells . An sbv antibody positive serum sample from an experimentally infected cow was used as a positive control . To check for background signals and possible cross - reactivity, a serum neutralization test (snt) was developed for confirmation of indeterminate and positive results . Serial dilutions of the test serum (lowest dilution 1:5) were incubated for 1 h at 37c with an equal volume of cell culture supernatant containing 100 infectious doses of sbv and subsequently mixed with vero cells . To detect sbv - specific rna, we performed a 1-step real - time reverse transcription quantitative pcr (rt - qpcr) on serum, as described (1). All 60 participants (75% male; median age 48 years [interquartile range (iqr) 4156 years]) reported sheep husbandry in the sbv - epizootic area (table 1). Altogether, 48 (80%) participants had contact with lambs that had characteristic malformations or with the respective birth products (median 10 [iqr 420] sick lambs). In livestock from 36 (60%) participants, sbv was laboratory confirmed . Median time from first signs in animals to blood withdrawal was 45 days (iqr 3966 days). A total of 55 (98%) of 56 participants self - reported insect bites during late summer to autumn; among these, 22 (39%) indicated frequent insect bites . Nine (15%) shepherds reported having had signs and symptoms since the disease had appeared in the study area or after handling diseased animals (table 1): myalgia and arthralgia (7 shepherds), headache (4), fever (4), skin rash (2), and respiratory problems (2). Of the 36 shepherds whose livestock had laboratory - confirmed sbv infection, 5 (14%) reported signs and symptoms: myalgia and arthralgia (4 shepherds), headache (2), fever (2), skin rash (2), and respiratory problems (2). Self - reported signs and symptoms of fever, headache, skin rash, myalgia / arthralgia, respiratory problems, or photophobia since sbv infection appeared in the study area or after handling diseased animals and resulting from unknown cause in each exposure category . No sbv - specific antibodies were detected in any serum specimens (table 2). Eight specimens showed indeterminate fluorescent signals in the ifat at a 1:20 serum dilution for igg (n = 1) or igm (n = 7) but were not reactive at 1:80 (figure). These 8 samples were retested by snt (serum dilution 1:10) and showed no virus inhibition at any serum dilution during 7 days of incubation . Two (25%) of these 8 shepherds reported symptoms . For the bovine control serum, * sbv, schmallenberg virus; ifat, indirect fluorescent antibody test; snt, serum neutralization test; rt - qpcr, quantitative reverse transcription pcr . Performed in only 8 serum samples with ifat indeterminate results; 2/8 (25%) reported symptoms as outlined in table 1 . Fluorescent light microscopy images of serum samples tested for antibodies to schmallenberg virus by indirect fluorescent antibody test on infected vero cells mixed with noninfected vero cells . A) nonreactive negative serum; b) positive serum reactive with infected cells only (green); c) indeterminate serum with faint nonspecific reactivity . We investigated the risk for human infection after possible high exposure to an emerging vector - borne epizootic disease through contact with infected animals and tissues or through insect bites . No evidence of sbv infection among the shepherds was found by molecular and serologic tests, even though most of the shepherds had received substantial exposure through repeated direct contact with sheep with laboratory - confirmed sbv - infection and with birth products known to contain high virus loads in the sbv - epizootic area . Reported symptoms were compatible with illnesses commonly experienced during the winter (i.e., influenza - like illness caused by human respiratory viruses) without considerable differences between the exposure categories . The likelihood of virus detection by rt - qpcr is certainly limited because sbv viremia in livestock lasts only a few days (4,8). However, after the end of the viremic phase, detection of specific antibodies can be expected . The period between exposure and sampling was sufficiently long to for antibodies to have developed after infection . Furthermore, a large proportion of the participants indicated having been frequently bitten by insects in the epizootic area . Midge bites are difficult to recall, and therefore this exposure could not be assessed precisely . Although sbv has been isolated from certain midge species, entomologic knowledge about the ability of different midge species to transmit sbv, i.e., vector competence and host feeding behavior, is still scarce . Nevertheless, on the basis of results from our study and the phylogenetic relationship of sbv, we conclude that the novel virus is unlikely to pose a threat to humans by transmission from infected livestock or from midges.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.